MXPA01012385A - Angiogenic proteins and uses thereof. - Google Patents

Abstract

Disclosed are human angiogenic polypeptides, biologically active, diagnostically or therapeutically useful fragments, analogs, or derivatives thereof, and DNA(RNA) encoding such angiogenic polypeptides. Also provided are procedures for producing such polypeptides by recombinant techniques and antibodies, agonists and antagonists against such polypeptides. Such polypeptides and polynucleotides may be used therapeutically for stimulating wound healing and for vascular tissue repair. Also provided are methods of using the antibodies and antagonists to inhibit tumor angiogenesis and thus tumor growth, inflammation, diabetic retinopathy, rheumatoid arthritis, and psoriasis. Further provided are methods of using the antibodies and agonists to promote angiogenesis and lymphangiogenesis. The antagonists may also be used to treat chronic inflammation caused by increased vascular permeability. In addition to these disorders, the antagonists may also be employed to treat retinopathy associated with diabetes, rheumatoid arthritis and psoriasis. The agonists and/or antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.

Description

? .

ANGIOGENIC PROTEINS AND USES THEREOF BACKGROUND OF THE INVENTION 5 FIELD OF THE INVENTION The present invention relates to angiogenic proteins, and to agonists or antagonists of angiogenic proteins. The invention also relates to methods of 10 selection to identify agonists and antagonists of the activities of angiogenic proteins.

TECHNICAL BACKGROUND 15 The formation of new blood vessels, or angiogenesis, is essential for embryonic development, subsequent growth and tissue repair. Angiogenesis is also an essential part of certain pathological conditions, such as neoplasia (ie, 20 tumors and gliomas) Abnormal angiogenesis is associated with other diseases such as inflammation, rheumatoid arthritis, psoriasis and diabetic retinopathy (Folkman, J., and Klagsbrum, M., Science 235: 442-447 (1987)).

REF: 134294 Fibroblast growth factor molecules, both acidic and basic, are mitogenic for endothelial cells and other cell types. Angiotropma and angiogenin can induce angiogenesis, although their functions are unclear (Folkman, J., Cancer Medicine, Lea and Feiber Press, pp. 153-170 (1993)). A highly selective mitogen for vascular endothelial cells is vascular endothelial growth factor or VEGF (Ferrara, N. et al., Endocr. Rev. 13: 19-32 (1992)), which is also known as vascular permeability factor (VPF). Endothelial growth factor is a secreted angiogenic mitogen whose specificity towards target cells seems to be restricted to vascular endothelial cells. The mouse VEGF gene has been characterized and its expression pattern in embryogenesis has been analyzed. Persistent VEGF expression was observed in epithelial cells adjacent to the fenestrated endothelium, for example, in the choroidal plexus and in the renal glomeruli. The data are consistent with a role of VEGF as a multifunctional regulator of the growth and differentiation of edelothelial cells (Breier, G. et al., Development 114: 521-532 (1992)).

VEGF shares sequence homology with growth factors derived from human platelets, PDGFa and PDGFb (Leung, D., et al., Science 246: 1306-1309, (1989)). The degree of homology is approximately 21% and 23%, respectively. Eight cysteine residues that contribute to the formation of disulfide bridges are strictly conserved in these proteins. Although these are similar, there are specific differences between VEGF and PDGF. Although PDGF is a major growth factor for connective tissue VEGF is highly specific for endothelial cells. Alternatively, spliced mRNA molecules have been identified for both VEGF, PLGF and PDGF and these different splicing products differ in biological activity and in their specific character of receptor binding. VEGF and PDGF function as homo-dimers or heterodimers and bind to receptors that exhibit intrinsic tyrosine kinase activity after receptor dimerization. VEGF has four different forms of 121, 165, 189 and 206 amino acids due to alternative splicing. VEGF121 and VEGF165 are soluble and can promote ang? Ogenesis, while VEGF189 and VEGF206 bind to proteoglycans containing heparin on the surface . & á * íjíi- * • * - '*. Írr * r-J * lm cellular. The temporal and spatial expression of VEGF has been correlated with the physiological proliferation of blood vessels (Gajdusek, CM, and Carbon, SJ, Cell Physiol., 139: 570-579 (1989); McNeil, PL, et al., J. Cell Biol. 109: 811-822 (1989)). Their high affinity binding sites are located only on endothelial cells in tissue sections (Jakeman, L.B., et al., Clin Invest, 89: 244-253 (1989)). The factor can be isolated from pituitary cells and from various tumor cell lines, and has been implicated in some human gliomas (Plate, K.H., Nature 359: 845-848 (1992)). As an interesting aspect, the expression of VEGF121 or VEGF165 confers Chinese hamster ovary cells the ability to form tumors in nude mice (Ferrara, N. et al., J. Clin.Perse 91: 160-170 (1993 )). It was shown that inhibition of VEGF function mediated by anti-VEGF monoclonal antibodies inhibits tumor growth in mice with a deficient immune system (Kim, K.J., Nature 362: 841-844 (1993)). In addition, it has been shown that a dominant-negative mutant of the VEGF receptor inhibits the growth of glioblastomas in mice. - It was also discovered that vascular permeability factor (VPF) is responsible for persistent microvascular hyperpermeability to plasma proteins even after cessation of damage, which is a common feature of normal wound healing. This suggests that VPF is an important factor in wound healing. Brown, L.F. et al., J. Exp. Med. 176: 1375-1379 (1992). VEGF expression is elevated in vascularized tissues (eg, lung, heart, placenta and solid tumors) and correlates with angiogenesis both temporally and spatially. It has also been shown that VEGF induces angiogenesis in vivo. Because angiogenesis is essential for the repair of normal tissues, especially vascular tissues, the use of VEGF has been proposed to promote repair of vascular tissue (for example, atherosclerosis). The patent E.U.A. No. 5,073,492, issued December 17, 1991 to Chen et al., Discloses a method for synergistically improving the growth of endothelial cells in an appropriate environment comprising adding to the environment, VEGF, effectors and serum derived factor. In addition, the DNA of the C subunit of vascular endothelial cell growth factor was prepared by polymerase chain reaction techniques. DNA encodes a protein that could exist either as a heterodimer or as a homodimer. The protein is a mitogen of mammalian vascular endothelial cells, and, as such, is useful for promoting vascular development and repair, as described in European Patent Application No. 92302750.2, published September 30, 1992. Recent additions to the vascular endothelial growth factor family include VEGF 3, VEGF-D, and VEGF-E. VEGF-3 growth factors are strong mitogens that promote the proliferation of vascular endothelial cells and / or mesoderm, as described in International Publication No. WO 96/39421, published December 12, 1996 for Hu et al. . VEGF-D is another element of the vascular endothelial growth factor family, and has the ability to stimulate and / or improve the proliferation or differentiation of endothelial cells, as described in international publication No. WO 98/07832 , published on February 26, 1998. More recently, Meyer et al. published a new element of the vascular endothelial growth factor family, naming it VEGF-E. VEGF-E is a potent angiogenic factor that binds selectively to VEGF receptor-2 (KRD) (Meyer et al., EMBO J, 18: 363-374 (1999)). Therefore, there is a need for treatments that promote or inhibit angiogenic proteins.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to members of the VEGF / PDGF families of proteins, and related proteins, collectively preferred in the present invention as "angiogenic proteins" or "angiogenic polypeptides", as well as agonists and / or antagonists of angiogenic proteins. . In accordance with a further aspect of the present invention, methods are provided for using such polypeptides or polynucleotides that encode such polypeptides for therapeutic purposes, for example, to stimulate angiogenesis, wound healing, the growth of damaged bones and tissues, and to promote repair of vascular tissue. In particular, methods for using such polypeptides or polynucleotides encoding such polypeptides are provided for the treatment of peripheral arterial disease, such as critical limb ischemia and coronary heart disease. In accordance with even another aspect of the present invention, agonists are provided for such polypeptides, which could be used to enhance the action of such polypeptides, for example, to promote angiogenesis, lymphoangiogenesis, or to promote repair of vascular tissue. The present invention also relates to variants of the polypeptides described above in the present invention which code for antigenic or immunogenic epitopes of the polypeptides. In accordance with even another aspect of the present invention, agonists are provided for such polypeptides, which could be used to enhance or promote the action of such polypeptides, for example, to prevent tumor angiogenesis and thus inhibit the growth of tumors, to treat diabetic retinopathy, inflammation, rheumatoid arthritis and psoriasis. In accordance with even another aspect of the present invention, agonists are provided for such polypeptides, which could be used to enhance the action of such polypeptides, for example, to promote angiogenesis, lymphoangiogenesis, or to promote repair of vascular tissue. ? In accordance with even another aspect of the present invention, antibodies against such polypeptides and methods for producing such antibodies are provided. In accordance with even a further aspect of the present invention, methods are provided for using such antibodies for therapeutic purposes, for example, to stimulate angiogenesis, wound healing, growth of damaged bones and tissues, to promote repair of vascular tissue, and to stimulate lmfoangiogenesis. In particular, procedures are provided for using such antibodies for the treatment of diseases of critical limb ischemia and coronary heart disease. In accordance with even another aspect of the present invention, antagonists are provided for such polypeptides, which could be used to inhibit the action of such polypeptides, for example, to prevent tumor angiogenesis and thus inhibit tumor growth. , to treat diabetic retinopathy, inflammation, rheumatoid arthritis and psoriasis. In accordance with one aspect of the present invention, novel mature polypeptides, as well as biologically active and useful fragments are provided in 2 ^ x .Xé ^ ¡& rz diagnosis or therapy, analogs and derivatives thereof. The polypeptides of the present invention are of human origin. In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules comprising the polynucleotides encoding the full-length or truncated angiogenic polypeptides having the amino acid sequences shown in Table 1. The present invention also relates to to fragments, analogs and derivatives of biologically active angiogenic proteins and useful for diagnosis or therapy. In accordance with even another aspect of the present invention, methods for producing such polypeptides are provided by recombinant techniques comprising culturing recombinant prokaryotic and / or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions that promote the expression of said proteins and the subsequent recovery of said proteins. In accordance with another aspect of the present invention, nucleic acid probes are provided which comprise nucleic acid molecules of sufficient length to hybridize specifically to the nucleic acid sequences of the present invention. In accordance with another aspect of the present invention, methods are provided for diagnosing diseases or I susceptibility to diseases related to mutations in the nucleic acid sequences of the present invention and the proteins encoded by said nucleic acid sequences. In accordance with even a further aspect of the present invention, there is provided a method for using such polypeptides, or polynucleotides that encode such polypeptides, for purposes related to scientific research, DNA synthesis, and the manufacture of vectors. DNA In accordance with even another aspect of this invention, methods are provided for screening for angiogenic protein agonists and / or antagonists that could enhance or inhibit the desired activity. These and other aspects of the present invention should be apparent to those skilled in the art from the teachings of the present invention.

BRIEF DESCRIPTION OF THE FIGURES The following figures are illustrations of embodiments of the invention and are not intended to limit the scope of the invention as encompassed by the claims. Figures 1A-1E show the full-length nucleotide (SEQ ID NO: 15) and the deduced amino acid sequence (SEQ ID NO: 16) of VEGF2. The polypeptide comprises approximately 419 amino acid residues of which approximately 23 represent the leader sequence. The standard abbreviation of a letter for amino acids is used. Sequence determination was performed using the automated DNA sequence analyzer model 373 (Applied Biosystems, Inc.). The accuracy of the sequence determination is predicted to be greater than 97%. Figures 2A-2D show the nucleotide sequence (SEQ ID NO: 25) and the deduced amino acid sequence (SEQ ID NO: 26) of a truncated biologically active form of VEGF2. The polypeptide comprises approximately 350 amino acid residues of which approximately the first 24 amino acids represent the leader sequence. Figures 3A-3D are an illustration of the LIÍJ / aA¿- * ^ ~ ¿^ "> ^ s * fc ^" --- "* aitt ^" e - ^ - ^ fe- ***. ~. < tJ * - * - Ai AA? .ñ ta. > --------------------------------------------------------------------------------------------------------------------------------------------- The amino acid sequence homology between PDGF-A (SEQ ID NO: 2), PDGF-B (SEQ ID NO: 4), PIGF (SEQ ID NO: 6), PIGF-2 (SEQ ID NO: 8), GDGF (SEQ ID NO: 10), VEGF (SEQ ID NO: 12), VEGF-A (SEQ ID NO: 14), VEGF-2 ( SEQ ID NO: 16), VEGF-3 (SEQ ID NO: 18), VEGF-D (SEQ ID NO: 20), VEGF-D1 (SEQ ID NO: 22) and VEGF-E (SEQ ID NO: 24) The framed areas indicate the conserved sequences and the location of the eight conserved cysteine residues.In the figures the decoration means "Decoration # 1": The shaded residues (with black background) are the residues that coincide exactly with the consensus sequence called "Consense # 1".

DETAILED DESCRIPTION OF THE PREFERRED MODALITIES Definitions In accordance with one aspect of the present invention, polypeptide molecules comprising members of the PDGF and VEGF families are provided. More specifically, members of the PDGF and VEGF families include: platelet-derived growth factor-A (PDGF-A), - as described in European patent No. EP-682110 (SEQ ID NO: 1-2 ); platelet-derived growth factor B (PDGF-B), as described in European Patent No. EP-282317 (SEQ ID NO: 3-4); placental growth factor (PIGF), as described in international publication No. WO 92/06194 (SEQ ID NO: 5-6) placental growth factor 2 (PIGF-2), as described in Hauser et al., Gorwth Factors, 4: 259-268 (1993) (SEQ ID NO: 7-8); glioma-derived growth factor (GDGF), as described in European Patent No. EP-399816 (SEQ ID NO: 9-10); vascular endothelial growth factor (VEGF), as described in the international publication WO 90/13649 (SEQ ID NO: 11-12); Vascular endothelial growth factor A (VEGF-A), as described in European Patent No. EP-506477 (SEQ ID NO: 13-14); vascular endothelial growth factor 2 (VEGF-2), as described in International Publication No. WO 96/39515 (SEQ ID NO: 15-16); vascular endothelial growth factor 3 (VEGF-3), as described in International Publication No. WO 96/39421 (SEQ ID NO: 17-18); vascular endothelial growth factor-D (VEGF-D), as described in international publication No. WO 98/07832 (SEQ ID NO: 19-20); vascular endothelial growth factor-D1 (VEGF-D1), as described in international publication No. WO 98/02543 (SEQ ID NO: 21-22); and vascular endothelial growth factor (VEGF-E), as described in German Patent No. DE19639601 (SEQ ID NO: 23-24), and collectively referred to herein as "angiogenic proteins". or "angiogenic polypeptides". The aforementioned references are incorporated in their entirety in the present invention for referenceAs used in the present invention "agonist" refers to any polynucleotide, polypeptide, antibody or molecule, including small molecules, that promotes or enhances the desired activity of the angiogenic proteins. As used in the present invention, "antagonist" refers to any polynucleotide, polypeptide, antibody or molecule, including small molecules, that reduce or inhibit the desired activity of the angiogenic protein. As used in the present invention, "desired activity" refers to the ability of the agonist and / or antagonists to promote the proliferation of endothelial cells (angiogenesis or lymphoangiogenesis), or to inhibit the proliferation of endothelial cells (angiogenesis or lymphangiogenesis). ) in relation to the natural activity of angiogenic proteins.

Angiogenic protein agonists and antagonists The present invention relates to angiogenic protein agonists and / or antagonists. One embodiment of angiogenic protein agonists includes antibodies that bind to the polypeptide and promote or enhance the desired activity. Examples of these agonists include monoclonal or polyclonal antibodies directed to specific angiogenic polypeptides which bind to the angiogenic polypeptides and promote the angiogenic activity of those polypeptides, for example, by stabilizing the dimerized form of the angiogenic protein, or by aggregation of the polypeptides that bind to the antibodies, and thereby concentrate or localize the activity of the angiogenic polypeptides. Another potential angiogenic protein agonist includes small molecules that pro-increase or enhance the activity of angiogenic proteins. Such small molecule agonists could be involved in binding to angiogenic protein receptors, for example, or related receptors, and thereby enhance the activities of angiogenic proteins. In a further embodiment, the angiogenic protein agonist includes polypeptides that enhance the activity of the angiogenic proteins. Such polypeptide agonists could be involved in binding to angiogenic proteins, for example, or to related receptors, and thereby enhance the activities of angiogenic proteins. Another example includes antisense constructs that promote or enhance the desired activity of angiogenic proteins. Potential antagonists of angiogenic protein include an antibody, or in some cases, an oligonucleotide, which binds to the polypeptide and effectively eliminates the activity of the angiogenic protein. Alternatively, a potential antagonist could be a closely related protein that binds to angiogenic protein receptors, however, these are inactive forms of the polypeptide and thus prevent the action of angiogenic proteins. Examples of these antagonists include a dominant negative mutant of an angiogenic protein polypeptide, for example, a strand of a heterodimeric form of an angiogenic protein can be. dominant and could be mutated in such a way that the biological activity is not conserved. An example of a mutant . * & amp; & & amp. & amp; Dominant negative includes truncated versions of a dimeric angiogenic protein that can interact with another dimer to form the wild type angiogenic protein, however, the homodimer is inactive and can not exhibit the desired activity characteristics. Another potential angiogenic protein antagonist is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple helix formation or antisense DNA or RNA, of which both methods rely on the binding of a polynucleotide to DNA or RNA. For example, the 5 'coding portion of the polynucleotide sequence, which codes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix-see Lee et al., Nucí Acids Res. 6: 3073 (1979); Cooney et al., Science 241: 456 (1988) and Dervan et al., Science 251: 1360 (1991)), whereby transcription and production of an angiogenic protein is prevented. The antisense RNA oligonucleotide hybridizes with the mRNA in vivo and blocks the production of the mRNA molecule in the angiogenic protein polypeptide (Antisense-Okano, J. Neurochem, 56: 560 (1991): Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells in such a way that the antisense RNA or DNA can be expressed in order to inhibit the production of the angiogenic protein. In a further embodiment, angiogenic protein antagonists also include small molecules that bind to and occupy the active site of the polypeptide thereby rendering the catalytic site inaccessible to the substrate such that normal biological activity is prevented. Examples of small molecules include but are not limited to peptides or small peptide molecules. Antagonists could be used to limit the angiogenesis necessary for the metastasis of solid tumors. Because angiogenesis and neovascularization are the essential step in the growth of solid tumors, the inhibition of angiogenic activity of the angiogenic protein is very useful to prevent further growth, retard or even reverse t.áat.j i¡, á., ¿»< ¿?, H¡, »t!» *. «.- solid tumors. This invention also relates to a method for selecting compounds to identify those that are agonists or antagonists of the angiogenic protein. An example of such a method takes advantage of the ability of angiogenic proteins to significantly stimulate the proliferation of human endothelial cells in the presence of the A-comitogen. Endothelial cells are obtained and cultured in 96-well flat bottom culture plates. (Costar, Cambridge, MA) in a reaction mixture supplemented with Con-A (Calbiochem, La Jolla, CA). The Con-A compound, polypeptides of the present invention and the compound to be selected are added. After incubation at 37 ° C, the cultures are pulsed with 1 FCi of 3 [H] thymidine (5 Ci / mmol, Ci = 37 BGq, NEN) for a sufficient time to incorporate 3 [H] and harvest on filters of fiberglass (Cambridge Technology, Watertown, MA). The incorporation of average 3 [H] -thymidine is determined (cpm) of cultures in triplicate using a liquid flash counter (Beckman Instruments, Irvine, CA). The significant incorporation of 3 [H] thymidine, as compared to a control test in which the compound is excluded, indicates the stimulation of endothelial cell proliferation. To test the agonists, the test described above is performed and the ability of the compound to promote the incorporation of 3 [H] t? Midin in the presence of an angiogenic protein indicates that the compound is an agonist for the angiogenic protein. In contrast, to evaluate for antagonists, the test described above and the ability of the compound to inhibit the incorporation of 3 [H] thymidine in the presence of a protein are performed.

Angiogenic indicates that the compound is an antagonist for the angiogenic protein. Alternatively, antagonists for the angiogenic protein can be detected by combining an angiogenic protein and a potential antagonist under appropriate conditions for a test of 15 competitive inhibition. The angiogenic protein can be labeled, such as by radioactivity, as is the case of the number of angiogenic protein molecules bound to the receptor the effectiveness of the potential antagonist can be determined. Alternatively, the response of a known second messenger system can be measured after interaction with the angiogenic protein and the receptor and could be compared in the presence or absence of the compound. Such Second systems include but are not limited to cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis. In another method, a mammalian cell or a membrane preparation that expresses the angiogenic protein receptor with labeled angiogenic protein in the presence of the compound is cultured and incubated. The ability of the compound to increase or inhibit this interaction can then be measured.

Epitopes and antibodies The present invention encompasses polypeptides comprising, or alternatively, consisting of an epitope for the polypeptide having an amino acid sequence of SEQ ID NOS: 2 or 4, or an epitope of the polypeptide sequence encoded by a sequence of polynucleotides contained in deposit No. 97149 or 75698 of ATCC or that is encoded by a polynucleotide that hybridizes to the complement of the sequence of SEQ ID NOS: 1 or 3 or that is contained in deposit No. 97149 or 75698 of ATCC conditions of astringent hybridization or low stringency hybridization conditions as defined above. A representative clone containing the , "JLA- to iJfaL sequence for SEQ ID NO: 2 or 4, in the American Type Culture Deposit (" ATCC ") on March 4, 1994 and was given the deposit number ATCC 75698, and May 12 of 1995 and was given the deposit number ATCC 97149. The ATCC is located at 10801 University Boulevard, Manassas, Virginia 20110-2209, USA. The ATCC deposit was made in accordance with the terms of the Budapest Treaty on international recognition. The present invention also encompasses polynucleotide sequences that encode an epitope of a polypeptide sequence of the invention (such as, for example, the sequence described in SEQ ID NOS: 1 or 3). Polynucleotide sequences of the complementary strain of a polynucleotide sequence encoding an epitope of the invention, and polynucleotide sequences that hybridize to the complementary strand under stringent hybridization conditions or low stringency hybridization conditions defined above. The term "epitopes", as used in the present invention, refers to portions of a polypeptide that have antigenic or immunogenic activity in an animal, preferably a mammal, and more preferred in a human. In a preferred embodiment, the present invention encompasses a polypeptide comprising an epitope, as well as the polynucleotide encoding this polypeptide. An "immunogenic epitope", as used in the present invention, is defined as a portion of a protein that evokes an antibody response in an animal, as determined by any method known in the art, such as, for example, by methods to generate antibodies described later. (See, for example, Geysen et al., Proc. Nati, Acad. Sci USA 81: 3998-4002 (1983)). The term "antigenic epitope" as used in the present invention is defined as a portion of a protein to which the antibody binds immunospecifically to its antigen as determined by any method known in the art, for example, by the immunological tests described in the present invention. Immunospecific binding excludes non-specific binding but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes do not necessarily need to be immunogenic. Fragments that function as epitopes can be produced by any conventional means. See, for example, Houghten, Proc. Nati Acad. Sci. USA 82: 5131-5135 (1985), also described in the patent E.U.A. feAAÁJ & Ju i ». * - 4, 631,211). In the present invention, the antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferred at least 8, at least 9, at least 10 at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50 and more preferred between about 15 and about 30 amino acids. Preferred polypeptides comprise immunogenic or antigenic epitopes that are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 amino acid residues in length. Preferred non-exclusive additional antigenic epitopes include the antigenic epitopes described in the present invention, as well as portions thereof. Antigenic epitopes are useful, for example, to create antibodies, including monoclonal antibodies, that bind specifically to the epitope. Preferred antigenic epitopes include the antigenic epitopes described in the present invention, as well as any combination of two, three, four, five or more of these antigenic epitopes. The antigenic epitopes can be used as the target molecules in the tests immunological See, for example, Wilson et al., Cell 37: 767-778 (1984); Sutcl ffe et al., Science 219-660-666 (1983)). Likewise, immunogenic epitopes can be used, for example, to induce antibodies in accordance with methods known in the art. See, for example, Sutcliffe et al., Supra; Wilson et al., Supra; Chow et al., Proc. Nati Acad. Sci. USA 82: 910-914; and Bittle et al., J. Gen. Virol. 66: 2347-2354 (1985). Preferred immunogenic epitopes include the immunogenic epitopes described in the present invention, as well as any of two, three, four, five or more of these immunogenic epitopes. Polypeptides that comprise one or more of these immunogenic epitopes. Polypeptides comprising one or more immunogenic epitopes can be presented to induce an antibody response together with a carrier protein, such as albumin, to an animal system (such as a mouse or rabbit), or, if the polypeptide is of sufficient length (at least about 25 amino acids), the polypeptide can be presented without a carrier. However, immunogenic epitopes comprising as little as 8 or 10 amino acids have been shown to be sufficient to raise the antibodies that can bind to at least the linear epitopes in a denatured polypeptide (e.g. in Western blotting). Polypeptides having epitopes of the present invention can be used to induce antibodies in accordance with methods known in the art including, but not limited to, in vivo immunization, in vitro immunization and phage display methods. See for example Sutcliffe et al., Supra; Wilson et al., Supra, and Bittle et al., J. Gen. Virol. , 66: 2347-2354 (1985). If immunization is used in vivo, the animals can be immunized with the free peptide; however, the antibody titer against the peptide could be enhanced by coupling the peptide to a macromolecular carrier, such as limpet hemocyanin (KLH) or tetanus toxoid. For example, peptides containing cysteine residues can be coupled to a carrier using a linker such as the maleylimidobenzoyl ester-N-hydrosuccinimide (MBS), while other peptides could be coupled to the carriers using a more general binding agent such as glutaraldehyde. Animals such as rabbits, rats and mice are immunized either with the free peptide or with peptides coupled to carrier, for example, by intrapeptidal and / or intrapetermic injection of emulsions that -i.?m? t * ai? tUU * Sam **. ^ Mta ^ A ^^. they contain approximately μg of peptide or carrier protein and Freund's adjuvant or any other known adjuvant to stimulate an immune response. Several booster injections may be needed, for example, at intervals of about two weeks, to provide a useful titre of antipeptide antibody which can be detected, for example, by ELISA tests using free peptide absorbed to a solid surface. The titre of any of the anti-peptide antibodies in serum from an immunized animal could be increased by selecting antipeptide antibodies, for example, by adsorption to the peptide on a solid support and elution of the selected antibodies in accordance with methods known in the art. As one of ordinary skill in the art will appreciate, and as discussed above, the polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to other polypeptide sequences. For example, the polypeptides of the present invention can be fused to the constant domain of the immunoglobulins (IgA, IgE, IgG, IgM) or to portions thereof (CH1, CH2, CH3), or any combination thereof and portions thereof. thereof) resulting in chimeric polypeptides. Such fusion proteins could facilitate purification and could increase the half-life in vivo. This has been demonstrated for chimeric proteins consisting of the first two domains of the human CD4 polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. See, for example, EP 394,827; Traunecker et al., Nature, 331: 84-86 (1998). Improved delivery of an antigen through the epithelial barrier to the immune system has been demonstrated for antigens (eg, insulin) conjugated to an FcRn binding partner such as fragments of IgG or Fc (see, for example, PCT publications WO 96/22024 and WO 99/04813). It has also been found that IgG fusion proteins having a disulfide linked dimeric structure due to the disulfide bonds of the IgG portion are more efficient in binding and neutralizing other molecules than monomeric polypeptides or fragments alone. See for example Fountoulakis et al., J. Biochem., 270: 3958-3964 (1995). The nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag (e.g., the hemagglutinin ("HA") marker or pennant tag) to aid in the detection and purification of the expressed polypeptide. . For example, a system described by Janknecht et al. allows easy purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc Nati Acad Sci USA 88: 8972-897). Additional fusion proteins of the invention can be generated through gene intermingling, interspersed motifs, interspersed exons, and / or interspersed codons (collectively preferred as "DNA intermixed").

The intermixing of DNA can be used to modulate the activities of the polypeptides of the invention, such methods can be used to generate polypeptides with altered activity, as well as agonists and antagonists of the polypeptides. See, in general, the E.U.A. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8: 724-33 (1997); Harayama, Trends Biotechnol. 16 (2): 76-82 (1998); Hansson, et al., J. Mol. Biol. 287: 265-76 (1999); and Lorenzo and Blasco, Biotechniques 24 (2): 308-13 (1998) (each of these pattems and publications are incorporated herein by reference in their entirety). In one embodiment, the alteration of polynucleotides corresponding to SEQ ID NO: 1 or 3 and the polypeptides encoded by these polynucleotides, can be achieved by DNA intermixing. DNA intermixing involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the polynucleotide sequence. In another embodiment, the polynucleotides of the invention, or the encoded polypeptides, could be altered to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another modality, one or more components, motives, sections, domains, fragments, etc. of a polynucleotide encoding a polypeptide of the invention could be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.

Antibodies Additional polypeptides of the invention refer to antibodies and cell antigen receptors T (TCR) which bind immunospecifically to a polypeptide, polypeptide fragment, or SEQ variant tá & á * ... 'to ¡iXl.a..m..AS ,, A ..? ^. m A,. ^ S ^ ^. ^ ** AmA, .mA * Am. r. * - At? * ». * Jk¡. ** .- ¿at ^, 3¡Sk ... J * í- X -" ^ tíÜiÉrihr "1 ^ ID NO: 2 or 4, and / or an epitope, of the present invention (as determined by immunological tests known in the art to evaluate specific antibody-antigen binding). Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, or humanized, or chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') fragments, fragments produced by a gene library. Fab expression, anti-idiotypic (anti-ld) antibodies (including, for example, anti-ld antibodies for antibodies of the invention), and epitope-binding fragments of any of the foregoing. The term "antibody", as used in the present invention, refers to immunoglobulin molecules and to immunologically active portions of immunoglobulin molecules, ie, molecules that contain an antigen binding site which binds immunospecifically to a antigen. The immunoglobulin molecules of the invention can be of any type (for example IgG, IgE, IgM, IgD, IgA and IgY), class (for example IgG, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of the immunoglobulin. Thus, the antibodies are fragments of human antigen-binding antibody of the present invention and include, but are not limited to Fab ', Fab' and F (ab ') 2, Fd, Fvs of a single chain (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising any of the VL or VH domains. The antigen-binding antibody fragments including the individual chain antibodies may comprise the variable region or regions alone or in combination with all or a portion of the following: hinge regions, CH1, CH2 and CH3 domains. Also included in the invention are antigen-binding fragments which also comprise a combination of the variable region or regions with a hinge region., and domains CH1, CH2 and CH3. The antibodies of the invention can come from an animal including birds and mammals. Preferably, the antibodies are human, mouse (e.g. mouse and rat), monkey, goat, rabbit, sheep, guinea pig, camel, horse or chicken. As used in the present invention, "human" antibodies include antibodies that have the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals Transgenic proteins for one or more human immunoglobulins and that do not endogenously express the immunoglobulins, as described above and, for example, in the patent E.U.A. No. 5,939,598 to Kucherlapati et al. The antibodies of the present invention can be monospecific, bispecific, trispecific or have a higher multispecificity. The multispecific antibodies may be specific for epitopes other than a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or a solid supported material. See, for example, publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; of the PCT; Tutt, et al., J. Immunol. 147: 60-69 (1991); patent of E.U.A. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148-1547-1553 (1992). The antibodies of the present invention can be described or specified in terms of the epitope or epitopes or portion (s) of a polypeptide of the present invention which recognize or specifically bind. The epitope or epitopes or polypeptide portion or portions may be specified as described herein t.d.Á ... t k & *? A *. ^. ^ .aAAÉ. invention, for example by the N-terminal and C-terminal positions, by size in the contiguous amino acid residues, or as listed in the tables and figures. In one embodiment, the antigenic polypeptides or peptides can be used to generate antibodies specific for PDGF-A include the following: a polypeptide comprising the amino acid residues from about Lys -72 to about Leu-80 in SEQ ID NO: 2, from about Ile-82 to about Ile-88 in SEQ ID NO: 2, from about Pro-106 to about Ser-114 in SEQ ID NO: 2, from about Lys-139 to about Val-145 in SEQ ID NO: 2, from about Arg-159 to about Lys-165 in SEQ ID NO: 2, and from about Ser-183 to about Thr-211 in SEQ ID NO: 2. It has been determined that these polypeptide fragments carry antigenic epitopes of the PDGF protein -A by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Ile-82 to about Ile-88 in SEQ.

ID NO: 2 ÍAti £ a .j "" fcrt iA & i * .. - Non-limiting examples of antigenic polypeptides or peptides that can be used to generate antibodies specific for PDGF-B include the following: a polypeptide comprising amino acid residues from about Arg-39 to about Gln-45 in SEQ ID NO: 4, from about Asp-51 to about Asp-56 in SEQ ID NO: 4, from about Thr-65 to about Gly-71 in SEQ ID NO: 4, from about Leu-110 to about Ala-116 in SEQ ID NO: 4, from about Ser-131 to about Thr-144 in SEQ ID NO: 4, from about Pro-188 to about Thr-206 in SEQ ID NO: 4, from about Arg-216 to about Lys-227 in SEQ ID NO: 4, and from about Thr-229 to about Leu-235 in SEQ ID NO: 4. It was determined that the polypeptide fragments carry the antigenic epitopes of the PDGF protein -B med by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Arg-39 to about Gln-45 in SEQ ID NO: 4, -from about Asp-51 to about Asp-56 in SEQ ID NO: 4, and from approximately Thr-65 up approximately Gly-71 in SEQ ID NO: 4. Non-limiting examples of antigenic polypeptides or peptides that can be used to generate antibodies specific for PIGF include the following: a polypeptide comprising the amino acid residues from about Val -46 to about Cys -52 in SEQ ID NO: 6, from about Arg-110 to about Ser-116 in SEQ ID NO: 6, and from about Val -126 to about Asp-144 in SEQ ID NO: 6. It has been determined that these polypeptide fragments carry antigenic epitopes of the protein PIGF by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Val-46 to about Cys-52 in SEQ ID NO: 6. The non-limiting examples of antigenic polypeptides or peptides that can be used to generate antibodies specific for PIGF- 2 include the following: a polypeptide comprising the amino acid residues from about Val-46 to about Cys-52 in SEQ ID NO: 8, from about Arg-110 to Í? *? A * iÁA? -? MÁím -..., - li -a jt - * .. á .Í «l approximately Ser- 116 in SEQ ID NO: 8, and from approximately Val-126 to approximately Asp -159 in SEQ ID NO: 8. It has been determined that these polypeptides carry the antigenic epitopes of the PIGF-2 protein by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Val-46 to about Cys-52 in SEQ ID NO: 8. Non-limiting examples of antigenic polypeptides or peptides that can be used to generate antibodies specific for GDGF include the following: a polypeptide comprising the amino acid residues from about Thr-30 to about Ala-36 in SEQ ID NO: 10, from about Tyr-456 to about Cys -51 in SEQ ID NO: 10, from about Glu 63 to about 68 in SEQ ID NO: 10, from about Ser-125 to about Cys-142 in SEQ ID NO: 10, from about Pro-144 to about His-151 in SEQ ID NOr-10. from about Gln-155 to about Lys-172 in SEQ ID NO: 10, and from about Asn-179 to about Arg-190 in SEQ ID NO: 10. It has been determined that these polypeptide fragments carry the antigenic epitopes of the protein GDGF by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Thr-60 to about Ala-36 in SEQ ID NO: 10, and from about Tyr-46 to about Cys-51 in SEQ ID NO: 10. The examples Non-limiting polypeptides or antigenic peptides can be used to generate antibodies specific for VEGF include the following: a polypeptide comprising the amino acid residues from about Glu-64 to about Ile-69 in SEQ ID NO: 12, from about Gly-85 to about Gly-91 in SEQ ID NO: 12, from about His-125 to about Cys-143 in SEQ ID NO: 12, from about Pro-145 to about His-152 in SEQ ID NO: 12, from about Gln- 156 to about Lys-173 in SEQ ID NO: 12, and from about Asn-180 to about Arg-191 in SEQ ID NO: 12. It has been determined that these polypeptide fragments carry the antigenic epitopes of the VEGF protein by analyzing the antigenic index of Jameson-Wolf using the default parameters. Non-limiting examples of antigenic polypeptides or peptides that can be used to generate antibodies specific for VEGF-A include the following: a polypeptide comprising the amino acid residues from about Thr-30 to about Ala-36 in SEQ ID NO: 14, from about Tyr-46 to about Cys -51 in SEQ ID NO: 14, from about Glu-63 to about Ile-68 in SEQ ID NO: 14, from about Ser-125 to about Val-143 in SEQ ID NO: 14 , from about Gly-145 to about Cys-166 in SEQ ID NO: 14, from about Pro-168 to about His-175 in SEQ ID NO: 14, from about Gln-179 to about Lys-196 in SEQ ID NO: 14, and from about Asn-203 to about Arg-214 in SEQ ID NO: 14. It has been determined that those polypeptide fragments carry the antigenic epitopes of the VEGF-A protein by anti-aliquot analysis. Jameson-Wolf gene using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Thr-30 to about Ala-36 in SEQ ID NO: 14, and from about Tyr-46 to about Cys-51 in SEQ ID NO: 14. The examples Non-limiting polypeptides or antigenic peptides that can be used to generate antibodies specific for VEGF-2 include the following: a polypeptide comprising the amino acid residues from about Asp-40 to about Ala-45 in SEQ ID NO: 16, from about Lys-54 to about Leu-60 in SEQ ID NO: 16, from about Gln-84 to about Gly-89 in SEQ ID NO: 16, from about Arg-94 to about Thr-106 in SEQ ID NO: 16, from about Ile-122 to about Cys-131 in SEQ ID NO: 16, from about Asn-175 to about Leu-181 in SEQ ID NO: 16, from about Gln-237 to about Pro-244 in SEQ ID NO. : 16, from about Asp-267 to about Phe-276 in SEQ ID NO. 6, from about Pro-282 to about Asp-287 in SEQ ID NO: 16, from about Ser-303 to about Ser-314 in SEQ ID NO: 16, from about Ala 330 to about Thr-338 in SEQ ID NO: 16, from about Arg-345 to about Cys-358 in SEQ ID NO: 16, from about Gly-373 to about Cys-395 in SEQ ID NO: 16, and from approximately Pro-410 to approximately Ser-419 in SEQ ID NO: 16. It has been determined that these polypeptide fragments carry the antigenic epitopes of the VEGF-2 protein by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Asp-40 to about Ala-45 in SEQ ID NO: 16, from about Lys-54 to about Leu-60 in SEQ ID NO: 16, from about Gln -84 to about Gly-89 in SEQ ID NO: 16, from about Arg-94 to about Thr-106 in SEQ ID NO: 16, and from about 122 to about Cys-131 in SEQ ID NO: 16. Non-limiting examples of polypeptides or antigenic peptides that can be used to generate antibodies specific for VEGF-3 include the following: $$ í.? á.á? m¡ - ... a polypeptide comprising the amino acid residues from about Ser-24 to about Lys-34 in SEQ ID NO: 18, from about Ala-45 to about Arg-50 in SEQ ID NO: 18, from about Arg-125 to about Ala - 138 in SEQ ID NO: 18, from about Pro-141 to about Ser-149 in SEQ ID NO: 18 and from about H-s-167 to about Pro-172 in SEQ ID NO: 18. It has been determined that those fragments carry the antigenic epitopes of the VEGF-3 protein by analyzing the antigenic index of Jameson Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Ser-24 to about Lys-34 in SEQ ID NO: 18 and from about Ala-45 to about Arg-50 in SEQ ID NO: 18. The examples are not Limitations of polypeptides or antigenic peptides that can be used to generate antibodies specific for VEGF-D include the following: a polypeptide comprising the amino acid residues from about Met-1 to about Gln-14 in SEQ ID NO: 20, from about -29 to about Arg-41 in SEQ ID NO: 20, from about Met -48 to about Thr-58 in SEQ ID NO: 20, from about Glu-75 to about Thr-87 in SEQ ID NO: 20, from about Leu 95 up to about Phe-103 in SEQ ID NO: 20, from about Pro-181 to about Lys -191 in SEQ ID NO: 20, from about Trp-199 to about Cys-204 in SEQ ID NO: 20, from about Asp-281 to about Thr-293 in SEQ ID NO: 20, from about Pro-310 to about Ala-316 in SEQ ID NO: 20 and from about Gly-318 to about Pro- 325 in SEQ ID NO: 20. It has been determined that these polypeptide fragments carry the antigenic epitopes of the VEGF-D protein by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Met-1 to about Gln-14 in SEQ ID NO: 20, from about H-s-29 to about Arg-41 in SEQ ID NO: 20, from approximately Met-48 to approximately Thr- 58 in SEQ ID NO: 20 and from approximately Glu- 75 hastia-approximately Thr- 87 in SEQ ID NO: 20. Non-limiting examples of antigenic polypeptides or peptides that can be used to generate antibodies specific for VEGF-D-1 include the following: a polypeptide comprising the amino acid residues from about Ser-22 to about Gln-43 in SEQ ID NO: 22, from about His-58 to about Arg-70 in SEQ ID NO: 22, from about Met-77 to about Thr-87 in SEQ ID NO: 22, from about Glu-104 to about Thr- 116 in SEQ ID NO: 22, from about Leu 124 to about Phe-132 in SEQ ID NO: 22, from about Pro-210 to about Lys -220 in SEQ ID NO: 22, from about Trp-228 to about Cys -233 in SEQ ID NO: 22, from about Asp-310 to about Thr-322 in SEQ ID NO: 22, from about Pro-339 to about Ala-345 in SEQ ID NO: 22 and from about Gly-347 to about Pro-3 54 in SEQ ID NO: 22. It has been determined that these polypeptide fragments carry the antigenic epitopes of the VEGF-D protein by analyzing the antigenic index of Jameson-Wolf using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about Ser-22 to about Gln-43 in SEQ ID NO: 22, from about H? S-58 to about Arg-70 in SEQ ID NO: 22 and from approximately Met-77 to about Thr-87 in SEQ ID NO: 22. Non-limiting examples of antigenic polypeptides or peptides that can be used to generate antibodies specific for VEGF-E include the following: a polypeptide comprising the amino acid residues from approximately Asp-21 to approximately Trp-26 in SEQ ID NO: 24, from about Asp-46 to about Phe-56 in SEQ ID NO: 24, from about Gly-68 to about Ser-74 in SEQ ID NO: 24 and from about Pro-121 to about Arg-132 in SEQ ID NO: 24. It has been determined that these polypeptide fragments carry the antigenic epitopes of the VEGF-E protein by analyzing the antigenic index of Jameson-Wolff using the default parameters. In a preferred embodiment, the antigenic epitopes include the amino acid residues from about > "*? & Asp-21 approximately Trp-26 in SEQ ID NO: 24. Antibodies that bind specifically to any epitope or polypeptide of the present invention can also be excluded. Thus, the present invention includes antibodies that they bind in a specific manner to the polypeptides of the present invention, and allow the exclusion thereof .. The antibodies of the present invention can also be described or specified in terms of their reaction 10 cross-linked, antibodies that do not bind to any other analogue, ortholog, or homologous of a polypeptide of the present invention are included. Antibodies that bind to polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, so 15 minus 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described in the present invention) to a polypeptide of the present invention are also included therein. In modalities Specific antibodies, the antibodies of the present reaction cross-react with homologues of murine, rat and / or mouse polypeptides and the corresponding epitopes thereof. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50% identity (as calculated using methods known in the art and described in the present invention) with a polypeptide of the present invention are also included therein. In a specific embodiment, the cross-reactivity described above is with respect to any individual specific antigenic or immunogenic polypeptide, or combination or combinations of 2,3,4,5, or more of the specific antigenic and / or immunogenic polypeptides described herein invention. Also included in the present invention are antibodies that bind to polypeptides encoded by polynucleotides that hybridize to a polynucleotide of the present invention under stringent hybridization conditions (as described in the present invention). The antibodies of the present invention can also be described or specified in terms of their binding affinity towards a polypeptide of the invention. Preferred binding affinities include those with a dissociation constant Kd less than 5X10_2M, 10"2M, 5X10" 3M, 10"3M, 5X1-0" M, 10"4M, 5X10 ~ 5M, 10" 5M, 5X10"6M , 10 ~ 6M, 5X10 ~ 7M, 107M, 5X10"8M, 10" 8M, 5X10"9M, 10 ~ 9M, 5X10 ~ 10M, 10" 10M, dXlO ^ M, 10_11M, 5X10"12M, 10" 10-12M , 5X10"13M, 10" 1JM, SXIO ^ ', IO' ^ M, 5X10"15M or 10" 15 M. The invention also provides antibodies that competitively inhibit the binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, eg, the immunological tests described therein In preferred embodiments, the antibody competitively inhibits epitope binding by at least 95%, at least 90 %, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50% The antibodies of the present invention can act as agonists or antagonists of the polypeptides of the present invention. For example, the present invention includes antibodies that perturb receptor / ligand interactions with the polypeptides of the invention either partially or completely. Preferably, the antibodies of the present invention bind to an antigenic epitope described herein, or to a portion thereof. The invention features receptor-specific antibodies and ligand-specific antibodies. The invention also features receptor-specific antibodies that do not prevent binding to the ligand but prevent receptor activation. The activation of the receptor (i.e., signaling) can be determined by techniques described therein or known in some other manner in the art. For example, activation of the receptor can be determined by detecting phosphorylation (eg, tyrosine or septen / threonine) of the receptor or its substrate by immunoprecipitation followed by western blot analysis (eg as described above). In specific embodiments, antibodies are provided that inhibit ligand activity or receptor activity by at least 95%, by at least 90%, by at least 85%, by at least 80%, by at least 75%, at least 70%, at least 60%, or at least 50% of the activity in the absence of the antibody. The invention also features receptor-specific antibodies that both prevent ligand binding and receptor activation as well as antibodies that recognize the ligand receptor complex, and preferably do not specifically recognize the unbound receptor or the unbound ligand. Likewise, neutralizing antibodies that bind to the ligand and prevent binding of the ligand to the receptor, as well as antibodies, are included in the invention.; that join the ligand, thereby avoiding láttL? t k tétk-r. '< iflf * "* & -. * í ~~ ?? receptor activation, but do not prevent the ligand from binding to the receptor. Antibodies that activate the receptor are also included in the invention. These antibodies can act as receptor agonists, i.e. potentiate or activate either all or a subset of the biological activities of receptor activation mediated by the ligand, for example, by inducing dimerization of the receptor. The antibodies can be specified as agonists, antagonists or inverse agonists for the biological activities comprising the specific biological activities of the peptides of the invention described therein. Antibody agonists can be made using methods known in the art. See, for example, PCT publication WO 96/40281; patent of E.U.A. No. 5,811,097; Deng et al., Blood 92 (6): 1981-1988 (1998); Chen et al., Cancer Res. 58 (16): 3668-3678 (1998); Harrop et al., J. Immunol. 161 (4): 1786-1794 (1998); Zhu et al., Cancer Res. 58 (15): 3209-3214 (1998); Yoon et al., J. Immunol. 160 (7): 3170-3179 (1998); For et al., J. Cell. Sci. 111 (Pt2): 237-247 (1998); Pitard et al., J. Immunol. Methods 205 (2): 177-190 (1997); Liautard et al., Cytokine 9 (4): 233-241 (1997); Carlson et al., J. Biol. Chem. 272 (17): 11295-11301 (1997); Taryman et al., Neuron 14 (4): 755-762 (1995); Muller et al., Structure 6 (9): 1153-1167 (1998); Bartunek et al., Cytokine 8 (1): 14-20 (1996) (all of which are incorporated by reference in the present invention in their entirety). The antibodies of the present invention can be used, for example, but not limited to, to purify, detect and target the polypeptides of the present invention, including diagnostic and therapeutic methods both in vivo and in vi tro. For example, antibodies have use in immunological tests to quantitatively and qualitatively measure the levels of the polypeptides of the present invention in biological samples. See, for example, Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed., 1998) (incorporated herein by reference in its entirety). As discussed in more detail below, the antibodies of the present invention could be used either alone or in combination with other compositions. The antibodies can also be fused recombinantly to a heterologous polypeptide at the N- or C-terminal end or can be chemically conjugated (including conjugations in a covalent and non-covalent form) to polypeptides or other compositions. For example, the antibodies of the present invention can be fused in recombinant form or can be conjugated to molecules useful as markers in screening tests and to effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, for example, PCT publications WO 92/08495; WO 92/14438; WO 91/14438; WO 89/12624; patent of E.U.A. No. 5,314,995; and EP 396,387. Antibodies of the invention include derivatives that are modified, i.e., by covalently binding any type of molecule to the antibody in such a way that the covalent binding does not prevent the antibody from generating an anti-idiotypic response. For example, but not by way of limitation, antibody derivatives include antibodies that have been modified, for example by glycosylation, acetylation, polyethylene glycol treatment, phosphilation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, binding to a cellular ligand or other protein, etc. Any number of chemical modifications can be made by known techniques, including but not limited to specific chemical dissociation, acetylation, formylation, synthesis Metabolic tunicamicma, etc. In addition, the derivative may contain one or more non-classical amino acids. The antibodies of the present invention can be generated by any suitable method known in the art. Polyclonal antibodies to an antigen of interest can be produced by various methods known in the art. For example, a polypeptide of the invention can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the production of serum containing polyclonal antibodies specific for the antigen. Various adjuvants can be used to increase the immune response, depending on the host species, and include but are not limited to, Freund's adjuvant (complete and incomplete), mineral gels such as aluminum hydroxide, surfactants such as lysolecithm, pluronic polyols , polyanions, peptides, oil emulsions, limpet hemocyanins, dinitrophenol and potentially useful human adjuvants such as BCG (Bacillus Calmette-Guerin) and Corinebacterium Parvum. Such adjuvants are also known in the art. - Monoclonal antibodies can be prepared using a wide variety of techniques known in the field including the use of hybridoma, recombinant and phage display technology, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed., 1988).; Hammerling, et al., In: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N. Y., 1981) (these references are incorporated for reference in their entirety). The term "monoclonal antibody" as used in the present invention is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from an individual clone, including any eukaryotic, prokaryotic or phage clone, and not the method by which it is produced. Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art and are discussed in greater detail in the examples. In a non-limiting example, mice can be immunized with a polypeptide I ¿Jla lJ J * a it ja a ^ .J- fcá¿3 ¿i¿ü AJÍHÍ-Í *. of the invention or with a cell that expresses such a polypeptide. Once an immune response is detected, for example, that antibodies specific for the antigen are detected in the mouse serum, the spleen of the mouse is removed and the splenocytes are isolated. The splenocytes are then fused by well-known methods to any appropriate myeloma cell, for example cells from the SP 20 cell line available from the ATCC. Hybridomas are selected and cloned by limited dilution. The hibpdoma clones are then evaluated by methods known in the art for cells that secrete antibodies that can bind to the polypeptide of the invention. Ascyte fluid, which usually contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones. Accordingly, the present invention provides methods for generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell that secretes an antibody of the invention in which, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with an antigen of the invention with cells of a,., then activating the resulting hybridomas. of the fusion with respect to hybridoma clones that secrete an antibody that can bind to a polypeptide of the invention. Antibody fragments that recognize specific epitopes can be generated by known techniques. For example, Fab and F (ab ') 2 fragments of the invention can be produced by proteolytic cleavage of the immunoglobulin molecules, using enzymes such as papain (to produce) Fab fragments) or pepsin (to produce F (ab') fragments). 2. The ab 's fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain, for example, the antibodies of the present invention can also be generated using various known phage display methods in the In the phage display methods, the functional antibody domains on the surface of the phage particles carrying the polynucleotide sequences encoding them are displayed In a particular embodiment, such a phage can be used to display binding domains antigen expressed from a repertoire or library of combinatorial antibodies (e.g., human or murine). i? i? i? i, i. i. *. ei?.? .- m, i * ¿*. ° A .. ... ítt? i. antigen-binding domain that binds to the antigen of interest can be selected or identified with antigen, for example, using labeled antigen or antigen bound or captured on a solid surface or sphere. The phage used in these methods are usually filamentous phages that include fd and M13 binding domains expressed from the phage with the Fab, Fv or Fv antibody domains stabilized with disulfide, fused in recombinant form either to the protein of the gene III of phage or gene VIII. Examples of phage display methods that can be used to make the antibodies of the present invention include those described in Brikman et al., J. Immunol. Methods 182: 41-50 (1995); Ames et al., J. Immunol. Methods 184: 177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24: 952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); PCT application No. PCT / GB91 / 01134; PCT applications No. WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and patents of E.U.A. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571.6987 5,427.90 and 5,516,637; 5,780,225; 5,568,727; 5,733,743 and 5,969.10! each of which is incorporated in the present invention for reference in its entirety. As described in the above references, after selecting the phage, the regions encoding the phage antibody can be isolated and used to generate whole antibodies, including human antibodies, or any other fragment that binds to the desired antigen, and expressing it in any desired host, including mammalian cells, insect cells, plant cells, yeast and bacteria, for example as described in more detail below. For example, techniques can also be used to recombinantly produce Fab, Fab 'and F (ab') 2 fragments using methods known in the art such as those described in PCT application WO 92/22324; Mullmax et al., BioTechniques 12 (6): 864-869 (1992); and Sawai et al., AJRI 34: 26-34 (1995); and Better et al., Science 240: 1041-1043 (1998) (these references being incorporated for reference in their entirety). Examples of techniques that can be used to produce single chain Fvs and antibodies include those described in US Pat. 4,946,778 and 5,258.4-98; Huston et al., Methods in Enzymology 203: 46-88 (1991); Shu et al., PNAS 90: 7995-7999 (1993); and Skerra et al., Science 240: 1038-1040 (1998). For some uses, including the use of antibodies in vi and for in vitro detection tests, it may be preferable to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are obtained from different animal species, such as antibodies having a variable region obtained from a murine monoclonal antibody and a human immunoglobulm constant region. Methods for producing chimeric antibodies are known in the art. See for example Morrison., Science 229: 1202 (1985); Oi et al., Biotechniques 4: 214 (1986); Gilíes et al., (1989) J. Immunol. Methods 125: 191-202; US patents Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entirety. Humanized antibodies are antibody molecules from antibodies of non-human species that bind to the desired antigen having one or more complementarity determining regions (CDRs) from non-human species and a framework region from a human immunoglobulin molecule. . Frequently, framework residues in human frame regions will be substituted with the residue * '^^^ Ss corresponding from the donor CDR antibody to alter, preferably to improve, the binding to the antigen. These frame substitutions are identified by methods known in the art, for example, by modeling the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify framework residues. not common in particular positions. (See, for example, Queen et al., U.S. Patent No. 5, 585, 089; Riechmann et al., Nature 332: 323 (1988), which are incorporated in the present invention for reference in their entirety). The antibodies can be humanized using a variety of techniques known in the art including, for example, CDR grafting (EP 239,400, PCT publication WO 91/09967, patents of E.U.A.

Nos. 5,225,539; 5,530,101; and 5,585,089), striae formation or new surface formation (EP 592,106; 519,596; Padlan, Molecular Immunology 28 (4/5): 489-498 (1991); Studnicka et al., Protein Engineering 7 (6): 805-814 (1994); Roguska et al., PNAS 91: 969-973 (1994)) and chain exchange (U.S. Patent No. 5,565,332). Fully human antibodies are particularly desirable for the treatment of patients Í & á-áA. Ai * ¿human. Human antibodies can be prepared by a variety of methods known in the art including phage display methods described above using antibody libraries obtained from human immunoglobulin sequences. See also patents of E.U.A. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/50433, WO 98/24893; WO 98/16654, WO 96/34096, WO 96/33735 and WO 91/10741; each of which are incorporated in the present invention for reference in its entirety. Human antibodies can also be produced using transgenic mice which can not express functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes could be introduced randomly or by homologous recombination in mouse embryonic stem cells. Alternatively, the variable region, the constant region and the human diversity region could be introduced into mouse embryo stem cells in addition to the human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes could be made non-functional separately or simultaneously with the introduction of loci of Human immunoglobulin by homologous recombination. In particular, the homozygous deletion of the JH region prevents the production of endogenous antibody. The modified embryonic stem cells are expanded and micromjected into blastocysts to produce chimeric mice. The chimeric mice are then propagated to produce homozygous offspring which expresses the human antibodies. The transgenic mice are immunized in the customary manner with a selected antigen, for example, all or a portion of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained from immunized, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes hosted by the transgenic mice are transposed during the differentiation of the B cell, and subsequently subjected to class switching and somatic mutation. In this way, using a technique as such, it is possible to produce therapeutically useful antibodies of IgG, IgA, IgM and IgE. For a review of this technology to produce human antibodies, see Lonberg and Huszar, Int. Rev. Immunol. -13: 65-93 (1995). For a detailed discussion of this technology to produce human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, for example, PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; US patents Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771 and 5,939,598 which are incorporated herein by reference in their entirety. In addition, companies such as Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can be involved to provide human antibodies directed against a select antigen using technology similar to that described above. Fully human antibodies that recognize a selected epitope can be generated using a technique known as "guided selection". In this method, a non-human monoclonal antibody, for example, a mouse antibody, is used to guide the selection of a fully human antibody that recognizes the same epitope. (Jespers et al., Bio / technology 12: 899-903 (1988)). In addition, antibodies to the polypeptides of the invention can, in turn, be used to generate anti-idiotype antibodies that "mimic" the polypeptides of the invention using techniques well known to the art. experts in the art. (See for example., Greenspan &Bona, FASEB J. 7 (5): 437-444; (1989) and Nissinoff, J. Immunol. 147 (8): 2429-2438 (1991)). For example, antibodies that bind to, and competitively inhibit, the multimerization of the polypeptide and / or the binding of a polypeptide of the invention to a ligand can be used to generate anti-idiotypes that "mimic" the multimerization of the polypeptide and / or the binding domain and, as a consequence, bind to and neutralize the polypeptide and / or its ligand. Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize the polypeptide ligand. For example, such anti-idiotypic antibodies can be used to bind a polypeptide of the invention and / or to bind their ligands / receptors, thereby blocking their biological activity.

Polynucleotides encoding antibodies The invention also provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof. The invention also encompasses polynucleotides that hybridize under stringent or stringent astringency hybridization conditions, eg, as defined above, to polynucleotides that encode an antibody, preferably, that binds specifically to a polypeptide of the invention , preferably, an antibody that binds to a polypeptide having the amino acid sequence of SEQ ID Nos. 2 or 4. The polynucleotides can be obtained, and the nucleotide sequences of the polynucleotides can be determined, by any known method in the technique. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (for example as described in Kutmeier et al., Bio Techniques 17: 242 (1994)). which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, quenching and ligating those oligonucleotides, and then amplifying the ligated oligonucleotides by PCR. Alternatively, a polynucleotide encoding an antibody could be generated from nucleic acid from an appropriate source. If a clone containing nucleic acid coding is not available for a particular antibody, but the sequence of the antibody molecule is known, a nucleic acid encoding for immunoglobulin can be chemically synthesized or can be obtained from an appropriate source (eg, an antibody cDNA library, or a gene library). CDNA generated from, or nucleic acid, preferably poly A + RNA, isolated from, any tissue or cells expressing the antibody, such as hibpdoma cells that are selected to express an antibody of the invention) by PCR amplification using synthetic primers that can hybridize to the 3 'and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, for example, a cDNA clone from a cDNA library encoding for the antibody. The amplified nucleic acids generated by PCR can then be cloned into replicable cloning vectors using any method well known in the art. Once the nucleotide sequence and the corresponding amino acid sequence is determined, the nucleotide sequence of the antibody can be manipulated using methods well known in the art to manipulate nucleotide sequences for example, recombinant DNA techniques, site-directed mutagenesis, PCR , etc. (See, for example, the techniques described in Sambrook et al., Molecular 1990, Cloning: A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds 1998, Current Protocols in Molecular Biology, John Wiley &Sons, NY, which are incorporated herein by reference in their entirety), to generate antibodies having a different amino acid sequence, for example to create substitutions, deletions and / or amino acid insertions in a specific embodiment, the amino acid sequence of the heavy chain and / or light chain variable domains can be inspected to identify complementarity determining sequences (CDRs) by methods that are well known in the art, for example, by comparison with known amino acid sequences from other heavy chain and light chain variable regions to determine regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs can be inserted into the framework regions, for example, in framework regions of human to humanize a non-human antibody, as described supra.

I á.? ÁJki: ^, sfaJA¿a¿fa & Frame regions can be framework regions that occur naturally or can be consensus framework regions, and preferably are framework regions of human (see for example, Chothia et al., J. Mol. Biol. 278: 457-47 (1998) for a list of human framework regions). Preferably, the polynucleotide generated by the combination of framework regions and CDRs encode for an antibody that binds specifically to the polypeptide of the invention. Preferably, as discussed supra, one or more amino acid substitutions can be made within the framework regions, and, preferably, amino acid substitutions improve the binding of the antibody to its antigen. Additionally, such methods could be used to make amino acid substitutions or deletions of one or more cysteine residues of the variable region that participate in the tetrachain disulfide bonds to generate antibody molecules lacking one or more tetrachain disulfide bridges. . Other alterations to the polynucleotide are encompassed by the present invention and are within the skill of the art. In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al., Proc. Nati, Acad. Sci. 81: 851-855 (1984), Neuberger et al. al., Nature 312: 604-608 (1984); Takeda et al., Nature 314: 452-454 (1985)) by splicing genes from a mouse antibody molecule with specific character to the appropriate antigen together with genes from a human antibody molecule of appropriate biological activity. As described above, a chimeric antibody is a molecule in which different portions are obtained from different animal species, such as those having a variable region obtained from a mAB of the world from a constant region of human immunoglobulin, by example, humanized antibodies. Alternatively, techniques described for the production of single chain antibodies can be adapted (U.S. Patent No. 4,946,778; Bird, Science 242: 423-42 (1988); Huston et al., Proc. Nati Acad. Sci. USES 85: 5879-5883 (1998); Huston et al., Proc. Nati Acad. Sci.

USA 85: 5879-5883 (1988); and Ward et al., Nature 334: 544-54 (1989)) to produce single chain antibodies. Single chain antibodies are formed by linking the fragments of the heavy and light chains of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli could also be used (Skerra et al., Science 242: 1038-1041 (1988)).

