MXPA01006510A - Method for accelerating the rate of mucociliary clearance by using a kunitz-type serine protease inhibitor - Google Patents

Abstract

The instant invention provides for a composition and method for using Kunitz-type serine protease inhibitors, e.g., aprotinin or bikunin, for stimulating the rate of mucociliary clearance of mucus and sputum in lung airways of subjects afflicted with mucociliary dysfunctions such as cystic fibrosis.

Description

METHOD TO ACCELERATE THE RAPIDITY OF MUCOCILIAR DEPURATION USING A SERINE PROTEASE INHIBITOR KUNITZ TYPE Field of the Invention The present invention relates to compositions comprising protease inhibitor serine proteins that stimulate the speed of ucociliary clearance of mucus and sputum in the respiratory tract of the lung. The present invention also relates to methods for stimulating the rapidity of mucociliary clearance in mammals. BACKGROUND OF THE INVENTION Prob emic Atendi ode Mucociliary dysfunction, characterized by the inability of the ciliated epithelium to clear mucus and sputum in the lung airways, is a serious complication of chronic lung obstructive disorders such as chronic bronchitis. (CB) bronchiectasis (BE), asthma and especially cystic fibrosis (CF). Patients suffering from mucociliary dysfunction are particularly vulnerable to secondary bacterial infections. The treatment and maintenance of modalities for CF and other respiratory diseases associated with mucociliary dysfunction, and the need for improved treatments, have been described. See for example, Braga "Drugs in Bronchial Mucology, Raven Press, New York, 1989; Lethem et al, Am Rev. Respir. Dis. 142: 1053-1058, Patent No. 5,830,436, Fibrosi s Ci sti ca Cystic fibrosis is an autosomal recessive disease that causes abnormalities in the transport of fluids and electrolytes in the exocrine epithelium, and mutations have been found within the DNA coding of a protein called the transmembrane conductance regulator of the cystic fibrosis (CFTR) in virtually all patients with CF. Lung cells are particularly affected. Di Santagrese et al, Am J. Med. 66; 121-132 (1979) .In CF, the luminal border of the cell mucosa of the respiratory pathway does not respond to the activation of the protein kinase dependent on the cAMP of the membrane channels of the chlorine ion.The permeability of the cell to Cl is affected and the absorption of Na + through the membrane of the cell is accelerates, both of these desba Electrolyte sets tend to reduce the hydration level of the mucus from the respiratory pathway, thus contributing to viscous secretions of the lung characteristic of CF. Knowles, Clin. Chest, Med. 11:75 (1986). Opportunistic bacteria and mycoplasmas enter the respiratory tract of the lung and establish colonies within the mucus. The thick mucus associated with CF isolates these pathogens from the immune system. Since mucociliary clearance is reduced in patients with CF, bacterial clearance is also reduced. Then congestion and infection of the lung are common. The prolonged presence of these pathogenic agents invariably initiates inflammatory reactions that compromise lung function. Bedrossian et al., Human Pathol, 7: 195-204, 1976. The viscosity of mucus in lungs with CF is due in part to decreased mucus hydration as it is related to poor Cl channel function and concentration modification. of the sodium ion (NA ~) in the liquid of the surface of the respiratory route (ASL) that changes the speed of mucociliary clearance of the respiratory route (MCC). The mechanisms involved in the transport of mucus have been studied in vitro and in vivo. CB, CF and BE sputum are slowly transported by the ciliated epithelium of the mammal of the mucus-cleared bovine trachea (MDBT) (ills et al, J. Clin.Research 97 (1): 9-13, 1995) . The slow transportability of diseased sputum in the MDBT can be linked to its low electrolyte / osmolyte content (Wills et al, J. Resp. Crit. Care Med. 151 (4): 1255-1258, 1997). In fact, diseased sputum is known to have a low electrolyte content relative to plasma (Matthews et al., Am. Rev. Resp. Dis. 88: 199-204, 1963; Potter et al., Am. Rev. Resp. Dis-67 (1): 83-87, 1967; "To kiewicz et al, Am. Rev. Resp. Dis. 148 (4, Pt, 1): 1002-1007, 1993.) Additional studies in the MDBT have shown that the mobility of the diseased mucus is significantly improved by following the Sodium chloride treatment (Wills et al, 1995) Furthermore, clinical studies have shown that inhalation of a hypertonic saline solution, or epithelial sodium channel blocking amiloride (ENaC), can significantly increase MCC in the ill patients (Robinson et al, Thorax 52 (10): 900-903, 1997; App et al, Am. Rev. Resp. Dis. 141, 605-612, 1990) Recently, the relationship between clearance has been described of mucus and its ionic composition in vivo in the guinea pig model of tracheal mucus velocity (TMV) The in vivo studies show that an aerosol for 5 minutes of hypertonic saline solution transiently increases TMV. TMV was observed one minute after the aerosol in hypertonic saline solution (14.4%). TMV was 5.1 + _1.0 mm.min "1 (m = 9) in animals exposed to 0.9% saline compared to animals exposed to hypertonic saline that obtained 11.3 + _1.3 mm.min" 1 ( n = 9; p < 0.001) (Newton &Hall, 1977). Inhaled amiloride also caused an increase in TMV. A significant increase in TMV was observed 15 minutes after a 20 minute aerosol of amiloride (10mM). The TMV was 3.2 ^ 2.5 mm.min-1 (n = 9) in animals exposed to water compared to 8. I ^ 0 .3 mm.min "1 in animals exposed to amiloride (m = 8; p ^ 0.05 ) Newton et al, Ped. Pulm. S17, Abs 364, 1998) These agents appear to act by increasing the ionic content of the surface fluid of the respiratory tract (ASL) .The genetic clinical evidence of the subjects with pseudohypoaldosterism Systemic (SPHA) also supports the point that down-regulation of the epithelial sodium channel activity of the airways will increase mucociliary clearance in the lung.SPAH patients with loss of function in gene mutations for the epithelial sodium channel subunits, which did not have sodium absorption from the surfaces of the respiratory tract, they had increased the concentration of the sodium ion in the liquid of the nasal surface in comparison with the normal subjects, and had had an increase in 4 ve in the rapidity of mucociliary clearance in the lung compared to normal subjects (Kerem et al, New England J. Med. 341, 156-162, 1999). Recently, a serine protease called channel-activating protease-1 (CAP-1) has been found in the apical membrane of epithelial cells of the amphibian kidney Xenopus (A6 cells) (Vallet et al, Nature 389 (6651); 610, 1997). CAP-1 appears to modulate the activity of the Na + channel in this cell. Exposure of the apical membrane to the Kunitz bovine prototype inhibitor, aprotinin, reduced the transepithelial transport of Na + (Vallet et al, 1997: Chraibi et al, J. Gen. Physio. 111 (1): 127-138, 1998 ). The effect of bukinin (1-170), a human homolog of two Kunitz domains of bovine aprotinin (Delaria et al, J, Biol. Chem. 272 (18); 12209-12214, 1997; Marlor et al, J. Biol. Chem. 272 (18): 12202-12208, 1997), was evaluated using short circuit current (Isc) in cultured normal human bronchial epithelial cells (HBE) in vitro (McAulay et al, Ped. Pulm. , Abs 141, 1998). Bukinin (1.5 ug.ml "1: 70nM) significantly inhibited 54% Na + in Isc in normal HBE cells (n = 5-8; p < _0.05 ~) .In general, bikunin (70 nM) ) inhibited 58% of the baseline with Isc in 90 minutes In a further study, bikunin (5 ug.ml "l) significantly inhibited 84% of Na + in Isc in normal HBE cells (n = 6; < _0.01) while the alpha (1) inhibitor of serine proteases from the serpin-protease inhibitor family (ot? -PI (50 ug.ml "1) was without a significant effect.

In cultured human epithelial cells of the respiratory tract with cystic fibrosis, Isc was inhibited by bikunin (1-170) (1 ug / mL), and was inhibited by aprotinin (20 ug / mL). Two recent studies by a simple research group have shown an induced effect of the protease inhibitor in TMV. The oti-PI (10 mg) given 30 minutes before the immunogenic test of the antigen or 1 hour after the immunogenic test, attenuated the antigen-induced reduction in the TMV in allergic sheep, 6 hours after the immunogenic test (O '). Riordan et al, Am. J. Resp. Crit. Care Med. 97 (5): 1522-1528, 1977). In figure 1 in O'Riordan et al's 1977 paper, the authors showed that the self-administered ci-PI (without immunogenic antigen test) to the respiratory tract of allergic sheep had no effect on the baseline of the TMV in a period of 6 hours. In the second study, cti-PI was given 6 hours after the immunogenic test of the antigen and caused only a significant conversion of the antigen-induced drop in the TMV, 24 hours after the immunogenic test (O'Riordan et al. , J. App. Physio. 85 (3): 1086-1091, 1998). The authors argue that the mechanism for the effect of cci-PI is associated with its property of elastase ant i-neutrophilia, where neutrophil elastase is thought to be the enzyme responsible for the reduced rapidity of mucociliary clearance in its model . They reason that cci-PI can be used to treat mucociliary dysfunction caused by the release of neutrophil elastase induced by allergy in asthma (O'Riordan et al 1998); they did not speculate about the potential role in other respiratory diseases. Brief Description of the Invention The present invention is directed to the use of serine protease inhibitors of the Kunitz family, which stimulate the rapidity of mucociliary clearance (MCC) of mucus and sputum in the lung airways. Kunitz serine protease inhibitors can be used to treat lung diseases such as cystic fibrosis (CF) chronic bronchitis (CB) and bronchiectasis (BE) where mucus retention and accumulation is a major clinical problem. Up to now, prior art has not associated protease inhibitors with the ability to increase MAP's xapidity above the baseline rate. Serum protease inhibitors of the Kunitz type can also be used to treat chronic sinusitis, and the sticky ear where mucus retention and accumulation is a clinical problem. The current invention contemplates the use of serine protease inhibitor proteins that include Kunitz domains or Kunitz-like domains, for use in the method to stimulate MCC. In one embodiment of the invention, bovine protease inhibiting serine proteins, such as aprotinin and variants and fragments thereof such as those described in EP 821007, published on January 28, 1998 can be used in the practice of the invention . In another embodiment of the invention, human serine protease inhibitors are contemplated for use in the method for stimulating the rapidity of MCC. Representative examples of the human serine protease inhibitors include bikunin and variants and fragments thereof. same as those described in WO 97/33996, published September 18, 1997 (Bayer Corp.), and U.S. Pat. No. 5,407,915, published on April 18, 1995 (Bayer AG) which are hereby incorporated in their entirety. BRIEF DESCRIPTION OF THE DRAWINGS The invention will be better understood from a consideration of the following detailed description and claims, taken in conjunction with the drawings in which: Figure 1 details the nucleotide sequence of EST R35464 (SEQ ID NO .: 12) and the translation of this DNA sequence (SEQ ID NO: 13) which produces an open reading structure with some similarity of sequence to aprotinin. The translation product contains 5 of the 6 cysteines in the correct spacing that is characteristic of inhibitory domains similar to Kunitz (indicated in bold). The position normally occupied by the remaining cysteine (at codon 38) contains in its place a phenylalanine (indicated by an asterisk). Figure 2 details the nucleotide sequence of EST R74593 (SEQ ID NO: 14), and the translation of this DNA sequence (SEQ ID NO: 15) that produces an open reading structure with homology to the Kunitz class of the domains of serine protease inhibitors. The translation product contained 6 cysteines at the correct spacing that is characteristic for inhibitory domains similar to Kunitz (indicated in bold). However, this sequence of the reading structure includes stop codons at codon 3 and 23. Figure 3 details a deduced nucleic acid sequence from human placental bikunin (SEQ ID NO: 9), labeled "consensus" and paired with the translated protein amino acid sequence labeled "translation" (SEQ ID NO: 10). Also as a comparison, the nucleic acid sequence for ESTs H94519 (SEQ ID NO .: 16), N39798 (SEQ ID NO .: 17), R74593 (SEQ ID NO .: 14) is shown. and R35464 (SEQ ID NO .: 12). The nucleotides underlined in the consensus sequence correspond to the site of the PCR primers described in the examples. The amino acids underlined in the translated consensus sequence are residues whose identity has been confirmed by the formation of amino acid sequences of the bikunin of the purified natural human placenta. The amino acid and nucleotide codes are standard single-letter codes, "N" in the nucleic acid code indicates an unassigned nucleic acid, and "*" indicates a stop codon in the amino acid sequence. Figure 4A details the original diagram of a series of ESTs with some homology of nucleic acid sequences with the human placenta bikunin encoding the EST, or portions thereof. They show for reference the relative positions of bikunin (7-64) and bikunin (102-159), labeled KID1 and KID2 respectively. Figure 4B details a more detailed subsequent diagram of EST incorporating additional ESTs. The numbers in the axis of the upper X refer to the length in the base pairs, starting at the first base from the EST sequence plus in the 5 'direction. The length of each bar is in proportion to the length in the base pairs of the individual ESTs including spaces. The EST access numbers are indicated to the right of their respective EST bars. Figure 4C details the corresponding alignment of the oligonucleotide sequences of each of the illustrated ESTs shown schematically in Figure 4B.

The bikunin labeled in the upper sequence (SEQ ID NO: 51) represents the sequence of consensus oligonucleotides derived from nucleotides that overlap at each position. The numbers refer to the position of the base pair within the EST map. The oligonucleotides in EST R74593 that are underlined and in bold (at map positions 994 and 1005) are base inserts observed in R74593 that were consistently absent in each of the other overlapping ESTs. Figure 4D details the amino acid translation of the oligonucleotide consensus sequence for the bikunin detailed in Figure 4C (SEQ ID NO: 45). Figure 4E details the nucleotide sequence (SEQ ID NO .: 46) and the corresponding translation of the amino acids (SEQ ID NO .: 47) of a placental bikunin coding sequence that is derived from a collection of human placental cDNA by PCR-based amplification. Figure 4F details the nucleotide sequence (SEQ ID NO .: 48) and the corresponding translation of the amino acids (SEQ ID NO: 49) of a natural human placental bikunin coding clone that was isolated from a lambda cDNA library of human placenta by colony hybridization. The . Figure 4G compares the alignment of the known amino acid oligonucleotide sequences for the placenta bikunin obtained by EST overlap (SEQ ID NO: 45), PCR-based cloning (SEQ ID NO .: 47), and conventional colony hybridization lambda (SEQ ID NO: 49). Figure 5 shows a graph of the purification of human placenta bikunin from placental tissues after filtration with Superdex 75 gel. The graph is a superposition of the protein elution profile as measured by OD 280 nm (FIG. solid line), the activity of the protein eluted in a trypsin inhibition assay (% inhibition shown in rounds) and the activity of the protein eluted in a kalikrein inhibition assay (% inhibition shown by the squares). Figure 6 shows a graph schematizing the purification of human placenta bikunin from placental tissue using C18 reverse phase chromatography. The graph is a superposition of a protein elution profile as measured by OD 215 nm (solid line), the activity of the protein eluted in a trypsin inhibition assay (% inhibition shown by the circles) and the activity of the protein eluted in an inhibition assay of kalikrein (% inhibition shown per square). Figure 7 details a silver-colored SDS-PAGE gel of a highly purified placenta bikunin (lane 2), and a series of molecular size marker proteins (lane 1) of the indicated sizes in kilodalloons. The migration was from the top to the bottom. Figure 8 shows the amount of the trypsin inhibitory activity present in a cell-free fermentation broth from the growth of yeast strains SC101 (panel 8A) or WHL341 (panel 8B) that were stably transformed with a plasmid that directs the expression of placenta bikunin. Figure 9 shows a silver-colored SDS-PAGE (9A) and a Western blot with an anti-placental bikunin (102-159) pAb (Figure 9B) of a growth cell-free fermentation broth from the yeast strain SC101 (recombinants 2.4 and 2.5) that were stably transformed with a plasmid that directs the expression of bovine aprotinin or placental bikunin (102-159). The migration was from the top to the bottom. Figure 10 is a photograph showing silver-colored SDS-PAGE of highly purified placental bukunin (102-159) (lane 2) and a series of molecular size marker proteins (lane 1) of the indicated sizes in kilodal tones The migration was from the top to the bottom. Figure 11 is a photograph showing the • results of Northern blots of mRNA from various human tissues that hybridized to a 32P labeled cDNA probe that encodes either the placental bikunin (102-159) (figure HA) or encodes placenta bikunin (1- 213) (figure 11B). The migration was from the top to the bottom. The numbers to the right of each spotting refer to the kilobase size of the adjacent RNA markers. The organs from which the mRNA was derived, are described in each track of the stain. Figure 12 details a placental bikunin immunoblot derived from placenta with a rabbit antiserum cross-checked against synthetic reduced placenta bikunin (7-64) (Figure 12A) or 102-159 (Figure 12b). For each set, the contents were: molecular size markers (tracks 1); natural placenta bikunin isolated from the human placenta (lanes 2); synthetic placenta bikunin (7-64) (lanes 3) and synthetic placenta bikunin (102-159) (lanes 4). SDS-PAGE gels of 10-20% tricine were stained and developed with a primary polyclonal antibody purified with protein A (8 ug IgG in 20 ml 0.1% BSA / Tris buffer saline (pH 7.5), followed by a secondary antibody from goat anti-rabbit conjugated with an alkaline phosphatase The migration was from the upper part to the lower part Figure 13 details a SDS-PAGE gel of 10-20% tricine colored with Coomassie blue of 3 micrograms of placenta bikunin highly purified (1-170) derived from a baculovirus / Sf9 expression system (lane 2) Lane 1 contains molecular size markers The migration was from the upper to the lower part Figure 14 details a comparison of the effect of increasing concentrations of human placenta bikunin derived from Sf9 (1-170) (full circles), synthetic placenta bikunin (102-159) (open circles), or aprotinin (open squares) at the activated partial time of thromboplastin a of human plasma. The coagulate was started with CaCl2. The concentration of the proteins is plotted against the prolongation in multiples of the clotting time. The non-inhibited time of coagulation was 30.8 seconds. Figure 15 illustrates the effect of bikunin at dose levels of 2uM and 0.2 uM in relation to amiloride (100 uM) and Hank's balanced salt solution (HBSS) (control) on potential differences in guinea pig trachea of the Indies with a subsequent treatment of 3 hours. Figure 16 illustrates (a) the positioning of the instillation syringe and the beta probe in relation to the trachea of the guinea pig; (b) a representative graph for the measurement of the mean speed of the trachea (TMV) using S. cerevi sa e; labeled 32P; and (c) a sustained increase in TMV in vivo in guinea pigs in response to bikunin (5 ug) relative to control of the HBSS vehicle at 1.5, 1.75, 2.0, 2.25 and 2.5 hours after tracheal instillation. Figure 17 illustrates that bikunin (70 nM) decreases the current sodium in human bronchial epithelial cells cultured in vitro in relation to amiloride (10 uM). Figure 18 illustrates the effect of a 5 minute aerosol of hypertonic saline (14.4%) by increasing the TMV following an aerosol treatment in the guinea pig trachea. Figure 19 illustrates the effect of a 20 minute aerosol of amiloride (10 mM) on the TMV following the aerosol treatment in a guinea pig trachea. Figure 20 illustrates that bikunin (5 ug / mL), aprotinin (5 ug / mL), and aprotinin double mutein (0.5 ug / mL, 1.5 ug / mL and 5 ug / mL) decrease the short circuit current of sodium in human bronchial cells cultured in vitro. Figure 21 illustrates that aprotinin (1 ug / mL) inhibited Isc in vitro in human bronchial epithelial cells with CF. Figure 22 illustrates that the bikunin aerosol (3 mL of 3 ug / mL) significantly increases TMV in sheep relative to the PBS control. Figure 23 illustrates that bikunin (50 ug / mL) inhibited sodium current in vitro in tracheal epithelial cells of guinea pigs for a period of 30 minutes. Figure 24 illustrates that bikunin (100 ug / mL) significantly inhibited sodium current in vitro in sheep tracheal epithelial cells for a period of 90 minutes. Figure 25 illustrates that (a) exposure to LPS caused a significant influx of PMN and that (b) bikunin significantly inhibited the potential difference in guinea pigs.

Indians pre-exposed to LPS. Figure 26 illustrates that the double aprotinin mutein (10 ug) increased the TMV in vivo in guinea pigs relative to HBSS for a sustained period of 1.5 to 2.5 hours after administration. Figure 27 depicts a plasmid map of pBC-BK (CMV-IE = immediate cytomegalovirus early, DHFR = dihydrofolate reductase, AMP-r = resistance to ampicillin). Figure 28 illustrates that (a) bikunin expressed in CHO (1-170) (10 ug / mL) decreases sodium current in vitro in human bronchial epithelial cells with CF for a period of 90 minutes and (b) bikunin of CHO (1-170) at 1.5 and 10 ug / mL and aprotinin at 20 ug / mL decrease the sodium current in 90 minutes after apical application to human bronchial epithelial cells of CF in vitro. Figure 29 illustrates the process steps for purifying bikunin (1-170) from a CHO cell expression system. Figure 30A shows a graph of the migration of isoforms of purified bikunin CHO (1-170) using C18 reverse phase chromatography. The graph is a superposition of the elution profile of the protein as measured by the absorbance at 280 nm (solid line) and the percentage of acetonitrile in 0.1% trifluoroacetic acid used to elute the protein (diamonds). Figure 30B is a photograph showing a silver-colored SDS-PAGE of glycosylated isoforms (lanes 45-55) of purified bikunin (1-170) expressed from an expression system of CHO cells and a series of marker proteins of molecular size (between lanes 54 and 55) of the sizes indicated in kilodaltons. The migration was from the top to the bottom. Figure 31 is a photograph showing a silver-colored SDS-PAGE of a treated N-glycosidase F (lanes 2 and 4) and untreated (lanes 1 and 3) of purified bikunin isoforms (1-170) of CHO and a series of marker proteins of molecular size of the sizes indicated in kilodaltons. The migration was from the top to the bottom. Detailed Description of the Invention The present invention relates to compositions comprising serotonin protease inhibitor proteins of the Kunitz type and fragments thereof which stimulate the rapidity of mucociliary clearance of mucus and sputum in the respiratory tract of the lung. The compositions also encompass a new identified human protein called here the human placenta bikunin containing two inhibitory serine protease domains of the Kunitz class.

