MXPA02002130A - Aqueous liquid detergent compositions comprising a polymeric stabilization system. - Google Patents

Abstract

The present invention relates to aqueous liquid detergent compositions and methods of using such compositions to launder fabrics. More specifically, the present invention relates to aqueous liquid detergent compositions comprising one or more particulate solids, such as peroxycarboxylic acids, and a polymeric stabilization system.

Description

ty? X COMPOSITIONS OF AQUEOUS LIQUID DETERGENTS COMPRISING A POLYMER STABILIZATION SYSTEM TECHNICAL FIELD The present invention relates to aqueous liquid detergent compositions and methods of using said compositions for washing fabrics. More specifically, the present invention relates to aqueous liquid detergent compositions comprising one or more solids 10 particulates such as peroxycarboxylic acids ("peracid") and a polymeric stabilization system.

BACKGROUND OF THE INVENTION In the past, suspension systems for suspending solid particles in liquid compositions have been employed in specific types of personal care compositions. For example, suspension systems comprising phases of surfactants and / or liquids • structuring surfactants have been incorporated into the 20 compositions of liquid detergents. Examples of such suspension systems based on surfactants are described in EP 442 549 B1, US 4,828,747, EP 160 342 B2, EP 386 566 A1, US 5,391, 324, EP 668 903 and No. 5,409,632, which deal with the suspension of hard-to-water-soluble perishables preformed by phases of surfactants. Such phases of surfactants are produced using (i) one or more nonionic surfactants (under electrolyte) or (ii) combinations of anionic and / or nonionic surfactants with fatty acids and / or electrolytes. GB 2279660 discloses the use of xanthan gum as a suspending agent for solid particles in a liquid detergent product. More specifically, GB 2279660 describes a composition of an aqueous liquid laundry detergent. 10 stable fluid comprising xanthan gum (a polysaccharide polymer) for phase stability, in conjunction with a specific pH jump system for effective cleaning and bleaching stability of the product, in a suspension containing the peroxyacid . This is done without the use of a polymer that increases stability, which is a polymer of a Hydrophobic monomer and a hydride monomer. The patents of E.U.A. No. 4,992,194 and 5,073,285, both issued to Liberati et al. on February 12, 1991 and December 17, 1991, respectively, describe formulations of heavy-duty liquid detergents with aqueous structure containing solid organic peroxyacid, 20 particulate, and substantially insoluble in water, combinations of surfactants, pH adjusting systems and selected decoupling polymers.

The patent of E.U.A. No. 4,879,057 issued to Dankowski et al., On November 7, 1989, discloses aqueous bleaching suspensions including peroxycarboxylic acid suspended in a carrier liquid in the presence of an organic thickening agent and an acidifying agent. The 5 suspensions contain agar or xanthan polysaccharide as thickener and a neutral salt that forms hydrates. It is well known that aqueous liquid laundry detergent products containing suspended solids such as solid peroxyacid, substantially insoluble in water may present problems of phase stability, particularly at varying environmental temperatures and at which the products They can be exposed. j ^ XX'r Another problem is the pH of the product and of the washing solution, because a low product pH is required for the bleaching stability, while the washing pH has advantages for efficient cleaning and bleaching. (see US Patent No. 4,259,201, Cockrell). In addition, when the levels of surfactant agents of product detergents are increased in such compositions to achieve F greater cleaning and bleaching, the viscosity of the product frequently increases to unacceptable levels. Finally, the suspensions of solid particles, especially of peroxycarboxylic acids, frequently present problems of ocular irritations.

However, the use of polymer stabilization systems of the present invention, especially ethoxylated polymers and / or low levels (<1%) of ethoxylated nonionics in aqueous liquid detergent compositions to stabilize solid particles, such as 5, peroxycarboxylic acids substantially insoluble in water, and / or to reduce eye irritation of the compositions, nor has it been suggested in the prior art. Accordingly, there is a need for an aqueous liquid detergent composition comprising one or more particulate solids. 10 such as peroxycarboxylic acids ("peracids") and a polymeric stabilization system and a method for washing clothes by said composition.

BRIEF DESCRIPTION OF THE INVENTION The present invention satisfies and meets the needs identified above, by providing a composition of aqueous liquid detergents comprising one or more particulate solids. ^ such as peroxycarboxylic acids ("peracids") and a system of 20 polymer stabilization. Many aqueous liquid detergent compositions comprise solid particles insoluble in water or partially insoluble in water, such as bleaching agents. Surprisingly it was possible Note that the use of a polymer stabilization system in aqueous liquid detergent compositions appropriately stabilizes the composition as a whole, such that the viscosity of the composition does not increase to an unacceptable level for consumers during the useful life of the product of the product. liquid laundry detergent containing the composition. In other words, the polymer stabilization system stabilizes the composition as a whole, such that the viscosity of the composition does not become too viscous to be used by consumers as a liquid liquid detergent during the life of the product. 10 product. Preferably, the viscosity of the composition is less than 2000 4 cps (viscosities are Brookfield viscosities at 60 rpm), more preferably, the viscosity of the composition is less than 1500 cps, even more preferably, the viscosity of the composition is less than 1000 cps and Even greater preference, the viscosity of the composition is less than 800 cps. In one aspect of the present invention, there is provided an aqueous liquid detergent composition comprising one or more particulate solids such as peroxycarboxylic acids ("peracids") and a system • Polymeric stabilization. In another aspect of the present invention, there is provided an aqueous liquid detergent composition comprising a surfactant, one or more particulate solids such as peroxycarboxylic acids ("peracid") and a polymeric stabilization system.

In still another aspect of the present invention, there is provided an aqueous liquid detergent composition comprising one or more particulate solids such as peroxycarboxylic acids ("peracid") and a polymeric stabilization system that includes a polymeric compound selected from the group comprising polymers nonionic ethoxylates, polymers of anionic polyterephthalate, ethoxylated nonionic surfactants, polyvinylacetate, polyvinylpyrrolidone, polyvinyl N-oxides, polycarboxylates and mixtures thereof. In still another aspect of the present invention, a method is provided for washing fabrics that require washing, which comprises the contact of the fabrics with the aqueous liquid detergent composition of the present invention. Accordingly, the present invention provides a composition of aqueous liquid detergents comprising a stabilization system Polymeric and a method of washing fabrics that require washing, which includes contacting the fabrics with the aqueous liquid detergent composition of the present invention. These and other aspects, objects, features and advantages will be explained in the following detailed description, the examples and the appended claims. All percentages, ratios and proportions used herein are expressed based on weight, unless otherwise indicated *. t ^ y yt? contrary. All documents cited are included herein by reference.

DETAILED DESCRIPTION OF THE INVENTION Aqueous Liquid Detergent Compositions _ "" Liquid Aqueous Detergent Compositions "as used herein, refers to liquid laundry detergent compositions for heavy duty use, liquid detergent compositions 10 for light use (compositions liquid for dishwashing), liquid fabric softeners, liquid conditioners for fabrics, compositions of • liquid cleaning for hard surfaces.

"Particulate Solids" "Particulate solids" as used herein, refers to any detergent ingredient having solid form (ie, granules, powder, flakes, chips, particles, etc.) or is substantially insoluble in water. Preferably, the particulate solids have a particle size of 1-2000 microns. Preferably, the particulate solids are peroxycarboxylic acids (peracids).

Peroxycarboxylic Acids Any suitable preformed peroxycarboxylic acid (hereinafter referred to as peracids and / or peroxyacids) known in the art can be used in the compositions of the present invention as a particulate solid. The preformed peracid as used herein is any convenient compound that is stable and that provides, under conditions of use by the consumer, an effective amount of peracid anion. The preformed peracid compound is preferably selected from the group comprising peroxycarboxylic acids and salts, percarbonic acids and salts, acids and peroxymonosulfuric salts and mixtures thereof. Examples of suitable peracids include, but are not limited to, organic peroxycarboxylic acids with the general formula: OR II Y-R-C-O-OH Wherein R is a substituted alkylene or alkylene group containing from 1 to about 22 carbon atoms, or a substituted phenylene or phenylene group, and Y is hydrogen, halogen, alkyl, aryl, -C (O) OH or -C ( O) OOH. Such organic peroxyacids suitable for use in the present invention may comprise one or two peroxy groups and may be '-an -ÉÍ a-t. to . & - ^ * - sa¡ - ^ á ^^ aife a ^^ j ^^ É & ^^ aíA aliphatic or aromatic. When the organic peroxycarboxylic acid is aliphatic, the unsubstituted peracid has the general formula: O? - (CH2) rt-C-O-0H wherein Y may be, for example, H, CH 3, CH 2 Cl, C (O) OH or C (O) OOH; and n is an integer from 0 to 20. When the organic peroxycarboxylic acid is aromatic, the unsubstituted peracid has the general formula: O 10 Y-C6H4-C-0-OH • Where Y can be, for example, hydrogen, alkyl, alkylhalogen, halogen, C (0) OH or C (0) OOH. Typical monoperoxy acids useful herein include alkyl and aryl peroxyacids such as: (i) peroxybenzoic acid and peroxybenzoic acid with substitution in the ring, for example, peroxy-a-naphthoic acid, monoperoxyphthalic acid (magnesium salt hexahydrate) and o-carboxybenzamidoperoxyhexanoic acid (sodium salt); 20 (ii) aliphatic, substituted aliphatic monoperoxy acids and Arylalkyls, for example, peroxylauric acid, peroxystearic acid, N-nonaoylaminoperoxycaproic acid (NAPCA), N, N- (3-) acid actylsuccinoyl) aminoperoxycaproic acid (SAPA) and N, N-phthaloylaminoperoxycaproic acid (PAP); (iii) amidoperoxyacids, for example, monononylamides of peroxysuccinic acid (NAPSA) or peroxyadipic acid (NAPAA). The diperoxy acids presently useful herein include alkyl diperoxyacids and aryl diperoxy acids, such as: - (1) -12-diperoxydecanedioic acid, (v) 1, 9-diperoxyacetic acid, (vi) diperoxybrassic acid diperoxysebacic acid and diperoxyisophthalic acid, (vii) 2-decyldiperoxybutan-1,4-dioic acid, (viii) 4,4'-sulfonylbisperoxybenzoic acid, such peroxycarboxylic acids are described in US Pat., 483,781, issued to Hartmann on November 20, 1984, the patent of E.U.A. No. 4,634,551 issued to Burns et al., The European Patent No. 0,133,354, Banks et al., Published February 20, 1985 and the US patent. No. 4,412,934, issued to Chung et al., On November 1, 1983. The sources also include 6-nonylamino-6-ocoperoxycaproic acid as fully described in the U.S. patent. 20 No. 4,634,551, issued on January 6, 1987 to Bums et al. The persulfate compounds, such as OXONE, manufactured and marketed by E.l. DuPont de Nemours of Wilmington, DE can also be used as a suitable source of peroxymonosulfuric acid.

Preferred peracids for use in the compositions of the present invention are those with the general formula: wherein R is a C 1-4 alkyl and n an integer from 1 to 5. A particularly preferred peracid has the formula wherein R is CH 2 and n is 10 5, that is, phthaloylaminoperoxycaproic acid (PAP), as described in the US patents. No. 5,487,818, 5,310,934, 5,246,620, 5,279,757 and • 5,132,431. PAP is available at Ausimont SpA under the trade name of Euroco. Peracids used herein preferably have 15 a solubility in aqueous liquid compositions, measured at 20 ° C, from about 10 ppm to about 10,000 ppm, more preferably, from about 20 ppm to about 5,000 ppm, even more preferably from about 15 ppm to about • 1, 000 ppm, still more preferably, approximately 50 ppm 20 approximately 800 ppm. In a particularly preferred embodiment of the present invention, the peracid has an average particle size of less than 100 microns, more preferably less than 80 microns, of greater still preferred, less than 60 microns. More preferably, when the peracid is PAP, it has an average particle size of about 20 to about 50 microns. Preferably, the peracid is present at a level of from about 0.1% to about 25%, more preferably, from about 0.1% to about 20%, even more preferably, from about 1% to about 10% and even more preferably from about 2% to about 4%. Alternatively, the peracid may be present at a much higher level of, for example, 10 10% to 40%, more preferably 15% to 30%, most preferably even 15% to 25%.

Polymeric stabilization system In addition to one or more particulate solids, the compositions 15 of the present invention comprise a polymeric stabilization system. The polymeric stabilization system of the present invention comprises polymeric compounds (including oligomeric compounds). ^ fc * "Polymeric compounds" as used herein, includes oligomeric compounds and means polymeric and / or oligomeric compounds 20 which are characterized by having both hydrophilic components and hydrophobic components. The polymeric compounds for use in the compositions of the present invention may include a variety of units monomeric charged, e.g., anionic or even cationic (see U.S. document 4,956,447), as well as uncharged and the structures may be linear, branched or even star-shaped. They may also include protective portions that are especially effective in controlling molecular weight or altering physical or surfactant properties. Load structures and distributions can be adapted to applications < specific for a variety of detergent products or detergent additives. Many of the appropriate polymeric compounds are characterized as having nonionic hydrophilic segments or hydrophobic segments that are interactive with anionic surfactants. Examples of polymeric compounds suitable for use in the compositions of the present invention include, but are not limited to, polymeric compounds with: (a) one or more nonionic hydrophilic components consisting substantially of: (i) polyoxyethylene segments with a degree of polymerization of at least 2 or • (ii) segments of oxypropylene or polyoxypropylene with a degree of polymerization from 2 to 10, wherein said hydrophilic segment does not comprise an oxypropylene unit unless it is found bound to adjacent portions at each end by ether bonds or (iii) a mixture of oxylalkylene units comprising oxyethylene and from 1 to about 30 oxypropylene units or (b) one or more hydrophobic components including: (i) segments of oxyalkylene terephthalate C3, wherein, if said hydrophobic components also comprise oxyethylene terephthalate, the ratio of oxyethylene terephthalate: C3 oxyalkylene terephthalate units is about 2: 1 or less and / or (ii) C4-C6 alkylene segments or oxyalkylene. C4-C6 or mixtures thereof and / or (iii) (poly) vinyl ester segments, preferably poly (vinyl) acetate with a degree of polymerization of at least 2 and / or (iv) substituents of C 1 -C 4 alkyl ether or C 4 hydroxyalkyl ether or mixtures thereof, wherein said substituents are present in the form of C 1 -C 4 alkyl ether derivatives or hydroxyalkyl ether cellulose or mixtures thereof and said cellulose derivatives are amphiphilic; or (c) a combination of (a) and (b). Typically, the polyoxyethylene segments of (a) (!) Will have a degree of polymerization of 2 to about 200, although higher levels, preferably from 3 to about 150, more preferably from 6 to about 100, may be used. Suitable C-C6 alkylene hydrophobes oxy include, but are not limited to, protected terminals of polymeric compounds such as MO3S (CH2) n OCH2CH2O-, where M is sodium and n is an integer of 4-6, as described • * «and in the patent of E.U.A. Number 4,721, 580, issued on January 26, 1988 to Gosselink, included herein by reference. Other polymeric compounds useful in the compositions of the present invention include, but are not limited to, cellulose derivatives 5 as the hydroxyether cellulosic polymers (commercially available from Dow as METHOCEL®); copolymeric blocks of ethylene terephthalate or propylene terephthalate with polyethylene oxide or polypropylene oxide terephthalate, some of which examples are described in the patent of * E.U.A. No. 3,959,230 issued to Hays, 3,893,929 to Basadur, celluloses of 10 C 1 -C 4 alkyl and C 4 hydroxyalkyl celluloses, such as methylcellulose, ethylcellulose, hydroxypropyl methylcellulose and hydroxybutyl methylcellulose and similar Q. Examples of a variety of cellulosic polymeric compounds are described in U.S. Pat. No. 4,000,093 issued to Nicol et al. Other polymeric compounds which are characterized by hydrophobic segments of (poly) ester (esters) include grafted copolymers of (poly) vinyl ester, eg, C 1 -C 2 vinyl esters, preferably (acetate) poly (vinyl), grafted in oxide-based structures • Polyalkylene. See European patent application 0 219 048, published on 20 April 22, 1987 by Kud et al. Commercially available examples include SOKALAN compounds such as SOKALAN HP-22, available from BASF, Germany. Other polymeric compounds are polyesters with repeating units containing 10-15% by weight of ethylene terephthalate, together with 90-80% by weight of polyoxyethylene terephthalate, derived from a polyoxyethylene glycol with an average molecular weight of 300-5000. Commercial examples include ZELCON 5126 from duPont and MILEASE T from ICI. Other suitable polymeric compounds include polyesters of 1,2-propylene-terephthalate-polyoxyethylene terephthalate with fc ethyl or methyl termination of U.S. Patent No. 4,711, 730 issued on December 8, 1987 to Gosselink et al., The oligomeric esters with protected terminals of the U.S. Patent. No. 4,721, 580 issued on 26 Jan. 10, 1988 to Gosselink, wherein the anionic protected terminals comprise sulfolyethoxy groups derived from polyethylene glycol (PEG), the oligomeric block polyester compounds of the U.S.A. No. 4,702,857 issued October 27, 1987 to Gosselink, with terminal polyethoxy protectors of the formula X- (OCH 2 CH 2) n- wherein n is 12 to About 43 and X is a C 1 -C 4 alkyl or, preferably, methyl; All of these patents are included herein by reference. Additional polymeric compounds that can be used herein include some of the polymeric compounds of the Patent • from E.U.A. No. 4,877,896 issued October 31, 1989 to Maldonado et al., Which discloses esters of terephthalate with anionic protected terminals, especially sulfoaroyl, with said patent being incorporated herein by reference. The terephthalate esters comprise asymmetrically substituted oxy-1, 2-alkyleneoxy units. Included among the polymeric compounds of the U.S. Patent. No. 4,877,896 are materials with hydrophilic polyoxyethylene components or repeat units of C3 oxyalkylene terephthalate (propylene terephthalate) within the scope of the hydrophobic components of (b) (i) mentioned above. Additional classes of polymeric compounds include (I) nonionic terephthalates using diisocyanate coupling agents to link polymeric ester structures, see U.S.A. 4,201,824, Violland et al. and the document of E.U.A. 4,240,918 Lagasse et al; (II) polymeric compounds with carboxylate end groups formed by the addition of trimellitic anhydride to known polymeric compounds for converting the terminal hydroxyl groups into trimellitate esters. With an appropriate selection of the catalyst, the trimellitic anhydride forms bonds with the polymer terminals through an ester of the carboxylic acid isolated from the trimellitic anhydride rather than through the opening of the anhydride bond. Nonionic or anionic polymeric compounds can be used as starting materials as long as they have hydroxyl end groups that can be esterified. See document E.U.A. 4,525,524 Tung et al.; (III) anionic polymeric compounds based on terephthalate of the urethane-bound variety, see U.S.A. 4,201, 824, Viollant et al .; (IV) (caprolactam) poly (vinyl) and copolymers related to monomers such as vinyl pyrrolidone and / or dimethylaminoethyl methacrylate, including both cationic and nonionic polymers, see E.U.A. 4,579,681, Ruppert et al .; (V) grafted copolymers, in addition to SOKALAN types manufactured by BASF, by grafting acrylic monomers onto sulfonated polyesters, see EP 279,134 A, 1988, issued to Rhone Poulenc Chemie; (VI) grafted from vinyl monomers such as acrylic acid and vinyl acetate into proteins such as caseins, see EP 457,205 A, issued to BASF (1991); (VII) polymeric polyester-polyamide compounds prepared by the "fc" condensation of adipic acid, caprolactam and polyethylene glycol, especially for the treatment of polyamide fabrics, see Bevan et al., DE 2,335,044, issued to Unilever NV, 1974. Other useful polymeric compounds are 10 are described in U.S. Patent Nos. 4,240,918, 4,787,989, 4,525,524 and 4,877,896. • Still other classes of polymeric compounds for use in the compositions of the present invention include polyvinyl pyrrolidone polymers, polyamine N-oxide polymers, N-vinylpyrrolidone copolymers and 15 N-vinylimidazole, phthalocyanine, peroxidases, polyvinylacetate and mixtures thereof, some of which examples are described in the patent of E.U.A. No. 5,817,614 issued to Miracle et al. If used, these polymeric compounds typically comprise from about 0.01% to about 10% by weight of the composition, preferably of 20 about 0.01% to about 5%, and most preferably from about 0.05% to about 2%. The polymeric polycarboxylate materials can also be used as polymeric compounds according to the present invention. invention. Such polycarboxylate materials can be prepared by the polymerization or copolymerization of appropriate unsaturated monomers, preferably in their acid form. The unsaturated monomeric acids, which can be polymerized to form suitable polymeric polycarboxylates, include acrylic acid, maleic acid (or maleic anhydride), fumaric acid, itaconic acid, aconitic acid, mesaconic acid, citraconic acid, and methylenemalonic acid. The presence in the polymeric polycarboxylates in the present or monomeric segments, which do not contain carboxylate radicals such as vinylmethyl ether, styrene, ethylene, etc., is always adequate and 10 when said segments do not constitute more than about 40% by weight.