Methods for producing antibodies The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis, or preferably by recombinant expression techniques. The recombinant expression of an antibody of the invention, or fragment, derivative or analogue thereof, (for example a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires the construction of a vector of expression that contains a polynucleotide that codes for the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably containing the variable domain of the heavy or light chain) of the invention, is obtained, it can be producing the vector for the production of the antibody molecule by recombinant DNA technology using techniques known in the art. Therefore, they are described in present invention methods for preparing a protein expressing a polynucleotide containing a nucleotide sequence encoding the antibody. Methods that are known to those skilled in the art can be used to construct expression vectors containing sequences encoding for antibodies and appropriate transcriptional and translational control signals. These methods include, for example, recombinant DNA techniques in vi tro, synthetic techniques, and in vivo genetic recombination. In this manner, the invention provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, ligated into operable form to a promoter. Such vectors could include the nucleotide sequence coding for the constant region of the antibody molecule (see for example., PCT publication WO 86/05807; PCT publication WO 89/1036; and patent of E.U.A. No. 5,122,464) and the variable domain of the antibody can be cloned into such vector to express the entire heavy or light chain. The expression vector is transferred to a host cell by conventional techniques and the cells Transfected are then cultured by conventional techniques to produce an antibody of the invention. Therefore, the invention includes host cells that contain a polynucleotide that encodes an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In the preferred embodiments for the expression of double-chain antibodies, the vectors encoding both heavy and light chains can be co-expressed in the host cell to express the complete immunoglobulin molecule, as indicated in more detail below. A variety of host-expression vector systems can be used to express the antibody molecules of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest can be produced and purified subsequently, and also represent cells which when transformed or transfected with the nucleotide coding sequences, express an antibody molecule of the invention in situ . This includes but is not limited to microorganisms such as bacteria L.Í, ib »á.M A ....- (for example E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing sequences coding for the antibody; yeasts (eg, Sacharomyces, Pichia) transformed with yeast expression vectors containing sequences encoding the antibody; insect cell systems infected with recombinant virus expression vectors (eg, baculoviruses) containing sequences encoding the antibody; plant cell systems infected with recombinant virus expression vectors (eg, cauliflower mosaic virus, CaMV, tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (eg Ti plasmid) containing the sequences encoding the antibody; or mammalian cell systems (eg, COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters obtained from the genome of mammalian cells (eg, etalothionein promoter) or from viruses of mammals (for example the "late adenovirus promoter; the vaccinia virus 7.5 K promoter)." Preferably, bacterial cells such as Escherichia coll are used and, more preferred, eukaryotic cells, especially for the expression of the complete molecule of recombinant antibody, for the expression of a recombinant antibody molecule, for example, mammalian cells such as Chinese hamster ovary (CHO) cells, together with a vector such as the promoter element of the major intermediate initial gene from the Human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45: 101 (1986); Cockett et al., Bio / Technology 8: 2 (1). 990).) In bacterial systems, a number of expression vectors may conveniently be selected depending on the intended use for the antibody molecule being expressed. For example, when a large amount of such a protein is to be produced, to generate pharmaceutical compositions of an antibody molecule, vectors that direct the expression of high levels of fusion protein products that can be easily purified may be desirable. Such vectors include, but are not limited to, the pUR278 expression vector of E. coli (Ruther et al., EMBO J. 2: 1791 (1983)), in which the sequence encoding the antibody can be ligated into individual form in the frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye &Inouye, Nucleic Acids Res. 13: 3101-3109 (1985); Van Heeke & amp;; Schuster, J. Biol. Chem. 24: 5503-5509 (1989)); and similar. PGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can be easily purified from the lysed cells by adsorption and binding to matrix glutathione-agarose spheres followed by elution in the presence of free glutathione. The pGEX vectors are designed to include protease cleavage sites for thrombin or factor Xa so that the cloned target gene product can be released from the GST portion. In an insect system, californica Authentic Nuclear Polyhedrosis Virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The sequence encoding the antibody can be cloned individually into the non-essential regions (for example the polyhedrin gene) of the virus and placed under the control of an AcNPV promoter (for example the polyhedrin promoter). In mammalian host cells, a number of virus-based expression systems can be used. In cases where an adenovirus is used as an expression vector, the sequence encoding the antibody of interest can be ligated to an adenovirus transcription / translation control complex, eg, the tripartite leader sequence and the promoter. late. This chimeric gene can then be inserted into the adenovirus genome by recombination in vi tro or in vi vo. Insertion into a non-essential region of the viral genome (e.g., the El or E3 region) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in the infected host. (For example, see Logan &Shenk, Proc. Nati. Acad. Sci. USA 81: 355-359 (1984)) . Specific start signals for efficient translation of the inserted antibody coding sequences may also be required. These signals include the ATG start codon and the adjacent sequences. In addition, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the complete insert. These control signals and exogenous translation initiation codons could be from a variety of origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancing elements, transcription thermometers, etc. (See Bittner et al., Methods in Enzymol, 153: 51-544 (1987)). In addition, a host cell strain can be chosen that modulates the expression of the inserted sequences, or that modifies and processes the gene product in the specific manner desired. Such modifications (for example glycosylation) and processing (cutting) of the protein products could be important for the function of the protein. Different host cells have specific characteristics and mechanisms for the processing and post-translational modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the expressed foreign protein. For this purpose, eukaryotic host cells possessing the cellular machinery for proper processing of the primary transcript, glycosylation and phosphorylation of the gene product can be used. Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, and in particular breast tissue cancer cell lines such as, for example, BT483, .Mia .M. , Hs578T, HTB2, BT20 and T47D and normal mammary gland cell lines such as, for example, CRL7030 and Hs578Bst. For long-term production, and with high yield of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the antibody molecule can be genetically engineered. Instead of using expression vectors containing viral replication origins, host cells can be transformed with controlled DNA by the appropriate expression control elements (eg, promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.). ), and a marker that can be selected. After introducing foreign DNA, the genetically engineered cells are allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to selection and allows the cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can be conveniently used to design cell lines that express the antibody molecule. Such lines ífcJufctAa. *, * faith * »* j ~ t, ttÉfcad *, .. .--. . "»,. > ^ Amtm.

Designed cell phones could be particularly useful in the selection and evaluation of compounds that interact directly or indirectly with the antibody molecule. A number of selection systems can be used, including but not limited to genes for herpes simplex virus thymidine kinase (Wigler et al., Cell 11: 223 (1977)), hypoxanthine-guanine phosphoribosyl transferase (Szybalska &Szybalski , Proc. Nati, Acad. Sci. USA 48: 202 (1992)), and adenine phosphoribosyl transferase (Lowy et al., Cell 22: 817 (1980)) can be used in tk-, hgprt- or aprt- cells, respectively. In addition, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Nati, Acad. Sci. USA 77: 357 (1980); O'Hare et al., Proc. Nati Acad. Sci. USA 78: 1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan &Berg, Proc. Nati, Acad. Sci. USA 78: 2072 (1981)); neo, which confers resistance to the inoglycoside G-418 Clinical Pharmacy 12: 488-505; Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, 1993, TIB TECH 11 (5): 155-215); and hygro, which • .t. * T * ?. .á * A.2 ** áM * confers resistance to hygromycin (Santerre et al., Gene 30: 147 (1984)). Common methods known in the art of recombinant DNA technology can be applied routinely to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in chapters 12 and 13, Dracopoli et al. (eds.), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J .. Mol. Biol. 150: 1 (1981), which are incorporated herein by reference in their entirety. The expression levels of an antibody molecule can be increased by amplification of the vector (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3 (Academic Press, New York, 1987)). When a marker in the vector system expressing the antibody is susceptible to amplification, the increase in the level of inhibitor present in the host cell culture will increase the copy number of the marker gene. Because the region amplified is associated with the antibody gene, antibody production will also be increased (Crouse et al., Mol Cell. Biol. 3: 257 (1983)). The host cell can be co-transfected with two expression vectors of the invention, the first vector encodes the heavy chain of the polypeptide and the second vector encodes a light chain of the polypeptide. The two vectors could contain identical selectable markers that allow for equal expression of heavy and light chain polypeptides. Alternatively, a single vector encoding, and capable of expressing, both heavy and light chain polypeptides can be used. In such situations, the light chain must be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322: 52 (1986); Kohier, Proc. Nati. Acad. Sci. USA 77: 2197 ( 1980)). The sequences encoding the heavy and light chains could comprise cDNA or genomic DNA. Once the antibody molecule of the invention has been produced by an animal, chemically synthesized or expressed in recombinant form, it can be purified by any method known in the art for the purification of an immunoglobulin molecule, for example, by chromatography (for example, affinity ion exchange chromatography, particularly by affinity for the specific antigen after protein A and size column chromatography), centrifugation, differential solubility or by any other standard technique for protein purification. In addition, antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described in the present invention or known in some other manner in the art, to facilitate purification. The present invention encompasses antibodies fused in recombinant or chemically conjugated form (including both covalent and non-covalent conjugates) to a polypeptide (or a portion thereof, preferably of at least 10, 20, 30, 40, 50, 60, 70 , 80, 90 or 100 amino acids of the polypeptide) of the present invention to generate fusion proteins. The fusion is not necessarily direct, but can be presented through linker sequences. The antibodies may be specific for antigens other than the polypeptides (or a portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention. For example, antibodies can be used to direct the polypeptides of the present invention to particular types of cells, either in vi tro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for the particular cell surface receptors. The antibodies fused or conjugated to the polypeptides of the present invention can also be used in immunological tests in vi tro and in purification methods using methods known in the art. See for example, Harbor et al., Supra, and PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39: 91-99 (1994); patent of E.U.A. No. 5,474,981; Gillies et al., PNAS 89: 1428-1432 (1992); Fell et al., J. Immunol. 146: 2446-2452 (1991)), which are incorporated in the present invention for reference in their entirety. The present invention also includes compositions comprising the polypeptides of the present invention fused or conjugated to the antibody domains other than the variable regions. For example, the polypeptides of the present invention could be fused-or conjugated to an antibody Fc region, or a fraction thereof. The antibody portion fused to a polypeptide of the present invention could comprise the constant region, the hinge region, the CH1 domain, the CH2 domain and the CH3 domain or any combination of entire domains or portions thereof. The polypeptides could also be fused or conjugated to the above antibody portions to form multimers. For example, the Fc portions fused to the polypeptides of the present invention can form dimers by disulfide bonds between the Fc portions. Higher multimeric forms can be made by fusing the polypeptides to IgA and IgM portions. Methods for fusing or conjugating the polypeptides of the present invention to portions of antibody are known in the art. See, for example, US patents. Nos. 5,336,606; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc. Nati Acad. Sci. USA 88: 10535-10539 (1991); Zheng et al., J. Immunol. 154: 5590-5600 (1995); and Vil et al., Proc. Nati Acad. Sci. USA 89: 11337-11341 (1992) (which are incorporated herein by reference in their entirety). "As discussed, supra, polypeptides corresponding to a polypeptide, polypeptide fragment, or a variant of SEQ ID NOS: 2 or 4 can be fused or conjugated to the above antibody portions to increase the half-life of the polypeptides In vivo or for use in immunological tests using methods known in the art In addition, the polypeptides corresponding to SEQ ID NOS: 2 or 4 can be fused or conjugated to the above antibody portions to facilitate purification.A reported example describes chimeric proteins which consist of the first two domains of the CD4 - human polypeptide and of various domains of the constant regions of the heavy or light chains of mammalian immunoglobulus (EP 394,827; Traunecker et al., Nature 331: 84-86 (1988) The polypeptides of the present invention fused or conjugated to an antibody having dimeric structures linked by disulfide bridges ( gone to IgG) could also be more efficient to bind and neutralize other molecules, than the secreted monomeric protein or a protein fragment alone. (Fountoulakis et al., J. Biochem. 270: 3958-3964 (1995)). In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis, and in this way can result, for example, in improved pharmacokinetic properties (EP A 232,262). Fit In the alternative, it would be desirable to delete the Fc part after the fusion protein has been expressed, detected and purified. For example, the Fc portion could hinder therapy and diagnosis if the fusion protein will be used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hIL-5, have been fused with Fc portions for the purpose of high throughput screening tests to identify hIL-5 antagonists. (See, Bennett et al., J. Molecular Recognition 8: 52-58 (1995); Johanson et al., J. Biol. Chem. 270: 9459-9471 (1995) .In addition, antibodies or fragments thereof. the present invention can be fused to marker sequences, such as a peptide to facilitate purification In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide such as the marker provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA 91311), among others, many of which are commercially available, as described in Gentz et al., Proc. Nati, Acad. Sci. USA 86: 821-824 (1989), by example, hexa-histidine ensures convenient purification of the fusion protein Other peptide-based markers useful for purification aiMIA * A M 3rih t i.i £ r. they include, but are not limited to, the "HA" marker which corresponds to an epitope obtained from the influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (1984)) and the "FLAG" marker. The present invention also encompasses antibodies or fragments thereof conjugated to a diagnostic or therapeutic agent. Antibodies can be used in a diagnostic manner to, for example, monitor the development or progression of a tumor as part of a clinical evaluation procedure, for example, to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a substance that can be detected. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and non-radioactive paramagnetic metal ions. The detectable substance can be coupled or conjugated either directly to the antibody (or fragment thereof) or indirectly, by "an intermediate (such as, for example, a linker known in the art) using techniques lintel < & iJaAiáláferiri jirteáláÉ ^^ fc. In the field, see, for example, US patent. No. 4,741,900 for metal ions that can be conjugated to the antibodies and used as a diagnostic agent in accordance with the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase or acetylcholmesterase; examples of appropriate prosthetic group complex include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbellifone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotrizinylamine-fluorescein, dancillin chloride or phycoerythrin; an example of luminescent material includes lummol; examples of bioluminescent materials include luciferase, luciferin and aeuorin and examples of suitable radioactive materials include 1251, 131I, 1: L1In or "Tc. In addition, an antibody or fragment thereof can be conjugated to a therapeutic portion such as cytotoxin, by example a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, for example alpha particle emitters such as, 213Bi A cytotoxipa or cytotoxic agent includes any agent that is detrimental to cells Examples include paclitaxol, cytochalacin B , gramicidin B, ethidium bromide, hemetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyantrazionione, mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol and puromycin and analogues or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytaravin, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa, chlorambucil, melphalan, carmustine).

(BSNU) and lomustine (CCNU), cyclotosfamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamin plantin (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly called daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly called actmomycin), bleomycin, mithramycin and anthramycin (AMC)), and antimitotic agents (e.g., vincristine and vinblastine). The conjugates of the invention can be used to modify a given biological response, the therapeutic agent or drug portion should not be considered as limited to classical chemical therapeutic agents. For example, the drug portion can be a protein or polypeptide having a desired biological activity. Such proteins could include, for example, a toxin such as abpna, nema A, Pseudomonas exotoxin or diphtheria toxin; a protein such as tumor necrosis factor, alpha-interferon, beta-interferon, nerve growth factor, platelet-derived growth factor, tissue plasminogen activator, an apoptotic agent, eg, TNF-alpha, TNF-beta , AIM I (see, international publication No. WO 97/33899), AIM II (see, international publication No. WO 97/34911), Fas ligands (Takahashi et al., Int. Immunol., 6: 1567-1574 ( 1994)), VEGI (see, international publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, for example angiostatma or endostatma; or biological response modifiers, such as, for example, lymphocytes, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), stimulating factor of macrophage granulocyte colony ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF") or other growth factors. Antibodies can also be attached to supports f * - * t ^ y ^ n 5 4 .. L .. *. -l * solids, which are particularly useful for immunological tests or to purify the target antigen. Such solid supports include, but are not limited to glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. Techniques for conjugating such a therapeutic moiety to antibodies are well known, see, for example, Arnon et al., "Monoclonal Antibodies for Immunotherapy of Drugs in Cancer Therapy," in Monoclonal Antibodies and Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies for Drug Delivery", in Controlled Drug Delivery (2nd ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies 84: Biological and Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, and Future Prospective of The Therapeutic Use of Radiolabeled Antibody in Cancer Therapy" in Monoclonal Antibodies for Cancer Detection and Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation and Cytotoxic Properties of Antibody - Toxin Conjugates", Immunol. Rev. 62: 119-58 (1982). Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in the U.S. patent. No. 4,676,980, which is incorporated in the present invention for reference in its entirety. An antibody can be used, with or without a therapeutic portion conjugated thereto, administered alone or in combination with a cytotoxic factor or factors and / or cytokine or cytokines as a therapeutic agent.

Immunological determination of the phenotype The antibodies of the invention can be used in the immunological determination of the phenotype of cell lines and of biological samples. The translation product of the gene of the present invention could be useful as a cell-specific label, or more specifically as a cellular label that is differentially expressed at various stages of differentiation and / or maturation of particular cell types. Monoclonal antibodies directed against a specific epitope or combination of epitopes will allow the selection of cell populations that express the marker. Several techniques using monoclonal antibodies can be used to select cell populations that express to the label or markers, and include magnetic separation using magnetic beads coated with antibody, "visual inspection" with antibody bound to a solid matrix (ie plate), and flow cytometry (see, for example, US Patent No. 5,985,660; and Morrison et al., Cell, 96: 737-49 (1999)). These techniques allow the selection of particular cell populations such as those found in malignant haematological tumors (ie minimal residual disease (MRD) in patients with acute leukemia and "non-self" cells in transplants to avoid graft-versus-host disease). GVHD) .Alternatively, these techniques allow the selection of hematopoietic stem cells and precursors that can be subjected to proliferation and / or differentiation, such as those that could be found in human umbilical cord blood.

Antibody binding tests The antibodies of the invention can be evaluated for immunospecific binding by any method known in the art. Immunological tests that can be used include but are not limited to competitive and non-competitive testing systems using techniques such as Western Blot, radioimmunological tests, ELISA (enzyme-linked immunosorbent assay), "sandwich" immunological tests, immunoprecipitation tests, reactions with precipitin, precipitin reactions by gel diffusion, immunodiffusion tests, agglutination tests, complement-fixation tests, immunoradiometric tests, fluorescent immunological tests, immunological tests of protein A, to name a few. Such tests are routine and well known in the art (see, for example, Ausubel et al., Eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley &Sons, Inc. New York, which is incorporated in the present invention for reference in its entirety). Examples of immunological tests are briefly described below (but are not intended to be a limitation). Immunoprecipitation protocols usually comprise lysing a population of cells in a buffer solution for lysis such as RIPA buffer solution (1% NP-40 or triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and / or protease inhibitors (e.g., EDTA PMSF, aprotmine, sodium vanadate), add the antibody of interest to the cell lysate material, incubate for a period (for example, 1-4 hours) at 4 ° C, add protein A and / or G protein spheres -sepharose to the cell lysate material, incubating for approximately 1 hour or more at 4 ° C, washing the spheres in buffer for lysis and suspending the spheres again in SDS / sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, for example, Western Blot analysis. One skilled in the art will be aware of the parameters that can be modified to increase the binding of the antibody to an antigen and reduce the background (for example, by pre-clarifying the cell lysate material with sepharose beads. immunoprecipitation protocols see, for example, Ausubel et al, eds, 1994, Current Protocols m Molecular Biology, Vol. 1, John Wiley &Sons, Inc., New York at 10.16.1. they comprise preparing protein samples, subjecting the protein samples to electrophoresis in a polyacrylamide gel (for example, 8% -20% SDS-PAGE depending on the jftiiiiriii fcf it * n - t iirtf rí '3JfTB? l' "í if- - ^^^^^ fe ^^^ fc ^ ** ^^ ^ molecular weight of the antigen), transfer the protein sample from the gel of polyacrylamide to a membrane such as nitrocellulose, PVDF or nylon block the membrane in solution for blocking (for example, PBS with 3% BSA or skim milk), wash the membrane in buffer for washing (for example PBS-TWENN 20), block the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, wash the membrane in buffer for washing, block the membrane with a secondary antibody (which recognizes the primary antibody, for example, an anti-human antibody) conjugated to an enzyme substrate (for example horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (for example, 32P or 1251) diluted in blocking buffer, wash the membrane in buffer for washing and detect the presence of the antigen. A person skilled in the art will have the knowledge to know which parameters can be modified to increase the detected signal and to reduce the background noise. For further discussion regarding Western Blot protocols, see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & amp;; Sons, Inc., New York to 10.8.1.

ELISA tests comprise preparing the antigen, coating the cavity of a 96-well microtiter plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase) to the cavity and incubate for a certain time, and detect the presence of the antigen. In ELISA tests, the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (recognizing the antibody of interest) conjugated with a detectable compound could be added to the cavity. Also, instead of coating the cavity with the antigen the cavity could be covered with the antibody. In this case, a second antibody conjugated to a detectable compound could be added after the addition of the antigen of interest to the coated cavity. One skilled in the art will know which parameters to modify to increase the detected signal as well as other variations of the ELISA tests known in the art. For further discussion regarding ELISA tests see, for example, Ausubel et al, eds, 1994, Current Protocols m Molecular Biology, Vol. 1, John Wiley & Sons, Ine, New York to 11.2.1. The binding affinity of an antibody to a UtJ -'- 'HIJÉJ-iit' "" - ^ '^ T • fl? | -f- - ~ .-- ** - i - * - "antigen and the rate of extinction of an antibody-antibody interaction can be determined antigen by competitive binding tests An example of a competitive binding test comprises the incubation of labeled antigen (eg, 3H or 1251), with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and detection of antibody bound to the labeled antigen The affinity of an antibody of interest for a particular antigen and the binding rates can be determined from the data by plot analysis of scatchard.The competition with a second antibody can also be determined using tests In this case, the antigen is incubated with the antibody of interest conjugated to a labeled compound (e.g., 3H or 1251) in the presence of increasing amounts of a second unlabeled antibody.

Therapeutic Uses The present invention is also directed to antibody-based therapies which involve administering the antibodies of the invention to an animal, preferably a mammal, and more preferably a human patient, to treat one or more of the diseases, disorders or conditions described. The therapeutic compounds of the invention include, but are not limited to, the antibodies of the invention (including fragments, analogs and derivatives thereof as described in the present invention) and nucleic acids encoding the antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described in the present invention). The antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with aberrant expression and / or activity of a polypeptide of the invention, including, but not limited to, any of one or more of the diseases , disorders or conditions described in the present invention. The treatment and / or prevention of diseases, disorders or conditions associated with the aberrant expression and / or activity of a polypeptide of the invention includes, but is not limited to, alleviating the symptoms associated with those diseases, disorders or conditions. The antibodies of the invention can be provided in pharmaceutically acceptable compositions such as those known in the art or as described in the present invention, a summary of the ways in which the i «ti íl i? The antibodies of the present invention could be used in a therapeutic manner including the binding of polynucleotides or polypeptides of the present invention in a local or systemic form in the body or by direct cytotoxicity of the antibody, for example such as that which is mediated by complement cells (CDC) or by effector cells (ADCC). Some of these methods are described in more detail later. With the teachings provided in the present invention, one skilled in the art will know how to use the antibodies of the present invention for diagnostic purposes, therapeutic monitoring without undue experimentation. The antibodies of this invention could be conveniently used in combination with other monoclonal or chimeric antibodies, or with lymphokines or with hematopoietic growth factors (such as, for example, IL-2, IL-3 and IL-7), by example, which serve to increase the number or activity of the effector cells which interact with the antibodies. The antibodies of the invention can be administered alone or in combination with other types of treatments (eg radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents). In general, the administration of products from a species origin or the reactivity of species (in the case of antibodies) which is of the same species as that of the patient is preferred. Therefore, in a preferred embodiment, antibodies, fragments, derivatives, analogs or nucleic acids of human are administered to a human patient for therapy or prophylaxis. It is preferred to use antibodies of high affinity and / or potent in vivo inhibition and / or neutralizing against 10 polypeptides or polynucleotides of the present invention, fragments or regions thereof, both for immunological testing directed to, and for the therapy of disorders related to polynucleotides or polypeptides, including fragments thereof, of the 15 present invention. Such antibodies, fragments or regions of preference will have an affinity for the polypeptide polynucleotides of the invention, including fragments thereof. Their binding affinities include those with a dissociation constant or 20 Kd less than 5 X 10"2M, 10" 2 M, 5 X 103 M, 103 M, 5 X 10 ~ 4 M, 10 ~ 4 M, 5 X 10"5 M, 10" 5 M, 5 X 10 '6 M, 10"6 M, 5 X 10" 7 M, 10"7 M, 5 X 10" 8 M, 10"8 M, 5 X 10 ~ 9 M, 10 ~ 9 M, 5 X 10" 10 M, 10"10 M, 5 X 10" 11 M, 10"11 M, 5 X 10" 12 M, 10"12 M, 5 X 10" 13 M, 10 ^ 13 M, 5 X 10"14 M, 10" l "4 M, 5 X 10 -15 M and 10'15 M.

Gene Therapy In a specific embodiment, nucleic acids comprising sequences encoding the antibodies or functional derivatives thereof are administered to treat, inhibit or prevent a disease or disorder associated with the aberrant expression and / or activity of a polypeptide. of the invention, by gene therapy. Gene therapy refers to therapy performed by the administration to a subject of an expressed nucleic acid, or one that can be expressed. In this embodiment of the invention, the nucleic acids produce their encoded protein that mediates a therapeutic effect. Any of the methods for gene therapy available in the art according to the present invention can be used. The example methods are described below. For general reviews of gene therapy methods, see Goldspiel et al., Clinical Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993) and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, TIBTECH 11 (5): 155-215 (1993). The methods commonly known in the art of recombinant DNA technology that can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kliegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). In a preferred aspect, the compound comprises nucleic acid sequences encoding an antibody, said nucleic acid sequences being part of the expression vectors expressing the antibody or chimeric fragments or proteins or heavy or light chains thereof in a suitable host . In particular, such nucleic acid sequences have promoters linked in operable form to the antibody coding region, said promoter being inducible or constitutive and, optionally, tissue-specific. In another particular embodiment, nucleic acid molecules are used in which the sequences encoding the antibody and any other desired sequence are flanked by regions that promote homologous recombination at a desired site in the genome, thereby providing the expression mtrachromosomal of the nucleic acids encoding the antibody (Koller and Smithies, Proc. Nati, Acad. Sci. USA 86: 8932-8935 (1989); Zijlstra et al., Nature 342: 435-438 (1989). specific, the expressed antibody molecule is an individual chain antibody, alternatively, the nucleic acid sequences include sequences encoding both heavy and light chains, or fragments thereof, of the antibody. a patient can be direct, in which case the patient is exposed directly to the nucleic acid or to the vectors that carry the nucleic acid or indirectly , in which case, the cells are first transformed with the nucleic acids in vi tro, and then transplanted into the patient. These two methods are known, respectively, as gene therapy in vivo or ex vivo. In a specific embodiment, nucleic acid sequences are administered directly in vi, where it is expressed to produce the encoded product. This can be achieved by any of the numerous methods known in the art, for example, by building them as part of an appropriate nucleic acid expression vector and administering them in such a way that they become * ^ *** A *. intracellular, for example, by infection using defective or attenuated retroviral vectors or other viral vectors (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by using microparticle bombardment (e.g., a gene gun, Biolistic , Dupont) or coating with lipids or with cell surface receptors or with transfection agents, encapsulation in liposomes, microparticles or microcapsules, or administering them together with a peptide known to penetrate the nucleus, administering them bound to a ligand that undergoes endocytosis receptor-mediated (see, for example, Wu and Wu, J. Biol. Chem. 262: 4429-4432 (1987)) (which can be used to target cell types that specifically express receptors), etc. . In another embodiment, nucleic acid-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disturb the endosomes, allowing the nucleic acid to prevent lysosomal degradation. Even in another embodiment, the nucleic acid can be selected as a target in vivo for cell-specific uptake and expression, by targeting a specific receptor (see, for example, PCT publications WO 92/06180, WO 92/22635; WO92 / 20316; W093 / 14188, WO ? ¡ßr Lii. ? l.t.álr ?. , 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incorporated into the DNA of the host cell for expression by homologous recombination (Koller and Smithies, Proc. Nati, Acad. Sci. USA 86: 8932-8935 (1989); Ziljlstra et al., Nature 342: 435-438 (1989)). In a specific embodiment, viral vectors containing nucleic acid sequences encoding an antibody of the invention are used. For example, a retroviral vector can be used (see Miller et al., Meth Enzymol, 217: 581-599 (1993)). These retroviral vectors contain the necessary components for the correct packaging of the viral genome and its integration into the DNA of the host cell. The nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene to a patient. More details about retroviral vectors can be found in Boesen et al., Biotherapy 6: 291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make Stem cells are more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93: 644-651 (1994); Kiem et al., Blood 83: 1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4: 129-141 (1993); and Grossman and Wilson, Curr. Opm. In Genetics and Devel. 3: 110-114 (1993). Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are particularly attractive vehicles for delivering genes to the respiratory epithelium. Adenoviruses naturally infect the respiratory epithelium in which they cause mild disease. Other targets for adenovirus-based delivery are the liver, central nervous system, endothelial cells and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3: 499-503 (1993) present a review of gene therapy based on adenovirus. Bout et al., Human Gene Therapy 5: 3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelium of the rhesus monkey. Other examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252: 431-434 (1991); Rosenfeld et al., Cell 68: 143-155 (1992); Mastrangeli et al., J. Clin.

Invest. 91: 225-234 (1993); PCT publication W094 / 12649; and Wang et al., Gene Therapy 2: 775-783 (1995). In a preferred embodiment, adenoviral vectors are used. Adeno-associated viruses (AAV) have also been proposed for use in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med. 204: 289-300 (1993), US Patent No. 5,436,146 ). Another method for gene therapy involves the transfer of a gene to cells in tissue culture using methods such as electroporation, lipofection, transfection measured by calcium phosphate or viral infection. In general, the transfer method includes the transfer of a label that can be selected to the cells. The cells are then placed on selection to isolate those cells that have assimilated and that express the transferred gene. These cells are then delivered to the patient. In this embodiment, the nucleic acid is introduced into a cell before the resultant recombinant cell is administered in vivo. Such introduction can be effected by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, gene transfer measured by the chromosome , gene transfer mediated by microcells, fusion of spheroplasts, etc. Numerous techniques are known in the field for introducing foreign genes into cells (see, for example, Loeffler and Behr, Meth. Enzymol, 217: 599-618 (1993); Cohen et al., Meth Enzymol., 217: 618. -644 (1993); Cline, Pharmac. Ther .. 29: 69-92m (1985) and may be used in accordance with the present invention, provided that the necessary physiological and developmental functions of the recipient cells are not disrupted. The technique should ensure stable transfer of the nucleic acid to the cell, such that the cell can express the nucleic acid and preferably that it can be inherited and expressed by its daughter cells.The resulting recombinant cells can be delivered to a patient using Various methods known in the art Recombinant erythrocytes (hematopoietic stem cells or precursors) are preferably administered intravenously The amount of cells contemplated for use depends on the ect desired, the condition of the patient, etc., and this can be determined by the person skilled in the art.

Cells into which a nucleic acid can be introduced for the purpose of gene therapy encompasses any available, desired cell type and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes, erythrocytes such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem cells or precursors, in particular hematopoietic stem cells or precursors such as those obtained for example from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc. In a preferred embodiment, the cell used for gene therapy is autologous to the patient. In an embodiment in which recombinant cells are used in gene therapy, nucleic acid sequences encoding an antibody are introduced into the cells in such a way that the cells or their progeny can express them, and the recombinant cells are then administered. vi vo for the therapeutic effect. In a specific embodiment, stem cells or precursors are used. Potentially, any of the replenishing cells and / or precursors that can be isolated and - r¿ &- * l *. * - t, it ^ .., m ** Atm.¿ í • * AA? - * A- ^. A3íáitá, iÉl * kl: maintained in vi tro in accordance with this embodiment of the present invention (see, for example, PCT publication WO 94/08598; Stemple and Anderson, Cell 71: 973-985 (1992); Rhemwald, Meth Cell Bio 21A: 229 (1980) and Pittelkow and Scott, Mayo Clinic Proc. 61: 771 (1986)). In a specific embodiment, the nucleic acid to be introduced for the purpose of gene therapy comprises a promoter that can be induced linked operably to the coding region, such that the expression of the nucleic acid can be controlled by controlling the presence or absence of the appropriate transcription inducer.

Demonstration of therapeutic or prophylactic activity The compounds or pharmaceutical compositions of the invention are preferably evaluated in vi tro, and then in vi ve with respect to the desired therapeutic or prophylactic activity, before being used in humans. For example, in vi tro tests to demonstrate the therapeutic or prophylactic utility of a compound or pharmaceutical composition include, the effect of a compound on a cell line or a tissue sample of the patient. The effect of The composition or composition on the cell line and / or tissue sample can be determined using techniques known to those skilled in the art including, but not limited to, rosette formation tests and cell lysis tests. In accordance with the invention, the in vi tro tests that can be used to determine whether or not it indicates the administration of a specific compound,. It includes tests in cell culture in vi tro in which a sample of the patient's tea is grown in culture, and a compound is exposed to or administered in some other way, and the effect of such a compound on the tissue sample is observed.

Administration and therapeutic / prophylactic composition The invention provides methods of treatment inhibition and prophylaxis by administering to a subject an effective amount of a compound or a pharmaceutical composition of the invention, preferably an antibody of the invention. In a preferred aspect, the compound is substantially pure (eg, substantially free of substances that limit its effect or that produce undesirable side effects). Preferably, the subject is a animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc. and preferably it is a mammal and more preferred is a human. The formulations and methods of administration that can be used when the compound comprises a nucleic acid or an immunoglobulin are described above; The appropriate additional formulations and administration routes may be selected from those described hereinafter in the present invention. Various delivery systems are known and can be used to administer a compound of the invention, for example, encapsulation in liposomes, microparticles, microcapsules, recombinant cells that can express the compound, receptor-mediated endocytosis (see, for example, Wu and Wu, J. Biol. Chem. 262: 4429-4432 (1987)) , construction of a nucleic acid as part of a retroviral vector or other vector, etc. Introduction methods include but are not limited to the intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds or compositions can be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous shells (e.g. oral, rectal and intestinal mucosa, etc.) and can be administered together with other biologically active agents. The administration can be systemic or oral. In addition, one may wish to introduce the compounds or pharmaceutical compositions of the invention into the central nervous system by any appropriate route, including mtraventricular and mthecal injection.; Intraventricular injection can be facilitated using an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be used, for example, using an inhaler or nebulizer and the formulation with an aerosol agent. In a specific embodiment, one might wish to administer the compounds or pharmaceutical compositions of the invention locally to the area in need of treatment, - this may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, for example, together with a wound dressing after surgery, by injection, by means of a catheter, by means of a supposi, or by means of an implant, said implant being a porous, non-porous material or gelatinous, including membranes, such as sialastic membranes, or fibers. Preferably, when administering a protein, including an antibody, of the invention, care must be taken to use materials that do not absorb the protein. In another embodiment, the compound or composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249: 1527-1533 (1990); Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, Lopez -Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989), Lopez-Berestein, ibid., Pp. 317-327, see ibid in general form). Even in another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump can be used (see Langer, supra, Sefton, CRC Crit Ref Biomed Eng 14: 201 (1987), Buchwald et al., Surgery 88: 507 (1980), Saudek et al. , N. Engl. J. Med. 321: 574 (1989)). In another modality, polymeric materials can be used (see Medical Applications of Controlled Relay, Langer and Wise (eds.) CRC Pres., Boca Raton, Florida (1974), Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds. ), Wiley, New York (1984), Ranger and Peppas, J., Macromol, Sci. Rev. Macromol, Chem. 23:61 (1983), see also Levy et al., Science 228: 190 (1985); During et al., Ann. Neurol., 25: 351 (1989), Howard et al., J. Neurosurg., 71: 105 (1989)). Even in another embodiment, a controlled release system can be placed close to the therapeutic target, ie the brain, thus requiring only a fraction of the systemic dose (see, for example, Goodson, in Medical Applications of Controlled Relay, supra). , Vol 2, pp. 115-138 (1984)). Other release systems are discussed in the review by Langer (Science 249: 1527-1533 (1990)). In a specific embodiment in which the compound of the invention is a nucleic acid encoding a protein, the nucleic acid can be administered in vi ve to promote the expression of its encoded protein, by constructing it as part of an acid expression vecappropriate nucleic acid and administering it in such a way that it is made intracellular, for example using a retroviral vec(see U.S. Patent No. 4,980,286), or by direct injection, or using microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or with cell surface recep or with :: i2cc? On agents, administering it in a link to a peptide homeotic box type which is known to enter the nucleus (see, for example, Joliot et al., Proc. Nati, Acad. Sci. USA 88: 1864-1868 (1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly and incorporated into the DNA of the host cell for expression, by homologous recombination. The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of a compound, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means that it is approved by a regulatory agency of the federal or state government or is listed in the United States Pharmacopoeia or in another pharmacopoeia generally recognized for use in animals, and in more particular in humans. The term "vehicle" refers to a dnt, adjuvant, excipient or vehicle with which the therapeutic agent is administered. Such pharmaceutical vehicles can be sterile liquids, such as water and oils, including those of animal, vegetable, synthetic or petroleum origin, such as peanut oil, soybean oil, mineral oil, sesame oil and Similar. When the composition is administered via . ^ Ikiii intravenous water is the preferred vehicle. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid vehicles, in particular for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, glycerol monostearate, talc, sodium chloride, dry skim milk, glycerol, propylene glycol, water , ethanol and the like. If desired, the composition may also contain minor amounts of wetting agents or emulsifiers, or pH regulating agents. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with binders and traditional vehicles such as triglycerides. The oral formulation may include vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. in pharmaceutical grade. Examples of suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions contain an amount therapeutically You AaI Mi, j? The effective amount of the compound, preferably in pure form, together with an appropriate amount of vehicle so that the form for adequate administration to the patient is provided. The formulation must conform to the mode of administration. In a preferred embodiment, the composition is formulated in accordance with routine procedures relating to a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions made in sterile isotonic aqueous buffer. When necessary, the composition could also include a solubilizing agent and a local anesthetic such as lignocaine to relieve pain at the site of injection. In general, the ingredients are supplied either separately or mixed together in a unit dosage form, for example, as a dry lyophilized powder or as a water-free concentrated material in a hermetically sealed container such as a vial or bag that Indicate the amount of active agent. In cases in which the composition is administered by infusion, it can be dispensed - with an infusion bottle containing water or sterile pharmaceutical grade saline. When the t? A & á¡? a As? * ii, JíM *? X * composition is administered by injection, a sterile water vial for injection or saline can be provided so that the ingredients can be mixed before administration. The compounds of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those that are formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those that are formed with cations such as those derived from sodium, potassium, ammonium, calcium , ferric hydroxides, isopropylamine, diethylamine, 2-ethylaminoethanol, histidine, procaine, etc. The amount of the compound of the invention that will be effective for the treatment, inhibition and prevention of a disease or disorder associated with the aberrant expression and / or the activity of a polypeptide of the invention can be determined by standard clinical techniques. In addition, in vi tro tests can optionally be used to help identify optimal dosing intervals. The precise dose to be used in the formulation will also depend on the route of administration, and the severity of the disease or disorder, and should be decided upon. i.?,. ». i» i in accordance with the medical judgment and with the circumstances of each patient. Effective doses can be extrapolated from dose-response curves obtained from in vitro test systems or in animal models. For antibodies, the dose administered to a patient is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight. Preferably, the dose administered to a patient is between 0.1 mg / kg and 20 mg / kg of the patient's body weight, more preferred between 1 mg / kg to 10 mg / kg of the patient's body weight. In general, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to foreign polypeptides. Therefore, lower doses of human antibodies and less frequent administration are often possible. Furthermore, the dose and frequency of administration of the antibodies of the invention could be reduced by intensifying the absorption and penetration into the tissues (for example in the brain) of the antibodies by modifications such as, for example, the creation of derivatives with lipids. The invention also provides a pharmaceutical package or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally, a note in the form prescribed by a government agency that regulates the manufacture, use or sale of pharmaceutical or biological products, whose note reflects the approval by the agency to manufacture, may be associated with such container or containers. use or sell said product for administration in humans.

Diagnosis and imaging Marked antibodies can be used, and derivatives and analogs thereof that specifically bind to a polypeptide of interest for diagnostic purposes to detect, diagnose or monitor diseases, disorders and / or conditions associated with aberrant expression and / or the activity a polypeptide of the invention. The invention provides for the detection of aberrant expression of a polypeptide of interest, comprising a) evaluating the expression of a polypeptide of interest in the cells or body fluid of an individual using one or more antibodies specific for the polypeptide of interest, and b) comparing the level of expression of the gene with a reference level of expression of the gene, in which a Increase or decrease in the expression level of the polypeptide gene evaluated compared to the reference expression level is an indication of aberrant expression. The invention provides a diagnostic test for diagnosing a disorder, comprising a) evaluating the expression of a polypeptide of interest in the cells or body fluid of an individual using one or more antibodies specific for the polypeptide of interest, and b) 0 comparing the level of expression of the gene with a reference level of gene expression, in which an increase or decrease in the level of expression of the polypeptide gene evaluated compared to the reference expression level is an indication of a disorder particular. With respect to cancer, the presence of a relatively high amount of transcript in tissue biopsies from an individual could indicate a predisposition for the development of the disease, or could provide means to detect the disease before the onset of symptoms clinical trials. A more definitive diagnosis of this type could allow professional health care personnel to employ preventive measures or aggressive treatment at an earlier stage '- ^ X ÍÉ & 3 which prevents the further development or advancement of cancer. The antibodies of the invention can be used to evaluate protein levels in a biological sample using immunohistological methods known to those skilled in the art (for example, see Jalkanen, et al., J. Cell, Biol. 101: 976-985 (1985); Jalkanen et al., J. Cell. Biol. 105-3087-3096 (1987)). Other methods based on antibodies useful for detecting the expression of the gene of a protein include immunological tests, such as the enzyme-linked immunosorbent assay (ELISA) and the radiommunological test (RIA). Markers for appropriate antibody testing are known in the art and include enzyme type markers, such as glucose oxidase; radioisotopes such as iodine (125I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (121In) and technetium (99Tc); luminescent markers, such as lummol; and fluorescent labels, such as fluorescein and rhodamine and biotma. One aspect of the invention is the detection and diagnosis of a disease or disorder associated with the aberrant expression of a polypeptide of interest in an animal, preferably a mammal and more preferably a human. In one embodiment, the diagnosis comprises: a) administering (e.g., parenterally, subcutaneously or intraperitoneally) to an individual an effective amount of a labeled molecule that specifically binds to the polypeptide of interest; b) waiting for a certain time interval after administration to allow the labeled molecule to concentrate preferentially at the sites within the subject in which the polypeptide is expressed (and to remove the unbound labeled molecule up to the level of background); c) determine the background level; and d) detecting the labeled molecule in a subject, such that detection of the labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with aberrant expression of the polypeptide of interest. The background level can be determined by various methods including, comparing the amount of labeled molecule detected with a previously determined standard value for a particular system. It will be understood that the size of the subject and the system for image formation used will determine the amount of portion for image formation necessary to produce diagnostic images. In the case of a portion of radioisotope, for a human subject, the amount of r * ti * .A? * Í. * í.r * .- Í. ír * .- i * radioactivity injected will normally be in the range of 5 to 20 millicuries approximately 99mTc. The labeled antibody or antibody fragment then accumulates preferentially at the site of the cells containing the specific protein. Tumor imaging in vi vo is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 on Imaging Tumor: The Radiochemical Detection of Cancer, SW Burchiel and BA Rhodes, eds., Masson Publishing Inc. (1982) .Depending on several variables, including the type of marker used and the mode of administration, the range of time after administration to allow the charged molecule to concentrate preferentially at the sites within the subject and for the unbound labeled molecule to be removed until the background level is 6 to 48 hours or 6 to 24 hours or At 12 hours In another modality, the time interval after administration is 5 to 20 days or 5 to 10 days In one modality, the monitoring of the disease or disorder is carried out repeating the method to diagnose the disease or disorder, for example, one month after the initial diagnosis, six months after the initial diagnosis, one year after the initial diagnosis, etc. The presence of the marked molecule in the patient can be detected e using methods known in the art for in vivo scanning. These methods depend on the type of marker used. Those skilled in the art will be able to determine which is the appropriate method for detecting a particular marker. Methods and devices that can be used in the methods of the invention include, but are not limited to, computed tomography (CT), full body scanning such as positron emission tomography (PET), magnetic resonance imaging ( MRI), and sonography. In a specific embodiment, the molecule is labeled with a radioisotope and detected in the patient using a surgical instrument that responds to radiation (Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and detected in the patient using a scanning instrument that responds to fluorescence. In another embodiment, the molecule is labeled with a positron emitting metal and detected in the patient using positron emission tomography. Even in another embodiment, the molecule is labeled with a paramagnetic marker and detected ÍÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁÁ jiám éSAitAßA _ * m. *** A A.? i. * A.A ... * A ^ * in a patient using magnetic resonance imaging (MRI).

Cases The present invention provides kits that can be used in the above methods. In one embodiment, a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In a specific embodiment, the kits of the present invention contain a substantially isolated polypeptide comprising an epitope which is specifically immunoreactive with an antibody included in the kit. Preferably, the kits of the present invention also comprise a control antibody that does not react with the polypeptide of interest. In another specific embodiment, the kits of the present invention contain means for detecting the binding of an antibody to a polypeptide of interest (eg, the antibody can be conjugated to a detectable substrate such as a fluorescent compound, an enzyme substrate, a compound radioactive or a luminescent compound, or can be conjugated to a detectable substrate, a second antibody that recognizes the first antibody).

In another specific embodiment of the present invention, the kit is a diagnostic kit that is used to evaluate serum that contains specific antibodies against proliferative and / or cancerous polynucleotides and polypeptides. Such a kit could include a control antibody that does not react with the polypeptide of interest. Such a kit could include a substantially isolated polypeptide antigen comprising an epitope that is specifically immunoreactive with at least one anti-antibody to the polypeptide antigen. In addition, such a kit includes means for detecting the binding of said antibody to the antigen (for example, the antibody could be conjugated to a fluorescent compound such as fluorescein or rhodamine which can be detected by flow cytometry). In specific embodiments, the kit could include a polypeptide antigen produced in a recombinant or chemically synthesized form. The polypeptide antigen of the kit could also be attached to a solid support. In a more specific embodiment, the detection means of the kit described above includes a solid support to which said polypeptide antigen is bound. Such a case could also include an anti-human antibody l & tt. ^ JLAÍi * Í kiát ák Am. ^ * ^ é * t **. ^ m ^ ** írt, .A * A, ^ í *. im ** * ,. , .¡.a to «8». ,, *, * m * - At.fc »'\ * m, a marked with reporter not joined. In this embodiment, the binding of the antibody to the polypeptide antigen can be detected by the binding of said labeled antibody to a reporter. In a further embodiment, the invention includes a diagnostic kit that is used to evaluate serum containing antigens of the polypeptide of the invention. The diagnostic kit includes a substantially isolated antibody specifically immunoreactive with the polypeptide or polynucleotide antigens, and means for detecting the binding of the polypeptide or polypeptide antigen to the antibody. In one embodiment, the antibody is bound to a solid support. In a specific embodiment, the antibody can be a monoclonal antibody. The detection means of the kit could include a second labeled monoclonal antibody. Alternatively, or in addition, the detection means could include a labeled competent antigen. In a diagnostic configuration, the test serum is reacted with a solid phase reagent having a surface bound antigen obtained by the methods of the present invention. After binding with the antigen - with the antibody for the specific antigen, the reagent and removing the unbound serum components by washing, the reagent is reacted with the reporter-labeled human anti-antibody to bind the reporter to the reagent in proportion to the amount of anti-antibody for antigen bound on the solid support. The reagent is washed again to remove unbound labeled antibody, and determine the amount of reporter associated with the reagent. Typically, the reporter is an enzyme that is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO). The reagent for solid surface in the above test is prepared by known techniques for attaching protein material to a solid support material, such as polymer spheres, dip bars, 96-well plates or filter material. These binding methods usually include the adsorption of the protein to the support or the covalent attachment of the protein, typically through a free amino group, to a chemically reactive group on the solid support, such as a carboxyl, hydroxyl or activated aldehyde. Alternatively, streptavidin-coated plates may be used in conjunction with antigens treated with biotin. Therefore, the invention provides a system or Test case to carry out this diagnostic method. The kit generally includes a support with recombinant antigens attached to the surface, and an anti-human antibody labeled with a reporter to detect the antigen antibody of the antigen bound to the surface.

Polynucleotides Isolated nucleic acid molecules comprising the polynucleotides of the present invention include: platelet derived growth factor A (PDGF-A), as described in European patent number EP-682110 (SEQ ID NO: 1); platelet derived growth factor B (PDGF-B) as described in European patent number EP-282317 (SEQ ID NO: 3); placental growth factor (PIGF), as described in international publication number WO 92/06194 (SEQ ID NO: 5); placental growth factor 2 (PIGF-2), as described in Hauser et al., Growth Factors, 4: 259-268 (1993) (SEQ ID N0: 7); glioma-derived growth factor (GDGF), as described in European patent number EP-399816 (SEQ ID NO: 9); vascular endothelial growth factor (VEGF), as described in international publication number WO 90/13649 (SEQ ID NO: 11); vascular endothelial growth factor A (VEGF-A), as described in European patent number EP-506477 (SEQ ID N0: 13); vascular endothelial growth factor 2 (VEGF-2), as described in international publication number WO 96/39515 (SEQ ID N0: 15); vascular endothelial growth factor 3 (VEGF-3), as described in international publication number WO 96/39421 (SEQ ID N0: 17); vascular endothelial growth factor D (VEGF-D), as described in international publication number WO 98/07832 (SEQ ID NO: 19); vascular endothelial growth factor DI (VEGF-D1), as described in international publication number WO 98/02543 (SEQ ID NO: 21); and vascular endothelial growth factor E (VEGF-E), as described in German patent number DE19639601 (SEQ ID NO: 23). The aforementioned references are incorporated in the present invention for reference in their entirety. All the angiogenic proteins of the present invention are structurally related. It is particularly important that all eight cysteines are conserved within all members of the VEGF / PDGF families (see the framed areas of Figures 3A-3D). In addition, the rubric for the PDGF / VEGF families, PXCVXXXRCXGCC, (SEQ ID NO: 29), is preserved in all angiogenic proteins described in the present invention (see Figures 3A-3D). The angiogenic polypeptides of the present invention include polypeptides and full-length polynucleotide sequences that code for any leader sequence and for active fragments of the full-length polypeptides. The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA and synthetic DNA. The DNA can be double-stranded or single-stranded, and if it is a single strand it can be the coding strand or the non-coding strand (anti-sense). The coding sequence coding for the mature polypeptide may be identical to the coding sequence of the nucleotide sequences of Table 1, or it could be a different coding sequence which, as a result of the redundancy of the degeneracy of the genetic code, encodes the same mature polypeptide than the DNA of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23. The polynucleotides encoding the respective mature polypeptides of Figures 3A-3D could include: only the coding sequences Ífa4itAAlj Mtij A. A? JÍ »HAA. ^ A. for the mature polypeptides; the coding sequences for the respective mature polypeptides and additional coding sequences such as a leader or secretory sequence or a pro-protein sequence; the coding sequences for the respective mature polypeptides (and optionally the additional coding sequences) and non-coding sequences, such as introns or the 5 'and / or 3' non-coding sequence of the sequences encoding the mature polypeptide. Therefore, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide that includes only the coding sequences for the polypeptide as well as a polynucleotide that includes additional coding and / or non-coding sequences. The present invention also relates to variants of the polynucleotides described above in the present invention which code for fragments, analogs and polypeptide derivatives having the deduced amino acid sequence of Figures 3A-3D. The variant of the polynucleotide can be an allelic variant that occurs naturally in the polynucleotides or a variant that does not occur naturally in the polynucleotides. tuát i ÉÁ? tám.

Therefore, the present invention includes polynucleotides that encode the same respective mature polypeptides, as shown in Figures 3A-3D as well as variants of such polynucleotides whose variants code for fragments, derivatives or analogues of the polypeptides of Figures 3A -3D. Such nucleotide variants include deletion variants, substitution variants, and addition or insertion variants. As indicated above in the present invention the polynucleotide may have a coding sequence that is an allelic variant that occurs naturally in the coding sequence of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15 , 17, 19, 21 or 23. As is known in the art an allelic variant is an alternate form of a polynucleotide sequence having a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide. - The present invention also includes polynucleotides, in which the coding sequence for the mature polypeptide could be fused in the same reading frame to a polynucleotide that aids in the expression and secretion of a polypeptide from a ., > "T host cell, for example, a leader sequence that functions as a secretory sequence to control the transport of a polypeptide from the cell. The polypeptide having a leader sequence is a pre-protein and the host cell could cut the leader sequence to form the mature form of the polypeptide. The polynucleotides could also code for a pro-protein which is the mature protein plus the additional 5 'amino acid residues. A mature protein that has a pro-sequence is a pro-protein and is an inactive form of the protein. Once the pro-sequence is cut, an active mature protein remains. Therefore, for example, the polynucleotide of the present invention could with could codify for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a pre-sequence (leader sequence). The polynucleotides of the present invention could also have the coding sequence fused in frame to a marker sequence that allows purification of the polypeptide of the present invention. The marker sequence could be a hexa-histidine tag supplied by a pQE-9 vector to provide for the purification of the mature polypeptide fused to the tag in the case of a bacterial host or, for example, the tag sequence could be a tag of hemagglutinin (HA ) when a mammalian host is used, for example COS-7 cells. The HA mark corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I. et al., Cell 37: 767 (1984)). Additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence with at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 2; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 2, but lacking the N-terminal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 211 approximately in SEQ ID No. 2; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). The additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence of at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a sequence of nucleotide encoding the polypeptide having the amino acid sequence in SEQ ID No. 4; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 4, but lacking the N-terminal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 241 approximately in SEQ ID No. 4; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence of at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 6; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 6, but lacking Á * Í?,?. AÍ * m. tiM * of the N-terminal end methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 149 approximately in SEQ ID No. 6; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence of at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 8; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 8, but lacking the N-terminal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 170 approximately in SEQ ID No. 8; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). "Additional embodiments of the invention 1 include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence of at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% of identity with (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 10; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No 10, but lacking the N-terminal methionine, (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 190 approximately in SEQ ID No. 10; d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence with at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding the polypeptide having the sequence of amino acid in SEQ ID No. 12; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 12, but lacking the N-terminal methionine; (c) a sequence of H? Ú-.ÍI AÍ.Á i ..,? . IÍÁ ?? nucleotide 'which codes for the polypeptide having the amino acid sequence at positions from 1 to 191 approximately in SEQ ID No. 12; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence of at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 14; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 14, but lacking the N-terminal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 214 approximately in SEQ ID No. 14; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence per at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence that. encodes for the polypeptide having the amino acid sequence in SEQ ID No. 16; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 16, but lacking the N-terminal end methion; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 419 approximately in SEQ ID No. 16; or (d) a nucleotide sequence encoding the polypeptide having the amino acid sequence encoded by the cDNA clone contained in the ATCC deposit number 97149; (e) a nucleotide sequence encoding the mature VEGF2 polypeptide having the amino acid sequence encoded by the cDNA clone contained in the ATCC deposit number 97149; (f) a nucleotide sequence encoding the polypeptide encoded by the cDNA clone contained in the ATCC deposit number 97149, but lacking the N-terminal methionine; or (g) a sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f). The additional embodiments of the invention kflfc ^ ltiT. «^ fe ^». taA..ÍÍlffiafeái.JJ J * - "- 'Lj Amr ** - **, r * A. jC * tt * A, .jUJ ^ JtAjfc ^^ j ^ J include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence of at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a sequence of nucleotide encoding the polypeptide having the amino acid sequence in SEQ ID No. 18: (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 18, but lacking methionine from the N-terminal end, (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 207 approximately in SEQ ID No. 18, or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include nucl acid molecules eicos that comprise a polynucleotide having a nucleotide sequence with at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding for the polypeptide having the amino acid sequence in SEQ ID No. 20; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 20, but lacking of the methionine of the N-terminal end; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 325 approximately in SEQ ID No. 20; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence of at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 22; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 22, but lacking the N-terminal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 354 approximately in SEQ ID No. 22; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). Additional embodiments of the invention include isolated nucleic acid molecules comprising Í *? ii.á *?: * Mm? .A ~ t **. ... t, ** - ** *. **. ? m & < * HÉ & * Al'.1 *. »< 3 > A polynucleotide having a nucleotide sequence with at least 95% identity, and more preferred at least 96%, 97%, 98% or 99% identity with (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 24; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID No. 24, but lacking the N-terminal thermal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from 1 to 132 approximately in SEQ ID No. 24; or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), or (c). With the phrase a polynucleotide having a nucleotide sequence with at least, for example, 95% "identity" with a reference nucleotide sequence encoding an angiogenic polypeptide is meant that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence could include up to 5 point mutations per 100 nucleotides of the reference nucleotide sequence encoding the angiogenic polypeptide. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence could be deleted or substituted with another nucleotide, or could be inserted in the reference sequence a number of nucleotides up to 5% of the total nucleotides in the reference sequence. These mutations of the reference sequence could occur at the 5 'or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, scattered either individually between the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. As a practical matter, that a particular nucleic acid molecule is at least 95%, 96%, 97%, 98% or 99% identical to, for example, the nucleotide sequence shown in SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23 can be determined in conventional manner using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wl 53711). The Bestfit program uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best homology segment between two sequences. When the Bestfit program or any other sequence alignment program is used to determine whether or not a particular sequence is, for example, 95% identical to a reference sequence in accordance with the present invention, the parameters are set, of course. , in such a way that the percentage of identity is calculated through the complete length of the reference nucleotide sequence and that spaces in the homoology of up to 5% of the total number of nucleotides in the reference sequence are allowed. An "angiogenic" polynucleotide also includes those polynucleotides that can hybridize, under conditions of stringent hybridization, to the sequences contained in SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, or for example, the clone or cDNA clones contained in the ATCC deposit numbers 97149 or 75698, or the complements thereof. "Stringent hybridization conditions" refers to an overnight incubation at 4 ° C in a solution comprising 50% formamide, 5x SSC (750 mM NaCl, 75 mM sodium citrate), 50 mM phosphate sodium (7.6), 5x Denhardt solution of 10% dextran sulfate and 20 μg / ml of cut salmon sperm DNA, followed by washing the filters in 0.1 x SSC at 65 ° C approximately. The nucleic acid molecules can also be hybridized to the angiogenic polynucleotides under hybridization conditions with minor astringency. Changes in hybridization astringency and signal detection are achieved mainly by manipulating the formamide concentration (lower percentages of formamide result in reduced astringency); saline conditions or temperature. For example, minor stringency conditions include an overnight incubation at 37 ° C in a solution comprising 6X SSPE (20X SSPE = 3M NaCl, 0.2M NaH2P04, 0.02M EDTA, pH 7.4), 0.5% SDS, 30 % formamide, 100 μg / ml of DNA for blocking salmon sperm, - followed by washing at 50 ° C with 1XSSPE, 0.1% SDS. In addition, to achieve even less astringency, the washes made after the astringent hybridization can be performed at higher salt concentrations (eg 5X SSC). Note that variations in the above conditions can be achieved by inclusion and / or ? AjkátikjJ k? Hi¿Í. ** - *. **? A ?. < The substitution of alternating blocking reagents used to suppress the background in the reaction experiments. Typical blocking reagents include Denhardt reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available registered formulations. The inclusion of specific reagents for blocking may require modification of the hybridization conditions described above, due to problems with compatibility. Of course, a polynucleotide that hybridizes only to the polyA + sequences (such as any pol? A + region of the 3 'terminal end of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, may not be included in the definition of "polynucleotide", because such a polynucleotide will hybridize to any nucleic acid molecule containing a poly (A) stretch or complement thereof (eg, virtually any double-stranded cDNA clone) ). With the phrase a polynucleotide that hybridizes to a "portion" of a polynucleotide is meant a polynucleotide (either DNA or RNA) that hybridizes to at least about 15 nucleotides (nt) and more preferably at least about 20 nt, even more preferred at least about 20 nt, and still more preferred about 30-70 nt of the reference polynucleotide. These are useful as diassonic probes and primers as discussed above and in greater detail later. With the phrase a portion of a polynucleotide of "at least 20 nt in length" for example, is meant 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the nucleotide sequence of Table 1) . Of course, a polynucleotide that hybridizes only to a polyA sequence (such as the poly (A) stretch of the terminus 3 'terminal of SEQ ID NO: X), or a complementary stretch of residues T or (or U) will not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, due to that such a polynucleotide will hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone). "However, nucleic acid molecules having sequences at least 95%, 96%, 97%, are preferred, 98% or 99% identical to one of the sequences shown in SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, or to a nucleic acid sequence of the molecules of deposited cDNAs which in fact encode a polypeptide having angiogenic protein activity. By the phrase "a polypeptide having angiogenic activity" is meant polypeptides that exhibit angiogenic activity in a particular biological test. For example, angiogenic protein activity can be measured using, for example, mitogenic tests and endothelial cell migration tests. See, for example, Olofsson et al., Proc. Nati Acad. Sci. USA 93: 2576-2581 (1996) and Joukov et al., EMBO J. 5: 290-298 (1996). By the phrase "a polypeptide having lymphoangiogenic activity" is meant polypeptides having lymphoangiogenic activity in a particular biological test. For example, angiogenic protein activity can be measured using, for example, mitogenic tests and endothelial cell migration tests. See, for example, Olofsson et al., Proc. Nati Acad. Sci. USA 93: 2576-2581 (1996) and Joukov et al., EMBO J. 5: 290-298 (1996) See, for example, Olofsson et al., Proc. Nati Acad. Sci. USA 93: 2576-2581 (1996) and Joukov et al., EMBO J. 5: 290-298 (1996). Of course, due to the degeneracy of the genetic code, one skilled in the art will immediately recognize that a large number of nucleic acid molecules having a sequence of at least 90%95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence of the deposited cDNA molecules or of the nucleic acid sequences shown in SEQ ID NOS: 1, 3, 5, 7, 9 , 11, 13, 15, 17, 19, 21 or 23, will code for a polypeptide "having angiogenic protein activity". In fact, because the degenerate variants of these nucleotide sequences encode all for the same polypeptide, this is made clear to one skilled in the art even without performing the comparison test described above. It will also be recognized in the art that, for nucleic acid molecules that are not degenerate variants, a reasonable number of these will also code for a polypeptide having angiogenic protein activity. This is because the person skilled in the art is fully aware of the amino acid substitutions that less likely or do not significantly affect the function of the protein (e.g., replacing an aliphatic amino acid with a second aliphatic amino acid).