The present invention also provides methods for stimulating the rapidity of mucociliary clearance in patients with mucociliary dysfunction wherein an effective amount of the described serine protease inhibitors of the present invention is administered in a vehicle biologically compatible to the patient. A preferred application of placental bikunin, isolated domains, and other variants, is to stimulate mucociliary clearance in patients with CF, part of the therapy and administration of the disease. These methods and compositions reduce or eliminate the accumulation of mucus and sputum in the airways of the lung in patients with chronic obstructive pulmonary disease, thereby reducing the risk of secondary infections of the lung and other adverse side effects, as well as avoiding or delaying the need for lung transplant surgery in patients with CF. The method of the present invention contemplates the use of aprotinin to stimulate MCC. Aprotinin has been shown to reduce transepithelial transport of Na + in the apical membrane of epithelial cells of the kidney of the amphibian Xenopus (A6 cells) (Vallet et al 1997: Chraibi et al 1998). The mechanism of action of aprotinin has been proposed to involve the inhibition of CAP-1, a protease involved in the modulation of Na + channel activity in A6 cells. Bikunin (1-170) a human homolog of the two Kunitz domain of bovine aprotinin (Delaria et al 1997; Marlor et al 1997), also showed that it significantly inhibits the short circuit current (Isc) in normal cultured human bronchial epithelial cells (HBE), in vitro (McAulay et al 1998). Bikunin (1.5 ug, ml "1: 70 nM) significantly inhibited 54% of Na + in Isc in normal HBE cells ((n = 5-8, p <0.05) .In general, bikunin (70 nM) inhibited 58% of Isc in the baseline by 90 minutes In a further study, bikunin (5 ug.ml "l) significantly inhibited 84% of Na + in Isc in normal HBE cells (n = 6); p < _0.01) while the serine protease inhibitor of the serine alpha (1) -protease inhibitor (oti-PI) family (50 μg.mL "1) did not have a significant effect. human epithelial respiratory tract with cystic fibrosis cultured in vitro, Isc was inhibited by bikunin (1-170) (1 ug / mL), and was inhibited by aprotinin (20 ug / mL). observations, Kunitz-type serine inhibitors such as aprotinin, placenta bikunin and fragments thereof are considered therapeutic for the treatment of mucociliary dysfunction, including clista fibrosis. "Kunitz inhibitor" means a protease inhibitor; structurally, a "Kunitz inhibitor" or "Kunitz domain" is a protein or protein domain, typically about 60 amino acids in length and containing three disulfide bonds (See Laskowske &Kato, Ann. Rev. Biochem. 49, 593-626, 1980). An important advantage of the Kunitz domains of the serine protease inhibitor, bikunin and fragments and analogs thereof of the present invention, is that they are human proteins, and also less positively charged than Trasylol® (example 1), thus the risk of damage to the kidney in the administration of large doses of proteins is reduced. Being of human origin, the protein of the present invention can thus be administered to human patients with significantly reduced risk of undesirable immunological reactions compared to the administration of similar doses of Trasylol®. In addition, bikunin (102-159), bikunin (7-64), and bikunin (1-170) have been found to be significantly more potent inhibitors of plasma kalikrein than Trasylol® in vitro (example 3, 4 and 10). Thus bikunin and fragments of it are expected to be more effective in vivo in relation to aprotinin. The amount of the pharmaceutical composition to be used will depend on the recipient and the condition to be treated. The required amount can be determined without undue experimentation by protocols known to those skilled in the art. Alternatively, the amount required can be calculated based on the determination of the amount of the target protease such as plasmin, kalikrein or prostasin, which must be inhibited in order to treat the condition. Since the active materials contemplated in this invention are intended to be non-toxic, the treatment preferably involves the administration of an excess of the optimally required amount of active agent. To stimulate the rapidity of mucociliary clearance in patients with chronic lung obstructive disease, the proteins of the present invention can be used as Aprotinin Trasylol® while taking into account the differences in potency. The use of Trasylol® is detailed in the Physicians Desk Reference, 1995, listed as a complement to Trasylol®. Briefly, with the patient in a supine position, the cargo dose of placental bikunin, isolated domain or other variant is given by infusion slowly for about 20 to 30 minutes. In general, a total dose of between about 2x610 KIU (inhibitory units of kalikrein) and 8X106 KIU will be used, depending on factors such as the weight and condition of the patient. The preferred loading doses are those containing a total of 1 to 2 million inhibitory units of kalikrein (KIU). The proteins of the present invention, are used in pharmaceutical compositions formulated in the manner known in the art. Such compositions contain active ingredients plus one or more carriers, diluents, fillers, binders and other pharmaceutically acceptable excipients depending on the route of administration and dosage form contemplated. Examples of the therapeutically inert organic or inorganic carriers known to those skilled in the art include, but are not limited to, lactose, corn starch or derivatives thereof, talc, vegetable oils, waxes, fats, polyols such as polyethylene glycol, water , sucrose, alcohols, glycerin and the like. Various emulsifying preservatives, dispersants, flavorings, wetting agents, antioxidants, sweeteners, colorants, stabilizers, salts, buffers and the like may also be added as required to assist in the stabilization of the formulation or to help increase the bioavailability of the compositions. active ingredients or to produce an acceptable flavor or odor formulation in the case of oral, nasal, or pulmonary dosing. The inhibitor employed in such compositions may be in the form of the original compound itself, or optionally in the form of a pharmaceutically acceptable salt. The compositions thus formulated are selected as required for the administration of the inhibitor by any appropriate mode known to those skilled in the art. Methods of parenteral administration include intravenous (i.v), subcutaneous (s.c), intraperitoneal (i.p), and intramuscular (i.m) routes. Intravenous administration can be used to obtain an acute regulation of peak plasma concentrations of the drug as may be needed. Alternatively, the medicament can be administered at a desired rate continuously by intravenous catheter. Suitable vehicles include sterile, non-pyrogenic aqueous diluents, such as sterile water for injection, sterile buffer solutions or sterile saline. The resulting composition is administered to the patient before and / or during surgery by injection or intravenous infusion. The improved half-life and drug targeting to phagosomes such as neutrophils and macrophages involved in inflammation can be supported by entrapping the drug in liposomes. It should be possible to improve the selectivity of the liposomal attack by incorporating it into the exterior of the liposome ligands which bind to the macromolecules specific for target organs / tissues such as the Gl tract and the lungs. Alternatively, injectable im or sc injection with or without encapsulation of the medicament into degradable microspheres (eg, comprising poly-DL-lactide-co-glycolide) or protective formulations containing collagen, can be used to obtain a sustained sustained release of the medication. For improved convenience of the dosage form, it is possible to use an implanted intraperitoneal reservoir and a septum such as a Percuseal seal system. Improved comfort and patient compliance can also be achieved through the use of either injection pens (eg, Novo Pin or Q pen) or needle-free jet injectors (eg, Bioject, Mediject or Becton Dickinson). The precisely controlled release can also be achieved using implantable pumps with delivery to the desired site by means of a cannula. Examples include the subcutaneously implanted osmotic pumps of ALZA such as the ALZET osmotic pump. Oral delivery can be achieved by incorporating the drugs in tablets, coated tablets, dragees, soft and hard gelatin capsules, solutions, emulsions, suspensions or coated enteric capsules, designed to release the drug into the colon where the protease activity digestive is low. Examples of the latter include the OROS-CT / Osmet ™ system from ALZA and the PULSINCAP ™ system from Scherer Drug Delivery Systems. Other systems use cross-linked azo polymers that are degraded by specific bacterial azoreductases of the colon, or pH-sensitive polyacrylate polymers that are activated by the elevation of the pH in the colon. The above systems can be used in conjunction with a wide range of available absorption enhancers. Rectal delivery can be achieved by incorporating medications in suppositories. Nasal delivery can be achieved by incorporating the medication in carriers of bioadhesive particles (<200 mm) such as those comprising cellulose, polyacrylate or polycarbophil in conjunction with appropriate absorption enrichers such as phospholipids or acylcarnitine. Commercially available systems include those developed by Dan Biosis and Scios Nova. To stimulate the rapidity of mucociliary clearance, the preferred mode of administration of the placental bikunin variants of the present invention is by pulmonary delivery. The Kunitz-type serine protease inhibitors described herein can be administered to the lungs of a subject by any available means but are preferably administered by administering an aerosol suspension of respirable particles comprising the active compound which is inhaled by the subject. The respirable particles can be liquid or solid. They can deliver dry micron sized powders containing the drug in an appropriate carrier such as mannitol, sucrose, or lactose to the surface of the lung airways using dry powder inhalers such as those of Inhale ™, Dura ™ Fisons ( Spinhaler ™), and Glaxo (Rotahaler ™), or Astra's propellant-based metered-dose inhalers (Turbohaler ™). They can deliver solution formulations with or without liposomes using nebulizers. The aerosols of liquid particles comprising the protein can be produced by any appropriate means, such as a pressure-driven aerosol nebulizer or an ultrasonic nebulizer. See for example, U.S. Pat. No. 4,501,729. Nebulizers are commercially available devices that transform the solutions or suspensions of the active ingredient into a mist of therapeutic aerosol, either by accelerating a compressed gas typically air or oxygen, through a narrow venturi or through the ultrasonic agitation. Formulations suitable for use in nebulizers consist of the active ingredient in a liquid carrier. The carrier is typically water (and more preferably sterile pyrogen-free water) or a dilute aqueous alcohol solution preferably made isotonic with body fluids by the addition of for example, sodium chloride. Optional additives include preservatives if the formulation is not rendered sterile for example, methyl hydroxybenzoate, antioxidants, flavoring agents, volatile oils, buffering agents and surfactants. The solid particulate aerosols comprising the protein may similarly be produced with any aerosol generator of medicaments in solid particles. Aerosol generators for administering the medicaments of solid particles to a subject produce particles that are respirable as explained above, and generate an aerosol volume containing a predetermined metered dose of a medicament at a rate appropriate for human administration. An illustrative type of an aerosol generator of solid particles is an insufflator. Formulations suitable for administration by insufflation include finely ground powders which can be delivered by means of an insufflator or taken into the nasal cavity in the manner of a breath. In the insufflator, the powder (for example, a measured dose of the same effective to carry out the treatments described herein) is contained in capsules or cartridges, typically made of gelatin or plastic, which are perforated or opened in situ and the powder that delivered by air is passed through the device by inhalation or by means of a manually operated pump. The powder employed in the insufflator consists of either only the protein or a mixture of powders comprising the protein, an appropriate diluent of the powder such as lactose and an optional surfactant. A second type of illustrative aerosol generator comprises a metered dose inhaler. The metered dose inhalers are pressurized aerosol dispensers that typically contain a suspension formulation or solution of the active ingredient in a liquefied propellant. During its use, these devices discharge the formulation through a valve adapted to supply a measured volume, typically from 10 to 200 uL, to produce an atomization of fine particles containing the protein. Suitable propellants include certain chlorofluorocarbon compounds, for example, dichlorodifluoromethane, trichlorofluoromethane, dichloroteturofluoroethane, and mixtures thereof. The formulation may additionally contain one or more cosolvents for example, ethanol, surfactants, such as oleic acid or sorbitan trioleate, antioxidants and appropriate flavoring agents. For the dry powder inhaler devices or metered dose inhalers, the aerosol is formed from solid or liquid particles, it can be produced by the aerosol generator at a speed from about 5 to 150 liters per minute, more preferably from around from 10 to 100 liters per minute and more preferably for metered dose inhalers from about 10 to 50 liters per minute and more preferably for dry powder inhalers around 60 liters per minute. The aerosols generated by the nebulizer, jet or ultrasonic, can be produced by the aerosol generator at a rate from about 1 to 100 liters per minute more preferably from about 4 to 10 liters per minute. Aerosols that contain higher amounts of protein can be administered more quickly. The dose of the protease inhibitor will vary depending on the condition to be treated and the condition of the subject. The daily dose can be divided among one or several unit dose administrations. The daily dose in weight can range from about 0.01 to 20 milligrams of respirable particles for a human subject, depending on the age and condition of the subject. The pharmaceutical formulations in solid or liquid particles containing protease inhibitors of the present invention, must include particles of respirable size, that is, particles of a size small enough to pass through the mouth and larynx by inhalation and into the bronchi and alveoli of the lungs. In general, particles ranging from about 1 to 8 microns in size (more particularly less than about 6 microns in size) are respirable. Particles of non-respirable size that are included in the aerosol, tend to deposit in the throat and are preferably minimized by swallowing the amount of non-respirable particles in the aerosol. For nasal administration, a particle size in the range of 10-500 microns is preferred to ensure retention in the nasal cavity. In the manufacture of a formulation according to the invention, the protease inhibitor is typically mixed with, inter alia, an acceptable carrier. The carrier must of course be acceptable in the sense of being compatible with any other ingredient in the formulation and should not be harmful to the patient. The carrier can be a solid or a liquid or both, and is preferably formulated with the compound as a unit dose formulation eg, a capsule which can contain from 0.5% to 99% by weight of the active compound. One or more active compounds can be incorporated into the formulations of the invention whose formulations can be prepared by any of the well-known pharmacy techniques consisting essentially of the mixture of the components. The compositions containing respirable dry particles of the protease inhibitor can be prepared by grinding the inhibitor with a mortar and grinder, and then passing the micronized composition through a 400 mesh screen to separate or break up the large agglomerates. The pharmaceutical composition may optionally contain a dispersant which serves to facilitate the formation of an aerosol. An appropriate dispersant is lactose, which can be mixed with the active agent in any appropriate ratio (e.g., a one to one weight ratio). If desired, general gene therapy strategies ex vivo and in vivo can be employed to deliver the nucleic acid constructs encoding the serotonin protease inhibitor proteins of the Kunitz type such as bikunin, aprotinin or fragments and variants thereof. same as those described in WO 97/33996 (Bayer Corp.) and US Pat. No. 5,407,915 (Bayer AG). Gene therapy techniques that rely primarily on viruses have been used to transform lung cells as a means to treat the manifestations of CF in the lung and in associated extra-rapullar tissues. See WO 93/03709, published March 3, 1993, which describes the use of retroviral and non-retroviral vectors (for example, adenoviruses, viruses, and adeno-associated viruses) for the stable expression of the CFTR gene in patients with CF. Alternatively, non-viral methods for delivery of exogenous nucleic acids are also known and contemplated for use in the present invention. See WO 93/12240, published June 24, 1993 and references cited therein, which describe transcription or expression tapes that include the coding sequence for a CFTR molecule that is operably linked to functional regulatory sequences in a mammal. The nucleic acid constructs are then delivered to the airways and alveolus of the lung in a variety of ways including aerosol delivery alone or in combination with lipid base complexes, for example, Lipofectin ™. WO 95/26356, published October 5, 1995, discloses representative examples of the lipids used useful for transfection. It is therefore contemplated in the present invention that nucleic acid molecules encoding serine protease inhibitors of the Kunitz type such as bikunin, aprotinin or variants and fragments thereof, can be administered similarly to the lung airways by any Appropriate gene therapy method with a means to stimulate the rapidity of mucociliary clearance of mucus and sputum in a subject in need of such treatment. Search of the human sequence data The existence of a different human protein homolog in function of aprotinin is deduced following a particular analysis of sequence input with the tagged database of the expressed sequence (hereinafter referred to as dbEST). ) at the NCBI (National Center for Biological Information, Maryland). Using the TblastN algorithm (BLAST, or basic local alignment search tool, use the method of Altschul et al, (1990) J. Mol Biol 215, 00 403-410, to look for similarities between an interrogation sequence and all sequences In a database, protein or nucleic acid in any combination, the database was examined for nucleotide sequences that support homology to the sequence of the pre-pro-aprotine of bovine, Trasylol® This search for different clones it was selectively narrowed to two particular clones that could possibly encode a deduced amino acid sequence that would correspond to a homolog of the human protein as a function of aprotinin The selected nucleic acid sequences were R35464 (SEQ ID N0: 12) and R74593 (SEQ ID N0: 14) that were generated from a collection of nucleic acids from human placentas The protein sequence translated into the open reading structure s for R35464 (SEQ ID NO: 13) omitted one of the 6 cysteines that are critical for the formation of the covalent structure of the Kunitz domain, meaning that the nucleic acid sequence of R35464 could not result as a functional inhibitor. Similarly, the longest translated open reading structure of clone R74593 (SEQ ID NO: 15) contained a 5 'stop codon in the region encoding the Kunitz-like sequence, meaning that this sequence could not be translated to result in a functional segregated Kunitz domain. The importance of these sequences alone was not clear. It was possible that they represented a) the products of the pseudo genes, b) regions of the untranslated mRNA, or c) viable mRNA products that had been sequenced incorrectly. Discovery of human B ± kunin To specifically isolate and determine the current human sequence, cDNA primers were designed that were capable of hybridizing sequences located at 5 'and 3' of the cDNA segment encoding our proposed Kunitz-like sequences found within of R35464 and R74593. The primers used to amplify a fragment encoding the Kunitz-like sequence of R74593 were CGAAGC-TTCATCTCCGAAGCTCCAGACG (the 3 'primer with a HindIII site SEQ ID NO: 33) and AGCATCTAGACAATAATTACCTGACCAAGGA (the 5' primer with a Xbal site SEQ ID NO: 34). These primers were used to PCR amplify (30 cycles) a base pair 500 product from a clontech human placental cDNA library (MATCHMAKER, Cat # HL4003AB, Clontech Laboratories, Palo Alto, CA), which was subcloned inside a Bluescript-SK + and formed sequences with the T3 primer with a case of Sequenase ™ version 2.0. Surprisingly, the sequence of the fragment obtained using our primers was different from the sequence listed in the dbEST database for clone R74593. In particular, our new sequence contained an additional guanosine base inserted 3 'to the putative stop codon, but 5' to the coding segment of the Kunitz-like sequence (Figure 3). The insertion of an additional G changed the stop codon outside the reading structure by the Kunitz-like domain (G in the base pair 114 of the sequence corrected for R74593, figure 3). The subsequent interrogation sequence of the dbEST for sequences homologous to the Kunitz-like peptide sequence of R74593 resulted in H94519 derived from the human retinal collection and N39798. These sequences contained a sequence similar to Kunitz that was almost identical to the Kunitz-like domain encoded in R35464 except that it contained all 6 characteristic cysteines. The superposition of each of the nucleotide sequences with that of R74593 (corrected for the insertion of G in base pair 114) and R35464, was used to obtain a consensus nucleotide sequence for a partial human placenta bikunin (SEQ ID. NO: 9, figure 3). The translated consensus sequence resulted in an open reading structure extending from residue -18 to +179 (figure 3, full translation SEQID NO: 10) containing two complete sequences from the Kunitz-like domain, within the region of amino acid residues 17-64 and 102-159 respectively. Additional efforts were attempted to obtain the 5 'additional sequence by the dbEST interrogation sequence with the sequence of R35464. The possible matings of such searches, which possessed the additional 5 'sequence, were in turn used to reformulate the interrogation sequence in the dbEST. In such an iterative mode, a series of 5 'underlying sequences that include the clones were identified H16866, T66058, R34808, R87894, N40851 and N39876 (figure 4). The alignment of some of these sequences suggests the presence of a 5 'ATG that could serve as a starting site for the synthesis of the consensus sequence of the translated protein. From this selected information, it was now possible to selectively screen and determine the nucleic acid and polypeptide sequences of a human protein with aprotinin homologous function.

The reformulation of the dbEST interrogation revealed a variety of new EST entries shown schematically in Figure 4B. Overlaying them with the additional ESTs allowed us to construct a much longer consensus oligonucleotide sequence (Figure 4C), which extended both 5 'and 3' beyond the original sequence of oligonucleotides detailed in Figure 3. In fact , the new sequence of a total length of 1.6 kilobases extended to the 3 'end poly-A. The increasing number of ESTs underlying each base pair position along the sequence improved the level of confidence in certain regions such as overlapping sequences with the 3 'end of EST R74593 (Figure 3). Several ESTs underlying this region corroborated two critical base eliminations relative to R74593 (located as bold underlined in Figure 4C, map positions 994 and 1005). The translation of the new consensus sequence (figure 4D) into the structure coding for bikunin, resulted in a placenta bikunin form that was larger (248 amino acids) than the mature sequence (179 amino acids) encoding the original consensus (SEQ ID N0: 1), and was finalized by a stop codon structure within the consensus of the oligonucleotide. The increase in size was due to a change in the structure in the 3 'coding region resulting in the elimination of the two particular base inserts for the EST R74593. The structure change moved the stop codon of the original consensus (figure 3) out of the structure that allowed reading through the new structure that encoded the additional amino acid sequence. The new translation product (figure 4D) was identical to the sequence of the original consensus protein (SEQ ID NO: l) between residues +1 to +175 (coding Kunitz domains), but contained a new extension in the terminal C showing a long transmembrane domain of 24 residues (underlined in Figure 4D) followed by a short cytoplasmic domain of 31 residues. The precise sequence around methionine as the initiator and signal peptide was somewhat tentative due to the considerable heterogeneity among the ESTs underlying this region. The analysis of the protein sequence by Geneworks ™, highlighted the asparagine residues at positions 30 and 67 as consensus sites for the N-linked glycosylation. Asparagine 30 was not observed during the formation of N-terminal sequences of the full-length protein isolated from human placenta, consistent with that which was glycosylated. Cloning of human bikunin The existence of a human mRNA corresponding to the putative nucleotide sequence of human bikunin, inferred from the analysis of Figure 3, is confirmed as follows. The nucleic acid primer that hybridizes 5 'to the Kunitz cDNA coding sequence of R35464 (base pair 3-27 of the consensus nucleotide sequence in Figure 3): GGTCTAGAGGCCGGGGTCGTTTCTCGCCTGGCTGGGA (a 5 'primer derived from the sequence R35464 with an Xbal site, SEQ ID NO: 35), and the nucleic acid primer that hybridizes to the 3' in the Kunitz coding sequence of R74593 (base pair 680-700 of the consensus nucleotide sequence in Figure 3), a fragment of the expected size (almost 670 base pairs) of a cDNA consensus nucleotide sequence was used to amplify by PCR, from a human placental collection from Clontech, encoded the placental bukunin sequence of Figure 3 (shown schematically in Figure 4A.) By using a 5 'primer that hybridizes a sequence in R87894 which is a base pair 126 5' to the assumed ATG starting site discu above, (shown schematically in Figure 4A in base pair 110) plus the same 3 'primer to R74593 as used above, it was possible to amplify a fragment from a human placental collection of Clontech of the expected size (approximately 872 base pairs) predictable by the underlying layer EST (shown schematically in Figure 4). Sequence formation of fragment 872 b.p. showed that it contained a nucleotide segment corresponding to the base pairs 110 to 218 of EST R87894 at its 5 'end and base pairs 310 to 542 of the consensus placental bikunin sequence inferred from the EST overlay analysis (from Figure 3 ), at its 3 'end. This 3 'nucleotide sequence contains the entire Kunitz-like domain encoded by placental bikunin (102-159). To obtain a cDNA encoding the complete extracellular region of the protein, the following 5 'PCR primer: CACCTGATCGCGAGACCCC (SEQ ID NO: 36) designed to hybridize a sequence within EST R34808, was used with the same 3' primer to the EST 74593 to amplify (30 cycles) a product of approximately 780 base pairs of cDNA from the human placental cDNA library. This product was gel purified and cloned into a TA vector (Invitrogen) to form the DNA sequence by the dideoxy method (Sanger et al., (1977) Proc. Nati. Acad. Sci (EUA), 74, pages 5463- 5497) with the following primers: Specific vector: GATTTAGGTGACACTATAG (SP6) (SEQ ID NO: 37) TAATACGACTCACTATAGGG (T7) (SEQ ID NO: 38) Specific Gene: TTACCTGACCAAGGAGGAGTGC (SEQ ID NO .: 39) AATCCGCCATTCCTGCATTCCTGCTGGTG (SEQ ID NO .: 40) CAGTCACTGGGCCTTGCCGT (SEQ ID NO: 41) The resulting sequence of cDNA is detailed in Figure 4E together with its translation product.

At the nucleotide level, the sequence showed only minor differences of the EST consensus sequence (Figure 4D). The translation of the sequence resulted in a coding sequence containing an ATG starter site in the structure, signal peptide and mature placenta bikunin sequence and the transmembrane domain. The translated sequence of the PCR product lacked the last 12 amino acid residues of the cytoplasmic domain as a consequence of the selection choice of the 3 'primer for PCR amplification. This choice of the 3 'PCR primer (designated based on the sequence of R74593) was also responsible for the introduction of an artificial mutation S to F at amino acid position 211 of the translated sequence derived from PCR. The signal peptide deduced from the translation of the PCR fragment was somehow different from that of the EST consensus. To obtain a full-length placental bikunin cDNA, the PCR-derived product (Figure 4E) was gel purified and used to isolate a non-PCR-based full-length clone representing the bikunin sequence. The cDNA sequence derived from PCR was labeled with 32P-CTP by High Prime (Boehringer Mannheim) and used to probe a placental cDNA library (Stratagene, Unizap® collection?) Using colony hybridization techniques. Approximately 2 x 106 phage plaques were subjected to 3 rounds of screening and plaque purification. It was appreciated that two clones had the full length (about 1.5 kilobases) as determined by the enzyme restriction analysis and based on the comparison with the size of the EST consensus sequence (see above). Sequence formation of one of these clones by the dideoxy method resulted in the oligonucleotide sequence detailed in Figure 4F. The translation product of this sequence resulted in a protein with an initiating methionine in the structure, signal peptide and mature sequence of placental bikunin. The mature sequence of placental bikunin was identical to the mature sequence of the protein _ derived from the EST consensus translation although the sequence lengths and sequences of the signal peptide differed. Unlike the PCR-derived product, the cDNA derived by colony hybridization contained the complete ectodomain, transmembrane domain, cytoplasmic domain and codon detection in the structure. In fact, the clone stretched all the way to the poly-A endpoint. The initiator methionine was followed by a hydrophobic signal peptide that was identical to the signal peptide encoded in the clone derived by PCR. Subsequently, soluble fragments of the placental bikunin, bikunin 1-170 of the Sf9 cells (Example 9) and CHO cells (Example 17) were expressed and purified and found to be functional protease inhibitors.