• Particularly suitable polymeric polycarboxylates can be derived from acrylic acid. Such polymers based on acrylic acid, which are useful herein, are the water soluble salts of the 15 polymerized acrylic acid. The average molecular weight of said polymers in the acid form ranges, preferably, from about 2,000 to 10,000, more preferably from about 4,000 to 7,000, and even more preferably from about 4,000 to 5,000. Soluble salts • in water of said acrylic acid polymers may include, for example, the 20 alkali metal, substituted ammonium salts and ammonium. Soluble polymers of this type are known materials. The use of polyacrylates of this type in detergent compositions has been described, for example, in Diehl, U.S. Pat. No. 3,308,067, issued on March 7, 1967. 0 The acrylic / maleic based copolymers can also be used as a preferred polymeric compound of the polycarboxylate class. The average molecular weight of such copolymers in the acid form ranges preferably between about 2,000 and 100,000, more preferably between about 5,000 and 75,000, and even more preferably between 7,000 and 65,000. The ratio between acrylate and maleate segments in such copolymers will generally range from about 30: 1 to about 1: 1, more preferably between about 10: 1 and 2: 1. The water-soluble salts of such copolymers of acrylic acid / maleic acid may include, for example, the alkali metal, substituted ammonium salts and ammonium. Soluble acrylate / maleate copolymers of this type are known materials which are described in the European patent application No. 66915, published December 15, 1982, as well as in EP 193,360, published September 3, 1986, which also describes such polymers comprising hydroxypropylacrylate. Still other useful polymeric compounds of this class include the terpolymers of maleic / acrylic / vinyl alcohol. Said materials are also described in EP 193,360, including for example the terpolymer 45/45/10 of the acrylic / maleic / vinyl alcohol. Another polymeric compound that can be included is polyethylene glycol (PEG). Yet another class of polymeric compounds for use in the compositions of the present invention includes nonionic surfactants with a high degree of ethoxylation, preferably between about 9 and 30 moles of ethyleneoxy units. If the nonionic surfactants are used as the polymeric compounds, in accordance with the present invention then, preferably, the nonionic surfactants are present in the compositions of the present invention at a level of less than 1% by weight of the composition. A class of preferred polymeric compounds includes, but '"Without being limited thereto, the oligomeric terephthalate esters, typically prepared by processes including at least one transesterification / oligomerization, often with a catalyst of 10 metals such as titanium alkoxide (IV). Such esters can be made by additional monomers that can be incorporated into the ester structure through one, two, three, four or more positions without, of course, forming a densely entangled overall structure. Another type of preferred polymeric compound is a copolymer 15 with random blocks of ethylene terephthalate and polyethylene oxide terephthalate (PEO). More specifically, these polymers are composed of repeating units of ethylene terephthalate and PEO terephthalate at a preferred molar ratio between the ethylene terephthalate units and the PEO terephthalate units of about 25:75 to 20 about 35:65; said PEO terephthalate units with a polyethylene oxide content with a molecular weight of from about 300 to about 2,000. The molecular weight of this polymeric compound is preferably in the range of about 25,000 to approximately 55,000. See U.S. Patent No. 3,959,230 issued to Hays, 3,893,929 issued to Basadur, as examples of such polymeric compounds. Still another preferred polymeric compound is a polyester with 5 repeating units of ethylene terephthalate units containing from about 10 to 15% by weight units of ethylene terephthalate, • ß Together with a Proximately 90 to 80% by weight of units of polyoxyethylene terephthalate, derived from a polyoxyethylene glycol with an average molecular weight of from about 300 to about 5,000, and the ratio 10 mole of the ethylene terephthalate units with the terephthalate units r (* of polyoxyethylene in the polymeric compound is preferably between about 2: 1 to about 6: 1. Examples of this type of polymeric compound include the ZELCON® material. commercially available in DuPont and MILEASE® T from ICI, these polymeric compounds and 15 methods for their preparation are described in more detail in the Patent of E.U.A No. 4,702,857 issued to Gosselink. Another class of preferred polymeric compounds includes, but is not limited to, the substantially linear esterified ester oligomers f which are composed of an oligomeric ester structure of terephthaloyl and oxyalkylenoxy repeating units and sulfonated terminal portions derived from covalently allyl attached to the structure, for example as described in the US document 4,968,451, issued November 6, 1990 to J.J. Scheibel and E.P. A > , < Gosselink: such ester oligomers can be prepared by (a) the ethoxylation of allyl alcohol, (b) the reaction of the product of (a) with dimethyl terephthalate ("DMT") and 1,2-propylene glycol ("PG") in a two-step transesterification / oligomerization process and (c) the reaction of the product of (b) with sodium metabisulfite in water; the 1,2-propylene / polyoxyethylene terephthalate polyesters with protected non-ionic terminals a? L of US Pat. 4,711, 730 issued on December 8, 1987 to Gosselink et al., For example those produced by the transesterification / oligomerization poly (ethylene glycol) methyl ether, DMT, PG and Poly (ethylene glycol) ("PEG"); the oligomeric esters, partially and completely protected with anionic terminals, from the U.S.A. 4,721, 580 f 'issued on January 26, 1988 to Gosselink, such as the oligomers of ethylene glycol ("EG"), PG, DMT and Na-3,6-dioxa-8-hydroxyoctansulfonate; the oligomeric compounds of the ionically protected block polyester, 15 document of E.U.A. 4,702,857 issued on October 27, 1987 to Gosselink, for example produced from DMT, PEG protected with Me and EG and / or PG, or a combination of DMT, EG and / or PG, PEG protected with Me and Na-dimethyl -5-sulfoisophthalate and esters of terephthalate with terminals ^^^ protected anionic, especially sulfoaroyl, from the document of E.U.A. 20 4,877,896 issued on October 31, 1989 to Maldonado, Gosselink et al., The latter being typical of polymeric compounds useful in conditioning products for both laundry and fabric washing, one example being an ester composition made from the monosodium salt m-sulfobenzoic acid, PG and DMT optionally, but preferably further comprising PEG, e.g., aggregated PEG 3400. Another preferred polymeric compound is an oligomer with the empirical formula (CAP) 2 (EG / PG) 5 (T) 5 (SIP)? which includes units of 5 terephthaloyl (T), sulfoisophthaloyl (SIP), oxyethyleneoxy and oxy-1,2-propylene (EG / PG) and which is preferably terminated with terminal protections (CAP), preferably modified isethionates, as in an oligomer what ™ includes a sulfoisophthaloyl unit, 5 terephthaloyl units, oxyethyleneoxy units and oxy-1,2-propyleneoxy in a defined ratio, preferably from 10 about 0.5: 1 to about 10: 1, and two protected terminal units derived from sodium 2- (2-hydroxyethoxy) -ethansulfonate. Saying The polymeric compound preferably comprises between 0.5% and 20%, by weight of the oligomer, of a crystallinity reducing stabilizer, for example an anionic surfactant such as sodium dodecylbenzenesulfonate or a 15 selected member of xylene, cumene and toluene sulfonates or mixtures thereof; these stabilizers or modifiers are introduced into the synthesis vessel, according to the teachings of the document of U.S.A. 5,415,807 issued to Gosselink, Pan, Kellett and Hall, on May 16, 1995. Suitable monomers for the above polymeric compound include Na-2- (2-hydroxyethoxy) -ethanesulfonate, DMT, Na-dimethyl-5-sulfoisophthalate, EG and PG. Yet another group of preferred polymeric compounds represent the oligomeric esters comprising: (1) a structure that includes (a) at least one unit selected from the group comprising dihydroxysulfonates, polyhydroxysulfonates, a unit which is at least trifunctional, whereby ester bonds are formed which give rise to a branched oligomer structure and combinations thereof; (b) at least one unit that is a terephthaloyl moiety; and (c) at least one non-sulfonated unit which is a 1,2-oxyalkylenoxy portion and (2) one or more protected units selected from the non-ionic protected units, anionic protected units, such as alkoxylated isethionates, preferably ethoxylated , alkoxylated propansulfonates, alkoxylated propandisulfonates, alkoxylated phenolsulfonates, sulfoaroyl derivatives and mixtures thereof. The preferred ones of such esters are those that present the empirical formula:. { (CAP) x (EG / PG) y, (DEG) y "(PEG) y," (T) z (SIP) z, (SEG) q (B) m} wherein CAP, EG / PG, PEG, T and SIP are as defined hereinabove, (DEG) represents di (oxyethylene) oxy units; (SEG) represents units derived from the sulfoethyl ether of glycerin and units of related portions; (B) represents branching units which are at least trifunctional, wherein the ester bonds originate and a branched oligomer structure is formed; x is from about 1 to about 2; and 'is from about 0.5 to about 25; and "is from about 0 to about 12; and" 'is from 0 to about 10; and * + and "+ y '" sum of about 0.5 to about 25; z is from about 1.5 to about 25; z ' it is from O to approximately 12; z + z 'sum of about 1.5 to about 25; q is from about 0.05 to about 12; m is from about 0.01 to about 10 and x, and ', and ", and'", z, z ', q and m represent the average number of moles of the corresponding units per mole of said ester and said ester has a molecular weight which ranges from approximately 500 to approximately 5,000. 4fe 'The preferred SEG and CAP monomers for the above esters include Na-2- (2-, 3-dihydroxypropoxy) ethanesulfate ("SEG"), Na-2-. { 2- (2-hydroxyethoxy) ethoxy} ethanesulfonate ("SE3") and its homologues and mixtures of 10 the same and the products of the ethoxylation and sulphonation of the allyl alcohol. The esters of the polymeric compound preferred in this class include • product of the transesterification and oligomerization of 2-. { 2- (2-hydroxyethoxy) ethoxy} sodium ethanesulfonate and / or 2- [2-. { 2- (2-hydroxyethoxy) ethoxy} sodium ethoxy] ethane sulfonate, DMT, sodium 2- (2,3- 15 dihydroxypropoxy) ethanesulfonate, EG and PG using an appropriate Ti (IV) catalyst and can be designated as (CAP) 2 (T) 5 (EG / PG) 1.4 (SEG) 2.5 (B) 0.13, where CAP is (Na + - • 03S [CH2CH20] 3.5) - and B is a glycerin unit and the molar ratio of EG-PG is about 1.7: 1 as measured by the chromatography 20 of conventional gases after the finished hydrolysis. Yet another preferred class of polymeric compounds for use in the compositions of the present invention includes the oligomeric, substantially linear and terminally protected esters with polyethoxy / propoxy sulphonates, some of which examples and methods of preparation are described in the patent of E.U.A. No. 5,415,807 issued to Gosselink et al. The esters comprise oxyethyleneoxy units and units r *. of terephthaloyl. Preferred esters additionally comprise units 5 of oxy-1,2-propyleneoxy, sulfoisophthalate and, optionally, poly (oxyethylene) oxy units (with a degree of polymerization of 2 to 4). The esters have a relatively low molecular weight, which typically ranges from * about 500 to about 8,000. Considered in their broadest aspect, polymeric compounds of this kind encompass a base structure which is protected in one, or preferably both, terminal of the structure by the essential protected terminal units. The essential protected terminal units are anionic hydrophilic derivatives of poly-ethoxy / propoxy sulphonated groups and connected to the esters by a bond of esters. The preferred protected terminal units are of the formula (M03S) (CH2) m (CH2CH2?) (RO) n - where N is a salt enhancing cation such as sodium or tetraalkylammonium, m is or or 1, R is ethylene, propylene or a mixture thereof, and n is from 0 to 2; and mixtures thereof. Certain uncharged hydrophobic arylcarbonyl units are essential in the unit of the base structure of the oligoesters herein. Preferably, these are exclusively terephthaloyl units.

Preferred esters of this class comprise, per mole of said ester: (i) from about 1 to about 2 moles of poly-ethoxy / propoxy sulfonated protected terminal units of the formula 5 (M03S) (CH2) m (CH2CH2?) (RO) n- wherein H is a salt enhancing cation such as sodium or tetraalkylammonium, m is 0 or 1, R is ethylene, propylene or a mixture thereof, and n is from 0 to 2; and mixtures thereof; (ii) from about 0.5 to about 66 moles of units selected from the group comprising: a) oxyhexinoxy units, b) a mixture of oxyethyleneoxy and oxy-1,2-propyleneoxy units, fPI wherein said oxyethyleneoxy units are present in a mole ratio of oxyethyleneoxy and oxy-1,2-propyleneoxy ranging from 0.5: 1 to about 10: 1 and, 15 c) a mixture of a) or b) with units of poly (oxyethylene) oxy, wherein said poly (oxyethylene) oxy units have a degree of polymerization of 2 to 4; as long as said poly (oxyethylene) oxy units have a large polymerization of 2, the molar ratio of the poly (oxyethylene) oxy units and the total units of ii) ranges from 0: 1 to about 0.33: 1; and when said poly (oxyethylene) oxy units have a degree of polymerization of 3, the molar ratio of the poly (oxyethylene) oxy units and the total units of group ii) ranges from 0: 1 to about 0.22: 1; and when said poly (oxyethylene) oxy units having a degree of polymerization of 4, the molar ratio of the poly (oxyethylene) oxy units and the total units of the group i) ranges from 0: 1 to approximately 0.14: 1; Ii) from about 1.5 to about 40 moles of terephthaloyl units and iv) from 0 to about 26 moles of 5 5-sulfoisophthaloyl units of the formula - (0) C (C6H3) (S03M) C (0) - wherein M is a salt enhancing cation such as an alkali metal or tetraalkylammonium ion. More preferably, the polymeric compounds for use in the compositions of the present invention are selected from the group of 10 polymeric compounds that are described in the patents of E.U.A. No. 4,702,857 issued to Gosselink, 4,968,451 to Scheibel et al., 5,415,807 to Gosselink et al., And mixtures thereof. Even more preferably, the polymeric compounds for use in the compositions of the present invention are the polymeric compounds described in the US patent. No. 4,968,451 issued to Scheibel et al. In addition to stabilizing the compositions of the present invention, as described herein, the polymeric stabilization system also provides acceptable ocular irritation profiles for the compositions. In other words, the presence of the polymer stabilization system within the compositions of the present invention generates lower ocular irritation properties compared to compositions lacking the polymer stabilization system, as measured by the ex vivo eye exam in chickens, which can be done by the Nutrition and Food Research Institute TNO in the Netherlands. The preferred polymer stabilization system for this purpose comprises the polymeric compounds described in the U.S. Patent. No. 5 4,968,451 issued to Scheibel et al. In general, the compositions of the present invention J will comprise from about 0.01% to about 10%, by weight, of the polymeric compounds, typically from about 0.1% to about 5%, preferably from about 0.02% by weight. 10 approximately 3.0%. Aqueous Liquid Detergent Compositions ^ The present invention comprises water-based liquid detergent compositions. Aqueous liquid detergent compositions preferably comprise, in addition to particulate solid (s) and the The polymer stabilization system described above, from about 10% to about 98%, preferably from about 30% to about 95%, by weight, of an aqueous liquid vehicle which is preferably water. The detergent compositions W aqueous liquids of the present invention preferably also comprise 20 1 or more cleaning attachments. The term "cleaning adjunct materials", as used herein, refers to a liquid, solid or gaseous material for aqueous liquid detergent compositions, Preference compatible with the other ingredients present in the aqueous liquid detergent compositions of the present invention. The specific selection of the cleaning attachment materials is easily carried out considering the surface, the article or the fabric to be cleaned. Examples of suitable cleaning adjunct materials include, but are not limited to, surfactants, enhancers, bleaches, bleach activators, bleach catalysts, enzymes, enzyme stabilizer systems, chelants, optical brighteners, soil release polymers, agents transfer of dyes, dispersants, foam suppressants, dyes, perfumes, dyes, filler salts, hydrotropes, photoactivators, fluorescent, fabric conditioners, fabric softening agents, hydrolyzable surfactants, preservatives, antioxidants, anti-shrinkage agents, agents anti-wrinkles, germicides, fungicides, colored specks, silver protectors, anti-stain and / or anti-corrosive agents, alkalinity sources, solubilizing agents, vehicles, processing aids, pigments and pH control agents, as described in the US patent No. 5,705,464, 5,710,115, 5,698,504, 5,695,679, 5,686,014 and 5,646,101. The specific cleaning attachment materials are explained in detail later. If the cleaning adjunct materials are not compatible with the other ingredients present in the aqueous liquid detergent compositions of the present invention, then suitable methods can be used to keep the materials separated (without contact with each other). incompatible cleaning attachments and other ingredients, until the combination of both components is appropriate. Suitable methods * s can be any method known in the art, such as * gel capsules, encapsulation, tablets, physical separation, etc.

The aqueous liquid detergent compositions of the present invention comprise: A - (a) one or more particulate solids, preferably a peracid; (b) a polymer stabilization system; (c) optionally, but preferably, a surfactant and; 10 (d) optionally, but preferably, one or more cleaning adjunct materials. F Aqueous liquid detergent compositions can include from about 1% to about 99.9%, by weight of the composition, of the cleaning adjunct materials. 15 As used herein, "compositions for the "fabric washing" include detergent compositions for washing by hand or in a washing machine, including additive washing compositions and compositions suitable for use in soaking and / or pre-treating stained fabrics. the present invention are formulated as suitable compositions for used in a washing machine washing method, the compositions of the present invention preferably contain both a surfactant as an improving compound and, in addition, one or more adjunct cleaning materials, preferably selected from organic polymeric compounds, bleaching agents, additional enzymes, suds suppressants, dispersants, calcium carbonate dispersants of soap, soil suspending agents and anti-redeposition and corrosion inhibitors. The laundry compositions may also contain softening agents, such as additional cleaning materials attached. The aqueous liquid detergent compositions of the present invention can also be used as detergent additive products in liquid form. It is intended that such additive products complement or increase the efficacy of conventional detergent compositions and can be added at any stage of the washing process. If necessary, the density of laundry detergent compositions herein ranges from 400 to 1.200 g / liter, preferably from 500 to 950 g / liter of the composition measured at 20 ° C. of aqueous liquid detergents in accordance with the present invention can have "concentrated form"; in such case, aqueous liquid detergent compositions in accordance with the present invention will comprise a minor amount of water, as compared to conventional liquid detergents. Typically, the water content of the concentrated aqueous liquid detergent compositions is preferably less than 40%, more preferably less than 30% and, even more preferably, less than 20% by weight of the composition. In addition, the aqueous liquid detergent compositions according to the present invention can be isotropic liquids, aqueous gels and colored liquid compositions.

- Preferred cleaning adjuncts Agents surfactants Aqueous liquid detergent compositions of the The present invention preferably comprises a surfactant system that preferably includes one or more detersive co-surfactants. The co-surfactant agents can be selected from nonionic detersive surfactants, anionic detersive surfactants, zwitterionic detersive surfactants, detersive surfactants, 15 amine oxide, biodegradable branched surfactants and mixtures thereof. The surfactant system typically comprises from about 5% to about 70%, preferably from about 15% to about 30% by weight of the composition w of the detergent. 20 i. Anionic Surfactant Anionic surfactants include alkylbenzene sulfonates C-n-C-iß (LAS) and primary chain, C 1 or C 2 -C alkyl sulphates branched and randomized, (AS), secondary (2,3) alkyl sulfates of the formula CH3 (CH2) x (CHOS03"M +) CH3 and CH3 (CH2) and (CHOS03-M +) CH2CH3, where xy (and +1) are integers of at least about 7, preferably at least about 9, and M is a water-solubilizing cation, especially sodium, unsaturated sulfates, such as oleyl sulfate, alkylalkoxy sulphates C- IO-C-IS ("AEXS", especially ethoxy sulfates EO 1-7), the carboxylates of C10-C18 alkylalkoxy (especially the ethoxycarboxylates EO 1-5), the glycerol ethers of C10-Ci8, the alkyl polyglycosides and their corresponding sulfated polyglycosides, and the alpha-sulfonated fatty acid esters C-12-C18 In general terms, the anionic surfactants useful herein are described in US Patent No. 4,285,841 issued to Barrat et al., on August 25, 1981 and in U.S. Patent No. 3,919,678 issued to Laughiin et al., on December 30 1975. Anionic surfactants include water-soluble salts, particularly alkali metal, ammonium and alkylolammonium salts (eg, monoethanol ammonium or triethanolammonium), organic sulfuric reaction products that include an alkyl group in their molecular structure which contains from about 10 to about 20 carbon atoms and an ester group of sulfonic acid or sulfuric acid. (The term "alkyl" includes the alkyl portion of the aryl groups). Examples of this group of synthetic surfactants are alkyl sulphates, especially those obtained by sulfation of alcohols higher (carbon atoms Cß-C? 8) as those produced by reducing the glycerides of tallow or coconut oil. Other anionic surfactants herein are the water soluble salts of alkylphenol ether ethylene oxide sulfates containing from about 6 to 20 carbon atoms in the fatty acid group and from about 1 to 10 carbon atoms in the group of ester; the water-soluble salts of 2-acyloxy-alkan-1-sulfonic acids containing from about 2 to 9 carbon atoms in the acyl group and from about 9 to about 23 carbon atoms in the alkane portion; the water-soluble salts of olefin sulfonates containing from about 12 to 24 carbon atoms and b-alkyloxyalkane sulphonates containing from about 1 to 3 carbon atoms in the alkyl group and from about 8 to 20 carbon atoms in the portion of alkane. Particularly preferred anionic surfactants herein are alkyl sulfates, in particular alkylpolyethoxylate sulfates of the formula: wherein R is an alkyl chain with about 10 to about 22 carbon atoms, saturated or unsaturated, M is a cation that makes the compound soluble in water, especially a alkali metal, ammonium or substituted ammonium cation and on average x is from about 1 to about 15, and the C12-C15 primary and secondary alkyl sulfates are not ethoxylated. Under washing conditions with cold water, that is, less than about 18.3 ° C, it is preferable that there be a mixture of such ethoxylated and non-ethoxylated alkyl sulfates. The fatty acids useful in the present invention as ammonium surfactants include saturated and / or unsaturated fatty acids obtained from natural or synthetically prepared sources. Examples of suitable fatty acids include, but are not limited to, capric acid, 10 lauric, myristic, palmitic, stearic, arachidic and behenic. Other fatty acids include palmitoleic, oleic, linoleic, linolenic and ricinoleic acid.

^ P * Examples of suitable anionic surfactants are also provided in "Surface Active Agents and Detergents" (Vol. 1 and 2 by Schwartz, Perry and Berch). A variety of such surfactants are 15 also describes in general terms in U.S. Patent No. 3,929,678 issued December 30, 1975 to Laughiin et al., In column 23, line 58 to column 29, line 23. ii. Nonionic Surfactants 20 Suitable nonionic surfactants for detergents are described in general terms in U.S. Pat. No. 3,929,678 issued to Laughiin et al., December 30, 1975 and the U.S. Patent. No. 4,285,841 issued to Barrat et al., On August 25, 1981. Classes 8 Non-limiting examples of useful non-ionic surfactants include: Cs-C-iß alkyl ethoxylates ("AE") with EO of about 1-22, including so-called narrow peak alkyl ethoxylates and C6-C12 alkylphenol alkoxylates (especially ethoxylates and ethoxy) / propoxy mixed), 5-alkyldialkylamine oxide, alkanoyl glucosamide and mixtures thereof. If nonionic surfactants are used, the compositions of the present invention will preferably include up to about 10%, preferably from 0% to about 5%, more preferably from 0% to about 3%, by weight of a non-surface active agent. ionic. They are Preferred are the ethoxylated alcohols and ethoxylated alkylphenols of the formula R (OC2H4) nOH, wherein R is selected from the group comprising aliphatic hydrocarbon radicals containing from about 8 to about 15 carbon atoms and alkylphenyl radicals wherein the alkyl groups they contain from about 8 to about 12 15 carbon atoms, and the average value of n is from about 5 to about 15. These surfactants are described fully in the U.S. patent. No. 4,284,532, Leikhim et al., Issued August 18, 1981. Ethoxylated alcohols with an average of about 10 to about 15 carbon atoms are particularly preferred. 20 carbon in the alcohol and an average degree of ethoxylation of about 6 to about 12 moles of ethylene oxide per mole of alcohol.

Other nonionic surfactants for use herein include, but are not limited to: The condensates of polyethylene oxide, polypropylene and polybutylene of alkylphenols. In general, condensates are preferred 5 polyethylene oxide. These compounds include the condensation products of alkylphenols with an alkyl group containing JE at about 6 to about 12 carbon atoms with a straight chain or branched chain configuration with the alkylene oxide. In a preferred embodiment, the ethylene oxide is present with 10 an equal amount between about 5 and about 25 moles of the ethylene oxide per mole of the alkylphenol. Commercially available nonionic surfactants f of this type include Igepal® CO-630, marketed by GAF Corporation; and Triton® X-45, X-114, X-100 and X-102, all marketed by Rohm & Haas Company. These compounds are 15 commonly refer to alkylphenol alkoxylates (e.g., alkylphenol ethoxylates). The condensation products of aliphatic alcohols having from about 1 to about 25 moles of ethylene oxide. The alkyl chain of the aliphatic alcohol may be linear or branched, primary or secondary, and generally contains from about 8 to about 22 carbon atoms. Of particular preference are the condensation products of alcohols with an alkyl group containing from about 10 to about 20 carbon atoms, with about 2 to about 18 moles of ethylene oxide per mole of alcohol. Examples of commercially available nonionic surfactants of this type include Tergitol® 15-S-9 (the product of condensation of a C11-C15 linear secondary alcohol with 9 moles of ethylene oxide), Tergitol® 24-L-6 NMW (the condensation product of a C2-C14 primary alcohol with 6 moles of ethylene oxide with a narrow molecular weight distribution), both marketed by Union Carbide Corporation; Neodol® 45-9 (the condensation product of a linear alcohol C14-C? 5 with 9 moles of ethylene oxide), Neodol® 23-6.5 (the condensation product of a linear C12-C13 alcohol with 6.5 moles of oxide of ethylene), Neodol® 45-7 (the condensation product of a C14-C15 linear alcohol with 7 moles of ethylene oxide), Neodol® 45-4 (the condensation product of a C14-C15 linear alcohol with 4 moles of ethylene oxide), marketed by Shell Chemical Company, and Kyro® EOB (the condensation product of a C 13 -C 15 alcohol with 9 moles of ethylene oxide), marketed by The Procter & Gamble Company. Other commercially available nonionic surfactants include Dobanol 91-8® marketed by Shell Chemical Company and Genapol UD-080® marketed by Hoechst. This category of nonionic surfactants is generally referred to as "alkyl ethoxylates". The condensation products of ethylene oxide with a hydrophobic base formed by the condensation of propylene oxide with propylene glycol. The hydrophobic portion of these compounds preferably has a molecular weight of about 1, 500 to about 1, 800 and exhibits insolubility in water. The addition of polyoxyethylene portions to this hydrophobic portion tends to increase the water solubility of the molecule as a whole, and the liquid character of the product is retained to the point where the polyoxyethylene content reaches approximately 50% of the total weight of the condensation product, which corresponds to the condensation with a maximum of about 40 moles of the ethylene oxide. Examples of compounds of this type include some of the Pluronic® surfactants commercially available from BASF. 10 The condensation products of ethylene oxide with the product generated by the reaction of propylene oxide and ethylenediamine. The hydrophobic portion of these products consists of the reaction product of ethylene diamine and excess propylene oxide, and generally has a molecular weight of from about 2,500 to about 3,000. This portion Hydrophobic is condensed with the ethylene oxide to the extent that the condensation product contains from about 40% to about 80% by weight of polyoxyethylene and has a molecular weight of from about 5,000 to about 11,000. Examples of this type of agents ^ w non-ionic surfactants include some of the Tetronic® compounds 20 commercially available at BASF. Semi-polar nonionic surfactants are a special category of nonionic surfactants that include water-soluble amine oxides containing an alkyl portion of about 10 to about 18 carbon atoms and 2 portions selected from the group comprising alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; water-soluble phosphine oxides containing a alkyl portion of about 10 to about 18 carbon atoms carbon and two selected portions of the group comprising alkyl groups and hydroxyalkyl groups containing an alkyl portion of ^ & about 10 to about 18 carbon atoms and a portion selected from the soluble group comprising alkyl portions 10 and hydroxyalkyl of about 1 to about 3 carbon atoms carbon.

