MXPA02000417A - Methods of inducing cell death - Google Patents

Abstract

The invention relates to methods of inducing cell death.

Description

METHOD FOR INDUCING CELLULAR DEATH Description of the invention The present invention relates to methods for inducing cell death and preferably, but not exclusively, to methods for killing cells using E2 and / or E7 proteins from papilloma virus The papillomaviruses (PV), which are viruses of the family Papoviridae, are DNA viruses that have double-stranded circular DNA that contains a number of genes including the genes E2, E6 and E7. They infect epithelial cells and generally induce the formation of benign hyperproliferative lesions. Millions of men and women suffer from an infection of the genital tract caused by at least 95 types of human papillomavirus (HPV) J that causes genital warts. However, some types of papillomavirus are associated with more serious disorders, such as cancer. For example, HPV types 16 and 18 have been linked to cervical cancer in women (zur Halusen, H. (1991) Virology, 184, 9-13) and bovine papillomavirus (PVB) types 2 and 4 have been linked to cancer of the bladder and cancer of the upper alimentary canal, respectively, in cattle (Campo, M, S., et al. (1992) Cancer Res. 52, 6898-6904, Campo, MS, et al. (1994) Carcinogenesis, 15 , 1597-1601). Human cervical cancer cells express the viral oncogenes E6 and E7 and the products of these genes increase the REF. 135670 - cell proliferation and promote cell immortalization (Crook, T., and Vousdesn, K. H. (1996) Papillomavirus Reviews: Current Research on Papillomaviruses (lacey, C, ed) pp. 55-60, Leeds University Press, Leeds). The E2 gene of the human papillomavirus, or the lack of it, is also thought to play a major role in the development of cervical cancer with cells infected with PV. Large parts of cervical cancers contain chromosomal integrating copies of the HPV genome in which the viral E2 gene has been altered as a result of the opening of the viral circulating .ADN (Baker, C. C, et al. (1987) J. Virol., 61, 962-371). In addition, mutations in the E2 gene increase the immortalization capacity of HPV 16 (Romanczuk, H. and Howley, P.M. (1992) Proc. Nat'l Acad. Sci. USA 89, 3159-3163). The papillomavirus E2 genes encode sequence-specific .DNA binding proteins, which regulate the expression of the viral gene and which are also necessary for the replication of the viral .DNA (Thierry, F. (1996) Papillomavirus revu ews: current research on papillomaviruses (Lacey, C, ed) pp. 21-29, Leeds University Press, Leeds). The E2 proteins bind in the form of dimeros to final copies of an inverted repetitive sequence found in the viral Long Control Region (RCL). Depending on the particular PV virus and - of the particular E2 protein that is being studied, the binding of E2 to these sites can activate or repress the transcription of oncogenes E6 and E7. For example, the E2 protein of HPV 16 activates transcription from the P96 promoter located at the 3 'end of the HPV 16 RCL, which causes an increase in the transcription of the E6 and E7 oncogenes; while under exactly the same conditions, the E2 protein of PVB1 represses the activity of the P96 promoter (Boulvard, V., et al. (1994) EMBO J. 13, 55445511--55445599 ,, KKoovveellmmaann ,, RR eett aall,. (1996) Virol, 70, 7549-7560). Each subunit of the dimer E2 contains two domains that are separated by a flexible hinge region: The N-terminal domain of each eubunity mediates the regulation of viral transcription, while the C-terminal domain mmeeddiiaa calls uunniióón aall A.ADDNN ( (GGiirrii, I., and Yaniv, M (1988) EMBO J., 7, 2823-2329) In the PVB, the truncated E2 proteins lacking the N-terminal transcription domain are also expressed. (E2-TR) can repress viral transcription and also form transcriptionally inactive heterodimers with full length E2 (Barsoum, J. et al (1992) J. Virol., 66, 2941-3945). HPV 16, HPV 18 and PBV1 have drastic effects on the proliferation and survival of cervical carcinoma cell lines. - the expression of the E2 protein of HPV 16 in modified SiHa cells. SiHa cells are a cell line transformed by HPV 16 that contains a single altered copy of the E2 gene. Stable cell lines SiHa-E2 expressing the E2 protein of HPV 16 were produced under the control of the heavy metal inducible metallothionein promoter. The induction of E2 expression in these cells using heavy metals results in cell death by apopt osis (Sanchez-Perez, A. et al (1997) J. Gen. Virol., 78, 3009-3018). The cell death induced by E2 showed several of the characteristics of apoptosis, including: swelling as a bubble of the pl-asthmatic membrane, condensation of the cro atina and the appearance of cellular fragments with content of .DNA sub-GO. Similarly, the E2 protein of HPV 18 induces apoptosis in HeLa cells, which is a cell line transformed with HPV 1! which also contains altered copies of the E2 gene (Desaintes, C, et al. (1997) EMBO J. 16, 505-514). He expressed it? The E2 protein of PVB1 in SiHa or HeLa cells has been shown to suppress proliferation, when in part, by blocking the transition of cells from the Gl phase to the S phase (H ang, ES, et al., 1993). ) J. Vi ol., 67, 3720-3729, Dowhanick, JJ, et al. (1995) J. Virol., 69, 7791-7799, Hwang, ES, et al. (1996) Oncogene, 12, 795- 803). Since the - Proliferation assays used in these experiments recorded the formation of colonies after several days in culture, the E2 of PV31 could also induce apoptosis in these cell lines. There is also some evidence to suggest that the E2 protein could have effects on non-transformed cells by PVH. The expression of the E2 protein of HPV 31 in normal human skin keratinocytes negative for HPV (NHK cells), using a recombinant adenovirus, resulted in an arrest of the S-phase cell cycle and the appearance of cells with an ADD content. sub-GO; which is a characteristic of apoptotic cell death (Fratini, M. G., et al. (1997) EMBO J., 16, 318-331). However, the E2 of PVB1 has no effect on the proliferation of C33a cells, which is a cervical carcinoma cell line negative for HPV, or SAOS cells, which is an osteosarcoma cell line negative for HPV (Dowhan: .ck, JJ et al. (1995) J.