(Examples 10 and 18). Additionally, a soluble fragment of the placental bikunin that was also an active protease inhibitor was isolated from the human placenta (Example 7). Based on the above observations, it appears that the full-length placenta bikunin has the ability to exist as a transmembrane protein on the surface of cells, as well as a soluble protein. Other transmembrane proteins containing the Kunitz domains are known to undergo proteolytic processing to result in mixtures of associated forms of membranes and soluble ones. These include two forms of the amyloid precursor protein designated APP751 (Esch F., et al., (1990) Science, 248, pages 1122-1124) and APP 770 (Wang R., et al., (1991), J. Biol. Chem, 266, pages 16960-16964). Contact activation is a process that is activated by the exposure of damaged vascular surfaces to the components of the coagulation cascade. Angiogenesis is a process that involves local activation of plasmin on endothelial surfaces. The specificity of the placenta bikunin and its supposed ability to anchor to cell surfaces suggests that the physiological functions of the transmembranous placenta bikunin may include the regulation of contact activation and angiogenesis. The amino acid sequences for placental bikunin (7-64), bikunin (102-159), and full-length placenta bikunin (Figure 4F) were searched against the PIR protein databases (Version 46.0) and PatchX (Version 46.0) as well as the GeneSeq protein database (Version 20.0) of patented sequences using the program FastA of the Genetics Computer Group. Using the TfastA program of the Genetics Computer Group (Pearson and Lipman, 1988, Proc. Nati. Acad. Sci. USA 85: 2444-2448), these same protein sequences were searched against the translations of six GenBank structures (version 92.0 with updates as of 1/26/93) and in the AMBL (modified version 45.0) which are nucleotide databases as well as the GeneSeq nucleotide database (version 20.0) of the patented sequences. The EST and STS sub-conjugates of GenBank and EMBL were not included in this search set. The best matings resulting from these searches contained sequences that were only about 50% identical over their full length with the 58 amino acid protein sequence derived from our analysis of clones R74593 and R35464. Isolation of the Human Bikunin. As mentioned above, the synthetic peptides corresponding to bikunin (7-64) and bikunin (102-159) as determined from the translated consensus sequence for bikunin (Figure 3), could be multiplied (Examples 2 and 1, respectively) to produce the kallikrein inhibitory active protein (Examples 4 and 3). This unexpected property was exploited to find a purification scheme to isolate the natural placental bikunin from human tissue. Using a purification scheme employing affinity chromatography sepharose-kali krein as a first step, the potent, natural, highly purified kallikrein inhibitor was isolated. The isolated natural human bikunin had an identical N-terminus (formed in sequence by 50 amino acid residues) compared to the sequence predicted by the translation of the amino acid residues of the nucleic acid consensus sequence (Figure 3) +1 to + 50 (Example 7). This confirmed for the first time the existence of a novel inhibitor of natural kalikrein isolated from human placenta. Known Kunitz-like domains are listed below. The residues that are believed to make contact with the target proteases are indicated as being of special interest (bold / underlined). These particular residues are referred to as Xaa1"16 positions for specific reference as shown by the Xaa label Bikunin (7-64) (SEQ ID NO .: 4) Xa» 1 1 111 1 1 2 3 456789 0 1 234 s IHDFC VSKVV GRCRASMFKW YNVTDGSCQ FVYQGCO N SNN &'pCKEC u? KCATV Bikunina (102-159) (SEQ ID NO: 6) Y1EYCTANAVT OPCRAgFPRW YFDVERNSCN NFIYGGCRGN KNSY SEEAC MLRCFRfl Tissue factor path inhibitor precursor 1 (SEQ ID NO: 18) -gSFCAFKADjD GPCKAIMKRF FFNIFTRQCE EFJYGGCEgH QNRFES EEC KKMCTKD Tissue factor path inhibitor precursor (SEQ ID NO: 19) -jgDFCFLEEDP GICRGYITKY FYNNQTKQCE RFRYGGCLGK MNNF £ T --- EEC KNICEDg Tissue factor path inhibitor precursor (SEQ ID NO .: 20) -ÜS C TPADJR GLCRANBNgF YYNSVIGKCR PFftYSGCGGN ENNFTSKQEC l-RACKKG Tissue factor trajectory inhibitor precursor (SEQ ID NO: 21) - EIC PLDY GPCRALt? EY YYRYRTQSCR QFLYGGCgGN ANNF2TWEAC DDACWRI Precursor 2 of the tissue factor path inhibitor (SEQ ID NO: 22) -PSFCYSP I GLC £ ASV £ RY YENPRYRTCD AFTYTGCGQN DNNFVSREDC KRACAXA Protein counterpart of the amyloid precursor (SEQ ID NO: 23) -gAVCSQEAKT GPCRAVMPRT TFDLSKGKCV RFITGGCGGN RNNFE5EDYC MAVCKAK Aprotinin (SEQ ID NO .: 24) S DFCEPPY * T G £ C £ ARXIRY FYNAKAG CQ T V? GGCRAX XmFKSA? DQ MRTCGGA Precursor of the inter-a-t ripsin inhibitor (SEQ ID NO. : 25) CQLGYS & GPCMGMTSRY FYNGTSMACE tFQYGGCMGN GNNFVTEKEC LQTC Precursor of the Inter- -t ripsin inhibitor SEQ ID NO. : 26) VAACNLPIVg GPCB IOJ.W AFDAVKGKCV I.FPYGGCQGN GNKF? SEKEC REYCGVg Amyloid precursor protein (SEQ ID No. 27) -fiVCCSEOAE? GPCRAMISRW FDV EGKCA PFFYGGCOGN RNNraTEEYC MAVCGSA Collagen precursor a-3 (VI) (SEQ ID NO: 28) -CK P DS GTCRPFX 3C YYDPNTKSCA RFWYGGCGGN ENKFOSQKEC EKVC HKI-B9 (SEQ ID NO .: 29) - £ 3SVCAFPMEX GPCOTYKTRW FFNFETGECE LFAYGGCGGI? SNNFIJRKEKC EKFCKFT Placenta bikunin, isolated domains or other variants of the present invention can be produced by standard synthesis of solid phase peptides using either the t-Boc chemistry, as described by Merrifield R.B. and Barany G., in: The Peptides, Analysis, Synthesis, Biology, 2, Gross E. et al., Eds. Academic Press (1980) Chapter 1; or using the F-moc chemistry as described by Carpino LA, and Han GY, (1970) J. Amer Chem Soc., 92, 5748-5749, and illustrated in Example 2. Alternatively, the expression of a DNA encoding The placental bikunin variant can be used to produce the recombinant variants of placental bikunin.

The present invention provides the use of a purified human serine protease inhibitor that can specifically inhibit kallikrein, which has been isolated from human placental tissue, by means of affinity chromatography. The human serine protease inhibitor, here called human placenta bikunin, contains two domains of Kunitz class serine protease inhibitor. In a particular embodiment, the present invention encompasses a protein having the amino acid sequence: ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCOLFV YGGCDGNSNN SC / YLTKEECLKK CATVTEN? TG D ATSRM? SSVPSAPRRQ DSEDKSSDMF 10C NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACM RCFRQQ ENPPLPLGSK VW1AGAVS 179 (SEQ ID NO .: 1) In a preferred embodiment, the present invention provides a bikunin protein (bikunin (1-70)) having the amino acid sequence: ADRERSIKDF CLVSKWGRC RASMPRWWYN VTDGSCQ1.FV YGGCDGNSNN SO YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 JSYEEYCTANA VTGPCRASFP RWYFDVERNS C NFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK 170 . { SEQ ID NO: 52) In one aspect, the biological activity of the protein useful for practicing the present invention is that it can substantially bind and inhibit the biological activity of trypsin, human plasma and tissue kalikreins, human plasmin and the factor Xlla. In a preferred embodiment, the present invention provides a natural human placenta bikunin protein, in a glycosylated form. In a further embodiment, the present invention encompasses the natural human bikunin protein that has been formed and that contains at least one cis-cis-cis-bisine bisulfide bond. In a preferred embodiment, the protein contains at least one bisulfide bond between the cis-theine-cis-theine chains formed between a pair of cysteines selected from the group consisting of CYS11-CYS61, CYS20-CYS44, CYS36-CYS57, CYS 106-CYS 156, CYS 115-CYS 139, and CYS 131-CYS152, wherein the cysteines are numbered according to the amino acid sequence of natural human placenta bikunin. Someone with ordinary skill will recognize that the protein of the present invention can be multiplied in the appropriate conformation of three dimensions, such that the biological activity of natural human bikunin is maintained, where none, one or more, or all the bonds are present. bisulfide between natural chains of cysteine-cis-theine. In a more preferred embodiment, the protein of the present invention is appropriately multiplied and formed with all the appropriate natural bisulfide bonds of cysteine-cysteine. The active protein for use in the present invention can be obtained by purification of human tissue, such as the placenta, or by means of synthetic protein chemistry techniques as illustrated below by the Examples. It is also understood that the protein for use in the present invention can be obtained using molecular biology techniques, wherein the self-replicating vectors are capable of expressing the protein of the present invention from transformed cells. Such a protein can be made as segregated or non-segregated forms of transformed cells. In order to facilitate the secretion of transformed cells, to increase the functional stability of the translated protein, or to help multiply the bikunin protein, certain peptide signal sequences can be added to the NH2 terminal portion of the human bikunin protein. natural. In one embodiment, the present invention thus provides the natural human bikunin protein with at least an intact portion of the natural signal peptide sequence. Thus, one embodiment of the invention provides the natural human bikunin with at least a portion of the signal peptide, which has the amino acid sequence: A G S F L A w L s s L L L S G V L A -1 A D E R S I H D F C S K V V G R C R A S M P 25 R W W Y N V T D G S C Q L F V Y G G C D G N s N N 50 Y L T K E E C L X K C A T V T E N A T G D L A T S 75 R N A A S Y S V P S A P R R Q? S E D H S S S > M F 100 N Y E Y C T A N A V T G P C R A S F P R W Y F D 125 V E R N S C N F I Y G C R G N K N s Y R s E E 150 A C M L R C F R Q Q N P P P L G S K V V V L A 175 G A V S 179 (SEQ ID NO: 2.) In a preferred embodiment, the present invention provides the use of a natural human placenta bikunin protein with a portion of the intact leader sequence having the amino acid sequence of SEQ ID NO: 52 with an intact leader segment having the amino acid sequence: MAQLCGL RRSRAFLALL GSLLLSGVLA -1 (SEQ ID NO: 53) In another embodiment, the present invention provides the use of the bikunin protein with part of the intact leader sequence that has the amino acid sequence of SEQ ID NO: 52 with the intact leader segment having the amino acid sequence: MLR AEADGVSRLL GSLLLSGVLA -1 (SEQ ID NO: 54) In a preferred numbering system used herein, the numbered amino acid as +1 is assigned to the NH2 terminus of the amino acid sequence for natural human placenta bikunin, one will readily recognize that functional protein fragments can be derived from placental bikunin. natural mana, which will maintain at least part of the biological activity of the natural human placenta bikunin, and act as serine protease inhibitors. In one embodiment, the protein for use in the method of the present invention comprises a fragment of the natural human placenta bikunin, which contains at least one functional domain similar to Kunizt, which has the amino acid sequence of the human placenta bikunin. natural amino acids 7-159, hereinafter referred to as "bi kunina (7 - 159)". Thus, the present invention comprises a method that employs a protein having the amino acid sequence: I H D F C L V S K V V G R C R A S M P 25 R W W Y N V T D G S C Q L F V Y G G C D G N S N N 50 Y L T K E E C K K C A T V T E N A T G D L A T S 75 R N A A D S S V P S A P R R Q D S E D H S S D M F 100 N Y E E Y C T A N A V T G P C R A S F P W Y F D 125 V E K? C N N F? Y G G C R G N K N Y Y R S E E 150 A C M E C F R Q 159 . { SEQ ID NO: 3) wherein the amino acid numbering corresponds to that of the amino acid sequence of the natural human placenta bikunin. Another functional variant of this embodiment may be the fragment of the natural human placenta bikunin containing at least one functional domain similar to Kunitz, which has the amino acid sequence of the natural human placenta bikunin of amino acids 11-156, bikunin (11). -156) CLVSKVVGRCRASMP 25 R W W Y K V T D G S C Q L P V Y G G C D G N S N N 50 Y L T K E E C K K C A T V T E N A T G D L A T S 75 R N A A D S S V P S A P R R Q D S E D H S S D M F 100 N Y E E Y C T A N A V T G P C R A S F P W Y F D 125 V K R N S C N N F I Y G G C R G N K N S Y R S E E 150 A C M L R C 156 (SEQ ID NO .: 50). It can be recognized that the individual Kunitz-like domains are also fragments of the natural placenta bikunin. In particular, the present invention contemplates the use of a protein having the amino acid sequence of a first Kunitz-like domain consisting of the amino acid sequence of amino acids 7-64 of natural human placenta bikunin, hereinafter referred to as "bikunina (7- 64)". Thus, in one embodiment of the present invention it comprises a protein containing at least one Kunitz-like domain having the amino acid sequence: IHDF CLVSK VVGRC RASMP 25 RWWYN VTDGS CQLFV YGGCD GNSNN 50 YLTKE ECLKK CATV 64 (SEQ ID NO.: 4 ), wherein the amino acid numbering corresponds to that of the amino acid sequence of the natural human placenta bikunin. Another form of the protein of the present invention may be a first Kunitz-like domain consisting of the amino acid sequence of amino acids 11-61 of the natural human placenta bikunin, "bikunin (11-61)" which has the amino acid sequence: CLVSKVVGRCRASMP 25 RWWYNVTDGSCQLFVYGGCDG NSNN 50 YLTKSECLKKC 61 (SEQ IDNO .: 5) The present invention also provides a protein having the amino acid sequence of a Kunitz-like domain, which consists of the amino acid sequence of amino acids 102-159 of natural human placenta bikunin, hereinafter referred to as "bikunina (102-159)". Thus, one embodiment of the present invention comprises a protein containing at least one Kunitz-like domain having the amino acid sequence: Y E E Y C A A V T G P C A S F P R W Y F D 125 V E R N S C N N F R Y G G C R G N K N Y Y E E E 150 A C M L R C F R Q 159 . { SEQ ID NO .: 6) wherein the amino acid numbering corresponds to that of the amino acid sequence of the natural human placenta bikunin. Another form of this domain may be a domain similar to Kunitz, which consists of the amino acid sequence of amino acids 106-156 of the natural human placenta bikunin, "bi kunina (106-156)", which has the amino acid sequence : C T N V C A S F P R W Y F D 125 v E R N s C N N F I Y G G C G N K ü 3 S E E 150 A C M L R C 156 (SEQ ID NO .: 7) Thus, someone of ordinary skill will recognize that fragments of the natural human bikunin protein can be made and will retain at least some of the biological activity of the natural protein. Such fragments can be combined in different orientations or multiple combinations to provide alternative proteins that retain some of them, or more biological activity of the natural human bikunin protein. It will be readily recognized that the biologically active protein employed in the method of the present invention may comprise one or more of the current Kunitz-like domains in combination with additional Kunitz-like domains from other sources. The biologically active protein of the method of the present invention may comprise one or more of the current Kunitz-like domains in combination with additional protein domains from other sources with a variety of biological activities. The biological activity of the protein useful in the practice of the present invention can be combined with that of another known protein or proteins to provide multifunctional fusion proteins having predictable biological activity. Thus, in one embodiment, the method of the present invention comprises the use of a protein containing at least one amino acid sequence segment thereof which, or functionally equivalent to, the amino acid sequence of either SEQ ID NO. : 5 or SEQ ID NO. : 7. An open reading structure that terminates at an early detection codon can still encode a functional protein. The present invention comprises such an alternative termination, and in one embodiment the use of an amino acid sequence protein: AD R E S is provided? H D F C LV S K VVG R C R A S M P 25 RW W YN V T DG S C Q L »-F V Y G G C D G N S N N 50 YLT K E E C L K K C ATVT E NAT G D LA T S 75 RN A AD S S V P S A P RR Q DS 92 (SEQ ID NO .: 8) In one embodiment, the present invention provides the use of a recombinantly produced, substantially purified, native human bikunin protein with an intact segment of the leader sequence, and at least a portion of the region of intact natural transmembrane. Thus, one embodiment of the invention provides for the use of natural human bikunin, with an intact leader sequence, and with at least part of the transmembrane domain (underlined), having an amino acid sequence selected from: EST MLR AEADGVSRLL G? LLLSGVLA -1 PCR MAQLCGL RR? RAFLALL GSLLLSGVLA -1? CDNA MAQLCGL RRSRAFLALL GSLLLSGVLA -1 EST ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 PCR ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50? CDNA ADRERSIHDF CLVSK GRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 EST YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 PCR YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100? CDNA YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 EST NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNS RSEE 150 PCR NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150? Cdn NYEEYCTAJSA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 EST ACMLRCFRQQ ENPPLPLGSK WLGLFVM V ^ -ILFLGASM VYLIRVARRN 200 PCR ACMLRCFRQQ ENPPLPLGSK WVLAGLFVM VLILFLGASM VYLIRVARRN 200? CDNA ACMLRCFRQQ ENPPLPLGSK WVLAGLFVM VLILFLGASM VYLIRVARRN 200 EST QERALRTVWS SGDDKEQLVK NTYVL 225 PCR QERALRTVWS FGD 213? Cdn QERALRTVWS SGDDKEQLVK NTYVL 225 where EST is the consensus derivative of EST of SEQ ID NO. : 47, PCR is the PCR clone of the SEQ ID NO .: 47, and? CDNA is the cDNA lambda clone of SEQ ID NO .: 49. In a preferred embodiment, a protein of the method of the present invention comprises one of the amino acid sequences of SEQ ID NO .: 45, 47 or 49 where the protein has been cleaved in the region between the termination of the last Kunitz domain and the transmembrane region (underlined). The present invention also comprises the use of the protein wherein the signal peptide is removed. Thus, the method of the present invention provides a protein having the amino acid sequence of SEQ ID NO: 52 continuous with a transmembrane amino acid sequence: EST WVLAGLFVM VLILFLGASM VY ^ IRVARRN EST QERALRTVWS SGDDKEQLVK NTYVL (SEQ ID NO. : 69) an amino acid sequence of rransmemorana PCR VWIAGLFVM VLILFLGASM VYLIRVARRN PCR QERALRTVWS FGD. { SEQ ID NO .: 68) or a transmembrane amino acid sequence ? WLAGLFVM VLILFLGAS VYLIRVARRN? cDNA QERALRTVW? SGDDKEQLVK NTYVL (SEQ ID NO .: 67).

The invention also encompasses the use of the following proteins: ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLEV YGGCDGNSNN 50"YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 AND? BYCTANA VTGPCRASFP F.WYFDVERNS CNNPIYGGCR GNKNS RSEE 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN 200 QERALRTVWS SGDDKBQLVK NTYVL 225 . { SEQ ID NO. : 70), ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGHSNN 50 YLTKEECLKK CATVTENATQ DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NY? E? CTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 1S0 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN 200 QSRALRTVWS FGD 213 (SEQ ID NO: 71).

Protein amino acid sequences for use in the present invention clearly teach one skilled in the art the appropriate nucleic acid sequences that can be used in molecular biology techniques to produce the proteins for use in the present invention. Thus, one embodiment of the present invention provides the use of a nucleic acid sequence encoding a human bikunin having the DNA consensus sequence of Figure 3 (SEQ ID NO: 9), which is translated into the sequence of amino acid for the natural human placenta bikunin sequence of Figure 3 (SEQ ID NO .: 10). In another embodiment, the present invention provides a nucleic acid consensus sequence of Figure 4C (SEQ ID NO: 51) encoding an amino acid sequence of Figure 4D (SEQ ID NO: 45). In a preferred embodiment, the present invention provides the use of a nucleic acid sequence encoding the natural human placenta bikunin having the DNA sequence of Figure 4F (SEQ ID NO: 48) encoding the protein sequence of the SEQ ID NO .: 49. In another embodiment, the present invention provides a nucleic acid sequence of Figure 4E (SEQ ID NO .: 46) encoding a protein sequence of SEQ ID NO: 47. It can be recognized It is readily apparent that certain allelic mutations, and conservative substitutions, made in the nucleic acid sequence, can still be made and will result in a protein amino acid sequence comprised by the method of the present invention. One skilled in the art can recognize that certain allelic natural mutations of the protein of the present invention, and conservative amino acid substitutions in the protein of the present invention, will not significantly alter the biological activity of the protein, and are encompassed by the present invention. The present invention also provides pharmaceutical compositions containing the human placenta bikunin and fragments thereof which are useful for stimulating MCC in patients incapacitated by mucocilia dysfunction. The present invention also provides methods for the stimulation of MCC in a patient suffering from mucociliary dysfunction, wherein an effective amount of the described human serine protease inhibitors of the present invention are administered to the patient in a biologically compatible vehicle. The present invention also provides a method for stimulating MCC that employs placenta bikunin variants, and the Kunitz specific domains described above, that contain amino acid substitutions that alter the specificity of the protease. Preferred substitution sites are indicated below at the Xaa1 to Xaa32 positions in the amino acid sequence for bikunin. of natural placenta. Xaal to Xaald substitutions are also preferred for bikunin variants (7-64), whereas substitution in Xaal7 up to Xaa32 is preferred for bikunin variants (102-159). Thus, the method of the present invention comprises the use of a protein having an amino acid sequence: Ala Asp Arg Glu Arg Ser lie Xaal Asp Phe 10 cys Leu Val Ser Lys Val Xaa2 Gly Xaa3 Cys 20 Xaa4 Xaa5 Xaa6 Xaa7 Xaa8 Xaa9 Trp Trp Tyr Asn 30 Val Thr Asp Gly Ser Cys Glp Leu Phe Xaa10 40 Tyr Xaa3-1 Gly Cys Xaa12 Xaa3-3 Xaa1 * Ser Asn Asn 50 Tyr Xaa15 Thr Lys Glu Glu Cys Leu Lys Lys 60 Cys Ala Thr Xaa16 Thr Glu Asn Ala Thr Gly 70 Asp Leu Ser Thr Ser Arg Asn Wing Wing Asp 80 Ser Ser Val Pro Be Wing Pro Arg Arg Gln 90 Asp Ser Glu Hxs Asp Ser As As Met Met Phe 100 AE? Tyr Xaa17 Glu Tyr Cya Thr Ala Asn Ala 110 Val Xaa18 Gly Xaaa9 Cys Xaa20 Xaa21 Xaa21 Xaa22 Xaa23 Xaa24 120 Xaa25 Trp Tyr Phe Aep Val Glu Arg Asn Ser 130 Cys Asn Asn Phe Xaa26 Tyr Xaa27 Gly Cys Xaa2d 140 Xaa29 Xaa30 Lys Asn Ser Tyr Xaa31 Ser Glu Glu 150 Wing Cys Met Leu Arg Cys Phe Arg Xaa32 Gln 160 Glu Asn Pro Pro Leu Pro Leu Gly Ser Lys 170 Val Val Val Leu Ala Gly Ala Val Ser 179 (SEQ ID NO: 11). wherein Xaal-Xaa32 each independently represents an amino acid residue that occurs naturally except Cys, with the proviso that at least one of the amino acid residues Xaal-Xaa32 is different from the corresponding amino acid residue of the natural sequence. In the current context, the term "naturally occurring amino acid residue" is intended to indicate any of the 20 commonly occurring amino acids, that is, Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His , Lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr and Val.