F Semi-polar nonionic surfactant detergent agents include the surfactants of amine oxide with the formula O 15 R3 (OR4) xN (R5) 2 wherein R3 is an alkyl, hydroxyalkyl or alkylphenyl group or mixtures thereof containing from about 8 to 20 about 22 carbon atoms; R4 is an alkylene or hydroxyalkylene group containing from about 2 to about 3 carbon atoms or mixtures thereof; x comprises from 0 to about 3; and each R 5 is an alkyl or hydroxyalkyl group which contains from about 1 to about 3 carbon atoms or a polyethylene oxide group containing from about 1 to about 3 ethylene oxide groups. The R5 groups may be linked to one another, for example through an oxygen or nitrogen atom to form an annular structure. These surfactants of the amine oxide include, in particular, C 10 -C 18 alkyldimethylamine oxides and C 8 -C 12 alkoxyethyldihydroxyethyl amine oxides. The alkylpolysaccharides described in the U.S.A. 4,565,647 issued to Llenado, January 21, 1986, with a hydrophobic group containing from about 6 to about 30 carbon atoms, preferably from about 10 to about 16 carbon atoms and a polysaccharide, for example a polyglycoside, a group hydrophilic containing from about 1.3 to about 10, preferably from about 1.3 to about 3, more preferably from about 1.3 to about 3.7 units of saccharide. Any reducing saccharide containing 5 or 6 carbon atoms can be used, for example portions of glucose, galactose and galactosyl can be substituted by glucosyl moieties. (Optionally, the hydrophobic group is attached to positions 2,3,4, etc., thereby providing a glucose or galactose as opposed to a glucoside or galactoside). Intersaccharide junctions can be, for example, between an additional saccharide position and positions 2, 3, 4 and / or 6 in the a saccharide units. Optionally, and less preferred, there can be a polyalkylene oxide chain linking the hydrophobic portion with the polysaccharide portion. The preferred alkylene oxide is ethylene oxide. Typical hydrophobic groups include alkyl groups, whether saturated or unsaturated, branched or unbranched, containing from about 8 to about 18, preferably from about 10 to about 16, carbon atoms. Preferably, the alkyl group is a straight chain saturated alkyl group. The alkyl group may comprise up to about 3 hydroxyl groups and / or the polyalkylene oxide chain may comprise up to about 10, preferably less than 5, alkylene oxide portions. Suitable alkyl polysaccharides are octyl, nonyl, decyl, undecyldecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl and octadecyl, di-, tri-, tetra-, penta- and hexaglucosides, galactosides, lactosides, glucoses, phytosides, phytoses and / or galactoses. Suitable mixtures include alkyl di-, tri-, tetra- and pentaglucosides of coconut and tallow alkyl tetra-, penta- and hexyl-glucosides. Preferred alkyl polyglycosides have the formula R20 (CnH2nO) t (glycosyl) x "wherein R2 is selected from the group comprising alkyl, alkylphenyl, hydroxyalkyl, hydroxyalkylphenyl, and mixtures thereof, wherein the alkyl groups contain from about 10 to about 18, preferably from about 12 to about 5 about 14 carbon atoms; n is 2 or 3, preferably 2; t is from 0 to about 10, preferably 0; and x is from about 1.3 to about 10, preferably from about 1.3 to about 3, more preferably from about 1.3 to about 2.7. The glycosyl is derived preferably from glucose. For In order to prepare said compounds, the alcohol or alkyl polyethoxy alcohol is first formed and then reacted with glucose, or a source of glucose, to form the glucoside (linkage at position 1). The additional glycosyl units can be linked between their position 1 and positions 2, 3, 4 and / or 6 of the preceding glycosyl units, preferably predominantly in the 15 position 2. The fatty acid amide surfactants have the formula: Wherein R6 is an alkyl group containing from about 7 to about 21 (preferably from about 9 to about 17) carbon atoms and each R7 is selected from the group which consists of hydrogen, C1-C4 alkyl, C1-C4 hydroxyalkyl and - (C2H40) xH, wherein x ranges from about 1 to about 3. Preferred amides are C8-C20 ammonia amides, monoethanolamides, diet-nolamides and isopropanolamides . Conventional non-ionic and amphoteric surfactants include C12-C18 alkyl ethoxylates (AE) including so-called narrow peak alkyl ethoxylates and C6-C2 alkylphenol alcoxylates (especially ethoxylates and ethoxy / propoxy) • mixed). The C10-C18 N-alkyl polyhydroxy fatty acid amides can also be used. Typical examples include N-methylglucamides 10 C12-C18. See WO 9,206,154. Other surfactants derived from sugar include the N-alkoxy polyhydroxy fatty acid amides, such as N- (3-methoxypropyl) glucamide C-? O-C? 8. The N-propyl glucamides to C12-C18 N-hexyl can be used for low foam formation. Conventional C10-C20 soaps can also be used. If you want a For high foaming, branched-chain C-io-C-iß soaps can be used. Examples of nonionic surfactants are described in the U.S. Pat. No. 4,285,841 issued to Barrat et al., On August 25 Preferred examples of these surfactants include 20 ethoxylated alcohols and ethoxylated alkylphenols of the formula R (OC2H4) nOH, wherein R is selected from the group comprising aliphatic hydrocarbon radicals containing from about 8 to about 15 carbon atoms and alkylphenyl radicals wherein the alkyl groups they contain from about 8 to about 12 carbon atoms, and the average value of n is from about 5 to about 15. These surfactants are described in full in the U.S. Patent. No. 4,284,532 issued to Leikhim et al., On August 18, 1981. Of particular preference are alcohols with an average of about 10 to about 15 carbon atoms in the alcohol and an average degree of ethoxylation of about 6 to about 12 moles of ethylene oxide per mole of alcohol. Mixtures of anionic and nonionic surfactants are especially useful. Other conventional surfactants that are useful are listed in standard texts, including C12-C18 betaines and sulfobetaines (sultaines). 15 iii. Amine Oxide Surfactants The compositions herein also contain amine oxide surfactants of the formula: R ^ EOMPOMBOkNÍOXCHzR'k.qHzO (I) 20 It is generally observed that the structure (I) provides a long chain portion R1 (EO) x (PO) and (BO) z and two short chain portions, CH2R ' . R 'is preferably selected from hydrogen, methyl and -CH2OH. For the Generally, R1 is a primary or branched hydrocarbyl portion, which may be saturated or unsaturated, preferably, R1 is a primary alkyl portion. When x + y + z = 0, R1 is a hydrocarbyl portion with a * • Chain length from approximately 8 to approximately 18. When x 5 + y + z is different from 0, R1 can be longer, with a chain length within the range C? 2-C24. The general formula also includes oxides of - ^ amine, where x + y + z = 0, R1 = Cß-C-iß, R 'is H and q is 0-2, preferably 2. These amine oxides are illustrated by alkyldimethylamine oxide C 2-Ci 4, hexadecyldimethylamine oxide, octadecylamine oxide and its 10 hydrates, especially the dihydrates are described in the patents of E.U.A. No. 5,075,501 and 5,071, 594, included herein by reference. The invention also includes amine oxides, wherein x + y + z is non-zero, specifically x + y + z is from about 1 to about 10, R1 is a primary alkyl group containing from 8 to 15 about 24 carbons, preferably about 12 to about 16 carbon atoms; in these embodiments, y + z is preferably 0 and x is preferably from about 1 to about 6, most preferably from about 2 to about 4; EO represents ethyleneoxy, PO represents propyleneoxy and BO represents butyleneoxy. Such amine oxides can be prepared by conventional synthetic methods, for example by reaction of alkyl ethoxy sulfates with dimethylamine followed by oxidation of the ethoxylated amine with hydrogen peroxide.

The highly preferred amine oxides herein are solids at room temperature, most preferably their melting point is within the range of 30 ° C to 90 ° C. The right amine oxides to be used herein are marketed by various suppliers, including Akzo Chemie, Ethyl Corp. and Procter & Gamble. See the compilation of McCutcheon and the review article by Kirk-Othmer for a ^. Meet other manufacturers of amine oxide. The commercially available preferred amine oxides are ADMOX 16 and ADMOX 18 dihydrate solids, ADMOX 12 and especially ADMOX 14 from Ethyl Corp.

Preferred embodiments include the dihydrate of the dodecyldimethylamine oxide, the dihydrate, the hexadecyldimethylamine oxide, the octadecyldimethylamine oxide dihydrate, the hexadecyltris (ethyleneoxy) dimethylamine oxide, the tetradecyldimethylamine oxide dihydrate, and mixtures thereof. Although in some of the preferred embodiments R 'is H, there is some freedom that R' is slightly greater than H.

Specifically, the invention also encompasses the embodiments wherein R 'is CH20H, such as hexadecylbis (2-hydroxyethyl) amine oxide, • sebobis (2-hydroxyethyl) amine, stearylbis (2-hydroxyethyl) amine oxide and 20 oleylbis (2-hydroxyethyl) amine oxide. iv. Biodegradable Branched Surfactants The present invention includes important embodiments comprising at least one biodegradable branched surfactant and / or altered and / or branched crystallinity in the middle of the chain or a mixture of these surfactants. The terms "biodegradablely branched" and / or "altered crystallinity" and / or "branched to the middle of the chain" (the acronym "MCB" used hereafter) indicate that such surfactants or mixtures of surfactants are characterized by the presence of surfactant molecules with a moderately non-linear hydrophobe; more particularly, wherein the surfactant hydrophobe is not completely linear on the one hand, nor is it branched to a degree that would cause unacceptable biodegradation. Preferred biodegradable branched surfactants are distinguished from the known commercial types LAS, ABS, Exxal, Lial, etc., whether branched or unbranched. The biodegradable branched materials comprise a slight branching at a particular location, for example from about one to about three branches of methyl and / or ethyl and / or propyl and / or butyl in the hydrophobe, where the branching is located at a remote distance of the main surfactant group, preferably towards the hydrophobic center. Typically, between one and three such branches may be present in a single hydrophobe, preferably only one. Such biodegradable branched surfactants may comprise exclusively linear aliphatic hydrophobes, or hydrophobes may include a cycloaliphatic or aromatic substitution. The MCB analogs of the surface active agents of the common linear alkyl sulfate, linear alkyl poly (alkoxylate), linear alkoylbenzenesulfonate are highly preferred; said surfactants are suitably selected from the C8-Ci8 alkylsulfates branched in C1-C4 at the half chain, the alkylethoxylated, propoxylated or branched Cs-C-iß butoxylated alcohols at C 1 -C 4 at the center of the chain, the alkyl ethoxy sulfates Cß-Ciß branched at C 1 -C 4 at the center of the chain, the C 8 -C 16 alkylbenzene sulfonates branched at C 1 -C 4 at the center of the chain and mixtures thereof. When they are anionic, the agents Surfactants can generally be in the form of an acid or a salt, for example sodium, potassium, ammonium or substituted ammonium. The biodegradable branched surfactants offer substantial improvements with respect to • the effectiveness of the cleaning and / or the utility in cold water and / or the resistance to the hardness of the water and / or the economy of use. Such surfactants Generally, they can belong to any known class of surfactants, for example anionic, nonionic, cationic or zwitterionic agents. The biodegradable branched surfactants are synthesized through Procter & amp; Gamble, Shell and Sasol. These surfactants are fully described in W098 / 23712 A, 20 published 04/06/98; W097 / 38957 A, published on 10/23/97; W097 / 38956 A, published on 10/23/97; WO97 / 39091 A, published on 10/23/97; WO97 / 39089 A, published on 10/23/97; WO97 / 39088 A, published on 10/23/97; WO97 / 39087 A1 published on 10/23/97; W097 / 38972 A published on 10/23/97; W098 / 23566 A Shell, published 04/06/98; Sasol's technical bulletins; and the following pending patent applications assigned to Procter & Gamble. Preferred biodegradable branched surfactants herein include, in more detail, the MCB surfactants, as described in the following references: W098 / 23712 A published on 06/04/98, includes the description of nonionic surfactants MCB, including the primary alkyl polyoxyalkylene MCB of the formula (I): CH3CH2 (CH2) wC (R) H (CH2) xC (R1) H (CH2) and C (R2) H (CH2) z (EO / PO) mOH (1) wherein the total number of carbon atoms in the branched primary alkyl portion of this formula, including branching R, R1 and R2, but not including the carbon atoms in the EO / PO alkoxy portion, is preferably 14- 20, and wherein in addition, for this mixture of surfactants, the total average number of carbon atoms in the hydrophobic portion of the primary alkyl MCB is preferably 14.5-17.5, most preferably 15-17; R, R and R2 are independently selected from hydrogen and alkyl 1-3C, preferably methyl, provided that R, R1 and R2 are not hydrogen in their entirety and, when z is 1, at least R or R1 is not hydrogen; w is an integer of 1-13; x is an integer of 0-13; and is an integer of 0-13; z is an integer of at least 1; w + x + y + z is 8-14 and EO / PO are alkoxy portions that are preferably selected from ethoxy groups, mixed propoxy and ethoxy / propoxy, wherein m is at least 1, preferably 3-30, more preferably 5-20, even more preferably 5-15. Such non-ionic MCB agents may alternatively include portions derived from butylene oxide and the -OH portion may be replaced with one of the well known protected terminal portions used for conventional nonionic surfactants. ? W097 / 38957 A, published on 10/23/97, includes the description of alcohols branched in half or near the middle of the chain of the formula R-CH2CH2CH (Me) CH-R1-CH2OH (I) and HOCH2-R-CH2- 10 CH2-CH (Me) -R '(II), which comprises: (A) dimerizing the alpha-olefins of the formula RCH = CH2 and R1CH = CH2 to form olefins of formula R (CH2) 2-C (R1) = CH2 and if (B) (i) shale the olefins and react them with carbon monoxide / hydrogen under Oxo conditions or ( ii) make them react directly from step (A) with CO / H2 under Oxo conditions. In the 15 above formula, R, R1 = linear alkyl 3-C-7-C. W097 / 38957 A also describes (i) the production of alkyl sulfate MCB surfactants, sulfating (I) or (II); (ii) the preparation of alkylethylsulphates MCB comprising the ethoxylation and then the sulfation (I) or (II); (iii) the preparation ^ F of alkyl carboxylate surfactants MCB comprising the 20 oxidation (I) or (II) or its aldehyde intermediates and (v) the preparation of surfactants of acyl taurate MCB, acyl isethionate MCB, acyl sarcosinate MCB or acyl N-methylglucamide MCB, using the carboxylates of branched alkyl as feedstock.

Document W097 / 38956 A, published on 10/23/97, describes the preparation of branched alpha-olefins in the center or near the center of the chain that is carried out by: (a) the preparation of a carbon monoxide mixture and hydrogen; (b) reacting this mixture in the presence of a catalyst under Fischer-Tropsch conditions to prepare a hydrocarbon mixture comprising the aforementioned olefins and (c) separating the olefins from the hydrocarbon mixture. W097 / 38956 A further describes the preparation of alcohols branched in half or near the middle of the chain by the reaction of olefins 10 mentioned with CO / H2 under Oxo conditions. These alcohols can be used to prepare (1) sulfate MCB surfactants through the * B sulfation of alcohols; (2) MCB alkyl ethoxy sulfates by the ethoxylation and sulfation of the alcohols or; (3) branched alkyl carboxylate surfactants by the oxidation of alcohols or their intermediates 15 aldehyde. The branched carboxylates formed can be used as feedstock to prepare acyltaurate, acyl isethionate, acyl sarcosinate, N-methylglucamide branched acyl surfactants, etc. Document WO97 / 39091 A, published on 10/23/97, includes the Description of a surfactant composition of detergents comprising at least 0.5 (especially 5, more especially 10, more especially still 20) percent by weight of the longer alkyl chain MCB surfactant of the formula (I). A-X-B (I), where A is a hydrophobic C-alkyl MCB of 9-22 (especially 12-18) with: (i) one of the longest linear C chains attached to the X-B portion with 8-21 C atoms; (ii) 1-3 C alkyl portion (s) branching from its longest linear chain; (iii) at least one of the branched alkyl portions linked directly to a C of the longest linear C chain, at a position within the range of the 2 C position, counting from C1 being bound to the CH2B, carbon omega-2 (terminal C minus 2C); and (iv) the surfactant composition has a total average number of C atoms in the A-X portion of 14.5-17.5 (especially 15-17); and B is a hydrophilic portion 10 (main surfactant group) which is preferably selected from sulfates, sulphonates, polyoxyalkylene (especially polyoxyethylene or polyoxypropylene), alkoxylated sulfates, polyhydroxy portions, phosphate esters, glycerol sulfonates, polygluconates, polyphosphate esters, phosphonates, sulfosuccinates, »Polyalkoxylated carboxylates, glucamides, taurinates, sarcosinates, glycinates, 15 isethionates, mono- / di-alkanol-amides, monoalkanolamide sulphates, diglycolomide and its sulfates, glyceryl esters and their sulfates, glycerol ethers and their sulphates, polyglycerol ether and sulfates thereof, sorbitan esters, esters of polyalkoxylated sorbitan, ammonium-alkane sulfonates, amidopropiibetaines, ^^^ F rented quaternaries, alkylated / polyhydroxyalkylated quaternaries 20 (oxypropyl), imidazolines, 2-yl succinates, alkyl esters and sulfonated fatty acids; and X- is -CH2 or -C (O). WO 97/39091 A also discloses a laundry detergent or other cleaning composition that comprises: (a) 0.001-99% of a surfactant detergent agent (I); and (b) 1-99.999% of ingredients attached. WO 97/39089 A, published on 10/23/97, includes the description of liquid cleaning compositions comprising: (a) as a part of the surfactant system, 0.1-50 (especially 1-40) percent in weight of a surfactant branched to the middle of the chain with the formula (I); (b) as the other part of the surfactant system, 0.1-50 weight percent of co-surfactants; (c) 1-99.7 weight percent of a solvent; and (d) 0.1-75 weight percent of adjunct ingredients. The The formula (I) is A-CH2-B, where A = a hydrophobic of alkyl MCB 9-22 (especially 12-18) C with: (i) one of the longest linear chains C * attached to the X-B portion with 8-21 C atoms; (ii) alkyl portion (s) 1-3C branching from its longest linear chain, (iii) at least one of the branched alkyl portions attached directly to a C of the C chain 15 linear longer in a position within the range of position 2 C, counting from Carbon No. 1 that is attached to the CH2B portion, to the omega-2 carbon (terminal C minus 2C); and (iv) the surfactant composition has a total average number of C atoms in the A-X portion of 14.5-17.5 (especially 15-17); and B is a hydrophilic portion selected from 20 sulfates, polyoxyalkylenes (especially polyoxyethylene and polyoxypropylene) and alkoxylated sulfates.