** For example, the guidelines concerning how to make phenotypically silent amino acid substitutions are provided in Bowie, JU et al., "Deciphermg the Message m Protein Sequences: Tolerance to Amino Acid Substitutions" Science 247: 1306-1310 (1990) , in which the authors indicate that proteins are surprisingly tolerant to amino acid substitutions. Therefore, the present invention is directed to polynucleotides having at least 70% identity, preferably at least 90% and more preferred at least 95%, 96%, 97% or 98% identity with a polynucleotide that codes for the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and the polypeptides encoded by such polynucleotides. "Identity" by itself has a recognized significance in the art and can be calculated using published techniques. (See, for example: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, AM, ed., Oxford Umversity Press, New York, (1988), BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, DW ed., Academic Press, New York, (1993 ); COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffm, AM and Griffin, HG eds., Humana Press, New Jersey, (1994); SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G., Academic Press, (1987); and SEQUENCE ANALYSIS PRIMER, Gpbskov, M. and Devereux, J., eds., M. Ston Press, New York, (1991) Although there are a number of methods for measuring the identity between two polynucleotide or polypeptide sequences, the The term "identity" is well known to those skilled in the art (Carrillo, H., and Lipton, D., SIAM J. Applied Math 48: 1073 (1988)). The methods commonly used to determine identity or similarity between two sequences include, but are not limited to, those described in "Guide to Huge Computers," Martin J. Bishop, ed., Academic Press, San Diego, ( 1994), and Carrillo, H., and Lipton, D., SIAM J. Applied Math. 48: 1073 (1988). Methods for aligning polynucleotides or polypeptides are encoded in computer programs, including the GCG program package (Devereux, J. et al., Nucleic Acids Research 12 (1): 387 (1984)), BLASTP, BLASTN, FASTA (Atschul , SF et al., J. Molec. Biol. 215: 403 (1990), the Bestfit program (Wisconsin sequence analysis package, version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wl. 53711 (using the local homology algorithm of Smith and Waterman, Advances in Appli ed Mathematics 2: 482-489 (1981)) With the phrase a polynucleotide having a nucleotide sequence with at least, for example, 95% " "identity" with a reference nucleotide sequence of the present invention, is meant that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence could include up to 5 point mutations per 100 nucleotides. two of the reference nucleotide sequence coding for the angiogenic polypeptide. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence could be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence could be inserted in the reference sequence. The sequence to be analyzed could be an entire sequence of the sequences SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, the ORF (open reading frame), or any fragment specified as described in the present invention. As a practical matter, it can be determined whether or not a particular nucleic acid molecule or polypeptide is identical in & minus 90%, 95%, 96%, 97%, 98% or 99% to a nucleotide sequence of the present invention, in a conventional manner using known computer programs. A preferred method for determining the best overall comparison between a sequence to be analyzed (a sequence of the present invention) and a reference sequence, also known as global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6: 237-245 (1990)). In a sequence alignment the sequences to be analyzed and reference are both DNA sequences. An RNA sequence can be compared by converting the U into T (uracil in thiouracil). The result of said global sequence alignment is in percent identity. The preferred parameters used in the FASTDB alignment of DNA sequences to calculate the percent identity are: Matrix = unitar? A, k-tuplo = 4, punishment for non-pairing = l, punishment for a? Ón = 30, length of group of randomization = 0, marking by cut = l, punishment by space = 5, punishment by space size = 0.05, window size = 500 or the reference nucleotide sequence length, whichever is shorter. If the reference sequence is shorter than the sequence to be analyzed due to 5 'or 3' deletions and not due to internal deletions, a manual correction to the results must be made. This is because the FASTDB program does not take into account truncations at the 3 'and 5' ends of the reference sequence when the percent identity is calculated. For the reference sequences truncated at the 5 'or 3' ends, in relation to the sequence to be analyzed, the percent identity is corrected by calculating the number of bases of the sequence to be analyzed which are at the 5 'and 3' ends of the sequence. the reference sequence, which are not paired / aligned, as one percent of the total bases of the sequence to be analyzed. Whether a nucleotide is paired / aligned or not determined with the results of the FASTDB sequence alignment. This percentage is subtracted after the identity percent calculated by the previous FASTDB program, using the specified parameters, to arrive at a final identity percent score. This corrected score is that which is used for the purposes of the present invention. Only the bases outside the bases of the 5 'and 3' end of the reference sequence, as shown by the FASTDB alignment, which are not paired / aligned with the sequence by Í.Á? * Ítí * t! ..,. R? .A .. ftt | fa. < , .. ** .1 analyze, calculate with the purpose of manually adjusting the percent identity score. For example, a reference sequence of 90 bases is aligned with a sequence to be analyzed from 100 bases to determine percent identity. The deletions occur at the 5 'end of the reference sequence and therefore, the FASTDB alignment does not show an alignment / alignment of the first 10 bases at the 5' end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5 'and 3' unpaired ends / total number of bases in the sequence to be analyzed) so that 10% of the sequence is subtracted or subtracted. identity percent score calculated by the FASTDB program. If the remaining 90 bases matched perfectly, the final identity percent would be 90%. In another example, a reference sequence of 90 bases is compared to a sequence to be analyzed of 100 bases. On this occasion the deletions are internal deletions in such a way that there are no bases at the 5 'or 3' ends of the reference sequence that are not paired / aligned with the sequence to be analyzed. In this case, the identity percent calculated by FASTDB is not manually corrected. Again, only the bases at the ends I A.A.k.JÁ.li A * Ar-i, * i. * J », t .. 5 'and 3' of the reference sequence that are not paired / aligned with the sequence to be analyzed are manually corrected. No other manual corrections are made for the purposes of the present invention. With the phrase a polypeptide having at least one amino acid sequence, for example, 95% "identical" to an amino acid sequence to be analyzed of the present invention, is meant that the amino acid sequence of the reference polypeptide is identical to the sequence to be analyzed except that the reference polypeptide sequence could include up to 5 amino acid alterations per 100 amino acids of the amino acid sequence to be analyzed. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to an amino acid sequence to be analyzed, up to 5% of the amino acid residues in the reference sequence could be inserted, deleted or substituted with another amino acid. These alterations of the reference sequence could occur at the ammo or carboxy terminal positions of the amino acid sequence or anywhere between those terminal positions, scattered either individually between the residues in the reference sequence or in one or more contiguous groups within the reference sequence. As practical, it can be determined whether or not a particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the amino acid sequences shown in Table 1 or the sequence of amino acids encoded by the deposited DNA clone, in conventional manner using known computer programs. A preferred method for determining the best overall comparison between a sequence to be analyzed (a sequence of the present invention) and a reference sequence, also known as global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6: 237-245). In a sequence alignment the sequences to be analyzed and reference are both nucleotide or amino acid sequences. The result of said global sequence alignment is in percent identity. The preferred parameters used in the FASTDB alignment are: Matr? Z = PAM 0, k-tuple = 2, punishment for non-mating = l, punishment for union = 20, length of randomization group = 0, marking by cut = l, window size = sequence length, penalty for space = 5, Or && amp; punishment for space size = 0.05, window size = 500 or the reference amino acid sequence length, whichever is shorter. If the reference sequence is shorter than the sequence to be analyzed due to deletions at the N- or C-terminal ends, not due to internal deletions, a manual correction to the results must be made. This is because the FASTDB program does not take into account the truncations at the N- or C-terminal ends of the reference sequence when the global identity percentage is calculated. For the reference sequences truncated at the N- and C-terminal ends, in relation to the sequence to be analyzed, the percent identity is corrected by calculating the number of residues of the sequence to be analyzed that are at the N- and C-termini. -terminals of the reference sequence, which are not paired / aligned, as a corresponding reference residue, as a percentage of the total bases of the sequence to be analyzed. Whether a residue is paired / aligned or not determined with the results of the FASTDB sequence alignment. This percentage is subtracted after the percent identity, calculated by the previous FASTDB program, using the parameters tm AÍ * A.Í A jí mA .. *, í * .áÁ-ll? .. specified, to reach a final identity percent score. This final identity percent score is that used for the purposes of the present invention. Only the residues of the N- and C-terminal ends of the reference sequence, which are not paired / aligned with the sequence to be analyzed, are considered for the purpose of manually adjusting the percent identity score. That is, only the positions of the residues to be analyzed outside the residues of the N- and C-terminal ends furthest from the reference sequence. For example, a reference sequence of 90 amino acid residues is aligned with a sequence of 100 residues to be analyzed to determine percent identity. Deletions occur at the N-terminus of the reference sequence and therefore, the FASTDB alignment does not show an alignment / alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the unpaired N- and C-terminal ends / total number of residues in the sequence to be analyzed) so that 10% of the sequence is subtracted or subtracted. the percent identity score calculated by the A *, tA * Aj.A *, ¡. ** ** - »**? ..., - a¡m | t,.": .... ^ _a-J m ^ ü ..- -JE , ... ^ ... H. A, "-m *. ** FASTDB program. If the remaining 90 residues matched perfectly, the final identity percent would be 90%. In another example, a reference sequence of 90 residues is compared with a sequence to be analyzed of 100 residues. On this occasion, deletions are internal deletions in such a way that there are no residues at the N- and C-terminal ends of the reference sequence that are not paired / aligned with the sequence to be analyzed. In this case, the identity percent calculated by FASTDB is not manually corrected. Again, only the positions of the residues outside the N- or C-terminal ends, as shown in the FASTDB alignment, that are not paired / aligned with the sequence to be analyzed are manually corrected. No other manual corrections are made for the purposes of the present invention.

Angiogenic polypeptides The present invention also relates to polypeptides having the deduced 3A-3D sequences, as well as fragments, analogs, and derivatives of such polypeptides. In the present invention a "polypeptide fragment" refers to an amino acid sequence "'' - .-. 'f ^ cuts SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, or encoded by the cDNA contained in a deposited clone. Protein fragments can be "independent", or to be comprised within a larger polypeptide of which the fragment forms a part or region, more preferred as a single continuous region. Representative examples of the polypeptide fragments of the invention, include for example, fragments from amino acid No. 1-20, 21-40, 41-60, 61-80, 81-100, 102-120, 121-140, 141-160, 161-180, 181-200, 201-220, 221-240, 241-260, 261-280 or approximately 281 until the end of the coding region. In addition, the polypeptide fragments can be of 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 amino acids approximately in length. In this context "approximately" includes the intervals indicated in particular, larger or smaller by several amino acids (5, 4, 3, 2 or 1), at either end or at both ends (see Table 1).

TABLE 1 Preferred polypeptide fragments include the secreted angiogenic protein as well as the mature form. More preferred polypeptide fragments include the secreted angiogenic protein or the mature form having a continuous series of residues deleted from the terminal ammo- or carboxy terminal, or both. For example, any number of amino acids can be deleted in a range of 1-60 from the amino terminus of either the secreted angiogenic polypeptide or the mature form. In the same way, any number of amino acids can be deleted, in a range of 1-30 from the carboxy terminal end of the secreted angiogenic protein or the mature form. In addition, any of the combinations are preferred of the previous deletions at the terminal amino- and carboxy termini. Likewise, polynucleotide fragments that code for these angiogenic polypeptide fragments are also preferred. Also preferred are angiogenic polypeptide and polypeptide fragments characterized by structural or functional domains, such as fragments comprising the regions of the alpha helix and those forming the alpha helix, the regions forming the beta sheet and the region of the beta sheet, the regions of turn and the regions that form the turns, the region of the spiral and the region that forms the spiral, the hydrophilic regions, the hydrophobic regions, the amphipatic alpha regions, the beta amphipathic regions, flexible regions, the surface forming regions, the substrate binding region and regions of high antigenic index. The poly fragments of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24 that fall within the conserved domains are contemplated specifically by the present invention. (See figures 3A-3D). In addition, the polynucleotide fragments encoding these domains are also contemplated. Other preferred fragments are fragments of biologically active angiogenic protein. Biologically active fragments are those that exhibit similar, but not necessarily identical, activity to an activity of one of the described angiogenic polypeptides. The biological activity of the fragments could include a desired enhanced activity or a reduced undesirable activity. The polypeptides of the present invention can be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides. It will be recognized in the art that some amino acid sequences of the angiogenic polypeptides can be varied without significantly affecting the structure or function of the protein. If such differences in the sequence are contemplated, it must be remembered that there will be critical areas in the protein that determine the activity. Therefore, the invention also includes variations of the angiogenic polypeptides that demonstrate substantial angiogenic polypeptide activity or that include regions of angiogenic proteins such as the protein portions discussed below. Such mutants include deletions, insertions, inversions, ? ^? AIÍÁI * repetitions and substitutions of type. As indicated above, the guidelines concerning which of the amino acid changes have the probability of being phenotypically silent can be found in Bowie, J.U. et al. , "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247: 1306-1310 (1990). Therefore, the fragments, derivatives or analogues of the polypeptides of Table 1 could be: (I) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a residue of conserved amino acid) and such a substituted amino acid residue could be encoded or not by the genetic code; or (ii) one in which one of the amino acid residues includes a substituent group; or (iii) one in which the mature polypeptide is fused with another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol); or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence that is used to purify the mature polypeptide or a pro-protein sequence; or (v) one that comprises few amino acid residues shown in SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, and that retains the conserved motif and continues to retain the activity characteristics of the VEGF / PDGF polypeptide family. Such fragments, derivatives, and analogs are considered to be within the scope of those skilled in the art from the teachings of the present invention. Substitutions of charged amino acids with another charged amino acid and with amino acids with neutral or negative charge are of particular interest. The latter result in proteins that have reduced positive charge to improve the characteristics of the angiogenic protein, it is quite desirable to avoid aggregation. The aggregation of proteins not only results in the loss of activity but can also cause problems when preparing pharmaceutical formulations, because these can cause an immune response (Pinckard et al., Clin. Exp. Imol. 2: 331- 340 (1967); Robbinson et al., Diabetes 36: 838-845 (1987); Cleland et al., Cri., Rev. Therapeutic Drug Carrier Systems 10: 307-377 (1993)). Amino acid replacement can also change the selectivity of binding to cell surface receptors Ostade et al. , Nature 361: 266-268 (1993) Í A A * * .. ..,,,,,,, describen describen describen describen describen describen describen describen,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, TN TN TN TN TN TN TN TN TN TN TN TN TN TNF-alpha a a a * *,,,,,,, a. Therefore, the angiogenic proteins of the present invention could include one or more amino acid substitutions, deletions or additions either from natural mutations or caused by the man . As indicated, the preference changes are from a minor nature, such as conservative amino acid substitutions that do not significantly affect the configuration or activity of the protein (see table 2).

TABLE 2 Conservative amino acid substitutions Aromatic Phenylalanine, tryptophan, t iros ina Hydrophobic Leucine, Isoleucine, Valine Polar Glutamine, Asparagine Basics Arginine, Lysine and Histidine Acid Aspartic Acid, Glutamic Acid Small Alanine, Serine, Threonine, Methionine, Glycine Of course, the number of amino acid substitutions that a person skilled in the art could make depends im -A *. ** m rA *. of many factors, including those described above. Generally speaking, the number of substitutions for any angiogenic polypeptide determining will not be greater than 50, 40, 30, 25, 20, 15, 10, 5 or 3. The amino acids in the angiogenic proteins of the present invention which are essential for their functioning can be identified by methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). This last procedure introduces individual mutations of alanine in each residue of the molecule. The resulting mutant molecules are then evaluated for biological activity, such as receptor binding activity or proliferative activity in vi tro or in vivo. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224: 899-904 (1992) and de Vos et al., Science 255: 306-312 (1992)). The polypeptides and polynucleotides of the present invention are preferably provided in isolated form, and it is also preferred that they are purified up to * $ s homogeneity. The term "isolated" means that the material is removed from its original environment (from the natural environment if it occurs in nature). For example, a polynucleotide or polypeptide that occurs naturally and that is present in a living animal is not isolated, but the same polynucleotide or DNA or polypeptide, separated from some or all of the materials coexisting in the natural system, is isolated. Such a polynucleotide could be part of a vector and / or such a polynucleotide or polypeptide could be part of a composition and still be isolated in the sense that such a vector or composition is not part of its natural environment. In specific embodiments, the polynucleotides of the invention have a length of less than 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb or 7.5 kb. In a further embodiment, the polynucleotides of the invention comprise at least 15 contiguous nucleotides of the coding sequence of an angiogenic protein described, but do not comprise all or a portion of any intron of the particular angiogenic protein. In another embodiment, the nucleic acid comprising a coding sequence for a particular angiogenic protein does not contain coding sequences for a genomic flanking gene (ie, 5 'p 3' to the gene of the particular angiogenic protein in the genome). The polypeptides of the present invention include the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24 (and in particular the mature polypeptide thereof), as well such as polypeptides having at least 70% similarity (preferably at least 70% identity) with the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24 and more preferred at least 90% similarity (more preferred at least 95% identity) with the polypeptides of SEQ ID NOS : 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, and even more preferred to at least 95% similarity (even more preferred at least 90% identity with the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24 and also includes portions of such polypeptides comprising such portions of the polypeptide generally, at least 30 amino acids and more preferred at least 50 amino acids As already known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acids substitutes of a polypeptide with the sequence of a second polypeptide.

The fragments or portions of the polypeptides of the present invention could be used to produce the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments could be used as intermediates to produce full-length polypeptides. The fragments or portions of the polynucleotides of the present invention could be used to synthesize the full length polynucleotides of the present invention.

Deletions at the terminal amino and terminal carboxy ends In addition, genetic manipulation of proteins can be used in order to improve or alter one or more characteristics of the original angiogenic proteins. The suppression of carboxy terminal amino acids can enhance the activity of proteins. An example is the inferieron gama that shows an activity up to 10 times higher when 10 amino acid residues are deleted from the carboxy terminal end of the protein (Dóbeli et al., J. of Biotechnology 7: 199-216 (1988)). Therefore, one aspect of the invention is to provide polypeptide analogues of the angiogenic proteins and nucleotide sequences that id ^ a.á ajtaai.aaia code for such analogs that exhibit increased stability (eg, when exposed to typical thermal, pH or other storage conditions) with reaction to the original angiogenic protein. The present invention also includes deletion mutants having amino acids deleted from both N-terminal and C-terminal ends. Such mutants include all combinations of N-terminal deletion mutants and C-terminal deletion mutants described by the following formulas. Such combinations can be made using recombinant techniques known to those skilled in the art. In particular, deletions at the N-terminal end of the angiogenic polypeptides can be described by the following general formulas: 1) m2-211, where m2 is an integer from 1 to 210, where m2 corresponds to the position of the amino acid residue in SEQ ID NO: 2. In addition, deletions at the C-terminal end can also be described by the general formula l-n2, in which n2 is an integer from 2 to 211 in which n2 corresponds to the position of the amino acid residue identified in SEQ ID NO: 2. In addition, the invention tAAMtmit. * - * - "mylia also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m2-n2 of SEQ ID NO: 2, in which n2 and m2 are whole as described above. 2) m4-241, in which m is an integer from 1 to 240, in which m4 corresponds to the position of the amino acid residue in SEQ ID NO: 4. In addition, deletions at the C-terminal end can also be describe by the general formula l-n4, in which n4 is an integer from 2 to 241 in which n4 corresponds to the position of the amino acid residue identified in SEQ ID NO: 4. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m4-n4 of SEQ ID NO: 4, in which n4 and m4 are integers as described above. 3) m6-149, in which m4 is an integer from 1 to 148, in which m6 corresponds to the position of the amino acid residue in SEQ ID NO: 6. In addition, deletions at the C-terminus can also be made. describe by the general formula l-n6, in which n6 is an integer from 2 to 149 in which n6 corresponds to the position of the residue of .AA-AAJUUt r- -Í.? «..atea». -i._a «fc. amino acid identified in SEQ ID NO: 6. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m6-n6 of SEQ ID NO: 6, in which n6 and m6 are integers like those described above. 4) m8-170, in which m8 is an integer from 1 to 169, in which m8 corresponds to the position of the amino acid residue in SEQ ID NO: 8. In addition, deletions at the C-terminal end can also be describe by the general formula l-n8, in which n8 is an integer from 2 to 170 in which n8 corresponds to the position of the amino acid residue identified in SEQ ID NO: 8. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m8-n8 of SEQ ID NO: 8, in which n8 and m8 are integers as described above. 5) m10-190, in which m? 0 is an integer from 1 to 189, in which m10 corresponds to the position of the amino acid residue in SEQ ID NO: 10. In addition, deletions at the C-terminus also can be described by the general formula l-n10, in which n? 0 is an integer from 2 to 190 in which n10 corresponds to the position of the amino acid residue identified in SEQ ID NO: 10. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m10-n10 of SEQ ID NO: 10, in which n? 0 and m10 are integers such as those described previously. 6) m12-191, in which m12 is an integer from 1 to 190, in which m12 corresponds to the position of the amino acid residue in SEQ ID NO: 12. In addition, deletions at the C-terminus can also be made. describe by the general formula l-n1, in which n12 is an integer from 2 to 191 in which n12 corresponds to the position of the amino acid residue identified in SEQ ID NO: 12. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m12-ni2 of SEQ ID NO: 12, in which n12 and m12 are integers as described above. 7) m? 4-214, in which m1 is an integer from 1 to 213, where m6 corresponds to the position of the amino acid residue in SEQ ID NO: 14. In addition, deletions at the C-terminus also can be described by the general formula l-n14, in which ni4 is an integer from 2 to 214 in which ni4 corresponds to the position of the amino acid residue identified in SEQ ID NO: 14. In addition, the invention also provides polypeptides having one or more amino acids deleted from both terminal amino and terminal carboxy termini, which can generally be described as having residues m14-n? 4 of SEQ ID NO: 14, in which ni4 and mi4 are integers as described above. 8) rri? 6-419, where m? 6 is an integer from 1 to 418, in which i6 corresponds to the position of the amino acid residue in SEQ ID NO: 16. In addition, deletions at the C-terminus terminal can also be described by the general formula l-n16, in which n16 is an integer from 2 to 419 in which n16 corresponds to the position of the amino acid residue identified in SEQ ID NO: 16. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m? 6-n? 6 of SEQ ID NO: 16, in which ni6 and mi6 are integers as those described above. A polypeptide fragment comprising the amino acid residues F-32 to R-226 of SEQ ID NO: 16 as well as the polynucleotides of the invention is specifically preferred. Í? K álÉ, Í¿ * ÍA. * Ü ** .Í, Í .. they code for this polypeptide. In addition, another preferred embodiment comprises amino acids S-228 to S-419 of SEQ ID NO: 16. Polynucleotides encoding this polypeptide are also preferred. In addition, this polypeptide F-32 to R-226 of SEQ ID NO: 16 is preferably associated with a polypeptide S-228 to S-419 of SEQ ID NO: 16. The association can be through disulfide, covalent interactions or non-covalent, by binding through a linker (linkers of the serine, glycine, proline type), or by an antibody. 9) m18-207, in which rri? 8 is an integer from 1 to 206, in which m8 corresponds to the position of the amino acid residue in SEQ ID NO: 18. In addition, deletions at the C-terminus also they can be described by the general formula l-n18, in which ni8 is an integer from 2 to 207 in which ni8 corresponds to the position of the amino acid residue identified in SEQ ID NO: 18. In addition, the invention also provides polypeptides that they have one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can generally be described as having residues m18-n? 8 of SEQ ID NO: 18, in which ni8 and m are integers as described above. 10) m20-325, in which m20 is an integer of 1 to illAJgJi .t ,: a .... i ... 324, in which m20 corresponds to the position of the amino acid residue in SEQ ID NO: 20. In addition, deletions at the C-terminus can also be described by the general formula l-n20, in which n20 is an integer from 2 to 325 in which n20 corresponds to the position of the amino acid residue identified in SEQ ID NO: 20. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which are can generally be described as having residues m20-n20 of SEQ ID NO: 20, in which n20 and m20 are integers as described above. 11) m22-354, in which m22 is an integer from 1 to 353, in which m22 corresponds to the position of the amino acid residue in SEQ ID NO: 22. In addition, deletions at the C-terminus can also be describe by the general formula l-n22, in which n22 is an integer from 2 to 354 in which n22 corresponds to the position of the amino acid residue identified in SEQ ID NO: 22. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can be described in general by having residues m22-n22 of SEQ ID NO: 22, in which n22 and m22 are integers as the alescruos above. 12) m24-132, in which m24 is an integer from 1 to 131, in which m24 corresponds to the position of the amino acid residue in SEQ ID NO: 24. In addition, deletions at the C-terminal end can also be described by the general formula l-n24, in which n24 is an integer of 2 to 132 in which n24 corresponds to the position of the amino acid residue identified in SEQ ID NO: 24. In addition, the invention also provides polypeptides having one or more amino acids deleted from both amino terminal and carboxy terminal ends, which can be describe in general having residues m24-n24 of SEQ ID NO: 24, in which n24 and m24 are integers as described above. In yet another aspect, the present invention also includes deletion mutants having amino acids deleted from both the N-terminal and C-terminal residues. Such mutants include all combinations of the N-terminal deletion mutants and deletion mutations described above. In another aspect of the invention, the mutants of the angiogenic polypeptide sequences described are useful as screening agents for detecting agonists and / or antagonists of angiogenic activity, or these may be modify to be used as an agonist-type agent and / or antagonists for the angiogenic activity of the disclosed angiogenic polypeptides, or they can be used in a co-treatment application together with another agent, such as a monoclonal antibody specific for a polypeptide Angiogenic described, for example, whose result may be of the agonist and / or antagonist type for the angiogenic activity of the described angiogenic polypeptides. In another aspect of the invention, fragments of the other angiogenic polypeptides of the invention referred to and described can be generated, SEQ ID NOS: 2, 4,6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21 or 23 to produce mutants that could be useful as agonist and / or antagonist type agents for Modulate the activities of the described angiogenic polypeptides. In addition, these polypeptide mutants could be used in a co-treatment application together with another agent, such as a monoclonal antibody specific for an angiogenic polypeptide described, for example, to enhance or reduce a desired specific activity. The term "gene" means the segment of DNA involved in the production of a polypeptide chain; it includes regions before and after the coding region (leader and trailing) as well as interspersed sequences (introns) between the individual coding segments (exons). The present invention is also directed to fragments of the isolated nucleic acid molecules described in the present invention with the phrase a fragment of an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NOS: 1, 3, 7 , 9, 11, 13, 15, 17, 19, 21 or 23, are meant fragments of at least about 15 nt, and more preferred at least about 20 nt even more preferred at least about 30 nt and still more preferred at least about 40 nt in length which are useful as diagnostic probes and primers as discussed in the present invention. Of course, the longest fragments of 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 1000, 1025, 1050, 1075, 1100, 1125, 1150, 1175, 1200, 1225, 1250, 1275, 1300, 1325, 1350, 1375, 1400, 1425, 1450, 1475, 1500, 1525, 1550, 1575, 1600, 1625 or 1650 nt of length are also useful in accordance with the present invention as are the fragments corresponding to most, if not all, of the nucleotide sequences shown in SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23. With the phrase a fragment of at least 20 nt in length, for example, is meant fragments that include 20 or more contiguous bases from the nucleotide sequence shown in SEQ ID. NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23. In this context "approximately" includes the intervals indicated in particular, larger or smaller by several (5, 4, 3, 2 or 1) nucleotides, at either end or both terminal ends (5, 4, 3, 2 or 1). Preferably, these fragments code for a polypeptide having biological activity. The full-length gene fragments of the present invention could be used as a hybridization probe for a cDNA library to isolate the full length cDNA and to isolate other cDNA molecules having a high sequence similarity to the gene or a similar biological activity. Preferably, probes of this type have at least 30 bases and could contain, for example, 50 or more bases. The probe could also be used to identify a cDNA clone corresponding to a full-length transcript and a clone or genomic clones containing the complete gene including regulatory and promoter regions, exons and introns. An example of a selection comprises isolating the coding region of the gene using the known DNA sequence to synthesize an oligonucleotide probe. The labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to select a library of cDNA, genomic DNA or human mRNA to determine which of the elements of the library the probe hybridizes to.

Fusion proteins Any described angiogenic polypeptide can be used to generate fusion proteins. For example, angiogenic polypeptides can be used, when they are fused to a second protein as an antigenic tag. Antibodies raised against the angiogenic polypeptide can be used to indirectly detect the second protein by binding to the angiogenic polypeptide. In addition, because the secreted proteins target cell sites based on 1 the traffic signals, the angiogenic polypeptides could be used as a molecule to select targets once they are fused to other proteins. Examples of domains that can be fused to the described angiogenic polypeptides include not only heterologous signal sequence, but also other heterologous functional regions. The fusion does not necessarily have to be direct, but can be presented through linker sequences. In addition, the fusion proteins could also be engineered to improve the characteristics of one or more of the described angiogenic polypeptides. For example, a region of additional amino acids, in particular amino acids charged to the N-terminus of the angiogenic polypeptides can be added to improve stability and persistence during purification from the host cell or subsequent handling and storage. In addition, peptide portions can be added to any of the disclosed angiogenic polypeptides to facilitate purification. Such regions can be removed prior to the final preparation of the particular angiogenic polypeptide. The addition of peptide portions to facilitate -; "3ne or ae polypeptides are techniques . * .Á * M..aa-a ^ aja-i familiar and routine in the field. In addition, the disclosed angiogenic polypeptides, including fragments, and specifically epitopes with portions of the constant domain of the immunoglobulins (IgG) can be combined, which results in chimeric polypeptides. These fusion proteins facilitate purification and have an increased half-life in vivo. One reported example describes chimeric proteins consisting of the first two domains of the human CD4- polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EP A 394,827; Traunecker et al., Na ture 331: 84-86 (1988)). Fusion proteins having dimeric structures linked by disulfide bridges (due to IgG) could also be more efficient in binding and neutralizing other molecules, than the secreted monomeric protein or a protein fragment alone (Fountoulakis et al., J. Biochem 270: 3958-3964 (1995)). Similarly, EP-A-0 464 553 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of the constant region of immunoglobulin molecules together with another human protein or a portion thereof. In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis, and can therefore result, for example, in improved pharmacokinetic properties (EP-A 0232 262). Alternatively, deletion of the Fc part would be desirable after the fusion protein has been expressed, detected and purified. For example, the Fc portion could hinder therapy and diagnosis if the fusion protein will be used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hIL-5, have been fused with Fc portions for the purpose of high throughput screening tests to identify hIL-5 antagonists. (See, D. Bennett et al., J. Molecular Recognition 8: 52-58 (1995); K. Johanson et al., J. Biol. Chem. 270: 9459-9471 (1995) .In addition, angiogenic polypeptides described may be fused to marker sequences, such as a peptide to facilitate the purification of a particular angiogenic polypeptide In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the Tag tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. _- *** -,? l ^. ^, Nati. Acad. Sci. USA 86: 821-824 (1989), for example, hexa-histidine ensures convenient purification of the fusion protein. Another peptide tag useful for purification, the "HA" marker which corresponds to an epitope obtained from the influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (1984)). Therefore, any of these prior fusions can be engineered using the described angiogenic polypeptides.

Vectors and host cells The present invention also relates to vectors containing polynucleotides encoding the described angiogenic proteins, host cells and the production of the polypeptides by recombinant techniques. The vector could be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors can be replication competent or replication defective. In the latter case, viral propagation will usually only occur in complementary host cells. The polynucleotides that code for the angiogenic proteins described can be attached to a vector fcj | .Í. «jfit, t« tt? f *. that contains a marker that can be selected for its propagation in a host. In general, a plasmid vector is introduced into a precipitate, such as a calcium phosphate precipitate, or into a complex with a charged lipid. If the vector is a virus, it could be packaged in vi tro using a packaging cell line and then transduced into host cells. The polynucleotide insert encoding the angiogenic protein of interest described must be operably linked to an appropriate promoter, such as the PL promoter from lambda phage, the E. coli lac, trp, phoA and tac promoters, the initial and of SV40 and retroviral LTR promoters to name a few. Other suitable promoters will be known to the person skilled in the art. The expression constructs will also have sites for the initiation and termination of transcription, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs will preferably include a start translation codon at the start and a stop codon (UAA, UGA or UAG) appropriately placed at the end of the polypeptide to be translated.

As indicated, the expression vectors of preference will include at least one selectable marker. Such markers include genes for dihydrocodeto reductase, G418 or neomycin resistance for eukaryotic cell culture and resistance genes for tetracycline, kanamycin or ampicillin to grow in E. coli and other bacteria. Representative examples of suitable hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as the S2 cells of Drosophila and Sf9 of Spodoptera; animal cells such as CHO, COS, 293 cells and Bowes melanoma cells; and plant cells. The culture media and conditions appropriate for the host cells described above are known in the art. Preferred vectors for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN, Inc .; Bluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc .; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc ,. among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene, and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be readily apparent to one skilled in the art. The introduction of the construction into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid mediated transfection, electroporation, infection transduction, or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology. (1986). It is specifically contemplated that the described angiogenic polypeptides can be expressed, in fact, by a host cell lacking a recombinant vector. The disclosed angiogenic polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anionic or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, chromatography of affinity, romatography with hydroxyapatite and chromatography with leptin. Most preferably, high performance liquid chromatography ("HPLC") is used for the purification. The described angiogenic polypeptides, and preferably the secreted form, can also be recovered from purified products from natural sources, including fluids, tissues and body cells, whether they are directly isolated or cultured; products of chemical synthesis processes and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending on the host used in a recombinant production process, the described angiogenic polypeptides may or may not be glycosylated. In addition, the described angiogenic polypeptides could also include an initial residue of modified methionine, in some cases as a result of host-mediated processes. Therefore, it is well known in the art that the N-terminal methionine encoded by the translation start codon is usually removed with high efficiency of any protein after translation in all eukaryotic cells. Although N-terminal methionine in most proteins is also efficiently eliminated in most procapone, for some proteins, this process of elimination in prokaryotes is inefficient, depending on the nature of the amino acid to which methionine from the N-terminal end is covalently linked. In addition to encompassing host cells containing the vector constructs discussed in the present invention, the invention also encompasses primary, secondary and immortalized host cells of vertebrate origin, in particular of mammalian origin, which have been engineered to suppress or replace the material endogenous gene (e.g., the coding sequence of the angiogenic protein), and / or to include genetic material (e.g., heterologous polynucleotide sequences) that are operably associated with the polynucleotides encoding the disclosed angiogenic proteins of the invention, and which activate / alter and / or amplify the exogenous polynucleotides encoding the angiogenic proteins described. For example, techniques known in the art can be used to operably associate the heterologous control regions (e.g. promoter and / or enhancer) and the endogenous polynucleotides that .í? ÁÁÁ * A? bá * i¿á¡. ^ - -. *, **. * .TO. i code for the angiogenic protein sequences described by homologous recombination (see, for example, U.S. Patent No. 5,641,670, issued June 24, 1997, International Publication No. WO 96/29411, published September 26, 1996; International publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc. Nati, Acad. Sci. USA 86: 8932-8935 (1989); and Zijlstra et al., Nature 342: 435 -438 (1989), the descriptions of which are incorporated herein by reference in their entirety In addition, the polypeptides of the invention can be chemically synthesized using techniques known in the art (for example, see Creighton, 1983, Proteins: Structures and Molecular Principies, WH Freeman & Co. , N.Y., and Hunkapiller, M., et al., 1984, Nature 310: 105-111). For example, a peptide corresponding to a fragment of an angiogenic polypeptide of the invention can be synthesized using a peptide synthesized. In addition, if desired, amino acids of the non-classical type or chemical analogues of amino acid can be introduced as a substitution or addition in the sequence of polynucleotides encoding the angiogenic protein. Non-classical amino acids include, but are not limited to, the D-isomers of the common amino acids 2, 4-diaminobutyric acid, α-ammo isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino acid isobutyric acid, 3-aminopropionic acid, ornithma, norleucma, norvaline, hydroxyprolma, sarcosine, citrulma, homocitrulin, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylamine, b-alanine, fluorine-amino acids, designer amino acids such as b-methyl amino acids, Ca-methylamino acids, Na-methylammo acids and acid analogs in general. In addition, the amino acid can be D (dextrorotatory) or L (levorotatory). The invention encompasses angiogenic polypeptides that are differentially modified during or after translation, for example by glycosylation, acetylation, phosphorylation, amidation, or formation of derivatives by known protecting / blocking groups, proteolytic cleavage, binding to an antibody molecule or another cellular ligand, etc. any of a number of chemical modifications can be effected by known techniques, including but not limited to specific chemical cleavage with cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tumicamicma. Additionally, post-translational modifications encompassed by the invention include, for example, N-linked or O-linked carbohydrate chains, N-terminal or C-terminal processing, attachment of chemical moieties to the base structure of amino acid, chemical modifications of the N-linked or O-linked carbohydrate chains and the addition or deletion of an N-terminal methionine residue as a result of expression in prokaryotic host cells. The polypeptides can also be modified with a detectable marker, such as an enzymatic, fluorescent, isotopic or affinity tag to allow detection and isolation of the protein. The invention also provides chemically modified derivatives of angiogenic proteins which could provide additional advantages such as improved solubility, stability and circulation time of the polypeptide, or reduced immunogenicity (see U.S. Patent No. 4,179,337). The chemical portions for the formation of derivatives can be selected from water-soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, i - - i. *, liiH? = Salfa carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides could be modified at random positions within the molecule, or at predetermined positions within the molecule and could include 1, 2, 3 or more chemical moieties attached. The polymer can be of any molecular weight and could be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about KDA and about 100 kDa (the term "about" indicates that in polyethylene glycol preparations, some molecules will weigh more, some less, than the indicated molecular weight) to facilitate handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (for example, the duration of sustained release desired effects, if any, on biological activity, ease of handling, degree or lack of antigenic character, and other known effects). of polyethylene glycol for a therapeutic or analogous protein Polyethylene glycol molecules (or other chemical moieties) must be bound to the protein by considering the effects on the functional or antigenic domains of the protein There are a number of binding methods available to those skilled in the art. technique, for example EP 0 401 384, incorporated in the present invention for reference (coupling of PEG to G-CSF), see also Malik et al., Exp. Hematol 20: 1028-1035 (1992) which reports the treatment with PEG of GM-CSF using trecilous chloride). For example, polyethylene glycol can be covalently linked by amino acid residues through a reactive group, such as a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule can be attached. Amino acid residues that have a free amino group could include lysine residues and the amino acid residues of the N-terminus; those having a free carboxyl group could include aspartic acid residues, glutamic acid residues, and the C-terminal amino acid residues. Sulfhydryl groups could also be used as a reactive group to join the polyethylene glycol molecules. For the therapeutic purposes, binding in a lower group is preferred, such as binding at the N-terminal end or in the lysine group. Chemically modified proteins at the N-terminus could be specifically desired. Using polyethylene glycol as an illustration of the The present composition can be selected from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.) the proportion of polyethylene glycol molecules to protein molecule (or peptide) in the reaction mixture, the type of reaction with polyethylene glycol to be made, and the method to obtain the protein treated with PEG at the selected N-terminal end. The method for obtaining the PEG-treated preparation at the N-terminus (ie the separation of this portion from the other portions with a single PEG molecule, if necessary) could be by purification of the PEG-treated material at the end. N-terminal from a population molecules treated with PEG. Selectively chemically modified proteins can be achieved in the modification of the N-terminal end by reductive alkylation which exploits the differential reactivity of the different types of primary ammo groups (lysine versus N-terminal) available for the formation of derivatives in a particular protein. Under the appropriate reaction conditions, the formation of derivatives is substantially selective of the N-terminal protein with a polymer containing carbonyl groups. The angiogenic polypeptides of the invention they can be in monomers or multimers (ie dimers, trimers, tetramers or higher multimers). Accordingly, the present invention relates to monomers and multimers of the described angiogenic polypeptides of the invention, their preparation and compositions (preferably, pharmaceutical compositions) containing them. In specific embodiments, the polypeptides of the invention are monomers, dimers, trimers or tetramers. In further embodiments, the multimers of the invention are at least dimers, at least trimers or at least tetramers. The multimers encompassed by the invention can be homomers or heteromers. As used in the present invention, the term homomer, refers to a multimer containing only angiogenic polypeptides of the invention (including fragments, variants, splice variants and fusion proteins of the angiogenic proteins as described in the present invention. ). These homomers may contain angiogenic polypeptides having the same or different amino acid sequences. In a specific embodiment, a homomer of the invention is a multimer containing only polypeptides having an amino acid sequence to one of the proteins angiogenic described. In another specific embodiment, a homomer of the invention is a multimer containing angiogenic polypeptides having different amino acid sequences. In specific embodiments, the multimer of the invention is a homodimer (eg, they contain angiogenic polypeptides having identical or different amino acid sequences) or a homotrimer, for example, (eg, they contain angiogenic polypeptides having identical and / or different amino acid sequences. ). In the further embodiments, the homomeric multimer of the invention is at least one homodimer, at least one homotrimer or at least one homotetramer. As used in the present invention, the term "heteromer" refers to a multimer containing one or more heterologous polypeptides (ie, different protein polypeptides) in addition to the angiogenic polypeptides of the invention. In a specific embodiment, the multimer of the invention is a heterodimer, a heterotrimer or a heterotetramer. In the further embodiments, the multimer of the invention is at least one homodimer, at least one homotrimer or at least one homotetramer. The multimers of the invention could be the result of hydrophobic, hydrophilic, ions and / or covalent associations and / or they could be linked indirectly, for example, by liposome formation. In this way, in one embodiment, the multimers of the invention, such as, for example, homodimer and homotrimers, are formed when the polypeptides of the invention come into contact with one another in solution. In another embodiment, the heteromultimers of the invention, such as, for example, heterotrimers or heterotetramers, are formed when the polypeptides of the invention come into contact with the antibodies to the polypeptides of the invention (including antibodies to the heterologous polypeptide sequence in the a fusion protein of the invention) in solution. In other embodiments, the multimers of the invention are formed by covalent associations with and / or between the angiogenic polypeptides of the invention. Such covalent associations could involve one or more amino acid residues contained in the polypeptide sequences (for example, those indicated in SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24). In one example, the covalent associations are intertwined between the cysteine residues located within the polypeptide sequences that interact in the original polypeptide (i.e., they occur naturally). In another case, the covalent associations are the consequence of chemical or recombinant manipulation. Alternatively, such covalent associations could involve one or more amino acid residues contained in the sequence of the heterologous polypeptide in an angiogenic fusion protein. In one example, the covalent associations are between the heterologous sequence contained in a fusion protein of the invention (see, for example, U.S. Patent No. 5,478,925). In a specific example, the covalent associations are between the heterologous sequence contained in an angiogenic polypeptide-Fc fusion protein (as described in the present invention). In another specific example, the covalent associations of the fusion proteins of the invention are between the heterologous polypeptide sequence from another ligand / receptor member of the TNF family that can form covalently associated multimers, such as, for example, osteoprotegerin ( see, for example, international publication No. WO 98/49305, the contents of which are incorporated herein by reference in their entirety). The multimers of the invention can be generated using chemical techniques known in the art. For example, polypeptides that are desired to be contained in the multimers of the invention can be chemically entangled using linker molecules and linker molecule length optimization techniques known in the art (see, e.g., U.S. Patent No. 5,478,925, which are incorporated in the present invention for reference in its entirety). Additionally, the multimers of the invention can be generated using techniques known in the art to form one or more intermolecular interlaces between the cysteine residues located within the sequence of the polypeptides that are desired to be contained in the multimer (See, for example, U.S. Patent No. 5, 478, 925, which is incorporated herein by reference in its entirety). In addition, the polypeptides of the invention can be modified routinely by the addition of cysteine or biotin to the C-terminal or N-terminal end of the polypeptide and techniques known in the art can be applied to generate multimers containing one or more of these modified polypeptides (see, for example, U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). Additionally, techniques known in the field can be applied to generate liposomes containing the polypeptide components that are desired are contained in the multimer of the invention (see, for example, U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). Alternatively, multimers of the invention could be generated using genetic manipulation techniques known in the art. In one embodiment, the multimers of the invention are produced in recombinant form using fusion protein technology described in the present invention or otherwise known in the art (see, e.g., U.S. Patent No. 5,478,925, which is incorporated herein by reference). incorporated herein by reference in its entirety). In a specific embodiment, polynucleotides encoding a homodimer of the invention are generated by ligating a polynucleotide sequence encoding a polypeptide of the invention to a sequence encoding a polypeptide linker and then also to a synthetic polynucleotide encoding the translated product. of the polypeptide in the inverted orientation from the original C-terminal end to the N-terminus (lacking the leader sequence) (see, e.g., U.S. Patent No. 5,478,925, which is incorporated herein by reference) In its whole) . In another embodiment, recombinant techniques described in the present invention or in some other manner known in the art are applied to generate the recombinant polypeptides of the invention which contain a transmembrane domain (or a hydrophobic or signal peptide) and which are they can be incorporated by liposome membrane reconstitution techniques (see, for example, U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety) Biological Activities of the Angiogenic Polypeptides The angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides, can be used in tests to evaluate for one or more biological activities. If the angiogenic polynucleotides or polypeptides, or the angiogenic polypeptide or polypeptide agonists or antagonists, exhibit activity in a particular test, it is likely that the angiogenic polynucleotides or polypeptides may be involved in diseases associated with biological activity. Therefore, angiogenic polypeptides could be used to treat associated diseases. The following biological activities described are included within the "desired activities" of the angiogenic proteins.

Immune activity The angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be useful for treating deficiencies or disorders of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells. Immune cells develop through a process called hematopoiesis, producing myeloid cells (platelets, red blood cells, neutrophils, and macrophages) and lymphoid cells (B and T lymphocytes) from pluripotent stem cells. The etiology of these immune deficiencies or disorders can be genetic, somatic, such as cancer or some autoimmune disorders, acquired (for example by chemotherapy or toxins), or infectious. In addition, angiogenic polynucleotides or polypeptides, or angiogenic polypeptide or polynucleotide agonists or antagonists, can be used as a marker or detector of a particular immune system disease or disorders. The angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polypeptides or polypeptides, could be useful for treating or detecting deficiencies or disorders of the hematopoietic cells. The angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used to increase the differentiation and proliferation of hematopoietic cells, including pluripotent stem cells, in an effort to treat those disorders associated with a reduction in some ( or in many) types of hematopoietic cells. Examples of immunological deficiency syndromes include, but are not limited to: blood protein disorders (eg, agammaglobulmemia, disgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge syndrome, HIV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocytic bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott-Aldpch disorders, anemia, thrombocytopema, or hemoglobinuria.

In addition, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, can also be used to modulate "hemostatic activity (the arrest of bleeding) or thrombolytic activity. (formation of clots). For example, by increasing hemostatic or thrombolytic activity, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could be used to treat blood coagulation disorders. (eg afibrinogenia, factor deficiencies), blood platelet disorders (e.g., thrombocytopenia), or injuries resulting from trauma, surgery or other causes. Alternatively, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, that can reduce hemostatic or thrombolytic activity could be used to inhibit or dissolve clots, important in the treatment of heart attacks (infarction) ), apoplexy or scarring. The angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides, could also be used to treat or detect autoimmune disorders. Many autoimmune disorders result from the inappropriate recognition of oneself as a foreign material by immune cells. This inappropriate recognition results in an immune response that leads to the destruction of host tissue. Therefore, the administration of angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides, that can inhibit an immune response, in particular the proliferation, differentiation, or chemotaxis of T cells, could be an effective therapy for prevent autoimmune disorders. Examples of autoimmune disorders that can be treated or detected include, but are not limited to: Addison's disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's syndrome, Grave's disease, multiple sclerosis, myasthenia gravis, neuritis, ophthalmia, ulcerous pemphigoid, pemphigus, polyendocrinopathies, purpura, Reiter's disease, Stiff-Man syndrome, autoimmune thyroiditis, systemic lupus erythematosus, autoimmune pulmonary inflammation, Guillam-Barre syndrome, diabetes mellitus dependent on insulin, and autoimmune inflammatory eye disease. Likewise, allergic reactions and conditions, such as asthma (in particular allergic asthma) or other respiratory problems, could also be treated by the angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides. In addition, these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could also be used to treat and / or prevent organ rejection or host-graft disease (GVHD). Organ rejection occurs because the immune cells of the host destroy the transplanted tissue through an immune response. Similarly, an immune response in GVHD is also involved, but in this case, the foreign transplanted immune cells destroy the tissues of the host. The administration of angiogenic polynucleotides or polypeptides, or of agonists or antagonists of the angiogenic polynucleotides or polypeptides, which inhibits an immune response, in particular proliferation, Nfc- j «a..ut ^ i. High &L.

Differentiation or chemotaxis of T cells, could be an effective therapy to prevent organ rejection or GVHD. Similarly, the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could also be used to modulate inflammation. For example, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could inhibit the proliferation and differentiation of cells involved in an inflammatory response. These molecules can be used to treat inflammatory conditions, both chronic and acute, including inflammation associated with infection (for example, septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion, lethality by endotoxin, arthritis, hyperacute rejection mediated by complement, nephritis, lung damage induced by cytokines or chemokine, inflammatory bowel disease, Crohn's disease, or those resulting from the overproduction of cytokines (for example TNF or IL-1).

Hyperproliferative Disorders Angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, can be used to treat or detect hyperproliferative disorders, including neoplasms. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could inhibit the proliferation of the disorders through direct or indirect interactions. Alternatively, the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could proliferate other cells which can inhibit the hyperproliferative disorder. For example, hyperproliferative disorders can be treated by increasing an immune response, in particular by increasing the antigenic qualities of the hyperproliferative disorder or by causing the T cells to proliferate, differentiate or mobilize. This immune response can be increased by either increasing an existing immune response, or initiating a new immune response. Alternatively, the reduction of an immune response could also be a method for treating hyperproliferative disorders, such as with a chemotherapeutic agent. Examples of hyperproliferative disorders that can be treated or detected by angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, include, but are not limited to, neoplasms located in: abdomen, bone tissue, breast tissue, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, thyroid, pituitary, testes, ovaries, thymus, thyroid), eye, head and neck, nervous system (central and peripheral), lymphatic system, pelvis, skin, tissue soft, spleen, thorax, and in the urogenital tract. Likewise, other hyperproliferative disorders can also be treated or detected by the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides. Examples of such hyperproliferative disorders include, but are not limited to: hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemias, purpura, sarcoidosis, Sezari syndrome, Waldenstron macroglobulinemia, Gaucher's disease, histiocytosis, and any other disease iAAA ^ * ^ - a ^ afct, »* ^» "^ hyperproliferative, in addition to neoplasia, located in a system or organ listed above.

Cardiovascular disorders Angiogenic polynucleotides or polypeptides, or angiogenic polynucleotide or polypeptide agonists or antagonists can be used to treat cardiovascular disorders, including peripheral arterial disease, such as limb ischemia. Cardiovascular disorders include cardiovascular abnormalities, such as arterio-arterial fistula, arteriovenous fistula, arteriovenous malformations of the brain, congenital heart defects, atresia, and scimitar syndrome. Congenital heart defects include constriction of the aorta, cor triatriatum, anomalies of the coronary vessels, cross heart, dextrocardia, patent ductus arteriosus, Ebstein anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of Fallot, transposition of large vessels, right ventricle with double outlet, tricuspid atresia, persistent truncus arteriosus and defects of the cardiac (septal) septum, such as aortopulmonary septal defect, defects of endocardium deadening, Lutembacher syndrome, Fallot trilogy, ventricular cardiac septal defects. Cardiovascular disorders also include heart diseases such as arrhythmias, carcinoid heart disease, elevated cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), cardiac aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, cardiac hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, cardiac rupture after infarction, rupture of the ventricular septum, diseases of the cardiac valve , myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including obstructive and tuberculous), pneumopericardium, post-pericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular complications of pregnancy, scimitar syndrome, cardiovascular syphilis and cardiovascular tuberculosis. Arrhythmias include breast arrhythmias, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Strokes syndrome, bundle block branch, sinoatrial block, Long QT syndrome, parasystole, Lown-Ganong-Levine syndrome, Mahaim-type pre-excitation syndrome, Wolf-Parkinson-White syndrome, Sick sinus syndrome, tachycardia, and ventricular fibrillation. Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal re-entry tachycardia, ectopic atrial tachycardia, ectopic joint tachycardia, sinoatrial nodal re-entry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia. Heart valve disease includes aortic valve insufficiency, aortic valve stenosis, cardiac murmur, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis. Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, subvalvular aortic stenosis, Í, * iá? SAtíí¿tA ... subvalvular pulmonary stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, fibroelastosis of the endocardium, Kearns syndrome, myocardial reperfusion injury and myocarditis. Myocardial ischemias include coronary heart disease, such as angina pectoris, aneurysm of the coronary artery, arteriosclerosis of the coronary artery, coronary thrombosis, coronary vasospasm, myocardial infarction, and myocardial paralysis (stunning). Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacilli angiomatosis, Hippel-Lindau disease, Klippel-Trenaunay-Weber syndrome, Sturge-Weber syndrome, angioneurotic edema, aortic diseases, Takayasu arteritis , aortitis, Leriche syndrome, occlusive diseases of the arteries, arteptis, enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-occlusive disease, hypertension, hypotension, ischemia, diseases peripheral vascular diseases, phlebitis, pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, occlusion of the vein of the ^ ..? á ^ ¿k ??, AJ Retina, Scimitar Syndrome, Syndrome of the superior vena cava, telangiectasia, atacia telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcer, vasculitis, and venous insufficiency. Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, aneurysms of the brain, coronary aneurysms, aneurysms of the heart, and ileal aneurysms. Occlusive diseases of the arteries include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya's disease, renal arterial obstruction, retinal artery occlusion, and thromboanginitis obliterans. Cerebrovascular disorders include diseases of the carotid artery, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg, cerebral hemorrhage, epidural hematoma, subdural hematoma, hemorrhage subarachnoid, cerebral infarction, cerebral ischemia (including transient), subclavian syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine and vertebrobasilar insufficiency. Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, embolisms due to fat, pulmonary emboli and thromboembolisms. Thrombosis includes coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg syndrome, and thrombophlebitis. Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injury, and peripheral limb ischemia. Vasculitis includes aortitis, arteritis, Behcet's syndrome, Churg-Strauss syndrome, mucocutaneous lymph node syndrome, thromboanginitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the polynucleotides or . mA * Á.Á * i.? *? A * t.-Á. ... já .._ .. ¿ají. -FAJ-Á Angiogenic polypeptides are especially effective for the treatment of critical limb ischemia and coronary diseases. As the examples are shown, administration of angiogenic polynucleotides and polypeptides to a rabbit forelimb with experimentally induced ischemia can restore the blood pressure rate, blood flow, angiographic marker, and capillary density. Angiogenic polypeptides can be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, reservoirs. sponge with foam gel, other commercially available reservoir materials, osmotic pumps, solid oral or suppository pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art. The angiogenic polypeptides can be administered as part of a pharmaceutical composition, described later in greater detail. Methods for supplying angiogenic polynucleotides are described with greater detail in the present invention.

Anti-angiogenesis activity The balance naturally present between stimulators and inhibitors of endogenous angiogenesis is one in which the inhibitory influences predominate. Raastinejad et al. , Cell 56: 345-355 (1989). In those rare cases in which neovascularization occurs under normal physiological conditions, such as wound healing, organ regeneration, embryonic development and female reproductive processes, angiogenesis is strictly regulated and delimited both spatially and temporally. Under conditions of pathological angiogenesis such as those that characterize the development of solid tumors, these regulatory controls fail. Unregulated angiogenesis becomes pathological and supports the progression of many neoplastic and non-neoplastic diseases. A number of serious diseases are dominated by abnormal neovascularization including the growth and metastasis of solid tumor, arthritis, some types of eye disorders, and psoriasis. See, for example, the revisions made by Moses et al. , Biotech. 9: 630-634 (1991); Folkman et al. , N. Engl. l? * L? a, it JL? ... & ia * A Í, j ¿Zí ..

J. Med. , 333: 1757-1763 (1995); Auerbach et al. , J. Microvasc. Res. 29: 401-411 (1985); Folkman, Advances ín Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, pgs. 175-203 (1985); Patz, Am. J. Ophtal ol. 5 94: 715-743 (1982); and Folkman et al. , Science, 221: 719-725 (1983). In a number of pathological conditions, the process of angiogenesis contributes to the pathological state. For example, significant data have been accumulated suggesting that the growth of solid tumors depends on the 10 angiogenesis. Folkman and Klagsbrun, Science 235: 442-447 (1987). The present invention provides for the treatment of diseases or disorders associated with neovascularization by administration of the 15 angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides. Malignant and metastatic tumor conditions that can be treated with the polynucleotides and polypeptides, or agonists or antagonists of the invention 20 include, but are not limited to, malignant tumors, solid tumors and cancers described in the present invention and that are otherwise known in the art (see Fishman et al., Medicine, 2nd ed., J. B.

Lippincott Co. , Philadelphia (1985) for a review of such disorders). Ocular disorders associated with neovascularization that can be treated with the angiogenic polynucleotides and polypeptides of the present invention (including angiogenic agonists and / or antagonists) include, but are not limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of premature macular degeneration, neovascularization of cornea graft, as well as other inflammatory disorders of the eye, papillary tumors and diseases associated with neovascularization of the choroid or iris. See, for example, the reviews made by Waltman et al. , Am. J. Ophtal. 85: 704-710 (1978) and Gartner et al. , Surv. Ophtal. 22: 291-312 (1978). Additionally, disorders that can be treated with the angiogenic polynucleotides and polypeptides of the present invention (including angiogenic agonists and / or antagonists) include, but are not limited to: hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed healing of wounds, granulations, hemophilic joints, hypertrophic scars, fractures that do not join, Osler-Weber syndrome, pyogenic granuloma, scleroderma, trachoma and vascular adhesions. In addition, the disorders and / or disease states that can be treated with the angiogenic polynucleotides and polypeptides of the present invention (including angiogenic agonists and / or antagonists) include, but are not limited to: solid tumors, blood-borne tumors such as leukemias , tumor metastasis, Kaposi's sarcoma, benign tumors, for example, hemangiomas, acoustic neuromas, neurofibromas, pyogenic trachoma and granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of premature macular degeneration, rejection of corneal graft, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma and uveitis, delayed healing of wounds, endometriosis, vasculogenesis, granulations, hypertrophic scarring (keloids), fractures that do not bind, scleroderma, trachoma, vascular adhesions, myocardial angiogenesis, collaterals of the coronary, colate of the brain, arteriovenous malformations, ischemic limb angiogenesis, Osler-Weber syndrome, plaque neovascularization, telangiectasia, hemophilic joints, angiofibroma, fibromuscular dysplasias, wound granulation, Crohn's disease, atherosclerosis, birth control agent preventing vascularization required for embryo implantation, controlling menstruation, diseases that have angiogenesis as a pathological consequence such as scratch disease of cat (minalia qumtosa de Róchele), ulcers (Helicobacter pylori), Bartonellosis and angiomatosis by bacilli.

Diseases at the cellular level Diseases associated with increased cell survival or with the inhibition of apoptosis that can be treated or detected by the angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides, include cancers (such as follicular lymphomas, carcinomas with mutations of p53, and hormone-dependent tumors, including but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma , myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, cancer of breast tissue, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and glomerulonephritis and rheumatoid arthritis related to the immune system) and viral infections (such as herpesviruses) , poxvirus and adenovirus), inflammation, graft versus host disease, acute graft rejection, and chronic graft rejection. In preferred embodiments, the angiogenic polynucleotides, polypeptides and / or antagonists of the invention are used to inhibit the growth, progression and / or metastasis of cancers, in particular those listed above. Additional diseases or conditions associated with increased cell survival that could be treated or detected by the angiogenic polynucleotides or polypeptides, or agonists or antagonists of the angiogenic polynucleotides or polypeptides, include, but are not limited to, progression and / or metastasis of malignant tumors and related disorders such as leukemias (including acute leukemias (eg, leukemia) acute lymphocytic, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemic leukemias) and chronic leukemias (eg, chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphomas (eg, Hodgkin's disease) and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphanangiosarcoma, lymphangioendotheliosarcoma, synovitis, mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast tissue cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma , carcinoma of the sweat gland a, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, tumor of -t < rs p ii. testicles, lung carcinoma, small cell carcinoma of the lung, urinary bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma and retinoblastoma. Diseases associated with increased apoptosis that could be treated or detected by angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, including AIDS; neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, degeneration of the cerebellum, and brain tumor or previous associated disease); autoimmune disorders (such as multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and glomerulonephritis and rheumatoid arthritis related to the immune system), myelodysplastic syndromes (such as aplastic anemia) ), graft-versus-host disease, ischemic damage (such as that caused by myocardial infarction, stroke, and reperfusion injury), liver damage (for íj At & AÉA. - * - *** Í? . Í *. example hepatitis related to liver damage, ischemia / reperfusion injury, cholestoci (bile duct damage) and liver cancer); toxin-induced liver disease (such as that caused by alcohol), septic shock, cachexia and anorexia.

Wound healing and epithelial cell proliferation In accordance with a further aspect of the present invention, there is provided a method for using the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, for therapeutic purposes, for example , to stimulate the proliferation of epithelial cells and basal keratinocytes with the purpose of healing wounds, and to stimulate the production of hair follicles and the healing of dermal wounds. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used clinically to stimulate wound healing including surgical wounds, excised wounds, deep wounds involving the damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, skin ulcers, ulcer ulcers, arterial ulcers, venous stasis ulcers, burns resulting from exposure to heat or chemicals, and other healing conditions of abnormal wounds such as uremia, malnutrition, vitamin deficiencies and complications associated with systemic treatment with steroids, radiation therapy and antineoplastic drugs and antimetabolites. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used to promote skin re-establishment subsequent to skin loss. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used to increase the adherence of the skin grafts to the wound bed and to stimulate the new formation of epithelium from the Lérida bed. The following are types of grafts in which the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the polynucleotides or polypeptides can be used.

AJkiá angiogénicos, to increase adherence to the bed of a wound: autografts, artificial skin, allografts, autodermal graft, autograft grafts, avascular grafts, Blair-Brown grafts, bone grafts, brephoplastic grafts, skin grafts, grafts delayed, dermal graft, epidermal graft, face graft, full thickness graft, heterologous graft, xenograft, homologous graft, hyperplastic graft, graft engraft, mesh graft, mucosal graft, Ollier-Thiersch graft, omenpal graft, patched graft, pedicle graft, penetrating graft, separate skin graft, thick graft. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, can be used to promote the resistance of the skin and to improve the appearance of aged skin. It is believed that angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, will also produce changes in the proliferation of hepatocytes, and in the proliferation of epithelial cells in the lung, breast tissue, pancreas, stomach, intestine. thin and large intestine. Angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could promote the proliferation of epithelial cells such as sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells and their precursors contained within the skin, lung, liver and gastrointestinal tract. The angiogenic polypeptides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could promote the proliferation of endothelial cells, keratinocytes, and basal keratinocytes. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could also be used to reduce the side effects of visceral poisoning resulting in radiation, chemotherapeutic treatments or viral infections. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could have a cytoprotective effect on the mucosa of the small intestine. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the. polynucleotides or fcJa «feA |« - * .fcj * í * ^. tai, .aJ * j * ^ * ..- Ai.i. ^ át ..