Virol. , 69, 7791-7799). Furthermore, the E2 protein of HPV has no effect on apoptosis levels in cells C33a, SAOS cells or HaCat cells, which is a cell line of human keratinocytes immortalized spontaneously and which is negative for HPV (Desaintes, C, et al. (1997) EMBO J., 16, 305-514; , there is no model that - can satisfactorily explain the effects of E2 proteins on cell proliferation. Figure 1 is a guematic representation of some of the possible routes of the E2 protein of HPV 16 towards the induction of apoptosis. The bottom line represents the integrated HPV genome and the inclined arrow indicates the P97 promoter. The E2 protein regulates the transcription of the E6 and E7 genes of the HPV 16 (clear boxes). E6 binds to p53 and this reduces the average vide of p53 in the cell. E7 binds to Rb and causes the release of E2F. Both p53 and E2F can cause apoptosis. Note that E2 could also induce apoptosis regardless of its effects on the transcription of E6 and E7. In cell lines containing HPV DNA, E2 of PVB1 and E2 of integrated HPV 18, they have been shown to repress the transcription of oncogenes E6 and E7 of HPV 18 (Hwang, ES et al. (1993) J. Virol, 67, 3720-3729, Desairttes, C, et al. (1997) EMBO J., 16, 504-514). The p53 tumor suppressor protein is well characterized. Numerous mutants of p53 exist, as well as genes related to p53 such as p73 and p63 (White, E. and Prives, C, Nature, 399, June 1999). The E6 protein binds to the tumor suppressor protein p53 and this interaction results in a decrease in the half-life of p53 in the cells (Werness, B. A. et al. - (1990) Science, 248, 76-79, Scheffner, M., et al. , (1990) Cell. 63, 1129-1136, Lechner, M. S. et al. (1992) EMBO J., 11, 3045-3052, Hubbert, N. ¡L. et al. (1992) J. Virol., 66, 6237-6241). Since p53 can block the progress of cell cycle and / or induce apoptosis (Gottlieb, T. M and Oren, M. (1998) Seminars in Cancer Biol., 8 359-368), a decrease in the concentration of E6 could be expected to cause an increase in p53 levels and an increase in the levels of cell cycle arrest and / or cell death (shown schematically in Figure 1). By adhering to this point of view, the expression of E2 of PVB1 in HeLa cells to stabilize p53 (Hwang, ES et al. (1993) J. Viro. '.. 67, 3720-3729, Desaintes, C , et al. (1997) EMBO J., 16,!> 05-514). However, E2-TR also represses transcription of E6 and E7 in these cells, but this truncated E2 protein can not stabilize p53 or induce apoptosis (Desaintes, C, et al. (1997) EMBO J., 16, 504 -514). This suggests that the regulatory domain of N-terminal transcription is responsible for these effects and that repressing the transcription of E6 by E2 is not the critical event for the induction of apoptosis. In addition, E2 expression of HPV 31 in NHK cells seems to destabilize p53 (Frattini, M. G. et al. (1997) EMBO J. 16, 318-331) The E7 protein binds to the suppressor protein of Rb tumor and the proteins related to Rb pl07 and pl30 (Dyson, N., et al. (1989) Science, 243, 934-937, Hu, T., et al. (1995) Int. J. Oncology 6, 167-174). The binding of E7 to Rb results in the release of E2F proteins from the Rb-E2F complexes and is also thought to lead to Rb for ubiquitin-dependent proteolysis (Boyer, SN et al. (1996) Cancer Res. 56, 4620-3624, Jones, DL and Munger, K. (1997; J. Virol., 71, 2905-2919, Virology, 239, 97-107). When released from Rb, members of the E2F family of transcription factors activate transcription of the genes required for S phase and overexpression of E2F-1 can induce apoptosis in serum-deprived cells (Wu X., and Levine, A. J. (1994) Proc. Nat '1 Acad. Sci. USA 91, 3602-3606, Qin. X. Q., et al. (1994) Proc. Nat 'l Acad. Sci. USA 91, 10918-10922). The repression of the transcription of E7 by E2, therefore, can be expected to reduce the levels of free E2F, causing a stoppage in the cell cycle (see attached Fig. 1). The expression of the E2 protein of PVB1 in HeLa cells is accompanied by a decrease in the level of .RNA of E2F-1 and protein, and by a reduced expression of the E2F-dependent genes (Hwang, ES et al. (1996) Oncogene, 12, 795-803). However, the expression of the E2 protein of HPV 16 in SiHa cells is accompanied by an increase in the activity of E2F (Sanchez-Perez, A.M. - et al. (1997) J. Gen. Virol. , 78, 3009-3018). In addition, overexpression of the E2 protein of HPV 31 in NHK cells is accompanied by an increase in the levels of E2F-1 mRNA (Frattini, M. G. et al., (1997) EMBO J. 16, 318-331). Another complication is that, unlike E2 of PVB1 which represses transcription, the E2 proteins of HPV 16 and HPV 18 have been shown to inhibit the transcription of oncogenes E6 and E7 of HPV 16 (Bouvard, V. et al. (1994) EMBO J. 13, 5451-5459, Kovelman, R., et al (1996) Virol, 70, 7549-7560). Any increase in E7 levels could be expected to result in an increase in free E2F levels and this, in turn, could lead to cell death (Sanchez-Perez, AM et al. (1997) J. Gen Virol. 78, 3009-3018). The models that seek to explain the effects of E2 proteins on cell proliferation through the repression or activation of transcription of genes E6 and E7 are obviously limited to cells positive for HPV. However, the E2 protein of HPV 31 appears to induce apoptosis in NHK cells negative for HPV (Frattini, M. et al. (1997) EMBO J. 16, 318-331) In addition, mutations in the HPV 16 RCL that block the binding of E2 to the proximal E2 promoter sites and prevent E2-mediated repression of the E6 and E7 transcription do not completely alleviate the negative effects - of the E2 on the efficiency of the transformation (Romanczuk, H., and Howley, M. (1992) Proc. Na t '1 Acad.