WO 97/39088 A, published on 10/23/97, includes the description of a surfactant composition comprising 0.001-100% of primary alkyl alkoxylated sulfate (s) MCB of the formula (I): CH3CH2 (CH) wCHR (CH2) xCHR1 (CH2) and CHR2 (CH2) 2OS? 3M (l) wherein the total number of C atoms in the compound (I) that includes R, R1 and R2, is preferably 14-20, and the total number of C atoms in the branched alkyl portions preferably has a 10 average 14.5-17.5 (especially 15-17); R, R1 and R2 are selected from H and alkyl 1-3C (especially Me) as long as R, R1 and R2 are not all H; when z = 1, at least R or R1 is not H; M are especially selected Na, K, Ca, Mg, quaternary alkylammonium cations of the formula N + R3R4R5R6 (II); M is especially Na and / or K; R3, R4, R5, R6 are selected H of H, alkylene 1-22C, branched alkylene 4-22C, alkanol 1-6C, alkenylene 1-22C and / or branched alkenylene 4-22C; w, x, y = 0-13; z is at least one; w + y + z = 8-14. WO97 / 39088 A also describes (1) a surfactant decomposition comprising a mixture of branched primary alkyl sulphates F with the formula (I) described above. M is a 20 cation soluble in water. When R2 is a 1-3C alkyl, the proportion of surfactants with z = 1 with respect to the surfactants with z = 2 or greater is preferably at least 1: 1 (more especially 1: 100); $ (2) a detergent composition comprising: (a) 0.001-99% primary alkoxylated alkylsulphate MCB of the formula (III) and / or (IV): CH3 (CH2) aCH (CH3) (CH2) bCH2? S03M (III) CH3 (CH2) bCH (CH3) (CH2) eCH (CH3) CH2? S03M (IV) where a, b, d and e are integers, preferably a + b = 10-16, d + c = 8-14, and when a + b = 10, a = 2-9 and b = 1-8; when a + b = 11, a = 2-10 and b = 1-9; when a + b = 12, a = 2-11 and b = 1-10; when a + b = 13, a = 2-12 and b = 1-11; when a + b = 14, a = 2-13 and b = 1-12; when a + B = 15, a = 2- 14 and b = 1-13; when a + b = 16, a = 2-14 and b = 1-14; when d + e = 8, d = 2-7 and e = 1-6; when d + e = 9, d = 2-8 and e = 1-7; when d + e = 10, d = 2-9 and e = 1-8; when d + e = 11, d = 2-10 and e = 1-9; when d + e = 12, d = 2-11 and e = 1-10; when d + e = 13, d = 2-12 and e = 1-11; when d + e = 14, d = 2-13 and e = 1-12; and (b) 1-99.99 weight percent of detergent adjuncts; (3) a primary alkyl sulfate surfactant agent branched to half the chain of the formula (V): (V) where x, y = 0-12; z is at least 2; x + y + z = 11-14; R1 and R2 are not both H; when one of R1 or R2 is H, and the other is Me, x + y + z is not 12 or 13; and when R1 is H and R2 is Me, x + y is not 11 when z = 3 and x + y it is not 9 when z = 5; (4) alkyl sulfates of the formula (III) wherein a and b are integers and a = b = 12 or 13, a = 2-11, b = 1-10 and M is Na, K and, optionally, substituted ammonium; (5) alkyl sulfates of the formula (IV) wherein d and e are integers and d = e is 10 or 11 and when d = 10, d = 2-9 and e = 1-8; when d = e = 11, d = 2-10 and e = 1-9 and M is Na, K, optionally substituted ammonium (especially Na); (6) Branched methyl primary alkyl sulfates selected from 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12- or 13-methylpentadecanol sulfate; 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13- or 14-methylhexadecanol sulfate; sulphate of 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,11-, 2,12 -methyltetradecanol; sulphate of 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,11-, 2,12 -, 2,13-methylpentadecanol and / or mixtures of these compounds. WO 97/39087 A, published 10/23/97 includes the description of a surfactant composition comprising 0.001-100% of alkoxylated primary alkylsulfate (s) branched to half the chain of formula (I), wherein the total number of C atoms in the compound (I), including R, R1 and R3, but not including the C atoms of the EO / PO alkoxy portions, is 14-20 and the total number of C atoms in the branched alkyl portions are on average 14.5-17.5 (especially 15-17); R, R1 and R2 = H or alkyl 1-3C (especially Me) and R, R1 and R2 are not all H; when z = 1, at least R or R1 is not H; M = specially selected cations of Na, K, Ca, Mg, quaternary alkylamines of the formula (II) (M is especially Na and / or K), R3, R4, R5, R6 = H, alkylene 1-22 C, alkylene branched 4-22C, 1-6C alkanol, 1-22C alkenylene and / or branched alkenylene 4-22C; w, x, y = 0-13; z is at least 1; w + x + y + z = 8-14; EO / PO are alkoxy portions, especially ethoxy and / or proproxy; M is at least 0.001, especially 0.1-30, more especially 0.5-10, more especially still 1- 5. Also described: (1) a surfactant composition comprising a mixture of branched alkoxylated primary alkyl sulfates of the formula (I) When R2 = alkyl 1-3C, the proportion of surfactants with z = 2 or greater with respect to the surfactant with z = 1, is at least 1: 1, especially 1.5: 1, more especially 3: 1 and, still more especially, 4: 1; (2) a detergent composition comprising: (a) 0.001-99% of alkoxylated primary alkyl sulphate branched to half the chain of the formula (III) and / or (IV), M is as described above; to, ^ P b, d and e are integers, a + b = 10-16, d + e = 8-14 and when a + b = 10, a = 2-9 and b = 1-8; when a + b = 11, a = 2-10 and b = 1-9; when a + b = 12, a = 2-11 and b «= 1-10; when a + b = 13, a = 2-12 and b = 1-11; when a + b = 14, a = 2-13 and 15 b = 1-12; when a + b = 15, a = 2-14 and b = 1-13; when a + b = 16, a = 2-14 and b = 1-14; when d + e = 8, d = 2-7 and e = 1-6; when d + e = 9, d = 2-8 and e = 1-7; when d + e = 10, d = 2-9 and e = 1-8; when d + e = 11, d = 2-10 and e = 1-9; when d + e = 12, d = 2-11 and e = 1-10; when d + e = 13, d = 2-12 and e = 1- • 11; when d + e = 14, d = 2-13 and e = 1-12; and (b) 1-99.99 percent by weight of 20 detergent attachments; (3) an MCB primary alkyl alkoxylated sulfate surfactant of the formula (V) R 1, R 2, M, EO / PO, m as described above; x, y = 0-12; z is at least 2; x + y + z = 11-14; (4) an alkoxylated alkyl sulfate branched to half the chain of the formula (III), 1 where: a = 2-11; b = 1-10; a + b = 12 or 13; M, EO / PO and m are as described above; (5) an alkoxylated alkyl sulfate compound branched to half the chain of the formula (IV), wherein: d + e = 10 or 11; when d + e = 10, d = 2-9 and e = 1-8 and when d + e = 11, d = 2-10 and e = 1-9; M is as described above (especially Na); EO / PO and m are as described above; and (6) ethoxylated primary alkyl sulfates with methyl branches selected from ethoxylated sulfate of 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, or 13- methylpentadecanol; ethoxylated sulfate of 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13- or 14-methylhexadecanol; 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,11- or 2, ethoxylated sulfate, 12-methyltetradecanol; Ethoxylated sulfate of 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,11-, 2, 12- or 2,13-methylpentadecanol and / or mixtures of these compounds. These compounds are ethoxylated with an average degree of ethoxylation of 0.1-10. WO / 97/38972 A, published on 10/23/97, includes the description of a method for manufacturing compositions of surfactant mixtures; of longer chain alkyl sulfate, comprising (a) ssuullffaattaction with SO3, preferably a downflow reactor, a mixture of long chain aliphatic alcohol with an average chain length of E1 > carbon of at least 14.5-17.5, with the alcohol mixture comprising at least 10%, preferably at least 25%, more preferably at least 50%, even more preferred, 75% and of greater preference still at least 95% of an aliphatic alcohol MCB of the formula (I); wherein R, R, R = H or alkyl 1-3C, preferably methyl, - provided that R, R1 and R2 are not all H, and when z = 1, at least R or R1 is not H; w, x, y = integers 0-13; z = integer of at least 1; and w + x + y + z = 8-14; where the total number of carbon atoms in the portion of branched primary alkyl of the formula (I), including the branching of R, 5 R1 and R2, is 14-20, and where in addition, for the alcohol mixture, the number total average carbon atoms in the primary alkyl portions branched with the formula (I) is > 14.5-17.5, preferably > 15-17; and (b) the neutralization of the alkyl sulfate acid obtained in step (a), of preference using a selected base of KOH, NaOH, ammonia, 10 • monoethanolamine, triethanolamine and mixtures thereof. Also, a method for making compositions of a mixture of longer-chain alkoxylated alkyl sulfate surfactants, comprising the alkoxylation of the long-chain aliphatic alcohol mixture, is disclosed. *, specified; the sulfation of the resulting polyoxyalkylene alcohol with SO3; And the neutralization of the resulting alkyl alkoxylated sulfate acid. Alternatively, alkoxylated alkyl sulphates can be produced directly from the polyoxyalkylene alcohol by sulfation f with SO 3 and neutralization. WO 98/23566 A Shell, published on 04/06/98, 0 discloses branched primary alcohol compositions with 8-36 C atoms and an average number of branches per mole of 0.7-3 and including branches of ethyl and methyl. Also described are: (1) a branched primary alkoxylate composition that can be prepared through the reaction of a branched primary alcohol composition, as described, with an oxirane compound; (2) a branched primary alcohol sulfate which can be prepared through the sulfation of a primary alcohol composition, as described; (3) a branched alkoxylated primary alcohol sulfate which can be prepared through the alkoxylation and sulfation of a branched alcohol composition, as described; (4) a branched primary alcohol carboxylate which can be prepared through the oxidation of a branched primary alcohol composition, as described; (5) a detergent composition comprising: (a) agent (s) 10 surfactant (s) selected from branched primary alcohol alkoxylates, as in (1), branched primary alcohol sulphates, as in (2), and F sulfates of branched alkoxylated primary alcohol, as in (3); (b) an improver; and (c) optionally, selected additive (s) of foam control agents, enzymes, bleaching agents, activators of 15 bleaching, optical brighteners, co-builders, hydrotropes and stabilizers. The primary alcohol composition and the sulfates, alkoxylates, alkoxy sulfates and carboxylates, prepared from it, present a F good detergency and biodegradability in cold water. Useful biodegradable branched surfactants 20 herein also include modified alkylaromatic surfactants, especially modified alkylbenzene sulfonate surfactants, described in commonly assigned co-pending patent applications (Cases No. 7303P, 7304P). In more detail, these surfactant agents include (Case No. 6766P) alkylarylsulfonate surfactant systems comprising from about 10% to about 100% by weight of said surfactant system of two or more alkylarylsulfonate surfactants with altered stability of the formula (B-Ar-D) ) a (Mq +) b, where D is S03-, M is a cation or a cationic mixture, q is the valence of said cation, a and b are selected numbers F such that said composition is electroneutral; Ar is selected from benzene, toluene and combinations thereof; and B comprises the sum of at least a portion of primary hydrocarbyl containing from 5 to 20 atoms 10 carbon and one or more portions that alter the crystallinity, wherein said interrupting portions of the altered crystallinity or branch off from said hydrocarbyl portion; and wherein said alkylarylsulfonate surfactant system exhibits an alteration of the crystallinity to the extent that its Critical Sodium Solubility Temperature, as measured by the The CST test is not more than 40 ° C and wherein, in addition, said surfactant alkylsulfonate system has at least one of the following properties: percentage biodegradation, as measured by the modified SCAS test, which exceeds the sulfonate tetrapropylenebenzene and the weight ratio between non-quaternary and quaternary carbon atoms in B 20 of at least about 5: 1. Said compositions also include surfactant mixtures comprising (preferably, consisting essentially of): (a) from about 60% to about 95% by weight (preferably, from about 65% to about 90%, most preferably from about 70% to about 85%) of a mixture of branched alkylbenzene sulphonates of the formula (I): (i) wherein L is an acyclic aliphatic moiety consisting of carbon and hydrogen and has two methyl termini, and wherein said mixture of branched alkylbenzene sulphonates contains two or more (preferably at least three, optionally more) of said compounds that are distinguished, by their molecular weight, from the anion of said formula (I), and in Wherein said mixture of branched alkylbenzene sulphonates is characterized by an average carbon content of about 10.0 to about 14.0 carbon atoms (preferably about 11.0 to about 13.0, most preferred of ^ P ^^ 1 about 11.5 to about 12.5), where said content The average carbon is based on the sum of carbon atoms in R1, L and R2 (preferably said sum of carbon atoms in R1, L and R2 is from 9 to 15, more preferably from 10 to 14) and, in addition, where L has no substituents other than A, R1 and R2; M is a cation or a cationic mixture (preferably selected from H, Na, K, Ca, Mg and mixtures thereof, most preferably selected from H, Na, K and mixtures thereof, most preferably still selected from H, Na and mixtures thereof ) with '- a valence q (typically 1 to 2, preferably 1); a and b are selected integers such that said compounds are electroneutral (a is typically 1 to 2, preferably 1, b is 1); R1 is C1-C3 alkyl (preferably CrC2 alkyl, more preferably methyl); R 2 is selected from H and C 1 -C 3 alkyl (preferably H and C 1 -C 2 alkyl, more preferably H and methyl, more preferably even H and methyl, as long as in a mole fraction of at least about 0.5, greater preference 0.7, more preferably still 0.9 to 1.0 of said branched alkylbenzene sulfonates, R2 being H); A is a portion of benzene (typically A is the portion -C6H4-, with the SO3 portion of the formula (I) in para-position to the L portion, although in some proportion, generally not greater than about 5%, preferably from 0 to 5% by weight, the SO3 portion is ortho-position to L); and (b) from about 5% to about 60% by weight (preferably from about 10% to about 35%, most preferably from about 15% to about 30%) of a mixture of unbranched alkylbenzene sulfonates of the formula (II): (ll) wherein a, b, M, A and q are as previously defined and Y is an unsubstituted linear aliphatic portion comprising carbon and hydrogen with two methyl termini, and wherein Y has an average carbon content of about 10.0 to approximately 14.0 (of 5 preferably from about 11.0 to about 13.0, most preferably from about 11.5 to about 12.5 carbon atoms); (preferably said mixture of alkylbenzene sulfonates is further characterized by a sum of carbon atoms in Y, from 9 to 15, more preferably from 10 to 14); and wherein said composition is further characterized by a 2/3-phenyl number of from about 350 to about 10,000 (preferably from about 400 to about 1, 200, more preferably from about 500 to about 700) (and also from preferably, wherein said surfactant mixture has an index of 2-methyl-2-phenyl of less than About 0.3, preferably less than about 0.2, more preferably less than about 0.1, even more preferred «• *» 'from 0 to 0.05). Also, included by the surfactants branched to the middle of the chain of the alkylbenzene derivative types, are the surfactant mixtures comprising the product of a process that includes the steps of: renting the benzene with an alkylating mixture; sulfonate the product of (I) and neutralize the product of (II); wherein said alkylator mixture comprises: (a) from about 1% to about 99.9% by weight of the branched C7-C2o monoolefins, said branched monoolefins have structures identical to those of the branched monoolefins formed through the dehydrogenation of branched paraffins of the formula R1LR2, wherein L is an acyclic aliphatic moiety comprising 5 carbon and hydrogen and two terminal methyls; R1 is a C1-C3 alkyl and R2 is selected from H and C1-C3 alkyl; and (b) of approximately 0.1% a IX, approximately 85%, by weight of the C7-C20 linear aliphatic olefins; wherein said alkylator mixture contains said branched C7-C20 monoolefins with at least two different carbon numbers in said range of C7-C20. and has an average carbon content of about 9.5 to about 14.5 carbon atoms; and wherein said components (a) and (b) have a weight ratio of at least about 15:85. 15 v. Ampholytic surfactant Ampholytic surfactants can be incorporated into the detergent compositions herein. These surfactant agents can be described in a broad sense as aliphatic derivatives of secondary or tertiary amines, or aliphatic derivatives of secondary amines and 20 heterocyclic tertials wherein the aliphatic radical can be straight or branched chain. One of the aliphatic substituents comprises at least about 8 carbon atoms, typically from about 8 to about 18 carbon atoms, and therefore less one comprises a solubilizing group in anionic water, e.g., carboxy, sulfonate, sulfate. See the patent of E.U.A. No. 3,929,678 issued to Laughiin et al., December 30, 1975, column 19, lines 18-35 for examples of ampholytic surfactants. Preferred amphoteric include C12-C18 alkyl ethoxylates ("AE") including the so-called narrow alkylated alkyl ethoxylates of C6-Ci2 alkylphenol (especially ethoxylated and ethoxy / mixed propoxy), C2-C18 betaines and sulfobetaines ("sultaines"), oxides of amine C? o-C18 and mixtures thereof. saw. Polyhydroxy fatty acid amide surfactant The detergent compositions herein may also comprise amide surfactants of the polyhydroxy fatty acid. The surfactant component of the polyhydroxy fatty acid amide comprises compounds of the structural formula: O R1 II I R2-C-N-Z wherein: R1 is H, C1-C4 hydrocarbyl, 2-hydroxyethyl, 2-hydroxypropyl or mixtures thereof, preferably CrC4 alkyl, more preferably C1 or C2 alkyl, even more preferably C1 alkyl (i.e., methyl) ); and R2 is a C5-C31 hydrocarbyl, preferably straight chain C7-C19 alkyl or alkenyl, more preferably straight chain Cg-C17 alkyl or alkenyl, more preferably even straight chain C11-C15 alkyl or alkenyl or mixtures of the same; and Z is a polyhydroxyhydrocarbyl with a linear hydrocarbyl chain with at least 3 hydroxyls directly linked to the chain, or an alkoxylated derivative (preferably ethoxylated or propoxylated) thereof. Preferably, Z is derived from a reducing sugar in a reductive amination reaction; more preferably, Z will be a glycityl. Suitable reducing sugars include glucose, fructose, maltose, lactose, galactose, mannose and xylose. As raw materials, high dextrose corn syrup, high-fmctose corn syrup and high-maltose corn syrup may be used, as well as the individual sugars listed above. These corn syrups can 10 provide a mixture of sugar components for Z. It should be understood that, in no way, is it intended to exclude other materials - ^ • adequate premiums. Z is preferably selected from the group comprising -CH2- (CHOH) n -CH2OH, -CH (CH2OH) - (CHOH) n -? - CH2OH, - CH2- (CHOH) 2 (CHOR ') (CHOH) -CH2OH and alkoxylated derivatives thereof, in Where n is an integer from 3 to 5, inclusive, and R 'is H or an alkoxylated aliphatic monosaccharide. More preferred are glycityls, where n is 4, particularly -CH2- (CHOH) 4-CH2OH. R 'can be, for example, N-methyl, N-ethyl, N-propyl, N-isopropyl, N-butyl, N-2-hydroxyethyl or N-2-hydroxypropyl. 20 R2-CO-N <; it can be, for example, cocamide, esteramide, oleamide, lauramide, myristamide, capricamide, palmitamide, seboamide, etc. Z can be 1-deoxyglucityl, 2-deoxyfmctityl, 1 -deoxytrityl, 1-deoxylactityl, 1-deoxygalactityl, 1-deoxyanityl, 1-deoxy-thiotriotyl, etc.

Methods for preparing the polyhydroxy fatty acid amides are known in the art. In general, they can be prepared by reacting an alkylamine with a reducing sugar in a reductive amination reaction to form a corresponding N-alkyl polyhydroxyamine, and then reacting the N-alkyl polyhydroxyamine with a fatty aliphatic ester or triglyceride in a condensation step. / amidation to form the N-alkyl, the N-polyhydroxy fatty acid amide product. The processes for the preparation of compositions comprising polyhydroxy fatty acid amides are described, for example, in the 10 British Patent Specification No. 809,060, published February 18, 1959, by Thomas Hedley & Co., Ltd .; the patent of E.U.A. Do not.

W 2,965,576, issued December 20, 1960 to E. R. Wilson, the patent of E.U.A. No. 2,703,798, issued to Anthony M. Schwartz, March 8, 1955 and the patent of E.U.A. No. 1, 985,424 issued on December 25, 15 1934 to Piggott, included herein by reference. vii. Cationic surfactant agent Cationic detersive surfactants suitable for F * used in the compositions of the present invention are those which comprise a long chain hydrocarbyl group. Examples of such cationic surfactants include ammonium surfactants, such as alkyltrimethylammonium halides, and those surfactants having the formula: [R2 (OR3) and] [R4 (OR3) and] 2R5N + X-, wherein R2 is an alkyl group and or alkylbenzyl with about 8 to about 18 carbon atoms in the alkyl chain, each R3 is selected from the group comprising -CH2CH2-, CH2CH (CH3) -, CH2CH (CH2OH) -, CH2CH2CH2- and mixtures thereof; each R 4 is selected from the group comprising C 1 -C 4 alkyl, C 1 -C 4 hydroxyalkyl, benzyl ring structures formed by the joining of two groups R 4, -CH 2 CHOH-CHOHCOR 6 CHOHCH 2 OH; wherein R6 is a hexose or a hexose polymer with a molecular weight of less than about 1000, and hydrogen when and is not 0; R5 is equal to R4 or is an alkyl chain, wherein the total number of carbon atoms of R2 plus R5 is not greater than about 18; each y is from 0 to approximately 10 and the sum of the y values is from 0 to < j r approximately 15; and X is any compatible anion. * The highly preferred cationic surfactants are the ^ water-soluble quaternary ammonium compounds useful in the present The composition of the formula (i): R? R2R3R4N + X ", wherein R1 is C? -Ci? Alkyl, each of R2, R3 and R4 is independently C1-C4 alkyl, hydroxyalkyl C1-C4, benzyl and - (C2H4o)? H, where x has the value of 2 to 5 and X is an anion.

^^., ^ No more than one of R2, R3 or R4 should be benzyl. The preferred alkyl chain length for R1 is Ci2-Ci5, particularly when the group Alkyl is a mixture of chain lengths derived from coconut or palm kernel fat or is derived synthetically by the formation of olefins or the synthesis of OXO alcohols. The preferred groups for R2R3 and R are 7 &? methyl and hydroxyethyl groups and the X anion must be selected from halide, methosulfate, acetate and phosphate ions. Examples of suitable quaternary ammonium compounds of the formula (i) for use herein include, but are not limited to: coconut trimethylammonium chloride or bromide; Coconut methylhydroxyethylammonium chloride or bromide; decyltriethylammonium chloride; decildimethylhydroxyethylammonium chloride or bromide; C12-C15 dimethylhydroxyethylammonium chloride or bromide; coconut dimethylhydroxyethylammonium chloride or bromide; methylomyristyltrimethylammonium sulfate; lauryl dimethylbenzylammonium chloride or bromide; lauryldimethyl (ethenoxy) 4ammonium chloride or bromide; Hill esters (compounds of the formula (i) wherein R1 is CH2-CH2-0-C-C-i2-i4alkyl and R2R3R4 are methyl); and di-alkyl imidazolines [(i)]. Other cationic surfactants useful herein are also described in the U.S.A. No. 4,228,044, issued to Cambre, on October 14, 1980, and in the European patent application EP 000,224. When included in those documents, the compositions of the present invention typically comprise from about 0.2%, preferably from about 1% to about 25%, of greater Preference is given to about 8% by weight of such cationic surfactants. viii. Zwitterionic Surfactants Zwitterionic surfactants, some of which examples are described in the U.S.A. No. 3,929,678, are also suitable for use in the compositions of the present invention. When included in that document, the compositions of the present invention typically comprise from about 0.2%, preferably from about 1% to about 15%, preferably to about 10% by weight of such zwitterionic surfactants. ix. Diamine surfactants A particularly preferred class of surfactants for use in liquid dishwashing compositions of the present invention are diamines. Preferably, the diamine, when present, is included in the composition at a level such that the ratio between the anionic surfactant present and the diamine is from about 40: 1 to about 2: 1. The diamines provide a greater elimination of fat and fatty food material, maintaining adequate levels of foam.

