MXPA01006345A

MXPA01006345A - Compositions and methods for the treatment of tumor.

Info

Publication number: MXPA01006345A
Application number: MXPA01006345A
Authority: MX
Inventors: Botstein David
Original assignee: Genentech Inc
Priority date: 1998-12-22
Filing date: 1999-12-16
Publication date: 2002-07-02
Also published as: AU2192800A; ZA200104218B; WO2000037640A3; CA2353775A1; KR20010102960A; WO2000037640A2; EP1141289A2; ZA200103885B; WO2000037640A9; JP2003524390A; IL143212A0

Abstract

The invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans. The invention is based upon the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with the overexpression of the gene product as compared to normal cells of the same tissue type and contribute to tumorigenesis. Accordingly, the proteins encoded by the amplified genes are believed to be useful targets for the diagnosis and/or treatment (including prevention) of certain cancers, and may act as predictors of the prognosis of tumor treatment. The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Description

COMPOSITIONS AND METHODS FOR THE TREATMENT OF A TUMOR FIELD OF THE INVENTION The present invention relates to compositions and methods for the diagnosis and treatment of tumors.

BACKGROUND OF THE INVENTION Malignant tumors (cancers) are the second leading cause of death in the United States, after heart disease (Boring et al., CA Cancel J. Clin. 43: 7 [1993]). Cancer is characterized by an increase in the number of abnormal or neoplastic cells derived from normal tissue which proliferate to form a tumor mass, the invasion of adjacent tissues by these neoplastic tumor cells and the generation of malignant cancers which finally disseminates through of the blood or the lymphatic system, regional lymphatic ani nodes and remote sites (metastasis). In a cancerous state, a cell proliferates under conditions in which normal cells would not grow. Cancer manifests itself in a wide variety of ways, characterized by different degrees of invasiveness and aggressiveness.

REF: 129687 AL. -aüü Alteration of gene expression is intimately related to uncontrolled cell growth and the elimination of differentiation which are common features of all cancers. The genomes of certain well-studied tumors have been found to show diminished expression of recessive genes, usually referred to as tumor suppression genes, which normally work to prevent the growth or overexpression, or both, of malignant cells or of some genes dominant, such as oncogenes, which act to promote malignant growth. Each of these genetic changes appears to be responsible for importing some trait that, in an aggregate manner, represents the complete neoplastic phenotype (Hunter, Cell, 64: 1129 [1991] and Bishop, Cell, 64: 235-248 [1991] ). A well-known mechanism of overexpression of the gene (for example an oncogene) in cancer cells is the amplification of genes. This is a process where the chromosome of an ancestral cell will produce multiple copies of a particular gene. The process involves an unscheduled replication of the region of the chromosome comprising the gene, followed by recombination of the replicated segments back to the chromosome (Alitalo et al., Adv. Cancer Res., 4.7: 235-281 [1986]). It is considered that overexpression of the gene goes parallel to the amplification of the gene, that is, it is appropriate to the number of copies that are made. Í.Í.? k i íjjL.

Proto-oncogenes encoding growth factors and growth factor receptors have been identified to play important roles in the pathogenesis of various human malignancies including breast cancer. For example, it has been found that the human ErbB2 gene (erbB2, also known as her2 or c-erbB-2), which codes for a 185-d transmembrane glycoprotein receptor (pl85HER2; HER2) related to the factor receptor. of epidermal growth (EGFR), is overexpressed in approximately 25% to 30% of human breast cancer (Slamon et al., Science, 235: 177-182 [1987]; Slamon et al., Science, 244: 707-712 [1989]). It has been reported that the amplification of a proto-oncogene gene is a typically related phenomenon in malignant forms of cancer, and may act as a predictor of clinical outcome (Schwab et al., Genes Chromosomes Cancer, 1: 181-193 [1990], Alitalo et al., Supra). Therefore, overexpression of eri > B2 is commonly considered as a predictor of a forecast poor, especially in patients with primary disease involving axillary lymph nodes (Slamon et al., [1987] and [1989], supra; Ravdin and Chamness, Gene, 159: 19-27 [1995] and Hynes and Stern , Biochim, Biophys, Acta, 1198 .: 165-184 [1994]) and has been related to sensitivity or resistance to hormone therapy and chemotherapeutic regimens .- ..jnau ¿ES & or,. which include CMF (cyclophosphamide, methotrexate and fluorouracil) and anthracyclines (Baselga et al., Oncology, 11 (3 Suppl 1): 43-48 [1997]). However, despite the relationship of overexpression of erJbB2 with poor prognosis, the probabilities of HER2 positive patients who respond clinically to treatment with taxanes are greater than three times those of HER2 negative patients (Ibid). A recombinant humanized monoclonal antibody against er > B2 (against HER2) (humanized version of the antibody against erbB2 4D5, termed as rhuMAb HER2 or Herceptin ^) has become clinically active in patients overexpressing erJbB2 in metastatic breast cancers that they have received extensively before anticancer therapy. (Baselga et al., J. Clin. Oncol., 14: 737-744 [nineteen ninety six] ) . In light of the foregoing, there is an obvious interest in identifying novel methods and compositions which are useful for the diagnosis and treatment of tumors which are associated with gene amplification.