By substituting one or more amino acids in one or more of the above-indicated positions, it may be possible to change the specificity profile of the natural placenta bikunin inhibitor or that of the Kunitz-like individual domains, bikunin (7-64), or bikunin (102-159) so as to preferably inhibit other serine proteases such as, but not limited to, the enzymes of the complement cascade, TF / FVIIa, Fxa, prostasin, thrombin, neutrophil elastase, cathepsin G or proteinase-3 . Examples of preferred variants of placental bikunin include those wherein Xaal is an amino acid residue selected from the group consisting of His, Glu, Pro, ala, Val or Lys, particularly where Xaal is His or Pro; or wherein Xaa2 is an amino acid residue selected from the group consisting of Val, Thr, Asp, Pro, Arg, Tyr, Glu, Ala, Lys, in particular wherein Xaa2 is Val or Thr; or wherein Xaa3 is an amino acid residue selected from the group consisting of Arg, Pro, Lie, Leu, Thr, in particular wherein Xaa3 is Arg or Pro; or wherein Xaa4 is an amino acid residue selected from the group consisting of Arg, Lys and Ser, Gln, in particular wherein Xaa4 is Arg or Lys; or wherein Xaa5 is an amino acid residue selected from the group consisting of Ala, Gly, Asp, Thr, in particular wherein Xaa5 is Ala; or wherein Xaa6 is an amino acid residue selected from the group consisting of Ser, Lie, Tyr, Asn, Leu, Val, Arg, Phe, in particular wherein Xaa6 is Ser or Arg; or wherein Xaa7 is an amino acid residue selected from the group consisting of Met, Phe, Lie, Glu, Leu, Thr and Val, in particular wherein Xaa7 is Met or lie; or wherein Xaa8 is an amino acid residue selected from the group consisting of Pro, Lys, Thr, Gln, Asn, Leu, Ser or Lie, in particular where Xaa8 is Pro or lie; or wherein Xaa9 is an amino acid residue selected from the group consisting of Arg, Lys or Leu, in particular wherein Xaa9 is Arg; or wherein XaalO is an amino acid residue selected from the group consisting of Val, Lie, Lys, Ala, Pro, Phe, Trp, Gln, Leu and Thr, in particular where XaalO is Val; or wherein Xaall is an amino acid residue selected from the group consisting of Gly, Ser and Thr, in particular where Xaall is Gly; or wherein Xaal2 is an amino acid residue selected from the group consisting of Asp, Arg, Glu, Leu, Gln, Gly, in particular wherein Xaal2 is Asp or Arg; or wherein Xaal3 is an amino acid residue selected from the group consisting of Gly and Ala; or wherein Xaal4 is an amino acid residue selected from the group consisting of Asn or Lys; or wherein Xaal5 is an amino acid residue selected from the group consisting of Gly, Asp, Leu, Arg, Glu, Thr, Tyr, Val, and Lys, particularly wherein Xaal5 is Leu or Lys; or wherein Xaal6 is an amino acid residue selected from the group consisting of Val, Gln, Asp, Gly, Lie, Ala, Met, and Val, in particular where Xaal6 is Val or Ala; or wherein Xaal7 is an amino acid residue selected from the group consisting of His, Glu, Pro, Ala, Lys and Val, in particular wherein Xaal7 is Glu or Pro; or wherein Xaald is an amino acid residue selected from the group consisting of Val, Thr, Asp, Pro, Arg, Tyr, Glu, Ala or Lys, in particular where Xaald is Thr; or wherein Xaal9 is an amino acid residue selected from the group consisting of Arg, Pro, Lie, Leu or Thr, in particular where Xaal9 is Pro; or wherein Xaa20 is an amino acid residue selected from the group consisting of Arg, Lys, Gln and Ser, in particular where Xaa20 is Arg or LYs; or wherein Xaa21 is an amino acid residue selected from the group consisting of Ala, Asp, Thr or Gly; in particular where Xaa21 is Ala; or wherein Xaa22 is an amino acid residue selected from the group consisting of Ser, Lie, Tyr, Asn, Leu, Val, Arg or Phe, in particular wherein Xaa2 is Ser or Arg; or wherein Xaa23 is an amino acid residue selected from the group consisting of Met, Phe, Lie, Glu, Leu, Thr and Val, in particular wherein Xaa23 is Phe or lie; or wherein Xaa24 is an amino acid residue selected from the group consisting of Pro, Lys, Thr, Asn, Leu, Gln, Ser, lie, in particular where Xaa24 is Pro or lie; or wherein Xaa25 is an amino acid residue selected from the group consisting of Arg, Kys or Leu, in particular wherein Xaa25 is Arg; or wherein Xaa26 is an amino acid residue selected from the group consisting of Val, Lie, Lys, Leu, Ala, Pro, Phe, Gln Trp and Thr, in particular where Xaa25 is Val or lie; or wherein Xaa27 is an amino acid residue selected from the group consisting of Gly, Ser and Thr, in particular wherein Xaa27 is Gly, or wherein Xaa28 is an amino acid residue selected from the group consisting of Asp, Arg, Glu, Leu, Gly or Gln, in particular where Xaa28 is Arg; or wherein Xaa29 is an amino acid residue selected from the group consisting of Gly and Ala; or wherein Xaa30 is an amino acid residue selected from the group consisting of Asn or Lys; or wherein Xaa31 is an amino acid residue selected from the group consisting of Gly, Asp, Leu, Asrg, Glu, Thr, Val, and Lys, in particular wherein Xaa31 is Arg or Lys; or wherein Xaa32 is an amino acid residue selected from the group consisting of Val, Gln, Asp, Lie, Ala, Met and Thr, in particular where Xaa32 is Gln or Ala. The invention also relates to DNA constructs that encode the placental bikunin protein variants of the present invention. These constructs can be prepared by synthetic methods such as those described in Beaucage S.L. and Caruthers M.H., (1981) Tetrahedron Lett, 22, pages 1859-1832; Matteucci M.D. and Caruther M.H. (1981), J. Am. Chem. Soc. 103, page 3185; or of the cDNA or genomic that may have been obtained by screening genomic or cDNA collections with cDNA probes designed to hybridize with the DNA sequence encoding the placental bikunin. The genomic or cDNA sequence can be modified at one or more sites to obtain the cDNA encoding any of the amino acid substitutions or deletions described in the description. The present invention also relates to expression vectors containing DNA constructs encoding placental bikunin, isolated domains or other variants of the present invention that can be used for the production of recombinant variants of placental bikunin. The cDNA must be connected to an appropriate promoter sequence that shows a transcriptional activity in the host cell of choice, has an appropriate terminator and a poly-adenylation signal. The cDNA encoding the placental bikunin variant can be fused to a 5 'signal peptide that will result in the protein encoded by the cDNA to undergo secretion. The signal peptide can be one that is recognized by the host organism. In the case of a mammalian host cell, the signal peptide can be the natural signal peptide present in the full-length placental bikunin. The methods used to prepare such vectors for the expression of placental bikunin variants are well known in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cald Spring Harbor, New York, ( 1989). The present invention also relates to transformed cells containing the DNA constructs encoding the placenta bikunin, isolated domains or other variants of the present invention that can be used for the production of recombinant variants of placental bikunin. A variety of combinations of the expression vector and the host organism exist and can be used for the production of the placental bikunin variants. Suitable host cells include Sf9 insect cells infected with baculovirus, mammalian cells such as BHK, CHO, Hela and C-127, bacteria such as E. coli, and yeasts such as Saccharomyces cervisiae. Methods for the use of expression systems of mammals, insects and microbials necessary to achieve expression of placental bikunin are well known in the art and are described, for example, in Ausubel F.M. and collaborators, Current Protocols in Molecular Biology, John Wiley & Sons (1995), chapter 16. For fragments of placental bikunin containing a simple Kunitz inhibitory domain such as bikunin (7-64) and (102-159), yeast and E. coli, expression systems are preferred, with yeast systems being most preferred. Typically, yeast expression would be carried out as described in US Pat. No. 5,164,482 for variants of aprotinin and adapted in Example 5 of the present specification for placental bikunin (102-159). The expression of E. coli can be carried out using the methods described in US Pat. No. 5,032,573. The use of mammalian and yeast systems is more preferred for the expression of larger placental bikunin variants containing the inhibitor domains such as variant bikunin (7-159). The DNA encoding variants of the placental bikunin possessing the amino acid substitution of the natural amino sequence can be prepared by the expression of the recombinant protein using the methods of Kunkel T.A., (1985) Proc. Nati Acad. Sci USA 82, pages 488-492. Briefly, the DNA to be mutagenized is cloned into a simple strand bacteriophage vector such as M13. An oligonucleotide that extends into the region to be changed and that encodes the substitution, hybridizes to single-stranded DNA and is double-stranded by standard techniques of molecular biology. This DNA is then transformed into an appropriate bacterial host and verified by dideoxynucleotide sequencing. The correct DNA is then cloned into the expression plasmid. Alternatively, the target DNA can be mutagenized by common PCR techniques, sequenced and inserted into the appropriate expression plasmid. The following particular examples are offered by way of illustration, and not limitation, of certain aspects and preferred embodiments of the present invention. All patents, patent applications and literature references cited in this application are incorporated by reference in their entirety. Example 1 Preparation of synthetic placenta bikunin (102-159) Materials and Methods / Reagents used: The fluorogenic substrate Tos-Gly-Pro-Lys-AMC was purchased from Bachem BioScience Inc. (King of Prussia, PA), PNGB, Pro-Phe-Arg-AMC, Ala-Ala-Pro-Met-AMC, bovine trypsin (type III), human plasma kalikrein, and human plasmin were from Sigma (San Luis, MO). The recombinant aprotinin (Trasylol®) was from Bayer AG (Wuppertal, Germany). The pre-loaded Gln Wang resin was from Novabiochem (La Jolla, CA). Thioanisolenedithiol and methyl t-butyl ether was from Aldrich (Milwaukee, Wl). Quantification of functional placental bikunin (7-64) (SEQ ID NO: 4) and (102-159). The amount of trypsin inhibitory activity present in the sample multiplied in various stages of purification was measured using GPK-AMC as a substrate. The bcvino trypsin (200 pmol) was incubated for 5 minutes at 37 C with bikunin (7-64) or (102-159), from various purification stages, in a buffer solution A (50 mM Hepes, pH 7.5 , 0.1 M NaCl, 2 mM CaC12 and 0.01% triton X-100). GPK-AMC (final 20 μm) was added and the amount of coumarin produced was determined by fluorescence measurement (ex = 370 nm, em = 432 nm) in a Perkin-Elmer LS-50B fluorimeter over a period of 2 minutes. For the samples that were tested, the percent inhibition for each was calculated according to equation 1; where RO is the rapidity of increase in fluorescence in the presence of the inhibitor and Rl is the speed determined in the absence of the aggregate sample. A unit of activity for the inhibitor is defined as the amount necessary to achieve 50% inhibition in the assay using the conditions as described. % inhibition = 100 x [1- R0 / R1] (1) Synthesis: Placental bikunin (102-159) (SEQ ID NO .: 6) was synthesized in a peptide synthesizer model 420A from Applied Biosystems using chemistry of NMP-HBTU Fmoc. The peptide was synthesized on a pre-filled Gln resin with an 8-fold excess of amino acid for each coupling. The splitting and deprotection were carried out in 84.6% trifluoroacetic acid (TFA), thioanisol 4.4%, ethanedithiol 2.2%, liquefied phenol 4.4%, and H20 4.4% for 2 hours at room temperature. The crude peptide was precipitated, centrifuged and washed twice in methyl t-butyl ether. The peptide was purified on a Dynamax 60A C18 reverse phase HPLC column using a gradient of TFA / acetonitrile. The final preparation (61.0 mg) resulted in the correct amino acid composition and molecular weight by Ele'ctrospray mass spectroscopy (MH + = 6836.1; calculated = 6835.5) for the predicted sequence: YEEYCTMFAV TGPCRASFPR WYFDVERNSC NNFIYGGCRG NKNSYRSEEA CMLRCFRQ- (SEQ ID NO: 6) Purification: The retraction of the placental bikunin (102-159) was carried out according to the method of Tam et al. (J. Am. Chem. Soc. 1991, 113; 6657-62). A portion of the purified peptide (15.2 mg) was dissolved in 4.0 ml of 0.1 M Tris, pH 6.0, and 8.0 M urea. Oxidation of the bisulfides was achieved by dropwise addition of a solution containing 23% DMSO, and Tris 0.1M, pH 6.0 to obtain a final concentration of 0.5 mg / ml of peptide in DMSO 20%, Tris 0.1 M, pH 6.0, and 1 M urea. The solution was left stirring for 24 hours at 25 ° C, after which was diluted 1:10 in a buffer solution containing 50 mM Tris, pH 8.0, and 0.1 M NaCl. The material was purified using an affinity column of kalikrein made by the covalent placement of 30 mg of bovine pancreatic kallkrein ( Bayer AG) to 3.5 ml of Sephase activated with CNBr (Pharmacia) in accordance with the manufacturers' instructions. The refolded material was loaded onto an affinity column at a flow of 1 ml / minute and washed with 50 mM Tris, pH 8.0, and 0.1 M NaCl until an absorbance at 280 nm of wash could no longer be detected. The column was eluted with 3 volumes each of 0.2 M acetic acid, pH 4.0 and 1.7. The active fractions were emptied (see below) and the pH of the solution was adjusted to 2.5. The material was applied directly to a Vydac C18 reverse phase column (5 microns, 0.46 x 25 cm) which had been equilibrated in 22.5% acetonitrile in 0.1% TFA. The separation was achieved using a linear gradient of 22.5 to 40% acetonitrile in 0.1% TFA and 1.0 ml / minute for 40 minutes. The active fractions were drained, lyophilized, dried in 0.1% TFA, and stored at -20 ° C until needed. Resulted. The synthetic placenta bikunin (102-159) was refolded using 20% DMSO as the oxidizing agent as described above, and purified by a 2-step purification protocol "as shown below, to result in an active trypsin inhibitor. (Table 1 below) Table 1. Table of Purification for the isolation of synthetic placenta bikunin (102-159) TABLE 1 Stage of Vol Mg / ml mg Units 0 SpA Performance purification (ml) (U) (U / mg ) Urea 8.0 M 4.0 3.75 15.0 0 20% DMSO 32.0 0.47 15.0 16, 162 1, 07 100 Affinity of 9.8 0.009D 0.09 15,700 170,000 97 kalikrein C18 3.0 0.013 i aabD 0.04 11, 964 300, 000 74 aProtein determined by AAA. bProtein determined by-OD280 nm using the extinction coefficient determined for the purified protein (1.7 x 104 Lmol "1 cm" 1). A unit is defined as the amount of material required to inhibit 50% of trypsin activity in a normal assay. Chromatography of the crude material refolded on an immobilized column of bovine pancreatic kalikrein selectively isolated 6.0% of the protein and 97% of the inhibitory activity of trypsin present. Subsequent chromatography using reverse phase C-18 resulted in an additional 2-fold purification, with an overall recovery of 74%. On the RPHPLC, the reduced and reduced placenta bikunin (102-159), showed elution times of 26.3 and 20.1 minutes, respectively. Mass spectrometry analysis of the purified material revealed a molecular mass of 6829.8; a loss of 6 mass units of the starting material. This demonstrates the complete formation of the 3 bisulfides predicted from the peptide sequence. The isoelectric points of the purified and refinished synthetic placenta bikunin (102-159) were determined using a Multiphor II electrophoresis system (Pharmacia) operated according to manufacturers' suggestions, together with the pl standards, using an Ampholine®PAG plate. precooked (pH 3.5 to 9.5) and focused for 1.5 hours. After staining, the migration distance from the cathodic edge - from the gel to the different protein bands - was measured. The pl of each unknown was determined using a standard curve generated by the graph of the migration distance of the standards against the corresponding pl. With this technique, was the p determined? of the placental bikunin (102-159) which was 8.3, in agreement with the predicted value of the amino acid sequence. This is a value lower than that of 10.5 established for the pl of aprotinin (Tenstad et al., 1994, Acta Physiol., Scand. 152: 33-50). Example 2 Preparation of synthetic placenta bikunin (7-64). Placenta bikunin was synthesized (7-64) (SEQ ID NO .: 4), was refolded and purified essentially as described for placental bikunin (102-159) (SEQ ID NO: 6) in Example 1 but with the following modifications: during withdrawal, the synthetic peptide was stirred for 30 hours as a solution in 20% DMSO at 25 ° C; Purification was achieved by C18 RP-HPLC with a linear gradient of 25 to 45% acetonitrile in 0.1% TFA for 40 minutes (1 ml / minute). The active fractions of the first C18 run were applied to the column and fractionated with a linear gradient (60 minutes, 1 ml / minute) of 20 to 40% acetonitrile in 0.1% TFA.

Results The purified reduced final peptide showed an MH + = 6563, consistent with the sequence: IHDFCLVSKV VGRCRASMPR WWYNVTDGSC QL-FVYGGCDG NSNNYL.TK? E CLKKCATV (SEQ ID NO.: 4) The refolding and purification produced a functional Kunitz domain that was active as a trypsin inhibitor (Table 2 below). Table 2. Purification table for the isolation of synthetic placenta bikunin (7-64). TABLE 1 Stage of Vol Mg / ml mg Units SpA Performance purification (ml) (U) (U / mg) Urea 8.0 M 8.0 2.5 20.0 0 20% - DMSO 64.0 0.31 20.0 68, 699 3, 435 100 Kal affinity 11.7 0.10 1.16 43, 333 36, 110 62 pH 4.0 Kal affinity 9.0 0.64 5. 4972 857 7.2 pH 1.7 C18-1 4.6 0.14 0.06 21, 905 350, 143 31.9 C18-2 -1.0 0.08 0.02 7, 937 466, 882 11.5 The refolded and purified protein showed a MH + = 6558, this is 5 ± 1 mass units less than for the reduced peptide. This demonstrates that the refolding caused the formation of at least one appropriate bisulfide bond. The pl of the placental bikunin (7-64) was determined using the methods used to determine the pl of the placental bikunin (102-159). The placenta bikunin (7-64) showed a pl that was much higher than the predicted value (pl = 7.9). The refined placenta bikunin (7-64) migrated to the cathode rim of the gel (pH 9.5) and a precise pl could not be determined under these conditions. Continuous preparation of the synthetic-effect bikunin (7-64). Because the synthetic placenta bikunin (7-64) may not have undergone complete deprotection before purification and refolding, the refolding was repeated using the protein that was ensured was completely unprotected. The placenta bikunin (7-64) was synthesized, refolded and purified essentially as described for placental bikunin (102-159), but with the following modifications: during withdrawal, the synthetic peptide (0.27 mg / ml ) was stirred for 30 hours as a solution in 20% DMSO at 25 ° C; Purification was achieved by RP-HPLC C18 with a linear gradient of 22.5 to 50% acetonitrile in 0.1% TFA for 40 minutes (1 ml / minute). Results The final purified reduced peptide showed an MH + = 6567.5, consistent with the sequence: IHDFCLVSKV VGRCRASMPRW WYNVTDGSC QLFVYGGCDG NSNNYLTKEE CLKKCATV (SEQ ID NP .: 4) Folding and purification resulted in a functional domain of Kunitz that was as active as an inhibitor of trypsin (Table 2B below). Table 2B. Purification table for the isolation of synthetic placenta bikunin (7-64). TABLE 2B Stage of Vol Mg / ml mg Units SpA Performance purification (ml) (U) (U / mg) Urea 8.0 M 4.9 2.1 10.5 0 20% DMSO 39.0 0.27 10.5 236, 000 22, 500 100 Affinity of 14.5 0.3 0.43 120, 000 279.070 50.9 kallikrein (pH 2) Inverse phase 0.2 1.2 0.24 70, 670 294.483 30.0 C18 The purified refolded protein showed an MH + = 6561.2, that is, 6.3 units of mass less than for the reduced peptide. This shows that the refolding caused the formation of three expected bisulfide bonds. The pl of the refractory placenta bikunin (7-64) was determined using the methods used to determine the pl of the placental bikunin (102-159). The refractory placenta bikunin (7-64) showed a pl of 8.85, slightly higher than the predicted value (pl = 7.9). Example 3 In vitro specificity of the functional placenta bikunin fragment (102-159). Proteases. The quantification of bovine trypsin was carried out, human plasmin, and pancreatic bovine kalikrein by titration in the active site using p-nitrophenyl p '-guanidobenzoate hydrochloride as previously described (Chase, T., and Shaw, E., (1970) Me th ods In zmol, 19, 20-27). Human kalikrein was quantified by titration at the active site using bovine aprotinin as a standard and PFR-AMC as a substrate assuming a 1: 1 complex formation. The Km for GPK-AMC with trypsin and plasmin under the conditions used for each enzyme was 29 μM and 726 μM, respectively; Km for PFR-AMC with human plasma kalikrein and bovine pancreatic kalikrein was 457 μM and 81.5 μM, respectively; the Km for AAPR-AMC with elastase was 1600 μM. The quantification of human tissue kallikrein (Bayer, Germany) was carried out by titration at the active site using p'nitrophenyl p 'guanidobenzoat hydrochloride or as previously described (Chase, T., and Shaw, E., ( 1970) Methods Enzmol, 19, 20-27). Ciné ti ca of Inhibition: Inhibition of trypsin by placental bikunin (102-159) (described in Example 1) or aprotinin, was measured by the incubation of 50 pM trypsin with placental bikunin (102-159). ) or aprotinin (0-3 nM) in buffer A in a total volume of 1.0 ml. After 5 minutes at 37 ° C, 15 μl of 2 mM GPK-AMC was added and the change in fluorescence was observed (as above). Inhibition of human plasmin by placental bikunin (102-159) and aprotinin was determined with plasmin (50 pM) and placental bikunin (102-159) (0-10 nM) or aprotinin (0-4) nM) in buffer solution containing 50 mM Tris hydrochloride (pH 7.5), 0.1 M NaCl, and 0.02% triton x-100. After 5 minutes of incubation at 37 ° C, 25 μl of 20 mM GPK-AMC was added and the change in fluorescence was monitored. Inhibition of human plasma kalikrein by placental bikunin (102-159) or aprotinin was determined using kalikrein (2.5 nM) and placental bikunin (102-159) (0-3 nM) or aprotinin (0-45 nM) ) in 50 mM Tris hydrochloride (pH 8.0), 50 mM NaCl, and 0.02% triton x-100. After 5 minutes at 37 ° C, 15 μl of 20 mM PFR-AMC was added and the change in fluorescence observed. Inhibition of bovine pancreatic kalikrein by placental bikunin (102-159) and aprotinin was determined in a similar manner with kalikrein (92 pM), placental bikunin (102-159) (0-1.6 nM) and aprotinin (0-14 pM) and a final substrate concentration of 100 μM. The apparent inhibition constant Ki * was determined using the Enzfitter package of a nonlinear data regression analysis program (Biosoft, Cambridge, UK): The kinetic data of each experiment were analyzed in terms of the equation for a strong inhibitor of link: i / V0 = 1 - (Eo + I0 + K¡ * [(E0 + I0 + KÍ *) 2. 4 E0I0] V2) / 2EC (2) where Vi / V0 is the fractional activity of the enzyme (inhibited speed versus non-inhibited), and E0 and I0 are the total concentrations of enzyme and inhibitor, respectively. The Ki values were obtained by correcting the effect of the substrate according to the equation: (Boudier, C, and Bieth, J. G, (1989) Biochim Biophys Acta. 995: 36-41). For the inhibition of human neutrophil elastase by placental bikunin (102-159) and aprotinin, elastase (19 nM) was incubated with placenta bikunin (102-159) (150 nM) or aprotinin (0-7.5 μM) in buffer solution containing 0.1 M Tris hydrochloride (pH 8.0 ), and triton X-100 at 0.05%. After 5 minutes at 37 ° C, AAPM-AMC (500 μM or 1000 μM) was added and the fluorescence was measured over a period of two minutes. Ki values were determined from Dixon graphs of the 1 / V form versus those performed [I] at two different concentrations of substrates (Dixon et al., 1979).