The diamines suitable for use in the compositions of the present invention have the formula: where each R20 is selected independently of the group * ^ ------- T c'ue ComPrenc | e hydrogen, linear or branched alkyl CrC4, alkyleneoxy t # formula: - < R210) 0) and R22 10 wherein R21 is linear or branched C2-C4 alkylene, and mixtures thereof; R22 is hydrogen, C1-C4 alkyl and mixtures thereof; and is from 1 to about 10; X is a unit selected from: i) C3-C? Linear alkylene, C3-C10 branched alkylene, C3-C10 cyclic alkylene, C3-C10 branched cyclic alkylene, an alkyleneoxyalkylene of the formula: 20 where R21 and y are as defined above; ii) linear alkylene C3-C10, straight branched C3-C10, cyclic C3-C10, branched cyclic Ce-Cío, wherein said unit comprises one or more donation or electron extraction portions that provide said amine with a pKa greater than 8; and iii) mixtures of (i) and (ii), as long as said diamine has a pKa of at least 8. Preferred diamines of the present invention have a pKi and pK2 which are each in the range of about 8 to about 11.5, preferably in the range of about 8.4 to about 11, most preferably from about 8.6 to about 10.75. For the purposes of the present invention, the term "pKa" also represents the terms "pK-T and" pK2", either separately or together The term" pKa "is used throughout the present specification of the same way in which it is employed by those skilled in the art.PKa values are easily obtained from standard literature sources, for example, "Critical Stability Constants: Volume 2, Amines" by Smith and Martel, Plenum Press, New York and London (1975) As a definition applied herein, the pKa values of the diamines are specified as measured in an aqueous solution at 25 ° C with an ionic strength of from about 0.1 to about 0.5 M. As used in the present, the pKa is an equilibrium constant that depends on the temperature and ionic strength, therefore, the value reported by literature references, not measured in the manner described above, may not be in conformity with the Lords and ranges comprised in the present invention. To eliminate ambiguity, the . ** •? Relevant conditions and / or references used for the pKas of this invention are as defined herein or in "Critical Stability Constants: Volume 2, Amines". A typical method of measurement is the potentiometric titration of the acid with sodium hydroxide and the determination of pKa 5 by appropriate methods as described and mentioned in "The Chemist's Ready Reference Handbook" by Shugar and Dean, McGraw Hill, New York, 1990. Preferred diamines for efficiency and delivery considerations are 1,3-bis (methylamino) cyclohexane, 1,3-diaminopropane 10 (pK ^ IO.5, pK2 = 8.8), 1,6-diaminohexane (pK? = 11; pK2 = 10), 1, 3-diaminopentane (Dytek EP) (pK -? = 10.5, pK2 = 8.9), 2-methyl-1,5-diaminopentane W ^ (Dytek A) (pK? = 11.2; pK2 = 10.0). Other preferred materials are the primary / primary diamines with alkylene spacers in the range of C4-Cß. In general, primary diamines are preferred to secondary and tertiary diamines. The following are non-limiting examples of diamines suitable for use in the present invention. 1-N, N-dimethylamino-3-aminopropane of the formula: ~ 9fP 1,6-diaminohexane of the formula: 7 1,3-diaminopropane of the formula: H-N - ^^ NH- 2-methyl-1, 5-diamnopentane of the formula: 1, 3-diaminopentane, available under the trade name Dytek EP, of the formula: 1,3-diaminobutane of the formula: Jeffamina EDR 148, a diamine with an alkylenoxy base structure, of the formula: .0. H2N NH, 3-methyl-3-aminomethyl-5-dimethyl-1-aminocyclohexane (isophoronediamine) of the formula: 1,3-bis (methylamino) cyclohexane of the formula: Suspension Agents The composition of the present invention may comprise and, preferably, comprise a suspending agent. A suspending agent is an ingredient that is specifically added to the composition of the present invention to suspend a particulate solid ingredient from the composition. Suitable suspending agents are those known in the art. Examples of suspending agents include gum-type polymers (eg, xanthan gum), polyvinyl alcohol and its derivatives, cellulose and its derivatives and polycarboxylate polymers including, but not limited to: tamarind gum (preferably including polymers) of xyloglucan), guar gum, locust bean gum (comprising, from - * preference, galactomannan polymers) and other industrial polymers and gums, including, but not limited to, tara, fenugreek, aloe, chia, flax seed, psyllium seed, quince seed, xanthan, gelano, welano, ramsano, dextran, curdlane, pullulan, scleroglucan, schizophyllan, 5 chitin, hydroxyalkyl cellulose, arabinano (preferably of sugar beets), de-branched arabinano (preferably of sugar beets), arabinoxylan (preferably of rye and wheat flour) , galactane (preferably of lupine and potatoes), galactane pectin (preferably of potatoes), galactomannan (preferably of carob and 10 including low and high viscosities), glucomannan, licenano (preferably from Icelandic moss), mañano (preferably of vegetable ivory), paquimano, rhamnogalacturonan, acacia gum, agar, alginates, carrageenan, chitosan, clavano, hyaluronic acid , heparin, inulin, cellodextrins, carboxymethylcellulose (CMC), dextrans, dextrins, 15 ethylhydroxyethylcellulose (EHEC), guar, hydroxyethylcellulose (HEC), hydroxypropylcellulose (HPC), hydroxybutylcellulose (HBC), karaya, larch, methylcellulose (MC), tamarind, scleroglucan, xanthan, carboxymethylhydroxyethylcellulose (CMHEC), methoxypropylmethylcellulose (MPMC), hexylcarboxymethylcellulose, C12-C20 alkyl carboxymethylcellulose, Methylhydroxyethylcellulose (MHEC), methylhydroxypropylcellulose (MHPC), hydroxyethylmethylcellulose (HEMC), hydroxypropylmethylcellulose (HPMC), hydroxybutylmethylcellulose (HBMC) and mixtures thereof.

- * A- Js? In a particularly preferred embodiment of the present invention, the suspending agent is selected from a type * rubber polymer or a polycarboxylate polymer. The gum-like polymer can be selected from the group comprising polysaccharide hydrocolloids, xanthan gum, guar gum, succinoglycan gum, cellulose, derivatives of any of the foregoing and mixtures thereof. In a preferred aspect of the present invention, the gum-type polymer is a xanthan gum or a derivative thereof. The rubber-like polymer, when present, is preferably included at a level of from 0.01% to 10%, more preferably from 0.1% to 3%. The polycarboxylate polymer can be a homo- or copolymer of monomer units selected from acrylic acid, methacrylic acid, maleic acid, maleic anhydride. The preferred polycarboxylate polymers are Carbopol from BF Goodrich. Suitable polymers have a molecular weight in the range of 10,000 to 100,000,000, preferably 1,000,000 to 10,000,000. The crosslinked polycarboxylate polymer, when present, is preferably included at a level from 0.01% to 2%, more preferably from 0.01% to 1%, even more preferably, from 0.1% to 0.8%. In another embodiment, the suspending agent comprises a combination of at least two polymers. In this embodiment, the first polymer is a rubber-like polymer and the second is a polymer of X dk ' interlaced polycarboxylate. Additionally, the composition may comprise other polymers. The ratio between the rubber-like polymer and the interlaced polycarboxylate polymer is 100: 1 to 1: 100, more preferably 1:10 < 5 to 10: 1. ^ x Optional Cleaning Attachments The aqueous liquid detergent compositions of the present invention, as described above, may include Optionally, in addition to the particulate solid (s), a polymer stabilization system and preferably one or more of the accompanying materials A ^ "preferred cleaning that were already explained and one or more of the materials * optional cleaning attachments that will be described below.

Blanoueo System The aqueous liquid detergent compositions of the present invention may comprise a bleaching system, in addition to the preformed peracid compound described above. Bleaching systems typically comprise a "bleaching agent" 20 (source of hydrogen peroxide) and an "initiator" or "catalyst". When present, bleaching agents will typically have levels of about 1%, preferably from about 5% to about 30%, preferably to about 20%, by weight of i r. the composition. If present, the amount of the bleach activator will typically be about 0.1%, preferably from about 0.5% to about 60%, preferably about 40% by weight of the bleaching composition comprising the bleaching agent plus the bleaching agent. bleach activator.

Bleaching agents Sources of hydrogen peroxide are described in detail in Kirk Othmer's Encyclopedia of Chemical Technology, fourth edition, (1992, 10 John Wiley & Sons), Vol. 4, pp. 271-300"Bleaching Agents (Survey)" incorporated herein, and comprise different forms of sodium perborate and sodium percarbonate, including various coated and modified forms. The preferred source of hydrogen peroxide used in the The present invention can be any convenient source, including the hydrogen peroxide itself. For example, perborate, e.g., sodium perborate (any hydrate, but preferably mono- or tetrahydrate), sodium carbonate peroxyhydrate or equivalent percarbonate salts, peroxyhydrate : 'f-- sodium pyrophosphate, urea peroxyhydrate or sodium peroxide, can 20 used in the present. Also available are sources of available oxygen, such as persulfate bleach (e.g., OXONE, manufactured by DuPont). Sodium perborate monohydrate and sodium percarbonate are particular preference. Also, mixtures of suitable hydrogen peroxide sources can be used. A preferred percarbonate bleach comprises dry particles with an average particle size scale of about 5 500 microns to about 1,000 microns, no more than about 10% by weight of said particles that are smaller than about 200 microns and not more than about 10% by weight of said particles that are larger than about 1.250 microns. Optionally, the percarbonate can be coated with 10 a sislicate, borate or surfactant agents soluble in water. The percarbonate is available in different commercial sources such as FMC, Solvay and Tokai • Den ka. The compositions of the present invention may also comprise, as a bleaching agent, a chlorine-type bleaching material.

Such agents are well known in the art and include, for example, sodium dichloroisocyanate ("NaDCC"). However, chlorine-type bleaches are less preferred for compositions that include enzymes. wf (a) Bleach activators 20 Preferably, the peroxygen bleach component in the composition is formulated with an activator (peracid precursor). The activator is at levels of about 0.01%, preferably about 0.5%, more preferably about 1% at about 15%, preferably about 10%, more preferably about 8%, by weight of the composition. Preferred activators are selected from the group consisting of tetracetyl ethylene diamine (TAED), benzoylcaprolactam (BzCL), 4-nitrobenzoylcaprolactam, 3-chlorobenzoylcaprolactam, benzoyloxybenzene sulfonate (BOBS), nonanoyloxybenzene sulfonate (NOBS), phenylbenzoate ( PhBz), de-decanoyloxybenzene sulfonate (C10-OBS), benzoylvalerolactam (BZVL), octanoyloxybenzene sulfonate (Cß-OBS), perhydrolyzable esters and mixtures thereof, more preferably, benzoylcaprolactam and benzoylvalerolactam. Particularly preferred bleach activators in the pH range between about 8 and about 9.5 are those selected having an OBS or VL leaving group. Preferred hydrophobic bleach activators include, but are not limited to, nonanoyloxybenzene sulfonate (NOBS), sodium sulfonate salt of 4- [N- (nonanoyl) aminohexanoyloxy] -benzene (NACA-OBS), one of whose examples is described in the US patent No. 5,523,434, dodecanoyloxybenzene sulfonate (LOBS or C? 2-OBS), 10-undecenoyloxybenzene sulfonate (UDOBS or Cu -OBS with unsaturation in the 10-position) and decanoyloxybenzoic acid (DOBA). Preferred bleach activators are those described in the documents of E.U.A. 5,698,504, issued to Christie et al., On December 16, 1997; No. 5,695,679, issued to Christie et al., On December 9, 1997; No. 5,686,401, issued to Willey et al., November 11, 1997; -s No. 5,686,014, issued to Hartshom et al., on November 11, 1997; No. 5,405,412, issued to Willey et al., On April 11, 1995; No. 5,405,413, issued to Willey et al., On April 11, 1995; No. 5,130, 045, issued to Mitchel et al., On July 14, 1992 and No. 4,412,934, issued to Chung et al., 5 on November 1, 1983, and the co-pending patent applications of E.U.A. with serial number 08 / 709,072, 08 / 064,564, included in its entirety by reference. # 'The molar ratio between the peroxygen bleach compound (as AvO) and the bleach activator in the present invention ranges Generally between at least 1: 1, preferably about 20: 1, more preferably from about 10: 1 to about 1: 1,? preferably at about 3: 1. Also, substituted bleach activators may be included , by quaternaries. The present compositions for washing clothes 15 preferably comprise a quaternary substituted bleach activator (QSB) or a peracid substituted by a quaternary (QSP); more preferably, the improver. The preferred QSBA structures are described in greater detail in the document of U.S.A. 5,686,015, issued to Willey et al., On November 11, 1997; the document of E.U.A. 5,654,421, issued 20 to Taylor et al., August 5, 1997; the document of E.U.A. 5,460,747, issued to Gosseling et al., On October 24, 1995; the document of E.U.A. 5,584,888, issued to Miracle et al., On December 17, 1996 and the * í x document of E.U.A. 5,578,136 issued to Taylor et al., November 26, 1996; included herein by reference.

The highly preferred bleach activators useful herein are substituted by amide, as described in the document of 5 E.U.A. 5,698,504, the document of E.U.A. 5,695,679 and the document of E.U.A. 5,686,014 that were previously cited. Preferred examples of such bleach activators include: (6-octanamido-caproyl) oxybenzene sulfonate, (6-nonanamidocaproyl) aoxylbenzene sulfonate, (6-decanamidocaproyl) oxybenzene sulfonate and mixtures thereof. 10 Other useful activators, described in the documents of E.U.A. 5,698,504, No. 5,695,679, No. 5,686,014, which were already cited above in the present and the document of US Pat. No. 4,966,723, issued to Hodge et al.

October 30, 1990, include activators of the benzoxacin type, as a , C6H4 ring to which a portion -C (0) OC (R1) = N- is attached at positions 1, 2. 15 Depending on the activator and the precise application, good bleaching results can be obtained with pH bleaching systems in use from about 6 to about 13, preferably from about 9.0 to about 10.5. Typically, for example, activators with electron extraction portions are used for ranges 20 of pH almost neutral or sub-neutral. The alkalis and buffering agents can be used to ensure said pH. Activators of acyl lactam, as described in documents of E.U.A. 5,698,504, No. 5,695,679 and No. 5,686,014, which * as already mentioned hereinabove, they are very useful here, especially the acyl caprolactams (see for example WO 94-28102 A) and acyl valerolactams (see US Pat. No. 5,503,639, issued to Willey et al. April 2, 1996, included herein by reference). (b) Organic peroxides, especially diacyl peroxides These are amply illustrated in Kirk Othmer, Encyclopedia of Chemical Technology, Vol. 17, John Wiley and Sons, 1982, on pages 27-90 and especially on pages 63-72, including in the present by reference. If a diacyl peroxide is used, it will preferably be one that exerts a minimal adverse impact on spot cleaning / filming. (c) Metal-containing blanching catalysts The compositions and methods of the present invention can utilize metal-containing bleach catalysts that are effective for use in bleaching compositions. Bleach catalysts containing manganese and cobalt are preferred. One type of metal-containing bleach catalysts is a catalyst system comprising a transition metal cation with a defined bleach catalytic activity, such as copper, iron, titanium, ruthenium, tungsten, molybdenum or manganese cations, a metal cation auxiliary with little or no catalytic bleaching activity, such as zinc or aluminum cations, and a scavenger with stability constants defined for the catalytic or auxiliary metal cations, particularly ethylenediaminetetracic acid, (acid) ethylenediaminetetra (methylene phosphonic) and water soluble salts thereof. Such catalysts are described in document E.U.A. 4,430,243 issued to Bragg, on February 2, 1982.

Manganese metal complexes If desired, the compositions herein can be catalyzed by a manganese compound. Such compounds and levels of use are well known in the art and include, for example, the t > manganese-based catalysts described in the U.S.A. No. 5,576,282; 5,246,621; 5,244,594; 5,194,416 and 5,114,606 and the publications of European patent applications No. 549,271 A1, 549,272 A1, 544,440 A2 and 544,490 A1. Preferred examples of these catalysts include Mn? V2 (u-0) 3 (1, 4,7-trimethyl-1, 4,7-triazacyclononan) 2 (PG6) 2, Mnm2 (u-0)? (U-OAc) ) 2 (1, 4,7- 5 trimethyl-1, 4,7-triazacyclononan) 2 (Cl 4) 2. Mn, v4 (u-0) 6 (1, 4,7-triazacyclononan) 4 (CI04) 4, MnmMnIV4 (u-0)? (U-OAc) 2- (1, 4,7-trimethyl-1, 4 , 7- triazacyclononan) 2 (CI0) 3, Mn? V (1, 4,7-trimethyl-1, 4,7-triazacyclononan) (OCH3) 3 (PF6), and mixtures thereof. Other metal-based bleach catalysts include those described in U.S. No. 4,430,243 and No. 5,114,611. The use of manganese with several complex ligands to intensify bleaching is also described in the following documents: the patents of E.U.A. No. 4,728,455; 5,284,944; 5,246,612; 5,256,779; 5,280,117; 5,274,147; 5,153,161 and 5,227,084. 4 Cobalt metal complexes Cobalt bleach catalysts useful herein are known and described, for example, in the U.A. Do not. 5,597,936; 5,595,967 and 5,703,030, and in M. L: Tobe, "Base Hydrolysis of 5 Transition-Metal Complexes," Adv. Inorg. Bioinorg. Mech .. (1983), 2, pages 1-94. The most preferred cobalt catalyst useful herein are salts of pentaamine cobalt acetate with the formula [Co (NH3) sOAc] Ty, at done "OAc" represents a portion of acetate and "Ty" is an anion, and especially? I * i pentaamine chloride cobalt acetate, [Co (NH3) sOAc] CI2; as well as 10 [Co (NH3) 5OAc] (OAc) 2; [Co (NH3) 5OAc] (PF6) 2; [Co (NH3) 5OAc] (S04); [Co (NH3) 5OAc] (BF4) and [Co (NH3) 5OAc] (N03) 2 (referred to as "PAC" herein). • These cobalt catalysts are easily prepared by known methods, such as those described, for example, in US Pat. No. 5,597,936; 5,595,967 and 5,703,030; in the article Tobe and the references cited therein, and in the US patent. No. 4,810,410; J. Med. Ed. (1989), 66 (12), 1043-45; The Synthesis and Characterization of Inorganic Compounds, W.L. Jolly (Prentice-Hall, 1970), pp. 461-3; Inorg. Chem. 18, 1497-1502 (1979); Inorg. Chem .. 2A. 2881-2885 20 (1982); Inorg. Chem .. 18. 2023-2015 (1979); Inorg. Synthesis, 173-176 (1960) and Journal of Phvsical Chemistrv. 56, 22-25 (1952).

- Transforming metal complexes of macropolycyclic rigid ligands Conveniently, the compositions herein can also include as a bleach catalyst a transition metal complex of a macropolycyclic rigid ligand. The phrase "macropolicíclico rigid ligand" is abbreviated occasionally as "MRL" in the explanations _ * later. The amount used is a catalytically effective amount, suitably from about 1 ppb or more, for example, from a maximum of about 99.9%, more typically from about 10.001 ppm or more, preferably from about 0.05 ppm to about 500 ppm (in where "ppb" indicates parts per billion (one billion) by weight and "ppm" indicates parts per million by weight). Suitable transition metals, e.g., Mn, are illustrated below. "Macropolycyclic" means that an MRL is a macrocycle and polycyclic. "Polycyclic" means at least bicyclic. The term "rigid" as used herein includes "having a superstructure" and "cross bridge." "Rigid" has been defined as the opposite imperative of flexibility: see D.H. Busch, Chemical Reviews. (1993), 93. 847-860, included in by reference. More particularly, "rigid", as used herein, means that the MRL must be determinably stiffer than a macrocycle ("original macrocycle") that is otherwise identical (has the same ring size and type). and number of atoms in the main ring, but lacking a superstate (especially the link portions or, " % A. 4 J_ preferably, the cross bridge portions) found in the MRLs. In determining the comparative stiffness of macrocycles with or without superstructures, the skilled person will use the free form (not the metal-bonded form) of the macrocycles. It is a known fact that stiffness is useful in the comparison of macrocycles; suitable tools for determining, measuring or comparing stiffness include computation methods (see, for example, Zimmer, Chemical Reviews (1995), 95 (38), 2629-2648 or Hancock et al., Inorganic Chimica Acta , (1989), 164, 73-84 The preferred MRLs herein are a special type of ultra-rigid ligand that is cross-stitched in. A "cross-bridge" Xrt tt is non-limitingly illustrated in 1.11. later, in 1.11, the cross bridge is a portion -CH2CH2-, connects N1 and N8 in the illustrative structure, in comparison, a "same side" bridge, for example, if one should be introduced through N1. and N12 at 1.11, would not be enough to constitute a -s-? 45"cross bridge" and, consequently, would not be preferred.The suitable metals in rigid ligand complexes include Mn (ll), Mn (III), Mn (IV), Mn (V), Mn (ll), Fe (ll), Fe (lll), Fe (IV), Co (l), Co (ll), Co (lll), Ni (l), Ni (ll), Ni (lll), Cu (l), Cu (ll), Cu (lll), Cr (ll) ), Cr (lll), Cr (IV), ------- ki * Cr (V), Cr (VI), V (lll), V (IV), V (V), Mo (IV) , Mo (V), Mo (VI), W (IV), W (V), W (VI), 20 PD (II), Ru (ll), Ru (lll) and Ru (IV). Preferred transition metals in the instant transition metal bleach catalyst include manganese, iron and chromium.

More generally, the MRLs (and the corresponding transition metal catalysts) herein comprise: (a) at least one macrocycle major ring that includes four or more heteroatoms and 5 (b) a covalently connected non-metallic superstructure , capable of increasing the stiffness of the macrocycle, preferably selected from (i) a bridge superstructure, such as a link portion (ii) a bridge superstructure, such as a cross-linked link portion, and (iii) combinations of the same. The term "superstructure" is used herein not only to increase the stiffness of the original macrocycle, but also to favor the folding of the macrocycle to coordinate a metal in a groove. Suitable superstates can be extremely simple, for example, a linker portion can be used as any of those illustrated in formula A and formula B which are presented below.

Formula A wherein n is an integer, for example between 2 and 8, preferably less than 6, typically between 2 and 4 or Formula B wherein m and n are integers of about 1 to 8, preferably 1 to 3; Z is N or CH and T is a compatible substituent, for example H, alkyl, trialkylammonium, halogen, nitro, sulfonate or the like. The aromatic ring at 1.10 can be replaced by a saturated ring, wherein the Z atom, which is connected to the ring, can comprise N, O, S or C. Suitable MRLs are illustrated non-limitingly by the following compound: Formula C This is an MRL according to the invention which is a bridge derivative of cmz, substituted with methyl (all nitrogen atoms are tertiary) highly preferred. Formally, this ligand is called 5,12-dimethyl-1, 5,8,12-tetrazacycle [6.6.2] hexadecane using the 4? Von Baeyer system extended. See "A Guide to IUPAC Nomenclature of Organic Compounds: Recommendations 1993", R. Pánico, W.H. Powell and J-C Richter (editors), Blackwell Scientific Publications, Boston, 1993; see especially section R-2.4.2.1. The transition metal bleach catalysts of Macrocyclic Rigid Ligands that are suitable for use in the compositions of the invention may generally include compounds ^^ known if they meet the definition in this, as well as, more preferably, any of a large number of novel compounds specifically designed for the present laundry uses and illustrated in a non-limiting manner by any of the following: Dichloro-5,12-dimethyl-1, 5 , 8,12-tetrazabicyclo [6.6.2] hexadecan manganese (II) Diaxa-5,12-dimeti-hexafluorophosphate -1, 5,8,12- 15 tetrazabicyclo [6.6.2] hexadecane manganese (II) Acid hexafluorophosphate -hydroxy-5,12-dimethyl-1, 5,8,12-tetrazabicyclo [6.6.2] hexadecan manganese (lll) Diacuo-5,12-dimethyl-1, 5,8,12- ^ tetrazabicyclo tetrafluorobo [6.6 .2] hexadecanmanganese (II) 20 Dichloro-5,12-dimethyl-1, 5,8,12-tetrazabicyclo [6.6.2] hexadecanmanganese (III) dichloro-5,12-di-n-butyl-1 hexafluorophosphate 5,8,12-tetrazabicyclo [6.6.2] hexadecanmanganese (II) ' Dichloro-5,12-dibenzyl-1, 5,8,12-tetrazabiecyclo [6.6.2] hexadecanmanganese (II) Dichloro-5-n-butyl-12-methyl-1, 5,8,12-tetrazabicyclo [6.6. 2] hexadecanmanganese (II) 5 Dichloro-5-n-octyl-12-methyl-1, 5,8,12-tetrazabicyclo [6.6.2] hexadecanmanganese (II) Dichloro-5-n-butyl-12-methyl -1, 5,8,12-tetrazabicyclo [6.6.2] hexadecanmanganese (II). As a practical matter, and in a non-restrictive way, the The laundry compositions and methods included herein may be adjusted to provide in the order of at least a part of one hundred There are millions of classes of active bleach catalysts in the aqueous wash medium, and will preferably provide from about 0.01 ppm to about 25 ppm, more preferably about 0.05 ppm. 15 to about 10 ppm, and even more preferably about 0. 1 ppm to about 5 ppm, of classes of bleach catalysts in the wash liquor. To obtain said levels in the wash liquor of an automatic washing process, typical compositions included herein will comprise from about 0.0005% to about 20 0.2%, more preferably from about 0.004% to about 0. 08% bleaching catalyst, especially the manganese or cobalt catalysts, by weight of the bleaching compositions. - (d) Other blanching catalysts The compositions included herein may comprise one or more other bleach catalysts. Preferred bleach catalysts are zwitterionic bleach catalysts, which are described in the U.S. Patent. No. 5,576,282 (especially 3- (3,4-dehydroisoquinolinio) propane sulfonate) and 5,817,614. Other bleach catalysts include cationic bleach catalysts, described in • Patent of E.U.A. No. 5,360,569, 5,442,066, 5,478,357, 5,370,826, 5,482,515, 5,550,256 and WO 95/13351, WO 95/13352 and WO 95/13353. 10 Enzymes. The detergent compositions of the present invention may further comprise one or more enzymes that provide cleaning efficacy benefits. Said enzymes include enzymes selected from 15 celluloses, hemicelluloses, peroxidases, proteases, gluco-amylases, amylases, lipases, cutinases, pectinases, xylanases, reductases, oxidases, phenoloxidases, lipoxygenases, ligninases, pullulanases, tanases, pentosanas, malanases, β-glucanases, arabinosidases, mannanases, xyloglucanases and mixtures thereof. A preferred combination is a detergent composition that 20 has a variety of conventional applicable enzymes such as protease, amylase, lipase, cutinase, mannanases, xyloglucanases and / or cellulose. When they are present in the compositions, the enzymes are i v about 0.0001% to about 5% active enzyme per weight of the detergent composition. The proteases to be used in the detergent compositions included herein include (but are not limited to) trypsin, subtilisin, chymotrypsin and elastase type proteases. Proteolytic enzymes of the subtilisin type are preferred for use herein. Particularly preferred is the bacterial serine proteolytic enzyme obtained from Bacillus subtilis and / or Bacillus licheniformis. Suitable proteolytic enzymes include Alcalase® 10 (preferred), Esperase®, Savinase® (Copenhagen, Denmark) by Novo Industri A / S, Maxatase®, Maxacal® and Maxapem 15® (Maxacal® made of proteins) ? (Delft, The Netherlands) of Gist-brocades and subtilisin BPN and BPN '(preferred), * that are commercially available. Preferred proteolytic enzymes are also modified bacterial serine proteases, such as 15 those manufactured by Genencor International, Inc. (San Francisco, California) which are described in European Patent 251,446B, provided December 28, 1994 (particularly pages 17, 24 and 98) and which are also referred to herein as "Protease B". The Patent of E.U.A. fW ^^ 5,030,378, Venegas, issued on July 9, 1991, refers to an enzyme 20 modified bacterial serine proteolytic (Genencor International) which is referred to as "Protease A" herein (as well as BPN '). See in particular columns 2 and 3 of the U.S. Patent. 5,030,378 to obtain a complete description, including the amino sequence, of Protease A and its variants. Other proteases are sold under the following trade names: Primase, Durazym, Opticlean and Optimase. The preferred proteolytic enzymes are then selected from the group consisting of Alcalase® (Novo Industri A / S), BPN ', Protease A and Protease B (Genencor) and 5 mixtures thereof. Protease B is the most preferred. Of particular interest for use herein are the proteases described in the U.S. Patent. No. 5,470,733. The proteases described in our co-pending application USSN 08 / 136,797 can also be included in the detergent composition of the invention. Another preferred protease, termed "Protease D", is a variant of carbonyl hydrolase having an amino acid sequence that does not * is found in nature, which is derived from a precursor carbonyl hydrolase by replacing a different amino acid with a A plurality of amino acid residues at a position of said carbonyl hydrolase equivalent to the +76 position, preferably also in combination with one or more positions of amino acid residues equivalent to those selected from the group consisting of +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, 20 +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265 and / or +274, in accordance with the substillin number of Bacillus amyloliquefaciens, as described in WO 95/10615 published April 20, 1995 by Genencor International (A. Baeck et al. entitled "Protease-Containing.