Sci. USA 89, 3159-3163). These reports suggest that E2 could influence cell proliferation independently of its effects on the transcription of E6 and E7. To address this issue, the E2 protein of HPV 16 was expressed in a variety of transiently transfected cell lines. It was demonstrated that this E2 protein can unexpectedly induce apoptosis both in cell lines transformed by HPV and in lines not transformed by HPV. In addition, it was shown that the E2-induced apoptosis of HPV 16 depends on p53 and that the ADljI binding activity of this E2 protein is not cell death. Publication of the International Patent WO 98/01148 (Harvard) discloses methods and compositions for interfering with the proliferation of cells infected and / or transformed by PV. There is no description of the use of E2 to kill PV-negative cells, the p53 status of cells, the induction of apoptosis in treated cells, or the generation of an immune response against PV. International Patent Publication WO 94/04686 (Biogen) describes a method for the distribution of proteins, including polypeptides E2 of HPV, to cells - based on the TA protein "of HIV The use of E2 to kill cells negative to HPV, the p53 status of the cells, the induction of apoptosis in the treated cells, or the generation of an immune response against PV is not described. International Patent Publication WO 92/12728 (Biogen) describes non-functional E2-derived polypeptides, specifically trans-activation repressors.

E2, which are dimerized with normal E2 and block its function in cells infected with HPV. The use of E2 to kill cé is not described; negative cells to PV, the p53 status of the cells, the induction of apoptosis in the treated cells, and the generation of an immune response against PV. International Patent Publication WO 98/32861 (Pasteur) describes methods and compositions for interfering with the proliferation of cells infected and / or transformed by PV. The use of E2 to kill PV-negative cells or the generation of an immune response against PV is not described, the use of E7 to kill cells is not described, and the use of any defective E2 protein in the binding of .DNA is not described. International Patent Publication WO 98/05248 (Bristol-Myers Squibb Company) describes the use of polypeptides corresponding to peptides expressed in mammalian cells in response to PV infection and where the peptides correspond to part of the E6 or E7 proteins. The use of E2 peptides and E2 DNA sequence to vaccinate against PA J infections or cervical cancer is not described.

In accordance with one aspect of the present invention, there is provided a method for inducing apoptosis of p53-negative wild type cells to PV, or p53 mutants or positive to the p5-related gene, comprising contacting these cells with an E2 protein. and / or E7 of PV, or a functional portion or a derivative thereof, or supplying to the cells a DNA sequence encoding an E2 and / or E7 protein of PV or a functional portion or derivative thereof In accordance with another aspect of the present invention, there is provided a method for killing PV positive cells, comprising contacting these cells with an E2 protein and / or E7 of PV or a functional portion or a derivative thereof, or supplying to the cells a DNA sequence encoding an E2 and / or E7 protein of PV or a functional portion or derivative of the same In accordance with another aspect of the present invention, there is provided a method for killing cells infected with a non-HPV oncogenic virus, which comprises contacting these cells with an E2 and / or E7 protein of PV or a functional portion or derivative thereof. same, or deliver to the cells a DNA sequence encoding an E2 and / or S7 protein of PV or a functional portion or derivative thereof.

Disagreement < In a further aspect of the present invention, there is provided a method for killing oncgenic or oncogenic precursor cells, comprising contacting these cells with a protein at E2 and / or E7 of PV or a functional or aerivate portion thereof. , or supplying the cells with a DNA sequence encoding an E2 and / or E7 protein of PV or a functional portion thereof or derived from it.

In accordance with another aspect of the present invention, there is provided a method for the treatment of cervical cancer, comprising contacting cervical cells of a subject with an E2 and / or E7 protein or a functional portion thereof, or supplying the cells with a DNA sequence encoding an E2 and / or E7 protein of PV or a functional portion of the same. Such a method is advantageous because an immune response against HPV can be produced by the E2 derivative in addition to causing the death of the cancer cells.

In accordance with another aspect of the present invention, there is provided a method for inducing apoptosis of PV-negative cells, comprising contacting these cells with a protein E2 and / or E7 of PV or a functional portion or derivative of the same and a wild-type p53 protein or a functional portion or derivative thereof.

In accordance with another aspect of the present invention, there is provided a method for inducing apoptosis of PV-positive cells, comprising contacting these cells with an E2 and / or E7 protein of PV or a functional portion or derivative thereof. and a type p53 protein wild or a functional portion or derivative thereof. Such a method is advantageous because an immune response against HPV can be produced by the derivative of E2.

In accordance with another aspect of the present invention, there is provided a method for inducing apoptosis of oncogenic PV cells, comprising bringing these cells into contact with an E2 and / or E7 protein of P? or a functional portion or derivative thereof and a wild-type p53 protein or a functional portion or derivative thereof.

In accordance with another aspect of the present invention, there is provided a method for inducing apoptosis of cervical cancer cells PV, comprising contacting these cells with a protein E2 and /} E7 of PV or a functional portion or derivative thereof and a wild-type p53 protein or a functional portion or derivative thereof, Such a method is advantageous because an unitary response against HPV can be produced by the derivative of E2.

In accordance with another aspect of the present invention, there is provided a method for inducing apoptosis of a? V-negative cells, comprising contacting these cells with a protein E2 and / or E7 of PV or a functional or derivative portion of the same and the wild-type p53 protein.

In accordance with another aspect of the present invention, there is provided a method for inducing apoptosis of PV-negative cells, comprising contacting these cells with a protein E2 and / or E7 of PV or a functional portion or derivative thereof. and a wild-type p53 protein and / or drugs that induce the production of wild-type p53 or the function of wild-type p53 in cells containing the p53 mutant. In accordance with another aspect of the present invention, there is provided a method for inducing apoptosis of negative PV cells, comprising contacting these cells with an E2 and / or E7 protein of PV or a functional portion or derivative thereof. and wild-type p53 In accordance with a further aspect of the present invention, there is provided a method for inducing apoptosis of PV-negative cells, comprising contacting these cells with a protein E2 and / or E7 of PV or a functional portion or derivative thereof and a wild-type p53 protein, and optionally agents that activate the function of p53 tjales as drugs that damage the .DNA or UV radiation, X-rays or other forms of radiation, E2 or E7 proteins or derivatives thereof can be supplied by viral methods eg, adenovirus, adeno-associated virus and poxvirus, or non-viral methods such as VP22, penetratin and liposomes . In this invention, the use of the E2 protein and functional derivatives or portions thereof are preferred, although the use of the E7 protein and functional derivatives or portions thereof, is also contemplated. The use of defective E2 derivatives of the .DNA binding is especially preferred in the methods according to the present invention, because they would neither allow nor participate in viral replication, but would continue to kill cells and induce an immune response. The E2 proteins of HPV 16, HPV 18 and PVBl affect the proliferation and / or survival of cell carcinoma cell lines (Sánchez-Pérez, A. M. et al. (1997) J.