Angiogenic polypeptides could also stimulate the healing of mucositis (ulcers of the mouth) resulting from chemotherapy and viral infections. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could also be used for the complete regeneration of the skin in total and partial gross skin defects, including burns, (i.e., repopulation of hair follicles) , sweat glands and sebaceous glands), the treatment of other skin defects such as psoriasis. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used to treat ulcerative epidermolysis, a defect in adhesion of the epidermis to the underlying dermis which results in the frequent occurrence of open blisters and painful accelerating the formation of new epithelium of these lesions. The angiogenic polypeptides or polypeptides, or the agonists or antagonists of the angiogenic polypeptides or polypeptides, could also be used to treat gastric and duodenal ulcers and aid healing by scarring the mucosal lining and regenerating the lining of the lining. the glandular mucosa and the mucous membrane of the duodenum in a faster form. Inflammatory bowel diseases, such as Crohn's disease and ulcerative colitis, are diseases that result in the destruction of the mucosal surface of the small or large intestine, respectively. Therefore, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could be used to promote the formation of new surfaces of the mucosal surface to aid in faster healing and to prevent progression of inflammatory bowel disease. It is expected that treatment with the angiogenic polypeptides or polypeptides, or with the agonists or antagonists of the angiogenic polynucleotides or polypeptides, will have a significant effect on mucosal production along the gastrointestinal tract and can be used to protect the intestinal mucosa. of harmful substances ingested or that are subsequent to surgery. The angiogenic polypeptides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used to treat diseases associated with subexpression of angiogenic polypeptides.

In addition, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could be used to prevent and cure damage to the lungs due to various pathological conditions. A growth factor such as angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, which could stimulate proliferation and differentiation and promote repair of the epithelium of the alveoli and bronchi to prevent or treat Acute or chronic lung damage. For example, emphysema could be effectively treated, which results in the progressive loss of the alveoli, and damage by inhalation, that is, those resulting from the inhalation of smoke and burns, which cause the necrosis of the epithelium. the bronchi and alveoli, using the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides. In addition, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could be used to stimulate proliferation and differentiation of type II pneumocytes, which could help treat or prevent diseases such as diseases of hyaline membrane, such as infant respiratory distress syndrome and bronchopulmonary dysia, in premature infants. Angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could stimulate the proliferation and differentiation of hepatocytes and, thus, could be used to alleviate or treat liver diseases and pathologies such as fulminating hepatic insufficiency. caused by cirrhosis, liver damage caused by viral hepatitis and toxic substances (ie, acetaminophen, carbon tetrachloride and other hepatotoxins known in the art). In addition, angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, could be used to treat or prevent the onset of diabetes mellitus. In newly diagnosed type I and II diabetes patients, in whom some islet cell functions remain, one could use the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the polynucleotides or polypeptides angiogenic, to maintain the function of the islets so that the permanent manifestation of the disease is alleviated, delayed or prevented. In addition, the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used as an assistant in the transplantation of islet cells to improve or promote the function of the islet cells.

Infectious Diseases The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, can be used to treat or detect infectious agents. For example, infectious diseases can be treated by increasing the immune response, in particular by increasing the proliferation and differentiation of B and / or T cells. The immune response can be increased by either increasing an existing immune response, or initiating a new immune response. Alternatively, the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could also directly inhibit the infectious agent, without the need to evoke an immune response. The viruses are an example of an infectious agent that can cause disease or symptoms that can be treated or detected by the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides. Examples of viruses include, but are not limited to, the following viral and RNA viral families: arboviruses, adenoviruses, arenavirids, arteriviruses, Birnavirids, buniavirids, calicivirids, circovirids, coronavirids, falvivirids, hepadnaviruses (Hepatitis), herpesviridae (such as , cytomegalovirus, herpes simplex, herpes Zoster), mononegaviruses (for example, paramyxovirids, morbilliviruses, rhabdovirids), ortomixavirids (for example, influenza), papovavirus, parvovirus, picornavirus, poxvirus (such as Smallpox or vaccinia), reovirids (for example, rotavirus), retrovirids (HTLV-I, HTLV-II, lentivirus), and togavirus (eg, rubivirus). Viruses that fall within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiolitis, encephalitis, eye infections (eg, conjunctivitis, keratitis), chronic liver disease, hepatitis (A, B, C, E, Active Chronic, Delta), meningitis, opportunistic infections (eg AIDS), pneumonia, Burkitt's lymphoma, smallpox, hemorrhagic fever, measles, mumps, parainfluenza, rabies, common cold, polio, leukemia, rubella, transmitted diseases sexually, skin diseases (eg, Kaposi's sarcoma, warts) and viremia. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, can be used to treat or detect any of these symptoms or diseases. Similarly, with the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, bacterial or fungal agents that can cause diseases or symptoms can be treated or detected, including, but not limited to, the following families of fungi. and Gram-negative and Gram-positive bacteria: actinomycetes (eg Corinebacterium, Mycobacterium, Norcardia), aspergillosis, Bacillaceae (eg, Anthrax, Clostridium), Bacetoidaceae, Blastomycosis, Bordetella, Borrelia, brucellosis, candidiasis, Campylobacter, coccidiomycosis, cryptococcosis , Dermatocicosis, Enterobacteriaceae (Klebsiella, Salmonella, Serratia, Yersinia), t ~ * .a.íi.j *? * * t ...

Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales (Mycoplasmatales), Neisseriaceae (for example, Acinetobacter, Gonorrhea, Meningococci), Pasteurellacea infections (for example, Actinobacilus, Heamophilus, Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, syphilis and Staphylococcus. These families of bacteria or fungi can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (for example, infections related to AIDS), paronychia (paronychia), prosthetic-related infections, Reiter's disease, respiratory tract infections, such as whooping cough or empyema, sepsis, Lyme disease, cat scratch disease (Cat Scratch Disease), dysentery, paratyphoid fever, food poisoning, typhoid, pneumonia, gonorrhea, meningitis, chlamydia, syphilis, diphtheria, leprosy, paratuberculosis, tuberculosis, lupus, botulism, gangrene, tetanus, impetigo, rheumatic fever, scarlet fever , sexually transmitted diseases, skin diseases (eg cellulitis, dermatocicosis), toxemia, urinary tract infections, wound infections. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, can be used to treat or detect any of these symptoms or diseases. In addition, with the angiogenic polynucleotides or polypeptides, or with the antagonists or antagonists of the angiogenic polynucleotides or polypeptides, parasitic agents causing diseases or symptoms can be treated or detected including, but not limited to, the following families: amoebiasis, babesiosis, coccidiosis , cryptosporidiosis, dientamoebiasis, equine syphilis, ectoparasites, giardiasis, helminthiasis, leishmaniasis, teileriasis, toxoplasmosis, trypanosomiasis and trichomonas. These parasites cause a variety of diseases or symptoms, including, but not limited to: scabies, thrombiculiasis, eye infections, intestinal diseases (e.g., dysentery, giardiasis), liver diseases, lung disease, opportunistic infections (e.g., those related to AIDS), malaria, complications of pregnancy and toxoplasmosis. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polypeptides or polypeptides, can be used to treat or detect .JAÁikJ.timiL. * - A.m ***. *. M * amis £ .a? T any of these symptoms or diseases. Preferably, the treatment using the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, can be either by administering an effective amount of angiogenic polypeptide to the patient, or by removing cells from the patient, supplying the cells with polynucleotide angiogenic, and return the manipulated cells to the patient (ex vivo therapy). In addition, the angiogenic polypeptide or polynucleotide can be used as an antigen in a vaccine to create an immune response against the infectious disease.

Regeneration Angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, can be used to differentiate, proliferate and attract cells, which leads to tissue regeneration. (See, Science 276: 59-87 (1997)). Tissue regeneration can be used to repair, replace or protect tissue damaged by congenital defects, trauma (wounds, burns, incisions, ulcer), age, disease (for example -HA ÁAJ -t .íu? -a ... ír ?. . «Jt. j,. ^, ^ aja.aa.naalAa osteoporosis, osteoarthritis, penodontal disease, liver failure), surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury or systemic damage by cytokines. The tissues that could be regenerated using the present invention include organs (eg, pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac), vasculature (including vascular and hepatic), nervous, hematopoietic tissue and skeletal (bone, cartilage, tendon and ligament). Preferably, regeneration occurs without scarring or with reduced scarring. Regeneration may also include angiogenesis. In addition, the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polypeptides or polypeptides, could increase the regeneration of tissues that are difficult to cure. For example, increased tendon / ligament regeneration could hasten the recovery time after damage. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides of the present invention could also be used prophylactically in an effort to avoid damage. Specific diseases that could be treated include tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. A further example of regenerating tissue from scarring that does not heal includes pressure ulcers, ulcers associated with vascular insufficiency, and surgical and traumatic wounds. Likewise, brain and nervous tissues could also be regenerated using the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, to proliferate and differentiate the nerve cells. Diseases that could be treated using this method include diseases of the central and peripheral nervous system, neuropathies, or mechanical and traumatic disorders (e.g. spinal cord disorders, head trauma, cerebrovascular disease and stroke). Specifically, diseases associated with damage to peripheral nerves, peripheral neuropathies (e.g., those resulting from chemotherapy or other medical therapies), localized neuropathies, and central nervous system diseases (e.g., Alzheimer's disease, Parkinson's disease, Hungtington's disease, amyotrophic lateral sclerosis, and Dhy-Drager syndrome) using the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides.

Chemotaxis The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could have chemotaxis activity. A chemotactic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T cells, stem cells, eosinophils, epithelial and / or endothelial cells) to a particular site in the body, such as a site of inflammation, of infection or hyperproliferation. The mobilized cells can then combat and / or cure the particular trauma or abnormality. The angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could increase the chemotactic activity of particular cells. These chemotactic molecules can then be used to treat inflammation, infection, hyperproliferative disorders, or any disorder of the immune system by increasing the number of cells chosen as targets at a particular site in the body. For example, chemotactic molecules can be used to treat wounds and other traumas to the tissues by attracting cells of the immune system to the damaged site. Like a chemotactic molecule, angiogenic polypeptides can also attract fibroblasts, which can be used to treat wounds. It is also contemplated that angiogenic polynucleotides or polypeptides, or agonists or antagonists of angiogenic polynucleotides or polypeptides, may inhibit chemotactic activity. These molecules can also be used to treat disorders. Therefore, the angiogenic polynucleotides or polypeptides, or the agonists or antagonists of the angiogenic polynucleotides or polypeptides, could be used as a chemotaxis inhibitor.

Binding activity the angiogenic polypeptides may be used to select for molecules that bind to the angiogenic polypeptides or for molecules to the which angiogenic polypeptides bind. The binding of an angiogenic polypeptide and the molecule can activate (agonist), increase, inhibit (antagonists), or decrease the activity of the angiogenic polypeptide or the bound molecule. Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors), or small molecules. Preferably, the selection of these molecules involves producing appropriate cells that express the angiogenic polypeptide, either as a secreted protein or on the cell membrane. Preferred cells include cells from mammals, yeasts, Drosophila, or E. coli. Cells that express the angiogenic polypeptide (or the cell membrane containing the expressed polypeptide) are preferably then contacted with a test compound that potentially contains the molecule to observe binding, stimulation or inhibition of the activity of either the angiogenic polypeptide or the molecule. The test could simply evaluate the binding of a candidate compound to the angiogenic polypeptide, in which binding is detected by a label, or in a test involving competition with a labeled competitor.

In addition, the test could also evaluate whether the candidate compound results in a signal generated by binding to the angiogenic polypeptide. Alternatively, the test can be performed using cell-free preparations, polypeptide / molecule fixed to a solid support, pools of chemical compounds, or mixtures of natural products. The test could also simply comprise the steps of mixing a candidate compound with a solution containing the angiogenic polypeptide, measuring the activity or angiogenic polypeptide binding / molecule, and comparing the activity or angiogenic polypeptide / molecule binding with a reference standard. Preferably, an ELISA test can measure the level or activity of angiogenic polypeptide in a sample (for example biological sample) using a monoclonal or polyclonal antibody. The antibody can measure the level or activity of the angiogenic polypeptide either by binding, directly or indirectly, to the angiogenic polypeptide or by competition with the angiogenic polypeptide for a substrate. Additionally, the receptor to which the angiogenic polypeptide binds can be identified by -t * »A3b *. *!, - £ í - *,. ** a? tr. numerous methods known to those skilled in the art, for example, ligand visualization and FACS classification (Coligan, et al., Current Protocols in Immun., 1 (2), chapter 5, (1991)). For example, expression cloning is used in cases where polyadenylated RNA is prepared from a cell that responds to polypeptides, for example, NIH3T3 cells of which are known to contain multiple receptors for the family proteins. FGF, and SC-3 cells, and a cDNA library created from RNA are divided into mixtures and used to transfect COS cells or other cells that do not respond to the polypeptides. The transfected cells which are cultured on glass slides are exposed to the polypeptide of the present invention, after they have been labeled. The polypeptides can be redisked by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. After fixation and incubation, the slides are subjected to autoradiographic analysis. The positive mixtures are identified and sub-mixtures are prepared and re-transfected using an iterative sub-mixing and re-selection procedure, which at a given moment provides an individual clone encoding the putative receptor. As an alternative method for receptor identification, the tagged polypeptides can be linked by photoaffinity with the cell membrane or with extracts preparations that express the receptor molecule. The interlaced material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the polypeptide receptors can be excised, resolved into peptide fragments, and subjected to protein sequence microdetermination. The amino acid sequence obtained from the sequence microdetermination will be used to design a set of degenerate oligonucleotide probes to select a cDNA library to identify the genes encoding the putative receptors. Additionally, this invention provides a method for screening compounds to identify those that modulate the action of the polypeptide of the present invention. An example of such a test comprises combining a mammalian fibroblast cell, the polypeptide of the present invention, the compound to be selected and 3 [H] thymidine under culture conditions. -4.- ***..*,*. ? ,, * -, * ,, ^ *, - *. *. * .. ** .-. ~ mi-m, ***. llleA tt .. *. * .. & .. ***.% * tUt t &, cellular in which the fibroblast cells will normally proliferate. A control test could be performed in the absence of the compound to be selected and compared with the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the consumption of 3 [H] thymidine in each case. The amount of proliferation of fibroblast cells is measured by liquid flash chromatography which measures the incorporation of 3 [H] thymidine. By this method both the agonist compounds and the antagonist compounds can be identified. In another method, a mammalian cell or a membrane preparation that expresses a receptor for a polypeptide of the present invention with a polypeptide of the present invention is incubated in the presence of the compound. The ability of the compound to intensify or block this interaction can then be measured. Alternatively, the response of a known second messenger system can be measured by following the interaction of a compound to be selected and the receptor for the angiogenic polypeptide and the ability of the compound to bind to the receptor and induce a second response is measured. messenger to determine if the compound is a potential agonist or antagonist. l? t - .. * ¡á, * f * ÍA ¿.M-JÍM. ..- Ar iA &A¡.A S * .¿Am, - -. , jfc. . . . _ *. . Jt Ifc i * < a¡ ^ -i JJ. TO*. A - AUCAt., ... A * ... * Sk.il jfc &ljt Such second messenger systems -include but not limited to, cAMP, guanylate cyclase, ion channels or phosphoinositide hydrolysis. The above can be used as markers for diagnosis or prognosis Molecules discovered using these tests can be used to treat the disease or to obtain a particular result in a patient (e.g. growth of blood vessels) by activating or inhibiting angiogenic polypeptide / molecule binding In addition, the assays can detect agents which can inhibit or enhance the production of the angiogenic polypeptide from appropriately engineered cells or tissues.Therefore, the invention includes a method for identifying compounds that bind to the angiogenic polypeptide comprising the steps of: (a) incubating a compound for candidate binding with the angiogenic polypeptide, and (b) determining whether or not In addition, the invention includes a method for identifying agonists / antagonists comprising the steps of: (a) incubating a candidate compound with the angiogenic polypeptide; (b) evaluating by testing a biological activity, and (c) determining whether a biological activity of the angiogenic polypeptide has been altered.

Antisense and ribozyme (antagonists) In specific embodiments, the antagonists according to the present invention are nucleic acids corresponding to the sequences contained in SEQ ID Nos. 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, or the complementary chain thereof. In one embodiment, the organism internally generates the antisense sequence, in another embodiment, the antisense sequence is administered separately (see, for example, O'Connor, J., Neurochem, 56: 560 (1991).) Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1998) .The antisense technology can be used to control the expression of genes through antisense DNA or RNA, or through the formation of the triple helix. argue for example in, Okano, J., Neurochem. 56: 560 (1991); Oligodeoxinucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1998). The formation of the triple helix is discussed in, for example, Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al., Science 251: 1300 (1991). The methods are based on the binding of a polynucleotide to a complementary DNA or RNA molecule. For example, the 5 'coding portion of a polynucleotide encoding the mature polypeptide of the present invention could be used to design an antisense RNA oligonucleotide with a length of about 10 to about 40 base pairs. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and receptor production. The antisense RNA oligonucleotide hybridizes to the mRNA molecule in vivo and blocks the translation of the mRNA molecule into the polypeptide for the receptor. In one embodiment, the angiogenic antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention. A vector as such could contain a sequence encoding the angiogenic antisense nucleic acid. A vector as such may remain episomal or be integrated into the chromosomes, as long as it can be transcribed to produce the desired antisense RNA molecule. Such vectors can be built ht .. i * iA * LA, itii? A. *. í.A by recombinant DNA technology methods common in the art. The vectors can be plasmids, viral or others known in the art, used for replication and expression in vertebrate cells, or for fragments thereof, can be performed by any promoter known in the art to act on vertebrate cells, preferably human cells. Such promoters can be of the type that can be induced or of the constitutive type. Such promoters include, but are not limited to, the SV40 initial promoter region (Bernoist and Chambon, Nature 29: 304-310 (1981), the promoter contained in the long terminal repeat portion to the 3 'end of the sarcoma virus). de Rous (Yamamoto et al., Cell 22: 787-797 (1980), the herpes thymidine promoter (Wagner et al., Proc. Na ti. Acad. Sci. USA 78: 1441-1445 (1981), regulatory sequences of the metallothionein gene (Brinster et al., Nature 296: 39-42 (1982)), etc. The antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a gene However, although it is preferred, absolute complementarity is not required A sequence "complementary to at least a portion of an RNA molecule", referred to in the present invention, refers to a sequence that have sufficient complementarity so that it can hybridize with the RNA molecule , forming a stable duplex; in the case of double-stranded antisense nucleic acids directed against RNA transcripts encoding angiogenic proteins, a single strand of duplex DNA could be tested in this way, or the formation of a triplex could be evaluated. The ability to hybridize will depend both on the degree of complementarity and the length of the antisense nucleic acid. In general, the larger the nucleic acid that is hybridized, the greater the number of non-base matings with an angiogenic RNA molecule that it can contain and nevertheless form a stable duplex (or triples, as the case may be). ). One skilled in the art can establish a tolerable degree of non-mating using standard procedures to determine the melting point of the hybridized complex. Oligonucleotides that are complementary to the 5 'end of the message, for example, the untranslated sequence to the 5' end and that includes the AUG start codon, should function more efficiently to inhibit translation. However, it has been shown that the sequences complementary to the sequences not translated towards the 3 'end of the mRNA molecules are also effective to inhibit the translation of the mRNA molecules. See generally, Wagner, R., 1994, Nature 372: 333-335. Therefore, oligonucleotides complementary to any of the 5'- or 3'-non-coding, non-translated regions of the angiogenic proteins shown in Figures 3A-3D could be used in an antisense method to inhibit the translation of endogenous mRNA that code for angiogenic proteins. Oligonucleotides complementary to the 5 'untranslated region of the mRNA molecule should include the complement of the AUG start codon. Antisense oligonucleotides complementary to the mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5'- or 3'- region or to the coding region of the angiogenic mRNA, the antisense nucleic acids should be at least six nucleotides in length, preferably oligonucleotides ranging from 6 to 50. nucleotides of approximately length. In specific aspects the oligonucleotide is at least 10 nucleotides, so Í. ??. Á.ÁRÍA & ttiÍÍi-M .. less 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides. The polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single chain or double chain. The oligonucleotide can be modified in the portion of the base, in the sugar portion, or in the phosphate base structure, for example, to improve the stability of the molecule, hybridization, etc. The oligonucleotide can include other adjoining groups such as peptides (for example, to target the receptors of the host cell in vivo), or agents that facilitate transport across the cell membrane (see, for example, Letsinger et al. , 1989, Proc. Nati, Acad. Sci. USA 86: 6553-6556, Lemaitre et al., 1987, Proc. Nati. Acad. Sci. 84: 648-652; Publication No. WO88 / 09810 of the PCT, published on December 15, 1988) or through the blood-brain barrier (see for example PCT Publication No. WO89 / 10134, published April 25, 1988), agents for hybridization-induced cutting, (see for example, Krol et al. ., 1988 BioTechniques 6: 958-976) or intercalating agents. (See, for example, Zon, 1988, Pharm. Res. 5: 539-549). For this purpose, the oligonucleotide can be conjugate to another molecule, for example, a peptide, an interlacing agent induced by hybridization, an agent for transport, an agent for cutting induced by hybridization, etc. the antisense oligonucleotide may comprise at least a portion of modified base which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2 -methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2 -met? Lt? O-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxosine, pseudoouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5- Methyluracil, urac-l-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid ( v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine. The antisense oligonucleotide may also comprise at least a portion of modified sugar that is selected from the group that includes, but is not limited to, arabinose, 2-fluoroarabinose, xylulose and hexose. In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate base structure selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphoniamidate, a methylphosphonate, an alkyl phosphotriester and a formatetal or analog thereof. Even in another embodiment, the antisense oligonucleotide is an α-anomeric oligonucleotide. An a-anomeopic oligonucleotide forms double-strand specific hybrids with the complementary RNA in which, contrary to the usual b-units, the strands run in parallel with one another (Gautier et al., 1987, Nucí Acids Res. 6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucí Acids Res. 15: 6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. : 327-330). The polynucleotides of the invention can be synthesized by standard methods known in the art, for example, using an automated DNA synthesizer (such as those commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al., (1988, Nucí Acids Res. 16: 3209), the methyl phosphonate oligonucleotides can be prepared using controlled porous glass polymer supports (Sarin et al., 1988, Proc. Nati, Acad. Sci. USA 85: 7448-7451), etc. Although antisense nucleotides complementary to sequence of the coding region encoding angiogenic proteins can be used, those which are complementary to the transcribed untranslated region are more preferred. Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (see, for example, international publication WO90 / 11364 of the PCT, published October 4, 1990).; Sarver et al., Science 247: 1222-1225 (1990)). Although ribozymes that cut the mRNA in site-specific recognition sequences can be used to destroy the mRNA molecules that code for the angiogenic proteins, it is preferred to use hammerhead ribozymes. The ribozymes with hammerhead shear the mRNA molecules at sites dictated by the flanking regions that form the base pairs complementary to the target mRNA molecule. The only requirement is that the target mRNA molecule has the following sequence of two bases: 5'-UG-3 '. The construction and production of hammerhead ribozymes is well known in the art and is described in greater detail in Haseloff and Gerlach, Nature 334: 585-591 (1988). There are numerous potential cut sites for the hammerhead ribozyme within the nucleotide sequences that code for the angiogenic proteins (SEQ ID Nos. 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23). Preferably, the ribozyme is genetically engineered so that the recognition site for cleavage is located near the 5 'end of the mRNA molecule encoding the angiogenic protein; that is, to increase efficiency and minimize intracellular accumulation of non-functional mRNA transcripts. As in the antisense approach, the ribozymes of the invention may be composed of modified oligonucleotides (e.g., for stability, targeting, etc., improved) and ? U = i * you * sJf- fai ¿fc;. * ^ J fej must provide cells expressing angiogenic proteins in vivo. You can introduce DNA constructs coding for the ribozyme in cells in the same manner described above for the introduction of antisense encoding DNA. A preferred delivery method involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, the pol III or pol II promoter, so that the transfected cells will produce sufficient amounts of the ribozyme to destroy the endogenous angiogenic proteins that encode the messages and inhibit their translation. Because ribozymes, unlike antisense molecules, are catalytic, a lower intracellular concentration is required to efficiency. Antagonist / agonist compounds can be used to inhibit the growth and cell proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e., the stimulation of tumor angiogenesis, and, therefore, to retard or avoid abnormal cell growth and proliferation, for example, in the formation or growth of tumors. & ^ É. . ^ atA, mttJi,. ^ -, Antagonists / agonists can also be used to prevent hypervascular disease, and prevent the proliferation of epithelial lens cells after extracapsular cataract surgery. preventing the mitogenic activity of the polypeptides of the present invention in cases such as restenosis after balloon angioplasty may also be desirable. Antagonists / agonists could also be used to prevent the growth of scar tissue during wound healing. Antagonists / agonists could also be used to treat the diseases described in the present invention.

Other Activities The polypeptides of the present invention, as a result of the ability to stimulate the growth of vascular endothelial cells, could be used in the treatment to stimulate the formation of new vascular tissue in ischemic tissues due to various pathological conditions such as thrombosis, arteriosclerosis and other cardiovascular conditions. These polypeptides are also Jut .ÁÁIj -Z &? tA - tA.i could be used to stimulate angiogenesis and limb regeneration, as discussed above. Polypeptides could also be used to treat wounds caused by injuries, burns, post-operative tissue repair and ulcers because they have the ability to be mitogenic for various cells of different origins, such as fibroblast cells and muscle cells. skeletal, and therefore, facilitate the repair or replacement of damaged or diseased tissue. The polypeptides of the present invention could also be used to stimulate neuronal growth and to treat and prevent the neuronal damage that occurs in certain disorders of neurons or neurodegenerative conditions such as Alzheimer's disease, Parkinson's disease and AIDS-related complex. The angiogenic proteins, and the agonists and / or antagonists for the angiogenic proteins, could have the capacity to stimulate the growth of chondrocytes, and therefore, these could be used to intensify the bone and periodontal regeneration and to help in the transplants of tissue or in bone grafts.

The polypeptides of the present invention could also be used to prevent skin aging caused by sunburn by stimulating the growth of keratinocytes. Angiogenic proteins, and agonists and / or antagonists for angiogenic proteins, could also be used in the maintenance of organs before transplantation or to support primary tissue cell cultures. The polypeptides of the present invention could also be used to induce tissue of mesodermal origin to differentiate it in early stage embryos. Angiogenic proteins, and agonists and / or antagonists for angiogenic proteins, could also increase or reduce the differentiation or proliferation of embryonic stem cells, in addition to the hematopoietic lineage, as discussed above. Angiogenic proteins, and agonists / antagonists for angiogenic proteins, could also be used to modulate characteristics of mammals, such as body weight, height, hair color, eye color, pigmentation, size and shape, iimil.-Í?., A.imA, *, percentage of adipose tissue of the skin (for example, cosmetic surgery). Similarly, angiogenic proteins, and agonists and / or antagonists for angiogenic proteins can be used to modulate the metabolism of mammals that affects catabolism, anabolism, processing, utilization and storage of energy. Angiogenic proteins, and agonists and / or antagonists for angiogenic proteins could be used to change the mental state or physical state of a mammal, influencing biological rhythms, heart rhythms, depression (including depressive disorders), tendency to violence, tolerance to pain, reproductive capacities (preferably through activism or inhibin activity), hormonal or endocrine levels, appetite, libido, memory, tension or other cognitive qualities. Angiogenic proteins, and agonists and / or antagonists for angiogenic proteins, could also be used as an additive or preservatives for foods, such as to increase or decrease storage capacities, fat content, lipids, proteins, carbohydrates, vitamins, minerals, cofactors or other nutritional components.

The aforementioned applications have uses in a wide variety of hosts. Such hosts include, but are not limited to, humans, murids, rabbits, goats, guinea pigs, camels, horses, mice, rats, hamsters, pigs, micro-pigs, chickens, goats, cows, sheep, dogs, cats, primates, human and human. In the specific modalities, the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat. In preferred embodiments, the host is a mammal. In the most preferred modalities, the host is a human.

Therapeutic Uses The angiogenic proteins of the present invention are potent mitogens for vascular and lymphatic endothelial cells. Accordingly, angiogenic polypeptides, or biologically active portions thereof, in conjunction with agonists and / or antagonists could be used to treat vascular trauma by promoting angiogenesis. For example, to stimulate the growth of transplanted tissue in cases in which coronary bypass surgery is performed. Angiogenic polypeptides could also be used, or ... * X ..X., ^^ j * X. biologically active portions thereof, together with agonists and / or antagonists to promote wound healing, in particular, to form new vascular tissue in damaged tissues or to stimulate collateral blood flow during ischemia and in cases where it is desired a new capillary angiogenesis. The angiogenic polypeptides, or the biologically active portions thereof, together with agonists and / or antagonists can be used to treat full thickness wounds such as skin ulcers., including pressure blisters, venous ulcers, and diabetic ulcers. In addition, the angiogenic polypeptides, or the biologically active portions thereof, together with agonists and / or antagonists can be used to treat burns and full thickness lesions in cases where a skin graft or flap is used to repair such burns and injuries. The angiogenic polypeptides, or the biologically active portions thereof, together with agonists and / or antagonists can also be used for use in plastic surgery, for example, for the repair of lacerations, burns or other trauma. In addition, the angiogenic polypeptides, or the biologically active portions thereof, together with agonists and / or antagonists can be used to promote healing of wounds and lesions of the eyes as well as to treat ocular diseases. In the same context, angiogenic polypeptides, or biologically active portions thereof, may also be used together with agonists and / or antagonists to induce the growth of damaged bone tissue, periodontal tissue or ligament tissue. The angiogenic polypeptides, or the biologically active portions thereof, may also be used together with agonists and / or antagonists to regenerate the supporting tissues of the teeth, including the cementum and periodontal ligament, which have been damaged, for example, due to illness or periodontal trauma. Because angiogenesis is important to keep wounds clean and infection-free, angiogenic polypeptides, or biologically active portions thereof, along with agonists and / or antagonists could be used in association with surgery and after repair of incisions. and cuts. Angiogenic polypeptides, or biologically active portions thereof, may also be used in conjunction with agonists and / or antagonists for the treatment of abdominal wounds. ÍííÁ. .X. A * í. Si -ÍÁÍÍ * ím¿ * r r ** - ^ J * í * -m tJBffltoa * Jto - »** - ¿« - - .aeá ?. in which there is a high risk of infection. Angiogenic polypeptides, or biologically active portions thereof, together with agonists and / or antagonists could be used to promote the formation of endothelium in vascular graft surgery. In the case of vascular grafts using synthetic or transplanted material, the angiogenic polypeptides, or the biologically active portions thereof, can be applied together with agonists and / or antagonists to the surface of the graft or at the junction to promote the growth of vascular endothelial cells. Angiogenic polypeptides, or biologically active portions thereof, may also be used in conjunction with agonists and / or antagonists to repair tissue damage of the myocardium resulting from myocardial infarction. Angiogenic polypeptides, or biologically active portions thereof, may also be used in conjunction with agonists and / or antagonists to repair the cardiac vascular system after ischemia. Angiogenic polypeptides, or biologically active portions thereof, together with agonists and / or antagonists could also be used to treat damaged vascular tissue as a result of coronary heart disease and vascular disease of the central and peripheral nervous system. Angiogenic polypeptides, or biologically active portions thereof, may also be used together with agonists and / or antagonists to cover artificial prostheses or natural organs that are transplanted into the body to minimize rejection of the transplanted material and to stimulate the vascularization of the transplanted materials. The angiogenic polypeptides, or the biologically active portions thereof, together with agonists and / or antagonists could also be used to repair vascular tissue from injuries resulting from trauma, for example, those that appear during arteriosclerosis and and which are required after of balloon angioplasty in cases in which vascular tissues are damaged. The angiogenic polypeptides, or the biologically active portions thereof, together with agonists and / or antagonists could also be used to treat peripheral arterial disease. Accordingly, in a further aspect, a method is provided for using the angiogenic polypeptides, or the biologically active portions thereof, together with the agonists to treat peripheral arterial disease. Preferably, an angiogenic polypeptide is administered to an individual, in conjunction with an agonist, for the purpose of alleviating or treating peripheral arterial disease. The appropriate dosages, formulations and administration routes are described below. Angiogenic polypeptides, or biologically active portions thereof, may also be used in conjunction with agonists and / or antagonists to promote endothelial function of lymphatic tissues and vessels, such as in the case of treatment of lymphatic vessel loss, occlusions of the lymphatic vessels, and lymphangiomas. The angiogenic polypeptides could also be used together with agonists to stimulate the production of lymphocytes. Angiogenic polypeptides, or biologically active portions thereof, together with agonists and / or antagonists could also be used to treat hemangioma in newborns. Accordingly, in a further aspect, a method is provided for using the angiogenic polypeptides in co-treatment with an agonist and / or antagonist to treat hemangioma in newborns. Preferably, an angiogenic polypeptide is co-administered to an individual, co-treated with an agonist for the purpose of relieving or treating hemangioma in newborns. The appropriate dosages, formulations and administration routes are described below. Angiogenic polypeptides could also be used, or the biologically active portions thereof, together with agonists and / or antagonists to prevent or treat the abnormal development of the retina in premature infants. Accordingly, in a further aspect, a method is provided for using the angiogenic polypeptides, together with agonists or antagonists to treat the abnormal development of the retina in preterm infants. Preferably, an angiogenic polypeptide co-treated with an agonist or antagonist is administered to an individual for the purpose of alleviating or treating the abnormal development of the retina in preterm infants. The appropriate dosages, formulations and administration routes are described below. Angiogenic polypeptides, or biologically active portions thereof, together with agonists and / or antagonists can be used to treat primary (idiopathic) lymphademas, including Milroy's disease and lymphedema praecox. Accordingly, in a further aspect, a procedure for using the ÍAAA.A. S? Íi? * I? L JLÜ.i? Angiogenic polypeptides together with an agonist to treat primary lymphademas (idiopathic), including Milroy's disease and lymphedema praecox. Preferably, an angiogenic polypeptide, co-treated with an agonist, is administered to an individual for the purpose of alleviating or treating primary (idiopathic) lymphademas, including Milroy's disease and lymphedema praecox. The angiogenic polypeptides together with agonists could also be used to treat edema as well as to affect blood pressure in an animal. The appropriate dosages, formulations and administration routes are described below. The angiogenic polypeptides, or biologically active portions thereof, together with agonists and / or antagonists could also be used to treat secondary (obstructive) lifetimes including those resulting from (I) the elimination of lymph nodes and vessels, (ii) radiotherapy and surgery in the treatment of cancer, and (iii) trauma and infection. Accordingly, in a further aspect, a method is provided for using the angiogenic polypeptides together with agonists to treat secondary (obstructive) lifetimes including those resulting from (I) the elimination of lymph nodes and vessels, (ii) radiotherapy and surgery in the treatment of cancer, and (iii) trauma and infection. Preferably, an individual is co-administered an angiogenic polypeptide with an agonist, for the purpose of treating secondary (obstructive) life times including those resulting from (I) the elimination of lymph nodes and vessels, (ii) radiotherapy and surgery in the treatment of cancer, and (iii) trauma and infection. The appropriate dosages, formulations and administration routes are described below. Angiogenic polypeptides, or biologically active portions thereof, together with agonists and / or antagonists could also be used to treat Kaposi's sarcoma. Accordingly, in a further aspect, a method is provided for using the angiogenic polypeptides together with an agonist to treat Kaposi's sarcoma. Preferably, an angiogenic polypeptide is administered to an individual for the purpose of relieving or treating Kaposi's sarcoma. The appropriate dosages, formulations and administration routes are described below. Antagonists of angiogenic polypeptides can be used to treat cancer by inhibiting the angiogenesis necessary to support the growth of cancer and tumors.

Methods of therapy with genes Another aspect of the present invention are the 5 methods of therapy with genes to treat disorders, diseases and conditions. The methods of gene therapy refer to the introduction of nucleic acid sequences (DNA, RNA and antisense DNA or RNA) in an animal to obtain the expression of the angiogenic polypeptide of the present invention. This method requires a polynucleotide that codes for an angiogenic polypeptide operably linked to a promoter and any of the other genetic elements necessary for the expression of the polypeptide by the target tissue. Such techniques of therapy and gene delivery are known in the art, see, for example, WO 90/11092, which is incorporated in the present invention for reference. Thus, for example, cells originating from a patient with a 0 polynucleotide (DNA or RNA) comprising a promoter operably linked to an ex vivo angiogenic polynucleotide can be genetically engineered, then delivering the genetically engineered cells to a patient to be treated with the polypeptide. Such methods are well known in the art. See, for example, Belldegrun, A., et al. , J. Na ti. Cancer Inst. 85: 207-216 (1993); Ferrantini, M. et al. , Cancer Research 53: 1107-1112 (1993); Ferrantini, M. et al. , J. Immunology 153: 4604-4615 (1994); Kaido, T., et al. , In t. J. Cancer 60: 221-229 (1995); Ogura, H., et al. , Cancer Research 50: 5102-5106 (1990); Santodonato, L., et al. , Human Gene Therapy 7: 1-10 (1996); Santodonato, L., et al. , Gene Therapy 4: 1246-1255 (1997); and Zhang, J.-F. et al. , Cancer Gene Therapy 3: 31-38 (1996)), which are incorporated in the present invention for reference. In one embodiment, the genetically engineered cells are arterial cells. Arterial cells can be reintroduced into the patient through direct injection into the artery, the tissues surrounding the artery, or through catheter injection. As discussed in more detail below, the angiogenic polynucleotide constructs can be delivered by any method that provides injectable materials to the cells of an animal, such as, injection into the interstitial space of the tissues (heart, muscle, skin, lung, liver and the like). The angiogenic polynucleotide constructs can be to be delivered in a pharmaceutically acceptable liquid or aqueous carrier. In one embodiment, the angiogenic polynucleotide is delivered as a naked polynucleotide. The term "naked" polynucleotide, DNA or RNA refers to sequences that are free of any delivery vehicle that acts to aid, promote or facilitate entry into cells, including viral sequences, viral particles, liposome formulations, lipofectin or agents precipitants and the like. However, angiogenic polynucleotides can also be delivered in liposome formulations and in lipofectin and the like formulations that can be prepared by methods known to those skilled in the art. Such methods are described, for example, in the U.S.A. Nos. 5,593,972, 5,589,466 and 5,580,859, which are incorporated in the present invention for reference. The angiogenic polynucleotide vector constructs used in the gene therapy method of preference are constructs that will not be integrated into the host genome nor will they contain sequences that allow replication. Suitable vectors include pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Pharmacia; and pEFI / V5, pcDNA3.1 and pRc / CMV2 available from Invitrogen. Other appropriate vectors will be apparent to the person skilled in the art. Any strong promoter known to those skilled in the art can be used to activate the expression of angiogenic DNA. Suitable promoters include adenoviral promoters, such as the adenovirus major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytium virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; the heat shock promoters; the albumin promoter; the ApoAI promoter; the human globin promoters; the viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; Retroviral LTRs; the b-actin promoter; and the promoters of human growth hormone. The promoter can also be an original promoter for the respective gene that codes for a given angiogenic protein. Unlike other gene therapy techniques, a major advantage of introducing naked nucleic acid sequences into target cells is the transient nature of the synthesis of the polynucleotide in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months. The angiogenic polynucleotide construct can be delivered in the interstitial space of tissues within an animal, including that of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone tissue, cartilage , pancreas, kidney, gallbladder, stomach, intestine, testes, ovaries, uterus, rectum, nervous system, eye, gland, and connective tissue. The interstitial space of the tissues comprises the mucopolysaccharide matrix, fluid, intercellular between the reticular fibers of the tissues of the organs, the elastic fibers in the walls of the blood vessels or chambers, the collagen fibers of the fibrous tissues, or that same matrix within the connective tissue that surrounds the muscle cells or in the lagoon of the bone tissue. In the same way it is the space occupied by the plasma of the circulation and the lymphatic fluid of the lymphatic channels. For the reasons discussed above, provision to the interstitial space of muscle tissue is preferred. These can be conveniently delivered by injection into the tissues comprising these cells. Preferably, these are delivered and expressed in non-dividing persistent cells which are differentiated, although delivery and expression can be obtained in undifferentiated cells or in less fully differentiated cells, such as, for example, blood stem cells or skin fibroblasts. The muscle cells in vivo are particularly competent with respect to their ability to absorb and express the polynucleotides. For the injection of naked acid sequences, the amount of effective dose of DNA or RNA will be in the range of about 0.5 mg / kg of body weight to about 50 mg / kg of body weight. Preferably, the dose will be from about 0.005 mg / kg to about 20 mg / kg and more preferably from about 0.05 mg / kg to about 5 mg / kg. Of course, as will be appreciated by the person skilled in the art, this dose will vary in accordance with the injection site in the tissue. Those skilled in the art can readily determine the appropriate and effective dose of the nucleic acid sequence and this will depend on the condition being trying and the route of administration. The preferred route of administration is via the parenteral route of injection into the interstitial space of the tissues. However, other routes of parenteral administration can also be used, such as inhaling a particular aerosol formulation for delivery to the lung tissue or the bronchi, throat or mucous membranes of the nose. In addition, naked angiogenic DNA constructions can be delivered to the arteries during angioplasty through the catheter used in the procedure. The naked polynucleotides are delivered by any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, and so-called "gene guns". . These delivery methods are known in the art. It has been shown that naked VEGF-2 nucleic acid sequences can be administered in vivo, which results in the successful expression of the VEGF-2 polypeptide in the femoral arteries of rabbits. The constructions can also be supplied i ?????????????????????????????????????????????????????????????????????????????????????????? Such methods of delivery are known in the art In certain embodiments, the angiogenic polynucleotide constructs are complexed into a liposome preparation The liposomal preparations used in the present invention include cationic (positively charged), anionic preparations (with negatively charged) and neutrals However, cationic liposomes are particularly preferred because they can form a complex with strong charge between the cationic liposome and the polyanionic nucleic acid.Ca lmonic liposomes have been shown to mediate the m-cell delivery of plasmid DNA (Felgner et al., Proc. Nati, Acad. Sci. USA (1987) 84: 7413-7416, which is incorporated in the present invention for reference) mRNA (Malone e. t al., Proc. Na ti. Sci. USA (1989) 86: 6077-6081, which is incorporated in the present invention for reference); and purified transcription factors (Debs et al., J. Biol. Chem. (1990) 265: 10189-10192, which is incorporated in the present invention for reference) in functional form. Cationic liposomes can be easily obtained. For example, N [1- (2,3-dioleyloxy) propyl] -N, N, N-triethylammonium (DOTMA) liposomes are particularly useful and can be obtained under the trademark Lipofectin, from GIBCO BRL, Grand Island, NY (See also Felgner et al., Proc. Nati, Acad. Sci. USA (1987) 84: 7413-7416, which is incorporated in the present invention for reference). Other commercially available liposomes include transfectace (DDAB / DOPE) and DOTAP / DOPE (from Boehringer). Other cationic liposomes can be prepared from materials that can be readily obtained using techniques known in the art. See, for example, PCT Publication No. WO 90/11092 (which is incorporated herein by reference) for a description of the synthesis of DOTAP liposomes (1,2-bis (oleoyloxy) -3- (trimethylammonium propane). The preparation of DOTMA liposomes is explained in the literature, see for example, P. Felgner et al. , Proc. Na ti. Acad. Sci. USA (1987) 84: 7413-7417, which is incorporated in the present invention for reference. Similar methods can be used to prepare liposomes from other cationic type lipids. Similarly, anionic and neutral liposomes, such as, for example, Avanti Polar Lipids (Birmingham, Ala.), Can be readily obtained, or they can be easily prepared using readily available materials. Such materials include among others phosphatidyl, choline, cholesterol, phosphatidylethanolamine, dioleylphosphatidylcholine (DOPC), dioleylphosphatidylglycerol (DOPG), dioleylphosphatidylethanolamine (DOPE). These materials can also be mixed with the DOTMA and DOTAP starting materials in appropriate ratios. Methods for making liposomes using these materials are well known in the art. For example, dioleylphosphatidylcholine (DOPC), dioleylphosphatidylglycerol (DOPG) and dioleylphosphatidylethanolamine (DOPE) commercially available in various combinations can be used to make conventional liposomes, with or without the addition of cholesterol. In this way, for example, DOPG / DOPC vesicles can be prepared by drying 50 mg of each of DOPG and DOPC under a stream of nitrogen gas in a flask for sonication. The sample is placed under a vacuum pump overnight and hydrated the next day with deionized water. After the sample is sonicated for 2 hours in a stoppered bottle, using a model sonicator ? .Í Í ... X * .... 350 of Heat Systems equipped with a probe with inverted cup (bath type) at the maximum value while the bath is circulated at 15 EC. Alternatively, negatively charged vesicles can be prepared without subjecting them to sonication to produce multiple sheet vesicles or by extrusion through nucleopore membranes to produce unilamellar vesicles of discrete size. Other methods are known and these are available to those skilled in the art. Liposomes may comprise multiple-sheet vesicles (MLV), small unilamellar vesicles (SUV), or large unilamellar vesicles (LUV), with SUVs being preferred. The various liposome-nucleic acid complexes are prepared using methods known in the art. See, for example, Straubinger et al. , Methods of Immunology (1983), 101: 512-527, which is incorporated in the present invention for reference. For example, MLVs containing nucleic acid can be prepared by depositing a thin film of phospholipid on the walls of a glass tube and subsequently hydrating with a solution of the material to be encapsulated. SUVs are prepared by prolonged sonication of MLVs to produce a homogenous population of unilamellar liposomes. The material to be trapped is added to a preformed MLV suspension and then sonicated. When liposomes containing cationic lipids are used, the dried lipid film is resuspended in an appropriate solution such as sterile water or an isotonic buffer such as 10 mM Tris / NaCl, sonicated, and then the preformed liposomes are mixed directly. with DNA. The liposome and DNA form a very stable complex due to the binding of liposomes with positive charge to the cationic DNA. SUVs find utility with small fragments of nucleic acid. LUVs are prepared by a number of methods, known in the art. Commonly used methods include chelation of Ca2 + -EDTA (Papahadjopoulos et al., Biochem Biophys. Acta (1975) 394: 483; Wilson et al., Cell (1979) 17:77); ether injection (Deamer, D and Bangham, A., Biochem. Biophys. Acta (1976) 443: 629; Ostro et al., Biochem. Biophys. Res. Commu. (1977) 76: 836; Fraley et al., Proc. Nati Acad. Sci. USA (1979) 76: 3348); dialysis with detergent (Enoch, H., and Strittmatter, P., Proc. Nati, Acad. Sci. USA (1979) 76: 145); and reverse phase evaporation (REV) (Fraley et al., J. Biol. Chem. (1980) 255: 10431; Szoka, F. and Papahadjopoulos, D., VéLíí i &á,. * .AtJÜt-t, i? Jt ** = te. , && amp; ** .. 94 Proc. Nati Acad. Sci. USA (1978) 75: 145; Schaefer-Ridder et al. , Science (1982) 215: 166), which are incorporated in the present invention for reference. In general, the ratio of DNA to liposomes will be from about 10: 1 to about 1:10. Preferably, the ratio will be from about 5: 1 to about 1: 5. More preferred, the ratio will be from about 3: 1 to about 1: 3. Even more preferred, the ratio will be about 1: 1. The patent E.U.A. No. 5,676,954 (which is incorporated in the present invention for reference) reports on the injection of genetic material, complexed with cationic liposomal carriers, in mice. The E.U.A. Nos. 4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622, 5,580,859, 5,703,055, and the international publication no. WO 94/9469 (which are incorporated herein by reference) provide cationic lipids to be used in the transfection of DNA in cells and mammals. The E.U.A. Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and international publication No. WO 94/9469 (which are incorporated herein by reference) provide methods for delivering cationic DNA-lipid complexes to mammals In certain embodiments, cells are engineered, ex vivo or in vivo, using a retroviral particle containing RNA which comprises a sequence encoding an angiogenic protein. Retroviruses from which retroviral plasmid vectors can be derived include, but are not limited to, the Moloney murine leukemia virus, splenic necrosis virus, Rous sarcoma virus, Harvey sarcoma virus, virus. of bird leukosis, gibbon leukemia virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and breast tissue tumor virus. The retroviral plasmid vector is used to transduce packaging cell lines to form producer cell lines. Examples of transferable packaging cells include, but are not limited to, cell lines PE501, PA317, R-2, R-AM, PA12, T19-14X, VT-19-17-H2, RCRE, RCR , GP + E-86, GP + envAml2 and DAN as described in Miller, Human Gene Therapy 1: 5-14 (1990), which is incorporated by reference in the present invention in its entirety. The vector can transduce the packaging cells by any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and precipitation with CaP04. In an alternative, the retroviral plasmid vector can be encapsulated in a liposome, or can be coupled to a lipid, and then administered to a host. The producer cell line generates infectious retroviral vector particles which include the polynucleotide that codes for an angiogenic protein. Such retroviral vector particles can then be used to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the angiogenic protein. In some other embodiments, cells are genetically engineered, ex vivo or in vivo, with the angiogenic polynucleotide contained in an adenovirus vector. The adenovirus can be manipulated in such a way that it encodes and expresses the angiogenic protein, and at the same time is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. Expression of the adenovirus is achieved without integration of the viral DNA into the chromosome of the host cells, thereby relieving concerns about insertion mutagenesis. In addition, they have been used for many years I adenovirus as live enteric vaccines with an excellent safety profile (Schwartz, A. R. et al., (1974) Am. Rev. Respir Dis. 109: 233-238). Finally, adenovirus-mediated gene transfer has been demonstrated in a number of cases including the transfer of alpha-1-antitrypsin and CFTR to the lungs of cotton rats (Rosenfeld, M., et al., (1991) Science 252: 431-434; Rosenfeld et al., (1992) Cell 68: 143-155). In addition, intensive studies to try to establish adenovirus as a causative agent in human cancer were uniformly negative (Grenn, M., et al (1979) Proc. Nati, Acad. Sci. USA 76: 6606). Suitable adenoviral vectors useful in the present invention are described, for example, in Kozarsky and Wilson, Curr. Opin. Genet Devel. 3: 499-503 (1993); Rosenfeld et al., Cell 68: 143-155 (1992); Engelhardt et al., Human Genet. Ther. 4: 759-769 (1993); Yang et al., Nature Genet. 7: 362-369 (1994); Wilson et al., Nature 365.-691-692 (1993); and the patent E.U.A. No. 5,652,224, which are incorporated in the present invention for reference. For example, the Ad2 adenovirus vector is useful and can be grown in human 293 cells. These cells contain the El region of the adenovirus and constitutively express Ela and Elb, which complement the defective adenovirus by supplying the products of the deleted genes of the vector. In addition to Ad2, other varieties of adenoviruses (eg, Ad3, Ad5 and Ad7) are also useful in the present invention. Preferably, the adenoviruses used in the present invention are of poor replication. Deficient replication adenoviruses require the aid of an auxiliary virus and / or a packaging cell line to form infectious particles. The resulting virus is capable of infecting the cells and can express a polynucleotide of interest which is operably linked to a promoter, eg, the HARP promoter of the present invention, but can not replicate in most cells. Deficient replication adenoviruses can have deletions in one or more of a total or a portion of the following genes: Ela, Alb, E3, E4, E2a or Ll up to L5. In some other embodiments, the cells are genetically engineered, ex vivo or in vivo, using an adeno-associated virus (AAV). AAVs are naturally occurring defective viruses which require helper viruses to produce infectious particles (Muzyczka, N., Curr. Topi cs in Microbiol, Immunol 158: 97 (1992)). This is also one of the few viruses that can integrate their DNA into cells that do not divide. The vectors are contained as low as 300 base pairs of AAV can be packaged and can be integrated, but the space for the exogenous DNA is limited up to about 4.5 kb. Methods for producing and using such AAV are known in the art. See, for example, U.S.A. Nos. 5,139,941, 5,173,414, 5,354,678, 5,436,146, 5,474,935, 5,478, 745 and 5,589, 377. For example, an AAV vector suitable for use in the present invention will include all the sequences necessary for replication, formation of the capsid and integration into the host cell of DNA. The angiogenic polynucleotide construct is inserted into the AAV vector using standard cloning methods, such as those found in Sambrook et al. , Molecular Cloning: A Labora tory Manual, Cold Spring Harbor Press (1989). The recombinant AAV vector is then transfected into the packaging cells which are infected with an auxiliary virus, using any standard technique, including lipofection, electroporation, calcium phosphate precipitation, etc. the appropriate auxiliary viruses IHAAA? AA? R? Ímí. ??? *, *. nl? ^? jaíi? ¡? .. they include adenovirus, cytomegalovirus, vaccinia virus or herpesvirus. Once the packaging cells are transfected and infected, they will produce infectious AAV viral particles which contain the angiogenic polynucleotide construct. These viral particles are then used to transduce eukaryotic cells, either ex vivo or in vivo. The transduced cells will contain the angiogenic polynucleotide construct integrated into their genome, and will express the angiogenic protein. Another method of gene therapy involves operably associating heterologous control regions and endogenous polynucleotide sequences (e.g., encoding an angiogenic protein) by homologous recombination (see, for example, U.S. Patent No. 5,641,670, issued Oct. 24, 1995). June 1997, International Publication No. WO 96/29411, published September 26, 1996, International Publication No. WO 94/12650, published August 4, 1994, Koller et al., Proc. Na ti. Acad. Sci. USA 86: 8932-8935 (1989) and Zijlstra et al., Nauret 342: 435-438 (1989) This method involves the activation of a gene which is present in the target cells, but which is normally not expressed in the cells, or is expressed at a lower level than what is desired. tAJ.A. The polynucleotide constructs are made, using standard techniques known in the field, such that they contain the promoter with the sequences for targeting flanking the promoter. Suitable promoters are described in the present invention. The sequence for target selection has sufficient complementarity to an endogenous sequence to allow homologous recombination of the sequence to target the promoter with the endogenous sequence. The sequence for targeting will be close enough to the 5 'end of the desired endogenous polynucleotide sequence of the angiogenic protein so that the promoter will be operably linked to the endogenous sequence after homologous recombination. The promoter and the sequences for target selection can be amplified using PCR. Preferably, the amplified promoter contains distinct restriction enzyme sites on the 5 'and 3' ends. Preferably, the 3 'end of the first target selection sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5 'end of the second target selection sequence contains the same restriction site than the 3 'end of the amplified promoter. The promoter and sequences for selection of amplified targets are digested and ligated together. The promoter-sequence construct for selecting targets is delivered to the cells, either as a naked polynucleotide, or together with agents that facilitate transfection, such as liposomes, viral sequences, viral particles, whole viruses, lipofection, precipitation agents, etc. ., described in detail above. The P-sequence promoter for selecting targets can be delivered by any method, including direct needle injection, intravenous injection, topical administration, catheter infusion, particle accelerators, etc. The methods are described in more detail later. The cells absorb the promoter-sequence construct to select targets. Homologous recombination between the construct and the endogenous sequence is presented, such that an endogenous sequence coding for an angiogenic protein is under the control of the promoter. The promoter then activates the expression of the endogenous angiogenic sequence.

The polynucleotides that code for the angiogenic protein can be administered together with other polynucleotides that code for other angiogenic proteins. Preferably, the polynucleotide encoding the angiogenic protein contains a secretory signal sequence that facilitates the secretion of the protein. Typically, the signal sequence is placed in the coding region of the polynucleotide so that it is expressed towards or at the 5 'end of the coding region. The signal sequence may be homologous or heterologous to the polynucleotide of interest and may be homologous or heterologous to the cells to be transfected. Additionally, the signal sequence can be chemically synthesized using methods known in the art. Any mode of administration of any of the above-described polynucleotide constructs can be used so long as the mode results in the expression of one or more molecules in an amount sufficient to provide a therapeutic effect. This includes direct needle injection, systemic injection, catheter infusion, biolistic injectors, particle accelerators (ie, "gene guns"), gelfoam sponge deposits, other commercially available reservoir materials, osmotic pumps (eg, mini Alza pumps), oral or solid suppository pharmaceutical formulations (tablets or pills) and decantation or topical applications during surgery. For exam direct injection of naked plasmid precipitated with calcium phosphate in rat liver and in rat sn or from a plasmid coated with protein in the portal vein has resulted in gene expression of the foreign gene in rat livers (Kaneda et al., Science 243: 375 (1989)). A preferred method of local administration is by direct injection. Preferably, a recombinant molecule of the present invention comed with a delivery vehicle is administered by direct injection into, or locally, within the area of the arteries. The local administration of a composition within the area of the arteries refers to injecting the composition to centimeters and preferably to millimeters within the arteries. Another method of local administration is to contact a polynucleotide construct of the present invention having or around a surgical wound. For exam a patient can undergo surgery and can be coating the polynucleotide construct on the tissue surface within the wound or construction can be injected into tissue areas within the wound. Therapeutic compositions useful in systemic administration include recombinant molecules of the present invention complexed to a targeted delivery vehicle of the present invention. Suitable delivery vehicles for use with systemic administration comprise liposomes containing ligands to direct the vehicle to a particular site. Preferred methods of systemic administration include intravenous injection, aerosol, oral and percutaneous (topical) delivery. Intravenous injections can be performed using standard methods in the art. The aerosol delivery can also be effected using standard methods in the art (see, for example, Stribling et al., Proc. Nati, Acad. Sci. USA 189: 11277-11281, 1992, which is incorporated in the present invention. for reference). Oral delivery can be effected by complexing a polynucleotide construct of the present invention to a carrier that can withstand degradation by digestive enzymes in the viscera of an animal. Examples of such vehicles include capsules or tablets of plastic material, such as those known in the art. Topical delivery can be effected by mixing a polynucleotide construct of the present invention with a lipophilic reagent (eg, DMSO) that can pass into the skin. The determination of an effective amount of substance to be delivered depends on a number of factors including, for example, the chemical structure and biological activity of the substance, the age and weight of the animal, the precise condition that the treatment requires and its severity, and the route of administration. The sequence of treatments depends on a number of factors, such as the amount of polynucleotide constructs that are administered per dose, as well as the health and history of the individual. The precise amount, the number of doses, and the times when the doses are administered will be determined by the attending physician or veterinarian. The therapeutic compositions of the present invention can be administered to any animal, preferably to mammals and birds. Preferred mammals include humans, dogs, cats, mice, rats, rabbits, sheep, cows, horses and pigs, with humans being particularly preferred.

Pharmaceutical Compositions Polypeptides, polynucleotides and angiogenic agonists and antagonists can be used in combination with a pharmaceutically acceptable carrier. Such compositions comprise a therapeutically effective amount of the polypeptide or agonist or antagonist, and a pharmaceutically acceptable carrier or excipient. Such a vehicle includes but is not limited to saline, regulated saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulations must be adjusted to the mode of administration. The invention also provides a package or pharmaceutical case comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Along with the container or containers may be a note in a form prescribed by the government agency that regulates the manufacture, use or sale of pharmaceutical products or biological products, whose note reflects the approval, by the agency, for the manufacture, use or sale for human administration. In addition, the pharmaceutical compositions can be used in conjunction with other therapeutic compounds. The pharmaceutical compositions can be i &? A? ii ** J ** m- .. Aa¡ * At - $. *. administering in a convenient manner such as via the routes of topical, intravenous, intraperitoneal, intramuscular, intra tumor, subcutaneous, intranasal or intradermal administration. The pharmaceutical compositions are administered in an amount that is effective for the treatment and / or prophylaxis of the specific indication. In general, the pharmaceutical compositions are administered in an amount of at least about 10 mg / kg of body weight and in most cases will be administered in an amount not more than about 8 mg / kg of body weight per day. In most cases, doses are from approximately 10 mg / kg to approximately 1 mg / kg of body weight per day, taking into account the routes of administration, symptoms, etc. Angiogenic polypeptides, and agonists or antagonists which are polypeptides could also be used in accordance with the present invention by expressing such a polypeptide in vivo, which is often referred to as "gene therapy", described above. In this way, for example, cells such as bone marrow cells can be genetically engineered with a polynucleotide (DNA or RNA) encoding the t £ A * .. Jk -2tii * tt ~ ¿-. i *: *****. *. .- * ~. - < ? JÍ? A * ¡A. ** * ÍÉ- * ex vivo polypeptide, then the genetically engineered cells are provided to a patient to be treated with the polypeptide. Such methods are well known in the art. For example, cells can be genetically engineered by methods known in the art using a retroviral particle containing RNA that encodes the polypeptide of the present invention. Similarly, cells can be genetically engineered in vivo for the expression of an in vi ve polypeptide, for example, by methods known in the art. As is known in the art, a producer cell can be administered to produce a retroviral particle containing RNA encoding a polypeptide of the present invention to a patient to genetically engineer cells in vivo and to express the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such methods should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for genetically engineering the cells could be other than a retroviral particle, for example, an adenovirus, which can be used to genetically engineer cells in vivo after combining it. Í? K.á.Á.? A. - faith. & a * »> .. A * 3Í £ A * + IAA. "to ,.,.**. Ate s. with an appropriate supply vehicle. Retroviruses from which the retroviral plasmid vectors mentioned above in the present invention can be obtained include, but are not limited to, Moloney murine leukemia virus, spleen necrosis virus, retroviruses such as sarcoma virus. de Rous, Harvey's sarcoma virus, bird leukosis virus, gibbon leukemia virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus and breast tissue tumor virus. In one embodiment, the retroviral plasmid vector is derived from the Moloney murine leukemia virus. The vector includes one or more promoters. Suitable promoters that may be used include, but are not limited to, retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller et al. , Biotechniques 7: 980-990 (1989), or any other promoter (eg, cellular promoters such as eukaryotic cell promoters including, but not limited to, the histone, pol III and b-actin promoters). Other viral promoters that could be used include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters and parvovirus B19 promoters. The selection of an appropriate promoter will be apparent to those skilled in the art from the teachings contained in the present invention. The nucleic acid sequence encoding the polypeptide of the present invention is under the control of an appropriate promoter. Suitable promoters that can be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytium virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; the heat shock promoters; the albumin promoter; the ApoAl promoter; the human globin promoters; the viral thymidine kinase promoters, such as the herpes simplex thymidine kinase promoter; Retroviral LTR (including the modified retroviral LTRs described above in the present invention); the b-actin promoter; and the promoters of human growth hormone. The promoter may also be the original promoter from which it controls the gene encoding the polypeptide. The retroviral plasmid vector is used to transduce the packaging cell lines to form producer cell lines. Examples of packaging cells that can be transfected include, but not limited to, cell lines PE501, PA317, y-2, y-AM, PA12, T19-14X, VT-19-17-H2, yCRE, yCRIP, GP + E-86, GP + envAml2 and DAN as described in Miller, Human Gene Therapy 1: 5-14 (1990), which is incorporated by reference in the present invention in its entirety. The vector can transduce the packaging cells by any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and precipitation with CaP04. In an alternative, the retroviral plasmid vector can be encapsulated in a liposome, or can be coupled to a lipid, and then administered to a host. The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence or sequences encoding the polypeptides. Such retroviral vector particles can then be used to transduce eucapone cells, either in vi tro or in vivo. Transduced eucanon cells will express the nucleic acid sequence or sequences encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells and bronchial epithelial cells.