Inhibition of human tissue kalikrein by aprotinin, placental bikunin fragment (7-64) or placental bikunin fragment (102-159) was measured by incubation of 0.35 nM human tissue kalikrein with bikunin from placenta (7-64) (0-40 nM) or placental bikunin (102-159) (0-2.5 nM), or aprotinin (0-0.5 nM) in a 1 ml reaction volume containing a buffer solution of 50 mM Tris hydrochloride, with a pH of 9.0, 50 mM NaCl, and 0.1% triton x-100. After 5 minutes at 37 ° C, 5 ul of 2 mM PFR-AMC was added reaching a final of 10 uM and the change in fluorescence was monitored. The Km for PFR-AMC with human tissue kalikrein under the conditions used was 5.7 uM. Inhibition of the human factor Xa (American Diagnostica, Inc., Greenwich, CT) by synthetic placenta bikunin (102-159), recombinant placenta bikunin, and aprotinin, was measured by incubation of the human factor Xa 0.87 nM with increasing amounts of inhibitor in the buffer solution containing 20 mM Tris (pH 7.5), 0.1 M NaCl, and 0.1% BSA. After 5 minutes at 37 ° C, 30 ul of 20 mM LGR-AMC (Sigma) was added and the change in fluorescence observed. Inhibition of human urokinase (Sigma) by Kunitz inhibitors was measured by incubation of urokinase (2.7 ng) with inhibitor in a total volume of 1 ml buffer containing 50 mM Tris hydrochloride (pH 8.0) , 50 mM NaCl, and 0.1% triton x-100. After 5 minutes at 37 ° C, 35 ul of 20 mM GGR-AMC (Sigma) was added and the change in fluorescence observed. Inhibition of Factor Xla (from Enzyme Research Labs, Southbend, IN) was measured by incubation of FXIa (0.1 nM) with either placental bikunin from 0 to 800 nM (7-64), or placental bikunin from 0 to 140 nM. (102-159) or aprotinin from 0 to 40 uM in buffer solution containing 50 mM Hepes, pH 7.5, 100 mM NaCl, 2 mM CaC12., triton x-100 0.01%, and BSA 1% in a total volume of 1 ml. After 5 minutes at 37 ° C, 10 ul of 40 mM Boc-Glu (Obzl) -Ala-Arg-AMC (Bachem Biosciences, King of Prussia, PA) was added and the change in fluorescence observed. RESULTS: A direct comparison of the inhibition profiles of placental bikunin (102-159) and aprotinin was made by measuring its inhibition constants with various proteases under identical conditions. The Ki values are listed in Table 3 below. Table 3. Ki values for the inhibition of the various proteases by bikunin (102-159). TABLE 3 Protease Bikunin Aprotinin Substrate Km (concentration) (102- Ki (nM) (concentration) (mM) 159) Ki (nM) Trypsin (48.5 0.4 GPK-AMC (0.03 0.022 pM) mM) Chymotrypsin 0.24 0.86 AAPF-pNA (0.08 0.027 (5 nM) mM ) Kalikreina 0.4 0.02. PFR-AMC (0.1 0.08 pancreatic of mM) bovine (92.0 pM) Kalikrein of 0.3 19.0 PFR-AMC (0.3 0.46 human plasma mM) (2.5 nM) Human plasmin 1.8 1.3 GPK-AMC (0.5 0.73 (50 pM) mM) Elastase of 323.0 8500.0 AAPM-AMC (1.0 1.6 neutrophil μM) human (19 nM) Factor Xlla > 300.0 12,000.0 PFR-AMC (0.2 0.35 μM) Kalikrein from 0.13 0.004 PFR-AMC (10 μM) 0.0057 human tissue (0.35 nM) Factor Xa (0.87 274 NI to 3 LGR-AMC (0.6 ND nM) μM mM) Urokinase 11000 4500 GGR-AMC (0.7 ND mM) Xla Factor (0.1 15 288 E (Obz) AR-AMC 0.46 nM) (0.4 mM) Placental bikunin (102-159) and aprotinin inhibited bovine trypsin and human plasmin to a comparable degree under the conditions employed. Aprotinin inhibited elastase with a Ki of 8.5 μM. The placenta bikunin (102-159) inhibited elastase with a Ki of 323 nM. The Ki value for the inhibition of placental bikunin (102-159) of bovine pancreatic kalikrein was 20 times higher than that of inhibition of aprotinin. In contrast, placental bikunin (102-159) is a more potent inhibitor of human plasma kalikrein than aprotinin and binds with a 56-fold higher affinity. Because placenta bikunin (102-159) is 50 times more potent than Trasylol® as an inhibitor of kalikrein, smaller amounts of human placenta bikunin, or fragments thereof (ie, bikunin from placenta (102-159)) than Trasylol® in order to maintain the effective doses in the patient of the inhibitor in KIU. This reduces the cost per dose of the medication and reduces the likelihood of adverse nephrotoxic effects when the medication is re-exposed to patients. In addition, the protein is derived from the human, and therefore much less immunogenic in man than the aprotinin that is derived from cows. This results in significant reductions in the risk of incurring adverse immunological events during re-exposure of the drug to patients. Example 4 In vitro specificity of the functional placenta bikunin fragment (7-64). The in vitro specificity of the functional human placenta bikunin (7-64) described in Example 2 was determined using the materials and methods described in the previous Examples. -Results: The table below shows the efficacy of placenta bikunin (7-64) as an inhibitor of various serine proteases in vitro. The data are shown in comparison to the data obtained by the inhibition of sieving using placental bikunin (102-159), or aprotinin (Trasylol®). Table 4A. Ki values for the inhibition of various proteases by bikunin (7-64). TABLE 4A Bikunin Protease (7 Aprotinin Ki Bikunin (concentration) 64) Ki (nM) (nM) (102-159) Ki (nM) Trypsin (48.5 0.17 0.8 0.4 pM) Kalikrein 0.4 0.02 0.4 bovine pancreatic (92.0 pM) Kali krein from 2.4 19.0 0.3 human plasma (2.5 nM) Pl a sine 3.1 1.3 1. human (50 pM i Chymotrypsin 0.6 0.9 0.2 of bovine ( 5 nM) Factor Xlla> 300 12000> 300 Elastase > 100 8500 323 The results show that the amino acid sequence encoding placenta bikunin (7-64) can be refolded to obtain an active serine protease inhibitor that is effective against at least four serine proteinases similar to trypsin. Table 4B below also shows the efficacy of refolded placenta bikunin (7-64) as an inhibitor of various serine proteases in vitro. The refined placenta bikunin (7-64) was prepared from protein that was ensured that it was completely deprotected before purification and refolding. The data shown are compared against the data obtained by the inhibition of screening using placental bikunin (102-159), or aprotinin (Trasylol®).

Table 4B. Ki values for the inhibition of various proteases by the refolded bikunin (7-64). 'TABLE 4B Protein Bikunin (7 Aprotinin Ki Bikunin (concentration 64) Ki (nM) (nM) (102-159 Ki (nM) Trypsin (50 0.2 0.8 0.3 pM) Kalikrein 0.7 19.0 0.7 human plasma (0.2 nM) Plasmin 3.7 1.3 human (50 pM) Xlla Factor Not made 12, 000 4, 500 Factor Xla 200 288 15 (0.1 nM! Kali kreina 2.3 0.004 0.13 human tissue • Surprisingly, placental bikunin (7-64) was more potent than aprotinin in inhibiting human plasma kalikrein, and at least similar in efficiency as the plasmin inhibitor. These data show that placenta bikunin (7-64) is at least as effective as aprotinin, using in vitro assays, and that one would expect better or similar potency in vivo. Example 5 Expression of the placental bikunin variant (102-159) in yeast. The DNA sequence encoding placenta bikunin 102-159 (SEQ ID NO: 6) was generated using synthetic oligonucleotides. The final DNA product consisted of 15 nucleotides (5 'to 3') of the propeptide sequence of the coupling yeast factor in a fused to the cDNA sequence within the structure coding for placental bikunin (102-159). , followed by a detection codon in the structure. When cloned into a yeast expression vector, the cDNA would direct the expression of a fusion protein comprising a propeptide of the N-terminal yeast coupling factor oc, fused to the 58 amino acid sequence of the placental bikunin. (102-159). The processing of this fusion protein at a KEX-2 cleavage site at the junction between the coupling factor and the Kunitz domain was designed to release the Kunitz domain at its natural terminus N. An oligonucleotide was synthesized in the sense 5 'of the following sequence and containing a HindIII site for cloning: GAA GGG GTA AGC TTG GAT AAA AGA TAT GAA GAA TAC TGC ACC GCC AAC GCA GTC ACT GGG CCT TGC CGT GCA TCC TTC CCA CGC TGG TAC • TTT GAC GTG GAG AGG (SEQ ID NO: 42) A 3 'antisense oligonucleotide was synthesized from the following sequence and contained both a BamHI site for cloning and a detection codon,: CGC GGA TCC CTA CTG GCG GAA GCA GCG GAG CAT GCA GGC CTC CTC AGA GCG GTA GCT GTT CTT ATT GCC CCG GCA GCC TCC ATA GAT GAA GTT ATT GCA GGA GTT CCT CTC CAC GTC AAA GTA CCA GCG (SEQ ID NO: 43) The oligonucleotides were dissolved in a 10 mM Tris buffer solution pH 8.0 containing lmM EDTA, and 12 ug of each oligo was added and combined and brought to 0.25M NaCl. To hybridize, the oligonucleotides were denatured by boiling for 5 minutes and allowed to cool to 65 ° C at room temperature for 2 hours. Overlaps were extended using the Klenow fragment and digested with HindIII and BamHI. The resulting digested double strand fragment was cloned into pUC19 and the sequence was confirmed. A clone containing the fragment of the correct sequence was digested with BamHI / HindIII to release the bikunin containing the fragment with the following strand sequence +: GAA GGG GTA AGC TTG GAT AAA AGA TAT GAA GAA TAC TGC ACC GCC ' AAC GCA GTC ACT GGG CCT TGC CGT GCA TCC TTC CCA CGC TGG TAC TTT GAC GTG GAG AGG AAQ. TCC TGC AAT AAC TTC ATC TAT GGA GGC TGC CGG GGC AAT AAG AAC AGC TAC CGC TCT GAG GAG GCC TGC ATG CTC CGC TGC TTC CGC CAG TAG GGA TCC. { SEQ ID. : 44) which was then gel purified and ligated into the BamHI / HindI I I cut of pS604. The binding mixture was extracted with phenyl / chloroform and purified on a Minispin S-200 column. the binding product was directed to transform into yeast strains SC101 and WHL341 and placed on ura selection plates. Twelve colonies of the strain were returned to the ura deposit plates. A simple colony was inoculated in 2 ml of ura DO medium and allowed to grow overnight at 30 ° C. The cells were pelleted for 2 minutes at 14,000 xg and the supernatants were evaluated for their placental bikunin content (102-159).

Detection of the expression of placental bikunin (102-159) in transformed yeast. First, supernatants (50 ul per assay) were evaluated for their ability to inhibit the in vitro activity of trypsin using the assay methods as described in Example 1 (1 ml assay volume). A single sample of an unused medium as well as a yeast clone expressing an inactive variant of aprotinin, served as negative controls. A yeast clone that expressed the natural aprotinin, served as a positive control and is shown for comparison. The second method to quantify the expression of placental bikunin (102-159) exploited the use of polyclonal antibodies (pAbs) against the synthetic peptide to observe the accumulation of recombinant peptide using Western blot. These studies were carried out only with the recombinants derived from the strain SC101, since they produced a greater inhibitory activity than the recombinants derived from the strain WHL341. To produce the pAb, two 6-8 week old New Zealand white female rabbits (Hazelton Research Labs, Denver, Pa) were immunized on day zero with 250 ug of purified and purified synthetic placenta bikunin (102-159), in a complete Freund's adjuvant, followed by perforations on days 14, 35 and 56 and 77, each with 125 ug of the same antigen in an incomplete Freund's adjuvant. The antiserum used in the current studies was collected after the third shot by established procedures. The polyclonal antibodies were purified from the antiserum on protein A.

Colonies 2.4 and 2.5 of the transformation of yeast SC101 (figure 8) as well as an aprotinin control were grown overnight in 50 ml of ura DO media at 30 ° C. the cells were pelleted and the supernatant was concentrated 100-fold using a Centriprep 3 concentrator (Amicon, Beverly, MA). Samples from each (30 μl) were subjected to SDS-PAGE in 10-20% tricine-buffered gels (Novex, San Diego, CA) using the procedures of the manufacturers. Duplicate gels were developed with a silver staining kit (Integrated Separation Systems, Nantick, MA) or transferred to nitrocellulose and developed with the purified polyclonal antibody obtained from synthetic bikunin (102-159). Goat anti-rabbit conjugated alkaline-phosphatase antibody was used as the secondary antibody according to the manufacturers' instructions (Kirkegaard and Perry, Gaithersburg, MD). Purification of placental bikunin (102-159) from a transformed strain of SC101 The fermentation broth of a 1L culture of the 'strains SC101 2.4, was harvested by centrifugation (4,000 g x 30 minutes) and then applied to a column of 1.0 ml of anhydroquimiotripsin-sepharose (Takara Biochemical Inc., CA), which was previously equilibrated with a 50 mM Hepes buffer 7.5 mM solution containing 0.1 M NaCl, 2 mM CaCl 2 and 0.01% X-100 triton (v / v). The column was washed with the same buffer but containing 1.0 M NaCl until the A280 nm declined to zero, when the column was eluted with 0.1 M formic acid pH 2.5. the eluted fractions were emptied and applied to a C18 column (Vydac, .5um, 4.6x250 mm) previously equilibrated with 0.1% TFA, and eluted with a linear gradient of 50 min. of acetonitrile from 20 to 80% in 0.1% TFA. Fractions containing the placental bikunin (102-159) were drained and rechromatographed at C18 using elution with a gradient of linear acetonitrile 22.5 to 50% in 0.1% TFA. Res u l two. Figure 8 shows the percentage of trypsin activity inhibited by twelve colonies derived from the transformation of each of the strains SC101 and WHL341. The results show that all twelve colonies of yeast strain SC101, transformed with trypsin inhibitory placenta bikunin (102-159), had the ability to produce a substantial amount of trypsin inhibitory activity compared to controls negative, both of which showed no ability to inhibit trypsin. The activity is therefore related to the expression of a specific inhibitor in cells transformed by the placental bikunin variant (102-159). Yeast samples WHL341, contained a minimal inhibitory activity of trypsin. This can be correlated to the slow growth observed with this strain under the conditions used. Figure 9 shows SDS-PAGE and Western analysis of supernatants of yeast SC101. The silver-colored SDS-PAGE of the supernatants, derived from the recombinant yeasts 2.4 and 2.5 which express the placenta bikunin (102-159) as well as from the yeast expressing aprotinin, produced a protein band that goes to approximately 6 kDa, corresponding to the expected size for each recombinant Kunitz inhibitor domain. Western analysis showed that the 6 kDa bands expressed by the 2.4 and 2.5 colors reacted with the pAb obtained from placental bikunin (102-159). The same 6 kDa band in the aprotinin control did not react with the same antibody, demonstrating the specificity of the antibody for the placental bikunin variant (102-159). The final preparation of the C-terminal domain of the placenta bikunin was highly pure by silver-colored SDS-PAGE (FIG. 10). The overall recovery of the trypsin inhibitory activity derived from the broth in the final preparation was 31%. N-terminal sequence formation of the purified inhibitor indicated that 40% of the protein is correctly processed to produce the correct N-terminus for placental bikunin (102-159) while about 60% of the material contained a portion of the yeast coupling factor a. The purified material comprised an active serine protease inhibitor which exhibited an apparent Ki of 0.35 nM for the in vitro inhibition of plasma kalikrein. In conclusion, the accumulation of both the activity of the protease inhibitor and the immunochemically related protein to synthetic bikunin (102-159) in the fermentation broth, as well as the isolation of placental bikunin (102-159) from from one of the transformed lines, provided proof of the expression of placental bikunin in the recombinant yeast strains described herein, showing for the first time, the utility of yeasts for the production of placental bikunin fragments. Additional constructs were prepared, in an effort to increase the expression level of the Kunitz domain contained within placental bikunin 102-159, as well as to increase the yield of the protein with the correct N-terminus. It is hypothesized that the terminal N residues of placental bikunin 102-159 (YEEY--) may have presented a cleavage site that is only poorly recognized by KEX-2 yeast protease that enzymatically removes the pro-region of yeast A-factor. Therefore, we prepare constructs of yeast expression for the production of placental bikunin 103-159 (termination N of EEY ...), 101-159 (termination N of NYEEY ...) and 98-159 (DMFNYEEY ..) in order to modify the subsites P 'that surround the site of unfolding KEX-2. To try to increase the expression levels of the recombinant protein, we also use the preferred yeast codons more than the mammalian preferred codons, to prepare some of the constructs described below. The constructs were prepared essentially as described above for the placenta bikunin 102-159 (defined as construct # 1) but with the following modifications: Constructo # 2 placental bikunin 103-159, use of the oligonucleotide yeast codon in the sense 5 ' GAAGGGGTAA GCTTGG ATA A AAGAGA AGAA TACTGTACTG CTAATGCTGT TACTGGTCCA TGTAGAGCTT CTTTTCCAAG ATGGTACTTT GATGTTGAAA GA (SEQ ID NO .: 55) and oligonucleotide in the antisense 3 ACTGGATCCT CATTGGCGAA AACATCTCAA CA? ACAGGCT'ICTTCAGATC TGTAAGA ATT TTTATTACCT CTACAACCAC CGTAAATAAA ATTATTACAA GAATTTCTTT CAACATCAAA GTACC ATCT (SEQ ID NO .: 56) they were manipulated as described for the production of an expression construct (construct # 1 above) for the expression of placental bikunin 102-159.

Constructo # 3 placental bikunin 101-159, use of yeast codon An oligonucleotide in the 5 'direction GAAGGGGTAA GCTTGG ATAA AAGAAATTAC GAAGAATACT GTACTGCT ?? TGCTGTGACT GGTCCATGTA GAGCTTCTGTTCCAAGATGG TAC? TGATG TTGAAAGA (SEQ ID NO.57) and the same oligonucleotide in the 3 'antisense as used for construct # 2, were manipulated as described for the production of an expression construct (construct # 1 above) for the expression of placental bikunin 102-159. Construct # 4 placenta bikunin 98-159, use of the yeast codon An oligonucleotide in the 5 'direction GAAGGGGTAA GCTTGGATAA AAGAGATATG TTTAATTACG AAGAATACTG TACTGCTAAT GCTGTTACTG GTCCATGTAG AGCTTCTTTT CCAAGATGGT ACTTTGATGTTGAAAGA (SEQ ID NO .: 58) And the same 3 'antisense oligonucleotide as used for construct # 2 was manipulated as described for the production of an expression construct (construct # 1 above). The yeast strains SC101 (MATa, ura 3-52, suc 2) were transformed with the plasmids containing each of the above cDNAs, and the proteins were expressed using the methods described above for the production of placental bikunin. -159 with the use of the human codon. Approximately 250 ml of each yeast culture were harvested and the supernatant from the centrifugation (15 minutes x 3000 RPM) was separately subjected to a purification on 1 ml columns of kali krein-sepharose as described above. The relative amount of the trypsin inhibitory amount in the aplisate, the amount of purified protein recovered and the N-terminal sequence of the purified protein were determined, and are listed below in Table 7. Table 7 Relative production levels of different proteins that contain the Kunitz domain in the C terminal of Bikunina de Placenta TABLE 7 Construct or Concentration Formation of the relative sequence feedback N terminal inhibitor in Sequence quantity aplisate # 2 103-159 None None None Undetermined express ion # 3 101-159 251 of None None Low express inhibition ion # 4 98-159 93% of 910 DMFNYE- Good express inhibition correct ion Product # 1 102-159 82% of 480 AKEEGV- Expression inhibition the active protein processed incorrectly The results show that fragments of placental bikunin of different lengths containing the Kunitz domain at the C terminal, show a wide variation in the ability to express the functional protein secreted. The constructs that express fragments 101-159 and 103-159, produced little or no activity in the supernatants before purification, and N-terminal sequence formation of the 0.05 ml aliquots of each purified fraction resulted in undetectable amounts of the inhibitor. On the other hand, the expression of placental bikunin 102-159 or 98-159 resulted in significant amounts of protease activity prior to purification. The formation of the N-terminal sequence showed, however, that the purified protein recovered from the expression of 102-159, was once again again processed from incorrectly, mainly by showing an N-term consistent with the processing of the majority of the ptotein at a site within the pro-sequence of the yeast coupling factor a. The purified protein recovered from the expression of placental bikunin 98-159 however, was completely processed at the correct site to produce the correct N-term. Additionally, it almost recovered twice compared to recovery of placental bikunin 102-159. The placenta bikunin 98-159 thus represents a preferred fragment length for the production of the Kunitz domain at the C-terminus of placental Bikunin by the pre-pro-sequence coupling factor KEX-2 processing system of the S. cerevi sa e. Example 6 Alternative procedure for yeast expression The 58 amino acid peptide derived from the translation product R74593 can be amplified by PCR from PCR product R87894 -R74593 cloned into the TA ™ vector (Invitrogen, San Diego, CA) after forming the DNA sequence or from the human placental cDNA. The amplified DNA product will consist of 19 nucleotides of the leader sequence of the yeast coupling factor paired to the sequence R74593 that codes for the YEEY-CFRQ (58 residues), so as to prepare the translation product in a structure, construct a fusion protein of Kuni domain t z / coupling factor a. The protein sequence also contains a Kex 2 split that will release the Kunitz domain at its natural N-terminus. The oligonucleotide in the 5 'direction, which contains a HindIII site for cloning, will contain the following sequence: GCCAAGCTTG GATAAAAGAT ATGAAGAAT ACTGCACCGC CAACGCA. { SEQ ID NO. : 30) The 3 'antisense oligonucleotide contains a BamHI site for cloning as well as a stop codon and is of the following sequence: GGGGATCCTC ACTGCTGGCG GAAGCAGCGG AGCAT. { SEQ ID NO. : 31) The complete cDNA sequence of nucleotide 206 to be cloned into the expression vector of the yeast, is of the following sequence: CCAAGC TGG ATAAAAGATA TGAAGAATAC TGCACCGCCA ACGCAGTCAC TGGGCCTTGC CGTGCATCCT TCCCACGCTG GTACTTTGAC GTGGAGAGGA ACTCCTGCAA TAACTTCATC TATGGAGGCT GCCGGGGCAA TAAGAACAGC TACCGCTCTG AGGAGGCCTG CATGCTCCGC TGCTTCCGCC AGCAGTGAGG ATCCCC (SEQ ID NO .: 32) After PCR amplification, this DNA will be digested with HindIII, BamHI and cloned into the vector is of yeast expression pMT15 (see US Pat. No. 5,164,482, incorporated by reference in its entirety) also digested with HindIII and BamHI. The resulting plasmid vector is used to transform yeast strain SC106 using the methods described in U.S. Pat. 5,164,482. The URA 3 + yeast transformants are isolated and cultured under inducing conditions. The performance of the recombinant placenta bikunin variants is determined according to the amount of the trypsin inhibitory activity, which accumulates in the culture supernatants over time, using the in vitro assay method described above. The fermentation broths are centrifuged at 9000 rpm for 30 minutes. The supernatant is then filtered through a 0.4 filter, then a 0.2 μm filter, diluted to a conductivity of 7.5 ms, and adjusted to a pH of 3 with citric acid. The sample is then absorbed in a batch over 200 ml of S-Sepharose rapid flow (Pharmacia) in 50 mM sodium citrate pH 3 and stirred for 60 minutes. The gel is subsequently washed in sequences with 2 L each of 50 mM sodium citrate pH 3.0; 50 M Tris hydrochloride pH 9.0; HEPES 20 mM pH 6.0. the washed gel is transferred into an appropriate column and eluted with a linear gradient of 0 to 1 M sodium chloride in 20 mM HEPES pH 6.0. The eluted fractions containing the trypsin inhibitory activity in vitro are then emptied and further purified either by a) chromatography on an immobilized anhydrotrypsin column (essentially as described in example 2); b) by chromatography on an immobilized bovine kalikrein column; or c) a combination of conventional chromatographic steps including gel filtration and / or anion exchange chromatography. EXAMPLE 7 Isolation and characterization of natural human placenta bikunin from the placenta The bikunin protein was purified to appear homogeneous from a frozen whole placenta (Analytical Biological Services, Inc., Wilmington, DE). The placenta (740 gm) was thawed at room temperature and cut into pieces of 0.5 to 1.0 cm, placed on ice and washed with a 600 ml PBS buffer. The wash was decanted and 240 ml of placenta pieces were placed in a Waring blender. After adding 300 ml of buffer solution consisting of 0.1 M Tris (pH 8.0), and 0.1 M NaCl, the mixture was mixed at high speed for 2 minutes, decanted into 750.0 ml centrifuge tubes and placed on ice. This procedure was repeated until all the material was processed. The combined suspension was centrifuged at 4500 xg for 60 minutes at 4 ° C. The supernatant was filtered through a cheese cloth and the purified placenta bikunin using an affinity column of kalikrein made by the covalent placement of 70 mg of bovine pancreatic kalikrein (Bayer AG) to 5.0 ml of Sepharose activated with CNBr ( Pharmacia) in accordance with the instruction of the manufacturers. The material was loaded onto the affinity column at a flow of 2.0 ml / min and washed with 0.1 M Tris (pH 8.0), 0.1 M NaCl until the absorbance at 280 nm of the wash could no longer be detected. The column was further washed with 0.1 M Tris (pH 8.0), 0.5 M NaCl and then eluted with 3 volumes of 0.2 M acetic acid, pH 4.0. The fractions containing the inhibitory activity of trypsin and kalikrein (see below) were drained, frozen and lyophilized. The placental bikunin was further purified by gel filtration chromatography using a Superdex 7510/30 column (Pharmacia) placed in a Beckman System Gold HPLC system. Briefly, the column was equilibrated in Tris 0.1 M NaCl 0.15 M, and triton X-100 0.1% at a flow of 0.5 ml / min. The lyophilized sample was reconstituted in 1.0 ml of 0.1 M Tris, pH 8.0 and injected onto the gel filtration column in 200 μl aliquots. The fractions were collected (0.5 ml) and assayed for inhibitory activity of kalikrein and trypsin. The active fractions were drained and the pH of the solution was adjusted to 2.5 by the addition of TFA. The material was applied directly to a C18 Vydac reverse phase column (5 microns, 0.46x25 cm) which had been equilibrated in 20% acetonitrile in 0.1% TFA. The separation was achieved using a linear gradient of acetonitrile from 20 to 80% in 0.1% TFA and 1 ml / min for 50 minutes after an initial 20 minute wash in 20% acetonitrile in 0.1% TFA. The fractions were collected (1 ml) and tested for inhibitory activity of trypsin and kalikrein. Fractions containing the inhibitory activity were concentrated using a speed-vac concentrator (Savant) and subjected to N-terminal sequence analysis. Functional assays for placental bikunin: Identification of placental functional bikunin was achieved by measuring its ability to inhibit bovine trypsin and human plasma kalikrein. The inhibitory activity of trypsin was carried out in a test buffer (50 mM Hepes, pH 7.5, 0.1 M NaCl, 2.0 mM CaC12, 0.1% triton x-100) at room temperature in a microtiter plate. 96 wells (Perkin Elmer) using Gly-Pro-Lys-aminomet i lcumar ina as a substrate. The amount of coumarin produced by trypsin was determined by measuring the fluorescence (ex = 370 nm, em = 432 nm) in a Perkin Elmer LS-50B fluorimeter equipped with a plate reader. Trypsin (23 μg in 100 μl buffer) was mixed with 20 μl of the sample to be tested and incubated for 10 minutes at 25 ° C. The reaction was started by the addition of 50 μl of the GPK-AMC substrate (33 μM at the end) in a test buffer. The intensity of the fluorescence was measured and the percentage of inhibition for each fraction was determined by:% inhibition = 10 Ox [1-Fo / Fl] where Fo is the fluorescence of the unknown and Fl is the 'control fluorescence only of trypsin. The kallikrein inhibitory activity of the fractions was similarly measured using 7.0 nM kalikrein in a test buffer solution (50 mM Tris, pH 8.0, 50 mM NaCl, 0.1% triton x-100) and 66.0 μM Pro-Phe- Arg-AMC as a substrate. Determination of the specificity in vi tro of the placenta bikunin The specificity of the natural human placenta bikunin was determined using the materials and methods as described in the previous examples. The placental bikunin was quantified by active site titration against a known concentration of trypsin using GPK-AMC as a substrate to observe the unbound trypsin fraction. Protein sequence formation The 1 ml fraction (C18-29 Delaria) was reduced to 300 ml in volume, over a speed-vac to reduce the amount of organic solvent. The sample was then loaded onto a Hewlett-Packard miniature biphasic reaction column, and washed with 1 ml of 2% trifluoroacetic acid. The sample was formed in sequence on a protein sequence forming system model G1005A from Hewlett-Packard, using the Edman degradation. The sequence formation methods of version 3.0 and all the reagents were supplied by Hewlett-Packard. The sequence was confirmed by 50 cycles. Resulted. The placenta bikunin was purified to apparent homogeneity by sequential affinity of kalikrein, gel filtration, and reverse phase chromatography (see purification table below): Table 5 Purification table for natural placenta bikunin (1-179) a unit is defined as that amount that inhibits 50% of the trypsin activity in a standard assay. The majority of the inhibitory activity of trypsin and kalikrein was eluted from the affinity column of kalikrein in the elution with pH 4.0.