Gen Virol. 78, 3009-3018, Desaintes, C. et ai. (1997) EMBO J. 16, 504-514, Hwang, E. S., et al. (1993) J. Virol. 67, 3720-3729). Previously we proposed that the E2 protein of HPV 16 induces apoptosis in transformed SiHa cells - with HPV 16, by activating the transcription of the viral E7 gene (Sanchez-Perez, A.M. et al. (1997) J. Gen. Virol, 78, 3009-3018). By contrast; others have proposed that the E2 protein of HPV 18 induces apoptosis in HeLa cells transformed with HPV 18, by repressing the transcription of the viral E6 and E7 genes (Desaintes, C, et al. (1997) EMBO J. 16, 504- 514). It has been shown that the E2 protein of HPV 16 induces apoptosis in several cell lines not transformed by HPV, which supports the demonstration that the E2 protein of HPV 3] appears to induce apoptosis in NHK cells negative for HPV (Frattini, MG et al. (1997) EMBO J. 16, 318-331 These data demonstrate that none of the above mechanisms can be entirely correct, either E2 protein induces apoptosis, independent of the HPV genome or these proteins induce apoptosis through of two routes: one that requires other proteins of HPV and one independent of the other proteins of HPV The E7 protein has been extensively studied, mainly as oncoprotein, but also as an inducer of apoptosis For example, it has been shown that E7 sensitizes keratinocytes to undergo spontaneous apoptosis and apoptosis in response to tumor necrosis factor a (Stoppler, H. et al (1998) Oncogene 17, 1207-1214). which suggests that apoptosis - induced by E7 occurs through p53-dependent and p53-independent pathways (Howes, KA et al. (1994) Genes and Dev. 8, 1300-1310 Pan. H. and Griep. AE (1994) Genes and Dev. 8 1285-129 ?, Stoppler, H. et al. (1998) Oncogene 17, 1207-1214). Here we show that in HeLa cells, overexpression of the E7 protein of HPV 16 induces apoptosis. The apoptosis induced by E7 can be abolished by overexpressing Qcn of the E6 protein of HPV 16 or by the expression of a trans-dominant negative mutation of p53. These results strongly suggest that the E7 protein of HPV 16 induces p53-dependent apoptosis in these cells. It has been demonstrated that, similar to E7, the E2 protein of HPV induces apoptosis in HeLa cells and that this apoptosis depends on p53. Protein E7 and E2 induce apoptosis in cells containing the E6 gene of HPV 16. Since E6 binds to p53 and this interaction results in a decrease in the half-life of p53, this could be remarkable. However, p53 activity has been demonstrated in several HPV-positive cell lines (Butz, K. et al. (L995) Oncogene, 10, 927-936, Desaintes, C, et al. (1997) EMBO J. 16, 504-514). It was demonstrated that the activity of binding to .DNA specifies the sequence of protein E2 of HPV 16 is not required for the induction of apoptosis in HeLa cells. In contrast, the N-terminal do, including the - Functional transcription is necessary for the induction of apoptosis by the proti ina E2 of HPV 16. Similar experiments with E2 heterodimers of PVBl and E2-TR of PVBl showed that two functional activation domains are necessary for the poor activation of the transcript (Barsoum, J et al (1992) J. Virol. 66, 3941-3945). Why two activation domains are essential for the E2 dimer for the activation of transcription or inducea, on apoptosis, is unknown until now. In short, it was shown that the E2 protein of HPV 16 causes apoptosis in the auseneia of other HPV gene products and that this apoptosis induced by E2 is p53 dependent. The integration of the HPV genome in the host chromosome and the consequent alteration of the E2 gene, removes this proapoptotic signal. since the integrated HPV sequences continue to produce the E6 and E7 proteins, these cells continue to proliferate and are likely to form cervical tumors. In the present description, the following expressions are used with the following non-limiting meanings, given by the explanation: 1) The term "positive V" means that a cell has been infected or transformed by PV and the term "negative PV" has the opposite meaning. 2) The terms; "Protein" and "polypeptide" are used interchangeably, although the term "protein" can generally be considered as a polypeptide of naturous origin! The functional derivatives of E2 or E7 are proteins or polypeptides having part of the biological function of E2 or E7, for example, the N-terminal transcription / replication domain of the E2 protein (amino acids 1 to 200) or the domain of C-terminal DNA binding of protein E (amino acids 279 to 365). The functional portions of E2 or E7 are peptides that have at least part of the native sequence of E2 or E7, respectively. Methods for inducing cell death and products in accordance with the present invention will now be described, by way of example only, with reference to the accompanying drawings, Figures 2 to 14, in which: Figure 2 shows the effect of the E2 of HPV 16 in HeLa cells. Figure 3A and 3B show the results of experiments using E2 and E7 to induce apoptosis in HeLa cells. Figure 4A-4C shows the results of experiments demonstrating that apoptosis induced by E2 and E7 is dependent on B > Figure 5A-5D shows that the results of the experiments demonstrating that the E2Ct truncated E2 protein mutated in N296, K299 and R304, folds and dimerizes, but does not bind to DNA. Figure 6 shows the results of experiments demonstrating that DNA