Diagnostic tests this invention also relates to the use of genes encoding angiogenic proteins as part of a diagnostic test for detecting diseases or susceptibility related to the presence of mutations in nucleic acid sequences diseases encoding the angiogenic proteins. Individuals that carry mutations in a gene and code for an angiogenic protein can be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis can be obtained from the patient's cells, such as blood, urine, saliva, tissue biopsy and autopsy material. Genomic DNA can be used directly for detection or can be amplified by enzymes using PCR (Saiki et al., ** Í ^ * Í,? .AAÁ.TIA ** r. *.

Na ture 324: 163-166 (1986)) before analysis. RNA or cDNA can also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid encoding an angiogenic protein can be used to identify and analyze mutations thereof. For example, deletions and insertions can be detected by a change in the size of the amplified product compared to the normal genotype. They can be identified by hybridizing amplified point mutations to radiolabeled RNA encoding the angiogenic protein, or alternatively, antisense DNA sequences specific for radiolabelled RNA encoding the angiogenic protein DNA. By digestion with RNase A or by differences in melting temperatures, the perfectly matched sequences of unpaired duplexes can be distinguished. Genetic tests based on differences in DNA sequence can be obtained by detecting the alteration in the electrophoretic mobility of the DNA fragments in gels with or without denaturing agents. The deletions and small insertions in the sequence can be visualized by high resolution gel electrophoresis. The DNA fragments of different sequences Ì á.? T.¿ .. í.ttf iá, iA¿A * Aiia can be distinguished on denaturing gels gradienre formamide in which the mobilities of different DNA fragments are retarded in the gel at positions different in accordance with their specific or partial melting temperatures (see for example, Myers et al., Science 230: 1242 (1985)). Sequence changes at specific sites can also be revealed by nuclease protection tests such as RNase and SI protection or the chemical dissociation method (eg, Cotton et al., PNAS, USA 85: 4397-4401 (1985)). Therefore, the detection of a DNA sequence can be achieved by methods such as hybridization, RNase protection, chemical dissociation, direct determination of the DNA sequence or the use of restriction enzymes, (for example, length polymorphisms). Restriction Fragments (RFLP for its acronym in English) and Southern blotting of genomic DNA. Mutations can also be detected by in situ analysis, in addition to more conventional gel electrophoresis and DNA sequence determination. The present invention also relates to a diagnostic test for detecting altered levels of angiogenic proteins in various tissues since an over expression of the proteins compared to normal tissue samples control can detect the presence of a disease or susceptibility to disease, for example, abnormal cellular differentiation. The tests used to detect levels of angiogenic proteins in a sample obtained from a host are well known to those skilled in the art and include radioimmunoassays testing, competitive binding Western blot analysis, ELISAs and test "sandwich". An ELISA test (Coligan et al., Current Protocols in Immunology 1 (2), chapter 6, (1991)) comprises initially preparing an antibody specific for the antigen of the angiogenic protein, preferably a monoclonal antibody. In addition, a reporter antibody is prepared against the monoclonal antibody. A detectable reagent such as radioactivity, fluorescence or, in this example, a horseradish peroxidase enzyme is attached to the reporter antibody. A sample is removed from a host and incubated on a solid support, for example, a polystyrene box, which binds to the proteins in the sample. Then cover any of the protein binding sites in the box incubating with a protein not specific, such as bovine serum albumin. Next, the monoclonal antibody is incubated in the box for a time in which the antibodies bind to any of the angiogenic proteins bound to the polystyrene box. All unbound monoclonal antibody is washed with buffer. The reporter antibody linked to the horseradish peroxidase is placed in the box which results in the binding of the reporter antibody to any monoclonal antibody bound to the angiogenic protein. The unbound reporter antibody is then washed. The substrates for peroxidase are then added to the box and the amount of color developed in a given period is a measure of the amount of angiogenic protein present in a given volume of patient sample when compared against a standard curve. A competitive test can also be used in cases in which antibodies specific for an angiogenic protein are bound to a solid support. The polypeptides of the present invention are then labeled, for example, by radioactivity, and a sample obtained from the host is passed through a solid support and the amount of the label is detected, for example by liquid flash chromatography, which it can be correlated with an amount of angiogenic protein in the sample. A "sandwich" test is similar to an ELISA test. In a "sandwich" test the angiogenic protein is passed through a solid support and bound to the antibody bound to a solid support. A second antibody is then ligated to the angiogenic protein. A third antibody is then passed which is labeled and specific for the second antibody, through the solid support and binds to the second antibody and then an amount can be quantified.

Identification of polynucleotide The sequences of the present invention are also valuable for the identification of chromosomes. The sequence specifically targets, and a single human chromosome can hybridize to a particular site. In addition, there is a current need to identify particular sites on the chromosome. Today, a few chromosome marker reagents based on real sequence data (of repeating polymorphism) are available to mark chromosomal sites. Mapping of DNA molecules to chromosomes according to the present invention is an important first step to correlate those sequences with the genes associated with the disease. Briefly, the sequences can be mapped to the chromosomes by preparing PCR primers (preferably 15-25 base pairs) from cDNA. Computer analysis of cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification procedure. These primers are then used to select by PCR somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the initiator will give an amplified fragment. PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, sub-localization can be achieved with panels of fragments from specific chromosomes or mixtures of large genomic clones in analogous form. Other mapping strategies that can be used in a similar way to map up to their chromosome include in situ hybridization, pre-selection with labeled flow-labeled chromosomes and preselection by hybridization to build chromosome-specific cDNA libraries. Fluorescence in situ hybridization (FISH) of a clone of CDNA for a metaphase chromosome expansion to provide a precise chromosome location in a single step. This technique can be used with probes from cDNAs as short as 50 or 60 base pairs. For a review of this technique, see Verma et al. , Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988). Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available online through the Welch Medical Library of John Hopkins University). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified by linkage analysis (co-inheritance of physically adjacent genes). With the current resolution of physical mapping and genetic mapping techniques, a cDNA molecule precisely located to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes a mapping resolution of 1 megabase and one gene per 20 kb). Comparison of affected and unaffected individuals usually involves first looking for structural alterations in the chromosomes, such as deletions or translocations that are visible in chromosome smears or that can be detected using PCR based on that cDNA sequence. Finally, the determination of the complete sequence of the genes coming from several individuals is necessary to confirm the presence of a mutation and to distinguish the mutations of the polymorphisms. Having generally described the invention, it will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to be a limitation.

EXAMPLES EXAMPLE 1 IN VITRO EXPRESSION OF ANGIOGENIC PROTEINS EXAMPLE: Bacterial Expression and Purification of Angiogenic Proteins The DNA sequence encoding the angiogenic protein can be amplified using oligonucleotide primers for PCR corresponding to the 5 'sequences of the processed protein (minus the signal peptide sequence) and the 3 'vector sequences towards the gene. The additional nucleotides corresponding to the gene are added to the 5 'and 3' sequences. This PCR product can be cloned into pQE60 (Quiagen, Inc. Chatsworth, CA 91311). The enzyme restriction sites correspond to the restriction enzyme sites in the pQE60 vector of bacterial expression. Vector pQE-60 codes for antibiotic resistance (Ampr), a bacterial origin of replication (op), a promoter operator that can be regulated with IPTG (P / O), a ribosome binding site (RBS), a 6-His mark and restriction enzyme sites. The pQE-60 vector is then digested with Ncol and BglII. The amplified sequences are ligated to the pQE-60 vector and inserted into the frame with the sequence coding for the histidine tag and the ribosome binding site (RBS). The ligation mixture is then used to transform the M15 / rep4 strain of E. coli (Quiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, ( 1989). M15 / rep4 contains multiple copies of plasmid pREP4, which expresses the lacl repressor and also confers resistance to kanamycin (Kanr). Transformants are identified by their ability to grow on LB plates and colonies resistant to ampicilm / kanamycin are selected. Plasmid DNA is isolated and confirmed by restriction analysis. The clones containing the desired constructions are grown overnight (O / N) in liquid culture in LB medium supplemented with Amp (100 ug / ml) and Kan (25 ug / ml). The O / N culture is used to inoculate a large crop at a ratio of 1: 100 to 1: 250. The cells are cultured to an optical density 600 (D.O.600) between 0.4 and 0.6. Then IPTG is added ("isopropyl-B-D-thiogalactopyranoside") to a final concentration of 1 mM. The IPTG induces, inactivating the lacl repressor, the elimination of P / O which leads to an increased expression of the gene. The cells are cultured for an additional 3 to 4 hours. Then they are harvested by centrifugation. The cell tablet is solubilized in the chaotropic agent 6 molar guanidine hydrochloride. After clarifying, the solubilized angiogenic polypeptide is purified from this solution by chromatography on a nickel-chelate column under conditions that allow strong binding of the 6-His-tagged proteins (Hochuli, E. et al., J. Chomatograpy 411: 177 -184 (1984)). The proteins are eluted from the column in 6 molar guanidine hydrochloride, pH 5.0 and with the purpose of naturalizing again they were adjusted to 3 molar guanidine hydrochloride, 100 mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione ( rusty) After incubation in this solution for 12 hours, the proteins were dialyzed against 10 mmolar sodium phosphate. In addition to the above expression vector, the present invention also includes an expression vector comprising a phage operator and promoter elements operably linked to a polynucleotide encoding the angiogenic polypeptide, called pHE4a. (Accession number ATCC 209645, filed on February 25, 1998). This vector contains: 1) a gene for j «lfa¿a ^ A ^ - ^ * ¿*,« * - neomycin phosphotransferase as a selection marker, 2) an origin of replication of E. coli, 3) a sequence of phage promoter T5, 4) two sequences of lac operator, 5) a Shine-Delgarno sequence, and 6) the repressor gene of the lactose operon (laclq). The origin of replication (oriC) is obtained from pUC19 (LTI, Gaithersburg, MD). The promoter sequence and the operator sequences are synthetically processed. DNA can be inserted into the pHEa by restricting the vector with Ndel and Xbal, BamHl, Xhol, or Asp718, running the restricted product on a gel, and isolating the largest fragment (the most rigid fragment should be approximately 310 base pairs). ). The DNA insert is generated in accordance with the PCR protocol described above, using primers for PCR having restriction sites for Ndel (5 'primer) and Xbal, BamHl, Xhol, or Asp718 (3' primer). The PCR insert is gel purified and restricted with compatible enzymes. The insert and the vector are linked according to standard protocols. The genetically engineered vector can easily be substituted in the previous protocol to express' protein in the bacterial system. l? > A¿AtÍa * ¿bAA.i * ifa »g -» - "- '* - * * - * ..

EXAMPLE IB: Cloning and expression of angiogenic proteins in a baculovirus expression system The DNA sequence encoding a full-length angiogenic protein is amplified using oligonucleotide primers for PCR corresponding to the 5 'and 3' sequences of the gene. The amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment is then digested with the respective endonucleases and purified again on a 1% agarose gel. This fragment is called F2. The vector pA2 (modifications of the pVL941 vector, discussed later), is used for the expression of proteins using the baculovirus expression system (for a review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHl and Xbal. It uses the polyadenylation site of simian virus (SV) 40 for efficient polyadenylation. For an easy selection of recombinant virus, the gene for beta-galactosidase from E. coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The sequences for polyhedrin are flanked on both sides by viral sequences for the cell-mediated homologous recombination of the co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pA2 such as pRGl, pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170: 31-39). The plasmid is digested with restriction enzymes and dephosphorylated using bovine intestine phosphatase by methods known in the art. The DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is called V2. The F2 fragment and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E.coli DH5 alpha cells are then transformed and the bacterium containing the plasmid is identified using the respective restriction enzymes.

The sequence of the cloned fragment is confirmed by DNA sequence determination. 5 μg of plasmid was co-transfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al., Proc. Nati, Acad. Sci. USA, 84: 7413-7417 (1987)). 1 μg of baculoGold virus DNA and 5 μg of the plasmid were mixed in a sterile cavity of microtitre plates containing 50 μl of Grace's free medium serum (Life Technologies Inc., Gaithersburg, MD). After this, 10 μl of Lipofectin plus 90 μl of Grace's medium were added, mixed and incubated for 15 minutes at room temperature. The transfection mixture was then added by dripping to the Sf9 insect cells (ATCC CRL 1711) seeded in 35mm tissue culture plates with 1 ml Grace's medium without serum. The plates are rocked back and forth to mix the newly added solution. The plates are then incubated for 5 hours at 27 ° C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal bovine serum is added. The Plates are returned to the incubator and incubation is continued at 27 ° C for 4 days. After 4 days, the supernatant is collected and plate tests similar to those described by Summers and Smith are performed. { supra). As an amendment, an agar gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used which allows the blue stained plates to be easily isolated. (A detailed description of a "plaque test" can also be found in the user guide for insect cell cultures and baculovirology distributed by Life Technologies Inc., Gaithersburg, pages 9-10). Four days after serial dilution the virus is added to the cells and the blue-stained plates are removed with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35mm dishes. Four days later the supernatants of these culture boxes are harvested and stored at 4 ° C. jjj fc j.iA? i- Sf9 cells are cultured in Grace's medium supplemented with 10% heat-inactivated FBS. Cells are infected with the recombinant baculovirus to a multiplicity of infection (MOI) of 2. The medium is removed six hours later and replaced with F900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later, 5 μCi of 35S-methionine and 5 μCi of 35S-cysteine (Amersham) are added. The cells are incubated for another 16 hours before they are harvested by centrifugation and the labeled proteins are visualized by SDS-PAGE and autoradiography. The sequence microdetermination of the amino acid sequence of the amino terminus of the purified protein can be used to determine the amino terminal sequence of the produced angiogenic protein.

EXAMPLE IC: Recombinant angiogenic protein expression in mammalian cells Cloning and expression in COS cells The expression of the plasmids, X-HA (X represents an angiogenic protein of interest) obtained from a pcDNA3 / Amp vector (Invitrogen) containing: 1) the origin of replication SV40, 2) ampicillin resistance gene, 3) origin of replication of E. coli, 4) CMV promoter followed by a polylinker region, an SV40 intron and the polyadenylation site. The DNA fragments encoding the complete precursor of the angiogenic protein and an HA tag fused in the frame towards the 3 'end is cloned in the polylinker region of the vector, therefore, the expression of the recombinant protein is directed under the CMV promoter. The HA mark corresponds to an epitope obtained from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Conolly, and R. Lerner, 1984, Cell 37: 767 , (1984)). The infusion of the HA tag to the target protein allows the recombinant protein to be easily detected with an antibody that recognizes the HA epitope. The strategy of plasmid construction is described below: The DNA sequence encoding an angiogenic polypeptide is constructed by PCR using 2 primers: a 5 'primer containing a Ba Hl site followed by 18 nucleotides of the coding sequence starting from the initiation codon; the 3 'primer contains the complementary sequences for an Xhol site, the translation stop codon, the HA tag and the last 18 nucleotides of the sequence encoding the angiogenic polypeptide (not including the stop codon). Therefore, the PCR product contains a BamH1 site, the coding sequence followed by the HA tag fused in the frame, a stop codon to terminate the translation adjacent to the HA mark and the Xhol site. The DNA fragments amplified by PCR and the vector pcDNA3 / Amp, they are digested with the respective restriction enzymes and ligated. The ligation mixture is transformed into the SURE strain of E. coli (available from Stratagene Cloning Systems, La Jolla, CA 92037), the transformed culture is plated on medium plates with ampicillin and the resistant colonies are selected. Plasmid DNA is isolated from the transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant angiogenic polypeptide, COS cells are transfected with the expression vector by the DEAE-DEXTRAN method (J. Sambrook, E. Fritsch T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) ). The expression of the X-HA protein is detected by the radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). The cells are labeled for 8 hours with 35S-cysteine two days after transfection. The culture medium is then collected and the cells are lysed with detergent (RIPA regulatory solution (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, Tris 50 mM, pH 7.5) (Wilson, I. et al., Id. 37: 767 (1984)) Both the lysate cell material and the culture medium are precipitated with a monoclonal antibody specific for HA.The precipitated proteins are analyzed in 15% SDS-PAGE gels.

Cloning and expression in other mammalian cells The angiogenic polypeptide can be expressed in a mammalian cell. A typical mammalian expression vector contains a promoter element, which serves as a mediator of the initiation of mRNA transcription, a protein coding sequence, and the signals required to complete the transcription and polyadenylation of the transcript. Additional elements include tensors, Kozak sequences and interspersed sequences (introns) flanked by the donor and acceptor sites for RNA splicing. A transcription with high efficiency is obtained with the initial and late promoters from SV40, the long terminal repeats (LTR) from retroviruses, for example RSV; HTLVI, HIVI and the initial promoter of cytomegalovirus (CMV). However, cellular elements can also be used (for example, the human actin promoter). Expression vectors suitable for use in the practice of the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2DHFR (ATCC 37146), pBC12MI (ATCC 67109 ), pCMVSport 2.0, and pCMVSport 3.0. Mammalian host cells that could be used include, Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and ovarian cells of Chinese hamster (CHO). Alternatively, the angiogenic polypeptide can be expressed in stable cell lines containing the polynucleotide encoding the angiogenic polypeptide integrated into a chromosome. Cotransfection with a selectable marker such as DHFR, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells. The transfected gene encoding the angiogenic polypeptide can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) marker is useful for developing cell lines that carry several hundred or even several thousand copies of the gene of interest. (See, for example, Alt, FW, et al., J. Biol. Chem. 253: 1357-1370 (1978), Hamlin, JL and Ma, C., Biochem et Biophys. Acta, 1097: 107-143 (1990 ); Page, MJ and Sydenham, MA Biotechnology 9: 64-68 (1991)). Another marker for useful selection is the enzyme glutamine synthetase (GS) (Murphy et al., Biochem J. 227: 277-279 (1991); Bebbington et al., Bio / Technology 10: 169-175 (1992). In the case of markers, the mammalian cells are cultured on selective medium and the cells with the highest resistance are chosen.These cell lines contain the gene or amplified genes integrated into a chromosome.Officially, Chinese hamster ovary (CHO) cells are used. NSO for the production of proteins The derivatives of the plasmid pSV2-DHFR (Accession No. ATCC 37146), the expression vectors pC4 (No. ÍLAí * .ÍA, .ÁA.kÚM l ,. - * - toa m, ** ¿t É * A? m? * A- L. -.

Access Code 209646) and pC6 (Accession No. ATCC 209647) contain the Rous sarcoma virus promoter (LTR) (Cullen et al., Molecular and Cellular Biology, 438-447 (March, 1985)) in addition of a fragment of the CMV enhancer (Boshart et al., Cell 41: 521-530 (1985)). Multiple cloning sites, for example with the restriction enzymatic cleavage sites BamHl, Xbal and Asp718, facilitate the cloning of the gene encoding the angiogenic polypeptide. The vectors also contain the 3 'intron, the polyadenylation and termination signal of the rat preproinsulin gene, and the mouse DHFR gene under the control of the initial SV40 promoter. Specifically, plasmid pC6 or pC4 is digested with the appropriate restriction enzymes and then dephosphorylated using bovine intestinal phosphatase by methods known in the art. The vector is then isolated from a 1% agarose gel. The cDNA sequence encoding the full-length angiogenic protein is amplified using oligonucleotide primers for PCR corresponding to the 5 'and 3' sequences of the gene. If a signal sequence that occurs naturally to produce a secreted protein is used, the vector does not need a second peptide Alternatively, if a naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence in an effort to secrete the protein from the cell (See for example, WO 96/34891.) The amplified fragment is then digested with the appropriate restriction enzyme and purified on a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc. ., La Jolla, Ca.) The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase, then the HB101 or XL-1 Blue cells of E. coli and the bacteria containing the fragment inserted into the plasmid are transformed. pC6 or pc4 are identified using, for example, restriction enzyme analysis Chinese hamster ovary cells lacking a gene for active DGFR for transfection are used 5μg of the expression plasmid pC6 or pC4 s and cotransfected with 0.5 ug of the plasmid pSVneo using lipofectin (Felgner et al., supra). Plasmid pSV2-neo contains a selectable dominant marker, the neo gene of Tn5 that codes for an enzyme that confers resistance to a group of antibiotics including G418. The cells are seeded in alpha medium minus MEM supplemented with 1 mg / ml of G418. After 2 days, the cells are treated with trypsin and plated for cloning of hybridoma (Greiner, Germany) in alpha medium minus MEM supplemented with 10, 25 or 50 ng / ml of methotrexate plus 1 mg / ml of G418. After about 10-14 days the individual clones are treated with trypsin and then seeded in 6-well Petri dishes or 10 ml flasks using different methotrexate concentrations (50 nM, 100 nM, 200 nM, 400 nM, 800 nM ). Clones growing at the highest concentrations of methotrexate are then transferred to 6-cavity new Petri dishes containing even higher concentrations of methotrexate (1 uM, 2 uM, 5 uM, 10 mM, 20 mM). The same procedure is repeat until clones are obtained that grow at a concentration of 100-200 uM. The expression of the angiogenic polypeptide is analyzed, for example, by SDS-PAGE and Western blot or by reverse phase HPLC analysis.

EXAMPLE 2 Isolation of genomic clones that code for angiogenic polypeptides A human Genomic Pl library is selected (Genomic Systems, Inc.) by PCR, using primers selected for the corresponding cDNA sequence SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23, respectively, according to the method of Sambrook et al.

EXAMPLE 3 Distribution of angiogenic polypeptides in tissues The tissue distribution of mRNA expression of an angiogenic protein was determined using protocols for Northern blot analysis, described by, among others, Sambrook et al. For example, probes specific for the gene encoding the angiogenic protein of interest are labeled with P32 using the rediprime ™ DNA labeling system (Amersham Life Science), in accordance with the manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN-100 ™ column (Clontech Laboratories, Inc.), in accordance with the manufacturer's No. PT1200-1 protocol. The purified labeled probe is then used to examine various human tissues for mRNA expression. Multiple-Tissue Northern blots (MTN) containing various human tissues (H) or tissues of the human immune system (IM) (Clontech) are screened with the probe labeled using the ExpressHyb ™ hybridization solution (Clontech) ) in accordance with the manufacturer's protocol No. PT1190-1. After hybridization and washing, the blots are mounted and exposed to a film at -70 ° C overnight, and the films are developed according to standard procedures.

EXAMPLE 4 Chromosomal Mapping of angiogenic proteins A set of oligonucleotide primers according to the sequence at the 5 'end of the sequences SEQ ID NOS are designed: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, respectively . Preferably this initiator has an extension of approximately 100 nucleotides. This set of primers is used after ? i i? '-. i i? ÍSJÉÍJ? r * 'in a polymerase chain reaction under the following conditions: 30 seconds, 95 ° C; 1 minute, 56 ° C; 1 minute, 70 ° C. This cycle is repeated 32 times followed by a 5 minute cycle at 70 ° C. Human, mouse and hamster DNA is used as a template in addition to a hybrid somatic cell panel containing individual chromosomes or fragments of chromosomes (Bios, Ine). The reactions are analyzed either in 8% polyacrylamide gels or in 3.5% agarose gels. Chromosomal mapping is determined by the presence of a PCR fragment of approximately 100 base pairs in the particular somatic cell hybrid.

EXAMPLE 5 Purification of the angiogenic polypeptide from a body of inclusion The following alternative method can be used to purify the angiogenic polypeptide expressed in E. coli when it is present in the form of inclusion bodies. Unless otherwise specified, all the following steps are conducted at a temperature of 4-10 ° C. After completing the production phase of the fermentation of E. coli, the cell culture is cooled to a temperature of 4-10 ° C and the cells are harvested by continuous centrifugation at 15,000 rpm (Heraeus Sapatech). Based on the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4 . The cells are dispersed until a homogeneous suspension is obtained using a high shear mixer. The cells are then lysed by passing the solution through a microfluidizer (Microfuidics, Corp. or APV Gaulin, Inc.) 2 times at 69.2-103.8 kg / cm2. The homogenized material is then mixed with NaCl solution to a final concentration of 0.5 M NaCl, followed by centrifugation at 7000 x g for 15 minutes. The resulting tablet is washed again using 0.5 M NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4. The resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After centrifugation at 7000 xg for 15 minutes, the tablet is discarded and the supernatant containing the polypeptide is incubated at 4 ° C throughout the i,? A. »íA? At. * .. ?? To? A.m. overnight to allow additional extraction with (GuHCl). After centrifugation at high speed (30,000 xg) to remove the insoluble particles, the protein solubilized with GuHCl is reconfigured by rapid mixing of the extract with GuHCl with 20 volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM of NaCl, 2mM EDTA with vigorous stirring. The reconfigured diluted protein solution is kept at 4 ° C without mixing for 12 hours before the subsequent purification steps. To clarify the reconfigured polypeptide solution, a pre-prepared tangential filtration unit equipped with a membrane filter of 0.16 μm with an appropriate surface area (eg Filtron), equilibrated with 40 mM sodium acetate, pH 6.0 is used. the filtered sample is loaded onto a cation exchange resin (for example Poros HS-50, Perseptive Biosystems). The column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM and 1500 mM NaCl in the same buffer, in steps. The absorbance of the effluent at 280 nm is monitored continuously. Fractions are collected and then analyzed by SDS-PAGE.

The fractions containing the angiogenic polypeptide are then mixed and combined with four volumes of water. The diluted sample is then loaded into a pre-prepared set of columns in series of strong anion exchange resins (Poros HQ-50, Perseptive Biosystems) and weak anion exchange (Poros CM-20, Perseptive Biosystems). The columns are equilibrated with 40 M sodium acetate pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCl. The CM-20 column is then eluted using a linear gradient of 10 column volumes varying from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCl, 50 mM sodium acetate, pH 6.5. The fractions are collected under constant monitoring at A280 of the effluent. Fractions containing the polypeptide (determined, for example by 16% SDS-PAGE) are then mixed. The resulting angiogenic polypeptide should have a purity greater than 95% after the steps of reconfiguration and purification above. No significant bands of contaminants should be observed from the 16% SDS-PAGE gel stained with Commassie blue when 5 ug of purified protein is loaded. The purified angiogenic protein can also be evaluated for endotoxin / LPS contamination, and typically the LPS content is less 0.1 ng / ml according to the LAL tests.

EXAMPLE 6 Construction of N-terminal deletion mutants and / or C-tristamine The following general method can be used to clone the deletion mutants at the N-terminal or C-terminal end of an angiogenic protein. In general, two oligonucleotide primers of about 15-25 nucleotides are obtained from the desired 5 'and 3' positions of a polygonucleotide of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23, respectively. The 5 'and 3' positions of the primers are determined based on the desired polygonucleotide fragment encoding the angiogenic polypeptide. An initiation and stop codon is added to the 5 'and 3' primers respectively, if necessary, to express the angiogenic polypeptide fragment encoded by the polynucleotide fragment. Additional nucleotides can also be added jAlX i-containing restriction sites to facilitate cloning of the polynucleotide fragment encoding the angiogenic polypeptide into a desired vector to the 5 'and 3' primer sequences. The polynucleotide fragment encoding the angiogenic polypeptide is amplified from a clone of genomic DNA or from cDNA using the oligonucleotide primers and conditions for appropriate PCR discussed in the present invention or known in the art. The angiogenic polypeptide fragments encoded by the appropriate polynucleotide fragments of the present invention can be expressed and purified in the same general manner as full-length polypeptides, although routine modifications may be necessary due to differences in chemical and physical properties between a particular fragment and a full-length polypeptide. The amplified polynucleotide fragment and the expression vector are digested with restriction enzymes that recognize the sites and primers. Then the digested polynucleotides are ligated together. The polynucleotide fragment encoding the angiogenic polypeptide is inserted into the restricted expression vector, preferably in a form that places the coding region of the angiogenic polypeptide fragment towards the 3 'end of the promoter. The mixture for ligating is transformed into cells of fí. competent coli using standard procedures and as described in the examples of the present invention. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA is confirmed by restriction analysis, PCR and DNA sequence determination.

EXAMPLE 7 Dβ fusion proteins angiogenic polypeptides The angiogenic polypeptides are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, the fusion of the angiogenic polypeptides to the His tag, the HA tag, protein A, the IgG domains, and the maltose binding protein facilitates purification. (See Example 5, see also EP 394,827, Traunecker, et al., Nature 331: 84-86 (1988)). Similarly, fusion to IgG-1, IgG-3, and albumin increases the half-life in vivo. Nuclear localization signals fused to angiogenic polypeptides can directing the protein to a specific subcellular location, while the heterodimer or covalent homodimers can increase or decrease the activity of a fusion protein. Fusion proteins can also create chimeric molecules that have more than one function. Finally, the fusion proteins can increase the solubility and / or stability of the fused protein compared to the unfused protein. All types of fusion proteins described above can be made by modifying the following protocol, which indicates the fusion of a polypeptide to an IgG molecule, or a protocol described in the examples. In brief, the human Fc portion of the IgG molecule can be amplified by PCR, using primers spanning the 5 'and 3' ends of the sequence described below. These primers should also have convenient restriction enzyme sites that facilitate cloning into an expression vector, preferably a mammalian expression vector. For example, if pC4 is used (access number 209646), the Fc portion of human can be ligated into the BamHl cloning site. Note that site 3 'Ba Hl must be destroyed. Then, the vector containing the Fc portion of human is restrained with BamHI, linearizing the vector, and the polynucleotide encoding the angiogenic polypeptide, isolated by PCR, is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced. If the signal sequence that occurs naturally to produce the secreted protein is used, pC4 does not need a second signal peptide. Alternatively, if the naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence. (See, for example, WO 96/34891). Fc region of human IgG: GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCC AGCACCTGAATTAGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAAACCCA AGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGTGGTGGA CGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGT GGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCAC GTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGC AAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGA AAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCT GCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTG 1-i ubA? -lt ** - > • ** *** »** ** '- ¿ ~? - * ~ -. * r A * AtA.mt * A-? jfcj¿.-iatjA GTCAAAGGCTTCTATCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGG CAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCT CCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGG GAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACA CGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGTGCACGGCCGCGACT CTAGAGGAT (SEQ ID No. 30).

EXAMPLE 8 Production of an antibody EXAMPLE 8A: Hybridoma Technology The antibodies of the present invention can be prepared by a variety of methods. (See, Current Protocols, chapter 2). As an example of such methods, cells expressing the angiogenic polypeptide are administered to an animal to induce the production of serum containing polyclonal antibodies. In a preferred method, a preparation of the angiogenic protein is prepared and purified to be substantially free of natural contaminants. The preparation is then introduced to an animal in order to produce polyclonal antiserum with a higher specific activity. In the most preferred method, the antibodies of the present invention are monoclonal antibodies (or fragments thereof that bind to proteins). Such monoclonal antibodies can be prepared using hybridoma technology. (Kohier et al., Nature 256: 495 (1975); Kohier et al., Eur. J. Immunol., 6: 511 (1976); Kohleret al., Eur. J. Immunol., 6: 292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, NY, pp. 563-681 (1981)). In general, such methods involve immunizing an animal (preferably a mouse) with the angiogenic polypeptide or, more preferably, with a cell that expresses the secreted angiogenic polypeptide. Such cells can be cultured in any appropriate tissue culture medium; however, it is preferred to culture the cells in Eagle's modified Earle's medium supplemented with 10% fetal bovine serum (inactivated at approximately 56 ° C), and supplemented with approximately 10 g / liter of non-essential amino acids, approximately 1000 U / ml of penicillin, and approximately 100 ug / ml of streptomycin. The splenocytes of such mice are extracted and fused with an appropriate myeloma cell line. In accordance with the present invention, any appropriate myeloma cell line could be used; however, it is preferred to use the precursor myeloma cell line (SP20), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting the dilution as described by Wands et al. (Gastroenterology 80: 225-232 (1981)). The hybridoma cells obtained by such screening are then tested to identify clones that secrete antibodies that can bind to the angiogenic polypeptide. Alternatively, additional antibodies capable of binding to the angiogenic polypeptide can be produced in a two step procedure using anti-idiotypic antibodies. Such a method takes advantage of the fact that the antibodies themselves are antigens, and therefore, it is possible to obtain an antibody that binds to a second antibody. In accordance with this method, antibodies specific for protein are used to immunize an animal, preferably a mouse. Splenocytes from such an animal are then used to produce hybridoma cells, and the hybridoma cells are selected to identify clones that produce an antibody whose ability to bind to the angiogenic protein-specific antibody complex can be blocked by the angiogenic protein. Such antibodies comprise anti-idiotypic antibodies to the angiogenic protein-specific antibody complex and can be used to immunize an animal to induce further formation of angiogenic protein-specific antibodies. It will be appreciated that Fab and F (ab ') 2 and other fragments of the antibodies of the present invention could be used in accordance with the methods described therein. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F (ab ') 2 fragments). Alternatively, fragments that bind to the secreted angiogenic protein can be produced through the application of recombinant DNA technology or through synthetic chemistry. For the in vivo use of antibodies in humans, it may be preferred to use "humanized" chimeric monoclonal antibodies. Such antibodies can be produced using genetic constructs derived from hybridoma cells that produce the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. (See, for a review, Morrison, Science 229: 1202 (1985); Oi et al., BioTechmques 4: 214 (1986); Cabilly et al., Patent E.U.A. No. 4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312: 643 (1984); Neuberger et al., Nature 314: 268 (1985).

EXAMPLE 8B: Isolation of Antibody Fragments Directed Against the Angiogenic Polypeptide from a ScFvs Library Naturally occurring V genes isolated from human PBL were constructed in a large library of antibody fragments which contain reactivities against the angiogenic polypeptides. to which the donor may or may not have been exposed (see for example, US Patent No. 5,885,793 incorporated in the present invention for reference in its entirety) Rescue of the library A scFvs library is constructed from Human PBL RNA as described in the document WO92 / 01047. To rescue the antibody fragments that display phage, approximately 106 E. coli were used l-Á *, tn. ~ A. i, .. i * íá * k. * +? f? -in-,. which houses the phagemid to inoculate 50 ml of 2xTY containing 1% glucose and 100 ug / ml of ampicillin (2xTY-AMP-GLU) and are grown to a D.O. of 0.8 with agitation. 5 ml of this culture was used to inoculate 50 ml of 2xTY-AMP-GLU, 2 x 108 TU of the delta 3 gene helper (M13 delta gene III, see WO92 / 01047) are added and the culture is incubated at 37 ° C. C for 45 minutes without stirring and then at 37 ° C for 45 minutes with shaking. The culture is centrifuged at 4000 rpm for 10 minutes, and the tablet is resuspended in 2 liters of 2xTY containing 100 ug / ml ampicillin and 50 ug / ml kanamycin and grown overnight. The phages are prepared as described in WO 92/01047. The phage M13 delta gene III is prepared as follows: the auxiliary phage M13 delta gene III does not code for the gene III protein, therefore the antibody fragments that display the phage (phagemid) have a higher avidity of antigen binding. M13 delta gene III particles are prepared by growing the phage-helper in cells harboring a pUC19 derivative by supplying the wild-type gene III protein during phage morphogenesis. The culture is incubated for 1 hour at 37 ° C without stirring and then for another hour at 37 ° C with shaking. The cells are centrifuged (IEC-Centra 8, 4000 revs / minute for 10 minutes), resuspend in 300 ml of 2xTY broth containing 100 ug / ml ampicillin / ml and 25 ug / ml kanamycin / ml (2xTY-AMP-KAN ) and are grown overnight, stirring at 37 ° C. The phage particles are purified and concentrated from the culture medium by means of two precipitations with PEG (Sambrook et al., 1990), are resuspended in 2 ml of PBS and passed through a 0.45 μm filter (Minisart NML, Sartorius) to give a final concentration of 1013 transducing units / ml approximately ( clones resistant to ampicillin).

Visual inspection of the library Immunology tubes (Nunc) were coated overnight in PBS with 4 ml of a 100 ug / ml solution or 10 ug / ml of a polypeptide of the present invention. The tubes are blocked with 2% MarPBS for 2 hours at 37 ° C and then washed three times in PBS. Approximately 1013 TU of the phage is applied to the tube and incubated for 30 minutes at room temperature with rotating shaking on a turntable that rotates up and down and then allowed to stand for another 1.5 hours. The tubes are washed three times with PBS 0.1% Tween-20 and 10 times with PBS. The phages are eluted by adding 1 ml of 100 mM triethylamine and rotating them for 15 minutes on a turntable that rotates up and down after which the solution is immediately neutralized with 0.5 ml of 1.0 M Tris-HCl, pH 7.4. The phages are then used to infect 10 ml of E. coli TG1 hemi-log by incubating the phage eluted with the bacteria for 30 minutes at 37 ° C. E. coli is then seeded in plaque on TYE plates containing 1% glucose and 100 ug / ml ampicillin. The resulting bacterial library is then rescued with the auxiliary phage delta gene 3 as described above to prepare the phage for a subsequent round of selection. This procedure is then repeated for a total of 4 rounds of affinity purification with tube washing increased up to twenty times with PBS, 0.1% Tween-20 and twenty times with PBS for rounds 3 and 4.

Characterization of binders Eluted phage from the 3rd and 4th rounds of selection were used to infect E. coli HB2151 and soluble scFv (Marks et al., 1991) was produced from individual colonies for testing. The ELISA tests are carried out with microtiter plates coated with 10 pg / ml of the polypeptide of the present invention in 50 M bicarbonate solution pH 9.6. Clones that were positive in the ELISA were also characterized by PCR fingerprinting (see WO 92/01047) and then by sequence determination.

EXAMPLE 9 Production of angiogenic protein for selection tests The following protocol produces a supernatant containing the angiogenic polypeptide to be tested. This supernatant can then be used in the selection tests described in examples 14-21. First, the poly-D-lysine buffer solution (644 587 Boehringer-Mannheim) (1 mg / ml in PBS) 1:20 in PBS (c / s calcium or magnesium 17-516 F from Biowhittaker) is diluted for a working solution of 50 ug / ml. 200 ul of this solution is added to each of the cavities (plates of 24 cavities) and incubated at room temperature for 20 minutes. It must be ensured that the solution is distributed in each cavity (note: A 12-channel pipettor with the tips could be used in every third channel). The poly-D-lysine solution is aspirated and rinsed with 1 ml of PBS (saline regulated with phosphates). The PBS should remain in the cavity until just before the cells are plated and the plates can be coated with poly-lysine with an anticipation of up to two weeks. 293T cells are plated (cells are not carried beyond P + 20) at a density of 2 x 10 5 cells / well in 0.5 ml of DMEM medium (Dulbecco's Modified Eagle Medium) (with 4.5 g / 1 glucose). and L-glutamine (12-604F from Biowhittaker)) / 10% heat-inactivated FBS (14-503F from Biowhittaker) / lx Penstrep (17-602E from Biowhittaker). The cells are allowed to develop overnight. The next day, they are mixed together in a sterile solution container: 300 ul of Lipofectamine (18324-012 Gibco / BRL) and 5 ml of Optimem I (31985070 Gibco / BRL) / 96-well plate. Approximately 2 ug aliquots are taken, with a small volume multichannel pipettor of an expression vector containing a polynucleotide insert, produced by the methods described in Examples 8-10, in a 96-well round-bottom plate marked appropriately. 50 ul of the Lipofectamine / Optimem I mixture is added to each well with a multi-channel pipettor. Pipet gently up and down to mix. It is incubated at room temperature for 15-45 minutes. After about 20 minutes, a multi-channel pipettor is used to add 150 ul of Optimem I to each well. As a control, a DNA plate of the vector lacking an insert with each set of transfections must be transfected. Preferably, the transfection must be done through teamwork by objectives to perform the following tasks. Through teamwork, the runtime is cut in half, and the cells do not stay in PBS for long. First, Person A aspirates the medium of four plates of 24 cavities with cells, and then Person B rinses each cavity with 0.5-1 mL of PBS. Person A then aspirates the PBS rinse, and Person B, using a 12-channel pipettor with the tips in each third channel, adds the 200 ul of DNA / Lipofectamine / Optimem I complex first to the odd-numbered cavities, and then to the cavities with even number, of each row of the plates of 24 cavities. It is incubated at 37 degrees centigrade for six hours. While the cells are incubated, the appropriate media are prepared, either 1% BSA in DMEM with lx penstrep, or HGS CHO-5 medium (116.6 mg / l CaCl2 (anhydrous); 0.00130 mg / l of CuSO4-5H20; 0.050 mg / l of Fe (N03) 3-9H20; 0.417 mg / L of FeSO4-7H20; 311.80 mg / L KCl; 28.64 mg / l MgCl2; 48.84 mg / l of MgSO4; 6995.50 mg / l NaCl; 2400.0 mg / l of NaHCO3; 62.50 mg / l of NaH2PO4-H20; 71.02 mg / l of Na2HP04; 0.4320 mg / L of ZnSO4-7H20; 0.002 mg / L of arachidonic acid; 1022 mg / l of cholesterol; 0.070 mg / l of DL-alpha-Tocopherol acetate; 0.0520 mg / l of lmoléic acid; 0.010 mg / l of linolenic acid; 0.010 mg / l of myristic acid; 0.010 mg / l oleic acid; 0.010 mg / L of palmic acid; 0.010 mg / l of palmitic acid; 100 mg / L Pluronic F-68; 0.010 mg / l of stearic acid; 2.20 mg / L of Tween 80; 4551 mg / l of D-glucose; 130.85 mg / ml of L-alanma; 147.50 mg / ml of L-arginine-HCl; 750 mg / ml of L-asparagine-H20; 6.65 mg / ml L-aspartic acid; 29.56 mg / ml of L-cysteine-2HCl-H20; 31.29 mg / ml of L-c? Stina-2HCl; 7.35 mg / ml L-glutamic acid; 365.0 mg / ml L-glutamine; 18.75 mg / ml glycine; 52.48 mg / ml of L-h? Stdma-HCl-H20; 106.97 mg / ml of L-isoleucine; 111.45 mg / ml L-leucine; 163.75 mg / ml L-lysine HCl; 32.34 mg / ml of L-methionine; 68.48 mg / ml L-phenylalanine; 40.0 mg / ml L-proline; 26.25 mg / ml L-serine; 101.05 mg / ml L-threonine; 19.22 mg / ml L-tryptophan; 91.79 The amount of L-trirosine-2Na-2H20; and 99.65 mg / ml L-valine; 0.0035 mg / l of biotin; 3.24 mg / l of D-pantothenate of Ca, -11.78 mg / l of choline chloride; 4.65 mg / l folic acid; 15.60 mg / l of i-inositol; 3.02 mg / l of niacinamide; 3.00 mg / l of pyridoxal HCl; 0.031 mg / l of pyridoxine HCl; 0.319 mg / l of riboflavin; 3.17 mg / l thiamine HCl; 0.365 mg / l of thymidine; 0.680 mg / l of vitamin Bi2; 25 mM of HEPES regulatory solution; 2.39 mg / l Na hypoxanthine; 0.105 mg / l of lipoic acid; 0.081 mg / l sodium putrescine-2HC1; 55.0 mg / l of sodium pyruvate; 0.0067 mg / l of sodium selenite; 20 uM ethanolamine; 0.122 mg / l of ferric citrate; 41.70 mg / L of methyl-B-cyclodextrin complexed with linoleic acid; 33.33 mg / l of methyl-B-cyclodextrin complexed with oleic acid; 10 mg / L of methyl-B-cyclodextrin complexed with retinal acetate. The osmolarity is adjusted up to 327 mOsm) with 2 mm of glutamine and 100 grams of lx penstrep. (BSA (81-068-3 Bayer) dissolved in 1 liter of DMEM for a reserve solution of 10% BSA). The medium is filtered and 50 ul are collected for the endotoxin test in 15 ml conical polystyrene containers. The transfection reaction is terminated, preferably with teamwork, at the end of the incubation period. Person A aspirates the transfection medium, while person B adds 1.5 ml of appropriate medium to each cavity. Incubate at 37 ° C for 45 or 72 hours depending on the medium used: 1% BSA for 45 hours or CHO-5 for 72 hours. On the fourth day, using a 300-μl multichannel pipettor, a 600-ul aliquot was placed in a cavity plate 1 ml deep and the supernatant remaining in a 2-ml-deep cavity. The supernatants from each well can then be used in the tests described in examples 10-12. It is specifically understood that when activity is obtained in any of the tests described below using a supernatant, the activity originates from either the angiogenic polypeptide directly (eg, as a secreted protein) or through the angiogenic polypeptides that induce the expression of other proteins, which are then secreted into the supernatant. Therefore, the invention also provides a method for identifying the protein in the supernatant characterized by an activity in a particular test.

EXAMPLE 10 Selection test to identify changes in small molecule concentration and membrane permeability It is known that the binding of a ligand to a receptor alters the intracellular levels of small molecules, such as calcium, potassium, sodium, and pH, as well as alters the membrane potential. These alterations can be measured in any test to identify supernatants that bind to the receptors of a particular cell. Although the following protocol describes a calcium test, this protocol can be easily modified to detect changes in potassium, sodium, pH, membrane potential, or any other small molecule that can be detected by a fluorescent probe. The following test uses a Plate Reader to Form Fluorometric Imaging ("FLIPR") to measure changes in fluorescent molecules (molecular probes) that bind to small molecules. Clearly, any fluorescent molecule that detects a small molecule can be used instead of the fluorescent calcium molecule, fluo-3, used in the present invention. For adherent cells, the cells are seeded at a density of 10,000-20,000 cells / well in a black 96-well Co-star plate with a transparent background. The plate is incubated in an incubator with C02 for 20 hours. The adherent cells are washed twice in a Biotek washer with 200 ul of HBSS (Hank's Balanced Salt Solution) leaving 100 ul of buffer after the final wash. A stock solution of 1 mg / ml fluo-3 in DMSO-10% pluronic acid is prepared. To load the cells with fluo-3, 50 ul of a solution of 12 ug / ml of fluo-3 are added to each cavity. The plate is incubated at 37 ° C in an incubator with C02 for 60 minutes. The plate is washed four times in the Biotek washer with HBSS leaving 100 ul of buffer. For non-adherent cells, the cells are centrifuged from the culture medium. The cells are resuspended to a density of 2-5 x 10 6 cells / ml with HBSS in a 50 ml conical tube. To each milliliter of the cell suspension, 4 ul of a 1 mg / ml solution of fluo-3 in DMSO-10% pluronic acid are added. The tube is placed then in a water bath at 37 ° C for 30-60 minutes. The cells are washed twice with HBSS, resuspended to a density of 1 x 106 cells / ml, and dispensed in a microplate, 100 ul / well. The plate is centrifuged at 1000 rpm for 5 minutes. The plate is then washed in a Denley Cell Wash apparatus with 200 ul, followed by an aspiration step up to 100 ul of final volume. For a test that is not cell-based, each cavity contains a fluorescent molecule, such as fluo-3. The supernatant is added to the cavity, and a change in fluorescence is detected. To measure intracellular calcium fluorescence, FLIPR conforms to the following parameters: (1) the gain of the system is 300-800 mW; (2) the exposure time is 0.4 seconds; (3) the chamber opening (F / high) is F / 2; (4) excitation = 488 nm; (5) emission = 530 nm; and (6) the addition of the sample is 50 ul. An increased emission at 530 nm indicates an extracellular signaling event caused by a molecule, either the angiogenic polypeptide or a molecule induced by the angiogenic polypeptide, which has resulted in an increase in intracellular Ca2 + concentration.

EXAMPLE 11 Selection test to identify tyrosine kinase activity Protein Tyrosine Kinases (PTK) represent a diverse group of transmembrane and cytoplasmic kinases. Within the group of Tyrosine Kinase Protein Receptor (RTPK) are the receptors for a range of mitogenic or metabolic growth factors including the subfamilies of the receptors for PDGF, FGF, EGF, NGF, HGF and Insulin. In addition, there is a large RPTK family for which the corresponding ligand is unknown. Ligands for RPTKs include mainly secreted small proteins, but also extracellular matrix proteins and membrane-bound proteins. The activation of the RPTK caused by the ligands implies the dimerization of the receptor mediated by the ligand, which results in the transphosphorylation of the receptor subunits and the activation of the tyrosine kinases of the cytoplasm. Tyrosine kinases in the cytoplasm include tyrosine kinases associated with the src family receptor (eg, src, yes, lck, lyn, fyn) and cytosol protein tyrosine kinases not attached to the receptor, such as the Jak family, whose members are mediators in signal transduction induced by the cytokine receptor superfamily (eg, interleukins, interferons, GM-CSF and leptin). Due to the wide variety of known factors that can stimulate tyrosine kinase activity, it is a matter of interest to identify whether the angiogenic polypeptide or a molecule induced by the angiogenic polypeptide can activate or not the tyrosine kinase signal transduction pathways. . Therefore, the following protocol is designed to identify such molecules that can activate the signal transduction pathways of tyrosine kinase. The target cells (e.g. primary keratinocytes) are seeded at a density of approximately 25,000 cells per well in a 96-well Loprodyne silent selection plate purchased from Nalge Nunc.

(Naperville, IL). The plates are sterilized with two 30-minute rinses with 100% ethanol, rinsed with water and dried overnight. Some plates are coated for 2 hours with 100 ml of type I collagen tissue culture grade (50 mg / ml), gelatin (2%) or polylysine (50 mg / ml), all of which were purchased from Sigma Chemicals (St. Louis, MO) or with 10% matrigel purchased from Becton Dickinson (Bedford, MA) or bovine serum, are rinsed with PBS and store at 4 ° C. Cell growth in these plates is evaluated by plating 5,000 cells / well in medium for growth and by indirect cell number quantification using alamarBlue as described by the manufacturer Alamar Biosciences, Inc. (Sacramento, CA) after 48 hours. Becton Dickinson Falcon # 3071 plate covers (Bedford, MA) are used to cover the Loprodyne silent selection plates. Plates for Falcon Microtest III cell culture could also be used in some proliferation experiments. To prepare the extracts, cells are seeded A431 on nylon membranes of Loprodyne plates (20,000 / 200 ml / cavity) and are grown overnight in complete medium. The cells are inactivated by incubation in serum-free basal medium for 24 hours. After 5-20 minutes of treatment with EGF (60 ng / ml) or 50 ul of the supernatant produced in example 12, the medium is removed and 100 ml of buffer for extraction is added (20 mM of HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-100, ..I JIM L **. ** ..- *: * 0.1% SDS, 2 mM Na3V04, 2 mM Na4P207 and a cocktail of protease inhibitors (# 1836170) obtained from Boehrmger-Mannheim (Indianapolis, IN) to each well and plate Stir on a rotary shaker for 5 minutes at 4 ° C. The plate is then placed in a vacuum transfer manifold and the extract is filtered through the 0.45 mm membrane of the bottoms of each cavity using vacuum. The extracts are collected in a 96-well plate for capture / test at the bottom of the vacuum manifold and placed immediately on ice. To obtain the extracts clarified by centrifugation, the content of each cavity is removed, after solubilization with detergent for 5 minutes, and centrifuged for 15 minutes at 4 ° C at 16,000 x g. The filtered extracts are evaluated with respect to tyrosine kinase activity levels. Although many methods are known for detecting tyrosine qu activity, only one method is disclosed in the present invention. In general, the tyrosine kinase activity of a supernatant is evaluated by determining its ability to phosphorylate a tyrosine residue on a specific substrate (a peptide treated with biotin). The Peptides treated with biotin that can be used for this purpose include PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2-p34) and PSK2 (corresponding to gastrin amino acids 1-17). Both peptides are substrates for a range of tyrosine kinases and can be obtained from Boehringer Mannheim. The tyrosine kinase reaction starts by adding the following components in order. First, add 10 ul of peptide treated with 5 uM biotin, then 10 ul of ATP / Mg2 + (5 mM ATP / 50 mM MgCl2), then 10 uL of buffer solution for 5x test (40 mM of imidazole hydrochloride, pH 7.3, 40 mM beta-glycerophosphate, 1 mM EGTA, 100 mM MgCl 2, 5 mM MnCl 2, 0.5 mg / ml BSA), then 5 μl sodium vanadate (1 mM) and then 5 μl water. The components are mixed gently and the reaction mixture is pre-incubated at 30 ° C for 2 minutes. The reaction is started by adding 10 ul of the control enzyme or the filtered supernatant. The reaction of the tyrosine kinase test is then finished by adding 10 ul of EDTA 120 mm and placing the reaction on ice. The tyrosine kinase activity is determined by transferring a 50 ul aliquot of the reaction mixture laAo-im. to a microtiter plate module (MTP) and incubate at 37 ° C for 20 minutes. This allows the 96-well plate coated with streptavidin to be associated with the peptide treated with biotin. The MTP module is washed four times with 300 ul of PBS / well. Subsequently, 75 ul of anti-antibody for phosphotyrosine conjugated to horseradish peroxidase (anti-P-Tyr-POD (0.5 u / ml)) is added to each cavity and incubated at 37 ° C for one hour. The cavity is washed as indicated above. Then add 100 ul of substrate solution for peroxidase (Boehringer Mannheim) and incubate at room temperature for at least 5 minutes (up to 30 minutes). The absorbance of the sample at 405 nm is measured using a reader for ELISA test. The level of activity of peroxidase bound is quantified using a reader for ELISA test and reflects the level of tyrosine kinase activity. *, i Si-? Ú. A¡ á..jfliíifajtat. AAÚ-JL.

EXAMPLE 12 Selection test to identify phosphorylation activity As an alternative and / or potential complement for the tyrosine kinase protein activity assay described in Example 11, a test that detects the activation (phosphorylation) of the major intracellular signal transduction intermediates can also be used. For example, as described below, a particular test can detect the tyrosine phosphorylation of the Erk-1 and Erk-2 kinases. However, phosphorylation of other molecules, such as Raf, JNK, p38, MAP, Map kinase kinase (MEK), Mek qumasa, Src, muscle specific kinase (MuSK), IRAK, Tec and Janus, can also be detected. as well as any other molecule of phospho- pine, phosphotyrosine or phosphothreonine, substituting these molecules instead of Erk-1 or Erk-2 in the following test. Specifically, test plates are prepared by coating the cavities of a 96-well plate for ELISA testing with 0.1 ml of G protein (1 ug / ml) for two hours at room temperature, (TA). The tiatdtiÉ.AA-At &? fet & j, a = hi? ria £ íj.Aa > _-. It ^: < -, - .1-plates are then rinsed with PBS and blocked with 3% BSA / PBS for one hour at RT. The G protein plates are then treated with 2 commercial monoclonal antibodies (100 ng / well) against Erk-1 and Erk-2 (1 hour at RT) (Santa Cruz Biotechnology). (To detect other molecules, this step can be easily modified by substituting a monoclonal antibody that detects any of the molecules described above). After rinsing 3-5 times with PBS, the plates are stored at 4 ° C until they are used. A431 cells are seeded at a density of 20,000 / cavity in a 96-well Loprodyne filter plate and grown overnight in growth media. The cells are then weakened for 48 hours in basal medium (DMEM) and subsequently treated with EGF (6 ng / well) or with 50 ul of the supernatants obtained in example 12 for 5-20 minutes. The cells are solubilized and the extracts are filtered directly to the test plate. After incubation with the extract for 1 hour at RT, the cavities are rinsed again. As a positive control, a commercial MAP kinase preparation (10 ng / well) is used in place of the cell extract laaa «jia¿ * & $ í *? ¿a.

A431 The plates are subsequently treated with a commercial polyclonal (rabbit) antibody (1 ug / ml) which specifically recognizes the phosphorylated epitope of the Erk-1 and Erk-2 kinases (1 hour at RT). This antibody is treated with biotin by standard procedures. The bound polyclonal antibody is then quantified by successive incubations with the Europium-streptavidin complex and with the Europium fluorescence enhancing reagent in the Wallac DELFIA instrument (resolved fluorescence versus time). An increased fluorescent signal with respect to the background indicates phosphorylation by the angiogenic polypeptide or a molecule induced by the angiogenic polypeptide.

EXAMPLE 13 Method for determining alterations in the gene coding for the angiogenic polypeptide RNA is isolated from whole families or from individual patients presenting a phenotype of interest (such as a disease). From these RNA samples, cDNA is then generated using the protocols known in the art. (See, Sambrook). The cDNA is then used as a template for PCR, using primers surrounding the regions of interest in the nucleotide sequence encoding the respective angiogenic polypeptide. The conditions for suggested PCR consist of 35 cycles at 95 degrees centigrade for 30 seconds; 60-120 seconds at 52-58 degrees Celsius; and 60-120 seconds at 70 degrees Celsius, using the regulatory solutions described in Sidransky, D., et al., Science 252: 706 (1991). Subsequently, the sequence of the PCR products is determined using primers labeled at their 5 'end with T4 polynucleotide kinase., using the product SequiTherm Polymerase (Epicenter Technologies). The intron-exon boundaries of the selected exons of the gene encoding the angiogenic polypeptide are also determined and the genomic PCR products are analyzed to confirm the results. The PCR products harboring the suspected mutations in the gene encoding the angiogenic polypeptide are then cloned and their sequence determined to validate the results of direct sequence determination. The PCR products of the gene encoding the angiogenic polypeptide are cloned into tail vectors T as described in Holton, TA and Graham, MW, Nucleic Acids Research, 19: 1156 (1991) and the sequence is determined with T7 polymerase. (United States Biochemical). Affected individuals are identified by mutations in the gene encoding the angiogenic polypeptide that are not present in unaffected individuals. Genomic transpositions are also contemplated as a method for determining alterations in the gene encoding the angiogenic polypeptide. The genomic clones isolated in accordance with Example 2 are nick translated with digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Mannheim) and the FISH analysis is performed as described in Johnson, Cg. et al., Methods Cell Biol. 35: 73-99 (1991). Hybridization with the labeled probe is effected using a large excess of human cot-1 DNA for specific hybridization of the genomic locus encoding the angiogenic polypeptide. The chromosomes are counter-stained with 4,6-diamino-2-phenyl indole and propidium iodide, resulting in a combination of C- and R- bands. Aligned images are obtained for accurate mapping using triple band filter equipment (Chroma Technology, Brattleboro, VT) in combination with a cold chamber with charge coupled device (Photometrics, Tucson, AZ) and with wavelength filters of variable excitation. (Jonson, Cv. Et al., Genet, Anal. Tech. Appl., 8:75 (1991)). The image collection, analysis and measurements of chromosome fragment lengths are performed using the Isee graphic program system (Inovision Corporation, Durham, NC). Chromosomal alterations of the genomic region of the gene encoding the angiogenic polypeptide (hybridized by waves) are identified as insertions, deletions and translocations. These alterations are used as a diagnostic marker for an associated disease.

EXAMPLE 14 Method for detecting abnormal levels of angiogenic polypeptide in a biological sample The angiogenic polypeptides can be detected in a biological sample, and if an increased or reduced level of the angiogenic polypeptide is detected, this polypeptide is a marker for a particular phenotype. The detection methods are numerous, and therefore it is understood that the expert the technique can modify the following test to fit your needs LiAJ¿JA¿A. LI "** - * - For example, antibody-sandwich ELISA tests are used to detect the angiogenic polypeptide in a sample, preferably a biological sample.The cavities of a microtiter plate are coated with specific antibodies for the angiogenic polypeptide, at a final concentration of 0.2 to 10 ug / ml The antibodies can be monoclonal or polyclonal and are produced using the method described in example 8. The 0 cavities are blocked in such a way that the binding is not reduced. of the angiogenic polypeptide to the cavity, then the coated cavities are incubated for a period greater than 2 hours at room temperature with a sample containing the angiogenic polypeptide, preferably serial dilutions of the sample must be used to validate the results. The plates are then washed three times with deionized water or distilled water to remove the non-union angiogenic polypeptide. Subsequently, 50 ul of conjugate or specific antibody-alkaline phosphatase are added at a concentration of 25-400 ng, and incubated for 2 hours at room temperature. The reaction is measured using a microtiter plate reader. A curve is prepared Standard can, using serial dilutions of a control sample, and applying the concentration of angiogenic polypeptide on the X axis (logarithmic scale) and the fluorescence or absorbance on the axis of the Y (linear scale) The concentration of the angiogenic polypeptide in the sample is extrapolated using the standard curve.

EXAMPLE 15 Formulations The invention also provides methods of treatment and / or prevention of diseases, disorders and / or conditions (such as, for example, one or more of the diseases, disorders and / or conditions described in the present invention) by administering to a subject an amount effective of a therapeutic agent. By the term "therapeutic agent" is meant a polynucleotide or polypeptide of the invention (including fragments and variants), agonists or antagonists thereof, and / or antibodies thereto, in combination with a pharmaceutically acceptable type of carrier (for example, example, a sterile vehicle). The therapeutic agent will be formulated and dosed in a manner consistent with good medical practice, taking into consideration the clinical condition of the patient (especially the side effects of treatment with the therapeutic agent only), the delivery site, the method of administration, the administration schedule, and other factors known to practitioners. Therefore, the "effective amount" for the purposes of the present invention is determined by such considerations. As a general proposal, the total pharmaceutically effective amount of the therapeutic agent administered parenterally per dose will be in the range of about 1 ug / kg / day to 10 mg / kg / day of the patient's body weight, although, as indicated above , this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg / kg / day, and more preferred for humans between about 0.01 and 1 mg / kg / day for the hormone. If administered continuously, the therapeutic agent is typically administered at a dose rate of about 1 ug / kg / hour to about 50 ug / kg / hour, either through 1-4 injections per day or by continuous subcutaneous infusions, using for example, a mini-pump. You can also use a t-ÍAJALiJ * intravenous bag solution. It seems that the duration of treatment needed to observe the changes and the post-treatment interval for the responses to appear vary depending on the desired effect. Therapeutic agents can be administered orally, rectally, parenterally, intracystemally (intracistemally), intravaginal, intraperitoneal, topical (for example by powders, ointments, gels, drops or transdermal patches), buccally, or as an oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a filler, diluent, encapsulating or auxiliary material for formulations of any type, solid, semi-solid or non-toxic liquid. The term "parenteral" as used in the present invention refers to modes of administration which include injection and infusion intravenously, intramuscularly, intraperitoneally, mestreternally, subcutaneously and intra-articularly. The therapeutic agents of the invention are administered in an appropriate manner by sustained release systems. Appropriate examples of sustained release therapeutics are administered orally, rectally, parenterally, intracystemally (intracistemally), vaginally, intraperitoneally, topically (for example by powders, ointments, gels, drops or transdermal patches), buccally, or as an oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a filler, diluent, encapsulating or auxiliary material for formulations of any type, solid, semi-solid or non-toxic liquid. The term "parenteral" as used in the present invention refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intra-articular injection or infusion. The therapeutic agents of the invention are also administered in an appropriate manner by sustained release systems. Appropriate examples of sustained release therapeutics include appropriate polymeric materials (such as, for example, semi-permeable polymer matrices in the form of shaped articles, eg, films, or microcapsules), appropriate hydrophobic materials (such as for example an emulsion) in an acceptable oil) or ion exchange resins, and slightly soluble derivatives (such as, for example, a slightly soluble salt). Matrices for sustained release include polylactides (U.S. Patent No. 3,773,919, EP 58,881), . ^ Ju ^ af »* - i. ? ^ A. copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U., et al., Biopolymers 22: 547-556 (1983)), poly (2-hydroxyethyl methacrylate) (R. Langer et al., J. Biomed, Mater. Res. 15: 167-277 (1981), and R. Langer, Chem. Tech. 12: 98-105 (1982)), ethylene vinylacetate (R. Langer et al.) Or poly acid -D- (-) -3-hydroxybutyric (EP 133,988). Sustained-release therapeutics also include therapeutics of the invention entrapped in liposomes (see generally, Langer, Science 249: 1527-1533 (1990); Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 317-327 and 353-365 (1989)). Liposomes containing therapeutic agent are prepared using methods known per se: DE 3,218,201; Epstein et al., Proc. Nati Acad. Sci. USA 82: 3688-3692 (1985); Hwuang et al., Proc. Nati Acad. Sci. USA 77: 4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese patent application 83-118008; Patent E.U.A. Nos. 4,485,045 and 4,544,545; and EP 102,324. Typically, the liposomes are of the small unilamellar type (approximately 200-800 Angstroms) in which the lipid content is greater than about 30 mole percent cholesterol, being .Ár.í.M .ÍÁ * -. L. i¡A2. ** tli * ±. adjusted the proportion selected for the optimal therapeutic agent. Even in a further embodiment, the therapeutic agents of the invention are delivered by a pump (see Langer, supra; Sefton, CRC Crit. Ref. Biomed.