Cleaning Compositions "from the USA with serial No. 08 / 322,676, filed October 13, 1994. Useful proteases are also described in PCT publications: WO 95/30010, published November 9, 1995 by The 5 Procter &Gamble Company, WO 95/30011, published November 9, 1995 by The Procter &Gamble Company; »» * T ----- t: '95/29979, published on November 9, 1995 by The Procter & Gamble Company. Other particularly useful proteases are variants of 10 multiply substituted proteases comprising a substitution of an amino acid residue for another amino acid residue that is produced : f.-Pi- naturally at an amino acid residue position corresponding to position 103 of subtilisin of Bacillus amyloliquefaciens in combination with a substitution of an amino acid residue for another amino acid residue 15 which occurs naturally in one or more amino acid residue positions corresponding to positions 1, 3, 4, 8, 9, 10, 12, 13, 16, 17, 18, 19, 20, 21, 22, 24, 27, 33, 37, 38, 42, 43, 48, 55, 57, 58, 61, 62, 68, 72, 75, 76, 77, 78, 79, 86, 87, 89, 97, 98, 99, 101, 102, 104, 106, 107, 109, 111, 114, 116, 117, 119, 121, 123, 126, 128, 130, 131, 133, 134, 137, 140, 141, 142, 20 146, 147, 158, 159, 160, 166, 167, 170, 173, 174, 177, 181, 182, 183, 184, 185, 188, 192, 194, 198, 203, 204, 205, 206, 209 , 210, 211, 212, 213, 214, 215, 216, 217, 218, 222, 224, 227, 228, 230, 232, 236, 237, 238, 240, 242, 243, 244, 245, 246, 247 , 248, 249, 251, 252, 253, 254, 255, 256, 257, 258, x 259, 260, 261, 262, 263, 265, 268, 269, 270, 271, 272, 274 and 275 of subtilisin of Bacillus almyloliquefaciens; wherein said said protease variant includes a substitution of amino acid residues at positions corresponding to positions 103 and 76, there is also a substitution of a 5 amino acid residue at one or more amino acid residue positions other than amino acid residue positions corresponding to positions 27, 99, 101, 104, 107, 109, 123, 128, 166, 204, 206, 210, 216, 217, 218, 222, 260, 265 or 274 of subtilisin of Bacillus almyloliquefaciens and / or variant of substituted proteases multiple which comprise a substitution of an amino acid residue by another amino acid residue that occurs naturally in one or more amino acid residue positions corresponding to positions 62, 212, 230, 232, 252 and 257 of ^ Bw subtilisin of Bacillus amyloliquefaciens, as described in PCT Published Application No. WO 99/20727, WO 99/20726 and WO 99/20723, all 15 property of The Procter & amp; amp;; Gamble Company.

Proteases described in patent applications EP 251 446 and WO 91/06637 are also suitable for the present invention.

BLAP® protease described in WO91 / 02792 and its variants • described in WO 95/23221. 20 See also a high pH protease from Bacillus sp.

NCIMB 40338 described in WO 93/18140 A for Novo. Enzymatic detergents comprising protease, one or other enzymes and a reversible protease inhibitor are described in WO 92/03529 A for Novo. When desired, a protease having reduced absorption and increased hydrolysis is available as described in WO 95/07791 for Procter & Gamble. A recombinant trypsin-like protease for detergents suitable herein is described in WO 94/25583 for Novo. Other suitable proteases are described in EP 516 200 by Unilever. Commercially available proteases that are useful in the present invention are known as ESPERASE®, ALCALASE®, DURAZYM®, SAVINASE®, EVERLASE® and KANNASE®, all from Novo Nordisk A / S of Denmark, and as MAXATASE®, MAXACAL®, PROPERASE® and MAXAPEM®, all from Genencor International (formerly Gist-Brocades of the Netherlands). Protease enzymes may be incorporated into the compositions according to the present invention at a level of from about 0.0001% to about 2% active enzyme per weight of the composition. The bleach / amylase / protease combinations (EP 755,999 A; EP 756,001 A; EP 756,000 A) are also useful. Also related to the enzymes included herein, the enzymes and their directly linked inhibitors, eg, the protease and its inhibitor linked by a peptide chain as described in WO 98/13483 A, are useful in conjunction with the hybrid formers of the present. Enzymes and their unbound inhibitors used in Selected combinations of the present invention include the protease with protease inhibitors selected from proteins, peptides and peptide derivatives as described in WO 98/13461 A, WO 98/13460 A, WO 98/13458 A, WO 98 / 13387 A. Amylases can be used with amylase antibodies according to the teachings of WO 98/07818 A and WO 98/07822 A, lipases can be used together with lipase antibodies according to the teachings of WO 98/07817 A and WO 98 / 06810 A, proteases can be used in conjunction with protease antibodies according to the teachings of WO 98/07819 A and WO 98/06811 A, Cellulose can be combined with cellulose antibodies according to the teachings of WO 98/07823 A and WO 98/07821 A. More generally, the enzymes can be combined with antibodies directed against similar or dissimilar enzymes, for example according to the teachings of WO 98/07820 A or WO 98/06812 A. The preferred enzymes in the to present can be of any suitable origin, such as vegetable, animal, bacterial, fungal and ferment origin. Preferred selections are influenced by factors such as pH activity and / or optimum stability, thermostability and stability against active detergents, formers and the like. In this regard, bacterial or fungal enzymes, such as bacterial proteases and amylases, as well as fungal celluloses are preferred.

Amylases (a and / or ß) can be included to eliminate carbohydrate-based stains. WO 94/02597 describes laundry washing compositions that incorporate mutant amylases. See also WO 95/10603. Other amylases known to be used in laundry detergent compositions include both a- and β-amylases. A-amylases are known in the art and include those described in the U.S. Patent. No. 5,003,257; EP 252,666; WO / 91/00353; ^ 1 ^ FR 2,676,456; EP 285,123; EP 525,610; EP 368,341; and Patent Specification of Great Britain No. 1, 296,839 (Novo). Other suitable amylases 10 are the amylases with increased stability described in the document W094 / 18314 and WO96 / 05295, Genencor, and the variants of amylases that ^ p have a further modification of the immediate parent available in 0 Novo Nordisk A / S, described in WO 95/10603. The amylases described in EP 277 216 are also suitable. Some examples of commercial products of α-amylases are Purafect Ox Am® from Genencor and Termamyl®, Ban®, Fungamyl® and Duramyl®, all available from Novo Nordisk A / S Denmark. Document W095 / 26397 describes other suitable amylases: characterized a-amylases • by having a specific activity at least 25% greater than the activity Specific to Termamyl® within a temperature range of 25 ° C to 55 ° C and with a pH value in the range of 8 to 10, as measured by the Phadebas® α-amylase activity test. The variants of the enzymes mentioned above, described in WO 96/23873 (Novo), are suitable. i?% 4? ordisk). Other amiolytic enzymes with improved properties with respect to the activity level and the combination of thermostability and a higher level of activity are described in W095 / 35382. The compositions of the present invention can also 5 comprising a mannanase enzyme Preferably, the mannanase is selected from the group consisting of: three mannan degrading enzymes: EC 3.2.1.25: ß-mannosidase, EC 3.2.1.78: Endo-1, 4-ß-mannosidase, * named afterwards as "mananase" and EC 3.2.1.100: 1, 4-ß-manobiosidase and combinations thereof. (IUPAC Classification- 10 Enzyme nomenclature, 1992 ISBN 0-12-227165-3 Academic Press). More preferably, the compositions of the present invention, T tP when a mannanase is present, comprises a β-1,4-Mannosidase (E.C. 3.2.1.78) called Mananase. The term "mannanase" or "galactomannanase" denotes a mannanase enzyme defined in accordance 15 with the technique as officially termed endo-1, 4-beta-mannosidase from mannan and having the alternative names beta-mannanase and endo-1, 4- mannanase and catalyzing the reaction: random hydrolysis of 1, 4-beta bonds - D- handsidic in mannans, galactomannans, glucomannans and galactoglucomannans. In particular, Mannanases (EC 3.2.1.78) constitute a group of polysaccharides that decompose mannan and denote enzymes that are capable of dividing polynyan chains containing mannose units, that is, they are capable of dividing glycosidic bonds in maman, glucomannan, galactomannan and galactogluco-mannan. Mannans are polysaccharides that have a base structure composed of linked β-1,4-mannose; glucomannans are polysaccharides that have a basic structure or more or less alternating regularly ß-1, 4-mannose and glucose attached; the 5 galactomannans and galactoglucomannans are mannans and glucomannans with a-1,6,6 galactose side branches attached. These compounds can be acetylated. ^ The decomposition of galactomannans and galactoglucomannans is facilitated by the complete or partial removal of 10 the lateral galactose branches. In addition, the decomposition of acetylated mannans, glucomannans, galactomannans and galactogluco-mannans ^ p facilitates by complete or partial deacetylation. The acetyl groups * can be eliminated by alkali or by acetyl esterases * morning. Oligomers that are released from the mannanases or by a combination of mannanases and a-galactosidase and / or morning sugar acetyl esterases can be further decomposed to release free maltose by β-mannosidase and / or β-glucosidase. AFF "Mannanases have been identified in several Bacillus organisms, eg, Talbot et al., Appl. Environ Microbiol., Vol. 56, No. 11, 20 pp. 3505-3510 (1990) describes a beta-mannanase. derived from Bacillus stearothermophilus in dimeric form having a molecular weight of 162 kDa and an optimum pH of 5.5-7.5 Mendoza et al., World J. Microbiol. Biotech., Vol. 10, No. 5, pp. 551-555 (1994) describes a beta-mannanase derived from Bacillus subtilis which has a molecular weight of 38 kDa, an optimal activity at pH 5.0 and 55C and a pl of 4.8. JP-03047076 describes a beta-mannanase derived from Bacillus sp., Which has a molecular weight of 373 kDa as measured by gel filtration, an optimum pH of 8-10 and a pl of 5.3-5.4. JP-63056289 discloses the production of an alkaline thermostable beta-mannanase that hydrolyzes the beta-1,4-D-mannopyranoside bonds of, e.g., mannans and produces hand-oligosaccharides. JP-63036774 relates to the microorganism Bacillus FERM P-8856 which produces beta-mannanase and beta-mannosidase at an alkaline pH. The document 10 JP-08051975 describes alkaline beta-mannanases from Bacillus sp. alkalof ílico AM-001. A purified mannase from Bacillus amyloliquefaciens useful for the FB bleaching of pulp and paper and a method of preparation thereof is described in WO 97/11164. WO 91/18974 describes a hemicellulose as a glucanase, xylanase or mannanase active in a 15 temperature and pH extremes. WO 94/25576 discloses an enzyme of Aspergillus aculeatus, CBS 101.43, which exhibits mannanase activity which could be useful for the decomposition or modification of the cell wall material of plants or algae. WO 93/24622 describes • an isolated mannanase from Trichoderma reseei that is useful for bleaching 20 lignocellulosic pulps. A hemicellulose able to decompose the hemicellulose containing mannan is described in W091 / 18974 and a purified mannanase from Bacillus amyloliquefaciens is described in W097 / 11164.

Preferably, the mannanase enzyme will be an alkanal mannanase as defined below, more preferably a mannanase originating from a bacterial source. Especially, the laundry detergent composition of the present invention will comprise a 5 mannanase alkaline selected from the mannanase of Bacillus agaradhaerens strain NICMB 40482; the mannase of the Bacillus strain subtypes 168, gen yght; the mannase of Bacillus sp. I633 and / or Bacillus mannanase * sp. AAI12. The most preferred mannanase to be included in the compositions of detergents of the present invention, is the mannanase enzyme which is 10 originates from Bacillus sp. I633, as described in the patent application of Copendent Denmark No. PA 1998 01340. It is intended that the term "mannanase alkaline enzyme" encompass an enzyme having an enzymatic activity of at least 10%, preferably at least 25%, more preferably at least less 15 40% of its maximum activity at a given pH ranging from 7 to 12, preferably from 7.5 to 10.5. The alkaline mannanase of Bacillus agaradhaerens NICMB 40482 is described in the patent application of E.U.A. copendiente with the No. of * w series 09/111, 256. More specifically, this mannanase is: i) a polypeptide produced by Bacillus agaradhaerens, NICMB 40482; or ü) a polypeptide comprising an amino acid sequence as shown in positions 32-343 of SEQ ID NO: 2, as shown in the patent application of E.U.A. co-pending with serial No. 09/111, 256; or iii) an analogue of the polypeptide defined in i) or ii) which is at least 70% homologous with said polypeptide, or which is derived from said 5 polypeptide by substitution, deletion or addition of one or more amino acids, or that is immunologically reactive to a polyclonal antibody against said polypeptide in purified form. Also encompassed is the corresponding isolated polypeptide having a mannanase activity selected from the group consisting of: (a) polynucleotide molecules that encode a polypeptide having mannanase activity and comprising a nucleotide sequence α as shown in SEQ ID NO : 1 from nucleotide 97 to nucleotide 1029 as shown in the US patent application with serial No. 09/111, 256; 15 (b) classes homologous to (a); (c) polynucleotide molecules that encode a polypeptide having a mannanase activity that is at least 70% identical to the amino acid sequence of SEQ ID NO: 2 of amino acid residue 32 to amino acid residue 343 as shown in patent application 20 E.U.A. with serial No. 09/111, 256; (d) molecules complementary to (a), (b) or (c); and (e) degenerate nucleotide sequences of (a), (b), (c) or (d).

The plasmid pSJ1678 comprising the polynucleotide molecule (the DNA sequence) encoding said mannanase has been transformed into a strain of Escherichia coli which was deposited by the inventors in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of the Patent Procedure in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, D-38124 ^ f ^ Braunschweig, Germany, May 18, 1998 under deposit number DSM 12180. 10 A second most preferred enzyme is mannanase from the strain of Bacillus subtilis 168, which is described in the patent application of E.U.A. and ^^ 'and co-pending with serial No. 09 / 095,163. More specifically, this mannanase is: i) encoded by the coding part of the DNA sequence as shown in SEQ ID No. 5 which is shown in the patent application of E.U.A. with serial No. 09 / 095,163 or an analogue of said sequence; and / or ii) a polypeptide comprising an amino acid sequence as shown in SEQ ID NO: 6 which is shown in the US patent application. with serial No. 09 / 095,163; or iii) an analogue of the polypeptide defined in ii) which is at least 70% homologous to said polypeptide, or which is derived from said polypeptide by substitution, deletion or addition of one or more amino acids, or is immunologically reactive to a polyclonal antibody against said polypeptide in purified form. Also encompassed is the corresponding isolated polypeptide having mannanase activity selected from the group consisting of: (a) polynucleotide molecules that encode a polypeptide having mannanase activity and comprising a nucleotide sequence as shown in SEQ ID NO: 5 as is shown in the US patent application with serial No. 09 / 095,163; (b) classes homologous to (a); (c) polynucleotide molecules that encode a polypeptide having a mannanase activity that is at least 70% identical to the amino acid sequence of SEQ ID NO: 6 as shown in the patent application of E.U.A. with serial No. 09 / 095,163; (d) molecules complementary to (a), (b) or (c); and (e) degenerate nucleotide sequences of (a), (b), (c) or (d). A third most preferred mannanase is described in co-pending Danish patent application No. PA 1998 01340. More specifically, this mannanase is: i) a polypeptide produced by Bacillus sp. I633; ii) a polypeptide comprising an amino acid sequence as shown in positions 33-340 of SEQ ID NO: 2 as shown in the application of Denmark No. PA 1988 01340; or iii) an analogue of the polypeptide defined in i) or ii) which is at least 65% homologous to said polypeptide, which is derived from said polypeptide by substitution, deletion or addition of one or more amino acids, or which is immunologically reactive to a polyclonal antibody against said polypeptide in purified form. Also encompassed is the corresponding isolated polynucleotide molecule selected from the group consisting of: (a) polynucleotide molecules that encode a polypeptide having mannanase activity and comprising a nucleotide sequence as shown in SEQ ID NO: 1 of nucleotide 317 to nucleotide 1243 of the application of Denmark No. PA 1998 01340; (b) classes homologous to (a); (c) polynucleotide molecules that encode a polypeptide having a mannanase activity that is at least 65% identical to the amino acid sequence of SEQ ID NO: 2 of amino acid residue 33 to amino acid residue 340 of the Denmark application No. PA 1998 01340; (d) molecules complementary to (a), (b), or (c); and (e) degenerate nucleotide sequences of (a), (b), (c) or (d). Plasmid pBXM3 comprising the polynucleotide molecule (the DNA sequence) encoding a mannanase of the present invention has been transformed into a strain of Escherichia coli which was deposited by the inventors in accordance with the Budapest Treaty on International Recognition of the Deposit of Microorganisms for , _ «. the Purposes of the Patent Procedure in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, D-38124 Braunschweig, Germany, on May 29, 1998 under the deposition number DSM 12197. A fourth most preferred enzyme is described in co-pending Denmark Patent Application No. PA 1998 01341. More specifically, this mannanase is: i) a polypeptide produced by Bacillus sp. AAI 12; ii) a polypeptide comprising an amino acid sequence as shown in positions 25-362 of SEQ ID NO: 2 as shown in the application of Denmark No. PA 1998 01341; or iii) an analogue of the polypeptide defined in i) or ii) which is at least 65% homologous to said polypeptide, which is derived from said polypeptide by substitution, deletion or addition of one or more amino acids, or which is immunologically reactive to a polyclonal antibody confronted against said polypeptide in purified form. Also encompassed is the corresponding isolated polynucleotide molecule selected from the group consisting of: (a) polynucleotide molecules encoding a polypeptide having mannanase activity and comprising a nucleotide sequence as shown in SEQ ID NO: 1 of nucleotide 225 to nucleotide 1236 as shown in the application of Denmark No. PA 1998 01341; (b) classes homologous to (a); (c) polynucleotide molecules that encode a polypeptide having a mannanase activity that is at least 65% identical to the amino acid sequence of SEQ ID NO: 2 of amino acid residue 25 to amino acid residue 362 as shown in Denmark's request No. 5 PA 1998 01341; (d) molecules complementary to (a), (b) or (c); Y (e) degenerate nucleotide sequences of (a), (b), (c) or (d).