binding is not required for the induction of apoptosis, but that the N-terminal transcription regulation domain is necessary. Figure 7A and 7B show the results of experiments that demonstrate that E2-E2Ct heterodimers do not induce apoptosis; and Figure 8 shows schematically the proteins used in the following experiments. Figure 9 shows the DNA and amino acid sequences of the E2 of HPV 16. Figure 10 shows the .DNA and amino acid sequences of the E2DBM of HPV. Figure 11 shows the DNA and amino acid sequences of E2Ct. Figure 12 shows the DNA and amino acid sequences of E2CtDBm. Figure 13 shows that a VP22-E2 fusion protein induces apoptosis in HeLa cells, - - Figure 14 shows responses of E2 specific T cells of HPV 16. Experimental Procedures - General a. Plasmids Plasmids pCB6 + p53 and pCB6 + p53173L express wild type and mutant p53, respectively, and were supplied by Dr. Moshe Oren and Dr. A. Phillips, Plasmid pCMX-GFP3 expresses a green fluorescent protein and was supplied by Dr. Jeremy Tavaré. Plasmid pWEB was prepared by removing an Xhol-? CoRI fragment carrying the CMV promoter from plasmid pUHD 15-1 and using this fragment to replace the inducible tetracycline promoter in pUHD 10-3. The E2 expression plasmids (Fig. 9 E6 and E7 of HPV 16 were produced by cloning the appropriate HPV sequences obtained from genomic DNA of HPV 16, in a £ coRI site of plasmid pWEB, immediately downstream of the CMV promoter. The E2 gene was amplified by a Polymerase Catalyzed Chain Reaction (PCR) (94 ° C for 1 minute, 53 ° C for 3 minutes and 72 ° C for 1 minute, cycles) of the DNA template of HPV 16, using the oligonucleotide primers E25 '5' CTACGAATTCATGGAGACTCTTTGCCAACG 3 'and E23' 5 'GATAGAATTCTCATATAGACATAAATCCAG 3'. These primers place - EcoRI restriction sites (highlighted in bold type) at the 5 'and 3' ends of the E2 coding sequence. The PCR product was cloned into the £ coRI site of plasmid p'r? EB and sequenced using a panel of E2-specific sequencing primers, to verify the presence of any point mutation. The E6 gene was amplified by PCR (95 ° C for 1 minute, 52 ° C for 1 minute and 68 ° C for 2 minutes, for 30 cycles) of the template of HPV 16, using the primers E65 '5' TGAGAATGCATGCACCAAAAGAGAACTGCAATGTTTCAG 3 ' and E63 '5' ATCGAATTCTTACAGCTGGGTTTCTCTACG 3 ', which have £ coRI sites. The PCR product was cloned into the EcoRI site of the pWEB plasmid and sequenced using a panel of E6-specific sequencing primers. The E7 gene was amplified by PCR (94 ° C for 1 minute, 54 ° C for 2 minutes and 72 ° C for 1 minute, cycles) of the plant. The one of HPV 16, using the primers E75 '5' TCGGAATTCATGCATGGAGATACACCTAC 3 'and E73' 5 'AGCGAATTCTTATGGTTTCTGAGAACAGATGG 3', which have EcoRI sites. The PCR product was cloned into the pWEB plasmid and sequenced using E7 PCR primers. E2 mutated constructs were generated by PCR. The plasmid;? WEB-E2DBDm expresses a mutated E2 protein in which three amino acids within the domain of - DNA binding of E2 (N296, K299 and R304) were replaced by alanines. Mutations were introduced by PCR (94 ° C for -1 minute, .55 ° C for 1 minute and 68 ° C for 1 minute, for 30 cycles) using the primers pWEB5 'ACCTCCATAGAAGACACCGGG E2m CGACACTGCAGTATACAATGTACAATGCTTTTTAAATGCATATCTTAAACAT GCTAAAGTAGCAGCATCACC 3' with the plasmid pWEB-E2 as template. The bases in italics do not match the E2 gene and introduce the mutations. The PCR product contains a PstI site (rested in bold type) at its 3 'end. This site and a SstI site located within the CMV promoter, were used to replace the wild type E2 sequence in the plasmid pWEB-E2 by the mutated E2DBDm sequence. The entire PCR product was sequenced using a panel of E2-specific sequencing primers, to verify the presence of any unwanted mutation. Plasmid pWEB -E2Ct expresses a truncated E2 protein lacking the N-terminal amino acids of the E2 protein, from positions 1 to 279, but dimerizes are normally bound to .ADN (ewis, H. and Gaston, K. (1999) J. Mol. Biol. 294: 885-896). To create this mutant, 16 HPV sequences were amplified between the base pairs 3592 and 3852 by CPR (94 ° C for 1 minute, 55 ° C for 1 minute and 68 ° C for 1 month, for 30 cycles), using - the primers E2Ct5 'GAAACAGAATTCATGAACTGTAATAGTAACACTACACCC 3' and E23 'with the plasmid pWEB-E2 as plan; These primers place £ coRI restriction sites highlighted in bold letters) at both ends of the product and introduce an ATG translation start codon (highlighted in italics). The PCR product was cloned into the £ coRI site in the pWEB plasmid and sequenced using specific E2 primers. The plasmid pWEB-E2CtDBDm expresses a defective version of binding to the .DNA of the truncated protein E2Ct. This plasmid was produced in exactly the manner described for pWEB-E2Ct, except that the plasmid pWEB-E2DBDm (the one comprising the full-length E2 with the mutations N296A, K299A and R304A) was used as a template in the PCR reaction. Amino acid 86 of the protein E2Ct (Fig. 11) and of the protein E2CtDBDm ([Fig. 12) were expressed in XLl-blue cells of Escheri Ichia coli, using the expression vector pKK223-3 (Pharmacia Biotech). The coding sequences of E2Ct and 2CtDBDm were excised in the form of £ coRI fragments of the JS plasmids pWEB-E2Ct and pWEB-E2CtDBDm, respectively, and cloned in a single site .EcoRI downstream of the Ptac promoter from plasmid pKK223-3.