Eng. 14: 201 (1987); Buchwald et al., Surgery 88: 507 (1980); Saudek et al., N. Engl. J. Med. 321: 574 (1989)). Other controlled-release systems are discussed in Langer's review (Science 249: 1527-1533 (1990)). For parenteral administration, in one embodiment, the therapeutic agent is generally formulated by mixing it in the desired degree of purity, in an injectable unit dosage form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e. , one that is not toxic to the recipients at the dose and concentrations used and that is compatible with the other ingredients of the formulation. For example, the preferred formulation does not include oxidizing agents or other compounds known to be detrimental to the therapeutic agent. In general, the formulations are prepared by contacting the therapeutic agent uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is configured in the desired formulation. Preferably the vehicle is a parenteral vehicle, more preferred is a solution that is isotonic with the blood of the recipient. Examples of such vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as non-volatile oils and ethyl oleate are also useful in the present invention, as well as liposomes. The vehicle suitably contains minor amounts of additives such as substances that enhance the isotonic character and chemical stability. Such materials are not toxic to the receptors at the dose and concentrations used, and include regulatory solutions such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight polypeptides (less than about ten residues), eg, polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohol such as mannitol or sorbitol; counterions such as sodium; and / or nonionic surfactants such as polysorbates, poloxamers, or PEG. The therapeutic agent is typically formulated in such vehicles at a concentration of from about 0.1 mg / ml to 100 mg / ml, preferably 1-10 mg / ml, at a pH of about 3 to 8. It will be understood that the use of some of the the excipients, carriers, or prior stabilizers will result in the formation of polypeptide salts. The therapeutic agents used for therapeutic administration can be sterile. Sterility is easily achieved by filtration through sterile filtration membranes (eg, 0.2 micron membranes). Therapeutic polypeptide compositions are generally placed in a container having a sterile access door. For example, an intravenous solution bag or a bottle having a plug that can be punctured using a needle for hypodermic injection. In general, the therapeutic polypeptides will be stored in unit dose or multi-dose containers, for example, sealed vials or flasks, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10 ml vials are filled with 5 ml of aqueous solution of the therapeutic agents at 1% (w / v), and the resulting mixture is lyophilized. The solution for infusion is prepared by reconstituting the lyophilized therapeutic agents using bacteriostatic water for injection. The invention also provides a pharmaceutical package or kit comprising one or more containers filled with one or more of the ingredients of the therapeutic agents of the invention. Associated with such container or containers may be a note in the form prescribed by a government agency that regulates the manufacture, use or sale of pharmaceutical or biological products, whose note reflects the approval by the agency for the manufacture, use or sale for human administration. In addition, the therapeutic agent can be used in conjunction with other therapeutic compounds. The therapeutic agents of the invention can be administered alone or in combination with adjuvants. Adjuvants that can be administered with the therapeutic agents of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21 (Genentech, Inc.), BCG, and MPL. In a specific embodiment, the therapeutic agents of the invention are administered in combination with alum. In another specific embodiment, the therapeutic agents of the invention are administered in combination with QS-21. Additional adjuvants that can be administered with the therapeutic agents of the invention include, but are not limited to, monophosphorylated lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, aluminum salts, MF-59, and technology. of virosomal adjuvant. Vaccines that can be administered with the therapeutic agents of the invention include, but are not limited to, vaccines aimed at protection against MMR (measles, mumps, rubella), polio, varicella, tetanus / diphtheria, hepatitis A, hepatitis B, haemophilus mfluenzae B, whooping cough, pneumonia, influenza, Lyme disease, rotavirus, cholera, yellow fever, Japanese encephalitis, polio, rabies, typhoid fever, and pertussis. Combinations may be administered either concomitantly, for example, as a mixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which ¿KtiX. Awi combination agents are administered together as a therapeutic mixture, and also methods in which the combined agents are administered separately but simultaneously, for example, through separate intravenous lines in the same individual. Administration "in combination" also includes separate administration in which one of the compounds or agents is first administered, and then the second. The therapeutic agents of the invention can be administered alone or in combination with other therapeutic agents. Therapeutic agents that can be administered in combination with the compositions of the invention, include but are not limited to, other members of the TNF family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-inflammatory compounds, conventional immunotherapeutic agents, cytokines. and / or growth factors. Combinations may be administered either concomitantly, for example, as a mixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also methods in which the combined agents are administered separately but simultaneously, for example, through separate intravenous lines in the same individual. Administration "in combination" also includes separate administration also includes separate administration in which one of the compounds or agents is first administered, and then the second. In one embodiment, the therapeutic agents of the invention are administered in combination with other members of the TNF family. The TNF, TNF-related or TNF-like molecules that can be administered with the compositions of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF- beta), LT-beta (found in the LT-alpha2-beta heterotrimer complex), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328) , AIM-I (International Publication No. WO 97/33899), endoquma-alpha (International Publication No. WO 98/07880), TR6 (International Publication No. WO 98/30694), OPG, and neutrokine-alpha (International Publication No. WO 98/18921), OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30 and, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4 (International Publication No. WO 98/32856), TR5 (International Publication No. WO 98/30693), TR6 (International Publication No. W O 98/30694), TR7 (International Publication No. WO 98/41629), TRANK, TR9 (International Publication No. WO 98/56892), TRIO (International Publication No. WO 98/54202), 31 2C2 (International Publication No. WO 98/06842), and TR12, and soluble forms of CD 154, CD70, and CD 153. In some embodiments, the therapeutic agents of the invention are administered in combination with antiretroviral agents, nucleoside reverse transcriptase inhibitors, inhibitors of non-nucleoside reverse transcriptase, and / or protease inhibitors. Nucleoside reverse transcriptase inhibitors that can be administered in combination with the therapeutic agents of the invention, include, but are not limited to, RETROVIR ™ (zidovudine / AZT), VIDEX ™ (didanosine / ddl), HIVID ™ (zalcitabine / ddC), ZERIT'M (stavudine / d4T), EPIVIR ™ (lamivudine / 3TC), and COMBIVIR ™ (zidovudine / lamivudine). Non-nucleoside reverse transcriptase inhibitors that can be administered in combination with the therapeutic agents of the invention, include, but are not limited to, VIRAMUNE ™ (nevirapine), RESCRIPTOR ™ (delavirdine), and SUSTIVA ™ (efavirenz). The protease inhibitors that can be administered in combination with the therapeutic agents of the invention, include, but are not limited to,, CRIXIVAN ™ (mdinavir), NORVIR ™ (ritonavir), INVIRASE ™ (saquinavir), and VIRACEPT ™ (nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and / or protease inhibitors can be used in any combination with the therapeutic agents of the invention to treat AIDS and / or prevent or treat HIV infection. In other embodiments, the therapeutic agents of the invention may be administered in combination with opportunistic anti-infection agents. Anti-opportunistic agents that can be administered in combination with the therapeutic agents of the invention, include, but are not limited to, TRIMETOPRIM-SULFAMETOXAZOL ™, DAPSONE ™ PENTAMIDINE ™, ATOVAQUONE ™, ISONIAZID ™, RIFAMPIN ™ PIRAZINAMIDE ™, EFHAMBUTOL ™ , RIFABUTIN ™, CLARITHROMYCIN ™ AZITHROMYCIN ™, GANCICLOVIR ™, FOSCARNET ™, CIDOFOVIR ™ FLUCONAZOLE ™, ITRACONAZOLE ™, KETOCONAZOLE 'M, ACICLOVIR ™ FAMCICOLVIR ™, PYRIMETHAMINE ™, LEUCOVORIN ™, NEUPOGEN ™ (filgrastim / G-CSF), and LEUKINE ™ (sargramostim / GM-CSF). In a Specific embodiment, the therapeutic agents of the invention are used in any combination with TRIMETOPRIM-SULFAMETOXAZOL ™ DAPSONE ™, PENTAMIDINE ™, and / or ATOVAQUONE ™ to treat and / or prophylactically prevent an opportunistic infection of Pneumocystis carinii pneumonia. In another specific embodiment, the therapeutic agents of the invention are used in any combination with ISONIAZID ™, RIFAMPIN ™, PIRAZINAM1DE ™, and / or ETHAMBUTOL ™ to treat and / or prophylactically prevent a complex opportunistic infection of Micobacterium avium. In another specific embodiment, the therapeutic agents of the invention are used in any combination with RIFABUTIN ™, CLARITHROMICINA ™, and / or AZITHROMYCIN ™ to treat and / or prophylactically prevent an opportunistic infection of Mycobacterium tuberculosis. In another specific embodiment, the therapeutic agents of the invention are used in any combination with GANCICLOVIR ™, FOSCARNEF ™, and / or CIDOFOVIR ™ to treat and / or prophylactically prevent an opportunistic cytomegalovirus infection. In another specific embodiment, the therapeutic agents of the invention are used in any combination with FLUCONAZOLE ™, ITRACONAZOLE ™, and / or KETOCONAZOLE ™ to treat and / or prevent prophylactically Eafai fc «« - ktti? TÜ..a -arffc. an opportunistic fungal infection. In another specific embodiment, the therapeutic agents of the invention are used in any combination with ACICLOVIR ™ and / or FAMCICOLVIR ™ to treat and / or prophylactically prevent an opportunistic infection of herpes simplex virus type I and / or type II. In another specific embodiment, the therapeutic agents of the invention are used in any combination with PIRIMETHAMINA ™ and / or LEUCOVORIN ™ to treat and / or prophylactically prevent an opportunistic infection of Toxoplasma gondii. In another specific embodiment, the therapeutic agents of the invention are used in any combination with LEUCOVORIN ™ and / or NEUPOGEN ™ to treat and / or prophylactically prevent a bacterial opportunistic infection. In a further embodiment, the therapeutic agents of the invention are administered in combination with an antiviral agent. Antiviral agents that can be administered with the therapeutic agents of the invention include, but are not limited to, acyclovir, ribavirin, amantadine, and remantidine. In a further embodiment, the therapeutic agents of the invention are administered in combination with an antibiotic agent. The antibiotic agents that are »* .jL > á, aflf - * «* -« * «* > t- ... * s -a ^ ^ ...,. .. ^ ¿^ .3, _ ^,. *. **, * -. * t .. .. *** .-. *. ** L.t * -. *. . *. **. *. .., AA, js ** l * ím t.-. can be administered with the therapeutic agents of the invention include, but are not limited to, amoxicillin, beta-lactamases, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, damycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones , macrolides, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-sulfamethoxazole, and vancomycin. Conventional non-specific immunosuppressive agents, which may be administered in combination with the compositions of the invention include, but are not limited to, steroids, cyclosporine, cyclosporin analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15-deoxypergualin, and other immunosuppressive agents that act by suppressing the T cell response function. In specific embodiments, the therapeutic agents of the invention are administered in combination with immunosuppressants. Immunosuppressant preparations that can be administered with the therapeutic agents of the invention include, but are not limited to, ORTHOCLONE ™ (OKT3), SANDIMMUNE ™ / NEORAL ™ / SANGDYA ™ (cyclosporin), i ^ .A i »? 4tt.j..j? to.

PROGRAF ™ (tacrolimus), CELLCEPT ™ (mycophenolate), Azathioprine, glucocorticosteroids, and RAPAMUNE ™ (sirolimus). In a specific modality, immunosuppressants can be used to prevent organ rejection or bone marrow transplantation. In a further embodiment, the therapeutic agents of the invention are administered alone or in combination with one or more intravenous immunoglobulin preparations. Intravenous preparations of immunoglobulin that can be administered with the therapeutic agents of the invention include, but are not limited to, GAMMAR ™, IV EEGAM'M, SANDOGLOBULIN ™, GAMMAGARD S / D ™, and GAMIMUNE'M. In a specific embodiment, the therapeutic agents of the invention are administered in combination with intravenous immunoglobulin preparations in transplant therapy (e.g., bone marrow transplantation). In a further embodiment, the compositions of the invention are administered in combination with an antibiotic agent. Antibiotic agents that can be administered with the compositions of the invention include, but are not limited to, tetracycline, metronidazole, amoxicillin, beta-lactamases, aminoglycosides, macrolides, quinolones, fluoroquinolones, cephalosporins, erythromycin, ciprofloxacin, and streptomycin. In a further embodiment, the compositions of the invention are administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that can be administered with the compositions of the invention include, but are not limited to, glucocorticoids and non-spheroidal anti-inflammatories, ammoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, acid derivatives arylpropionic, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome, diphenpyramide, ditazole, emorfazone, guaiazulene, nabumetone, nimesulide , orgotein, oxaceprol, paraniline, pepsoxal, pifoxime, procuazone, proxazole, and tenidap. In another embodiment, the compositions of the invention are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be administered with the compositions of the invention include, but are not limited to, antibiotic derivatives (for example, doxorubicin, bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (eg, fluorouracil, 5-FU, methotrexate, floxuridine, interferon alfa-2b, glutamic acid, plicamycin, ercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustma, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine sulfate); hormones (eg, medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisine, and testolactone); nitrogenous mustard derivatives (for example, mefalen, corambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (e.g., betamethasone sodium phosphate); and others (eg, dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide). In a specific embodiment, the therapeutic agents of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) or any combination of the CHOP components. In another embodiment, the therapeutic agents of the invention are administered in combination with Rituximab. In a further embodiment, the therapeutic agents of the invention are administered with Rituximab and CHOP, or Rituximab and any combination of the CHOP components. In a further embodiment, the compositions of the invention are administered in combination with cytokines. Cytokines that can be administered with the compositions of the invention include, but are not limited to, IL2, IL3, IL4, IL5, IL6, IL7, ILIO, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and TNF-alpha. In another embodiment, the therapeutic agents of the invention can be administered with any interleukin, including, but not limited to, IL-lalpha, IL-lbeta, IL-2, IL-3, IL-4, IL-5, IL- 6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, and IL-21. In a further embodiment, the compositions of the invention are administered in combination with angiogenic proteins. Angiogenic proteins that can be administered with the compositions of the invention include, but are not limited to, Glioma Derived Growth Factor (GDGF), as described in European Patent Number EP-3998 16; Platelet-Derived Growth Factor-A (PDGF-A), as described in European Patent Number EP-682110; Growth Factor-Derived Platelets-B (PDGF-B), as described in European Patent Number EP-282317; Placenta Growth Factor (PIGF), as described in International Publication Number WO 92/06194; Placenta-2 Growth Factor (PIGF-2), as described in Hauser et al., Growth Factors, 4: 259-268 (1993); Vascular Endothelium Growth Factor (VEGF), as described in International Publication Number WO 90/13649; Vascular Endothelium-A Growth Factor (VEGF-A), as described in European Patent Number EP-506477; Vascular Endothelium Growth Factor-2 (VEGF-2), as described in International Publication Number WO 96/39515; Vascular Endothelium Growth Factor B-186 (VEGF-B 186), as described in International Publication Number WO 96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as described in International Publication Number WO 98/02543; Vascular Endothelial Growth Factor-D (VEGF-D), as described in International Publication Number WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as described in German Patent Number DE19639601. The aforementioned references are incorporated in the present invention for reference. In a further embodiment, the compositions of . The present invention is administered in combination with Fibroblast Growth Factors. The Fibroblast Growth Factors that can be administered with the compositions of the invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11 , FGF-12, FGF-13, FGF-14, and FGF-15. In additional embodiments, the compositions of the invention are administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.

EXAMPLE 16 Method to treat reduced levels of angiogenic protein The present invention also relates to a method for treating an individual in need of an increased level of angiogenic polypeptide activity in the body which comprises administering to said individual a composition comprising a therapeutically effective amount of angiogenic polypeptide or an agonist thereof. In addition, it will be appreciated that the conditions caused by a reduction in the standard or normal level of expression of the angiogenic polypeptide can be treated. kA¿AÉíÍ? & * J ?? j ad3i ...... .. ... * Li .: an individual, administering the angiogenic polypeptide, preferably in the moon form secreted. Therefore, the invention also provides a method of treating an individual in need of an increased level of angiogenic polypeptide comprising administering to said individual a pharmaceutical composition comprising an amount of angiogenic polypeptide to increase the level of angiogenic polypeptide activity in such an individual For example, a patient with reduced levels of angiogenic polypeptide receives a daily dose of 0.1-100 ug / kg of the polypeptide for six consecutive days. Preferably, the polypeptide is in the moon form secreted. The exact details of the dosage scheme, based on administration and formulation, are provided in Example 15.

EXAMPLE 17 Method to treat increased levels of angiogenic protein The present invention relates to a method for treating an individual in need of a reduced level of i-Á í..A.t * AÁÍ? - .it-A. ... • angiogenic activity of the polypeptide in the body comprising, administering to said individual a composition comprising a therapeutically effective amount of angiogenic polypeptide antagonist. Preferred antagonists for use in the present invention are antibodies specific for the angiogenic polypeptide. Antisense technology is used to inhibit the production of angiogenic polypeptides. This technology is an example of a method for reducing levels of angiogenic polypeptide, preferably a secreted form, caused by a variety of etiologies, such as cancer. For example, a patient who is diagnosed with increased abnormal levels of angiogenic polypeptide is administered intravenously antisense polynucleotides at doses of 0.5, 1.0, 1.5.2.0 and 3.0 mg / kg day for 21 days. This treatment is repeated after a rest period of 7 days if the treatment is well tolerated. The formulation of the antisense polynucleotide is provided in Example 15. .?..? Í ^ * t Mima ..: A * * * Aiia .l ^ * M * EXAMPLE 18 Method A dß treatment using gene therapy - ex vivo A method of therapy with genes transplants fibroblasts, which can express the angiogenic polypeptides, in a patient. In general, fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue culture medium and separated into small pieces. Small pieces of tissue are placed on a wet surface of a tissue culture flask, approximately 10 pieces are placed in each flask. The flask is turned down, sealed and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted and pieces of tissue remain fixed at the bottom of the flask and fresh medium is added (eg, Ham's F12 medium, with 10% FBS, penicillin and streptomycin). The flasks are then incubated at 37 ° C for about a week. At this time, new media is added and changed later every several days. After another two weeks in culture, a monolayer of fibroblasts appears. The monolayer is subjected to trypsin treatment and is í iUffinlífr a ...,. i *,. * - i ^ * í £ ¿ít * £ ** m *? &- - «fj- ^ larger flasks. It is digested pMV-7 (Kirschmeier, P.T. et al., DNA, 7: 219-25 (1988)), flanked by long-terminal repeats of Moloney murine sarcoma virus, with EcoRI and HindIII and subsequently treated with bovine intestine phosphatase. The linear vector is fractionated on an agarose gel and purified using glass beads. The cDNA encoding the angiogenic polypeptides can be amplified using primers for PCR corresponding to the 5 'and 3' end sequences, respectively as indicated in Example 1. Preferably, the 5 'primer contains an EcoRI site and the initiator 3 'includes a HindlII site. Equal amounts of the linear base structure of Moloney murine sarcoma virus and of the amplified EcoRI and HindIII fragments in the presence of T4 DNA ligase are added together. The resulting mixture is maintained under appropriate conditions to bind the two fragments. The ligation mixture is then used to transform the HB 101 bacterium, which is then plated onto agar containing kanamycin for the purpose of confirming that the vector contains the gene encoding the angiogenic polypeptide properly inserted.

Amphotropic packaging cells pA317 or GP + aml2 F are grown in tissue culture to a confluent density in Dulbecco's Modified Eagle's Medium (DMEM) with 10% bovine serum (CS), penicillin and streptomycin. The MSV vector containing the gene encoding the angiogenic polypeptide is then added to the medium and the packaging cells are translated with the vector. The packaging cells now produce infectious viral particles that contain the gene that codes for the angiogenic polypeptide (the packaging cells are now known as producer cells). New media is added to the transduced producer cells, and the medium is then harvested from a 10 cm plate of confluent producer cells. The spent medium, which contains the infectious viral particles, is filtered through a millipore filter to remove the detached production cells and this medium is then used to infect the fibroblast cells. The medium is removed from a sub-confluent plate of fibroblasts and rapidly replaced with the medium from the producer cells. This medium is removed and replaced with new medium. If the virus titer is high, then virtually all fibroblasts will be infected and no selection is required. If the title is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his markers. Once the fibroblasts have been infected efficiently, they are analyzed to determine whether the angiogenic protein is produced or not. Then, the genetically manipulated fibroblasts are transplanted into the host, either alone or after they have grown to confluence in cytodex 3 vehicle microspheres.

EXAMPLE 19 Gene therapy using an endogenous gene that codes for the angiogenic protein Another method of gene therapy according to the present invention involves operably associating the endogenous sequence encoding the angiogenic protein with a promoter by homologous recombination as described, for example, in the US patent. No. 5,641,670, issued June 24, 1997; International Publication No. WO 96/29411, published September 26, 1996; International Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc. Nati 4 &* t * *. *.? *.

Acad. Sci. USA 86: 8932-8935 (1989); and Zijlstra et al., Nature 342: 435-438 (1989). This method involves the activation of a gene that is present in the target cells, but that is not expressed in the cells, or is expressed at a lower level than desired. Polynucleotide constructs are elaborated which contain a promoter sequence and a sequence for selecting targets, which are homologous with the 5 'non-coding sequence of the endogenous gene coding for the angiogenic polypeptide, flanking the promoter. The sequence for selecting targets will be close enough to the 5 'end of the gene so that the promoter will be operably linked to the endogenous sequence after homologous recombination. The promoter and targeting sequences can be amplified using PCR. Preferably, the amplified promoter contains sites for the different restriction enzyme at the 5 'and 3' ends. Preferably, the 3 'end of the first target selection sequence contains the same site for restriction enzyme as the 5' end of the amplified promoter and the 5 'end of the second target selection sequence contains the same restriction site as the target. iL, * á * ¡i * L -extreme 3 'of the amplified promoter. The amplified promoter sequence and the sequence for selecting amplified targets are digested with the appropriate restriction enzymes and subsequently treated with bovine intestine phosphatase. The digested promoter sequence and the sequence for selecting digested targets are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under appropriate conditions to bind the two fragments. The construction is fractionated by size in an agarose gel and then purified by phenol extraction and ethanol precipitation. In this example, the polynucleotide constructs are administered as naked polynucleotides by electroporation. However, polynucleotide constructs can also be administered with agents that facilitate transfection, such as liposomes, viral sequences, viral particles, precipitating agents, etc. Such delivery methods are known in the art. Once the cells are transfected, homologous recombination is carried out which results in the promoter being operably linked to the endogenous gene sequence. This results in the expression of the angiogenic polypeptide in the cell. The expression can be .já, j á.a «j.« te ** t ^? - ^. t, «to detect by immunological staining, or any other method known in the art. Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in DMEM + 10% fetal bovine serum. Fibroblasts that are in the exponential phase of growth or at the beginning of the stationary phase are treated with trypsin and rinsed from the plastic surface with nutrient medium. An aliquot of the cell suspension is removed during counting, and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the tablet is resuspended in 5 ml of electroporation buffer (20 M HEPES pH 7.3, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HP04, 6 mM dextrose). The cells are recentrifuged, the supernatant is aspirated, and the cells are resuspended in buffer solution for electroporation containing 1 mg / ml of acetylated bovine serum albumin. The final cell suspension contains approximately 3X106 cells / ml. Electroporation should be done immediately after resuspending. Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid to direct it to the locus in which the gene encoding the angiogenic protein is located, the plasmid pUC18 (MBI Fermentas, Amherst, NY) is digested with HindIII. The CMV promoter is amplified by PCR with a Xbal site at the 5 'end and a BamHI site at the 3' end. Two sequences that do not code for the angiogenic protein are amplified by PCR: a sequence that does not code for the angiogenic protein (fragment 1 of angiogenic protein) is amplified with a HindIII site at the 5 'end and an Xba site at the 3' end; the other sequence that does not code for the angiogenic protein (fragment 2 of angiogenic protein) is amplified with a BamH1 site at the 5 'end and a HindIII site at the 3' end. The CMV promoter and the angiogenic protein fragments are digested with the appropriate enzymes (promoter of CMV-Xbal and BamHI, fragment 1 of angiogenic protein-Xbal, fragment 2 of angiogenic protein-BamHI) and ligated together. The resulting ligated product is digested with HindIII, and ligated with the pUC18 plasmid digested with HindIII. Plasmid DNA is added to a sterile cell with a 0.4 cm electrode space (Bio-Rad). The final DNA concentration is usually at least 120 μg / ml. Then 0.5 ml of the cell suspension (containing approximately 1.5 X 106 cells) is added to the cell, and the cell suspension and DNA solutions are mixed gently. The electroporation is carried out with a Gene-Pulser device (Bio-Rad). Capacitance and voltage are adjusted to 960 μF and 250-300 volts, respectively. As the voltage increases, cell survival decreases, but the percentage of surviving cells that stably incorporate the DNA introduced into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 msec should be observed. The cells subjected to electroporation are kept at room temperature for about 5 minutes, and the contents of the cell are then gently removed with a sterile transfer pipette. The cells are added directly to 10 ml of preheated nutrient medium (DMEM with 15% bovine serum) in a 10 cm box and incubated at 37 ° C. The next day, the medium is aspirated and replaced with 10 ml of fresh medium and incubated for an additional 16-24 hours. The genetically engineered fibroblasts are then injected into the host, either alone or after being grown to confluence in cytodex 3 vehicle microspheres. Fibroblasts now produce the protein product. The fibroblasts can then be introduced into a patient as described above.

EXAMPLE 20 Method of treatment using gene therapy - invivo Another aspect of the present invention is to use gene therapy methods in vi to treat disorders, diseases and conditions. The method of gene therapy refers to the introduction of naked nucleic acid sequences (DNA, RNA, and antisense DNA or RNA) that encode angiogenic polypeptides in an animal to increase or decrease expression of the angiogenic polypeptide. The polynucleotide encoding the angiogenic polypeptides can be operably linked to a promoter or any of the other genetic elements necessary for the expression of the angiogenic polypeptide by the target tissue. Such gene therapy and delivery techniques and methods are known in the art, see, for example, WO90 / 11092, W098 / 11779; patent E.U.A. No. 5693622, 5705151, 5580859; Tabata H. et al. (1997) Cardiovasc. Res. 35 (3): 470-479, Chao J et al. (1997) Pharmacol. Res. 35 (6): 517-522, Wolff J.A. (1997) Neuromuscul. Disord. 7 (5): 314-318, Schwartz B. et al. (1996) Gene Ther. 3 (5): 405-411, Tsurumi Y. et al. (1996) Circulation 94 (12): 3281-3290 (incorporated herein by reference). Poplinucleotide constructs containing the gene coding for the angiogenic polypeptides can be delivered by any method that provides injectable materials to the cells of an animal, such as injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, intestines and the like). In addition, the polynucleotide constructs can be delivered in a pharmaceutically acceptable aqueous vehicle or liquid. The term "naked" polynucleotide, DNA or RNA, refers to sequences that are free of any delivery vehicle that acts to aid, promote, or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like. However, polynucleotides encoding angiogenic polypeptides can also be delivered in liposome formulations (such as those taught in Felgner P.L. et al. (1995) Ann. NY Acad. Sci. 772: 126-139 and Abdallah B. et al. (1995) Biol. Cell 85 (1): 1-7) which can be prepared by methods well known to those skilled in the art. The polynucleotide vector constructs containing the gene encoding the angiogenic polypeptide used in the gene therapy method are preferably constructs that do not integrate into the host genome nor contain sequences that allow replication. Any strong promoter known to those skilled in the art can be used to activate DNA expression. Unlike other gene therapy techniques, one of the main advantages of introducing naked nucleic acid sequences into target cells is the transient nature of polynucleotide synthesis in cells. Studies have shown that DNA or replicant sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months. The polynucleotide construct containing the gene encoding the angiogenic polypeptide can be delivered to the interstitial space of tissues within an animal, including the tissues of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart lymph blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, intestines, testes, ovary, uterus, rectum, nervous system, eye, gland, and connective. The interstitial space of the tissues comprises the intercellular fluid, the mucopolysaccharide matrix between the reticular fibers of the tissues of the organs, the elastic fibers in the walls of the vessels or chambers, the collagen fibers of the fibrous tissues, or that same matrix within the connective tissue that wraps muscle cells or in the bone lagoon. In the same way it is the space occupied by the plasma of the circulation and the lymphatic fluid of the lymphatic channels. The supply to the interstitial space of muscle tissue is preferred for the reasons discussed below. These can be conveniently supplied by injection into the tissues comprising these cells. These are preferably supplied to and expressed in persistent cells that do not present division, which are differentiated, although delivery and expression can be achieved in undifferentiated cells or in differentiated cells in a less complete form, such as, for example, blood stem cells or skin fibroblasts. The muscle cells in vi vo are particularly competent in their ability to absorb and express the polynucleotides. For the injection of naked polynucleotide encoding the angiogenic polypeptide, an effective dose amount of DNA or RNA will be in the range of about 0.05 g / kg of body weight to about 50 mg / kg of body weight. Preferably the dose will be from about 0.005 mg / kg to about 20 mg / kg and more preferably from about 0.05 mg / kg to about 5 mg / kg. Of course, as the skilled artisan will appreciate, this dose may vary in accordance with the injection site in the tissue. Those skilled in the art can readily determine the appropriate and effective dose of the nucleic acid sequence and could depend on the condition being treated and the route of administration. The preferred route of administration is via the parenteral route of injection into the interstitial space of the tissues. However, other routes of parenteral administration can also be used, such as inhaling a particular aerosol formulation for delivery to the lung tissue or the bronchi, throat or mucous membranes of the nose. In addition, naked angiogenic DNA constructs can be delivered to the arteries "> i?, A.¡. ± * stJíiá * i, during the angioplasty through the catheter used in the procedure. The dose-response effects of the injected polynucleotide encoding the angiogenic polypeptide in muscle in vivo are determined as follows. Appropriate templates of DNA encoding the angiogenic polypeptide are prepared to produce mRNA encoding the angiogenic polypeptide prepared in accordance with recombinant DNA methodology. The DNA of the template, the 10 which can be either circular or linear, is used either as naked DNA or as DNA complexed with liposomes. The quadriceps muscles are then injected with various amounts of template DNA. Balb / C mice are anesthetized for 5 to 6 weeks 15 age of both genders by intraperitoneal injection with 0.3 ml of 2.5% Avertin. An incision of 1.5 cm is made in the anterior thigh, and the quadriceps muscle is directly visualized. The template DNA encoding the angiogenic polypeptide is injected into 0.1 ml of vehicle with 20 a syringe of 1 cm3 through a 27 gauge needle in a period of 1 minute, approximately 0.5 cm from the distal muscle dissection site towards the knee and approximately 02 cm deep. A suture is placed ^^^^^ lifTi lti on the injection site for future location, and the skin is closed with stainless steel clasps. After an appropriate incubation time (for example, 7 days) muscle extracts are prepared by excising the quadriceps. Every 5 cross sections of 15 μm of the individual muscles of the quadriceps are stained histochemically to evaluate the expression of the angiogenic protein. An evaluation of the elapsed time can be made so that the angiogenic protein is expressed in a similar way except that quadriceps from different mice are used at different times. The persistence of DNA encoding the angiogenic polypeptide in muscle can be determined after injection by Southern blot analysis after preparation of the total cellular DNA and the HIRT supernatants from injected and control mice can be used. The results of the above experiment can be used in mice to extrapolate the appropriate doses and other treatment parameters in humans and in other animals using naked DNA encoding the angiogenic polypeptide.

EXAMPLE 21 Angiogenic protein in transgenic animals Angiogenic polypeptides can also be expressed in transgenic animals. Animals of any of the species can be used, including, but not limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates, for example, baboons, monkeys, and chimpanzees to generate transgenic animals. In a specific embodiment, techniques described in the present invention or otherwise known in the art are used to express the polypeptides of the invention in humans, as part of a gene therapy protocol. Any known technique in the field can be used to introduce the transgene (ie, the polynucleotides of the invention) into animals to produce the founder lines of transgenic animals. Such techniques include, but are not limited to, pronuclear microinjection (Paterson et al., Appl. Microbiol. Biotechnol., 40: 691-698 (1994); Carver et al., Biotechnology (NY) 11: 1263-1270 (1993).; Wright et al., Biotechnology (NY) 9: 830-834 (1991); and Hoppe et al., U.S. Patent No. 4,873,191 (1989)); gene transfer mediated by retroviruses in germ lines (Van der Putten et al., Proc. Nati, Acad. Sci., USA 82: 6 148-6152 (1985)), blastocysts or embryos; selection of genes as targets in embryonic stem cells (Thompson et al., Cell 56: 313-321 (1989)); electroporation of cells or embryos (Lo, 1983, Mol Cell, Biol. 3: 1803-18 14 (1983)); introduction of the polyucleotide of the invention using a gene gun (see, for example, Ulmer et al., Science 259: 1745 (1993); introduction of nucleic acid constructs into embryonic pluripotent stem cells and transfer of the stem cells back to the blastocress, and sperm-mediated gene transfer (Lavitrano et al., Cell 57: 717-723 (1989), etc. For a review of such techniques, see Gordon, "Transgenic animals," Intl. Rev. Cytol. : 171-229 (1989), which is incorporated by reference in the present invention in its entirety Any technique known in the art can be used to produce transgenic clones containing polynucleotides of the invention, for example, nuclear transfer to oocytes without nucleus of nuclei from embryonic, fetal, or cultured adult cells induced at rest (Campell et al., Nature 380: 64-66 (1996); Wilmut et al., Nature 385: 810-813 (1997)).

The present invention provides transgenic animals that carry the transgene in all its cells, as well as animals that carry the transgene to some, but not all of its cells, that is, animals of the mosaic or chimeric type. The transgene can be integrated as an individual transgene or as multiple copies such as in the concatamers, for example, tandems head to head or head to tail. The transgene can also be selectively introduced into and activated in a particular cell type following, for example, the teachings of Lasko et al. (Lasko et al., Proc. Nat. Acad. Sci. USA 89: 6232-6236 (1992)). The regulatory sequences required for such cell-type specific activation will depend on the particular cell type of antibodies, and will be apparent to those skilled in the art. When it is desired that the transgene for the polynucleotide be integrated into the chromosomal site of the endogenous gene, it is preferred to select the genes as the target. In short, when such a technique is going to be used, the vectors containing some nucleotide sequences homologous to the endogenous gene are designed for the purpose of integrating, by homologous recombination with the chromosomal sequences, into and disrupting the function of the nucleotide sequence. of the endogenous gene. The transgene can also be introduced selectively into a particular cell type, thereby inactivating the endogenous gene only in that cell type, following, for example, the teaching of Gu et al. (Gu et al., Science 265: 103-106 (1994)). The regulatory sequences required by such a type of cell-specific inactivation will depend on the particular type of cell of interest, and will be apparent to those skilled in the art. The contents of each of the references indicated in this paragraph are incorporated in the present invention for reference in its entirety. Once the transgenic animals have been generated, the expression of the recombinant gene can be evaluated using standard techniques. The initial selection can be achieved by means of Southern blot analysis or PCR to analyze animal tissues to confirm that the transgene integration has been carried out. The level of mRNA expression of the transgene in the tissues of the transgenic animals can also be assessed using techniques including, but not limited to, Northern blot analysis of samples obtained from the animal, in situ hybridization analysis, and transcriptase Reverse-PCR (rt-PCR). Tissue samples expressing the transgenic gene can also be evaluated by immunocytochemistry or immunohistochemistry using antibodies specific for the transgene product. Once the founding animals are produced, they can reproduce sexually, inbreeding, exogamously, or by cross-linking to produce colonies of the particular animal. Examples of such breeding strategies include, but are not limited to: externally crossing the founder animals with more than one integration site in order to establish separate lines; crossbreed separate lines in order to produce transgenic compounds that express the transgene at higher levels due to the effects of the additive expression of each transgene; crossing of transgenic heterozygous animals to produce homozygous animals for a given integration site in order to increase expression and eliminate the need to select animals by DNA analysis; crossing of separate homozygous lines to produce heterozygous or homozygous mixed lines; and normal reproduction to place the transgene in a different background that is appropriate for an experimental model of interest. The transgenic animals of the invention have uses which include, but are not limited to, animal model systems useful for elaborating the biological function of the angiogenic polypeptides, to study the conditions and / or disorders associated with the aberrant expression of the angiogenic polypeptide, and in the selection of effective compounds for alleviating such conditions and / or disorders.

EXAMPLE 22 Animals with "fulminated" angiogenic protein The endogenous expression of the angiogenic protein gene can also be reduced by inactivating or "knocking out" the gene encoding the angiogenic protein and / or its promoter using targeted homologous recombination. (For example, see Smithies et al., Nature 3 17: 230-234 (1985), Thomas &Capecchi, Cell 51: 503-5 12 (1987), Thompson et al., Cell 5: 313-321 (1989 ), each of which is incorporated for reference in the present invention in its entirety). For example, a mutant, non-functional polynucleotide of the invention (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous polynucleotide sequence (either the coding regions or the regulatory regions of the gene) can be used, with or without a selectable marker and / or a negative selectable marker, to transfect the cells expressing the polypeptides of the invention in vivo. In another embodiment, techniques known in the art are used to generate fulminations in the cells they contain, but which do not express the gene of interest. The insertion of the DNA construct, by directed homologous recombination, results in the inactivation of the targeted gene. Such methods are particularly appropriate in agricultural and research fields in which modifications to embryonic stem cells can be used to generate animal offspring with an inactive target gene (for example, see Thomas &Capecchi 1987 and Thompson 1989, supra). However, this method can be routinely adapted for use in humans with the proviso that recombinant DNA constructs are administered or directed to the required site in vivo using appropriate viral vectors that will be apparent to those skilled in the art. In additional embodiments of the invention, cells are added that are genetically engineered to express the polypeptides of the invention, or in the form Alternatively, they are genetically engineered so as not to express the polypeptides of the invention (e.g., knockouts) to a patient in vivo Such cells may be obtained from the patient (i.e., animal, including human) or an MHC compatible donor and may include, but are not limited to, fibroblasts, bone marrow cells, blood cells (eg, lymphocytes), adipocytes, muscle cells, endothelial cells etc. Cells are genetically engineered in vi tro using recombinant DNA techniques for introducing the sequence encoding the polypeptide of the invention into the cells, or alternatively, for breaking the coding sequence and / or the endogenous regulatory sequence associated with the polypeptides of the invention, for example, by transduction (using viral vectors , and preferably vectors that integrate the transgene in the cell genome) or transfection procedures, including, but not limited to, going to, the use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. The sequence encoding the polypeptides of the invention can be placed under the control of a promoter, or strong promoter / enhancer constitutive or inducible to achieve expression, and preferably secretion, of the angiogenic polypeptides. The genetically engineered cells that express and preferably secrete the polypeptides of the invention can be introduced into the patient systemically, for example, in the circulation, or intraperitoneally. Alternatively, the cells can be incorporated into a matrix and implanted in the body, for example, genetically engineered fibroblasts can be implanted as part of a skin graft; Endothelial cells designed genetically as part of a lymphatic or vascular graft can be implanted. (See, for example, Anderson et al, U.S. Patent No. 5,399,349; and Mulligan & Wilson, Patent E.U.A. No. 5,460,959 each of which is incorporated for reference in the present invention in its entirety). When the cells to be administered are not autologous or not compatible with MHC, they can be administered using well-known techniques that prevent the development of an immune response by the host against the introduced cells. For example, the cells can be introduced in an encapsulated form which, although it allows an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the immune system of the host. The "knock out" animals of the invention have uses that include, but are not limited to, animal model systems useful for elaborating the biological function of angiogenic polypeptides, to study the conditions and / or disorders associated with aberrant expression of the angiogenic protein, and in the selection of effective compounds for alleviating such conditions and / or disorders.

EXAMPLE 23 Biological effects of the angiogenic polypeptide Tests for fibroblasts and endothelium cells Human lung fibroblasts were obtained from Clonetics (San Diego, CA) and maintained in Clonetics growth medium. Microvascular endothelial cells were obtained from the dermis of Cell Applications (San Diego, CA). For proliferation tests, human lung fibroblasts and microvascular endothelial cells of the dermis can be cultured at a density of 5,000 cells / well in a 96-well plate during a day in growth medium. The cells are then incubated for one day in basal medium with 0.1% BSA. After changing the medium with fresh medium 0.1% BSA, the cells are incubated with the test proteins for 3 days. Alamar Blue (Alamar Biosciences, Sacramento, CA) is added to each well to a final concentration of 10%. The cells are incubated for 4 hr. The viability of the cell is measured by reading in a CytoFluor fluorescence reader. For PGE2 tests, human lung fibroblasts are cultured at 5,000 cells / well in a 96-well plate for one day. After changing the medium to basal medium BSA 0.1%, the cells were incubated with FGF-2 or with the angiogenic polypeptide with or without IL-la for 24 hours. Supernatants were collected and evaluated for PGE2 using an EIA kit (Cayman, Ann Arbor, MI). For tests with IL-6, human lung fibroblasts were cultured at 5,000 cells / well in a 96-well plate for one day. After changing the medium to basal medium BSA 0.1%, the cells were incubated with FGF-2 or with the angiogenic polypeptide with or without IL-1 for 24 hours. The supernatants are collected and evaluated for IL-6 using the ELISA kit (Endogen, Cambridge, MA).

Human lung fibroblasts are cultured with FGF-2 or angiogenic polypeptide for 3 days in basal medium before adding Alamar Blue to evaluate the effects on fibroblast growth. FGF-2 should show a stimulation at 10-2500 ng / ml which can be used to compare the stimulation with the angiogenic polypeptide.

EXAMPLE 24 Effect of the angiogenic polypeptide on the growth of vascular endothelial cells On day 1, human umbilical vein endothelial cells (HUVEC) were seeded at a density of 2-5x104 cells / 35 mm box in M199 medium containing 4% fetal bovine serum ( FBS), 16 units / ml of heparin, and 50 units / ml of supplements for endothelial cell growth (ECGS, Biotechnique, Inc.). On day 2, the medium is replaced with M199 containing 10% FBS, 8 units / ml heparin, angiogenic protein, and positive controls, such as basic FGF (bFGF), are added at varying concentrations. On days 4 and 6, the medium is replaced. On day 8, cell number is determined with a Coulter Counter counter. An increase in the number of HUVEC cells indicates that the angiogenic polypeptide can proliferate vascular endothelial cells. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the easily modified studies exemplified to test the activity of the polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 25 Stimulating effect of the angiogenic polypeptide on the proliferation of vascular endothelial cells To evaluate the mitogenic activity of the growth factors, the colorimetric test MTS (3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxyethoxyphenyl) -2- (4-sulfophenyl) 2H-tetrazolium was carried out. ) with the electron coupling reagent PMS (phenazine methosulfate) (CellTiter 96 AQ, Promega). The cells are seeded in a 96-well plate cavities (5,000 cells / cavity) in 0.1 mL of medium supplemented with serum and allowed to adhere throughout the night. After weakening with serum for 12 hours in 0.5% FBS, conditions (bFGF, VEGF165 or the angiogenic polypeptide in 0.5% FBS) with or without heparin (8 U / ml) are added to the cavities for 48 hours. Add 20 mg of MTS / PMS mixture (1: 0.05) per well and incubate for 1 hour at 37 ° C before measuring the absorbance at 490 nm on a plate reader for ELISA tests. The background absorbance from the control cavities (some medium, no cells) is subtracted, and seven cavities are performed in parallel for each condition. See, Leak et al. In Vi tro Cell. Dev. Biol. 30A: 512-518 (1994). The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of the polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

A.Á- **, *** * - EXAMPLE 26 Inhibition of the stimulating effect of PDGF-induced proliferation of vascular smooth muscle cells.

The proliferation of HAoSMC can be measured, for example, by incorporation of BrdUrd. Briefly, subconfluent, inactive cells cultured on 4-chamber slides are transfected with AT2-3LP labeled with CRP or FITC. The cells are then pulsed with 10% bovine serum and 6 mg / ml BrdUrd. After 24 hours, immunocytochemistry analyzes are performed using the kit for staining with BrdUrd (Zymed Laboratories). Briefly, the cells were incubated with the anti-antibody for mouse BrdUrd treated with biotin at 4 ° C for 2 hours after being exposed to the denaturing solution and then incubated with the conjugate streptavidin-peroxidase and diaminobenzidine. After countertening with hematoxylin, the cells are mounted for microscopic examination, and BrdUrd-positive cells are counted. The BrdUrd index is calculated as one percent of the BrdUrd-positive cells with respect to the total number of cells. In addition, simultaneous detection of the BrdUrd (core) stain is performed and the iAjÉ, Js ^ "*" ii * J * ^ - »_« = h¡t absorption of FITC (cytoplasm) for individual cells by the concomitant use of bright field illumination and dark field-fluorescent UV illumination. See, Hayashida et al., J. Biol. Chem. 6: 271 (36): 21985-21992 (1996). The studies described in this example tested the angiogenic protein activity. However, one skilled in the art could easily modify the exemplified studies to test the activity of the polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 27 Stimulation of ßndothelial migration This example will be used to explore the possibility that the angiogenic polypeptide could stimulate cell migration from the lymphatic endothelium. Endothelial cell migration tests are performed using a 48-cavity chemotaxis microcamera (Neuroprobe Inc., Cabin John, MD, Falk, W., et al., J. Immunological Methods 1980; 33: 239-247). They are covered Á áA f * J "j¿ * -4..ta.jMft.? T_ ^ ¿_; polyvinylpyrrolidone-free polycarbonate filters with a pore size of 8 um (Nucleopore Corp. Cambridge, MA) with 0.1% gelatin for at least six hours at room temperature and dried with sterile air. The test substances are diluted to the appropriate concentrations in M199 supplemented with 0.25% bovine serum albumin (BSA), and 25 ul of the final dilution is placed in the lower chamber of the modified Boyden apparatus. Subconfluent, early passage (2-6) cultures of HUVEC or BMEC cells are washed and treated with trypsin for the minimum time required to achieve cell shedding. After placing the filter between the upper and lower chamber, 2.5 x 105 cells suspended in 50 ul of M199 containing 1% FBS are seeded in the upper compartment. The apparatus is then incubated for five hours at 37 ° C in a chamber moistened with 5% C02 to allow cell migration. After the incubation period, the filter is removed and the upper side of the filter is scraped with the cells that did not migrate with a rubber gendarme. The filters are fixed with methanol and stained with a Giemsa solution (Duff-Quick, Baxter, McGraw Park, IL). The migration is quantified by counting the cells of three random high-resolution fields (40x) in each cavity and all groups are performed in quadruplicate. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 28 Stimulation of nitric oxide production by endothelial cells It is believed that the nitric oxide released by the vascular endothelium is a mediator of vascular endothelial relaxation. Therefore, the activity of the angiogenic polypeptide can be evaluated by determining the production of nitric oxide by the endothelial cells in response to the angiogenic polypeptide. Nitric oxide is measured in 96-well plates of confluent microvascular endothelial cells after 24 hours of weakening and 4 hours of subsequent exposure to various levels of a positive and negative control.

II? *. * - *** • - ** »- > * .- - i. & .km ^ -A. angiogenic polypeptide. The amount of nitric oxide in the medium is determined using the Griess reagent to measure the amount of total nitrite after reducing the nitrate derived from nitric oxide by nitrate reductase. The effect of the angiogenic polypeptide on the release of nitric oxide is examined in HUVEC cells. In brief, the release of NO from the monolayer of cultured HUVEC cells is measured with a polar-specific electrode for NO connected to a NO meter (Iso-NO, World Precision Instruments Inc.) (1049). The calibration of the elements for NO is carried out in accordance with the following equation: 2KN02 + 2KI + 2H2S0462NO + I2 + 2H20 + 2K2S04 The standard calibration curve is obtained by adding graduated concentrations of KN02 (0, 5, 10, 25, 50, 100, 250, and 500 nmol / 1) in the calibration solution containing Kl and H2S04. The specific character of the Iso-NO electrode for NO is previously determined by measuring NO from authentic NO gas (1050). The culture medium is removed and the HUVEC cells are washed twice with Dulbecco's phosphate buffered saline. The the A'.? ?? ± < ** tk * A. ÚA &t; cells are then bathed in 5 ml of filtered solution of Krebs-Henseleit in 6-well plates, and the plates with cells are kept in a slide oven (Lab Line Instruments Inc.) to maintain the temperature at 37 ° C. The probe of the NO detector is inserted vertically into the cavities, keeping the tip of the electrode 2 mm below the surface of the solution, before adding the different conditions. S-nitroso acetyl penicillamine (SNAP) is used as a positive control. The amount of NO released is expressed as picomoles per lx 106 cells of the endothelium. All values reported are averages of four to six measurements in each group (number of cell culture cavities). See, Leak et al. Biochem. and Biophys. Res. Comm. 217: 96-105 (1995). The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide. ni.?H..A JA? A? * EXAMPLE 29 Effect of angiogenic polypeptide on cord formation in angiogenesis Another step in angiogenesis is the formation of Cord, marked by the differentiation of endothelial cells. This biological test measures the ability of microvascular endothelial cells to form capillary-like structures (hollow structures) when grown in vitro. CADMEC cells (microvascular endothelial cells) were purchased in Cell Applications, Inc. as proliferating cells (passage 2) and cultured in cell growth medium CADMEC from Cell Applications and used in passage 5. For the angiogenesis test in vi tro , the cavities of a 48-well cell culture plate were coated with Cell Applications adhesion factor medium (200 ml / well) for 30 minutes at 37 ° C. The CADMEC cells were seeded in the coated cavities at a density of 7,500 cells / cavity and they were grown overnight in growth medium. The growth medium is then replaced with regulatory buffer for control containing 300 mg of Cell Applications bead-forming medium or the angiogenic polypeptide (0.1 to 100 ng / ml) and the cells were cultured for a further 48 hr. The number and lengths of the capillary-type strings are quantified using the VIA-170 video image analyzer Boeckeler. All tests are done in triplicate. Commercial VEGF (50 ng / ml) is used (R & amp; amp;; D) as a positive control. B-Steradiol (1 ng / ml) is used as a negative control. The appropriate regulatory solution (without protein) is also used as a control. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 30 Angiogenic effect on chicken chorioallantoic membrane Chicken chorioallantoic membrane (CAM) is a well-established system for examining angiogenesis. The formation of blood vessels in CAM can be easily observed and quantified. The ability of the angiogenic polypeptide to stimulate angiogenesis in CAM can be examined. Fertilized eggs of White Leghorn (Gallus gallus) and Japanese quail (Coturnix coturnix) chicken were used and incubated at 37.8 ° C and 80% humidity. The differentiated CAM of chicken embryos of 16 days of age and quail of 13 days of age was studied with the following methods. On day 4 of development, a window is made in the shell of the chicken eggs. The embryos are inspected for normal development and the eggs are sealed with cellotape. These are continued to incubate until day 13. Thermanox covers (Nunc, Naperville, IL) are cut into discs approximately 5 mm in diameter. The sterile, salt-free growth factors are dissolved in distilled water and about 3.3 mg / 5 ml are pipetted onto the disks. After air drying, inverted discs are applied over the CAM. After 3 days, the specimens are fixed in 3% glutaraldehyde and 2% formaldehyde and rinsed in 0.12 M sodium cacodylate buffer solution. These are photographed with a stereo microscope [Wild M8] and embedded to cut semi-thin sections Y a.aAa tijt ultra-thin as described above. The controls are made with discs with vehicle alone. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of the polynucleotides encoding the angiogenic polypeptide (e.g., gene therapy), agonists and / or antagonists of the angiogenic polypeptide.

EXAMPLE 31 Dß angiogenesis test using a matrigel implant in a mouse The in vivo angiogenesis test of the angiogenic polypeptide measures the ability of an existing capillary network to form new blood vessels in an implanted capsule of murine extracellular matrix material (Matrigel). The protein is mixed with liquid matrigel at 4 ° C and the mixture is then injected subcutaneously into mice where it solidifies. After 7 days, the solid "plug" of Matrigel is removed and examined for the presence of new blood vessels. Matrigel Lii? -IA? ? t.i .. **? .? . ? '.AtJtAI *.

It is purchased from Becton Dickinson Labware / Collaborative Biomedical Products. When thawed at 4 ° C the Matrigel material is a liquid. Matrigel is mixed with the angiogenic polypeptide at 150 ng / ml at 4 ° C and extracted with cold 3 ml syringes. C57B1 / 6 female mice of approximately 8 weeks of age are injected with the mixture of matrigel and experimental protein at 2 sites in the middle ventral region of the abdomen (0.5 ml / site). After 7 days, the mice are sacrificed by cervical dislocation, the mat plug plugs are removed and cleaned (i.e., all membranes and hanging fibrous tissue are removed). Whole plugs in duplicate are fixed in formaldehyde at 10% neutral regulated, embedded in paraffin and used to produce sections for histological examination after staining with Masson's Trichrome. Cross sections are processed from three different regions of each plug. The selected sections are stained with respect to the presence of vWF. The positive control for this test is basic bovine FGF (150 ng / ml). Matpgel is only used to determine the basal levels of angiogenesis. The studies described in this example tested the activity in the angiogenic protein. However, a The person skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 32 Rescue of ischemia in the lower extremity model of the rabbit To study the in vivo effects of the angiogenic polypeptide on ischemia, a model of ischemia is created in the hind limb of a rabbit by surgically removing one of the femoral arteries as previously described (Takeshita, S. et al., Am. J. Pa thol 147: 1649-1660 (1995)). Removal of the femoral artery results in a retrograde propagation of thrombi and occlusion of the external iliac artery. Accordingly, the blood flowing to the ischemic limb depends on the collateral blood vessels originating from the internal iliac artery (Takeshita, S. et al., Am J. Pa thol 147: 1649-1660 (1995)). An interval of 10 days is allowed for the post-operative recovery of the rabbits and the development of endogenous collateral blood vessels. At 10 days after the operation (day 0), and after performing a baseline angiogram, the internal iliac artery of the ischemic limb is transfected with 500 mg of naked expression plasmid encoding the angiogenic polypeptide using arterial gene transfer using a balloon catheter coated with hydrogel as described (Riessen, R. et al., Hum Gene Ther 4: 749-758 (1993); Leclerc, G. et al., J. Invest. : 936-944 (1992)). When the DNA encoding the angiogenic polypeptide is used in the treatment, an individual bolus of 500 mg of the angiogenic or control protein is delivered to the internal iliac artery of the ischemic extremity in a period of 1 minute via a catheter. of infusion. On day 30, several parameters are measured in these rabbits: (a) BP relation - Blood pressure ratio of the systolic pressure of the ischemic limb with respect to the normal limb; (b) Blood Flow and Reserve Flow - Resting FL: blood flow during an undilated condition and FL Max: blood flow during a fully dilated condition (It is also an indirect measure of the number of blood vessels) and Flow Reserve is reflected by the ratio of Flmax: FL at Rest; (c) Angiographic Score - this is measured using the angiogram of collateral blood cases. A score is determined by the percent of circles in an overlapping grid that is divided by the opaque arteries passing through divided by the total number m of the rabbit's limb; (d) Capillary density - the number of collateral capillaries determined in sections analyzed with light microscopy taken from the hind limbs. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polypeptides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 33 Effect of the angiogenic protin on vasodilation Because dilatation of the vascular endothelium is important for reducing blood pressure, it was examined the ability of the angiogenic polypeptide to affect blood pressure in spontaneously hypertensive rats (SHR). Increasing doses (0, 10, 30, 100, 300, and 900 mg / kg) of the angiogenic polypeptide are administered to spontaneously hypertensive rats 13-14 weeks of age (SHR). The data is expressed as the average +/- SEM. The statistical analyzes are carried out with a t-test in pairs and the statistical significance is defined as p < 0.05 vs. the answer to the regulatory solution alone. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

A *** --a EXAMPLE 34 Ischemic skin flap model rat Evaluation parameters include skin blood flow, skin temperature and immunohistochemistry of factor VIII or alkaline phosphatase reaction of the endothelium. The expression of the angiogenic protein was studied during skin ischemia using in situ hybridization. The study in this model is divided into three parts as follows: a) ischemic skin b) ischemic skin wounds c) normal wounds The protocol of the experiment includes: a) lifting a skin flap randomly with full thickness of a single 3x4 pedicle cm, (myocutaneous flap on the lower back of the animal). b) a cut lesion (4-6 mm in diameter) in the ischemic skin (skin flap). c) topical wound treatment by cutting with the angiogenic polypeptide (day 0, 1, 2, 3, 4 after the injury) in the following dosage ranges: lmg to 10Omg. d) collect the injured tissues on days 3, 5, 7, 10, 14 and 21 after the lesion for histological, immunohistochemical, and in situ studies. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 35 Model of peripheral arterial disease Angiogenic therapy using the angiogenic polypeptide is a novel therapeutic strategy to obtain the restoration of blood flow around ischemia in cases of peripheral arterial diseases. The experimental protocol includes: a) one side of the femoral artery is ligated to create ischemic muscle in the hind limb, the other side of the hind limb serves as control. b) angiogenic protein is delivered intravenously and / or intramuscularly in a dose range of 20 mg - 500 mg, 3 times (perhaps more) per week for 2-3 weeks. c) ischemic muscle tissue is collected after ligating the femoral artery at 1, 2, and 3 weeks for the analysis of angiogenic protein expression and histology. Biopsies are also performed on the other side of normal muscle of the contralateral hind limb. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 36 Model of ischemic disease of the myocardium The angiogenic polypeptide was evaluated as a potent mitogen capable of stimulating the development of collateral vessels, and of restructuring new blood vessels after occlusion of the coronary artery. The alteration of angiogenic protein expression in situ was investigated. The experimental protocol includes: a) the heart is exposed through a thoracotomy on the left side in the rat. Immediately the left coronary artery is blocked with a thin suture (6-0) and the thorax is closed. b) the angiogenic protein is delivered intravenously and / or intramuscularly in a dose range of 20 mg - 500 mg, 3 times (perhaps more) per week for 2-4 weeks. c) 30 days after surgery, the heart is removed and cut into sections for morphometric and in situ analyzes. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 37 Model of healing of the corneal wound of the cornea of a rat This animal model demonstrates the effect of the angiogenic polypeptide on neovascularization. The experimental protocol includes: a) making an incision 1-1.5 mm long from the center of the cornea to the stromal layer. b) Insert a spatula under the lip of the incision facing the outer corner of the eye. c) make a bag (its base is 1-1.5 mm from the edge of the eye). d) placing a tablet, containing 50ng-5ug of the angiogenic polypeptide, inside the bag. e) treatment with angiogenic polypeptide can also be applied topically to corneal wounds in a dose range of 2 Omg-500mg (daily treatment for five days). The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the polypeptide angiogenic (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 38 Models of wound healing in diabetic mice and with difficulties for glucocorticoids A. Diabetic db + / db + mouse model To demonstrate that the angiogenic polypeptide can accelerate the healing process, the wound healing model of genetically diabetic mice was used. The full-thickness wound healing model in the db + / db + mouse is a model of wound healing that is well characterized, clinically relevant and reproducible. The healing of the diabetic wound depends on the formation of granulation tissue and the formation of new epithelium instead of the contraction (Gartner, MH et al., J. Surg. Res. 52: 389 (1992); Greenhalgh, DG et al., Am.J. Pathol. 136: 1235 (1990)). Diabetic animals have many of the characteristic situations presented in type II diabetes mellitus. The homozygous mice (db + / db +) are obese compared to their heterozygous equivalents normal (db + / + m). Diabetic mutant mice (db + / db +) have a single autosomal recessive mutation on chromosome 4 (db +) (Coleman et al., Proc. Nati, Acad. Sci. USA 77: 283-293 (1982)). The animals have polyphagia, polydipsia and polyuria. Diabetic mutant mice (db + / db +) have elevated blood glucose levels, normal or increased levels of insulin and suppressed cell mediated immune response (Mandel et al., J. Immunol., 120: 1375 (1978); Debray-Sachs; , M. et al., Gun, Exp. Lmmunol., 51 (1): 1-7 (1983), Leiter et al., Am. J. of Pathol., 114: 46-55 (1985)). Peripheral neuropathies, myocardial complications and microvascular lesions, thickening of the base membrane and abnormalities in glomerular filtration have been described in these animals (Norido, F. et al., Exp. Neurol. 83 (2): 221-232 (1984 ); Robertson et al., Diabetes 29 (1): 60-67 (1980); Giacomelli et al., Lab Invest. 40 (4): 460-473 (1979); Coleman, DL, Diabetes 31 (Suppl): 1-6 (1982)). These homozygous diabetic mice develop hyperglycemia that is insulin resistant analogous to human type II diabetes (Mandel et al., J. Immunol 120: 1375-1377 (1978)). The characteristics observed in these animals suggest that the healing in this model could be similar to ttta Jaj.afa¿, tt. Íjl | l t -Aa-tái. - > .,. the cure observed in human diabetes (Greenhalgh, et al., Am. J. of Pathol., 136: 1235-1246 (1990)). In this study, C57BL / KsJ (db + / db +) female mice were genetically diabetic and their non-diabetic heterozygous (db + / + m) equivalents (Jackson Laboratories). The animals were purchased at 6 weeks of age and the study starts when they are 8 weeks old. The animals were housed individually and received food and water without restriction. All manipulations were performed using aseptic techniques. The experiments are conducted in accordance with the rules and guidelines of the following institutions: Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the guidelines for the care and use of laboratory animals. The protocol for creating the wounds is made in accordance with previously reported methods (Tsuboi, R. and Rifkin, D.B., J. Exp. Med. 172: 245-25 1 (1990)). In short, the day on which the lesions are made, the animals are anesthetized with an intraperitoneal injection of Avertin (0.01 mg / ml), 2, 2, 2-tribromoethanol and 2-methyl-2-butanol dissolved in water deionized. The dorsal region of the animals is shaved and the skin is washed with a 70% solution of iodine and ethanol. The surgical area is dried with sterile gauze before causing the injury. Then a full thickness 8 mm wound is created using a Keyes tissue punch. Immediately after making the wound the surrounding skin is gently stretched to eliminate the expansion of the wound. The wounds are left open for the duration of the experiment. The treatment is applied topically for five consecutive days starting the day the wound is made. Before treatment, the wounds are gently cleaned with sterile saline and gauze sponges. Wounds are examined visually and photographed at a fixed distance on the day of surgery and at intervals of two days after surgery. Wound closure is determined by daily measurements on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson calibrator. Wounds are considered healed if the granulation tissue is no longer observed and the wound is covered with a continuous epithelium. The angiogenic polypeptide is administered using a range of different doses of the angiogenic polypeptide, from 4 mg to 500 mg per wound per day for 8 hours. ? í, ^.?? £ días días días días days by vehicle. The control groups with vehicle received 50 ml of the vehicle solution. The animals were sacrificed on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg / kg). The wounds and the surrounding skin are then collected for histology and immunohistochemistry studies. Specimen samples are placed in neutral 10% formalin-regulated tissue cassettes between sponges for biopsy for further processing. Three groups of 10 animals each were evaluated (5 diabetics and 5 non-diabetic controls): 1) vehicle placebo control 2) The angiogenic polypeptide The wound closure is analyzed by measuring the area on the vertical and horizontal axes and obtaining the total square area of the wound. An estimate of the contraction is made by establishing the differences between the area of the initial wound (day 0) and that which is measured after the treatment (day 8). The area of the wound on day 1 is 64mm2, the size corresponding to the perforation of the skin. The calculations are made using the following formula: [open area on day 8] - [open area on day 1] / [open area on day 1]. The specimens are fixed in formalin 10% regulated and embedded in paraffin blocks which are cut into sections perpendicular to the surface of the wound (5mm) using a Reichert-Jung microtome. Routine hematoxylin-eosin staining (H & E) is performed on the cross sections of the dissected wounds. The histological examination of the wounds is used to evaluate if the healing process and the morphological appearance of the repaired skin is altered or not by the treatment with the angiogenic polypeptide. This evaluation includes the verification of the presence of cell accumulation, inflammatory cells, capillaries, fibroblasts, formation of new epithelium and epidermal maturity (Greenhalgh, D.G. et al., Am. J. Pathol. 136: 1235 (1990)). A "blind" observer uses a micrometer with a calibrated lens. Tissue sections are also stained with immunohistochemistry using anti-rabbit polyclonal human keratin antibody using the ABC Elite detection system. Human skin is used as a positive tissue control while non-immune IgG is used as a negative control. The growth of keratinocytes is determined by evaluating the degree of new epithelial formation of the wound using a micrometer with calibrated lens. The proliferating antigen / cyclin nuclear cell (PCNA) in skin specimens is demonstrated using PCNA antiantibody (1:50) with an ABC Elite detection system. Human colon cancer served as a positive tissue control and human brain tissue was used as a negative control. Each specimen included a section with omission of the primary antibody and substitution with mouse non-immune IgG. The classification of these sections is based on the degree of proliferation on a scale of 0-8, with the lower side of the scale reflecting a slight proliferation with respect to the upper side that reflects intense proliferation. The experimental data are analyzed using an unpaired t-test. A value p < 0.05 is considered significant.