^ H The plasmid pBXM1 comprising the polynucleotide molecule (the DNA sequence) encoding a mannanase from the The present invention has been transformed into a strain of Escherichia coli that was deposited by the inventors in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124 15 Braunschweig, Germany, on October 7, 1998 under the deposition number DSM 12433. When present, mannanase is incorporated in the compositions of the present invention preferably at a level from 0.0001% to 2%, most preferably from 0.0005% to 0.1%, of even greater preference for 0.001% to 0.02% pure enzyme per weight of the composition. The compositions of the present invention can also understand a xyloglucanase enzyme. Xyloglucanases suitable for the purpose of the present invention are enzymes having activity -> > * A. * Xyloglucan-specific endoglucanase, preferably at a level from about 0.001% to about 1%, more preferably from about 0.01% to about 0.5%, by weight of the composition. As used herein, the term "endoglucanase activity" means the ability of the enzyme to hydrolyse the 1,4-β-D-glycosidic bonds present in any cellulosic material, such as cellulose, cellulose derivatives, lichenine, β -D-glucan or xyloglucan. The endoglucanase activity can be determined in accordance with methods known in the art, some of whose examples are described in 10 WO 94/14953 and hereinafter. One unit of endoglucanase activity (eg, CMCU, AVIU, XGU or BGU) is defined as the reduction sugar production μmol / min of a glucan substrate, with the glucan substrate being, eg, CMC (CMCU), Avicel activity swollen by acid (AVIU), xyloglucan (XGU) or cereal ß-glucan (BGU). The Reducing sugars are determined as described in WO 94/14953 and hereinafter. The specific activity of an endoglucanase towards a substrate is defined as units / mg of protein. Enzymes that exhibit, as their greatest activity, endoglucanase XGU activity (hereinafter referred to herein) are suitable. 20"specific for xyloglucan"), whose enzyme: i) is encoded by a DNA sequence comprising or being included in at least one of the following partial sequences: (a) ATTCATTTGT GGACAGTGGA C (SEQ ID No: 1) vi '(b) GTTGATCGCA CATTGAACCA (SEQ ID No: 2) (c) ACCCCAGCCG ACCGATTGTC (SEQ ID No: 3) (d) CTTCCTTACC TCACCATCAT (SEQ ID No: 4) (e) TTAACATCTT TTCACCATGA (SEQ ID No: 5) 5 (f) AGCTTTCCCT TCTCTCCCTT (SEQ ID No: 6) (g) GCCACCCTGG CTTCCGCTGC CAGCCTCC (SEQ ID No: 7) (h) GACAGTAGCA ATCCAGCATT (SEQ ID No: 8) ^^ w (i) AGCATCAGCC GCTTTGTACA (SEQ ID No : 9) 0) CCATGAAGTT CACCGTATTG (SEQ ID NO: 10) 10 (k) GCACTGCTTC TCTCCCAGGT (SEQ ID NO: 11) (I) GTGGGCGGCC CCTCAGGCAA (SEQ ID NO: 12) (m) ACGCTCCTCC AATTTTCTCT (SEQ ID NO: 13 ) (n) GGCTGGTAG TAATGAGTCT (SEQ ID No: 14) (or) GGCGCAGAGT TTGGCCAGGC (SEQ ID No: 15) 15 (p) CAACATCCCC GGTGTTCTGG G (SEQ ID No: 16) (q) AAAGATTCAT TTGTGGACAG TGGACGTTGA TCGCACATTG AACCAACCCC AGCCGACCGA TTGTCCTTCC TTACCTCACC ^ ATCATTTAAC ATCTTTTCAC CATGAAGCTT TCCCTTCTCT 20 CCCTTGCCAC CCTGGCTTCC GCTGCCAGCCTCCAGCGCCG CACACTTCTG CGGTCAGTGG GATACCGCCA CCGCCGGTGA CTTCACCCTG TACAACGACC TTTGGGGCGA GACGGCCGGC ACCGGCTCCC AGTGCACTGG AGTCGACTCC TACAGCGGCG ACACCATCGC TTGTCACACC AGCAGGTCCT GGTCGGAGTA GCAGCAGCGT CAAGAGCTAT GCCAACG (SEQ ID No: 17) or (r) CAGCATCTCC ATTGAGTAAT CACGTTGGTG TTCGGTGGCC CGCCGTGTTG CGTGGCGGAG GCTGCCGGGA GACGGGTGGG GATGGTGGTG GGAGAGAATG TAGGGCGCCG TGTTTCAGTC CCTAGGCAGG ATACCGGAAA ACCGTGTGGT AGGAGGTTTA TAGGTTTCCA GGAGACGCTG TATAGGGGAT AAATGAGATT GAATGGTGGC CACACTCAAA CCAACCAGGT CCTGTACATA CAATGCATAT ACCAATTATA CCTACCAAAA AAAAAAAAAA AAAAAAAAAA AAAA (SEQ ID NO: 18) or a sequence homologous thereto, encoding a polypeptide specific for xyloglucan with endoglucanase activity. ii) is immunologically reactive with an antibody raised against a highly purified endoglucanase encoded by the DNA sequence defined in i) and derived from Aspergillus aculeatus, CBS 101.43, and is specific for xyloglucan. More specifically, as used herein, the term "specific for xyloglucan" means that the endoglucanase enzyme exhibits enhanced endoglucanase activity in a substrate of xyloglucan, and preferably less than 75% activity, more preferably less than 50% activity, more preferably even less than about 25% activity in other cellulose-containing substrates, such as carboxymethyl cellulose, cellulose or other glucans. Preferably, the specificity of an endoglucanase towards xyloglucan is further defined as a relative activity determined as the release of reducing sugars under optimal conditions, generated through the incubation of the enzyme with xyloglucan and the other substrate to be examined respectively. For example, specificity can be defined as the activity of xyloglucan towards β-glucan (XGU / BGU), the activity of xyloglucan towards carboxymethylcellulose (XGU / CMCU) or the activity of xyloglucan towards the activity of Avicel swollen by acid (XGU / AVIU ), which is preferably greater than about 50, such as 75, 90 or 100. The term "derivative of", as used herein, refers not only to an endoglucanase produced by strain CBS 101.43, but also to an endoglucanase encoded by a DNA sequence isolated from strain CBS 101.43 and produced in a host organism transformed with said DNA sequence. The term "homologous", as used herein, denotes a polypeptide encoded by DNA, which hybridizes to the same probe as the coding of DNA for a endoglucanase enzyme specific for xyloglucan under certain specified conditions (such as pre-soaking in 5xSSC and pre-hybridization for 1 h at -40 ° C in a 5xSSC solution, dxDenhardt solution, and 50 μg of calf thymus DNA go denatured sonicate, followed by hybridization in the same solution supplemented with a probe labeled with 32-P-dCTP of 50 μCi for 18 h at -40 ° C and triple washing in 2xSSC, 0.2% SDS at 40 ° C for 30 minutes). More specifically, the term is intended to refer to a DNA sequence, which is at least 70% homologous to some of the sequences shown above, encoding a specific endoglucanase for xyloglucan, including at least 75%, at least 80%, at least 85%, at least 90% or even, at least 95% with any of the sequences that were already shown. The term is intended to include modifications of any of the DNA sequences shown above, such as nucleotide substitutions that do not produce another amino acid sequence of the polypeptide encoded by the sequence, but which correspond to the use of the host organism codon wherein a DNA construct is introduced, which comprises any of the DNA sequences, or nucleotide substitutions that do produce a different amino acid sequence and, therefore, possibly, a different protein structure, which can produce a mutant of endoglucanase with properties different from those of the native enzyme. Other examples of possible modifications are the insertion of one or more 20 nucleotides in the sequence, the addition of one or more nucleotides at each end of the sequence or the deletion of one or more nucleotides at each end or within the sequence. * * «_ X * _ > The endoglucanase specific for xyloglucan useful in the present invention is preferably one having a ratio of XGU / BGU, XGU / CMU and / or XGU / AVIU (as defined above) of more than 50, such as 75, 90 or 100. In addition, the endoglucanase specific for xyloglucan is preferably substantially devoid of activity towards β-glucan and / or exhibits a maximum of 25%, for example, at most 10% or about 5%, of activity towards carboxymethylcellulose and / or Avicel, when the activity towards xyoglucan is 100%. In addition, the endoglucanase specific for the xyloglucan of the invention is preferably substantially devoid of transferase activity, an activity that has been observed for most of the endoglucanases # specific for xyloglucan of plant origin. The endoglucanase specific for xyloglucan can be obtained from the fungal species A. aculeatus, as described in WO 94/14953. Microbial endoglucanases specific for xyloglucan have also been described in WO 94/14953. Specific endoglucanase for plant xyloglucan have been described, but these enzymes exhibit transferase activity and, therefore, should be considered inferior to the microbial endoglucanases specific for xyloglucan, when extensive degradation of xyloglucan is not desirable. An additional advantage of a microbial enzyme is that it can be produced in larger quantities in a microbial host than enzymes from other sources. Xyloglucanase, when present, is incorporated into the compositions of the invention, preferably at a level between 0.0001% and 5.2%, more preferably between 0.0005% and 0.1%, even more preferably, between 0.001% and 0.02. % of the pure enzyme by weight of the composition. The enzymes mentioned above can be of any appropriate origin, such as plant, animal, bacterial, fungal and yeast origin. In addition, the origin can be mesophilic or extremophilic 10 (psychrofilic, psychrotrophic, thermophilic, barophilic, alkalophilic, acidophilic, halophilic, etc.). The purified or non-purified forms of these enzymes can be used. At present, it is a common practice to modify the wild-type enzymes through protein / genetic engineering techniques to optimize their efficiency in detergent compositions for the washing of 15 clothing and / or tissue care of the invention. For example, the variants can be designed in such a way as to increase the compatibility of the enzyme with ingredients commonly comprised in such compositions. Alternatively, the variant can be designed in such a way that the optimum pH, the bleaching or chelating stability, the catalytic activity and the like of the The enzyme variant is adapted to the particular washing application. In particular, attention must be focused on the amino acids sensitive to oxidation in the case of the stability of the bleaching, and on surface charges for the compatibility of the surfactant. Point Isoelectricity of such enzymes can be modified through the replacement of some charged amino acids, e.g., an increase in the isoelectric point can help improve compatibility with anionic surfactants. The stability of the enzymes can be further increased by the creation of, for example, salt bridges, and the strengthening of calcium binding sites to increase the stability of the chelant. Other appropriate cleaning adjunct materials that may be added are enzymatic oxidation scavengers. Examples of such enzyme oxidation scavengers are the ethoxylated tetraethylene polyamines. A range of enzymatic materials is also disclosed in WO 9307263 and WO 9307260 issued to Genencor International, WO 8908694 and the document E.U.A. 3,553,139, issued January 5, 1971 to McCarty et al. Enzymes are further described in the documents of E.U.A. 4, 101, 457 and No. 4,507,219. Useful enzyme materials for liquid detergent formulations and their inclusion in such formulations are described in U.S.A. 4,261, 868. Several carbohydrase enzymes that impart antomicrobial activity can also be included in the present invention. Such enzymes include endoglycosidase, endoglycosidase type II and glucosidase as described in the patents of E.U.A. No. 5,041, 236,%, 395,541, 5,238,843 and 5,356,803, included herein by reference. Of course, other enzymes with microbial activity can also be used, including peroxidases, oxidases and several other enzymes. Also, it is possible to include an enzyme stabilization system in the compositions of the present invention when any enzyme is present in the composition.

Enzyme stabilizers Enzymes for use in detergents can be stabilized by different techniques. Stabilization techniques 10 enzymes are described and illustrated in the document of E.U.A. 3,600,319, EP 199,405 and EP 200,586. Enzyme stabilization systems are also described, for example, in the document of E.U.A. 3,519,570. A useful bacillus, the sp. AC13, which provides proteases, xylanases and cellulases, is described in WO 9401532. The enzymes used herein can be stabilized at 15 through the presence of water soluble sources of calcium and / or magnesium atoms in the final compositions, which provide the enzymes with such ions. Suitable enzyme stabilizers and levels of use are described in the U.S. patent. No. 5,705,464, 5,710,115 and 5,576,282. F 20 Enhancers The detergent and laundry compositions described herein comprise one or more enhancers or detergent improving systems. When they are found, the compositions typically comprise at least about 1% improver, preferably about 5%, more preferably about 10% to about 80%, preferably about 50%, most preferably about 30% by weight of the detergent improver . However, it is not intended to exclude higher or lower levels of breeders. Preferred builders for use in detergent and laundry compositions, particularly dishwashing compositions, described herein include, but are not limited to, water-soluble builder compounds (e.g., polycarboxylates), as described in the US patents 5,695,679, 5,705,464 and 5,710,115. Other suitable polycarboxylates are described in the patents of E.U.A. No. 4,144,226, 3,308,067 and 3,723,322. Preferred polycarboxylates are hydrocarboxylates containing a maximum of three carboxy groups per molecule, more particularly titrants. Inorganic detergent builders or those comprising P include, but are not limited to, the alkali metal, ammonium and alkanolammonium salts of polyphosphates (illustrated by the tripolyphosphates, vitreous polymeric pyrophosphate meta-phosphates), phosphonates (see, for example, U.S. Patent Nos. 3,159,581, 3,213,030, 3,422,021, 3,400,148 and 3,422,137), phytic acid, silicates, carbonates (including bicarbonates and sesquicarbonates), sulfates and aluminosilicates.

* • * However, non-phosphate builders are required in some scenarios. Importantly, the compositions herein work surprisingly well even in the presence of so-called "weak" improvers (as compared to phosphates), such as citrate, or in the so-called "under-improved" situation that may occur with zeolite improvers or silicate stratified. Suitable silicates include water-soluble sodium silicates with a SiO: Na20 ratio of about 1.0 to 2.8, with ratios of about 1.6 to 2.4 preferably, and a ratio of about 2.0 being most preferred. The silicates may be in the form of an anhydrous salt or a hydrated salt. The sodium silicate with a ratio of Si? 2: Na20 of 2.0 is more preferred. The silicates, when present, are preferably included in the laundry and laundry detergent compositions described herein at a level of from about 5% to about 50% by weight of the composition, most preferably about 10% to approximately 40% by weight. Partially soluble or insoluble builder compounds, which are suitable for use in detergent or laundry washing compositions, particularly granular detergent compositions, include, but are not limited to, crystalline layer silicates, preferably sodium silicates. in crystalline layers (partially soluble in water) as described in the US patent No. 4,664,839, and sodium aluminosilicates (insoluble in water). When present in detergent and laundry washing compositions, these improvers are typically included at a level of from about 1% to 80% by weight, preferably from about 10% to 70% by weight, most preferably about 20% to 60% by weight of the composition. The sodium silicates in crystalline layers with the general formula NaMSix02x +? And H20, wherein M is sodium or hydrogen, x is a number from about 0 to about 20, preferably 0, can be used in the compositions described herein. Sodium silicates 10 in crystalline layers of this type are described in EP-A-0164514 and methods for their preparation are described in DE-A-3417649 and DE-A-3742043. The most preferred material is delta-Na2S05, available from Hoechst AG as • NaSKS-6 (commonly abbreviated here as "SKS-6"). Unlike zeolite improvers, the Na SKS-6 silicate improver does not 15 comprises aluminum. NaSKS-6 presents the morphological form of delta-Na2Si? 5 of the stratified silicate. SKS-6 is a highly preferred layered silicate for use in the compositions described herein, but other of these layered silicates, such as those with the general formula NaMSix? 2x +? And H20, wherein M is sodium or hydrogen, x is a number of 1.9 20 to 4, preferably 2 and y is a number from 0 to 20, preferably 0, can be used in the compositions described herein. Several other stratified silicates from Hoechst include NaSKS-5, NaSKS-7 and NaSKS-11, such as the alpha, beta and gamma form. As mentioned previously, the delta form Na2SiOs (NaSKS-6) is most preferred for use herein. Other silicates may also be useful, such as, for example, magnesium silicate, which may serve as an agent that increases brittleness in granular formulations, as a stabilizing agent for oxygen bleach and as a component of foam control systems. The sodium silicate material in crystalline layers is preferably included in granular detergent compositions as a particulate in close mixture with a solid, ionizable, water soluble material. The solid, ionizable, water-soluble material is preferably selected from organic acids, salts of organic and inorganic acids and mixtures thereof. Aluminosilicate builders are of great importance in most heavy duty granular detergent compositions currently marketed, and may also be a significant ingredient in the formulation of liquid detergents. The aluminosilicate improvers have the empirical formula: [Mz (AI02) and] .xH20 where z and y are integers of at least 6, the molar ratio between z and y is in the range of 1.0 to about 0.5, and x is an integer of about 15 to about 264. Preferably, the aluminosilicate enhancer is an aluminosilicate zeolite with a formula of unit cells: Naz [(AI02) z (Si02) and] .xH20 where z and y are at least 6; the molar ratio between zey is from 1.0 to 0.5 and x is at least 5, preferably 7.5 to 276, more preferably from 10 to 264. The aluminosilicate builders preferably have a hydrated form and are preferably crystalline, comprising from about 10% to about 28%, most preferably from about 18% to about 22% water in bound form. These aluminosilicate ion exchange materials may have a crystalline or amorphous structure and may be natural aluminosilicates or derivatives synthetically. A method for producing the aluminosilicate ion exchange materials is described in the document of E.U.A. 3,985,669. Synthetic crystalline aluminosilicate ion exchange materials useful herein are available under the names Zeolite A, Zeolite B, Zeolite P, Zeolite X, Zeolite MAP and Zeolite HS and mixtures thereof. In an especially preferred embodiment, the crystalline aluminosilicate ion exchange material has the formula: Na? 2 [AI02) i2 (Si02) i2] .xH2? wherein x is from about 20 to about 30, especially about 27. This material is known as Zeolite A. Dehydrated zeolites (x = 0-10) can also be used herein. Preferably, the aluminosilicate has a particle size of about 0.1-10 microns in diameter. Zeolite X has the formula: Na86 [(Al? 2) 86 (Si? 2)? O6] .276H20 Citrate improvers, for example, citric acid and soluble salts thereof (particularly the sodium salt) are polycarboxylate builders of particular importance for detergent formulations.

F heavy-duty liquids, due to their availability of renewable resources and their biodegradability. The citrates can also be used in granular compositions, especially in combination with zeolite and / or layered silicate builders. Oxydisuccinates are also especially useful in such compositions and combinations. Suitable for the detergent compositions described herein are also the 3,3-dicarboxy-4-oxa-1,6-hexanedioates and the F related compounds that are described in the document of E.U.A. 20 4,566,984. Useful succinic acid builders include C5-C20 alkyl and alkenyl succinic acids and salts thereof. A particularly preferred compound of this type is dodecyl succinic acid. Specific examples of succinate builders include: lauryl succinate, myristylsuccinate, palmitylsuccinate, 2-dodecenylsuccinate (preferred), 2-pentadecenylsuccinate and the like. Lauryl succinates are the preferred improvers of this group and are described in the application to European patent 86200690.5 / 0,200,263, published on November 5, 1986. Fatty acids, for example, C 12 -C 18 monocarboxylic acids, can also be incorporated in the compositions, by themselves or in combination with the aforementioned improvers, especially the ^ p citrate and / or succinate enhancers, to provide additional breeding activity. This use of fatty acids will generally result in a lower 10 foam formation that must be taken into consideration by the formulator. Dispersants ^^^ One or more suitable polyalkyleneimine dispersants may be included in the laundry detergent compositions herein 15 invention. Examples of such suitable dispersants are found in European patent applications No. 111, 965, 111, 984 and 112,592; the EU.A. No. 4,597,898, 4,548,744 and 5,565,145. However, any suitable clay / earth dispersant or anti-redeposition agent can be used in the laundry washing compositions of the present invention. 20 invention. In addition, polymeric dispersing agents including polymeric polycarboxylates and polyethylene glycols are suitable for use in the present invention. The unsaturated monomeric acids that can being polymerized to form suitable polymeric polycarboxylates, include acrylic acid, maleic acid (or maleic anhydride), fumaric acid, itaconic acid, aconitic acid, mesaconic acid, citraconic acid and methylenemalonic acid. Particularly suitable polymeric polycarboxylates can be derived from acrylic acid. Such polymers based on acrylic acid, which are useful herein, are the water-soluble salts of the polymerized acrylic acid. The average molecular weight of such polymers in the acid form ranges preferably between about 2,000 and 10,000, more preferably between about 4,000 and 7,000 and even more preferably between about 4,000 and 5,000. The water-soluble salts of said acrylic acid polymers can include, for example, the alkali metal, ammonium and substituted ammonium salts. Soluble polymers of this type are known materials. The use of polyacrylates of this type in detergent compositions has been described, for example, in the document of E.U.A. 3,308,067. The acrylic / maleic based copolymers can also be used as the preferred component of the dispersing / anti-redeposition agent. These materials include the water-soluble salts of copolymers of acrylic acid and maleic acid. The average molecular weight of such copolymers in the acid form ranges, preferably, between about 2,000 and 100,000, more preferably, between about 5,000 and 75,000 and even more preferably between about 7,000 and 65,000. The relationship between the acrylate segments and the maleate segments in such copolymers will oscillate generally between about 30: 1 and about 1: 1, preferably between about 10: 1 and 2: 1. The water-soluble salts of said acrylic acid / maleic acid copolymers can include, for example, the alkali metal, ammonium and substituted ammonium salts. Soluble acrylate / maleate copolymers of this type are known materials which are described in European patent application No. 66915, published on December 15, 1982, as well as in EP 193,360, published on September 3, 1986, which also describes said polymers comprising hydroxypropylacrylate. Still other useful dispersing agents include the terpolymers of maleic / acrylic / vinyl alcohol. Such materials are also described in EP 193,360, including, for example, terpolymer 45/45/10 of acrylic / maleic / vinyl alcohol. Another polymeric material that can be included is polyethylene glycol (PEG). PEG can exhibit the performance of a dispersing agent, as well as acting as a clay / soil removal / anti-redeposition agent. The typical molecular weight, for these purposes, ranges from about 500 to about 100,000, preferably from about 1,000, to about 50,000 and even more preferably from about 1,500 to about 10,000. The polyaspartate and polyglutamate dispersing agents can also be used, especially in conjunction with the zeolite improvers. Dispersing agents, such as polyaspartate, preferably have a molecular weight (average) of about 10,000.

Dirt release agents The compositions in accordance with the present invention may optionally comprise one or more soil release agents, in addition to the polymeric compounds of the polymeric stabilization system 5 discussed above, including anti-redeposition agents. If used, the soil release agents will generally comprise about 0.01%, preferably ^ BWF about 0.1%, more preferably from about 0.2% to about 10%, preferably about 5%, higher 10 preferably at about 3% by weight of the composition. The following documents, included herein by reference, describe suitable soil release polymers for use in the present invention. E.U.A. 3,959,230, Hays, issued May 25, 1976; E.U.A. 3,893,929, Basadur, issued July 8, 1975; 15 E.U.A. 4,000,093, Nicol et al., Issued December 28, 1976; the patent of E.U.A. No. 4,702,857, Gosselink, issued October 27, 1987; E.U.A. 4,968,451, Scheibel et al., Issued November 6; E.U.A. 4,702,857, Gosseling, issued October 27, 1987; E.U.A. 4,711, 730, Gosselink et al., Issued December 8, 1987; E.U.A. 4,721, 580, 20 Gosselink, issued January 26, 1988; E.U.A. 4,877,896, Maldonado et al., Issued October 31, 1989; E.U.A. 4,956,447, Gosselink et al., Issued September 11, 1990; E.U.A. 5,415,807, Gosselink et al., issued on May 16, 1995; European patent application 0 219 048, published on April 22, 1987 by Kud et al. Other soil release agents are described in the documents: E.U.A. 4,201, 824, Violland et al .; E.U.A. 4,240,918 Lagasse et al., 5; E.U.A. 4,525,524, Tung et al .; E.U.A. 4,579,681, Ruppert et al .; E.U.A. 4,240,918; E.U.A. 4,787,989; E.U.A. 4,525,524; EP 279,134 A; 1988 issued to Rhone-Poulenc Chemie; EP 457,205 A issued to BASF (1991) and DE 9 2,335,044 issued to Unilever N.V., 1974, included herein by reference. 10 Commercially available land release agents include METOLOSE SM100, METOLOSE SM200 manufactured by Shin-etsu Kagaku Kogyo KK, SOKALAN type material, for example, SOKALAN HP-22, available from BASF (Germany), ZELCON 5126 (DuPont) and MILEASE T (ICI). Preferred SRA's typically comprise hydrophilic segments to hydrophilize the surface of hydrophobic fibers, such as polyester and nylon, and hydrophobic segments to deposit on the hydrophobic fibers and remain adhered thereto during the washing and rinsing cycles, F serving as an anchor for the hydrophilic segments. This can facilitate the 20 spot cleaning, which occurs after treatment with SRA, in subsequent washing procedures.