Inserts were sequenced using specific primers of E2 and pKK223-3.

- Plasmid pVP22-E2 was created by cloning the E2 open reading frame of full HPV 16 into the multiple cloning site of plasmid pVP22 / Myc-His (Invitrogen) in frame with the open reading frame of VP22. The insert was sequenced using specific primers of pVP22 / Myc-His. b. Protein Purification and Circular Dichroism Spectroscopy E. coli XLl-blue cells (Stratagene) containing pKK-E2Ct or pKK-E2DBDm, were grown to OD600 optical density nn 0.5. Then the expression of the protein was induced with 1 mM IPTG and the cells were incubated at 37 ° C overnight. Cells were harvested by centrifugation, resuspended in 50 mM Tris-Acetate-AEDT buffer solution (pH 7.5) containing 1 mM MgCl 2 and 1% 2-mercaptoethanol, and then broken by sonication at 4 ° C. The cell lysate was purified by centrifugation (15,000 g for 30 minutes at 4 ° C) and then incubated with 0-1% DNAse I for 30 minutes at 20 ° C. The cell extract was dialyzed for 3 hours against a 50 mM phosphate buffer solution (pH 5.7) containing 1% 2-mercaptoethanol and then centrifuged again. The supernatant was loaded onto a medium S-Sepharose cation exchange column equilibrated with 50 mM phosphate buffer (pH 5.7) containing - DTT 10 mM. After washing with 50 column volumes of phosphate buffer, the E2 protein was eluted using a linear gradient of 0.2-1M NaCl in the same buffer, in a volume of 500 mL (at a rate of 1 mL / .minute) . Protein peaks (detected by A nm) were collected and analyzed by Polyacrylamide Gel Electrophoresis with Sodium Dodecyl Sulfate (SDS-PAGE) and geil retardation assays (data not shown. Mixed E2 fractions were dialyzed against 10 volumes of solution 50 mM phosphate buffer (pH 5.7) containing 10 mM DTT for three hours and then applied to an HR 16/10 cation exchange FFLC column equilibrated with the nisma buffer.The E2 protein was eluted with a NaCl gradient from 0.1 to 1M and dialyzed against sodium phosphate buffer mM (pH 7.9) containing 1 mM DTT, for 3 hours before freezing and storage at -70 ° C. The isoelectric points (pl) and the molecular weight values were determined from the amino acid sequences of wild type E2 proteins (pl 9.7, Mr 10016.6) and mutant (pl 9.4; Mr 9831.4) using the "Expasy Tools" package " The molecular weights were confirmed in a VG Quattro quadrupole mass spectrometer with ionization by electrobraking. Structural integrity was confirmed using distant circular dichroism spectroscopy - d. Cell Culture and Transfections Cells SiHa, C33a, Saos-2, MCF-7 and COS-7 were maintained in Dulbecco's modified Eagle's medium (DMEM: Sigma) supplemented with 10% Bovine Fetal Serum (SFB: Sigma) and penicillin (100 000 U / liter) and streptomycin (100 mg / liter). NIH 3T3 cells were maintained in DMEM medium supplemented with 10% Calf Serum (ST: Sigma) and penicillin / streptomycin. HeLa cells were maintained in Minimum Essential Medium (MEM: Sigma) supplemented with 10% FBS, 2 mM L-glutamine and penicillin / streptomycin. 866, 873, 877, 915 and 808F cells were maintained in DMEM medium supplemented with 5% FBS penicillin / streptomycin, 2-mM L-glutamine, 5 μg / mL insulin, 0.01 μg / mL EGF, 0. 01 μg / mL of cholera toxin 0.4 μg / mL of hydrocortisone. All cells were maintained at 37 ° C in an atmosphere of 5% CO ?. Before the transient transaction, the cells were inoculated at a rate of 3 x 10 5 cells per well in 6 well plates with cover and incubated overnight to obtain a subconfluent culture. Reagents based on Tfx-50 liposomes for SiHa cells and NIH-3T3 cells, and Tfx-20 for all other cell lines (Promega), were used at :: 3: 1 liposome / DNA 1 L of free serum of culture medium, by transfection, in accordance with the instructions of the manufacturer. - transfected and transfected cells that underwent apoptosis, was determined in continuous, The percentage of apoptotic HeLa cells observed after transient transfection with plasmids expressing E2 and E7, is shown in Figure 2. In each experiment, approximately 5% of the untransfected cells and approximately 5% of the cells transfected with the empty vector pWEB, were apoptotic. Both E2 and E7 expression plasmids significantly increased the levels of apoptosis in the transfected population (Fig. 3a and Fig. 3b, respectively). Apoptotic cells in the transfected and non-transfected populations were identified in the manner shown in Figure 2 Transfection was performed in duplicate and repeated three times. These data demonstrate that the E2 and E7 proteins of HPV 16 induce apoptosis in HeLa cells. Later it was determined if these proteins could induce apoptosis in other cell lines, 3. E2 and E7 induce apoptosis in cell lines transformed by HPV and not transformed by HPV. The capacity of the E2 and E7 proteins of HPV 16 was tested to induce apoptosis in 6 cell lines transformed by HPV and in 4 cell lines not transformed by HPV. The results of this comparison - murine fibroblasts and a human mammary carcinoma cell line, respectively. Thus, the E2 protein is able to induce apoptos: .s in cellular lines negative for HPV. Another surprising feature of these results is that all cell lines induced to undergo apoptosis by E2 were also induced to undergo apoptosis by the E7 protein. Similarly, cell lines that are not sensitive to E2 expression are also not sensitive to E7 expression. Thus, the E2 and E7 proteins induce apoptotic cell death by the same route, or by routes that converge at the same point. All cell lines that were observed to undergo apoptosis in response to E2 or E7 expression are thought to contain wild-type p53. For example, NIH3T3 cells contain wild-type p53 and can undergo p53-dependent apoptosis (Chirillo, P. et al (1997) Proc. Nat'l \ Acad. Sci. USA 94, 8162-8167) In contrast, C33a cells contain mutated p53 (Crook, T., et al. (1991) Oncogene, 6 873-875) and Saos-2 cells are null for p53 and both cell lines do not undergo apoptosis in response to proteins. E2 or E7. To determine whether the p53 protein plays a role in cell death induced by E2 and / or E7, we proceeded to observe the effects of a transverse negative p53 mutant. - several cell lines not transformed by HPV (Table 1). These data imply that E2 does not kill cells simply by activating transcription of the E7 protein. To confirm this hypothesis, three point mutations were placed in the .ZDN binding site of the E2 protein (DBD) in positions that were known to be important for protein-DNA interactions. The crystalline structures of the E2 DBD of PVH 16 and the E2 DBD complex of PVB1-.DNA suggest that the amino acids N296, K299 and R304 in the DBD E2 of HPV 16 are critical for the recognition of the specific binding sites of E2 (Hegde, RS and Androphy, EJ (1998) J. Mol. Biol. 284, 1479-1489, Hegde, R. S. et al. 1992) Nature, 359, 505-512). Using site-directed mutagenesis, these three amino acids were replaced by alanines. Mutations were introduced in the context of both the full length E2 protein and the .AD? Binding domain. of the E2 protein only, to establish ie these mutations abolish the activity of binding to the .AD? without altering the overall conformation of the E2 DBD protein, both wild-type DBD and mutated DBD were expressed: n bacteria. Plasmid pKK-E2Ct expresses a truncated E2 protein (amino acids 280 to 365) that can be dimerized and bind normally to .AD? (Lewis, H. and Gaston K (199) J. Mol. Biol., 294: 885-896).