B. Rat model with difficulty for steroids The inhibition of wound healing caused by steroids has been well documented in several systems in vi tro and in vi vo (Wahl, S.M. Glucocorticoids and Wound healing.) In: Anti-Inflammatory .üJ i Steroid Action: Basic and Clinical Aspects. 280-302 (1989); Wahl, S.M.et al., J. Immunol. 115: 476481 (1975); Werb, Z. et al., J. Exp. Med. 147: 1684-1694 (1978)). Glucocorticoids delay wound healing by inhibiting angiogenesis, reducing vascular permeability (Ebert, R.H., et al., An. Intern. Med. 37: 701-705 (1952)), the proliferation of fibroblasts, and the synthesis of collagen.

(Beck, L.S. et al., Growth Factors, 5: 295-304 (1991); Haynes, B.F. et al., J. Clin. Invest. 61: 703-797 (1978)) and producing a transient reduction of circulating monocytes (Haynes, BF, et al., J. Clin Invest. 61: 703-797 (1978); Wahl, SM, "Glucocorticoids and wound healing ", in: Antiinflammatory Steroid Action: Basic and Clmical Aspects, Academic Press, New York, pp. 280-302 (1989)). Systemic administration of steroids to hinder wound healing is a well-established phenomenon in rats (Beck, LS et al., Growth Factors, 5: 295-304 (1991); Haynes, BF, et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, SM, "Glucocorticoids and wound healing", in: Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989); Pierce, GF et al., Proc. Nati, Acad. Sci. USA 86: 2229-2233 (1989)).

To demonstrate that the angiogenic polypeptide can accelerate the healing process, the effects of multiple topical applications of the angiogenic polypeptide on full thickness wounds caused by skin cutting were evaluated in rats in which healing has been impeded by the systemic administration of methylprednisolone. . In this example, young adult male Sprague Dawley rats weighing 250-300 g (Charles River Laboratories) were used. The animals were purchased at 8 weeks of age and the study starts when they are 9 weeks old. The animals were housed individually and received food and water without restriction. All manipulations were performed using aseptic techniques. This study was carried out in accordance with the rules and guidelines of the following institutions: Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the guidelines for the care and use of laboratory animals The protocol for creating wounds is carried out According to section A, above, the animals are anesthetized with an intramuscular injection of ketamine (50 mg / kg) and xylazine (5 mg / kg). jtiaAdAA .; -A -. * - .1. the animals and the skin is washed with a solution of iodine and 70% ethanol. The surgical area is dried with sterile gauze before causing the injury. Then a full thickness 8 mm wound is created using a Keyes tissue punch. The wounds are left open for the duration of the experiment. The applications of the test materials are administered topically once a day for 7 consecutive days starting the day the wound is made and after the administration of methylprednisolone. Before treatment, the wounds are gently cleaned with sterile saline and gauze sponges. Wounds are examined visually and photographed at a fixed distance on the day of surgery and at intervals of two days after surgery. Wound closure is determined by daily measurements on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if the granulation tissue is no longer observed and the wound is covered with a continuous epithelium. The angiogenic polypeptide is administered using a range of different doses of the polypeptide ? -Í..yámí. **? ÍA ,. , m. ** ••• -angiogenic, from 4 mg to 500 mg per wound per day for 8 days in a vehicle. The control groups with vehicle received 50 ml of the vehicle solution. The animals were sacrificed on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg / kg). The wounds and the surrounding skin are then collected for histology and immunohistochemistry studies. Specimen samples are placed in neutral 10% formalin-regulated tissue cassettes between sponges for biopsy for further processing. Four groups of 10 animals each were evaluated (5 with methylprednisolone and 5 without glucocorticoid): 1) no treatment group 2) vehicle placebo control 3) groups treated with the angiogenic polypeptide Wound closure is analyzed by measuring the area in the vertical and horizontal axes and obtaining the total square area of the wound. An estimate of the contraction is made by establishing the differences between the area of the initial wound (day 0) and that which is measured after the treatment (day 8). The area of the wound on day 1 is 64mm2, the size corresponding to the perforation of the skin. The calculations are made using the following formula: antagonists of the angiogenic polypeptide.EXAMPLE 39 Animal lymphatic model The purpose of this experimental method is to create an appropriate and consistent lymphedema model to evaluate the therapeutic effects of the angiogenic polypeptide on lymphoangiogenesis and the restoration of the lymphatic circulatory system in the hind limb of the rat. The effectiveness is measured by the volume of swelling of the affected limb, quantification of the network of lymphatic vessels, plasma protein in whole blood and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps most importantly, the chronic advance of edema continues for up to 3-4 weeks. Before starting surgery, a blood sample is removed for protein concentration analysis. A dose of pentobarbital is administered to male rats weighing about 350 g. Subsequently, the right legs are shaved from the knee to the hip. The shaved area is cleaned with a gauze soaked in 70% EtOH. Blood is withdrawn to perform the determination of total protein in serum. The measures t * í, -Zt. .?. A r. circumferential and volumetric measurements are made before injecting dye into the legs after marking 2 measurement levels (0.5 cm above the heel at an intermediate point of the dorsal leg). The intradermal back of both left and right legs is injected with 0.05 ml of 1% Evan's Blue. The circumferential and volumetric measurements are made after injecting the dye into the legs. Using the knee joint as a point of reference, a circumferential incision is made that allows the femoral vessels to be located. Forceps and hemostats are used to dissect and separate the skin flaps. After locating the femoral vessels, locate the lymphatic vessel that runs along one side and below the vessels. The main lymphatic vessels in this area are then coagulated electrically or ligated with suture. Using a microscope, the muscles in the back of the leg (near the semitendinosis and the adductors) are dissected by blunting. The popliteal lymph node is located later. The 2 proximal lymphatic vessels and 2 distal lymphatic vessels that supply blood to the popliteal nodule are then ligated by suturing.

The popliteal lymph node is then removed, along with any adipose tissue that accompanies it, cutting the connective tissues. The necessary precautions are taken to control any slight bleeding resulting from this procedure. After the lymphatic vessels become clogged, the skin flaps are sealed using liquid skin (Vetbond) (AJ Buck). The edges of the separated skin are sealed to the underlying muscle tissue while at the same time leaving a space of approximately 0.5 cm around the leg. The skin can also be secured by suturing the underlying muscle when necessary. To avoid infection, the animals are housed individually with mesh (without bed). The animals in recovery are inspected daily until the appearance of the optimal edematous peak, which typically appears between days 5-7. The edematous peak plateau is observed later. To assess the intensity of lymphedema, measure the circumference and volumes of 2 2 designated sites on each leg before the operation and daily for 7 days. The effect of plasma proteins on lmfadema is determined and it was also investigated whether the protein analysis is a useful test parameter or not. They were evaluated the weights of both extremities, the control ones and the edematous ones in 2 sites. The analysis is done in a blind way. Measurements of the Circumference: Under a brief amount of anesthetic gas to prevent movement of the limb, a tape is used to measure the circumference of the limb. 2 different people make measurements on the ankle bone and on the back of the leg and then those 2 readings are averaged. Readings are taken from both the control and edematous extremities. Volumetric measurements: On the day of the operation, animals are anesthetized with Pentobarbital and evaluated before surgery. The animals are anesthetized slightly with anesthetic halothane (rapid immobilization and rapid recovery) to make the daily volumetric measurements), both legs are shaved and they are shaped in the same way using waterproof markers on the legs. First the legs are immersed in water, then immersed in the instrument until each marked level and then measured using the Buxco edema software (Chen / Victor). One person records the data, while the other person submerges the leg to the marked area.

Measurements of plasma-blood prctein: Blood is withdrawn, centrifuged, and serum is separated before surgery and then at the end to make comparisons of total protein and Ca2 +. Limb weight comparison: After extracting the blood, the animal is prepared for tissue collection. The legs are amputated using a guillotine, then both the experimental and control legs are cut in the ligature and weighed. A second weigh is made as the tibio-heel joint is disarticulated and the leg is weighed. Histological preparations: The transverse muscle located behind the knee area (popliteal) is removed and accommodated in a metal mold, filled with freezeGel, immersed in cold methylbutane, placed in sample bags marked at -80 ° C until it is cut into sections. After cutting into sections, the muscle is observed with fluorescent microscopy with respect to the lymphatic vessels. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (e.g., gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 40 Suppression of the expression of the adhesion molecule induced by TNF-alpha mediated by the angiogenic polypeptide The recruitment of lymphocytes to the areas of inflammation and angiogenesis involves specific receptor-ligand interactions between cell surface adhesion molecules (CAMs) in lymphocytes and the vascular endothelium. The adhesion procedure, in both normal and pathological environments, follows a multistep cascade involving the expression of an intercellular adhesion molecule-one (ICAM-1), a vascular-cell adhesion molecule-one (VCAM-1). ) and the endothelium-1 leukocyte adhesion molecule (E-selectin), in endothelial cells (EC). The expression of these molecules and others in the vascular endothelium determines the efficiency with which the leukocytes can adhere to the local vasculature and extravasate to the local tissue during the development of an inflammatory response. The local concentration of cytokines and growth factor participates in the modulation of the expression of these CAMs. Tumor necrosis factor alpha (TNF-a), a potent pro-inflammatory cytokine, is a stimulator of the three CAMs in endothelial cells and may be involved in a wide variety of inflammatory responses, and often results in a situation or pathological state. The potential of angiogenic polypeptides to mediate a suppression of CAM expression induced by TNF-alpha can be examined. A modified ELISA test is used which uses ECs as a solid-phase absorber to measure the amount of CAM expression in ECs treated with TNF-alpha when co-stimulated with a member of the angiogenic protein family. To perform the experiment, cultures of human umbilical cord vein endothelial cells (HUVEC) were obtained from mixed cord samples and maintained in growth medium cultures (EGM-2, Clonetics, San Diego, CA) supplemented with 10% FCS and 1% penicillin / streptomycin in a humidified incubator at 37 ° C containing 5% C02. HUVEC cells are seeded in 96-well plates at concentrations of 1 x 104 cells / well in EGM medium at 37 ° C for 18-24 hrs or :. *** & * until confluence. The monolayers are then washed 3 times with a serum-free RPMI-1640 solution supplemented with 100 U / ml penicillin and 100 mg / ml streptomycin, and treated with a cytokine and / or certain growth factor or factors for 24 hours. has 37 ° C. After incubation, the cells are then evaluated for CAM expression. Human umbilical vein endothelial cells (HUVEC) are cultured in a standard 96-well plate until confluent. The growth medium is removed from the cells and replaced with 90 ul of medium 199 (10% of FBS). The samples for evaluation and the positive or negative controls are added to the plate in triplicate. (in volumes of 10 ul). The plates are incubated at 37 ° C either for 5 hours (for the expression of selectin and integrin) or for 24 h (for integrin expression only). The plates are aspirated to remove the medium and 100 μl of 0.1% paraformaldehyde-PBS solution (with Ca2 + and Mg2 +) is added to each well. The plates are kept at 4 ° C for 30 minutes. The fixative is then removed from the cavities and these are washed IX with PBS (+ Ca, Mg) + 0.5% BSA and drained. Do not allow the cavities to dry. 10 μl of diluted primary antibody is added to the cavities of . < J test and control. Anti-ICAM-1-Biotin, Anti-VCAM-1-Biotin and Anti-E-selectin-Biotin conjugates are used at a concentration of 10 μg / ml (1:10 dilution of a stock solution of 0.1 mg / ml of antibody). The cells are incubated at 37 ° C for 30 minutes in a humid environment. The cavities are washed X3 with PBS (+ Ca, Mg) + 0.5% BSA. Then add 20 μl of a dilute alkaline ExtrAvidin-Phosphatase solution (1: 5,000 dilution) to each well and incubate at 37 ° C for 30 minutes. The cavities are washed X3 with PBS (+ Ca, Mg) + 0.5% BSA. One tablet of p-nitrophenol phosphate pNPP is dissolved in 5 ml of glycine buffer (pH 10.4). 100 μl of pNPP substrate in glycine buffer is added to each test well. Standard cavities are prepared in triplicate from the working dilution of the Alkaline ExtrAvidin-Phosphatase solution in glycine buffer: 1: 5,000 (10 °) > 10 ~ ° '5 > 10_1 > 10"1'5 5 μl of each dilution is added to the cavities in triplicate and the content of AP resulting in each cavity is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng, then 100 μl of pNNP reagent should be added. To each of the standard cavities, the plate should be incubated at 37 ° C for 4 hours. volume of 50 μl of 3M NaOH to all cavities. The results are quantified in a plate reader at 405 nm. The background subtraction option is used in white cavities filled with glycine buffer alone. The template is adjusted to indicate the concentration of AP-conjugate in each of the standard cavities [5.50 ng; 1.74 ng; 0.55 ng; 0.18 ng]. The results are indicated as the amount of AP-conjugate bound in each sample. The studies described in this example tested the activity in the angiogenic protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides encoding the angiogenic polypeptide (eg, gene therapy), agonists, and / or antagonists of the angiogenic polypeptide.

EXAMPLE 41 Immunization of mice for the production of monoclonal antibody The animals were housed individually and received food and water without restriction. All manipulations were performed using aseptic techniques. The experiments were conducted in accordance with the rules and guidelines of the following institutions: Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the guidelines for the care and use of laboratory animals. The protein concentration is diluted in 350 μls phosphate buffered solution (PBS), or other neutral buffer solution, to a final protein concentration of 0.43 mg / ml. With 0.35 ml of Freund's complete adjuvant, emulsify the adjuvant and protein solution for a period of ten minutes using two 3 cm3 glass syringes and a disposable three-way wrench (Baxter Cat. No. 2C6240). To evaluate the emulsion with respect to quality, place 50 μl of the emulsion on the surface of cold water in a beaker. If the emulsion does not remain as an intact white droplet, then additional mixing is required. Extract the entire emulsion with one of the syringes, and using a 27-gauge needle, inject the mice subcutaneously with a total of 200 μl of emulsion distributed between 4-8 sites including the axilla and inguinal areas, the part back of the neck, already length of the loin. After two to three weeks, repeat the previous injection replacing Freund's incomplete adjuvant (as opposed to Freund's complete adjuvant). After an additional two or three weeks, a third injection is given as indicated above, making sure to use incomplete Freund's adjuvant. Ten to fourteen days after the third injection, 100-200 μl of mouse blood is obtained by bleeding from the tail vein. The blood sample is incubated at 37 ° C for 60 minutes, and then allowed to cool overnight at 4 ° C. After incubation at 4 ° C, the blood sample is centrifuged for ten minutes. The serum is transferred to a new tube, and evaluated for the serum titre of the mouse. If the titer is found to be very low, intraperitoneal (ip) injections may be administered at two week intervals. For ip injections, prepare 10-20 μg of protein per mouse in a volume of 200-400 μl of PBS per mouse. Using a 1 cm3 syringe and a 26-gauge needle, inject the solution into the mouse. Perform a second bleed of the tail 10-14 days after the Yes. Yes. injection, and reassess the mouse serum titer.

EXAMPLE 42 Titration of mouse serum by ELISA The ELISA plate is coated with 50 μl / well of purified antigen at a concentration of 2 μg / ml of PBS. Cover the ELISA plate with parafilm and incubate at 4 ° C overnight in a humid chamber. After incubation, the plate is washed four times with 200 μl / well of PBS per wash. Block with 3% BSA, 200 μl / well during 60 minutes at room temperature. The blocking solution is stirred. Serum samples are added in duplicate, 50 μl / well, at 10"2, 10 ~ 3, 10 ~ 4, 10" 5, 10"6, and 10" dilutions 1, diluted in PBS containing 0.1% BSA. Regulatory solution targets are included as well as serum for positive and negative control at previous dilutions. They are incubated at room temperature for 1-2 hours. They are washed with PBST (PBS with 0.05% tween), 250 μl / well, four times. 50 μl / cavity of mouse Anti-IgG are added - * feti fi ci treated with biotin at a concentration of 0.5 μg / ml in PBST containing 0.1% BSA and 2% horse serum. It is incubated at room temperature for 30 to 60 minutes. The plate is washed four times with PBST. 50 μl / reagent cavity are added to the plate ABC (Vector Cat. No. PK-6100) and incubate at room temperature for 30 minutes. The plate is washed six times with PBST. The substrate is prepared for detection by ELISA by dissolving 1 tablet of tetramethylbenzidine dihydrochloride (TMB) (Sigma Cat. No. T-3405) in 5 ml of ddH20. Add 5 ml of 0.1 M citrate and phosphate buffer (25.7 ml of 0.2 M dibasic sodium phosphate, 24.3 ml of 0.1 M citric acid monohydrate, pH 5.0). 2 μl of fresh 30% hydrogen peroxide is added, swirled and used immediately. After the plate is incubated and washed, 100 μl of substrate solution is added and incubated at room temperature for approximately 15-30 minutes. The reaction is stopped by adding 25 μl / 2M H2SO4 cavity, and the plate is read at 450 nm within 30 minutes against the controls.

EXAMPLE 43 Fusion protocol for the production of hybridomas One week before the fusion step, P3X growth medium (IX DMEM 0% (Gibco Car No. 11965-019), 5-10% fetal bovine serum, IX L-glutamine is prepared.

(Biofluids Cat. No. 300), and IX of sodium pyruvate (Biofluids cat No. 333). A new vial of P3X mouse myeloma cells is thawed in a cavity of a 6-well plate (see thawing protocol, fra) and expanded in P3X growth medium. If the viability is good, they are transferred the next day to a 100 mm plate. The cell density must not be greater than 10d cells / ml or more. further, the membranes of these cells should not have a grainy appearance. On the day that the fusion procedure is carried out, there should be 6-8 plaques at a density of 5-8 x 10 5 cells / ml. It is a good idea to try some of the PX3 cells in HAT medium. All cells must be dead around 4 days. Yes, P3X cells should be cultured in P3X medium containing 15 ug / ml 8-azaguanine to eliminate revertants. Four days before the fusion procedure, mice should be immunized with an ip injection of 10 μg approximately high purity protein. One day before the fusion, the P3X cells are separated and fed with fresh medium as necessary for the cells to be healthy and in development in the log phase the next day. On the day that the fusion procedure is carried out, 50 ml of P3X medium, PEG solution and HAT medium (IX DMEM 0%, 20% fetal bovine serum, 4% of the hybridoma complement-BM Condimed Hl are placed. (Boehringer-Mannheim), L-Glutamine IX, NE.AA IX, Sodium Pyruvate IX, IX HAT Medium (Sigma Cat. No. H0262), IX of 2ME 0.05M, and Penicillin-Streptomycin IX) in a water bath at 37 ° C. Have on hand 100 ml approximately 0% cold DMEM. Inspect all P3X plates for possible contamination and to assess the health of the cells. The cells of 4 plates or flasks are resuspended and combined in 50 ml tubes. Centrifuge at 200 x G for 10 minutes. The supernatant is aspirated. Each tube is resuspended with 10 ml of 0% DMEM medium and combined. Live cells are counted using tppan blue staining for viability (viability must be greater than 90%). The total number of cells should be 2-4 x 107 cells. If you do not have enough cells, then repeat the procedure with a few more plates. The cells are allowed to stand at room temperature in the room until they are used in the next step. Prepare the extraction hood in which the spleen is to be removed with: 70% EtOH, sterile instruments including sieve and plunger, 2 Petri dishes containing 10 ml of 0% DMEM and 15 ml centrifuge tubes (2) . The mouse is sacrificed, and the spleen is then collected from the body. The spleen is placed in the Petri box containing 0% DMEM. The sieve is placed in the other box containing 10 ml of 0% DMEM and the lid of the box is placed. The spleen is transferred to the screen using a pair of sterile forceps, and using syringes with needles, the spleen is crumbled in such a way that the cells fall into the medium. Then, using the other plunger, the spleen is gently passed through the sieve. It should be avoided to grind the tissue of the spleen organ through the sieve as this will result in a dense growth of fibroblasts. The screen is removed and the spleen cell suspension is transferred to a 15 ml centrifuge tube. The remaining cells are washed from the box with 5 ml of 0% DMEM, and added to the tube. Allow the tube to sit for 5 minutes to allow larger debris to settle to the bottom. Then, the cell suspension, minus the waste, is transferred to a second 15 ml tube. The cells are centrifuged for 10 minutes at 200 x G. The supernatant is aspirated and the spleen cells are resuspended in 5 ml of 0% DMEM. An additional 5 ml of 0% DMEM is added, and the entire volume is transferred to a 50 ml tube. Remove 10 μl of the spleen cell suspension, and add to 500 μl Trypan Blue in order to count the lymphocytes. (Note: usually a spleen will consistently give 108 lymphocytes).

Fusion Sufficient 'P3X cells are added to the 50 ml tube for centrifuge containing the spleen cells to make a ratio of lymphocyte to P3X cells of 5: 1. (for example, for 108 lymphocytes 2 x 107 P3X cells are needed). The total volume is brought to 45-50 ml with 0% DMEM, and centrifuged at 200 x G for 10 minutes. Prepare a transfer hood with a timer, warm PEG, warm P3X medium, and a beaker with water at approximately 38-40 ° C. All supernatant of the P3X-lymphocyte tablet is aspirated and the tube is shaken to loosen the tablet. The tube is placed in the water bath. The melting tube is kept in the warm water, while stirring gently, 1 ml of PEG is added by dripping in 1 minute. Then, let it rest by stirring occasionally for 1-2 minutes, after which 1 ml of P3X medium is added by dripping in 1 minute. Right away, 3 ml of P3X medium is added by dripping in 1 minute, followed by the addition of 10 ml of P3X medium by dripping in 1 minute. P3X medium is added gently to make a total volume of 45 ml. The tube is allowed to stand for 10 minutes, then centrifuged at 200 x G for 10 minutes. The supernatant is aspirated and the tablet is gently resuspended in 5 ml or less of HAT medium. The cell suspension is transferred to the bottle containing 400 ml of HAT medium and stirred to mix. Some of the cell suspension is poured into a sterile reservoir. The cells are seeded in 96-well plates, 200 μl / well, using a 12-channel pipettor with filtered tips. The plates are placed in the incubator. The plates are inspected daily to confirm the growth of the hybridoma or that there is no contamination. The you? i- ÉÉ? r? i - 1 ift? He? ii li. At this time, plates are incubated for three days. The first supply (change of medium) is done around day 7 by aspirating approximately half of the medium in each cavity using the multiple of 8 positions and replacing it with 100-150 μl / cavity of HT medium. The supply one week before the first selection helps to dilute any antibody produced by the unfused lymphocytes which have been found to continue to produce antibodies after 2 weeks in culture. Many or all of the cavities will be ready for sampling for selection 2 weeks after the fusion when the colony or colonies fill more than half of the cavity and the supernatant shows a change in color to orange / yellow.

EXAMPLE 44 Selection of mouse hybridomas by ELISA To select the mouse hybridomas, the plate is coated for ELISA tests (Immulon 2 microtiter plate with "U" bottom (Dynatech Cat. No. 011-010-3555)) with 50 μl / cavity of the antigen at 2 μg / ml PBS. The plate is covered for ELISA tests with seal of plastic and incubate at 4 ° C overnight. After incubation, the plate is washed four times with 200 μl / well of PBS per wash. Block with 3% BSA, 200 μl / well for 60 minutes at room temperature. The blocking solution is agitated. The hybridoma supernatants, 150 μl / well, are added to a Corming 96-well plate for testing, then 50 μl of each supernatant of the Corning plate is transferred to the ELISA plate. The targets of culture medium are included as well as the positive and negative controls for the mouse serum. It is incubated at room temperature for 1-2 hours, or overnight at 4 ° C. Wash with PBST (PBS with 0.05% tween), 250 μl / well four times. 50 μl / Cavity of Biotin treated Anti-mouse IgG H + L, at a concentration of 0.5 μg / ml in PBST containing 0.1-0.3% BSA and 1% horse serum. It is incubated at room temperature for 30 to 60 minutes. The plate is washed four times with PBST. 50 μl / reagent cavity are added to the plate ABC (Vector Cat. No. PK-6100) and incubate at room temperature for 30 minutes. The plate is washed six times with PBST. The substrate for detection by ELISA is prepared by dissolving 1 tablet of tetramethylbenzidine dihydrochloride (TMB) (Sigma Cat. No. T-3405) in 5 ml of ddH20. Add 5 ml of 0.1 M citrate and phosphate buffer (25.7 ml of 0.2 M dibasic sodium phosphate, 24.3 ml of 0.1 M citric acid monohydrate, pH 5.0). 2 μl of fresh 30% hydrogen peroxide is added, swirled and used immediately. After incubating and washing the plate, they are added 100 μl of substrate solution and incubate at room temperature for approximately 15-30 minutes. The reaction is stopped by adding 25 μl / 2M H2SO4 cavity, and the plate is read at 450 nm within 30 minutes against the controls.

EXAMPLE 45 Evaluation of the relative affinity of monoclonal antibodies derived from culture supernatants A. Determination of Antigen Coating Concentration Approximately 1 ml of antigen is prepared at a concentration of 4 ug / ml in PBS. It is transferred to a microtube for dilution. 0.5 ml of PBS is placed in each of 9 microtubes for dilution and serial dilutions of 1/2 are then made by transferring 0.5 ml from one tube to another from the 4 ug / ml tube. The resulting concentrations in the tubes are 4, 2, 1, 0.5, 0.25, 0.125, 0.06, 0.03, 0.015 and 0.0075 ug / ml. The plate is coated with the previous concentrations, 6 cavities each, 50 ul / cavity. Cover and incubate overnight at 4 ° C. After incubation, the plate is washed four times with 200 μl / PBS cavity per wash. Block with 3% BSA, 200 μl / well for 60 minutes at room temperature. The blocking solution is stirred. Observe the titration curve of the mouse serum which is positive for the antigen. From the titration curve, the dilution of serum that is just in the upper part of said curve is determined. Positive mouse serum in PBS containing 0.1% BSA is added to this dilution, 50 μl / well, rows B-D, columns 2-11. The control negative control serum should be included at the previous dilution in rows E-G, columns 2-11. It is incubated overnight at 4 ° C. After incubation, the negative control serum values are subtracted from the values of the positive control serum. The average values (D.O. 450) are plotted against the antigen concentration on a linear scale. The concentration of antigen coating that will give a D.O. sub-maximum. This is the coating concentration that will be used for the relative affinity test.

B. Determination of the mouse IgG concentration of a sample of the hybridoma supernatant using the "Mouse-IgG ELISA" kit (Cat. No. 1333 151) from Boehringer Mannheim Biochemica The concentrated buffer solution is diluted to 1/10 coating with ddH20. 10 to 20 ml are used. An aliquot of antibody (Ab) is obtained for capture. 3 tubes of the concentrated post-coating buffer solution (blocking solution) are thawed. 12 cavities are used for the patterns and 4-6 cavities for each supernatant that is evaluated. The number of milliliters needed of antibody for capture is calculated taking into account a volume of 50 ul / cavity of coating. The antibody is diluted to capture in the following ratio: 25 ul of Ab to capture X ul of Ab to capture 1 ml of Sol. Reg. for coating # ml of Sol. reg. for coating The Nunc plate is coated with the solution and incubated for 30 minutes at room temperature on a shaker. The concentrate of the post-coating buffer is diluted to 1/10 with ddH20. The plate is washed with a buffer solution for ELISA wash (0.9% NaCl, 0.1% Tween 20), and blocked with 200 ul / cavity of post-coating buffer solution (blocking solution) for 15 minutes at room temperature. The IgG standard is diluted in post-coating buffer solution (blocking solution) to the following concentrations: 0.2, 0.1, 0.05, 0.025, 0.0125 and 0.00625 ug / ml in post-coating buffer. The supernatants are diluted regulatory solution for blocking to the final concentrations of 1/100 and 1/1000. After the blocking step, the plate is washed and 50 ul / well of diluted IgG standards and diluted supernatants are added in duplicate. They are incubated for 30 minutes at room temperature in a shaker. The conjugate solution is diluted in post-coating buffer solution (blocking solution) in accordance with the following ratio: 50 ul of Conjugate X ul of Conjugate 1 ml of blocking solution # ml of blocking solution The plate is washed and 50 ul / cavity of conjugate are added. The plate is incubated for 30 minutes at room temperature in a shaker. One tablet of substrate is dissolved in 5 ml of buffer solution for substrate. The plate is washed and 50 ul / cavity of substrate is added. Incubate 30 minutes at room temperature on a shaker and read at 405 nm.

C. Relative affinity test The plate or plates appropriate for the ELISA test are coated with the previously determined antigen concentration overnight at 4 ° C. The plate is blocked as indicated above. Serial 1/3 dilutions of the test supernatant are prepared in PBS + 0.1% BSA. 50 ul / cavity of the dilutions of the supernatant sample, including the undiluted sample, are added, to the plate (s) for ELISA tests in duplicate or triplicate.

The positive control consists of a few cavities of the ii ^^ * ¿- -: -.A-Í ^ ?. i. M-i * i? .. A *, .. • ai, ..-: control of positive mouse serum at the same concentrations as those used to determine the concentration of the antigen coating. The negative control consists of a few cavities of the buffer solution for dilution. Cover and incubate overnight at 4 ° C. The IgG concentration of each supernatant is plotted against the average value (D.O. 450) in a 4-parameter curve fit. The supernatant curves that are further to the left are the supernatants that have the highest affinities.

EXAMPLE 46 Production of ascites in mice For the production of ascites, the hybridoma cells must be healthy and in the log growth phase. The cells are transferred to a 15 ml tube and counted. The volume containing 4 × 10 6 cells is determined, that volume is transferred to a second tube and the cells are centrifuged. The tablet is resuspended in 0.9 ml of HBSS (Hank's balanced salt solution) and transferred to an Eppendorf tube. .ééásk A syringe of 1 cmJ is filled with the cell suspension and the mice are injected ip as follows: 0.2 cm3 per mouse if the original number of cells was 4x06 and 0.3 cm if the original number of cells was 3x06. When the abdomen is very dilated and feels slightly hard, like a balloon, (usually around day 9 or 10 but some it takes until day 14) it is time to "drain the mouse".

A. Drained Hold the mouse in the left hand and use an alcohol pad to clean the abdominal area just above the left back leg. While holding the mouse over a 15 ml centrifuge tube, insert a 19-gauge needle into the abdomen. The small fluid should begin to drain immediately from the end of the needle into the centrifuge tube. A typical mouse should produce 3-6 ml of ascites fluid.

B. Processing and storage of the ascites The ascites fluid collected from each mouse in the group (all injected with the same hybridoma) is mixed and left at room temperature for 1-2 hours or i? a MÉájk, *. **. t * j *. -. * ..- .. ** *. * ,, A * ... JAiÁr- A .'.-.- .. me.,, * +. * L * i place at 37 ° C for 15- 30 minutes. The ascites are then brought to a temperature of 4 ° C and kept at that temperature overnight to allow the formation of a clot. The coagulated ascites are centrifuged for 10 minutes. The ascitos in liquid state are transferred to a 50 ml tube for centrifuge, and the tube is stored at -20 ° C. Subsequent drains can be added to this 50 ml tube. When all mice are sacrificed, the mixed ascites can be thawed, recentrifuged, and can be sampled for long-term storage at -20 ° C or -70 ° C. The ascites should be titrated by ELISA.

EXAMPLE 47 Protocol for freezing and thawing mouse myeloma and hybridoma cells A. Freezing The cells that are going to be frozen should be healthy, in the log growth phase and at a concentration of about 5-8 xlO5 cells / ml. The cells of a 6-well plate or flask are resuspended, transferred to a 15 ml tube and counted. The total number is calculated of cells and divided between l-3xl06 cells per bottle to determine the number of bottles to be frozen. The cells are centrifuged at 200-300 x G for 5-10 minutes. The supernatant of the cell tablet is aspirated and the tablet is resuspended in sufficient cold freezing medium (50% FBS, 10% DMSO in DMEM, or DMSO Origin Freezing Medium (IGEN), Fisher Cat. No. 10 -50-07 15) to obtain the desired number of cells / vial per ml (cell densities should be in a range of 5 x 105 to 1 x 10 7 cells / vial). The cell suspension is immediately transferred to the freezing bottles (cryophase), 1 ml per bottle, and placed on ice. The jars are transferred to a controlled speed freezer and the freezer is set at -70 ° C overnight. After 24 hours, the bottles are transferred to a tank of liquid nitrogen b to a freezer at -130 ° C for long-term storage.

B. Thawing 10 ml of cold medium (for example, Medium) are added.

P3X) to a 15 ml tube. A cryoprobe of frozen cells is removed and kept on dry ice until ready to thaw. The cells are rapidly thawed in a 37 ° C water bath. Hold the bottle while thawing and shake it gently until only a very small piece of ice remains in the jar. The contents of the bottle should not be allowed to reach a temperature above 4 ° C. Clean the exterior of the coppe- lator with alcohol. Using a sterile Pasteur pipette and without touching the edges of the cryoprobe, transfer the cell suspension in the bottle to 10 ml of cold medium. Centrifuge at 200-300 x G for 5-10 minutes. The supernatant is aspirated and the tablet is resuspended in 6 ml of medium for HT cloning (supra). It is transferred to a cavity of a 6-well plate. Viability is evaluated after 24 hours. The viability must not be less than 50%.

EXAMPLE 48 Test for angiogenic protein activity in vi tro The following test is designed to detect the activity of the angiogenic protein, preferably the activity of VEGF-2. For example, a chimeric receptor is generated by fusing the nucleotides encoding the extracellular domain of the Flt-4 receptor (SEQ ID NO: 27) (Galland et al., Genomics 13 (2): 475-478 (1992), incorporated in the present invention for reference in its entirety), with the nucleotides coding for the transmembrane domain and for the intracellular domain of Flk-1 (SEQ ID NO: 28) (Davis-Smith et al., EMBO J 15 (18) : 4919-4927 (1996), which is incorporated in the present invention for reference in its entirety). Therefore, the chimeric receptor will include amino acids 1 to 775 of SEQ ID NO: 27, fused to amino acids 765 to 1356 of SEQ ID NO: 28, respectively. Alternatively, the chimeric receptor can be designed as indicated above, but the transmembrane and intracellular erythropoietin receptor (EPOR) domains could be substituted for the transmembrane and intracellular domains of the Flk-1 receptor, as discussed in Pacifici et al., JBC 269 (3): 1571-1574 (1994), which is incorporated in the present invention for reference in its entirety (see specifically figure 1). The resulting DNA encoding the chimeric receptor is cloned into an appropriate mammalian, baculovirus, or bacterial expression vector, such as, for example, pC4, pCDNA3, or pA2, as discussed supra. Mammalian host cells that can be used for the expression of the chimeric receptor include NIH3T3 (supra), or the BaF3 pre-B cell line (Achen et al., PNAS 95 (2): 548-553 (1998), which is incorporated in the present invention for reference in its entirety). To evaluate the activity, the angiogenic protein can be contacted with a line of cells expressing the chimeric receptor, or with extracts thereof. Then, the angiogenic protein that binds to the chimeric receptor can be detected by measuring any resulting signal transduced by the chimeric receptor. It will be apparent that the invention can be practiced in some other way than that which is particularly described in the description and examples above. Numerous modifications and variations of the present invention are possible in the light of the foregoing teachings and, therefore, fall within the scope of the appended claims. The complete description of each document cited (including patents, patent applications, articles of scientific publications, abstracts, laboratory manuals, books, or other descriptions) in the Background of the Invention, Detailed Description, and Examples are incorporated in the present invention for reference. In addition, the sequence listing of the present invention is incorporated for reference. In addition, the Application E.U.A Serial No.. 08 / 207,412, currently issued as Patent E.U.A. No. 5,817,485, and 08 / 803,926 are incorporated for reference in their entirety. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