Guelantes agents The compositions of the present invention may comprise - - optionally a chelating agent that serves to chelate metal ions and : j metal impurities that, otherwise, would tend to deactivate the agents ' 5 v whiteners. Useful chelating agents can include any of those known to those skilled in the art, such as aminocarboxylates, . . phosphonates, aminophosphonates, polyfunctionally substituted aromatic chelating agents and mixtures thereof. Other examples of suitable chelating agents and levels to be employed are described in 10 the patents of E.U.A. No. 5,705,464, 5,710,115, 5,728,671 and 5,576,282. The presence of the chelating agents contributes to an additional increase in the chemical stability of the compositions. A chelating agent may also be desirable in the compositions of the present invention, since it allows to increase the ionic strength of the compositions herein and, therefore, their effectiveness with respect to stain removal and bleaching on different surfaces. Phosphonate chelating agents suitable for use herein may include ethane-1-hydroxy diphosphonates of the alkali metal (HEDP), Alkylene poly (alkylene phosphonate), as well as aminophosphonate compounds, including (acid) aminoaminotri (methylene phosphonic) (ATMP), nitotrotrimethylene phosphonates (NTP), ethylene diamine tetramethylene phosphonates and diethylenetriamine pentamethylene phosphonates (DTPMP). Phosphonate compounds may be present, either in their acid form or as salts of different cations in some or all of its acid functionalities. Preferred phosphonate chelating agents for use herein are diethylenetriaminepentamethylene phosphonate (DTPMP) and 1-hydroxy diphosphonate (HEDP). Such phosphonate chelating agents are commercially available from Monsanto 5 under the tradename DEQUEST®. Polyfunctionally substituted aromatic chelating agents may also be useful in the compositions herein. See the patent of E.U.A. No. 3,812,044, issued May 21, 1974, to CONNOR et al. Preferred compounds of this type in acid form are 10 dihydroxydisulfobenzenes such as 1,2-dihydroxy-3,5-disulfobenzene. A preferred biodegradable chelating agent for use herein is ethylene diamine-N-disuccinic acid, or alkali metal, or earth • alkaline, ammonium or substituted ammonium salts thereof or mixtures thereof. Ethylene-diamine-N-disuccinic acids, especially the 15 (S, S) -isomer, have been described extensively in the US patent. No. 4,704,233, issued November 3, 1987 to Hartmann and Perkins. Ethylenediamine-N.N'-disuccinic acid is, for example, commercially available under the trade name ssEDDS® in Palmer Research • Laboratories. Suitable aminocarboxylates for use herein include ethylenediamine tetracetates, diethylenetriamine pentacetate, diethylenetriamine pentacetate (DTPA), N-hydroxyethylethylenediamine triacetates, nitrile triacetates, tetraacetic acid propylenediamine (PDTA) and methylglycine di-acetic acid (MGDA), both in their acid form or in their alkali, ammonium and substituted ammonium metal salt forms. Particularly suitable aminocarboxylates for use herein are diethylenetriamine pentacetic acid, propylenediamine tetraacetic acid (PDTA), which is, for example, commercially available from BASF under the tradename Trilon FS®, and di-acetic acid from methylglycine (MGDA). ^ Other carboxylate chelating agents to be used herein include salicylic acid, aspartic acid, glutamic acid, glycine, 10 malonic acid or mixtures thereof. Another chelating agent to be used in the present has the formula: wherein Ri, R2, R3 and R4 are independently selected from the group comprising -H, alkyl, alkoxy, aryl, aryloxy, -Cl, -Br, -N02, -C (0) R 'and -SO2R "; where R 'is selected from the group comprising -H, -OH, alkyl, alkoxy, aryl and aryloxy; R "is selected from the group comprising alkyl, alkoxy, aryl and aryloxy and R5, Re, R7 and Re are independently selected from a group comprising -H and alkyl.

Particularly preferred chelating agents for use herein are (amino) acid (methylene phosphonic), di-ethylene-triamino-pentacetic acid, diethylenetriaminepentamethylene phosphonate, 1-hydroxyethane diphosphonate, ethylene diamine-N'-disuccinic acid and mixtures thereof. thereof. Typically, the compositions according to the present invention comprise a maximum of about 15%, preferably a maximum of about 5%, by weight of the total composition, of a chelating agent or mixtures thereof, preferably from 0.01% up to 1.5% by weight and more preferred from 0.01% to 0.5%. 10 Radical scavengers The compositions of the present invention may comprise radical scavengers or a mixture thereof. Suitable radical scavengers for use herein include the well known substituted mono- and dihydroxybenzenes and their analogs, aryl- and alkylcarboxylates and mixtures thereof. Preferred radical scavengers for use herein include di-tert-butyl-hydroxytoluene (BHT), hydroquinone, di-tert-butyl-hydroquinone, mono-tert-butyl-hydroquinone, tert-butyl-hydroxyanisole, benzoic acid, toluic, catechol, t-butylcatechol, benzylamine, 1, 1, 3-tris (2-methyl-4-hydroxy-5-t-butylphenyl) butane, n-propyl-gallate or mixtures thereof; highly preferred is di-tert-butylhydroxytoluene. Such radical scavengers, such as N- propyl-gallate, are commercially available from Ñipa Laboratories under the trade name Nipanox S1®. Radical scavengers, when used, are typically included herein in amounts of maximum about 10% by weight of the total composition, and preferably from about 0.001% to about 0.5% by weight. The presence of radical scavengers can contribute to ^^ r the chemical stability of the bleaching compositions of the present invention, as well as the safety profile of the compositions of the present invention.

Foam suppressors Another optional ingredient is a foam suppressant, such as, for example, silicones and silica-silicone mixtures. Examples of suitable foam suppressors are described in the U.S. Patents. No. 5,707,950 and 5,728,671. These foam suppressors are normally used at levels of from about 0.001% to about 2% by weight of the composition, preferably from about 0.01% to about 1% by weight. 20 Reinforcing agents to increase the foam If a high foam formation is desired, the reinforcing agents to increase the foam, such as the C10-C16 alkanoamides, they can be included in the compositions, typically at levels of 1% -10%. C10-C14 monoethanol- and diethanolamides illustrate a typical class of such reinforcing agents to increase foam. The use of said reinforcers to increase the foam with high foaming adjunct surfactants, such as the amine oxides, betaines and sultaines mentioned, also has advantages. If desired, the soluble magnesium salts, such as MgC, MgSO4 and the like, can be added at levels of, for example, 0.1% -2% to provide additional foams and increase efficiency with respect to fat removal. Other suitable examples of reinforcing agents for increasing foam are described in WO 99/27058 and WO 99/27057, both issued to The Procter & Gamble Company, published on June 3, 1999.

Brighteners Optical brighteners, fluorescent whitening agents or brighteners or whitening agents known in the art can be included in instant compositions when they are designed for fabric treatment or laundry, typically at levels of from about 0.05% to about 1.2% , by weight, of the detergent compositions herein. The commercial optical brighteners useful in the present invention can be classified into subgroups, including, but not necessarily limited to, those derived from stilbene, pyrazoline, coumarin, carboxylic acids, metincyanines, dibenzothiophen-5,5-dioxide, azoles, heterocyclic brighteners with 6-membered ring. This list is illustrative and not limiting. Examples of such brighteners are described in "The Production in Application of Fluorescent Brightening Agents," M. Zahradnik, published by John Wiley & Sons, New York (1982). Specific examples of optical brighteners that are useful in the present compositions are those identified in the U.S.A. No. 4,790,856, issued to Wixon, on December 13, 1988. These brighteners include the PHORWHITE series of brighteners from Verona. Other brighteners described in this reference include: Tinopal UNPA, Tinopal CBS and Tinopal 5BM, Tinopal PLC; available in Ciba-Geigy; Artic White CC and Artic White CWD, available at Hilton-Davis, located in Italy; 2- (4-styryl-phenyl) -2H-naphthol [1,2-d] triazoles; 4,4'-bis- (1, 2,3-triazol-2-yl) -stilbenes; 4,4'-bis (styryl) bisphenyls and the aminocoumarins. Specific examples of these brighteners include 4-methyl-7-diethyl aminocoumarin; 1,2-bis (-benzimidazol-2-yl) ethylene; 2,5-bis (benzoxazol-2-yl) thiophene; 2-styryl-napht- [1, 2-djoxazole and 2- (stilbene-4-yl) -2H-naphtho- [1,2-d] triazole. See also the patent of E.U.A. No. 3,646,015, issued on February 29, 1972 to Hamilton. Typically, anionic brighteners are preferred.

SOFTENING AGENTS Fabric softening agents can be included in laundry detergent compositions in accordance with the present invention. The inorganic softening agents are, for example, the smectite clays described in GB-A-1 400 898 and the document E.U.A. 5,019,292. Organic softening agents include water-insoluble tertiary amines, as described in GB-A-1 514 276 and EP-B-011 340, and their combination with mono C 12 -C 14 mono-quaternary ammonium salts is described in EP-B- 026 527 and EP-B-026 528 and the di-long chain amides as described in EP-B-0 242 919. Other useful organic ingredients of fabric softening system include polyethylene oxide materials with a high molecular weight as described in EP-A-0 299 575 and 0 313 146. Particularly suitable fabric softening agents are described in US Pat. No. 5,707,950 and 5,728,673. Smectite clay levels are usually in the range of 2% to 20%, preferably 5% to 15% by weight; the material is added as a dry mixed component to the rest of the formulation. Organic fabric softening agents, such as water insoluble tertiary amines or di-long chain amide materials are included at levels from 0.5% to 5% by weight, usually from 1% to 3% by weight, while the materials of polyethylene oxide with a high molecular weight and water-soluble cationic materials are added at levels from 0.1% to 2%, usually from 0.15% to 1.5% by weight. These materials are usually added to the spray dried portion of the composition, although it may sometimes be convenient to add them as a dry mixed particulate or spray them as molten liquid into other solid components of the composition. The biodegradable quaternary ammonium compounds as described in EP-A-040 562 and EP-A-239 910 have been presented as alternatives to di-long alkyl chain ammonium chlorides and methyl sulfates. Non-limiting examples of anions compatible with softeners for quaternary ammonium compounds and amine precursors include methyl chloride or sulfate.

Inhibition of dye transfer The compositions of the present invention can also include compounds that inhibit the transfer of solubilized and suspended dyes, which arise during laundry washing and conditioning operations, from one colored fabric to another. / '. Polymeric dye transfer inhibiting agents The detergent compositions according to the present invention can comprise from 0.001% to 10%, preferably from 0.01% to 2%, even more preferably, from 0.05% to 1% by weight of agents inhibitors of transfer of polymeric dyes. Said polymeric dye transfer inhibiting agents are normally included in detergent compositions to inhibit the transfer of dyes from colored fabrics to other fabrics which are washed together with it. These polymers have the ability to compose or absorb fugitive dyes extracted from colored fabrics before the dyes can adhere to other articles during washing. Especially suitable polymeric dye transfer inhibiting agents are the N-oxide polymers of 10 polyamine, copolymers of N-vinylpyrrolidone and N-vinylimidazole, polymers of polyvinylpyrrolidone, polyvinyloxazolidones and polyvinylimidazoles or mixtures thereof. Examples of such dye transfer inhibiting agents are described in the U.S. Patents. No. 5,707,950 and 5,707,951. The dye transfer inhibiting agents Additional suitable polymers include, but are not limited to, entangled polymers. Interlaced polymers are polymers whose base structure is interconnected to a certain degree; These links may be chemical in nature, possibly with active groups in the base structure or in branches. The interlaced polymers have been 20 described in the Journal of Polymer Science, number 22, pages 1035-1039. In one embodiment, the entangled polymers are prepared in such a way that they form a rigid three-dimensional structure that can capture the dyes in the pores formed by the three-dimensional structure. In other In this embodiment, the entangled polymers capture the dyes by swelling. Such entangled polymers are described in co-pending European patent application 94870213.9. The addition of such polymers also increases the efficiency of the enzymes according to the invention.

Effervescent System Optionally, the compositions of the present invention may comprise an effervescent system as described in the provisional patent application of E.U.A. with serial number 60/141, 340, filed on June 28, 1999 (Case "7638P").

PH variation and damping Many of the detergent and laundry detergent compositions described herein will be buffered, i.e., they are relatively resistant to pH drop in the presence of acidic soils. However, other compositions herein may have an extremely low damping capacity or may be substantially undamped. The techniques to control or vary the pH to recommended levels of use, include, more generally, the use not only of buffers, but also of alkalis, acids, pH jump system, two compartment containers etc. additional, and are well known to those skilled in the art.

Other materials The detersive or adjunct ingredients optionally included in the instant compositions may comprise one or more materials to aid in or increase the washing efficiency, the treatment of the substrate to be cleaned, or designed to improve the aesthetic appearance of the composition. The adjuncts may also be included in compositions of the present invention, at their conventional levels of use established by the art (generally, the enclosed materials comprise, in total, from about 30% to about 99.9%, preferably from about 70% to about 95% by weight of the compositions), include other active ingredients such as non-phosphatic enhancers, color specks, silver protectants, anti-aging agents. stains and / or anti-corrosion, colorants, fillers, germicides, alkalinity sources, hydrotropes, antioxidants, perfumes, solubilizing agents, vehicles, process aids, pigments and pH controlling agents as described in the US patents No. 5,705,464, 5,710,115, 5,698,504, 5,695,679, 5,686,014 and 5,646,101.

Washing methods In addition to the laundry washing methods described herein, the invention also encompasses a pre-wash treatment process for soiled and soiled fabrics, comprising direct contact of said soils and / or soils with a highly-effective form. concentrated of • -. the aforementioned washing composition for washing said fabrics by conventional aqueous washing solutions. Preferably, the laundry composition remains in contact with the stain / dirt for a period of about 30 seconds to 24 hours before washing the soiled / stained substrate previously treated in a conventional manner. More preferably, the pre-treatment times will range from about 1 to 180 minutes.

Product with instructions for use The present invention also encompasses the inclusion of instructions for the use of the aqueous liquid detergent compositions of the present invention with packages containing the compositions herein or with other forms of advertisements associated with the sale or use thereof. of the compositions. The instructions can be included in a manner typically used by consumer product manufacturers and suppliers. Examples include the provision of instmctions in a label attached to the container containing the composition; on a sheet attached to the container or accompanying it at the time of purchase; or in advertising, demonstrations and / or other written or oral instructions that may be related to the purchase or use of the compositions. Specifically, the instructions will include a description of the use of the composition, for example, the recommended amount of the composition that should be used in a washing machine to clean the fabric; the recommended amount of the composition that should be applied to the fabric, if soaking or rubbing is required. The compositions of the present invention are preferably included in a product. The product preferably comprises an aqueous liquid detergent composition that includes a polymeric stabilization system and optionally one or more cleaning adjunct materials, and further comprises instructions for the use of the fabric washing product when putting a fabric that requires cleaning, with a effective amount of the composition for the composition to clean the fabric. Although the particular embodiments of the invention have been described, it will be apparent to those skilled in the art that various changes and modifications of the invention may be made without representing a deviation from the purpose and scope of the invention. It is intended to cover, in the appended claims, all modifications that are within the scope of the invention.

EXAMPLES OF FORMULATION EXAMPLE 1 An aqueous liquid bleaching composition for use as an additive is prepared as follows: 1 The suspending agent may be any of the suspending agents described above, preferably xanthan gum. 2 The polymer stabilization system can be any of the polymer stabilization systems described above, preferably it is the polymer stabilization system comprising the polymer described in the US patent. No. 4,968,451.

EXAMPLE 2 A heavy-duty aqueous liquid bleach composition in a two-compartment bottle is prepared as follows: ace . 5 10 fifteen twenty 1 The suspending agent may be any of the suspending agents described above, preferably xanthan gum. 2 The polymer stabilization system can be any of the polymer stabilization systems described above, preferably it is the polymer stabilization system comprising the polymer described in the US patent. No. 4,968,451. The compositions of the present invention can be suitably prepared by any method chosen by the formulator, some of which non-limiting examples are described in the documents of E.U.A. 5,879,584, issued to Bianchetti et al., On March 9, 1999; E.U.A. 10 5,691, 297, issued to Nassano et al., On November 11, 1997; E.U.A. 5,574,005, issued to Welch et al., On November 12, 1996; E.U.A. 5,569,645, issued to Dinniwell et al., On October 29, 1996; E.U.A. • 5,656,422, issued to Del Greco et al., On October 15, 1996; E.U.A. 5,516,448, issued to Capeci et al., May 14, 1996; E.U.A. 5,489,392, 15 issued to Capeci et al., On February 6, 1996; E.U.A. 5,486,303, issued to Capeci et al., On January 23, 1996, included in its entirety herein by reference. In addition to the previous examples, the compositions of the • present invention can be formulated in any composition of 20 suitable laundry detergents, some of which non-limiting examples are described in the documents of E.U.A. 5,679,630, issued to Baeck et al., On October 21, 1997; E.U.A. 5,565,145, issued to Watson et al., On October 15, 1996; E.U.A. 5,478,489, issued to Fredj et al., The December 26, 1995; E.U.A. 5,470,507, issued to Fredj et al., On November 28, 1995; E.U.A. 5,466,802, issued to Panandiker et al., November 14, 1995; E.U.A. 5,460,752, issued to Fredj et al., On October 24, 1995; E.U.A. 5,458,810, issued to Fredj et al., On October 17, 1995; E.U.A. 5,458,809, issued to Fredj et al., On October 17, 1995; E.U.A. 5,288,431, issued to Huber et al., On February 22, 1994, included in its entirety by reference. After having described the invention in detail with reference to the preferred embodiments and examples, it will be apparent to those skilled in the art that different changes and modifications can be made without representing a deviation from the scope of the invention, and the invention should not be considered it is limited to the descriptions in the specification.

,"\ Y LIST OF SEQUENCES < 110 > Depoot, Karel deBuzzaccarmí, Francesco Roggeband, Rob < 120 > Aqueous liquid detergent compositions comprising a polymeric stabilization system < 130 > 7759 < 150 > US 60 / 151,232 < 151 > 1999-08-27 < 160 > 18 < 170 > Patentln version 3.0 < 210 > 1 < 211 > 21 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 1 attcatttgt ggacagtgga c 21 < 210 > 2 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 2 gttgatcgca cattgaacca 20 < 210 > 3 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 3 accccagccg accgattgtc 20 < 210 > 4 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 4 cttccttacc tcaccatcat 20 < 210 > 5 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 5 ttaacatctt ttcaccatga 20 < 210 > 6 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 6 agctttccct tctctccctt 20 < 210 > 7 < 211 > 28 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 7 gccaccctgg cttccgctgc cagcctcc 28 < 210 > 8 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 8 gacagtagca atccagcatt 20 < 210 > 9 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 9 agcatcagcc gctttgtaca 20 < 210 > 10 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 10 ccatgaagtt caccgtattg 20 < 210 > 11 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 11 gcactgcttc tctcccaggt < 210 > 12 < 211 > twenty "- ^ -« ^ A * < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 12 gtgggcggcc cctcaggcaa 20 < 210 > 13 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 13 acctcctcc aatttctctct 20 Ü '< 210 > 14 < 211 > 19 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 14 ggctggtagt aatgagtct 19 10 <; 210 > 15 < 211 > 20 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 15 ----- r 'ggcgcagagt ttggccaggc 20 < 210 > 16 < 211 > 21 < 212 > DNA < 213 > Aspergillus aculeatus 15 < 400 > 16 caacatcccc ggtgttctgg g 21 < 210 > 17 < 211 > 347 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 17 aaagattcat ttgtggacag tggacgttga tcgcacattg aaccaacccc agccgaccga 60 ttgtccttcc ttacctcacc atcatttaac atcttttcac catgaagctt tcccttctct 120 20 cccttgccac cctggcttcc gctgccagcc tccagcgccg cacacttctg cggtcagtgg 180 gataccgcca ccgccggtga cttcaccctg tacaacgacc tttggggcga gacggccggc 240- accggctccc agtgcactgg agtcgactcc tacagcggcg acaccatcgc ttgtcacacc 300 agcaggtcct ggtcggagta gcagcagcgt caagagctat gccaacg 347 - *? < 210 > 18 < 211 > 294 < 212 > DNA < 213 > Aspergillus aculeatus < 400 > 18 cagcatctcc attgagtaat cacgttggtg ttcggtggcc cgccgtgttg cgtggcggag 60 gctgccggga gacgggtggg gatggtggtg ggagagaatg tagggcgccg tgtttcagtc 120 cctaggcagg ataccggaaa accgtgtggt aggaggttta taggtttcca ggagacgctg 180 tataggggat aaatgagatt gaatggtggc cacactcaaa ccaaccaggt cctgtacata 240 aaaaaaaaaa aaaa accaattata caatgcatat cctaccaaaa aaaaaaaaaa 294 10 •

Claims (1)

NOVELTY OF THE INVENTION REINFORCEMENTS

1 - . 1 - An aqueous liquid detergent composition characterized in that it comprises: (a) one or more particulate solids and (b) a polymeric stabilization system. 2. The composition according to claim 1, further characterized in that said said or said particulate solids include a peracid. 3. The composition according to claim 2, further characterized in that said peracid is phthaloylaminoperoxycaproic acid. 4. The composition according to claim 1, further characterized in that said polymer stabilization system comprises a polymeric compound selected from the group that includes ethoxylated nonionic polymers, anionic polyterephthalate polymers, ethoxylated nonionic surfactants, polyvinylacetate, polyvinylpyrrolidone, N -polyvinyl oxides, polycarboxylates and mixtures thereof. 5. The composition according to claim 4, further characterized in that said polymeric compound is selected from the group comprising ethoxylated nonionic polymers, anionic polyterephthalate polymers. 6. - The composition according to claim 1, further characterized in that said said or said particulate solids are present is said composition at a level of 0.1% to 25% by weight of said # »composition. 7. The composition according to claim 1, further characterized in that said polymer stabilization system is included in said composition at a level of 0.01% to 10% by weight of said composition. 8. The composition according to claim 1, further characterized in that said composition comprises a suspending agent. 9. The composition according to claim 8, further characterized in that said suspending agent is xanthan gum. 10. The composition according to claim 1, further characterized in that said composition comprises a surfactant. 11. The composition according to claim 10, further characterized in that said surfactant is selected from the group comprising anionic, nonionic, cationic, amphoteric, zwitterionic surfactants and mixtures thereof. 12. The composition according to claim 1, further characterized in that said composition comprises one or more ^; cleaning adjunct materials selected from the group including: surfactants, enhancers, bleaches, bleach activators, bleach catalysts, enzymes, enzyme stabilization systems, chelants, optical brighteners, soil release polymers, 5 dye transfer agents , dispersants, foam suppressors, inks, perfumes, dyes, filler salts, hydrotropes, photoactivators, fluorescent agents, fabric conditioners, fabric softening agents, hydrolyzable surfactants, preservatives, antioxidants, anti-shrinking agents, anti-wrinkle agents , germicides, fungicides, 10 color specks, silver protectors, anti-stain and / or anti-corrosion agents, alkalinity sources, solubilizing agents, vehicles, process aids, pigments and pH controlling agents. 13. A method of washing fabrics that require washing, characterized in that it comprises the contact of such fabrics with the composition 15 of the aqueous liquid detergent as claimed in claim 1. 14. A method for reducing the ocular irritation properties of liquid compositions characterized in that it comprises one or more particulate solids including: (a) the provision of a liquid composition • comprising one or more particulate solids, (b) the addition of a system 20 of polymer stabilization. 15. The method according to claim 14, further characterized in that said liquid composition is an aqueous liquid composition. 16. The method according to claim 14, characterized further in that said said or said particulate solids include a peracid. 17. The method according to claim 16, further characterized in that said peracid is a phthaloylaminoperoxycaproic acid. 18. The method according to claim 14, "Fk" further characterized in that said polymeric stabilization system comprises a polymeric compound selected from the group including 10 ethoxylated nonionic polymers, anionic polyterephthalate polymers, ethoxylated nonionic surfactants, polyvinylacetate , polyvinylpyrrolidone, polyvinyl N-oxides, polycarboxylates and mixtures thereof. 19. The method according to claim 18, further characterized in that polymeric compound is selected from group 15 comprising ethoxylated nonionic polymers, anionic polyterephthalate polymers.