BRIEF DESCRIPTION OF THE INVENTION A. Modalities The present invention relates to compositions and methods for the diagnosis and treatment of growth and JA. proliferation of neoplastic cells in mammals, including humans. The present invention is based on the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with overexpression of the gene product and contributing to tumorigenesis. Consequently, the proteins encoded by the amplified genes are considered to be useful targets for the diagnosis or treatment (including prevention) or both of some cancers, and which may act as predictors of the prognosis of the tumor treatment. In one embodiment, the present invention relates to an isolated antibody which binds to a polypeptide referred to herein as PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. In one aspect the isolated antibody binds specifically to a PRO201 polypeptide, PR0292, PR0327, PR01265 PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. In another aspect, the antibody induces the death of a cell which expresses the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357. PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882. Frequently, the cell expressing the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 is a tumor cell overexpressing the polypeptide compared to a normal cell of the same type of tissue. In still another aspect, the antibody is a monoclonal antibody which preferably has residues of the non-human complementary determining region (CDR) and residues of the human framework region (FR). The antibody can be labeled and immobilized on a solid support. In still another aspect, the antibody is an antibody fragment, a single chain antibody, or a humanized antibody which binds, preferably specifically, to a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882. In another embodiment, the invention relates to a composition of matter which comprises an antibody which binds, preferably specifically to a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 in admixture with a pharmaceutically acceptable carrier. In one aspect, the composition of matter - comprises a therapeutically effective amount of the antibody. In another aspect, the composition comprises a further active ingredient which may, for example, be an additional antibody or a cytotoxic or chemotherapeutic agent. Preferably, the composition is sterile.

** - "*". "** - * .- * - * 'In a further embodiment, the invention relates to isolated nucleic acid molecules which code for antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343 , against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882, and recombinant host vectors and cells comprising such nucleic acid molecules. In a further embodiment, the invention relates to a method to produce antibodies against PR0201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882, where the method comprises culturing a host cell transformed with a nucleic acid molecule which encodes the antibody under conditions sufficient to allow antibody expression, and recover the antibody from the cell culture. The invention further relates to antagonists of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 that inhibit one or more biological or immunological functions or activities of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882.