Subsequent gel filtration chromatography (FIG. 5), produced a peak of inhibitory activity of trypsin and kalikrein with a molecular weight range of 10 to 40 kDa as judged by the standard curve generated by running molecular weight standards under identical conditions. C18 reverse phase chromatography (Figure 6) produced peaks of inhibitory activity with the most potent eluting at about 30% acetonitrile. The activity associated with the first peak to elute from C18 (fraction 29) exhibited an amino acid sequence starting with amino acid 1 of the predicted amino acid sequence of placental bikunin (ADRER ...; SEQ ID NO: 1) , and was identical to the predicted sequence of 50 sequence formation cycles (amino acids underlined in Figure 3). The cysteine residues within this stretched sequence were silent as expected by the sequence formation of the oxidized protein. The cysteine residues at amino acid positions 11 and 20 of the mature placenta bikunin were then identified from the formation of the S-pyridy letilated protein sequences whereby PTH-pyridile il-cis-tein was recovered. in cycles 11 and 20. Interestingly, asparagine at amino acid residue number 30 in the sequence (figure 3) was silent showing that this site is likely to be glycosylated. Fraction 29 produced a greater sequence correspondingly to that of the placental bikunin starting at residue # 1 (27 pmol in cycle 1) plus a minor sequence (2 pmol) also derived from the placental bikunin that starts at residue 6 (SIHD ...). This shows that the final preparation formed in sequence in fraction 29 is highly pure, and more likely responsible for the inhibitory activity of the protease associated with this fraction (Figure 6).

In this way, the final preparation of placental bikunin from C18 chromatography was highly pure based on silver-colored SDS-PAGE analysis (Figure 7), where the micro protein with an apparent Mr of 24 kDa on a tricine gel of 10 to 20% acrylamide (Novex, San Diego, CA) calibrated with the following molecular weight markers: insulin (2.9 kDa); bovine trypsin inhibitor (5.8 kDa); lysosine (14.7 kDa); β-lactaglobulin (18.4 kDa); carbonic anhydrase (29 kDa); ovalbumin (43 kDa). The anterior size of the placenta bikunin in the SDS-PAGE is consistent with that predicted from the full-length coding sequence (Figure 4F). As expected based on the results of the N-terminal sequence formation described above, the purified protein reacted with an antibody evoked from placental bikunin (7-64) to produce a band with the same M r.

(Figure 12A) as observed by the purified preparation detected on the gels by staining with silver (Figure 7). However, when the same preparation reacted with an antibody obtained from synthetic placenta bikunin (102-159) a band corresponding to the full-length protein was not observed. Rather, a fragment co-migrating with synthetic bikunin (102-159) of approximately 6 kDa was observed. The simplest interpretation of these results is that the purified preparation had been subjected to a subsequent degradation to purification to produce an N-terminal fragment comprising the N-terminal domain and a C-terminal fragment comprising the C-terminal domain. Assuming that the fragment reactive against the placental bikunin antiserum (7-64) is devoid of the C-terminus of the full-length protein, the size (24 kDa) would suggest a high glycosylation state. Table 6 below shows the potency of in vitro inhibition of various serine proteases by placental bikunin. The data are compared with those obtained with aprotinin (Trasylol®). Table 6 Ki values for the inhibition of various proteases by placental bikunin. TABLE 6 - Aprotinin Bikunin Protease (concentration) placenta Ki (nM) Ki (nM) Trypsin (48.5 pM) OR .13 0.8 Human plasmin 1.9 1.3 (50 pM) The results show that placental bikunin isolated from a natural source (human placenta) is a powerful inhibitor of trypsin-like serine proteases. EXAMPLE 8 Expression pattern of placental bikunin between different human organs and tissues A Northern multiple tissue was purchased from Clontech which contained 2 μg of poly-A + RNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney and human pancreas. Two different cDNA probes were used: 1) a gel-purified cDNA encoding the placental bikunin (102-159); 2) the cDNA derived from PCR of 780 base pairs (Figure 4E) released from a TA clone by digestion with EcoRI and gel purified. Each probe was labeled using 32PdCTP and a random priming labeling kit from Boehringer Mannheim Biochemicals (Indiana), then used to hybridize to Northern multiple tissue according to the manufacturers' specifications. Autoradiographs were generated using a Biomax film with an exposure time of 18 hours, and were developed using a Umax reader and read using Adobe Photoshop. Res ul ta two. The pattern of tissue expression observed using a placenta bikunin probe (102-159) (figure HA) or a larger probe containing the Kunitz domains of placental bukunin (figure 11B), was essentially the same as It would have been expected. The placenta bikunin mRNA was more abundant in the pancreas and the placenta. Significant levels were also observed in the lung, brain and kidney, while lower levels were observed in the heart and liver, and mRNA was not detectable in skeletal muscle. The size of the transcript was 1.95 kilobases in all cases, in close agreement with the predicted size of the placenta bikunin deduced from the EST overlay and the cloning of the full-length cDNA described in the previous sections. The wide distribution of mRNA tissue shows that placental bikunin is widely expressed. Since the protein also contains a leader sequence, it would have a broad exposure to the human immune system, requiring it to be recognized as a selfprotein. Additional evidence for a broad tissue distribution of placenta bikunin mRNA expression is derived from the fact that some of the EST entries with placental bikunin homology (Figure 4B) are derived from adult human brain. and children, and retina, breasts, ovaries, olfactory epithelium and human placenta. It is therefore concluded that the administration of the natural human protein to human patients would improbably obtain an immune response. Interestingly, the expression pattern of placental bikunin suggests in some way that of bovine aprotinin found at high levels in the lung and in the bovine pancreas. To further clarify the expression pattern of placental bikunin, the RT-PCR of the total RNA of the following human cells was determined: endothelial cells of the unstimulated human umbilical vein (HUVECs), HK-2 (derived line of the proximal tubule of the kidney), TF-1 (line of erit roleukemia) and forbolter (PMA), peripheral blood leukocytes stimulated human. The probes used: CACCTGATCGCGAGACCCC (sense; SEQ ID NO: 59) CTGGCGGAAGCAGCGGAGCATGC (antisense; SEQ ID NO: 60) They were designed to amplify a placenta bikunin of 600 base pairs that encodes a fragment of cDNA. The comparisons were normalized by the inclusion of actin primers to amplify an 800 base pair actin fragment. Since the fragment of 800 base pairs identified on the agarose gels with the ethidium bromide was of equal intensity in all the clues, the placenta bikunin fragment of 600 base pairs was absent from the HUVEC but present in significant quantities in each of the other cell lines. We conclude that placenta bikunin is not expressed in at least some endothelial cells but is expressed in some leukocyte populations. EXAMPLE 9 Purification and properties of placental (1-170) highly purified bikunin from a baculovirus Sf9 expression system A large fragment of placenta bikunin containing both Kunitz domains (Bikunina (1-170) (SEQ ID NO: 52) was expressed in the Sf9 cells as follows: The placental bikunin cDNA obtained by PCR (Figure 4E) and contained within a TA vector (see previous examples) was released by digestion with HindIII and Xbal yielding a fragment flanked by an Xbal 5 'site and a 3' HindIII site This fragment was gel purified and then cloned into an M13mpl9 vector ((New England Biolabs, Beverly, MA). In vitro mutagenesis (Kunkel TA, (1985) Proc. Nati. Acad. Sci. USA, _8_2: 488-492) was used to generate a 3 'site of Pstl at the Xbal site at the 5' end, but 5 ' the sequence encoding the ATG start site, natural placenta bikunin signal peptide and mature placenta bikunin coding sequence. The oligonucleotide used for the mutagenesis had the sequence: 'CGC GTCTCG GCTGACCTGGCCCTG CAG ATG GCG CACGTG TGCGGG 3' (SEQ ID NO .: 61) A stop codon (TAG) and a site BglII / Xmal was similarly engineered at the 3 'end of the cDNA using the oligonucleotide: 5' CTG ccc CGG GGC TCA AAG TAG GAA GAT CTG CCC CCC GGG GGG GTG GTT CTG GCG GGG CTG 3 '(SEQ ID NO .: 62). The stop codon was structured with the sequence encoding the placental bikunin and terminated immediately following the lysine at amino acid residue 170, thus coding a truncated placenta bikunin fragment devoid of the putative transmembrane domain. The product of digestion with Pstl and BglII was isolated and cloned in the BacPacd vector for expression of the placental bikunin fragment (1-170) which contains both Kunitz domains but which is truncated immediately at the N-terminus to the segment of Transmembrane course. The expression of bikunin for insect Sf9 cells was optimal at a multiplicity of infection from one to one when the medium was harvested 72 hours after infection. After harvest, the culture supernatant of the baculovirus cell (2L) was adjusted to a pH of 8.0 by the addition of Tris-HCl. The bikunin was purified by chromatography using a 5 ml bovine pancreatic kalikrein affinity column as previously described in Example 7 for the purification of the placental natural placental bikunin. The eluted material was adjusted to a pH of 2.5 with TFA and subjected to chromatography on a C18 reverse phase column (1.0x25 cm) equilibrated in 10% acetonitrile in 0.1% TFA at a flow of 1 ml / min. The bikunin was eluted with a linear gradient of acetonitrile from 10 to 80% in 0.1% TFA for 40 minutes. The active fractions were drained and lyophilized and redissolved in 50 mM Hepes (pH 7.5), 0.1 M NaCl, 2 mM CaC12, and 0.1% triton x-100, and stored at -20 ° C until required. . The concentration of recombinant bikunin was determined by amino acid analysis. Res ul ta two. The recombinant bikunin was purified from the culture supernatant of the baculovirus cell using a two-step purification protocol as shown below, to produce an active trypsin inhibitor (Table 8 below). Table 8 Purification of recombinant bikunin from the transformed culture supernatant TABLE 8 Volume Stage OD 280 OD 280 Units Puri fi ed activity (ml) / total ml (U) specific ion Sobrena2300.0 9.0 20, 700 6, 150, 000 297 da Af afity 23. O 0.12 2.76 40.700 14.746 de the Kalikreina C18 phase 0.4 3.84 1.54 11, 111 72, inverse 150 Chromatography of the crude material on an immobilized affinity column of bovine pancreatic kalikrein selectively isolated 0.013% of the protein and 0.67% of the inhibitory activity of trypsin present. The majority of the inhibitory activity of trypsin present in the starting supernatant was not bound to the immobilized kalikrein and the bikunin is not related (results not shown). Subsequent chromatography using reverse phase C18 yielded an additional 5-fold purification, with 0.2% recovery. The final preparation was highly pure by SDS-PAGE (FIG. 13), showing a Mr of 21.3 kDa and reacted on immunolabels to the rabbit antiplacenta bikunin 102-159 (not shown). N-terminal sequence formation (26 cycles) produced the expected sequence for mature placenta bikunin (Figure 4F) starting at residue +1 (ARDER ...) showing that the signal peptide was correctly processed in the cells Sf9.

The placental bikunin purified from Sf9 cells (100 pmol), was alkylated with pyridylethyl, digested with CNBr and then sequenced without resolution of the resulting fragments. The sequence formation of 20 cycles yielded the following terms N: Sequence Amount # of placental bikunin residue LRCFrQQENPP-PLG 21 pmol 154 168 (SEQ ID NO .: 63) ADRERSIHDFCLVSKWGRC 20 prnol 1 20 (SEQ ID NO .: 64) FNYeEYCTANAVTGPCRAS? 16 pmol 100 119 (SEQ ID NO .: 65) Pr-Y-V-GS-Q-F-Y-G 6 pmol 25 43 (SEQ ID NO .: 66) Thus, the N terms corresponding to each of the four expected fragments were recovered. This confirms that the expressed protein Sf9 contained the complete sequence of the ectodomain of placental bikunin (1-170). Example 10 Specificity of the inhibition of purified placental bikunin (1-170) derived from Sf9 cells The in vitro specificity of recombinant bikunin was determined using the materials and methods described in examples 3, 4 and 7 In addition, the inhibition of human tissue kalikrein by bikunin was measured by incubating recombinant bikunin with 0.35 nM human tissue kallikrein in a buffer containing 50 mM Tris (pH 9.0), 50 mM NaCl, and triton. x-100 to 0.01%. After 5 minutes at 37 ° C, 5 μl of 2 mM PFR-AMC was added and the change in fluorescence observed. Inhibition of tissue plasminogen activator (tPA) was also determined as follows: tPA (single chain form of human melanoma cell culture from Sigma Chemical Co., St, Louis, MO) was pre-incubated with an inhibitor for 2 hours. hours at room temperature in a Tris 20 mMpH 7.2 buffer solution containing 150 mM NaCl, and 0.02% sodium azide. The reactions were subsequently initiated by transfer to a reaction system comprising the following initial component concentrations: tPA (7.5 nM), inhibitor 0 to 6.6 μM, DI le-Lpro-Larg-pNitroaniline (lmM) in 28 mM Tris buffer pH 8.5, containing triton x-100 at 0.004% (v / v) and sodium azide at 0.005% (v / v). The formation of p-nor t roaniline was determined from the A405nm measured after incubation at 37 C for 3 hours. The table below shows the efficacy of recombinant bikunin as an inhibitor of various serine proteases in vitro. The data are shown compared against data obtained by screening inhibition using recombinant bikunin or aprotinin. Table 9 Comparisons of Ki values for the inhibition of various proteases by recombinant placental bikinin (1160) or aprotinin.

The results show that recombinant bikunin can be expressed in insect cells to produce an active protease inhibitor that is effective against at least 5 different serine protease inhibitors. Recombinant bikunin was more potent than aprotinin against kalikrein, trypsin and human plasma plasmin. Surprisingly, recombinant bikunin was more potent than synthetically derived bikunin fragments (1-64) and (102-159) against all the enzymes tested. These data show that recombinant bikunin is more effective than aprotinin using in vitro assays and that one would expect better potency in vivo. In addition to measuring the potencies against the specific proteases, the capacity of the placental bikunin (to prolong the activated partial thromboplastin time (APTT) was evaluated and compared with the activity associated with aprotinin.) The inhibitor was diluted in Tris 20 buffer solution. mM pH 7.2 containing 15 mM NaCl, and 0.02% sodium azide and added (0.1 mL) to a cell that was inside an MLA ElectraR800 automatic coagulation timer coagulometer (Medical Laboratory Automation, Inc., Pleasantville, NY) The instrument was set to APTT mode with an activation time of 300 seconds and the duplicate mode After the addition of 0.1 ml of plasma (Specialty Assayed Reference Plasma Lot 1-6-5185, Helena Laboratories, Bermount, TX), the APTT reagent (Automated APTT-lot 102345, from Organon Teknika Corp., Durham, NC) and 25 mM CaC12, were automatically dosed to initiate coagulation, and the clotting time was automatically observed The results (Figure 14) showed that a doubling of the coagulation time required approximately a final aprotinin 2 μM, but only placental bikunin derived from Sf9 0.3 μ. These data show that placenta bikunin is an effective anticoagulant, and useful as a drug for diseases that involve the pathological activation of the intrinsic path of coagulation.

Example 11 Measurement of the difference of tracheal potential in guinea pigs. The aim of this study was to investigate the effect of the serine protease inhibitor, Kunitz's bikunin, and the amiloride sodium channel blocker on the difference in tracheal potential in guinea pigs 3 hours after treatment. These agents were delivered into the cephalic trachea by topical instillation. TPD was observed 2 hours later for 60 minutes. The procedure used in this Example is described in Newton et al., In "Cilia, Mucus and Mucociliary Interactions", Ed., Baum, G.L. and collaborators, Marcel Dekker, New York, 1998; Newton et al., Ped. Pulm. S17, Abs 364, 1998). Materials and methods / reagents used. Aqueous formulations of bikunin (1-170) - (5 and 50 ug / mL (SEQ ID NO: 52)) (as described in Example 17 below) and amiloride (obtained from Sigma Chemicals, San Luis, MO , USA) (100 uM), were prepared, filtered sterile and tested by endotoxin before use. These formulations were prepared in a Hank's balanced salt solution (HBSS) containing 137 mM NaCl, 3 mM KC1, 3 mM KH2P04, 8 mM Na2HP0, 0.2% Tween-80, pH 7.1) were prepared, filtered sterile and tested by endotoxin for use in this example. The HBSS was used as a control solution. The Hypnorm® was obtained (fentanyl citrate 0.315 mg / mL and fluanisone 10 mg / mL) from Janssen Animal Health and Hypnovel® (midazolam 5 mg / mL) was obtained from Roche. Male Dunkin-Hartley guinea pigs (550-750 g) were supplied from David Hall, UK. Thermistor probes were obtained from Kane-May Ltd, UK. Induction of the anesia and administration of bikunin in the tracheal airway. The animals were anesthetized using halothane. Once a satisfactory level of anesthesia was induced, a small incision was made below the lower jaw. The trachea was exposed and 100 ul by volume of the vehicle, bikunin (0.5 ug or 5 ug) or amiloride (100 uM) were instilled onto the surface of the trachea using a needle and a syringe. Once injected, the incision was sealed on the skin using Vetbond® (cyanoacrylate tissue gum). The animals were allowed to recover. Preparation of the guinea pig for the measurement of the potential difference in the trachea. Two hours after treatment with the agent, the guinea pigs were anesthetized for a second time with Hypnom® and Hypnovel® and immobilized in a supine position. The rectal temperature, measured with a thermistor probe, was maintained at 37 ° C by manually adjusting a heat lamp. A ventral midline incision was made from the lower jaw to the clavicles. Using an obtuse dissection, a length of the trachea was exposed and a bisection was made at the upper edge of the sternum. The exposed jugular vein was exposed and cannulated. The caudal part of the trachea was then cannulated to allow the animal to spontaneously breathe air from the environment. The animal was then placed in the supine position and its body temperature was maintained using the heat lamp. 20 minutes after the induction of intramuscular anesthesia, the tracheal agar electrode was inserted into the cephalic trachea and the potential difference of the trachea was measured for 60 minutes. The reference electrode was placed under the cephalic trachea in contact with the cartilage of the trachea. The site of the wound was covered to prevent drying. Resulted. As shown in Figure 15, bikunin (5 ug) inhibited the potential difference in the trachea of the guinea pig in vivo after three hours of treatment in relation to the vehicle. The effect of amiloride (100 uM) and bikunin (0.5 ug) is shown for comparison. Example 12 Effect of bikunin on the speed of the tracheal mucus in the guinea pig. The aim of this study was to investigate the effect of bikunin of the Kunitz serine protease inhibitor on the tracheal mucus velocity of the guinea pig, 1.5 hours after treatment. This agent was delivered to the cephalic trachea by topical instillation. The TMV was monitored 1.5 hours later for 60 minutes. The procedure used in the Example is described in Newton et al., In "Cila, Mucus and Mucociliary Interactions", Ed., Baum, G.L. and collaborators, Marcel Dekker, New York, 1998; Newton et al., Ped. Pulm. S17, Abs. 364, 1998). Materials and methods / reagents used. A formulation of bikunin (1-170) (50 ug / mL bikunin (SEQ ID NO: 52) (as described in Example 17 below) was prepared in HBBS containing 137 mM NaCl, 3 mM KC1, 3 mM KH2P04, Na2HP04 8 mM, 0.2% Tween-80, pH 7.1). The formulation was sterile filtered and the endotoxin was tested before use in this example. The HBSS was used as a control solution. Hypnor® (fentanyl citrate 0.315 mg / mL and fluanisone 10 mg / mL) was obtained from Janssen Animal Health and Hypnovel® (midazolam 5 mg / mL) was obtained from Roche. The male Dunkin-Hartley guinea pigs (550-750 g) were supplied from David Hall, UK. The thermistor probes were obtained from Kane-May Ltd, UK. Induction of anesthesia and administration of bkunin in the tracheal airway. The animals were anesthetized using halothane. Once a satisfactory level of anesthesia was induced, a small incision was made below the lower jaw. The trachea was exposed and a volume of 100 ul of vehicle or bikunin (5 ug) was instilled on the surface of the trachea using a needle and syringe. Once instilled, the incision in the skin was sealed using Vetbond® (cyanoacrylate tissue gum). The animals were then left to recover. Measurement of mucus velocity in the trachea (TMV). TMV was observed using a collimated miniature beta particle detector probe, prepared to detect the radioactivity emitted from an aliquot injected from Sa ccha romyces cerevi siae labeled 32 P as transported over the mucociliary layer of the trachea of an anesthetized guinea pig ( Newton and Hall 1998). Figure 16 (a) illustrates the preparation of the syringe and beta probe. Figure 16 (b) illustrates the counts detected by the probe when the S was transported. Cerevi s labeled as 32P along the mucociliary layer of the trachea. 70 minutes after instilling the bikunin, each animal was anesthetized a second time using Hyponorm® and Hyponovel® and immobilized in a supine position. The first measurement of TMV was made 20 minutes later. Subsequent measurements were taken every 15 minutes. The procedure for TMV measurements is described, in detail, in Newton et al., "Cilia, Mucus and Mucociliary Interactions." Ed. Baum, G.L., Preil, Z, Roth, Y., Dormouse., Ostfield, E., Marcel Dekker. New York, 1990 and Newton and collaborators in Pedi a tri c Pu lmon ol ogy S17, Abs 364, 1998. Results. As shown in Figure 16 (c), bikunin (5 ug) increased the TMV in vivo in guinea pigs, relative to saline, for a sustained period of 1.5 to 2.5 hours after administration. Example 13 Bikunin decreases the sodium current in the short circuit current (Isc) of the cultured human bronchial epithelial cell (HBE) in vitro. The HBE cell tertiary monolayers, grown to confluence, were mounted on modified Ussing chambers, immersed in a Krebs buffer (KBR) and bubbled with 95% 02/5% C02 heated at 37 ° C.