- Plasmid pKK-E2CtDBDm expresses the equivalent E2 fragment containing mutations N296A, K299A and R304A. The E2Ct and E2CtDBDm proteins were purified from bacteria carrying the respective plasmids (Fig. 5a). Specifically, in Fig. 5 (a) experimental samples of the purified E2Ct and E2CtDBDm proteins were analyzed by SDS-PAGE. The sizes of the markers used are indicated in the Figure. In Figure 5 (b) and (c) the circular dichroism was used to show that the presence of mutations N296, K299 and R304 did not affect the conformation or dimerization of the E2CtDBDm protein. In the F: f.g. 5 (d) Increasing amounts (10, 50 and 250 nM, respectively) of E2Ct lanes 2-4) or of E2 (!: TDBDm (lanes 5-7) were added to the labeled oligonucleotides bearing the E2-binding site 1 of the genome of HPV 16: E2 (l) .The free DNA and the bound DNA were separated in a 6% polyacrylamide gel and visualized by autoradiography.The complex E2Ct-E2 (l) is indicated by an arrow. circular (DC), subsequently, was used to test whether the presence of mutations altered the conformation or dimerization of the E2DBD protein.The DC spectra for the E2Ct and E2CtDBDm proteins (Fig. 5b and 5c) are very similar. implies that mutations have little or no effect - apoptosis in HeLa cells, the activation domain of N-terminal transcription is essential. To confirm and extend these conclusions, we proceeded to observe the heterodimer capacity of E2 to induce cell death. 6. Two functional N-terminal domains are required for cell death induced by E2. The E2 proteins of PVBl and E2-TR were previously shown to form heterodimers (Barsoum, J. et al (1992) J. Virol. 66, 3941-3945). Although it is reported that these heterodimers bind to DNA in vi tro, they can not activate transcription in intact cells (Barsoum, J. et al (1992) J. Virol., 66, 3941-3945). In view of this, we proceeded to determine if the E2 and E2Ct proteins of HPV 16 would form heterodimers and whether these heterodimers would be able to induce cellular death. To check whether the heterodimers could be formed in vi tro or not, a fixed amount of wild-type E2Ct was mixed with increasing amounts of the defective DNA-binding protein E2CtDBDm. The ns amounts of E2Ct and E2CtDBDm indicated in Figure 7a were mixed and then denatured in 3M urea to facilitate the exchange of subunits. After conformation or renaturation by dilution in 0.1 M urea, the proteins were added to labeled oligonucleotides carrying the binding site of _ia ^ »ßg ß - E2 of HPV 16: E2 (l). The free and the .DNA were separated in a 6% polyacrylamide gel and visualized by autoradiography. The E2Ct-E2 complex (l) is indicated by an arrow. The renatured E2Ct protein binds to a labeled oligonucleotide carrying an E2 site, while the renatured E2CtDBDm protein has no DNA binding activity (Fig. 7a, C.rriles 3 and 4, respectively). By adding increasing amounts of E2CtDBDm to a fixed amount of E2Ct, a gradual decline in the binding activity to the .ADN Fig. 7a, lanes 5-8) was obtained. These data demonstrate that at least in this in vitro assay, these E2 proteins can form heterodimers. To investigate the formation of heterodimers in intact cells, HeLa cells transiently transfected with pWEB-E2 and increasing amounts of the plasmid pWEB empty (white squares), pW? LB-E2Ct and increasing amounts of pWEB (black circles) or pWEB-E2 and increasing amounts of pWEB-E2Ct (black boxes). The apoptotic cells were identified in the manner indicated in Figure 2 and the transfection was performed by duplicate and repeated three times. Plasmid pWEB-E2 induced high levels of cell death in the transfected population, whereas plasmid pWEB-E2Ct had no effect (Figure 7b). However, as increasing amounts of the pWEB-E2Ct plasmid were added to a transfection mixture that - contained pWEB-E2, the percentage of apoptotic cells in the transfected population declined and eventually reached background levels (Figure 7b). Increasing amounts of the plasmid pWEB-E2CtDBDm also decreased the level of cell death induced by pWEB-E2, while increasing amounts of pJWEB had no effect (data not revealed) . These data suggest that heterodimers containing E2 and E2Ct are formed in intact cells and that these heterodimers are incapable of inducing apoptosis. Thus, it seems that the E2 dimer requires two functional N-terminal domains in order to induce cell death. 7. A VP22-E2 fusion protein can induce apoptosis. The Herpes Simplex Virus type 1 (HSV-1) VP22 protein is a 38 kDa protein found in the virion tegument region, between the capsid and the envelope. When expressed in a transiently transfected cell, the VP22 protein is transported to the cytoplasm and then exported from the cell through a non-classical secretion mechanism. Subsequently, the protein enters the surrounding cell5 with a very high efficiency and is located in the nucleus by a mechanism that depends on the cytoskeletal actin. Once inside the nucleus, VP22 binds to the chromatin and is secreted in the daughter cells. The transport of VP22 between cells is so efficient that prctein can enter all the cells of a transfected monolayer (Elliott, G and O 'Hare, P (1997) Cell 88: 223-233) In order to clone the ORF of E2 in the VP22 vector (Invitrogen) in the correct reading frame, was first removed from the pWEB-E2 plasmid and inserted into the multiple cloning site of the pBluescript II KS plasmid (Stratagene) in the form of a £ coRI fragment. Then, this construct was digested with EcoRV and BamHI and the resulting E2 fragment was inserted into the multiple cloning site pVP22. The sequence analysis of .DNA was carried out using specific primers for both pVP22 and E2. The plasmids pVP22-E2, pVP22 and pWEB-E2 were cotransfected in HeLa cells with pCMX-GFP3 and the percentage of apDptotic cells in the transfected and untransfected populations was determined exactly in the manner previously described. After transient transfection with ppVP22-E2, the percentage of apoptotic cells was increased to approximately 30% (Figure 13). In contrast, plasmid pVP22 had no effect on the level of apoptosis. These data demonstrate that the VP22-E2 fusion protein is capable of inducing apoptosis in HeLa cells. - 8. E2 and the immune response E2 and the immune response. The anti-HPV Previous data agree with a possible role of E2 in the immunity to control HPV infections in cervical cancer and premalignant diseases related to HPV (Rocha-Zavaleta et al., (1997) Bri t.