LIST OF SEQUENCES < 110 > Human Genome Sciences, Inc. , et al < 120 > Angiogenic Proteins and Use of Same < 130 > PF112PCT5 < 140 > Unassigned < 141 > 2000- 06- 01 < 150 > 60/137, 796? < 151 > 1999-06- 03 < 160 > 30 < 170 > Patentln Ver. 2.1 1 < 210 > 1 < 211 > 1308 < 212 > DNA < 213 > Homo sapiens < 400 > 1 tccgcaaata tgcagaatta ccggccgggt cgctcctgaa gccagcgcgg ggaggcagcg 60 ig cggcggcggc cagcaccggg aacgcaccga ggaagaagcc cagcccccgc cctccgcccc 120 ttccgtcccc acccccatcc cggcggccca ggaggctccc cgcgctggcg cgcactccct 180 gtttctcctc ctcctggctg gcgctgcctg cctctccgca ctcactgctc gccgggcgcc 240 gtccgccagc tccgtgctcc ccgcgccacc ctcctccggg ccgcgctccc taagggatgg 300 tactgatttt cgccgccaca ggagaccggc tggagcgccg ccccgcggcc tcgcctctcc 360 tccgagcagc cagcgcctcg ggacgcgatg aggaccttgg cttgcctgct gctcctcggc 420 tgcggatacc tcgcccatgt tctggccgag gaagccgaga tcccccgcga ggtgatcgag 480 aggctggccc gcagtcagat ccacagcatc cgggacctcc agcgactcct ggagatagac 540 tccgtaggga gtgaggattc tttggacacc agcctgagag ctcacggggt ccatgccact 600 aagcatgtgc ccgagaagcg gcccctgccc attcggagga agagaagcat cgaggaagct 660 gtccccgctg tctgcaagac caggacggtc atttacgaga ttcctcggag tcaggtcgac 720 cccacgtccg ccaacttcct gatctggccc ccgtgcgtgg aggtgaaacg ctgcaccggc 780 tgctgcaaca cgagcagtgt caagtgccag ccctcccgcg tccaccaccg cagcgtcaag 840 - ^ 5 gtggccaagg tggaatacgt caggaagaag ccaaaattaa aagaagtcca ggtgaggtta 900 gaggagcatt tggagtgcgc ctgcgcgacc acaagcctga atccggatta tcgggaagag 960 ggcctaggga gacacgggaa gtcaggtaaa aaacggaaaa gaaaaaggtt aaaacccacc 1020 taaagcagcc aaccagatgt gaggtgagga tgagccgcag ccctttcctg ggacatggat 1080 gtacatggcg tgttacattc ctgaacctac tatgtacggt gctttattgc cagtgtgcgg 1140 tctttgttct cctccgtgaa aaactgtgtc cgagaacact cgggagaaca aagagacagt 1200 gcacatttgt ttaatgtgac atcaaagcaa gtattgtagc actcggtgaa gcagtaagaa 1260 gcttccttgt caaaaagaga gagagagaaa agaaaaaaaa aggaattc 1308 < 210 > 2 < 211 > 211 < 212 > PRT 20 < 213 > Homo sapiens < 400 > 2 Met Arg Thr Leu Wing Cys Leu Leu Leu Leu Gly Cys Gly Tyr Leu Wing 1 5 10 15 His Val Leu Wing Glu Glu Wing Glu lie Pro Arg Glu Val lie Glu Arg 20 25 30 Leu Wing Arg- Ser- Gln lie His Ser He Arg Asp Leu Gln Arg- Leu Leu 35 40 45 Glu He Asp Ser Val Gly Ser Glu Asp Ser Leu Asp Thr Ser Leu Arg 50 * 55 60 Wing His Gly Val His Wing Thr Lys His Val Pro Glu Lys Arg Pro Leu 65 70 75 80 Pro He Arg Arg Lys Arg Ser He Glu Glu Wing Val Pro Wing Val Cys 85 90 95 Lys Thr Arg Thr Val He Tyr Glu He Pro Arg Ser Gln Val Asp Pro 100 105 110 Thr Ser Wing Asn Phe Leu He Trp Pro Pro Cys Val Glu Val Lys Arg 115 120 125 Cys Thr Gly Cys Cys Asn Thr Ser Ser Val Lys Cys Gln Pro Ser. Arg 130 135 140 Val His His Arg Ser Val Lys Val Ala Lys Val Glu Tyr Val Arg Lys 145 150 155 160 Lys Pro Lys Leu Lys Glu Val Gln Val Arg Leu Glu Glu His Leu Glu 165 170 175 Cys Wing Cys Wing Thr Thr Ser Leu Asn Pro Asp Tyr Arg Glu Glu Asp 180 185 190 Thr Gly Arg Pro Arg Glu Ser Gly Lys Lys Arg Lys Arg Lys Arg Leu 195 200 205 Lys Pro Thr 210 < 210 > 3 < 211 > 2137 < 212 > DNA < 13 > Homo sapiens < 400 > 3 ccctgcctgc ctccctgcgc acccgcagcc tcccccgctg cctccctagg gctcccctcc 60 ggccgccagc gcccattttt cattccctag atagagatac tttgcgcgca cacacataca 120 aaaaggaaaa tacgcgcgca aaaaaaaaaa aagcccaccc tccagcctcg ctgcaaagag 180 aaaaccggag cagccgcagc tcgcagctcg cagcccgcag cccgcagagg acgcccagag 240 cggcgagcgg gcgggcagac ggaccgacgg actcgcgccg cgtccacctg tcggccgggc 300 ccagccgagc gcgcagcggg cacgccgcgc gcgcggagca gccgtgcccg ccgcccgggc 360 ccgccgccag ggcgcacacg ctcccgcccc cctacccggc ccgggcggga gtttgcacct 420 ctccctgccc gggtgctcga gctgccgttg caaagccaac tttggaaaaa gttttttggg 480 ggagacttgg gccttgaggt gcccagctcc gcgctttccg attttggggg cctttccaga 540 aaaaagctaa aaatgttgca gccggcgggc agaggaaaac gcctgtagcc ggcgagtgaa 600 gacgaaccat cgactgccgt gttccttttc ctcttggagg ttggagtccc ctgggcgccc 660 ccacacggct agacgcctcg gctggttcgc gacgcagccc cccggccgtg gatgctgcac 720 tcgggctcgg gatccgccca ggtagcggcc tcggacccag gtcctgcgcc caggtcctcc 780 cctgcccccc agcgacggag ccggggccgg gggcggcggc gccgggggca tgcgggtgag 840 ccgcggctgc agaggcc tga gcgcctgatc gccgcggacc cgagccgagc ccacccccct 900 ccccagcccc ccaccctggc cgcgggggcg gcgcgctcga tctacgcgtt cggggccccg 960 cggggccggg cccggagtcg gcatgaatcg ctgctgggcg ctcttcctgt ctctctgctg 1020 ctacctgcgt ctggtcagcg ccgaggggga ccccattccc gaggagcttt atgagatgct 1080 gagtgaccac tcgatccgct cctttgatga tctccaacgc ctgctgcacg gagaccccgg 1140 agaggaagat ggggccgagt tggacctgaa catgacccgc tcccactctg gaggcgagct 1200 ggagagcttg gctcgtggaa gaaggagcct gggttccctg accattgctg agccggccat 1260 gatcgccgag tgcaagacgc gcaccgaggt gttcgagatc tcccggcgcc tcatagaccg 1320 caccaacgcc aacttcctgg tgtggccgcc ctgtgtggag gtgcagcgct gctccggctg 1380 ctgcaacaac cgcaacgtgc agtgccgccc cacccaggtg cagctgcgac ctgtccaggt 1440 gagaaagatc gagattgtgc ggaagaagcc aatctttaag aaggccacgg tgacgctgga 1500 agaccacctg gcatgcaagt gtgagacagt ggcagctgca cggcctgtga cccgaagccc 1560 ggggggttcc caggagcagc gagccaaaac gccccaaact cgggtgacca ttcggacggt 1620 cggcccccca gcgagtccgc agggcaagca ccggaaattc aagcacacgc atgacaagac 1680 ggcactgaag gagacccttg gagcctaggg gcatcggcag gagagtgtgt gggcagggtt 1740 atttaatatg gtatttgctg tattgccccc atggggcctt ggagtagata atattgtctc 1800 cctcgtccgt ctgtctcgat gcctgattcg gacggccaat ggtgcctccc ccacccctcc 1860 acgtgtccgt ccacccttcc atcagcgggt ctcctcccag cggcctccgg ctcttgccca 1920 gcagctcaag aagaaaaaga aggactgaac tccatcgcca tcttcttccc ttaactccaa 1980 gaactt ggga taagagtgtg agagagactg atggggtcgc tctttggggg aaacgggttc 2040 cttcccctgc acctggcctg ggccacacct gagcgctgtg gactgtcctg aggagccctg 2100 aggacctctc agcatagcct gcc'tgatccc tgaaccc 2137 < 210 > 4 < 211 > 241 < 212 > PRT < 213 > Homo sapiens < 400 > 4 Met Asn Arg Cys Trp Wing Leu Phe Leu Ser Leu Cys Cys Tyr Leu Arg 1 5 10 15 Leu Val Ser Wing Glu Gly Asp Pro He Pro Glu Glu Leu Tyr Glu Met 20 25 30 Leu Ser Asp His Ser He Arg Ser Phe Asp Asp Leu Gln Arg Leu Leu 35 40 45 His Gly Asp Pro Gly Glu Glu Asp Gly Wing Glu Leu Asp Leu Asn Met 50 55 60 Thr Arg Ser His Ser Gly Glu Glu Leu Glu Ser Leu Wing Arg Gly Arg 65 70 75 80 Arg Ser Leu Gly Ser Leu Thr He Wing Glu Pro Wing Met He Wing Glu 85 90 95 Cys Lys Thr Arg Thr Glu Val Phe Glu He Ser Arg Arg Leu He Asp 100 ios no Arg Thr Asn Wing Asn Phe Leu Val Trp Pro Pro Cys Val Glu Val Gln 115 120 125 Arg Cys Ser Gly Cys Cys Asn Asn Arg Asn Val Gln Cys Arg Pro Thr 130 135 140 Gln Val Gln Leu Arg Pro Val Gln Val Arg Lys He Glu He Val Arg 145 150 155 160 Lys Lys Pro He Phe Lys Lys Wing Thr Val Thr Leu Glu Asp His Leu 165 170 175 Wing Cys Lys Cys Glu Thr Val Wing Wing Wing Arg Pro Val Thr Arg Ser 180 185 iso Pro Gly Gly Ser Gln Glu Gln Arg Wing Lys Thr Pro Gln Thr Arg Val 195 200 205 Thr He Arg Thr Val Arg Val Arg Arg Pro Pro Lys Gly Lys His Arg 210 215 220 Lys Phe Lys His Thr His Asp Lys Thr Wing Leu Lys Glu Thr Leu Gly 225 230 235 240 Wing < 210 > 5 < 211 > 1645 < 212 > DNA < 213 > Homo sapiens < 400 > 5 gggattcggg ccgcccagct acgggaggac ctggagtggc actgggcgcc cgacggacca 60 tccccgggac ccgcctgccc ctcggcgccc cgccccgccg ggccgctccc cgtcgggttc 120 gccttaccta cccagccaca cgggctcctg actccgcaag gcttccagaa gatgctcgaa 180 ccaccggccg gggcctcggg gcagcagtga gggaggcgtc cagcccccca ctcagctctt 240 ctcctcctgt gccaggggct ccccggggga tgagcatggt ggttttccct cggagccccc 300 cgtctgagaa tggctcggga gatgccggtc atgaggctgt tcccttgctt cctgcagctc 360 ctggccgggc tggcgctgcc tgctgtgccc ccccagcagt gggccttgtc tgctgggaac 420 ggctcgtcag aggtggaagt ggtacccttc caggaagtgt ggggccgcag ctactgccgg 480 ggctggtgga gcgctggaga gagtacccca cgtcgtgtcc gcgaggtgga gcacatgttc 540 agcccatcct gtgtctccct gctgcgctgc accggctgct gcggcgatga gaatctgcac 600 tgtgtgccgg tggagacggc caatgtcacc atgcagctcc taaagatccg ttctggggac 660 cggccctcct acgtggagct gacgttctct cagcacgttc gctgcgaatg ccggcctctg 720 tgaagccgga cgggagaaga aaggtgcggc gatgctgttc cccggaggta acccacccct 780 tggaggagag agaccccgca cccggctcgt gtatttatta ccgtcacact cttcagtgac 840 tcctgctggt acctgc cctc tatttattag ccaactgttt ccctgctgaa tgcctcgctc 900 ccttcaagac gaggggcagg gaaggacagg accctcagga attcagtgcc ttcaacaacg 960 tgagagaaag agagaagcca gccacagacc cctgggagct tccgctttga aagaagcaag 1020 acacgtggcc tcgtgagggg caagctaggc cccagaggcc ctggaggtct ccaggggcct 1080 gcagaaggaa agaagggggc cctgctacct gttcttgggc ctcaggctct gcacagacaa 1140 gcagcccttg ctttcggagc tcctgtccaa agtagggatg cggattctgc tggggccgcc 1200 acggcctggt ggtgggaagg ccggcagcgg gcggagggga ttcagccact tccccctctt 1260 cttctgaaga tcagaacatt cagctctgga gaacagtggt tgcctggggg cttttgccac 1320 tccttgtccc ccgtgatctc ccctcacact ttgccatttg cttgtactgg gacattgttc 1380 tttccggccg aggtgccacc accctgcccc cacatacaga cactaagaga gtgggccccg 1440 ggctggagaa agagctgcct ggatgagaaa cagctcagcc agtggggatg aggtcaccag 1500 gggaggagcc tgtgcgtccc agctgaaggc agtggcaggg gagcaggttc cccaagggcc 1560 ctggcacccc cacaagctgt ccctgcaggg ccatctgact gccaagccag attctcttga 1620 1645 ataaagtatt ctagtgtgga aacgc < 210 > 6 < 211 > 149 < 212 > PRT < 2 3 > Ho or sapiens < 400 > 6 Met Pro Val Met Arg Leu Phe Pro Cys Phe Leu Gln Leu Leu Ala Glv 1 5? Or 15 Leu Ala Leu Pro Ala Val Pro Pro Gln ßln Trp Ala Leu Ser Ala Gly 20 2S 30 Asn Gly Ser Glu Val Val Glu Val Phe Gln Glu Val Trp Gly 35 40 45 Arg Ser Tyr Cys Arg Ala Leu Glu Arg Leu Val Asp Val Val Ser Glu 50 55 60 Tyr Pro Ser Glu Val Glu His Met Phe Ser Pro Ser Cys Val Ser Leu 65 70 75 80 Leu Arg Cys Thr Gly Cys Cys Gly Asp Glu Asn Leu His Cys Val Pro 85 90 95 Val Glu Thr Wing Asn Val Thr Met Gln Leu Leu Lys He Arg Ser Gly 100 05 110 Asp Arg Pro Ser Tyr Val Glu Leu Thr Phe Ser Gln His Val Arg Cys 115 120 125 Glu Cys Arg Pro Leu Arg Glu Lys Met Lys Pro Glu Arg Cys Gly Asp 130 135 140 Wing Val Pro Arg Arg 145 < 210 > 7 < 211 > 597 < 212 > DNA < 213 > Homo sapiens < 400 > 7 acgtctgaga agatgccggt catgaggctg ttcccttgct tcctgcagct gctggccggg 60 ctggcgctgc ctgctgtgcc cccccagcag tgggccttgt cggctcgtca ctgctgggaa 120 gaggtggaag tggtaccctt ccaggaagtg tggggccgca gctactgccg ggcgctggag 180 aggctggtgg acgtcgtgtc cgagtacccc agcgaggtgg agcacatgtt cagcccatcc 240 tgtgtctccc tgctgcgctg caccggctgc tgcggcgatg aggatctgca ctgtgtgccg 300 gtggagacgg ccaatgtcac catgcagctc ctaaagatcc gttctgggga ccggccctcc 360 tacgtggagc tgacgttctc tcagcacgtt cgctgcgaat gccggcctct gcgggagaag 420 atgaagccgg aaaggaggag acccaagggc agggggaaga ggaggagaga gaaccagaga 480 cccacagact gccacctgtg cggcgatgct gttccccgga ggtaacccac cccttggagg 540 agagagaccc cgcacccggc tcgtgtattt attaccgtca cactcttcag tgactcc 597 < 210 > ß < 211 > 170 < 212 > PRT < 213 > Homo sapiens < 400 > 8 Met Pro Val Met Arg Leu Phe Pro Cys Phe Leu Gln Leu Leu Ala Gly 1 5? Or 15 Leu Ala Leu Pro Ala Val Pro Pro Gln Gln Trp Ala Leu Ser Ala Gly 20 25 30 Asn Gly Ser Ser Glu Val Glu Val Val Pro Phe Gln Glu Val Trp Gly 40 45 Arg Ser Tyr Cys Arg Ala Leu G Slluu AArrgg LLeeuu VVaall AAsspp Val Val Val Ser 55 60 i ^ i ^, AA¿J AJAtjj »- ** '- - - - * - - - - .-. - .. tAAt ^ -tA ^ .A .-. Ar A ».» »Tyr Pro Ser Glu Val Glu His Met Phe Ser Pro Ser Cys Val Ser Leu 65 70 75 80 Leu Arg Cys Thr Gly Cys Cys Gly Asp Glu Asp Leu His Cys Val Pro 85 90 95 Val Glu Thr Ala Asn Val Thr Met Gln Leu Leu Lys He Arg Ser Gly 100 OS 110 Asp Arg Pro Ser Tyr Val Glu Leu Thr Phe Ser Gln His Val Arg Cys 115 120 125 Glu Cys Arg Pro Leu Arg Glu Lys Met Lys Pro Glu Arg Arg Arg Pro 130 135 140 Lys Gly Arg Gly Lys Arg Arg Arg Glu Lys Gln Arg Pro Thr Asp Cys 145 150 155 160 His Leu Cys Gly Asp Ala Val Pro Arg Arg 165 170 < 210 > 9 < 211 > 577 < 212 > DNA < 213 > Homo sapiens < 400 > 9 aaccatgaac tttctgctct cttgggtgca ctggaccctg gctttactgc tgtacctcca 60 ccatgccaag tggtcccagg ctgcacccac gacagaaggg gagcagaaag cccatgaagt 120 ggtgaagttc atggacgtct accagcgcag ctat.tgccgt ccgattgaga ccctggtgga 180 catcttccag gagtaccccg atgagataga gtatatcttc aagccgtcct gtgtgcccct 240 aatgcggtgt gcgggctgct gcaatgatga agccctggag tgcgtgccca cgtcggagag 300 caacgtcact atgcagatca tgcggatcaa acctcaccaa agccagcaca taggagagat 360 gagcttcctg cagcatagca gatgtgaatg cagaccaaag aaagatagaa caaagccaga 420 aaatcactgt gagccttgtt cagagcggag aaagcatttg tttgtccaag atccgcagac 480 gtgtaaatgt tcctgcaaga acacagactc gcgttgcaag gcgaggcagc ttgagttaaa 540 cgaacgtact tgcagatgtg acaagccaag gcggtga 577 < 210 > 10 < 211 > 190 < 212 > PRT < 213 > Homo sapiens < 400 > 10 Met Asn Phe Leu Leu Ser Trp Val His Trp Thr Leu Wing Leu Leu Leu 1 5 10 15 Tyr Leu His His Wing Lys Trp Ser Gln Wing Wing Pro Thr Thr Glu Gly 20 25 30 Glu Gln Lys Wing His Glu Val Val Lys Phe Met Asp Val Tyr Gln Arg 35 40 45 Ser Tyr Cys Arg Pro He Glu Thr Leu Val Asp He Phe Gln Glu Tvr 50 S5 60 Pro Asp Glu He Glu Tyr He Phe Lys Pro Ser Cys Val Pro Leu Met 65 70 75 80 Arg Cys Wing Gly Cys Cys Asn Asp Glu Wing Leu Glu Cys Val Pro Thr 85 90 95 Ser Glu Ser Asn Val Thr Met Gln He Met Arg He Lys Pro His Gln 100 105 110 Ser Gln His He Gly Glu Met Ser Phe Leu Gln His Be Arg Cys Glu 115 120 125 Cys Arg Pro Lys Lys Asp Arg Thr Lys Pro Glu Asn His Cys Glu Pro 130 135 140 Cys Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp Pro Gln Thr Cys 145 150 155 160 Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys Wing Arg Gln Leu 165 170 175 Glu Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys Pro Arg Arg 180 185 190 < 210 > 11 < 211 > 989 < 212 > DNA < 213 > Homo sapiens < 400 > 11 cagtgtgctg gcggcccggc gcgagccggc ccggccccgg tcgggcctcc gaaccatgaa 60 ctttctgctg tcttgggtgc attggagcct cgccttgctg ctctacctcc accatgccaa 120 gtggtcccag gctgcaccca tggcagaagg aggagggcag aatcatcacg aagtggtgaa 180 gttcatggat gtctatcagc gcagctactg ccátccaatc gagaccctgg tggacatctt 240 ccaggagtac cctgatgaga tcgagtacat cttcaagcca tcctgtgtgc ccctgatgcg 300 atgcgggggc tgctgcaatg acgagggcct ggagtgtgtg cccactgagg agtccaacat 360 attatgcgga caccatgcag tcaaacctca ccaaggccag cacataggag agatgagctt 420 cctacagcac aacaaatgtg aatgcagacc aaagaaagat agagcaagac aagaaaatcc 480 - ctgtgggcct ggagaaagca tgctcagagc tttgtttgta caagatccgc agacgtgtaa 540 atgttcctgc aaaaacacag actcgcgttg caaggcgagg cagcttgagt taaacgaacg 600 tacttgcaga tgtgacaagc cgaggcggtg agccgggcag gaggaaggag cctccctcag 660 ggtttcggga accagatctc tcaccaggaa agactgatac agaacgatcg atacagaaac 720 cacgctgccg ccaccacacc atcaccatcg acagaacagt gaaacctgaa ccttaatcca 780 atgaaggaag aggagactct gcgcagagca ctttgggtcc ggagggcgag actccggcgg 840 aagcattccc gggcgggtga cccagcacgg tccctcttgg aattggattc gccattttat 900 ttttcttgct gctaaatcac cgagcccgga agattagaga gttttatttc tgggattcct 960 gtagacacac cgcggccgcc agcacactg 989 < 210 > 12 < 211 > 191 < 212 > PRT < 213 > Homo sapiens < 400 > 12 Me Leu Tyr Leu His His Wing Lys Trp Ser Gln Ala Wing Pro Met Wing Glu Gly 20 25 30 Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val Tyr Gln 35 40 45 Arg Ser Tyr Cys His Pro He Glu Thr Leu Val Asp He Phe Gln Glu 50 55 60 Tyr Pro Asp Glu He Glu Tyr He Phe Lys Pro Ser Cys Val Pro Leu 65 70 75 80 Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro 85 90 95 Tlir Glu Glu Be Asn He Thr Met Gln He Met Arg He Lys Pro His 100 105 110 Gln Gly Gln His He Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys 115 120 125 Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Asn Pro Cys Gly 130 135 140 Pro Cys Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp Pro Gln Thr 145 150 155 160 Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys Ala Arg Gln 165 170 175 Leu Glu Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys Pro Arg Arg 180 185 190 < 210 > 13 < 211 > 649 < 212 > DNA < 213 > Homo sapiens < 400 > 13 aaccatgaac tttctgctct cttgggtgca ctggaccctg gctttactgc tgtacctcca 60 ccatgccaag tggtcccagg ctgcacccac gacagaaggg gagcagaaag cccatgaagt 120 ggtgaagttc atggacgtct accagcgcag ctattgccgt ccgattgaga ccctggtgga 180 catcttccag gagtaccccg atgagataga gtatatcttc aagccgtcct gtgtgcccct 240 aatgcggtgt gcgggctgct gcaatgatga agccctggag tgcgtgccca cgtcggagag 300 caacgtcact atgcagatca tgcggatcaa acctcaccaa agccagcaca taggagagat 360 gagcttcctg cagcatagca gatgtgaatg cagaccaaag aaagatagaa caaagccaga 420 aaaaaaatca gttcgaggaa agggaaaggg aagcgcaaga tcaaaaacga aatcccggtt 480 taaatcctgg agagttcact gtgagccttg ttcagagcgg agaaagcatt tgtttgtcca 540 agatccgcag acgtgtaaat gttcctgcaa aaacacagac aggcgaggca tcgcgttgca 600 aacgaacgta gcttgagtta cttgcagatg tgacaagcca aggcggtga 649 < 210 > 14 < 211 > 214 < 212 > PRT < 213 > Homo sapiens < 400 > 14 Met Asn Phe Leu Leu Ser Trp Val His Trp Thr Leu Wing Leu Leu Leu 5 10 15 Tyr Leu His His Wing Lys Trp Ser Gln Wing Wing Pro Thr Thr Glu Gly 20 25 30 Glu Gln Lys Wing His Glu Val Val Lys Phe Met Asp Val Tyr Gln Arg ÍM ^^ ^^^ * ^ 3 ^ * ^ -'-- ^ --- ^^^ --- ** ^ * 5 ^ - ** • "£ *** - **** - * - * - .i á 35 40 45 Ser Tyr Cys Arg Pro He Glu Thr Leu Val Asp He Phe Gln Glu Tyr 50 55 60 Pro Asp Glu He Glu Tyr He Phe Lys Pro Ser Cys Val Pro Leu Met 65 70 75 80 Arg Cys Wing Gly Cys Cys Asn Asp Glu Wing Leu Glu Cys Val Pro Thr 85 90 95 Ser Glu Ser Asn Val Thr Met Gln He Met Arg He Lys Pro His Gln 100 105 110 Ser Gln His He Gly Glu Met Ser Phe Leu Gln His Be Arg Cys slu 115 120 125 Cys Arg Pro Lys Lys Asp Arg Thr Lys Pro slu Lys Lys Ser Val Arg 130 135 140 Oly Lys sly Lys Gly Gln Lys Arg Lys Arg Lys Lys Ser Arg Phe Lys 145 150 155 160 Be Trp Arg Val His Cys Glu Pro Cys Ser Glu Arg Arg Lys His Leu 165 170 175 Phe Val Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp 180 185 190 Ser Arg Cys Lys Ala Arg Gln Leu slu Leu Asn Glu Arg Thr Cys Arg 195 200 205 Cys Asp Lys Pro Arg Arg 210 < 210 > 15 < 211 > 1674 < 212 > DNA < 213 > Homo sapiens < 400 > 15 gtccttccac catgcactcg ctgggcttct tctctgtggc gtgttctctg ctcgccgctg 60 cgctgctccc gggtcctcgc gaggcgcccg ccgccgccgc cgccttcgag tccggactcg 120 acctctcgga cgcggagccc gacgcgggcg aggccacggc ttatgcaagc aaagatctgg 180 aggagcagtt acggtctgtg tccagtgtag atgaactcat gactgtactc tacccagaat 240 attggaaaat gtacaagtgt cagctaagga aaggaggctg gcaacataac agagaacagg 300 ctcaaggaca ccaacctcaa gaagagacta taaaatttgc tgcagcacat tataatacag 360 aagtattgat agatcttgaa aatgagtgga gaaagactca atgcatgcca cgggaggtgt 420 gtatagatgt ggggaaggag tttggagtcg cgacaaacac cttctttaaa cctccatgtg 480 tgtccgtcta cagatgtggg ggttgctgca atagtgaggg gctgcagtgc atgaacacca 540 gcacgagcta cctcagcaag acgttatttg aaattacagt gcctctctct caaggcccca 600 aaccagtaac aatcagtttt gccaatcaca cttcctgccg atgcatgtct aaactggatg 660 tttacagaca agttcattcc attattagac gttccctgcc agcaacacta ccacagtgtc 720 aggcagcgaa caagácctgc cccaccaatt acatgtggaa taatcacatc tgcagatgcc 780 tggctcagga agattttatg ttttcctcgg tgactcaaca atgctggaga gatggattcc 840 atgacatctg tggaccaaac aaggagctgg atgaagagac ctgtcagtgt gtctgcagag 900 cggggcttcg gcctgccagc tgtggacccc acaaagaact agacagaaac tcatgccagt 960 gtgtctgtaa aaacaaactc ttccccagcc aatgtggggc tttgatgaaa caaccgagaa 1020 gtgtgtatgt acacatgcca aaaagaacct gccccagaaa tcaaccccta aatcctggaa 1080 aatgtgcctg tgaatgtaca gaaagtccac agaaatgctt gttaaaagga aagaagttcc 1140 accaccaaac atgcagctgt tacagacggc catgtacgaa ccgccagaag gcttgtgagc 1200 atatagtgaa caggattttc gaagtgtgtc gttgtgtccc ttcatattgg caaagaccac 1260 aaatgagcta agattgtact gttttccagt tcatcgattt tctattatgg aaaactgtgt 1320 tgccacagta gaactgtctg tgaacagaga gacccttgtg ggtccatgct aacaaagaca 1380 aaagtctgtc tttcctgaac catgtggata actttacaga aatggactgg agctcatctg 1440 cttgtaaaga caaaaggcct ctggttttct gccaatgacc aaacagccaa gattttcctc 1500 tttaaaagaa ttgtgatttc tgactatata atttatttcc actaaaaata ttgtttctgc 1560 attcattttt atagcaacaa caattggtaa aactcactgt gatcaatatt tttatatcat 1620 gcaaaatatg tttaaaataa aatgaaaatt gtatttataa aaaaaaaaaa aaaa 1674 < 210 > 16 < 211 > 419 < 212 > PRT < 213 > Homo sapiens < 400 > 16 Met His Ser Leu Gly Phe Phe Ser Val Ala Cys Ser Leu Leu Ala Ala 1 5 10 15 Ala Leu Leu Pro Gly Pro Arg Glu Ala Pro Ala Ala Ala Ala Ala Ala Phe 20 25 30 Olu Ser sly Leu Asp Leu Ser Asp Ala Glu Pro Asp Wing Gly Glu Wing 35 40 45 Thr Wing Tyr Wing Ser Lys Asp Leu slu slu Gln Leu Arg Ser Val Ser 50 55 60 Ser Val Asp Glu Leu Met Thr Val Leu Tyr Pro Glu Tyr Trp Lys Met 65 70 s 75 80 Tyr Lys Cys Gln Leu Arg Lys Oly sly Trp Gln His Asn Arg Glu Gln 85 90 95 Wing Asn Leu Asn Ser Arg Thr slu slu Thr He Lys Phe Wing Wing 100 105 no His Tyr Asn Thr slu He Leu Lys Ser He Asp Asn slu Trp Arg Lys US 120 125 Thr sln Cys Met Pro Arg slu Val Cys He Asp Val sly Lys slu Phe 130 135 140 Oly Val Wing Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr 145 150 155 160 Arg Cys Gly Gly Cys Cys Asn Ser Glu Gly Leu Gln Cys Met Asn Thr 65 170 175 Ser Thr Ser Tyr Leu Ser Lys Thr Leu Phe slu He Thr Val Pro Leu 80 185 190 Ser Oln sly Pro Lys Pro Val Thr He Ser Phe Ala Asn His Thr Ser 195 200 205 Cys Arg Cys Met Ser Lys Leu Asp Val Tyr Arg Gln Val His Ser He 210 215 220 He Arg Arg Ser Leu Pro Wing Thr Leu Pro Gln Cys Gln Wing Ala Asn 225 230 235 240 Lys Thr Cys Pro Thr Asn Tyr Met Trp Asn Asn His He Cys Arg Cys 245 250 255 Leu Wing Sln Glu Asp Phe Met Phe Ser Ser Asp Wing Gly Asp Asp Ser 260 265 270 Thr Asp Gly Phe His Asp He Cys Gly Pro Asn Lys slu Leu Asp Glu 275 280 285 Glu Thr Cys Gln Cys Val Cys Arg Wing Gly Leu Arg Pro Wing Ser Cys 290 295 300 Gly Pro His Lys Glu Leu Asp Arg Asn Ser Cys Gln Cys Val Cys Lys 305 310 315 320 Asn Lys Leu Phe Pro Ser Gln Cys Gly Wing Asn Arg Glu Phe Asp Glu 325 330 335 Asn Thr Cys Gln Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gln Pro 340 34S 350 Leu Asn Pro Gly Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gln Lys 355 360 365 Cys Leu Leu Lys sly Lys Lys Phe His His Gln Thr Cys Ser Cys Tyr 370 375 380 Arg Arg Pro Cys Thr. Asn Arg Gln Lys Ala Cys slu Pro sly Phe Ser 385 390 395 400 Tyr Ser Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Gln Arg Pro 405 410 415 sln Met Ser < 210 > 17 < 211 > 624 < 212 > DNA < 213 > Homo sapiens < 400 > 17 atgagccctc tgctccgccg cctgctgctc gccgcactcc tgcagctggc ccccgcccag 60 gcccctgtct cccagcctga tgcccctggc caccagagga aagtggtgtc atggatagat 120 gtgtatactc gcgctacctg ccagccccgg gaggtggtgg tgcccttgac tgtggagctc 180 atgggcaccg tggccaaaca gctggtgccc agctgcgtga ctgtgcagcg ctgtggtggc 240 tgctgccctg acgatggcct ggagtgtgtg cccaccgggc agcaccaagt ccggatgcag 300 atcctcatga tccggtaccc gagcagtcag ctgggggaga tgtccctgga agaacacagc 360 cagtgtgaat gcagacctaa aaaaaaggac agtgctgtga agccagacag ggctgccact 420 ccccaccacc gtccccagcc ccgttctgtt ccgggctggg actctgcccc cggagcaccc 480 tccccagctg acatcaccca tcccactcca gccccaggcc cctctgccca cgctgcaccc 540 agcaccacca gcgccctgac ccccggacct gccgccgccg ctgccgacgc cgcagcttcc 600 tccgttgcca agggcggggc ttag 624 < 210 > 18 < 211 > 207 < 12 > PRT < 213 > Homo sapiens < 400 > 18 Met Ser Pro Leu Leu Ars Arg Leu Leu Leu Ala Ala Leu Leu sln Leu 1 S 1 15 Ala Pro Ala Gln Ala Pro Val Ser Gln Pro Asp Ala Pro Gly His sln 20 25 30 Arg Lys Val Val Ser Trp He Asp Val Tyr Thr Arg Wing Thr Cys Gln 35 40 4S Pro Arg Glu Val Val Pro Pro Leu Thr Val Glu Leu Met Gly Thr Val 50 55 60 Wing Lys sln Leu Val Pro Ser Cys Val Thr Val Gln Arg Cys Gly Gly 65 70 75 80 Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gln His Gln 85 90 95 Val Arg Met Gln He Leu Met He Arg Tyr Pro Ser Ser Gln Leu Gly 100 105 HO Glu Met Ser Leu Glu Glu His Ser Gln Cys slu Cys Arg Pro Lys Lys 115 120 125 Lys Asp Ser Wing Val Lys Pro Asp Arg Ala Wing Thr Pro His His Arg 130 135 '140 Pro sln Pro Arg Ser Val Pro Gly Trp Asp Ser Wing Pro Gly Wing Pro 145 150 v 155 160 Ser Pro Wing Asp He Thr Pro His Pro Thr Pro Wing Pro Gly Pro Wing 165 170 175 His Wing Wing Pro Ser Thr Thr Wing Wing Pro Pro Gly Pro Wing Wing 180 185 190 Wing Wing Wing Wing Wing Wing Wing Wing Gly Gly Wing 195 200 205 < 210 > 19 < 211 > 2846 < 212 > DNA < 13 > Homo sapiens < 400 > 19 ggaattcagt gaagtaagaa agacaaagtg ttcattggag atttttagta aggggccaac 60 agagctgcta aagtcatgct tcacttaacg atggggatat gttcggagaa atgcattgtt 120 aggtgatttt gtcgttgtgc aagcatctta gagtacactt agacaaacct agctggtata 180 acctaggtgt gtagtaggat atatggtata gcctattgtt cctaggctac aaacccatac 240 agcatgttcc tgtactgaat actgaggcaa ctgcaacacc gtggtgagta tttgtgtatc 300 taaacatacc taaacataga aaagatacag taaaaatatg gcattatagt cttatgggac 360 tactgtcata catacagtcc atatattgtt gactgtgtaa tgttgacctg aatgtcatta 420 tgtggcaggc acatgactgt gtcgctaacc tttgcacaag attactgtag gattacatga 480 gatagttgta aataattggt ggggtactgg gcacctagta ggtatgcata catgttcacc 540 atcattatgg ttgttttaaa tcacctaacc caggccctgc acatagtaag acatcaacaa 600 attgtagctg ctactatttt gcgcatctaa tcttaatatc atttattttg tagtccttgg 660 atgttccctc ctttatgact tctttttttt ttgttgtcct tcctttagcc ctccatcctc 720 tacagctcag catcagaaca ctctcttttt agactccgat atggggtcct ccaagaaagt 780 , a ^ .f? .. A & A. .A * A.r? ** ~ ..tAmM »mA? .AAA- *. * A ZAttOllßltm tactctctca gtgctcagcc gggagcagtc ggaaggggtt ggagcgaggg tccggagaag 840 cccgagttaa cattggcaga aaaatctgga tccgttttta ctgtttgatg aatttaaagg 900 aggtagacca ggaggatttc ctgatcatcc acatcgaggt tttgaaacag tatcctacct 960 cctggaaggg ggcagcatgg cttctgtgga cccatgaaga cacactggta aaatgaaccc 1020 aggagatttg cagtggatga ctgcgggccg gggcattctg cacgctgaga tgccttgctc 1080 agaggagcca gcccatggcc tacaactgtg ggttaatttg aggagctcag agaagatggt 1140 ggagcctcag taccaggaac tgaaaagtga agaaatccct aaacccagta aggatggtgt 1200 gacagttgct gtcatttctg gagaagccct gggaataaag tccaaggttt acactcgcac 1260 accaacctta tatttggact tcaaattgga cccaggagcc aaacattccc aacctatccc 1320 taaagggtgg acaagcttca tttacacgat atctggagat gtgtatattg ccctctctat 1380 atcccagcac aggtatgccc agggcagggt gcctttcagc ttacagaaca ttcagtgagg 1440 gaagagaata tgaacaccag tcatgacaca tcctgtgcac agatgaaagt ccaggcacca 1500 ttatgtgttt tgatacctcg ctaagacgtt ggcaacctcc atactgataa agggatggag 1560 ctacagtgga ctccaagggg agcaggaatc tgcctatctc ctgggagaag gaaatgga ag 1620 tgatgcacaa gagggcccga caaaaaatag aacctcatca cacagcagtg cttggagaag 1680 gtgacagtgt ccaagtggag aacaaggatc ccaagagaag ccactttgtc ttaattgctg 1740 aagagaacca gggagccatt gttatccaac atgcgatcat ctcagtccac attggaacga 1800 tctgaacagc agatcagggc tgcttctagt ttggaggaac tacttcgaat tactcactct 1860 gaggactgga agctgtggag atgcaggctg aggctcaaaa gttttaccag tatggactct 1920 cgctcagcat cccatcggtc cactaggttt gcggcaactt tctatgacat tgaaacacta 1980 aaagttatag atgaagaatg gcaaagaact cagtgcagcc ctagagaaac gtgcgtggag 2040 gtggccagtg agctggggaa gagtaccaac acattcttca agcccccttg tgtgaacgtg 2100 ttccgatgtg gtggctgttg caatgaagag agccttatct gtatgaacac cagcacctcg 2160 aacagctctt tacatttcca tgagatatca gtgcctttga catcagtacc tgaattagtg 2220 cctgttaaag ttgccaatca tacaggttgt aagtgcttgc caacagcccc ccgccatcca 2280 tactcaatta tcagaagatc catccagatc cctgaagaag atcgctgttc ccattccaag 2340 aaactctgtc ctattgacat gctatgggat agcaacaaat gtaaatgtgt tttgcaggag 2400 gaaaatccac tcgctggaac agaagaccac tctcatctcc aggaaccagc tctctgtggg 246 0 ccacacatga tgtttgacga agatcgttgc gagtgtgtct gtaaaacacc atgtcccaaa 2520 gatctaatcc agcaccccaa aaactgcagt tgctttgagt gcaaagaaag tctggagacc 2580 agcacaagct tgctgccaga atttcaccca gctgtgagga gacacctgca cagatgcccc 2640 tttcatacca gaccatgtgc aagtggcaaa acágcatgtg caaagcattg ccgctttcca 2700 gggctgccca aaggagaaaa ggggccccac agccgaaaga atccttgatt cagcgttcca 2760 agttccccat ccctgtcatt tttaacagca tgctgctttg ccaagttgct gtcactgttt 2820 2846 tgttaaaaaa ttttcccagg aaaaaa < 210 > 20 < 211 > 325 < 212 > PRT < 213 > Homo sapiens < 400 > 20 Met Arg Be Ser Gln Ser Thr Leu Glu Arg Sei Glu Gln Gln He Arg 1 5 10 is Ala Ala Ser Ser Leu Glu Glu Leu Leu Arg He Thr His Ser Glu Asp 20 25 30 Trp Lys Leu Trp Arg Cys Arg Leu Arg Leu Lys Ser Phe Thr Ser Met 35 40 45 Asp Ser Arg Ser Wing His Arg Ser Thr Arg Phe Wing Wing Thr Phe 50 55 60 Tyr Asp He Glu Thr Leu Lys Val He Asp Glu Glu Trp Gln Arg Thr 65 70 75 80 Gln Cys Ser Pro Arg Glu Thr Cys Val Glu Val Wing Ser Glu Leu Gly 85 90 95 Lys Ser Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Asn Val Phe Arg 100 105 110 Cys Gly Gly Cys Cys Asn Glu Glu Ser Leu He Cys Met Asn Thr Ser 115 120 125 Thr Ser Tyr He Ser Lys Gln Leu Phe slu He Ser Val Pro Leu Thr 130 135 140 Ser Val Pro slu Leu Val Pro Val Lys Val Wing Asn His Thr sly Cys 145 150 155 160 Lys Cys Leu Pro Thr Wing Pro Arg His Pro Tyr Ser He He Arg Arg 165 170 175 Ser He Gln He Pro Glu Glu Asp Arg Cys Ser His Ser Lys Lys Leu 180 185 190 Cys Pro He Asp Met Leu Trp Asp Ser Asn Lys Cys Lys Cys Val Leu 195 200 205 Gln Glu Glu Asn Pro Leu Wing Gly Thr Glu Asp His Ser His Leu Gln 210 215 220 slu Pro Wing Leu Cys sly Pro His Met Met Met Phe Asp Glu Asp Arg Cys 225 230 235 240 Glu Cys Val Cys Lys Thr Pro 'Cys Pro Lys Asp Leu He Gln His Pro 245 250 255 Lys Asn Cys Ser Cys Phe Glu Cys Lys Glu Ser Leu Glu Thr Cys Cys 260 265 270 Gln Lys His Lys Leu Phe His Pro Asp Thr Cys Ser Cys Glu Asp Arg 275 280 285 Cys Pro Phe His Thr Arg Pro Cys Wing Ser Gly Lys Thr Wing Cys Wing 290 295 300 Lys His Cys Arg Phe Pro Lys Glu Lys Arg Ala Wing Gln Gly Pro His 305 310 315 320 Ser Arg Lys Asn Pro 325 < 210 > 21 < 211 > 2004 < 212 > DNA < 213 > Homo sapiens < 400 > 21 ccagctttct gtarctgtaa gcattggtgg ccacaccacc tccttacaaa gcaactagaa 60 cctgcggcat gattttttta acattggaga attttctgga caygaagtaa atttagagtg 120 tcaggtagaa ctttcyaatt gacatgtcca ccttctgatt atttttggag aacattttga 180 tttttttcat ctctctctcc ccacccctaa gattgtgcaa aaaaagcgta ccttgcctaa 240 ttgaaataat ttcattggat tttgatcaga actgatcatt tggttttctg tgtgaagttt 300 tgaggtttca aactttcctt ctggagaatg ccttttgaaa caattttctc tagctgcctg 360 atgtcaactg cttagtaatc agtggatatt gaaatattca aaatgtacag agagtgggta 420 gtggtgaatg ttttcatgat gttgtacgtc cagctggtgc agggctccag taatgaacat 480 ggaccagtga agcgatcatc tcagtccaca ttggaacgac ctgaacagca gatcagggct 540 If: Éal.j, kA ** to J. I., gcttctagtt tggaggaact acttcgaatt actcactctg aggactggaa gctgtggaga 600 tgcaggctga ggctcaaaag ttttaccagt atggactctc gctcagcatc ccatcggtcc 660 actaggtttg cggcaacttt ctatgacatt gaaacactaa aagttataga tgaagaatgg 720 caaagaactc agtgcagccc tagagaaacg tgcgtggagg tggccagtga gctggggaag 780 cattcttcaa agtaccaaca gcccccttgt gtgaacgtgt tccgatgtgg tggctgttgc 840 aatgaagaga gccttatctg tatgaacacc agcacctcgt acatttccaa acagctcttt 900 gagatatcag tgcctttgac atcagtacct gaattagtgc ctgttaaagt tgccaatcat 960 acaggttgta agtgcttgcc aacagccccc cgccatccat actcaattat cagaagatcc 1020 atccagatcc ctgaagaaga tcgctgttcc cattccaaga aactctgtcc tattgacatg 1080 ctatgggata gcaacaaatg taaatgtgtt ttgcaggagg aaaatccact tgctggaaca 1140 ctcatctcca gaagaccact ggaaccagct ctctgtgggc cacacatgat gtttgacgaa 1200 gatcgttgcg agtgtgtctg taaaacacca tgtcccaaag atctaatcca gcaccccaaa 1260 aactgcagtt gctttgagtg caaagaaagt ctggagacct gctgccagaa gcacaagcta 1320 tttcacccag acacctgcag ctgtgaggac agatgcccct ttcataccag ac catgtgca 1380 agtggcaaaa cagcatgtgc aaagcattgc cgctttccaa aggagaaaag ggctgcccag 1440 gccgaaagaa gggccccaca tccttgattc agcgttccaa gttccccatc cctgtcattt 1500 ttaacagcat gctgctttgc caagttgctg tcactgtttt tttcccaggt gttaaaaaaa 1560 aaatccattt tacacagcac cacagtgaat ccagaccaac cttccattca caccagctaa 1620 ggagtccctg gttcattgat ggatgtcttc tagctgcaga tgcctctgcg caccaaggaa 1680 tggagaggag gggacccatg taatcctttt gtttagtttt gtttttgttt tttggtgaat 1740 gagaaaggtg tgctggtcat ggaatggcag gtgtcatatg actgattact cagagcagat 1800 gaggaaaact gtag'tctctg agtcctttgc taatcgcaac tcttgtgaat tattctgatt 1860 cttttttatg cagaatttga ttcgtatgat cagtactgac tttctgatta ctgtccagct 1920 tatagtcttc cagtttaatg aactaccatc tgatgtttca tatttaagtg tatttaaaga 1980 aaataaacac cattattcaa gtct 2004 < 210 > 22 < 211 > 354 < 212 > PRT < 213 > Homo sapiens < 400 > 22 Met Tyr. Arg Glu Trp Val Val Val Asn Val Phe Met Met Leu Tyr Val 1 5 10 15 Gln Leu Val Gln sly Ser Ser Asn Glu His Gly Pro Val Lys Arg Ser 20 25 30 Ser Gln Ser Thr Leu Glu Arg Ser Glu Gln sln He Arg Wing Wing Ser 35 40 45 Ser Leu Glu Glu Leu Leu Arg He Thr His Ser Glu Asp Trp Lys Leu 50 55 60 Trp Arg Cys Arg Leu Arg Leu Lys Ser Phe Thr Ser Met Asp Ser Arg 65 70 75 80 Ser Wing Being His Arg Being Thr Arg Phe Wing Wing Thr Phe Tyr Asp He 85 90 95 Glu Thr Leu Lys Val He Asp Glu Glu Trp Gln Arg Thr Gln Cys Ser 100 105 no Pro Arg Glu Thr Cys Val Glu Val Wing Ser Glu Leu Gly Lys Ser Thr 115 120 125 Asn Thr Phe Phe Lys Pro Pro Cys Val Asn Val Phe Arg Cys Gly Gly 130 135 140 Cys Cys Asn Glu Glu Ser Leu He Cys Met Asn Thr Ser Thr Ser Tyr -ToíÁÁÁÁÁ Á Mitta.? Í? il * '- * .., ** * i * As.v - 145 150 155 160 He Be Lys Gln Leu Phe Glu He Ser Val Pro Leu Thr Ser Val Pro 165 170 175 Glu Leu Val Pro Val Lys Val Wing Asn His Thr Gly Cys Lys Cys Leu 180 185 190 Pro Thr Wing Pro Arg His Pro Tyr Ser He He Arg Arg Ser He Gln 195 200 205 He Pro Glu Glu Asp Arg Cys Ser His Ser Lys Lys Leu Cys Pro He 210 215 220 Asp Met Leu Trp Asp Ser Asn Lys Cys Lys Cys Val Leu Gln Glu Glu 225 230 235 240 Asn Pro Leu Wing Gly Thr Glu Asp His Ser His Leu Gln slu Pro Wing 245 250 255 Leu Cys sly Pro His Met Met Met Phe Asp Glu Asp Arg Cys Glu Cys Val 260 265 270 Cys Lys Thr Pro Cys Pro Lys Asp Leu He Gln His Pro Lys Asn Cys 275 280 285 Ser Cys Phe slu Cys Lys Glu Ser Leu Glu Thr Cys Cys Gln Lys His 290 295 300 Lys Leu Phe His Pro Asp Thr Cys Ser Cys Glu Asp Arg Cys Pro Phe 305 310 • 315 320 His Thr Arg Pro Cys Wing Ser Gly Lys Thr Wing Cys Wing Lys His Cys 325 330 335 Arg Phe Pro Lys Glu Lys Arg Wing Wing Gln sly Pro His Ser Arg Lys 340 345 350 Asn Pro < 210 > 23 < 211 > 399 < 212 > DNA < 213 > Homo sapiens < 400 > 23 atgaagtttc tcgtcggcat actggtagct gtgtgcttgc accagtatct gctgaacgcg 60 gacagcacga aaacatggtc cgaagtgttt gaaaacagcg ggtgcaagcc aaggccgatg 120 gtctttcgag tacacgacga gcacccggag ctaacttctc agcggttcaa cccgccgtgt 180 gtcacgttga tgcgatgcgg cgggtgctgc aacgacgaga gcttagaatg cgtccccacg 240 gaagaggcaa acgtaacgat gcaactcatg ggagcgtcgg tctccggtgg taacgggatg 300 caacatctga gcttcgtaga tgcgattgta gcataagaaa aaccaccact cacgaccacg 360 ccaccgacga ccacaaggcc gcccagaaga cgccgctag 399 < 210 > 24 < 211 > 132 < 212 > PRT < 213 > Homo sapiens laü a ^ < 400 > 24 Met Lys Phe Leu Val Gly He Leu Val Wing Val Cys Leu His Oln Tyr 1 5 10 15 Leu Leu Asn Wing Asp Ser Thr Lys Thr Trp Ser slu Val Phe slu Asn 20 '25 30 Ser Gly Cys Lys Pro Arg Pro Met Val Phe Arg Val His Asp Glu His 35 40 45 Pro Glu Leu Thr Ser Gln Arg Phe Asn Pro Pro Cys Val Thr Leu Met 50 55 60 Arg Cys Gly Gly Cys Cys Asn Asp slu Ser Leu Glu Cys Val Pro Thr 65 70 75 80 Glu Glu Wing Asn Val Thr Met Gln Leu Met Gly Wing Ser Val Gly 85 90 95 Gly Asn Gly Met Gln His Leu Ser Phe Val Glu His Lys Lys Cys Asp 100 105 110 Cys Lys Pro Pro Leu Thr Thr Thr Pro Pro Thr Thr Thr Arg Pro Pro 115 120 125 Arg Arg Arg Arg 130 < 210 > 25 < 211 > 1526 < 212 > DNA < 213 > Homo sapiens < 400 > 25 cgaggccacg gcttatgcaa gcaaagatct ggaggagcag ttacggtctg tgtccagtgt 60 agatgaactc atgactgtac tctacccaga atattggaaa atgtacaagt gtcagctaag 120 tggcaacata gaaaggaggc acagagaaca aactcaagga ggccaacctc cagaagagac 180 tataaaattt gctgcagcac attataatac agagatettg aaaagtattg ataatgagtg 240 gagaaagact caatgcatgc cacgggaggt gtgtatagat gtggggaagg agtttggagt 300 cgcgacaaac accttcttta aacctccatg tgtgtccgtc tacagatgtg ggggttgctg 360 caatagtgag gggctgcagt gcatgaacac cagcacgagc tacctcagca agacgttatt 420 tgaaattaca gtgcctctct ctcaaggccc caaaccagta ttgecaatca acaatcagtt 480 cacttcctgc cgatgcatgt ctaaactgga tgtttacaga caagtteatt ccattattag 540 acgttccctg ccagcaacac taccacagtg tcaggcagcg aacaagacct gccccaccaa 600 ttacatgtgg aataatcaca tctgcagatg cctggctcag gaagatttta tgttttcctc 660 gatgactcaa ggatgctgga cagatggatt ccatgacatc tgtggaccaa acaaggagct 720 ggatgaagag acctgtcagt gtgtctgcag agcggggctt cggcctgcca gctgtggacc 780 ctagacagaa ccacaaagaa actcatgcca gtgtgtctgt aaaaacaaac tcttccccag 840 cca atgtggg gccaaccgag aatttgatga aaacacatgc cagtgtgtat gtaaaagaac 900 ctgccccaga aatcaacccc taaatcctgg aaaatgtgcc tgtgaatgta cagaaagtcc 960 acagaaatgc ttgttaaaag gaaagaagtt ccaccaccaa acatgeaget gttacagacg 1020 aaccgccaga gccatgtacg aggcttgtga gccaggattt tcatatagtg aagaagtgtg 1080 tcgttgtgtc ccttcatatt ggcaaagacc acaaatgagc ctgttttcca taagattgta 1140 gttcatcgat tttctattat ggaaaactgt gttgccacag tagaactgtc tgtgaacaga 1200 gagacccttg tgggtccatg ctaacaaaga tctttcctga caaaagtctg accatgtgga 1260 taactttaca gaaatggact ggagctcate tgcaaaaggc ctcttgtaaa gactggtttt 1320 ctgccaatga ccaaacagcc aagattttcc tcttgtgatt tctttaaaag aatgactata 1380 taatttattt ccactaaaaa tattgtttct gcattcattt ttatagcaac aacaattggt 1440 aaaactcact gtgatcaata tttttatatc atgcaaaata tgtttaaaat aaaatgaaaa 1500 ttgtatttat aaaaaaaaaa aaaaaa 1526 < 210 > 26 < 211 > 350 < 212 > PRT < 213 > Homo sapiens < 400 > 26 Met Thr Val Leu Tyr Pro Glu Tyr Trp Lys Met Tyr Lys Cys Gln Leu 1 5 10 15 Arg Lys Gly Gly Trp Gln His Asn Arg Glu Gln Wing Asn Leu Asn Ser 20 25 30 Arg Thr slu slu Thr He Lys Phe Wing Ala Ala His Tyr Asn Thr slu 35 40 45 He Leu Lys Ser He Asp Asn Glu Trp Arg Lys Thr Gln Cys Met Pro 50 55 60 Arg Clu Val Cys He Asp Val Gly Lys Glu Phe Gly val Wing Thr Asn 65 70 75 80 Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr Arg Cys Gly sly Cys 85 90 95 Cys Asn Ser Glu Gly Leu Gln'Cys Met Asn Thr Ser Thr Ser Tyr Leu 100 105 110 Ser Lys Thr Leu Phe Glu He Thr Val Pro Leu Ser Gln Gly Pro Lys 115 120 125 Pro Val Thr He Ser Phe Wing Asn His Thr Ser Cys Arg Cys Met Ser 130 135 140 Lys Leu Asp Val Tyr Arg Gln Val His Ser He He Arg Arg Ser Leu 145 150 155 160 Pro Ala Thr Leu Pro Gln Cys Gln Wing Wing Asn Lys Thr Cys Pro Thr 165 170 175 Ash Tyr Met Trp Asn Asn His He Cys Arg Cys Leu Wing Gln Glu Asp 180 185 190 Phe Met Phe Ser Ser Asp Wing Gly Asp Asp Ser Thr Asp Gly Phe His 195 200 205 A sp He Cys Gly Pro Asn Lys Glu Leu Asp Glu Glu Thr Cys Gln Cys 210 215 220 Val Cys Arg Ala sly Leu Arg Pro Wing Ser Cys Gly Pro His Lys Glu 225 230 235 240 Leu Asp Arg Asn Ser Cys Gln Cys Val Cys Lys Asn Lys Leu Phe Pro 245 250 255 Ser Gln Cys Gly Wing Asn Arg Glu Phe Asp Glu Asn Thr Cys Gln Cys 260 265 270 Val Cys Lys Arg- Thr Cys Pro Arg- Asp Gln Pro Leu Asn Pro Gly Lys 275 280 285 Cys Wing Cys slu Cys Thr Glu Ser Pro Gln Lys Cys Leu Leu Lys Gly 290 295 300 Lys Lys Phe His Gln Thr Cys Ser Cys Tyr Arg Arg Pro Cys Thr 305 310 315 320 Asn Arg sln Lys Ala Cys Olu Pro sly Phe Ser Tyr Ser Olu slu Val 325 330 335 Cys Arg Cys Val Pro Ser Tyr Trp Gln Arg Pro Gln Met Ser 340 345 350 < 210 > 27 < 211 > 1298 < 212 > PRT < 213 > Homo sapiens < 400 > 27 Met Gln Arg Gly Ala Ala Leu Cys Leu Arg Leu Trp Leu Cys Leu Gly 1 5 10 15 Leu Leu Asp Gly Leu Val Ser Asp Tyr Ser Met Thr Pro Pro Thr Leu 20 25 30 Asn He Thr Glu Glu Ser His Val He Asp Thr Gly Asp Ser Leu Ser 35 40 45 Be Ser Cys Arg Gly Gln His Pro Leu slu Trp Wing Trp Pro Gly Wing 50 55 '60 Gln Glu Wing Pro Wing Thr Gly Asp Lys Asp Ser Glu Asp Thr Gly Val 65 70 75 80 Val Arg Asp Cys Glu Gly Thr Asp Wing Arg Pro Tyr Cys Lys Val Leu 85 90 95 Leu Leu His Glu Val His Wing Asn Asp Thr Gly Ser Tyr Val Cys Tyr 100 105 110, Tyr Lys Tyr He Lys Wing Arg He Glu Gly Thr Thr Ala Ala Ser Ser 115 120 125 Tyr Val Phe Val Arg Asp Phe Glu Gln Pro Phe He Asn Lys Pro Asp 130 135 140 Thr Leu Leu Val Asn Arg Lys Asp Ala Met Trp Val Pro Cys Leu Val 145 150 155 160 Ser Ile Pro G1 Leu PíS Val thr Leu Arg Ser Gln Be Ser Val Leu 165 170 175 Trp Pro Asp Gly Gln Glu Val Val Trp Asp Asp Arg Arg Gly Met Leu 180 185 190 Val Ser Thr Pro Leu Leu His Asp Ala Leu Tyr Leu Gln Cys Glu Thr 195 200 205 Thr Trp Gly Asp Gln Asp Phe Leu Ser Asn Pro Phe Leu Val His He 210 215 220 Thr Gly Asn Glu Leu Tyr Asp He Gln Leu Leu Pro Arg Lys Ser Leu 225 230 235 240 Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn Cys Thr Val Trp Wing 245 250 255 Glu Phe Asn Ser Gly Val Thr Phe Asp Trp Asp Tyr Pro Gly Lys Gln 260 265 270 Wing slu Arg sly Lys Trp Val Pro slu Arg Arg Ser sln Gln Thr His 275 280. 285 Thr Glu Leu Ser Be He Leu Thr He His Asn Val Ser Gln His Asp 290 295 300 Leu Gly Ser Tyr Val Cys Lys Wing Asn Asn Gly He Gln Arg Phe Arg 305 310 315 320 Glu Ser Thr Glu Val He Val His Glu Asn Pro Phe He Ser Val Glu 325 330 335 Trp Leu Lys Gly Pro He Leu Glu Wing Thr Wing Gly Asp Glu Leu Val 340 345 350 Lys Leu Pro Val Lys Leu Wing Ala Tyr Pro Pro Pro Glu Phe Gln Trp 355 '360 365 Tyr Lys Asp sly Lys Wing Leu Ser sly Arg His Ser Pro His Wing Leu 370 375 • 380 Val Leu Lys Glu Val Thr Glu Wing Ser Thr Gly Thr Tyr Thr Leu Wing 385 390 395 400 Leu Trp Asn Ser Ala Ala sly Leu Arg Arg Asn He Ser Leu slu Leu 405 410 415 Val Val Asn Val Pro Pro Oln He His Olu Lys slu Wing Ser Ser Pro 420 425 430 Ser He Tyr Ser Arg His Ser Arg sln Wing Leu Thr Cys Thr Wing Tyr 435 440 445 sly Val Pro Leu Pro Leu Ser He sln Trp His Trp Arg Pro Trp Thr 450 455 460 Pro Cys Lys Met Phe Wing Sln Arg Ser Leu Arg Arg Arg sln sln Oln 465 470 475 480 AsP Leu MeC Pro Gln Cys Arg As? TrP Arg Wing Val Thr Thr Oln Asp 485 490 495 Wing Val Asn Pro He Glu Ser Leu Asp Thr Trp Thr Glu Phe Val Glu 500 505 510 Gly Lys Asn Lys Thr Val Ser Lys Leu Val He sln Asn Wing Asn Val 515 520 525 Ser Wing Met Tyr Lys Cys Val Val Ser Asn Lys Val Gly Gln Asp Glu 530 535 540 Dai? e Arg Leu He Tyr Phe Tyr Val Thr Thr He Pro Asp sly Phe Thr He 545 550 555 560 slu Ser Lys Pro Ser Glu Glu Leu Leu Glu sly sln Pro Val Leu Leu 565 570 575 Ser Cys sln Wing Asp Ser Tyr Lys Tyr slu His Leu Arg Trp Tyr Arg 580 585 590 Leu Asn Leu Ser Thr Leu His Asp Ala His sly Asn Pro Leu Leu Leu 595 600 605 Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro Leu Ala Ala Ser Leu 610 615 620 Glu slu Val Ala Pro Gly Ala Arg His Ala Thr Leu Ser Leu Ser He 625 630 635 640 Pro Arg Val Ala Pro Glu His Glu Gly His Tyr Val Cys Glu Val Gln 645 650 655 Asp Arg Arg Ser His Asp Lys His Cys His Lys Lys Tyr Leu Ser Val 660 665 670 Gl Ala Leu slu Ala Pro Arg Leu Thr Oln Asn Leu Thr Asp Leu Leu 675 680 685 Val Asn Val Ser Asp Ser Leu Glu Met Gln Cys Leu Val Ala Gly Wing 690 695 700 His Ala Pro Ser He Val Trp Tyr Lys Asp Glu Arg Leu Leu Glu Glu 705 710 715 720 Lys Ser Gly Val Asp Leu Wing Asp Ser Asn Gln Lys Leu Ser He Gln 725 730 735 Arg Val Arg Glu Glu Asp Wing Gly Pro Tyr Leu Cys Ser Val Cys Arg 740 745 750 Pro Lys Gly Cys Val Asn Ser Ser Wing Ser Val Wing Val Glu Gly Ser 755 760 765 Glu Asp Lys Gly Ser Met Glu He Val He Leu Val Gly Thr Gly Val 770 775 780 He Wing Val Phe Phe Trp Val Leu Leu Leu Leu He Phe Cys Asn Met 785 790 795 800 Arg Arg Pro Wing His Wing Asp He Lys Thr Gly Tyr Leu Ser He He 805 810 815 Met Asp Pro Gly Glu Val Pro Leu slu slu Gln Cys Glu Tyr Leu Ser 820 825 830 Tyr Asp Wing Ser Gln Trp Glu Phe Pro Arg slu Arg Leu His Leu sly 835 840 845 Arg Val Leu Gly Tyr Gly Wing Phe Gly Lys Val Val Glu Wing Ser Wing 850 855 860 ; jAi. > - Phe Gly He His Lys sly Ser Ser Cys Asp Thr Val Wing Val Lys Met 865 870 875 880 Leu Lys slu Gly Wing Thr Wing Ser Glu Gln Arg Wing Leu Met Ser Glu 885 890 895 Leu Lys He Leu He His Gly Asn His Leu Asn Val Val Asn Leu 900 905 910 Leu Gly Wing Cys Thr Lys Pro Gln Gly Pro Leu Met Val He Val Glu 915 920 925 Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu Arg Wing Lys Arg Asp 930 935 940 Wing Phe Ser Pro Cys Wing Glu Lys Ser Pro Glu Gln Arg sly Arg Phe 945 950 955 960 Arg Ala Met Val slu Leu Ala Arg Leu Asp Arg Arg Arg Pro Gly Ser 965 970 975 Be Asp Arg Val Leu Phe Wing Arg Phe Ser Lys Thr Glu Gly Gly Wing 980 985 990 Arg Arg Ala Ser Pro Asp Gln slu Ala slu Asp Leu Trp Leu Ser Pro 995 1000 1005 Leu Thr Met slu Asp Leu Val Cys Tyr Ser Phe Gln Val Ala Arg Gly 1010 1015 1020 Met Glu Phe Leu Wing Ser Arg Lys Cys He His Arg Asp Leu Ala Wing 1025 1030 1035 1040 Arg Asn He Leu Leu Ser Glu Be Asp Val Val Lys He Cys Asp Phe 1045 1050 1055 Gly Leu Wing Arg Asp He Tyr Lys Asp Pro Asp Tyr Val Arg Lys Gly 1060 1065 1070 Be Wing Arg Leu Pro Leu Lys Trp Met Wing Pro Glu Be He Phe Asp 1075 1080 1085 Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu 1090 1095 1100 Trp Glu He Phe Ser Leu Gly Wing Pro Pro Tyr Pro Gly Val Gln He 1105 1110 1115 1120 Asn Glu Glu Phe Cys Oln Arg Val Arg Asp Gly Thr Arg Met Arg Wing 1125 1130 H35 Pro Glu Leu Wing Thr Pro Wing He Arg His He Met Leu Asn Cys Trp 1140 1145 1150 Ser Gly Asp Pro Lys Wing Arg Pro Wing Phe Ser Asp Leu Val Glu He 1155 1160 1165 Leu Gly Asp Leu Leu Gln Gly Arg Gly Leu Gln Glu Glu Glu Glu Val 1170 1175 1180 Cys Met Wing Pro Arg Ser Ser Gln Ser Ser Glu Glu Gly Ser Phe Ser 1185 1190 1195 1200 Oln Val Ser Thr Met Wing Ala Leu His Wing S wing Wing Asp Wing Glu Asp 1205 1210 1215 Ser Pro Pro Ser Leu Gln Arg His Ser Leu Wing Wing Arg Tyr Tyr Asn 1220 1225 1230 Trp Val Ser Phe Pro sly Cys Leu Wing Arg Gly Wing Glu Thr Arg Gly 1235 1240 1245 Ser Ser Arg Met Lys Thr Phe Glu Glu Phe Pro Met Thr Pro Thr Thr 1250 1255 1260 Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp Ser Gly Met Val Leu Wing 1265 1270 1275 1280 Ser Glu Glu Phe Glu Gln He Glu Ser Arg His Arg Gln Glu Ser Gly 1285 1290 1295 Phe Arg < 210 > 28 < 211 > 1356 < 212 > PRT < 213 > Homo sapiens < 400 > 28 Met Gln Ser Lys Val Leu Leu Ala Val Ala Leu Trp Leu Cys Val Glu 1 5 10 15 Thr Arg Ala Ala Ser Val Gly Leu Pro Ser Val Ser Leu Asp Leu Pro 20 25 30 Arg Leu Be He Gln Lys Asp He Leu Thr He Lys Wing Asn Thr Thr 35 40 45 Leu Gln He Thr Cys Arg Gly Gln Arg Asp Leu Asp Trp Leu Trp Pro 50 55 60 Asn Asn Gln Ser Gly Ser Glu Gln Arg Val Glu Val Thr Glu Cys Ser 65 70 75 80 Asp Gly Leu Phe Cys Lys Thr Leu Thr He Pro Lys Val He Gly Asn 85 90 95 Asp Thr Gly Wing Tyr Lys Cys Phe Tyr Arg Glu Thr Asp Leu Wing Ser 100 105 lio Val He Tyr Val Tyr Val Gln Asp Tyr Arg Ser Pro Phe He Wing Ser 115 120 125 Val Ser Asp Gln His sly Val Val Tyr He Thr Glu Asn Lys Asn Lys 130 135 140 Thr Val Val He Pro Cys Leu Gly Ser He Ser Asn Leu Asn Val Ser 145 150 155 160 Leu Cys Ala Arg Tyr Pro Glu Lys Arg Phe Val pro Asp Gly Asn Arg 165 170 175 Be Ser Trp Asp Ser Lys Lys Gly Phe Thr He Pro Ser Tyr Met He 180 185 190 Ser Tyr Wing Gly Met Val Phe Cys Glu Wing Lys He Asn Asp Olu Ser 195 200 205 Tyr Gln Ser He Met Tyr He Val Val Val Val Gly Tyr Arg He Tyr 210 215 220 Asp Val Val Leu Ser Pro Ser His Gly He Glu Leu Ser Val Gly Glu 225 230 235 240 Lys Leu Val Leu Asn Cys Thr Wing Arg Thr Glu Leu Asn Val Gly He 245 250 '255 Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu 260 265 270 Val Asn Arg Asp Leu Lys Thr Gln Ser sly Ser Glu Met Lys Lys Phe 275 280 285 Leu Ser Thr Leu Thr He Asp Gly Val Thr Arg Ser Asp Gln Gly Leu 290 295 300 Tyr Thr Cys Ala Wing Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 305 310 315 320 Phe Val Arg Val His Glu Lys Pro Phe Val Wing Phe Gly Ser Gly Met 325 3-30 335 Glu Ser Leu Val Glu Ala Thr Val Gly Glu Arg Val Arg He Pro Wing 340 345 350 Lys Tyr Leu Gly Tyr Pro Pro Pro Glu He Lys Trp Tyr Lys Asn Gly 355 360 365 He Pro Leu Glu Ser Asn His Thr He Lys Wing Gly His Val Leu Thr 370 375 380 lie Met Glu Val Ser Glu Arg Asp Thr Gly Asn Tyr Thr Val He Leu 385 390 395 400 Thr Asn Pro He Ser Lys Glu Lys Gln Ser His Val Val Ser Leu Val 405 410 415 Val Tyr Val Pro Pro sln He sly Glu Lys Ser Leu He Ser Pro Val 420 425 430 Asp Ser Tyr Gln Tyr sly Thr Thr Gln Thr Leu Thr Cys Thr Val Tyr 435 440 445 Wing Pro Pro Pro His His He His Trp Tyr Trp Gln Leu Olu slu 450 455 460 Olu Cys Wing Asn Glu Pro Ser Gln Wing Val Ser Val Thr Asn Pro Tyr 465 470 475 480 Pro Cys Glu Glu Trp Arg Ser Val Glu Asp Phe Gln Gly Gly Asn Lys 485 490 495 g heflu Asn Lys Asn Gln Phe Wing Leu He Glu Gly Lys Asn Lys 500 505 510 Thr Val Ser Thr Leu Val He Gln Wing Wing Asn Val Ser Wing Leu Tyr 515 520 525 Lys Cys slu Wing Val Asn Lys Val Gly Arg Gly Glu Arg Val He Ser 530 535 540 Phe His Val Thr Arg Gly Pro Glu He Thr Leu Gln Pro Asp Met Gln 545 550 555 560 Pro Thr Glu Gln Glu Ser Val Ser Leu Trp Cys Thr Wing Asp Arg Ser 565 570 575 Thr Phe Glu Asn Leu Thr Trp Tyr Lys Leu Gly Pro Gln Pro Leu Pro 580 585 '590 He His Val Oly Glu Leu Pro Thr Pro Val cys Lys Asn Leu Asp Thr 595 600 605 Leu Trp Lys Leu Asn Wing Thr Met Phe Ser Asn Ser Thr Asn Asp He 610 615 620 Leu He Met Glu Leu Lys Asn Wing Ser Leu Gln Asp Gln Gly Asp Tyr 625 630 635 640 Val Cys Leu Wing Gln Asp Arg Lys Thr Lys Lys Arg His Cys Val Val 645 650 655 Arg Gln Leu Thr Val Leu Glu Arg Val Wing Pro Thr He Thr Gly Asn 660. 665 670 Leu Glu Asn Gln Thr Thr Ser He Oly Olu Ser He Olu Val Ser Cys 675 680 685 Thr Ala Ser sly Asn Pro Pro Pro Gln He Met Trp Phe Lys Asp Asn 690 695 700 Glu Thr Leu Val Glu Asp Ser Oly He Val Leu Lys Asp Oly Asn Arg 705 710 715 720 Asn Leu Thr He Arg Arg Val Arg Lys slu Asp Glu sly Leu Tyr Thr 725 730 735 Cys Gln Wing Cys Ser Val Leu Gly Cys Wing Lys Val Glu Wing Phe Phe 740 745 750 He He Glu Gly Wing Gln Glu Lys Thr Asn Leu Glu He He He Leu 755 760 765 Val Gly Thr Wing Val He Wing Met Phe Phe Trp Leu Leu Val He 770 775 780 He Leu Arg Thr Val Lys Arg Wing Asn Gly Gly Glu Leu Lys Thr Gly 785 790 795 800 Tyr Leu Ser lie Val Met. Asp Pro Asp Glu Leu Pro Leu Asp Glu His SOS 810 815 iKi ki Cys Glu Arg Leu Pro Tyr Asp Wing Ser Lys Trp Glu Phe Pro Arg Asp 820 825 830 Arg Leu Lys Leu Gly Lys Pro Leu Gly Arg Gly Wing Phe Gly Gln Val 835 840 845 He Glu Wing Asp Wing Phe Gly He Asp Lys Thr Ala Thr Cys Arg Thr 850 855 860 Val Wing Val Lys Met Leu Lys Glu Gly Wing Thr His Ser Glu His Arg 865 870 875 880 Ala Leu Met Ser Glu Leu Lys He Leu He His He Gly His His Leu 885 890 895 Asn Val Val Asn Leu Leu Gly Ala Cys Thr Lys Pro Gly Gly Pro Leu 900 905 910 Met Val He Val Glu Phe Cys Lys Phe Gly Asn Leu Ser Thr Tyr Leu 915 920 925 Arg Ser Lys Arg Asn Glu Phe Val Pro Tyr Lys Thr Lys Gly Ala Arg 930 935 940 Phe Arg Gln sly Lys Asp Tyr Val Gly Ala He Pro Val Asp Leu Lys 945 950 955 960 Arg Arg Leu Asp Ser He Thr Ser Ser Gln Ser Ser Ala Ser Ser Gly 965 970 975 Phe Val Glu Glu Lys Ser Leu Ser Asp Val Glu Glu Glu Glu Ala Pro 980 985 990 Glu Asp Leu Tyr Lys Asp Phe Leu Thr Leu Glu His Leu He Cys Tyr 995 1000 1005 Ser Phe Gln Val Ala Lys sly Met Glu Phe Leu Ala Being Arg Lys Cys 1010 1015 1020 He His Arg Asp Leu Wing Wing Arg Asn He Leu Leu Ser Glu Lys Asn 1025 1030 1035 1040 Val Val Lys He Cys Asp Phe Gly Leu Wing Arg Asp He Tyr Lys Asp 1045 1050 1055 Pro Asp Tyr Val Arg Lys Gly Asp Wing Arg Leu Pro Leu Lys Trp Met 1060 1065 1070 Wing Pro Glu Thr He Phe Asp Arg Val Tyr Thr He Gln Ser Asp Val 1075 1080 1085 Trp Ser Phe Oly Val Leu Leu Trp slu He Phe Ser Leu Gly Wing Ser 1090 1095 1100 Pro Tyr Pro Gly Val Lys He Asp slu Glu Phe Cys Arg Arg Leu Lys 1105 1110 1115 H20 Glu sly Thr Arg Met Arg Ala Pro Asp Tyr Thr Thr Pro Glu Met Tyr 1125 1130 113S Gln Thr Met Leu Asp Cys Trp His Gly Glu Pro Ser Gln Arg Pro Thr 1140 1145 1150 Phe Ser Glu Leu Val Glu His Leu Gly Asn Leu Leu Gln Wing Asn Wing 1155 1160 1165 Gln Gln Asp sly Lys Asp Tyr He Val Leu Pro He Ser slu Thr Leu 1170 1175 1180 Ser Met slu Glu Asp Ser Gly Leu Ser Leu Pro Thr Ser Pro Val Ser 1185 1190 1195 1200 Cys Met Glu Glu Glu Glu Glu Val Cys Asp Pro Lys Phe His Tyr Asp Asn 1205 1210 1215 Thr Wing Gly He Ser Gln Tyr Leu Gln Asn Ser Lys Arg Lys Ser Arg 1220 1225 1230 Pro Val Ser Val Lys Thr Phe slu Asp He Pro Leu Glu Pro Glu '1235 1240 1245 Val Lys Val He Pro Asp Asp Asn Gln Thr Asp Ser Gly Met Val Leu 1250 1255 1260 Wing Ser Glu Glu Leu Lys Thr Leu Glu Asp Arg Thr Lys Leu Ser. Pro 1265 1270 1275 1280 Ser Phe Gly Gly Met Val Pro Ser Lys Ser Arg Glu Ser Val Wing Ser 1285 1290 1295 Glu Gly Ser Asn Gln Thr Ser Gly Tyr Gln Ser sly Tyr His Ser Asp 1300 1305. 1310 Asp Thr Asp Thr Thr Val Tyr Ser Ser Glu Glu Wing Glu Leu Leu Lys 1315 1320 1325 Leu He Glu He Gly V al Gln Thr Gly Ser Thr Wing Gln He Leu sln 1330 1335 1340 Pro Asp Ser Gly Thr Thr Leu Ser Ser Pro Pro Val 1345 1350 1355 - < 210 > 29 < 211 > 13 < 212 > PRT < 213 > Homo sapiens < 220 > < 221 > SITE < 222 > (2) < 223 > Xaa is equal to any amino acid < 220 > < 221 > SITE < 222 > (5) < 223 > Xaa is equal to any amino acid < 220 > < 221 > SITE < 222 > (6) < 223 > Xaa is equal to any amino acid < 220 > < 221 > SITE < 222 > '7 »< 223 > Xaa is equal to any amino acid < 220 > < 221 > SITE < 222 > (10) < 223 > Xaa is equal to any amino acid < 400 > 29 Pro Xaa Cys Val Xaa Xaa Xaa Arg Cys Xaa Gly Cys Cys 1 5 10 < 210 > 30 < 211 > 733 < 212 > DNA < 213 > Homo sapiens < 400 > 30 gggatccgga gcccaaatct tctgacaaaa ctcacacatg cccaccgtgc ccagcacctg 60 aattcgaggg tgcaccgtca gtcttcctct tccccccaaa acccaaggac accctcatga 120 tctcccggac tcctgaggtc acatgcgtgg tggtggacgt aagccacgaa gaccctgagg 180 tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca aagccgcggg 240 aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg caccaggact 300 ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca acccccatcg 360 agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac accctgcccc 420 catcccggga tgagetgace aagaaccagg tcagcctgac ctgcctggtc aaaggcttct 480 catcgccgtg atecaagega gagtgggaga gcaatgggca gccggagaac aactacaaga 540 ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag ctcaccgtgg 600 acaagageag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat gaggctctgc 660 acaaccacta caegeagaag agcctctccc tgtctccggg taaatgagtg cgacggccgc gactetagag gat 720 • 733

Claims (17)

2. Having described the invention as above, the content of the following claims is claimed as property: 1. A nucleic acid molecule characterized in that it comprises a polynucleotide having a nucleotide sequence at least 95% identical to a sequence that is selected from the group consisting of: group consisting of: (a) a polynucleotide fragment of SEQ ID NO: X, which can be hybridized to SEQ ID NO: X; (b) a polynucleotide encoding a polypeptide fragment of SEQ ID NO: Y, which can hybridize to SEQ ID NO: X; (c) a polynucleotide encoding a polypeptide domain of SEQ ID NO: Y, which can hybridize to SEQ ID NO: X; (d) a polynucleotide encoding a polypeptide epitope of SEQ ID NO: Y, which can hybridize to SEQ ID NO: X; (e) a polynucleotide encoding a polypeptide of SEQ ID NO: Y, which can hybridize to SEQ ID NO: X, having biological activity; (f) a polynucleotide which is a variant of SEQ ID NO: X; (g) a polynucleotide which is an allelic variant of SEQ ID NO: X; (h) a polynucleotide encoding a homologous species of SEQ ID NO: Y; (i) a polynucleotide that can hybridize under stringent conditions to any of the polynucleotides specified in (a) - (h), wherein said polynucleotide does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence only of residues A or only residues T. 2. The nucleic acid molecule according to claim 1, further characterized in that the polynucleotide fragment comprises a nucleotide sequence that codes for a secreted protein.
3. 3. The nucleic acid molecule according to claim 1, further characterized in that the polynucleotide fragment comprises a nucleotide sequence coding for the sequence identified as SEQ ID NO: Y, which can be hybridized to SEQ ID NO. : X.
4. 4.- The nucleic acid molecule according to claim 1, further characterized in that the polynucleotide fragment comprises the complete nucleotide sequence of SEQ ID NO: X, which can be hybridized to SEQ ID NO: X
5. 5. The nucleic acid molecule according to claim 2, further characterized in that the nucleotide sequence comprises nucleotide deletions. IJJ? * S &Jfa.tfejis sequential from either the C-terminal or the N-te-rminal end.
6. 6. The nucleic acid molecule according to claim 3, further characterized in that the nucleotide sequence comprises sequential nucleotide deletions of either the C-terminal or the N-terminal end.
7. 7. A recombinant vector characterized in that it comprises the nucleic acid molecule according to claim 1.
8. 8. A method for preparing a recombinant host cell characterized in that it comprises the isolated nucleic acid molecule according to claim 1.
9. 9. - A recombinant host cell produced with the method according to claim 8.
10. 10. The recombinant host cell according to claim 9, characterized in that it comprises a vector sequence.
11. 11. An isolated polypeptide characterized in that it comprises at least 95% amino acid sequence identical to a sequence that is selected from the group consisting of: (a) a polypeptide fragment of SEQ ID NO: Y; (b) a polypeptide fragment of SEQ ID NO: Y, which has biological activity; (c) a polypeptide domain of SEQ ID NO: Yv (d) a polypeptide epitope of SEQ ID NO: Y; (e) a secreted form of SEQ ID NO: Y; (f) a full-length protein of SEQ ID NO: Y; (g) a variant of SEQ ID NO: Y; (h) an allelic variant of SEQ ID NO: Y; (i) a homologous species of SEQ ID NO: Y.
12. 12.- The isolated polypeptide according to claim 11, further characterized in that the secreted form of the full length protein comprises sequential amino acid deletions of either the C-terminal or the N-terminal end.
13. 13. An isolated antibody that specifically binds to the isolated polypeptide according to claim 11.
14. 14. A recombinant host cell expressing the isolated polypeptide according to claim 11.
15. 15. A method for preparing an isolated polypeptide characterized because it comprises (a) culturing the recombinant host cell according to claim 14 under conditions such that said polypeptide is expressed; and (b) recovering the polypeptide.
16. 16. - The polypeptide produced according to claim 15.
17. 17. A method for preventing, treating, or improving a medical condition, characterized in that it comprises administering to a mammal a therapeutically effective amount of the polypeptide according to claim 11 or the polynucleotide of according to claim 1. 18- A method for diagnosing a pathological condition or a susceptibility to a pathological condition in a subject characterized in that it comprises: (a) determining the presence or absence of a mutation in the polynucleotide according to claim 1; and (b) diagnose a pathological condition or a susceptibility to a pathological condition based on the presence or absence of said mutation. 19. A method for diagnosing a pathological condition or a susceptibility to a pathological condition in a subject characterized in that it comprises: (a) determining the presence or amount of expression of the polypeptide according to claim 11 in a biological sample; and (b) diagnose a pathological condition or a susceptibility to a pathological condition based on the presence or amount of expression of the polypeptide. 20. A method for identifying a binding partner for the polypeptide according to claim 11, characterized in that it comprises: (a) contacting the polypeptide according to claim 11 with a binding partner; and (b) determining whether or not the binding partner affects a polypeptide activity. 21. The gene corresponding to the cDNA sequence of SEQ ID NO: Y. 22. A method for identifying an activity in a biological test, characterized in that the method comprises: (a) expressing SEQ ID NO: X in a cell; (b) isolating the supernatant; (c) detecting an activity in a biological test; and (d) identifying the protein in the supernatant that has the activity. 23. The product produced by the method according to claim 20. SUMMARY OF THE INVENTION Angiogenic human polypeptides, fragments, analogues, or biologically active derivatives thereof, useful in therapy or diagnosis, and a DNA (RNA) molecule encoding such angiogenic polypeptides are described. Methods for producing such polypeptides are also provided by recombinant techniques and antibodies, agonists and antagonists against such polypeptides. Such polypeptides and polynucleotides can be used in therapeutic form to stimulate wound healing and repair of vascular tissue. Methods for using antibodies and antagonists to inhibit tumor angiogenesis and therefore tumor growth, inflammation, diabetic retinopathy, rheumatoid arthritis and psoriasis are also provided. Methods for using antibodies and agonists to promote angiogenesis and lymphangiogenesis are also provided. Antagonists could also be used to treat chronic inflammations caused by increased vascular permeability. In addition to these disorders, antagonists could also be used to treat retinopathy associated with diabetes, rheumatoid arthritis and psoriasis. The agonists and / or antagonists can be used in a composition with a pharmaceutically acceptable carrier, for example, as those described below in the present invention. ^ j ^^^^^ fc ^ j »j | ^ g ^ M |