The cells were allowed to equilibrate for 20 minutes before calibrating for background noise and fluid resistance. The transepithelial potential difference was then subjected to 0 mV using a WPI EVC 4000 voltage clamp. Ag / AgCl electrodes were used to observe the Isc. Once a stable baseline was reached (typically 10-20 minutes), the cells were treated with amiloride (10 uM). Once the response to amiloride was observed, it was washed with a KBR solution. After returning to baseline and equilibrium, bikunin (1-170) (as described in Example 17 below) (0.5-50 ug / raL in PBS) or PBS control were added. 90 minutes after the treatment with the agent, amiloride (10 uM) was added. Once the current was stable, forskolin (10 uM) and then bumetanide (100 uM) were added. Results As shown in Figure 17, bikunin (70 nM) inhibited sodium current in vitro in human bronchial epithelial cells for a period of 90 minutes. The cAMP-mediated chloride secretion induced by forskolin, and the monolayer resistance were not affected.

Example 14 Effect of the hypertonic solution (14.4%) on the TMV in the guinea pig. The purpose of this comparative study was to investigate the effect of hypertonic saline solution (14.4% x 5 minutes) on the tracheal mucus velocity in the guinea pig. This agent was delivered to the cephalic trachea by aerosol. The TMV was observed immediately and every 15 minutes for 30 minutes. The procedure used in this Example is described in Newton et al., In "Cila, Mucus and Mucociliary Interactives", Ed. Baum, G.L. and collaborators, Marcel Dekker, New York, 1998; Newton et al., Ped. Pulm. S17, Abs. 364, 1998). Materials and methods / reagents used. Hypnorm® (fentanyl citrate 0.315 mg / mL and fluanisone 10 mg / mL) were obtained from Janssen Animal Health and Hypnovel® (midazolam 5 mg / mL) was obtained from Roche. Male guinea pigs Dunkin-Hart law (550-750 g) were supplied by Harlan UK Ltd. Thermistor probes were obtained from Kane-May Ltd, UK. Measurement of tracheal mucus velocity.

The animals were anesthetized using Hypnorm® and Hypnovel®. TMV was monitored using a miniature beta lead detector probe collimated with lead placed to detect the radioactivity emitted from an aliquot injected from Sa ccha romyces cerevi if it was labeled 32P, as it was transported in the mucociliary layer of the trachea of a guinea pig. Indias anesthetized (Newton and Hall 1998). The first measurement of TMV (run 1) was made 20 minutes after the administration. Subsequent measurements were taken every 15 minutes. At a time point 6 minutes before the second run, a saline spray was administered for 5 minutes (0.9%) or hypertonic saline (14.4%). The radiolabeled tracer particles were given through a 0.5 um hole made in the trachea. An aerosol of ether saline solution (0.9%) or hypertonic saline solution (14.4%) was generated by a Pari pressure nebulizer. The spray was removed one minute before the second run. The procedure for TMV measurements is described, in detail, in Newton et al., "Cilia, Mucus and Mucociliary Interactions". Ed. Baum, GL, Preil, Z., Roth, Y. Dorothy, Ostfield, E., Marcel Dekker, New York, 1990 and Newton and collaborators in Pedi at ri c Pulmon olgy S il, Abs 364, 1998. Resul tados. As shown in Figure 18, hypertonic saline solution (14.4% x 5 minutes) caused a transient increase in TMV immediately after the aerosol. Example 15 Effect of amiloride on TMV in the guinea pig. The purpose of this study was to investigate the effect of amiloride (10 mM x 20 minutes) on the mucus of the trachea of anesthetized guinea pigs that breathed spontaneously. This agent was delivered to the cephalic trachea by aerosolization as described in Example 14. The method of measuring TMV used in this Example is described in Newton et al., In "Cilia, Mucus and Mucociliary Interact ions", Ed. , Baum GL and collaborators, Marcel Dekker, New York, 1998; Newton et al., Ped. Pulm. S17, Abs. 364, 1998). Materials and methods / reagents used.

An "amiloride formulation" 10 mM) in water was prepared for this example. Hypnorm® (fentanyl citrate 0.315 mg / mL and fluanisone 10 mg / mL) was obtained from Janssen Animal Health and Hypnovel® (midazolam 5 mg / mL) was obtained from Roche. Male Dunkin-Hartley guinea pigs (550-750 g) were supplied by Harlan UK Ltd. The thermistor probes were obtained from Kane-May Ltd, UK. Measurement of mucus velocity in the trachea. The animals were anesthetized using Hypnorm® and Hypnovel®. TMV was observed using a miniature beta lead detector probe collimated with lead placed to detect the radioactivity emitted from an aliquot injected from Sa ccha romyces cerevi if it was labeled 32P, as it was transported in the mucociliary layer of the trachea of a guinea pig. Indian anesthetized. The guinea pigs were anesthetized with Hypnorm® and Hyponovel® at time 0. Amiloride was administered by aerosol (10 mM x 20 minutes). The first measurement of TMV was made immediately afterwards and subsequent measurements were taken every 15 minutes. Resulted.

As shown in Figure 19, amiloride (10 mM x 20 minutes) caused a statistically significant increase in TMV 15 minutes after the aerosol. Example 16 Aprotinin double mutein decreases the sodium current in the short circuit current (Isc) of a cultured human bronchial epithelial cell (HBE). The purpose of this study was to investigate the effect of the inhibitor of serine protease from the Kunitz family of aprotinin double mutein on Isc in vitro.The monolayers of tertiary HBE cells grown to confluence, were mounted in modified Ussing chambers, submerged in a Krebs buffer (KBR) and were bubbled with 95% 02/5% C02 heated to 37 ° C. The aprotinin double mutein is Des Pro2-Serl0-Argl5-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinine which is described in Example 1 of EP 821 007, published on January 29, 1998, incorporated as a reference in its entirety The cells were allowed to equilibrate for 20 minutes before calibrating for background noise and fluid resistance The difference in transepithelial potential was subjected to 0 mV using a PI EVC 4000 voltage clamp. The Ag / Ag'Cl electrodes were used to monitor the Isc. Once a stable baseline was reached (typically 10-20 minutes), the cells were treated with a amiloride (10 uM). Once the response to the amiloride was observed, it was washed with KBR solution. After returning to baseline and equilibrium, bikunin (5 ug / mL), aprotinin double mutein (0.5 to 5 ug / mL), aprotinin (1.5 to 5 ug / mL) or PBS were added. 90 minutes after the treatment with the agent, amiloride (10 uM) was added. Resulted. As shown in Figure 20, the dose of aprotinin double mutein (0.5 to 5 ug / mL) dependently inhibited the sodium current in vitro in human bronchial epithelial cells for a period of 90 minutes. Example 17 Expression, purification and inhibitory comparative activity of placental bikunin protease (1-170) expressed in Chinese Hamster ovary (CHO) cells. (a) Development of high CHO production cell lines that express the bikunin. The stable production cell lines that secrete high amounts of bikunin were developed by transfecting CHO cells (dhfr-) with the expression vector shown in Figure 27. The vector was constructed using standard recombinant DNA techniques. A description of the construction of the expression vector and the CHO cell expression system can be found in U.S.S.N. 09 / 441,654, filed on November 12, 1999, entitled "Method of Producing Glycosylated Bikunin," by the inventor Sam Chan. Briefly, the expression vector pBC-BK was constructed by cloning the bikunin cDNA immediately in the 3 'direction of the cytomegalovirus immediate early promoter and in the 5' direction of the polyadenylation signal sequence. The expression vector pBC-BK consists of a transcriptional unit for bikunin, dihydrofolate reductase, and resistance to ampicillin. The bikunin cDNA was released from the cloning vector by restriction enzymes, obtuse termination, and ligated to a linearized pBC. The linearization of the pBC was done by digestion of a simple restriction enzyme. The orientation of the bikunin cDNA was confirmed by sequence formation. About 1 x 10 6 CHO cells (Chinese hamster ovary) were transfected with 10 μg of pBC-BK using lipofectin reagents (Life Technology, Bethesda, Maryland) in accordance with the manufacturers' instructions. The cells were then selected in the presence of 50 nM methotrexan and grown in DME / F12 media deficient in thymidine and hypoxanthine plus 5% dialyzed fetal bovine serum. The cell populations were screened for the production of bikunin with a chromogenic assay. Briefly, bikunin standards or culture fluid were serially diluted and incubated with an equal volume of kalikrein at 37 ° C for 30 minutes after which a chromogenic substrate, N-benzoyl-Pro-Phe-Arg, was added. -pna The reaction was incubated for 15 minutes before the addition of 50% acetic acid. The amount of p-nitroanilide released was measured at 405 nM. The high production populations were further selected in media containing increasing concentrations of methotrexate (100 to 400 nM methotrexate) and screened for the production of bikunin. Cloning was then applied by limiting dilution to derive clones with high and stable productivity. Cloning was done in the absence of methotrexate using normal tissue culture techniques by depositing 1 cell / well in 96-well plates. A clone designated FD3-1 was chosen by productivity evaluation in a bioreactor and deposited on November 12, 1999 with the American Type Culture Collection (ATCC), Rockville, MD, and assigned the designation of PTA patent deposit. 940 (b) serum-free production of bikunin in a perfusion bioreactor. The continuous production of bikunin was made by fermentation by continuous perfusion. A 1.5-liter Wheaton fermentor was inoculated with a stable cell line of CHO at 2 x 106 cells / ml and was perfused at an average exchange rate of 0.5 liters / day. The production medium was a DME / F12 base medium supplemented with insulin (10 μg / ml) and FeS04 * EDTA (50 μM). the density of the cell was maintained at 4 x 106 cells / ml. The average daily yield of the thermidor was ~ 20 mg / day. The production of bikunin was stable for 21 days. (c) Purification of bikunin (1-170) produced from a CHO cell expression system. The bikunin produced from CHO cells was purified using standard chromatography techniques involving ion exchange, metal chelates, and size exclusion chromatography as detailed in Figure 29. SP column (18 x 10 cm, 2.5 L) was prepared , with a rapid flow of Sepharose-SP (Pharmacia), and equilibrated. The CHO cell harvest was cold filtered (TCF) and diluted 1: 2.5 with cold sterile water, ~ and the pH was adjusted to 5.0. Chromatography was carried out at room temperature with cold buffer solutions. The cold starting material was loaded onto the column at 800 mL / minute (189 cm / hour). The amount of bikunin loaded on the column was in the range of 0.888-1.938 g (approximately 14 mg / L). After loading, the column was washed with an equilibrium buffer solution and the bikunin was eluted with an elution buffer solution. The eluate was collected at 2-8 ° C (in an ice bath) and adjusted immediately to a pH of 7 with 6N NaOH. The column was washed, then sanitized with cold INN NaOH (2-8 ° C), and stored at 2-8 ° C in 20% ethanol until its next use. The equilibration and washing buffer solution contained 50 mM NaCl, 30 mM NaH2P04, pH 5.0; the elution buffer solution contained 350 mM NaCl, 30 mM NaH2P04, pH 5.0; and the pH adjusting buffer was 1M citric acid, 1M NaH2P04, pH 2.4. The thawed SP-Sepharose eluate was concentrated by ultrafiltration (UF) approximately 10 times to reduce the volume before a 5- to 7-fold diafiltration (DF) was carried out in preparation for the anion exchange chromatography. All operations were carried out at room temperature in a horizontal flow hood. The UF / DF used a Millipore Pellicon 2"mini" filter system (Bedford, MA) and two 10 kDa regenerated cellulose cartridges (P2C010C01). The flows were approximately 130 ± 20 mL / minute for the two-cartridge system and were maintained by regulating the inlet and outlet pressures between 22 to 26 psi and 12 to 16 psi respectively. The circulation was with a peristaltic pump; the recirculation was set at 500 to 600 mL per minute before the transmembrane pressure adjustment. The diafiltration was carried out with a buffer solution of cold 10 mM NaH2P04, pH 8.1. Column chromatography of Q-Sepharose was carried out as follows. A Q-Sepharose rapid flow column of 13 x 9 cm, 1.2 L (Pharmacia) was washed with 5 column volumes (CV) of sterile water and equilibrated with approximately 10 CV of equilibration buffer. The SP diafiltrate eluate was adjusted to a pH of 8.1 and applied to the Q-Sepharose column at 100 mL / minute (45 cm / hour). The amount of bikunin loaded on the column was in the range of 1121-2607 mg (approximately 15 mg / mL). After loading, the column was washed with equilibrium buffer until the UV absorbance at A280 reached the baseline; then the bikunin was eluted. The eluate was collected and used as a feed material for Zn-IMAC, metal ion absorption chromatography immobilized with zinc. The column was cleaned with 1M NaOH, rinsed with sterile water, and dried. stored in 20% ethanol. All operations were carried out at 2-8 ° C. The equilibration and washing buffer solution for the Q-Sepharose column contained 10 mM NaH2P04, pH 8.1. The elution buffer solution contained 10 mM NaH2P04, 100 mM NaCl, pH 8.1. A Zn-IMAC column (5 x 10 cm) containing approximately 200 mL of bed volume of Chelating Sepharose Rapid Flow (Pharmacia) was loaded with 3 volumes of ZnSO4 solution (see below); it was washed with 2 volumes of sterile water, and equilibrated with 6 volumes of buffer solution as described below. The Q-Sepharose eluate was adjusted to a pH of 7.4 and 300 mM NaCl (by the addition of solid NaCl), applied to Zn-IMAC at 30 mL / minute (92 cm / linear hour), and then the column was washed with equilibrium buffer solution until the UV absorbance reached the baseline. The amount of bikunin loaded on the column was in the range of 0.097-1.681 g (approximately 0.63 mg / mL). Step flow and washing were collected for UF. The column was depleted, and sanitized with 0.5 M NaOH. All the operations of this stage were carried out at 2-8 ° C. The equilibrium buffer solution for Zn-IMAC contained 10 mM NaH2P04, • 300 mM NaCl, pH 7.4; the exhaustion buffer contained 50 mM EDTA, 10 mM NaH2P04, 300 mM NaCl, pH 7.4; the loading solution, 2 mg / mL of ZnSO4, 7H20. The flow rate of the Zn-IMAC was concentrated by ultrafiltration 5 times with the Pellicon 2 system (Millipore) by chromatography with Sephacryl S-200. The permeate flow rates were from about 60 to 70 mL / minute and were maintained as previously described. The recirculation was at 400 to 500 mL / minute. One column (10 x 58.5 cm) containing 4.59 L of High Resolution Sephacryl S-200 (Pharmacia) was equilibrated with 137 mM NaCl, 2.7 mM KC1, 10 mM NaH2P04, 8 mM Na2HP04, 2 mg / L of Tween 80, pH 7.2. The flow was 30 mL / minute (23 cm / hour). In a typical run, 1475 mg of bikunin was applied in a volume of 95 mL to the column. The subsequent casting of S-200 was treated with an Etox resin intermittently for the separation of any potential pyrogen. The 2705 ActiClean Etox resin (Sterogene Bioseparat ions, Inc.) was rinsed with 1M NaOH and incubated for 5 hours in 1M NaOH at room temperature with stirring. The resin was washed and equilibrated with PBS, pH 7.2. Eighty mL of the filtered and equilibrated resin was added to 1063 mL of bikunin S200 (5460.11 mg), and stirred overnight at 2-8 ° C. The ETOX resin was then separated by filtration with a filter from a 0.2 micron Nalgene flask. Resulted. Table 10 shows the average performance allowed by each stage. Table 10. Purification stage Average yield (%) SP-Sepharose 88.1 UF / DF plus filtration 81 Q-Sepharose 59 ± 14 Zn-IMAC 99.5 Sephacryl S-200 81 ETOX resin 93 The overall performance of bikunin was around 30% with a purity of 95%. The mass spectroscopy data also suggest that, in addition to the full length (1-170) bikunin molecules, species lacking three (GSK) and four (L-GSK) amino acids were present from the carboxy terminus of the bikunin (1-170) in the emptying of pure protein. The material produced was shown to be stable to degradation when exposed for 72 hours of incubation at room temperature or at 37 ° C, neutral pH. N-terminal sequence formation, gel electrophoresis, immunoblotting, and analysis of animo acids indicated that bikunin was substantially pure (no other sequences were detected). An additional step of reverse phase chromatography revealed that the purified bikunin derived from CHO was still capable of being fractionated into various species (Figure 30A). CHO bikunin (8.5 mg) was adjusted to a pH of 2.5 with trifluoroacetic acid (TFA, 0.1% final concentration) and subjected to chromatography on a C-18 reverse phase column (Vydac, 2.5 x 25 cm) balanced in 17.5% acetonitrile and 0.1% TFA in a flow of 2 ml / minute. CHO bikunin was eluted with a linear gradient of 17.5-40% acetonitrile in 0.1% TFA for 60 minutes. Figure 30B shows the silver-colored SDS-PAGE profile of these fractions (the track between 54 and 55 represents molecular size markers). A preliminary carbohydrate analysis was performed on the glycosylated isoforms of bikunin CHO, which have a MW ranging from about 21 kDa to about 38 kDa. The total sugar content was found to be 7.5%. Both sites linked in N (Asn-30 and Asn-67) were found to be occupied by the carbohydrate structures. The chromatographic and mass spectrometry analyzes confirmed the presence of highly branched and heterogeneous oligosaccharide structures, which contributed to the size heterogeneity observed for purified bikunin. About 90% of the oligosaccharides were sialylated and the remaining structures remained neutral. When treated with N-glycos idase F, the glycosylated isoforms of CHO bikunin (Figure 30B) were converted to a simple 18 kDa isoform (see Figure 31). The sialunic acid content of bikunin was analyzed by incubation with sialidase in a buffer solution of 50 mM sodium acetate, pH 5.0, for 18 hours in a capped microfuge tube. The sialic acids were separated on a Carbo Pac PA1 anion exchange column using a gradient of 20-250 mM sodium acetate buffer in 100 mM NaOH for 50 minutes at a flow rate of 1 ml / minute. The detection was made with an electrochemical pulse detector and quantified by comparing the retention times and the peak areas of the samples with the standard sialic acids (N-acetylneuraminic acid and N-glutarylneuramic acid). The results are shown in Table 11. Table 11. Sialic acid composition of bikunin.

Example 18 Comparative activity of placental bikunin protease inhibitor (1-170) expressed in Chinese hamster ovary cells (CHO). General . The in vitro specificity of recombinant bikunin was determined using the materials and methods described in Examples 3, 4, 7 and 10. Table 12 below shows the efficacy of recombinant bikunin as an inhibitor of various serine proteases in vitro. The data is shown using either recombinant bikunin or aprotinin. Pro teasas. The quantification of human plasmin and human plasma kalikrein was carried out by titration of active site using p-nitrophenyl p '-guanidinobenzoate hydrochloride, as previously described (Chase, T., and Shaw, E., ( 1970) Me th ods En zmol 19, 20-27). Human tissue kallikrein (Bayer, Germany) was quantified by active site titration using bovine aprotinin as a standard and PFR-AMC as a substrate assuming a 1: 1 complex formation. The Km for the GPK-AMC with plasmin under the conditions used was 726 μM; the Km for the PFR-AMC with human plasma kalikrein was 457 μM; the Km for the PFR-AMC with human tissue kalikrein was 5.7 μM. The inhibition of human plasmin by placental bikunin expressed in CHO (1-170) and aprotinin was determined with plasmin (50 pM) and the placenta bikunin expressed in CHO (1-170). (0-2 nM) or aprotinin (0-4 nM) in a buffer solution containing 50 mM Tris hydrochloride (pH 7.5), 0.1M NaCl, and 0.02% triton x-100. After 30 minutes of incubation at 37 ° C, 25 μl of 20 mM GPK-AMC was added and the change in fluorescence observed. Inhibition of human plasma kalikrein by CHO (1-170) expressed placenta bikunin or aprotinin was determined using kalikrein (0.2 nM) and placenta bikunin expressed by CHO (1-170) (0-4 nM ) or aprotinin (0-45 nM) in 50 mM Tris hydrochloride (pH 8.0), 50 mM NaCl, and 0.02% triton x-100. After 30 minutes at 37 ° C, 5 μl of 20 mM PFR-AMC was added and the change in fluorescence was observed. Inhibition of human tissue kalikrein by aprotinin or placental bikunin expressed in CHO (1-170) was measured by incubation of 0.35 nM human tissue kalikrein with placental bikunin expressed by CHO (1-170) (0). -10 nM) or aprotinin (0-0.5 nM) in a 1 ml reaction volume containing a buffer solution of 50 mM Tris hydrochloride, pH 9.0, 50 mM BaCl, and 0.1% triton x-100. After 5 minutes at 37 ° C, 5 ul of 2 mM PFR-AMC was added reaching a final concentration of 10 uM and the change in fluorescence was observed.

Inhibition of Factor Xla (from Enzyme Research Labs, South Bend, IN) was measured by incubation of FXIa (0.1 nM) with placenta bikunin expressed in CHO 0 up to 40 nM (1-170) or aprotinin 0 up to 4 uM in buffer solution containing 50 mM Hepes, pH 7.5, 100 mM NaCl, 2 mM CaCl, 0.01% triton x-100, and 1% BSA, in a total volume of 1 ml. After 30 minutes at 37 ° C, 10 ul of 40 mM Boc-Glu (Obzl) -Ala-Arg-AMC (Bachem Biosciences, King of Prussia, PA) was added and the change in fluorescence was observed. The apparent inhibition constant Ki 'was determined using the Enzfitter packet of the data regression analysis program (Biosoft, Cambridge, UK): The kinetic data of each experiment were analyzed in terms of the equation for a solid-link inhibitor: i / VD = 1 - (Eo + I0 + Ki * - [(Eo + I0 + K¡ *) 2 - 4 E0I0] V2) / 2E0 (2) where Vj./V0 is the activity of the fractional enzyme (inhibited against non-inhibited), and EQ and I0 are the total concentrations of the enzyme and the inhibitor, respectively. Ki values were obtained when coring for the effect of the substrate according to the equation: K1 = Ki * / (l + [SD] / Km) (3) (Boudier, C, and Bieth, J. G., (1989) Bi och im Bi ophys Ac ta. 995: 36-41). RESULTS: The Ki values are listed in Table 12 below. Table 12. Comparison of Ki values for the inhibition of various proteases by CHO bikunin (1-170) or aprotinin.