J. Cancer, 75, 1144-1150). The immunity induced against E2 could be protective and, in principle, could be targeted in the early stages of viral expression in the basal / parabasal cells of the cervical epithelium. Stimulation of local prolonged mucosal immunity would have the advantage over capsid-based vaccines to remove cells with .DNA in episomal form. Cells with episomal HPV DNA could form the mixture (latent state) from which subsequent integration events could occur (an increased risk for progression). Positivity to PV in women can be approximately 39% in sexually active women between 15 and 25 years of age. This decreases drastically with age and supports the view that there is an acquired immunity against. infection. The prospect of local administration of an immunogenic E2 protein or a modified E2 protein that could activate an apoptosis pathway, would represent a complementary attack on any cervical lesion with - therapeutic and preventive components. This would be relevant for high risk and low risk viral infection, including genital warts and others. One interesting possibility is that the immunogenicity of the E2 protein can be enhanced by being bound to its white DNA. This complex could distribute unique epitopes that would be recognized by the immune response in a natural cleansing. It has been shown that the responses of helper T cells against the E2 pRotein of HPV 16 seems to correlate with the clearance of viral infections, emphasizing the potential of this protein as a therapeutic prophylactic immunological target (Bontkes, H. J et al., ( 1999), Gen. Virol. 0: 2453-2459). Currently trials have been developed to measure the responses of E2-specific T cells of HPV 16, using interferon? ELISPOT. Figure 14 shows evidence of memory T cells versus E2 of HPV 16 in donor 1, but not in donor 2 However, prolonged exposure to the C-terminal fragment of the E2 protein of HPV 16 with analogous dendritic cells prepared from peripheral blood monocytes, is capable of generating primary activation of specific T cells. Dendritic cells (CDs) have been prepared from adherent peripheral blood mononuclear cells, in a medium

Claims (1)

1. - .DNA sequence coding for an E2 protein of PV or a functional portion or derivative thereof, whereby the cells die. 4. A method for inducing apoptosis of cells negative for PV or positive for PV, characterized in that it is attempted to contact these cells with an E2 protein of PV or a functional portion or derivative thereof and the wild type p53 protein or a functional portion or derivative thereof, whereby apoptosis is induced in the cells. 5. A method for inducing apoptosis in oncogenic cells, characterized in that it comprises contacting these cells with an E2 protein of PV or a functional portion or derivative thereof and a wild type p53 protein or a functional porbion or derivative of it, whereby apoptosis is induced in the cells. 6. A method for inducing apoptosis of cervical cancer cells positive for PV, characterized in that it comprises contacting these cells with an E2 protein of PV or one per functional ion or derivative thereof and the wild-type p53 protein or a functional portion or derivative thereof, whereby apoptosis is induced in the cells. 7. A method to induce apoptosis of - according to any of claims 1 to 6, characterized in that it comprises contacting the cells with a) an E2 protein of PV and b) a wild type p53 protein and / or drugs or pharmaceutical compositions that induce production of the p53 protein of wild-type or the function of the wild-type p53 protein in cells that co-have mutant p53. A method for inducing apoptosis in human papillomavirus negative (HPV) cells according to any of claims 1 to 5, characterized in that it comprises contacting the cells with an E2 protein of PV and at least one agent that activates the function of the p53 protein. 9. A method according to any of the preceding claims, characterized in that a substantial proportion of 1 s cells of a population of treated cells die. 10. A method according to any of claims 4 to 9, characterized in that the cells are infected with HPV. 11. A method according to claim 10, characterized in that the cells are transformed by HPV 12. A method according to any of claims 10 or 1, characterized in that the HPV claim 31, characterized in that the other protein or portion thereof is fragment C of the tetanus toxoid. 33. A method according to any one of the preceding claims, characterized in that a DNA sequence encoding a portion or derivative of E2 is used in which the portion or derivative has a defect in DNA binding compared to E2. of wild type. according to any of the preceding claims, characterized in that the E2 protein or functional portion or derivative thereof is complexed with DNA. 35-. A method according to any one of claims 1 to 34, characterized in that the E2 derivative of PV is an E2 derivative defective in DNA binding, comprising an amino acid sequence of E2 lacking the C-portion or portions. terminals of the native E2 sequence. 36, A method according to claim 35, characterized in that the E2 derivative of PV is an E2 derivative defective in DNA binding according to claim 35, comprising an E2 sequence in which the last 86 are missing. amino acids of the native E2 protein 37 A method of conformance with any of to. - - claims 35 or 36, characterized in that the derivative of E2 of PV is u? E2 derivative defective in the binding to the .ADN, which comprises a sequence of E2 in which there are missing the amino acids 296, 299 and 304 of the native E2 protein, 38. A homodimer characterized in that it comprises a derivative of E2 defective in the junction to DNA comprising an amino acid sequence of E2 which lacks the C-terminal portion or portions of a native E2 sequence; or a defective E2 derivative at the junction.ADN according to claim 35, comprising an E2 sequence in which the last 86 amino acids-s of the native E2 protein are missing; or an E2 derivative defective in the binding to the .ADN comprising an E2 sequence in which amino acids 296, 299 and 304 are missing from the native E2 protein, 39, A heteromer characterized in that it comprises a derivative of E2 defective in the an .DNA binding comprising an amino acid sequence of E2 that lacks the C-terminal portion or portions of a native E2 sequence; or an E2 derivative defective in conforming DNA binding to claim 35, comprising an E2 sequence in which the last 86 amino acids of the native E2 protein are missing; or an E2 derivative defective in DNA binding comprising lia.-a.-j44 ..