The results show that mbinant bikunin can be expressed in CHO cells to produce an active protease inhibitor that is effective against at least three different serine proteases. mbinant bikunin was more potent than aprotinin against human plasma kalikrein, and human FXIa. It was equally potent with aprotinin to inhibit human plasmin. Example 19 Aprotinin decreases the sodium current in the short circuit current (Isc) in human bronchial epithelial cells cultured with cystic fibrosis, in vitro. HBE cells were isolated from a lung transplant tissue from a CF patient and grown in collagen-coated flasks for one week. Cells were then passaged and seeded on Costar Transwell filters coated with collagen (0.33 cm2) and grown in a DMEM / F12 medium supplemented with 2% Ultroser G. The cells grew in a liquid air interface and were used 2 to 4 weeks after sowing. The cells in the Transwell filters were mounted in Costar Ussing modified chambers and were studied under Isc. Conditions. Baseline values of Isc were rded (0 to 10 minutes), and then aprotinin (1 mg / mL in PBS) was added to the apical side. Isc was rded for 100 minutes and then the apical bath fluid was exchanged with fresh buffer solution. Trypsin was added to the apical side (100 units BAEE / mL) and the Isc was rded for 10 minutes. The amiloride (10 uM) was then added to the apical side and the Isc was rded for another 10 minutes. Resulted. As shown in Figure 21, aprotinin (1 mg / mL in PBS) inhibited Isc in vitro in human bronchial epithelial cells with CF for a period of 100 minutes. After washing, Isc was increased by the treatment of the apical surface with serine protease, trypsin. Finally, the addition of amiloride (10 uM) showed that the changes in the Isc are the result of the changes in the sodium-dependent current. Example 20 Evaluation of the activity of bikunin (1-170) after nebulization. The purpose of this study was to evaluate the anti-protease activity of bikunin (1-170) described in Example 17 after nebulization. All studies were carried out with bikunin formulated in phosphate buffered saline, pH 7.4 (137 mM NaCl, 3 mM KCl, 3 mM KH2P04, 8 mM Na2HP04, 0.02 g / L Tween 80). Nebulization methods. Raindrop® medication nebulizer: The bikunin it was aerosolized at concentrations of 1 and 3 mg / mL. The reservoir of the nebulizer was filled with 2.5 mL of bikunin solution. The aerosol formation was carried out at 7.35 L / minute or 35 psi. Collision nebulizer: Bikunin was aerosolized at a concentration of 4.7 mg / mL. The reservoir of the nebulizer was filled with 2.5 mL of bikunin solution. The aerosol formation was carried out at 35 psi. Collection of nebulized samples. The aerosolized bikunin was collected using a twin punch (average cut-off of the aerodynamic particle 6.4 um at 60 L / minute through the system). The kicker works on the principle of hitting the liquid and divides the spray into a non-respirable fraction (>6.4 um collected in Stage 1) and a respirable fraction (6.4 6.4 um one collected in Stage 2). Measurement of the anti-protease activity.

The activity of bikunin was measured in vitro by its inhibition of human plasma kalikrein. Results Raindrop® medication nebulizer: Activity values (Ki) for pre- and post-nebulization samples were as follows: bikunin 1 mg / mL: Ki values were 0.47 (± 0.02) and 0.76 (± 0.04) respectively; and for bikunin (1-170) 3 mg / mL, the Ki values were 0.52 (± 0.03) and 0.62 (± 0.03) respectively. Collision nebulizer: The activity values (Ki) for the pre- and post-nebulization samples were 0.27 (± 0.03) and 0.45 (± 0.03) respectively. Conclusion: The pre- and post-nebulized bikunin samples from the Raindrop and Collison nebulizers showed similar activities (similar Ki values within the assay variability), indicating that bikunin (1-170) was stable to the formation of aerosol and retained its anti-protease activity after nebulization.

Example 21 The effect of bikunin on the speed of mucus in the trachea of sheep. The purpose of this study was to investigate the effect of the inhibitory bikinin of serine protease of the Kunitz family (1-170) described in Example 17 on the tracheal mucus velocity of sheep for 8 hours after treatment. This agent was delivered by nebulized aerosol administration to the respiratory tract. The procedure used in this example is described in O'Riordan et al., J. Applied Physiol. 85 (3), 1086-1091, 1998. Measurement of TMV. Adult sheep were fixed in a vertical position, with their heads immobilized, in a specialized body harness. They were nasally tubed with an endotracheal tube, with the fist placed just below the vocal cords. The aspirated air was heated and humidified.

To minimize the possible deterioration of the TMV caused by the inflatable bands, the endotracheal tube band remained deflated throughout the study except during the period of aerosol administration. To measure TMV, 5 to 10 Teflon particles opaque to radiation (approximately 1 mm in diameter, 0.8 mm thick and weighing 1.5 to 2 mg) were insufflated into the trachea by means of a catheter placed inside the tube. endotracheal The movement of Teflon particles was then measured over a period of one minute. The procedure used in this example is described in Russi et al., J. Applied Physiol. 59 (5), 1416-1422, 1985. A collar containing markers opaque to radiation of known length was applied to the exterior of the animals and was used as a standard to convert the distance traversed by the particles on a video screen in the actual distance traveled. The TMV was calculated from the average distance in a cephalic direction traveled per minute by the 5 to 10 Teflon particles. The baseline TMV was measured immediately before the administration of the aerosol.

Test substances: PBS, 1 mg / mL Bikunin in PSB; or 3 mg / mL of bikunin in PBS; were supplied to the sheep airways as an aerosol (3 mL) generated using a Raindrop jet nebulizer operated at a flow that produced drops of an average mass aerodynamic diameter of 3.6 um. TMV was inhibited immediately after administration of the test substance (0 hours), then again at 0.5, 1 ', 2, 3, 4, 5, 6, 7, and 8 hours. RESULTS As shown in Figure 22, 9 mg of a bikunin spray (3 mL of 3 mg / mL) delivered to the respiratory tract of the sheep, significantly increased the TMV at 0.0.5.3.4.5 , 6.7, and 8 hours compared to the same time points for a group of animals receiving the aerosol in a PBS vehicle. At 24 hours, the TMV had returned to baseline rates in both the bikunin treatment and the PBS vehicle groups. At a lower dose (3 mg of bikunin aerosol (3 mL of 1 mg / mL)), no significant differences in TMV were observed between the treatment groups and vehicle at any time point studied. Example 22 Bikunin (50 ug / ml) decreases the sodium current in the short circuit current (Isc) of tracheal epithelial cells from cultured guinea pigs (GPTE). The purpose of this study was to investigate the effect of bikunin ( 1-170) (see example 17) on Isc in GPTE cells in vitro. GPTE cells were seeded on Snapwell ™ inserts of 0.4 um pore size and 1.2 cm in diameter (Costar UK). The cells were grown to confluence and mounted in modified Ussing Chambers 2-4 days after placement in the air-liquid interface. The inserts were immersed in a Krebs buffer solution (KBR) and were bubbled with 95% 02/5% C02 heated to 37 ° C. After a balance period of 20 minutes, then the difference in t-telse potential was subtracted at 0 mV using a W PI EVC 4000 voltage clamp. Ag / AgCl electrodes were used to observe the Isc. Once a stable baseline was reached (typically 2.0-30 mins), the cells were treated with amiloride (30 uM). Once a response to the amiloride was obtained, it was washed with a KBR solution. After returning to baseline and equilibrium, the bikunin (1-170) described in Example 17 (10 a50 ug (mL) or PBS were added) 30 min after treatment with the agent, amiloride (30 uM) was added. Resulted As shown in figure 23, bikunin (1-170) (50 ug / mL) inhibited the in vitro sodium current in tracheal epithelial cells of guinea pigs for a period of 30 minutes. Example 23 Bikunin (1-170) (100 ug / mL) Decreases Sodium Current in the Short Circuit Current (Isc) of Cultured Sheep Trachea Epithelial Cells (OTE) The purpose of this study was to investigate the effect of bikunin (1-170) (see example 17), on Isc in OTE cells in vitro. OTE cells were seeded on Snapwell ™ inserts of 0.4 um pore size, 1.2 cm in diameter. The cells were grown to confluence and mounted on modified Ussing chambers 3-5 days after being placed in the air-liquid interface. The inserts were immersed in a Krebs buffer solution (KBR) and were bubbled with 95% 02/5% C02 heated to 37 ° C. After a 20 minute equilibrium period, the transepithelial potential difference was then subjected to 0 mV using a WWPI EVC 4000 voltage clamp. Ag / AgCl electrodes were used to monitor the Isc. Once a stable baseline was reached (typically 30 mins), the cells were treated with amiloride (10 uM). Once a response to the amiloride was obtained, it was washed with a KBR solution. After returning to the baseline, the bikunin (1-170) described in Example 17 (25, 50 or 100 ug / mL) or PBS was added. 90 minutes after the treatment with the agent, amiloride (10 uM) was added. Resul tates As shown in Figure 24, bikunin (1-170) (100 ug / mL) significantly inhibited the in vitro sodium current in sheep tracheal epithelial cells for a period of 90 minutes.

Example 24 Effect of bikunin (1-170) on the difference of tracheal potential in guinea pigs pretreated with LPS Inflammation of the airways dominated by the polymorphonuclear leukocyte (neutrophil) (PMN), is often a feature of the disease of the lung by CF. In the guinea pig, exposure to a lipopolysaccharide aerosol of E. coli (LPS) induces a marked influx of PMN in the bronchoalveolar lavage fluid 24 hours after undergoing the immunogenic test. The purpose of this study was to investigate the effect of bikunin (1-170) described in Example 17 on the potential difference of the trachea in guinea pigs pre-exposed to an LPS aerosol. Agents were delivered into the cephalic trachea by topical instillation. The TPDF was monitored for 60 minutes, 23 hours after exposure to LPS. Ma teriale / Reagents Bikunin (1-170) was formulated in Hank's balanced salt solution (HBSS). Amiloride was obtained from Sigma Chemical and formulated in HBSS. The vehicle control was HBSS. Hypnorm (pentanil citrate 0.315 mg / mL and Fluanisone 10 mg / mL) was obtained from Janssen Animal Health and Hypnovel (Midazolam 5 mg / mL) was obtained from Roche. The guinea pigs Dunkin-Hart law (600-700 g) were supplied by Harlan UK. Thermistor probes were obtained from Kane-May Ltd, UK. Induction of PMN flow Individual animals were exposed to an aerosol of 0.03 mg / mL LPS or PBS for 10 minutes. Preparation of the guinea pig for the measurement of the potential difference in the trachea Guinea pigs were anesthetized 23. 4 hours after treatment with LPS with Hypnorm and Hypnovel and immobilized in a supine position. An incision in the middle of the belly was made from the lower jaw to the clavicles. Using an obtuse dissection, a length of the trachea was exposed and a bisection was made at the upper edge of the sternum. The external jugular vein was exposed and cannulated. Part of the flow of the trachea was cannulated to allow the animal to spontaneously breathe air from the environment. The animal was then placed in the supine position and the body temperature was maintained at 37 ° C by manual adjustment of a heat lamp. The rectal temperature was monitored with a thermistor probe. 20 minutes after induction of anesthesia, bikunin (50 ug / ml) or amiloride (100 uM) was instilled into the cephalic trachea, the tracheal agar electrode was then inserted into the cephalic trachea and the potential difference in the trachea was measured for 60 minutes The reference electrode was placed under the cephalic trachea in contact with the cartilage of the trachea.The wound site was covered to prevent drying.Results As shown in Figure 25 (a), exposure to LPS caused a significant influx of PMN The bikunin significantly inhibited the potential difference in guinea pigs pre-exposed to LPS, as shown in Figure 25 (b) Example 25 The effect of aprotinin double mutein on mucus velocity of the trachea in guinea pigs The purpose of this study was to investigate the effect of aprotinin double mutein described in example 16 on the speed of the snot of the trachea of guinea pigs, 1.5 hours after This treatment agent was delivered into the cephalic trachea by topical instillation. The TMV was monitored 1.5 hours later for 60 minutes. Ma terials / Reagents Aprotinin double mutein (see example 16) was obtained from Biot echnologie, Bayer AG, Germany, USA and formulated in Hank's balanced salt solution (HBSS). Hypnorm (pentanyl citrate 0.315 mg / mL and Fluanisone 10 mg / mL) were obtained from Janssen Animal Health and the Hypnovel was obtained (Midazolam 5 mg / mL) from Roche. The Dunkin-Hartley male guinea pigs (600-750 g) were supplied by Harlan UK. The thermistor probes were obtained from Kane-May Ltd., UK. Induction of the anesia: The animals were anesthetized using halothane. Once a satisfactory level of anesthesia was induced, a small incision was made under the lower jaw. The trachea was exposed and 100 ul of vehicle or aprotinin double mutein (10 ug) was injected into the airway opening using a needle and a syringe. Once injected, the skin overlapping the injection site in the trachea was repaired. The animals were then left to recover. Measurement of mucus velocity in the trachea The velocity of mucus in the trachea (TMV) was monitored using a miniature beta particle detector probe collimated with lead placed to detect the radioactivity emitted from an aliquot of Saccharomyces cerevisiae labeled with phosphorus. when it was transported in the mucociliary layer of the trachea of an anesthetized guinea pig. 70 minutes after the instillation of the test agent, the guinea pigs were anesthetized a second time with Hypnorm and Hypnovel and immobilized in a supine position. The first measurement of TMV was made 20 minutes later. Results As shown in Figure 16, the double mutein protein (10 ug) increased the TMV in vivo in the guinea pig, in relation to the HBSS, during a sustained period of 1.5 to 2.5 hours after administration. Example 26 Bikunin (1-170) decreases sodium current in the short circuit current (Isc) of bronchial epithelial cells with human cystic fibrosis cultured in vitro HBE cells were isolated from a lung transplant tissue of a patient with CF and grew in collagen-coated flasks for a week. The cells were then passed and seeded on Costar Transwell filters coated with collagen (0.33 cm2) and grown in a DMEM / F12 medium supplemented with 2% Ultroser G. The cells grew in a liquid air interface and were used 2 to 4 weeks after sowing. The cells in the Transwell filters were mounted in Costar Ussing modified chambers and were studied under Isc conditions. Baseline values of Isc were recorded (from 0 to 20 minutes), and then Bikunin (1-170) (see example 17) (10 ug / mL in PBS) was added on the apical side. The Isc was recorded for 90 minutes and then the amiloride (10 uM) was added and the Isc was recorded for an additional 10 minutes. The fluid from the apical bath was then exchanged with fresh buffer and the Isc was recorded for an additional 15 minutes. Trypsin (1 uM) was added to the apical side and Isc was recorded for 15 minutes. Amiloride (10 uM) was then added to the apical side and Isc was recorded for another 10 minutes. Resulted As shown in Figure 28 (a), bikunin (1-170) (10 ug / mL in PBS) inhibited Isc in vitro in bronchial epithelial cells with human CF. During a period of 90 minutes. Isc was further reduced by the addition of amiloride (10 uM). With washing, the Isc was increased back to the current reached before the addition of the amiloride. After an additional 15 minutes, the apical surface was treated with trypsin (1 uM) and this also increased the Isc up to the level of the baseline current (that is, that observed at 20 minutes). Finally, the addition of amiloride (10 uM) inhibited most of the current and showed that the changes in the Isc were the result of the changes in the sodium-dependent current. Figure 28 (b) shows that bikunin (1-170) at 1.5 and 10 ug / mL, and aprotinin at 20 ug / mL inhibited Isc at 90 minutes after apical application to human epithelial cells bronchial tubes with CF in vitro. Although certain embodiments of the invention have been described in detail for illustration purposes, it will be readily apparent to those skilled in the art that the methods and formulations described herein can be modified without departing from the spirit and scope of the invention. In this manner, the invention is not limited except by the appended claims. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (25)

1. Claims Having described the invention as above, property is claimed as contained in the following. 1. The use of a serine protease inhibitor of the Kunitz type for the preparation of a medicament for accelerating the rapidity of mucociliary clearance in a subject in need of such treatment, characterized in that the medicament comprises an effective amount of prophylactic depuration mucociliary of a serine protease inhibitor of the Kunitz type and a physiologically acceptable carrier therefor.
2. 2. The use according to claim 1, characterized in that the composition is administered to the respiratory tract of the lung.
3. 3. The use according to claim 1, characterized in that the composition is administered directly by aerosol formation.
4. 4. The use according to claim 1, characterized in that the composition is administered directly as an aerosol suspension within the respiratory tract of the mammal.
5. 5. The use according to claim 4, characterized in that the aerosol suspension includes respirable particles in the size range from about 1 to about 10 microns.
6. 6. The use according to claim 4, characterized in that the aerosol suspension includes respirable particles in the size range from 1 to about 5 microns.
7. The use according to claim 4, characterized in that the aerosol suspension is delivered to the subject by a pressure-driven nebulizer.
8. 8. The use according to claim 4, characterized in that the aerosol suspension is delivered to the subject by means of an ultrasonic nebulizer.
9. 9. The use according to claim 4, characterized in that the aerosol suspension is delivered to the subject by a non-toxic propellant.
10. 10. The use according to claim 1, characterized in that the carrier is a member selected from the group consisting of a physiologically buffered solution, an isotonic saline solution, a normal saline solution and combinations thereof.
11. 11. The use according to claim 1, characterized in that the inhibitor of serine protease of the Kunitz type is aprotinin.
12. 12. The use according to claim 1, characterized in that the serine protease inhibitor of the Kunitz type comprises the amino acid sequence MAQLCGL RRSRAFLALL GSLI-SGVLA -1 ADRERSIHDF CLVSKWGRC RASMFRWWYN VTDGSCQLFV YGGCDGNSNN 50 YI / TKE? CL K CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ? NPPLPLGSK WLAGLPVM VLILFLGASM VTLIRVARRN 200 QERALRTVWS SGDDKEQLVK NTYVL 225 (SEQ ID NO .: 49).
13. 13. The use according to claim 1, characterized in that the serine protease inhibitor of the Kunitz type comprises the amino acid sequence: AGSFLAWL GSLLLSGVLA RASMPRWWYN VTDGSCQLFV -1 ADRERSIHDF CLVSKWGRC YGGCDGNSNN 50 YLTKEECLKK DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF CATVTE ATG NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR 100 GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK 179 VWLAGAVS (SEQ ID NO: 2), MLR AEADGVSRLL GSLLLSGVLA -1 ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGN = NN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDKSSDMF 100 NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPFLPLGSK WVLAGLFVM VLILFLGASM VYL, IRVARRN 200 QERALRTVWS SGDDKEQLVK NTYVL 225 (SEQ ID NO .: 45), MAQLCGL RRSRAFLALL GSLLLSGVLA -1 ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCD3NSN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCAN VTGPCRASFP HWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFHQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN 200 QERALRTVWS FGD 213 (SEQ ID NO: 47), ADRERSIHDr CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN 200 QERALRTVWS SGDDK? QLVK NTYVL 225 (SEQ ID NO: 70), ADRERS IKDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSE? 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILF GA = M VYLIRVARRN 200 QERALRTVWS FGD 213 (SEQ ID NO: 71).
14. 14. The use according to claim 1, characterized in that the serine protease inhibitor of the Kunitz type comprises the amino acid sequence: IHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATV 64 (SEQ ID NO.: 4), CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK C 61 (SEQ ID NO.: 5), YEEKTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQ 159 (SEQ ID NO: 6), CTANAVTGPC RA3FPRWYFD VERNSCNNFI YGGCRGNKNS YRSEE 150 ACMLRC "156 (SEQ ID NO: 7), IHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRJtfAAD SSVPSAPRRQ DSEDHSSDMF 75 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNF - YQGCR GNKNSYRSEE 125 ACMLRCFRQ 155 (SEQ ID NO.: 3), CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG CLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYE? YCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRC 156 (SEQ ID NO: 50), ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDONSNN 25 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 75 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 125 ACMLRCFRQQ ENPPLPLGSK VWLAGAVS 179 (SEQ ID NO.: 1), ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK 170 (SEQ ID NO: 52).
15. 15. The use according to claim 1, characterized in that the serine protease inhibitor of the Kunitz type comprises the amino acid sequence: ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDQSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DS 92 (SEQ ID NO: B).
16. 16. The use according to claim 12, 13, 14 or 15, characterized in that the serine protease inhibitor of the Kunitz type is glycosylated.
17. 17. The use according to claim 12, 13, 14 or 15, characterized in that the Kunitz-type serine protease inhibitor contains at least one cysteine-cis-chain inter-chain bisulfide bond.
18. The use according to claim 12, 13, 14 or 15, characterized in that the Kunitz-type serine protease inhibitor contains at least one cis-theine bis-cis-bisine bond between the chains selected from the cis-theine-cysteine pairs. consisting of CYS11-CYS61, CYS20-CYS44, CYS36-CYS57, CYS106-CYS156, CYS115-CYS139, and CYS 131 -CYS 152, wherein the cysteine residues are numbered according to the amino acid sequence of the natural bikunin of human placenta .
19. 19. The use of a serine protease inhibitor of the Kunitz type for the preparation of a medicament for accelerating the rapidity of mucociliary clearance in a subject requiring said treatment, characterized in that the medicament comprises an effective amount of imidatory purification mucociliary of a serine protease inhibitor of the Kunitz type as shown below and a physiologically acceptable carrier: MAQLCGL RRSRAFLALL GSLLLSGVLA -1 ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGQCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN 200 QERALRTVWS SGDDKEQLVK NTYVL 225 (S? Q ID NO .: 49).
20. 20. The use of a serine protease inhibitor of the Kunitz type for the preparation of a medicament for accelerating the rapidity of mucociliary clearance in a subject requiring such treatment, characterized in that the medicament comprises an effective amount of mucociliary clearance of a serine protease inhibitor of the Kunitz type as shown below and a physiologically acceptable carrier. AGSFLAWL GSLLLSGVLA -1 ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK VWLAGAVS 179 (SEQ ID NO: 2), MLR AEADGVSRLL GSLLLSGVLA -1 ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NY? EYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSE? 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVA-RRN 200 QERALRTVWS SGDDKEQLVK NTYVL 225 (SEQ ID NO .: 45), MAQLCGL RRSRAFLALL GSLLLSGVLA -1 ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN 200 QERALRTVWS FGD 213 (SEQ ID NO: 47), ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN 200 QERALRTVWS SGDDK? QLVK NTYVL 225 . { SEQ ID NO. : 70), RASMPRWWYN VTDGSCQLFV YGGCDGNSNN ADRERSIHDF CLVSKWGRC YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ 50 DSEDHSSDMF 100 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRCFRQQ ENPPLPLGSK VWLAGLFVM VLILFLGASM VYLIRVARRN FGD 213 200 QERALRTVWS (SEQ ID NO: 71).
21. 21. The use of a serine protease inhibitor of the Kunitz type for the preparation of a medicament for accelerating the rapidity of mucociliary clearance in a subject requiring said treatment, characterized in that the medicament comprises an effective amount of effective mucociliary clearance. mucociliary clearance of a serine protease inhibitor of the Kunitz type as shown below and a physiologically acceptable carrier. IHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATV 64. { SEQ ID NO. : 4) . CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK C 61 (SEQ ID NO.: 5), YEEKTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYF.SEE 150 ACMLRCFRQ 159 (SEQ ID NO: 6), CTANAVTGPC RASFPRWYFD VERNSCNNFI YGGCRGNKNS YRSEE 150 ACMLRC 156 . { SEQ ID NO. : 7), IHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 75 NYEEYCTANA VTGPCRASF? RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 125 ACMLRCFRQ 159 (SEQ ID NO: 3), CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCTANA VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 150 ACMLRC 156 (SEQ ID NO .: 50), ADRE SIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 25 YLTKEECLKK CATVT? NATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 75 NYEEYCAN VTGPCRA? FP RWYFDVERNS CNNFIYGGCR GNKNSYRSEE 125 ACMLRCFRQQ ENPPLPLGSK WVLAGAVS 179 (SEQ ID NO.: 1), ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DSEDHSSDMF 100 NYEEYCAN VTGPCRASFP RWYFDVERNS CNNFIYGGCR GNKNSYRS? E 150 ACMLRCFRQQ ENPPLPLGSK 170 (SEQ ID NO: 52).
22. 22. The use of a serine protease inhibitor of the Kunitz type for the preparation of a medicament for accelerating the rapidity of mucociliary clearance in a subject requiring said treatment, characterized in that the medicament comprises an effective amount of depuration. mucociliary of a serine protease inhibitor of the Kunitz type as shown below and a physiologically acceptable carrier. ADRERSIHDF CLVSKWGRC RASMPRWWYN VTDGSCQLFV YGGCDGNSNN 50 YLTKEECLKK CATVTENATG DLATSRNAAD SSVPSAPRRQ DS 92 (SEQ ID NO: 8).
23. 23. Use according to claims 19, 20, 21 or 22, characterized in that the serine protease inhibitor of the Kunitz type is glycosylated.
24. 24. The use according to claims 19, 20, 21 or 22, characterized in that the Kunitz-type serine protease inhibitor contains at least one cis-cyanine-cysteine bisulphide bond between chains.
25. 25. The use in accordance with claims 19, 20, 21 or 22, characterized in that the Kunitz-type serine protease inhibitor contains at least one cysteine-cis-chain inter-chain bisulfide bond selected from the cysteine-cysteine pair groups consisting of CYS11-CYS61, CYS20-CYS44, CYS36 -CYS57, CYS10 ß-CYS 156, CYS115-CYS139, and CYS131-CYS152, where the cysteine residues are numbered according to the amino acid sequence of the natural bikunin of the human placenta.