In a further embodiment, the invention relates to an isolated nucleic acid molecule that hybridizes to a nucleic acid molecule encoding a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 or its complement. The isolated nucleic acid molecule is preferably DNA, and the hybridization preferably occurs under astringent hybridization and washing conditions. Such nucleic acid molecules can act as molecules Antisense of the amplified genes identified herein, which in turn may find use in the modulation of the transcription or translation of the respective amplified genes, or as antisense primers in amplification reactions. In addition, such sequences can be used as part of a ribosome or a triple helix sequence which in turn can be used in the regulation of amplified genes. Another embodiment of the invention provides a method for determining the presence of PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 in a sample suspected of containing the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 wherein the method comprises exposing the sample to antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882 and to determine the binding of the antibody to a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 in the sample. In another embodiment, the invention provides a method for determining the presence of PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 in a cell, wherein the method comprises exposing the cell to an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882 and determine the binding of the antibody to the cell. In still another embodiment, the present invention relates to a method for diagnosing a tumor in a mammal, comprising detecting the level of expression of a gene encoding a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 (a) in a test sample of tissue cells obtained from the mammal and (b) in a control sample from known normal tissue cells of the same cell type , where a higher level of expression in na._ < _.a fm. * ?? - Vf? i "f ^ < l ?? i > i?, - .. iiá? rÉi? i HHtifir im ^? ii MitÉM ^^ UIIu i? Ummi ^ t ^^ The test sample compared to the control sample is indicative of the presence of the tumor in the mammal from which the test tissue cells are obtained.In another embodiment, the present invention relates to a method for diagnosing a tumor in a mammal comprising: (a) contacting an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882 with a test sample of tissue cells obtained from a mammal, and (b) detect the formation of a complex between the antibodies against PRO201, against PR0292, against PR0327 , against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or PR0882 and a polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 in the test sample, where the formation of a complex is indicative of the presence of a tumor in the mammal. The detection can be qualitative or quantitative and can be carried out in comparison to the monitoring of complex formation in a control sample of known normal tissue cells of the same cell type. A greater number of complexes formed in the test sample indicates the presence of a tumor in the . - * - * - • * - ^ "&.» mammal from which the test tissue cells were obtained. The antibody preferably has a detectable label. The formation of the complex can be monitored, for example, by light microscopy, flow cytometry, fluorimetry or other techniques known in the art. The test sample is usually obtained from an individual suspected of having growth or proliferation of neoplastic cells (eg, cancer cells). In another embodiment, the present invention relates to an equipment for the diagnosis of cancer comprising an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017 , against PR01112, against PRO509, against PR0853 or against PR0882 and a carrier (for example a shock absorber) in a suitable container. The kit preferably contains instructions for using the antibody to detect the presence of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 in a sample suspected of containing a the same. In still another embodiment, the invention relates to a method for inhibiting the growth of tumor cells comprising exposing tumor cells which express a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, tJ A ***? ? threw? lt ?. ¡Rtr ". ^,.»? .. .. .. 8¡? -. ÍO ?,. «?. < M »J« »» ^. ^ ~ _ ~ j £ = __ jl¡ _? ^ PRO509, PR0853 or PR0882 to an effective amount of an agent which inhibits a biological or immunological activity or the expression of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, whereby in this way the growth of tumor cells is inhibited. Preferably the agent is an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882, a molecule small and inorganic organic, peptide, phosphopeptide, antisense or ribosome molecule, or a triple helix molecule. In a specific aspect, the agent, for example antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882 induces cell death. In a further aspect, the tumor cells are further exposed to treatment by radiation or a cytotoxic or chemotherapeutic agent. In a further embodiment, the invention relates to an article of manufacture comprising: a package; a label on the package; Y ... '¿-i ... «. . r.r? .i. *. a composition comprising an active agent contained within the container, wherein the composition is effective to inhibit the growth of tumor cells and the label on the container indicates that the composition can be used to treat conditions characterized by overexpression of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, in comparison with a normal cell of the same type of tissue. In particular aspects, the active agent of the composition is an agent which inhibits the activity or overexpression of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882. . In preferred aspects, the active agent is an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882, or an antisense oligonucleotide. The invention also provides a method for identifying a compound that inhibits an activity of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, which comprises contacting a candidate compound with a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 under conditions and for a sufficient time to allow these two components to interact and determine whether the biological or immunological activity, or both, of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 is inhibited , PR01017, PR01112, PRO509, PR0853 or PR0882. In a specific aspect, either the candidate compound or the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 is immobilized on a solid support. In another aspect, the non-immobilized component exhibits a detectable label. In a preferred aspect, this method comprises the steps of: (a) contacting the cells and a candidate compound to be examined, in the presence of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 under conditions suitable for the induction of a cellular response normally induced by a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, and (b) determining the induction of the cellular response to determine whether the test compound is an effective antagonist. In another embodiment, the invention provides a method for identifying a compound that inhibits the expression of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 in cells expressing the polypeptide, wherein the method comprises contacting the cells with a candidate compound and determining whether the expression of the PRO201 polypeptide, PR0292, is inhibited, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882. In a preferred aspect, this method comprises the steps of: (a) contacting cells and a candidate compound to be examined, under conditions suitable to allow the expression of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, and (b) determine the inhibition of polypeptide expression.

B. Additional Modalities In other embodiments of the present invention, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509. , PR0853 or PR0882. In one aspect, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, so preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, still more preferably at least about 83% sequence identity, even more preferably at least less about 84% sequence identity, still more preferably at least about 85% sequence identity, still more preferably at least about 86% sequence identity, still more preferably at least about 87% sequence identity, still more preferably at least about 88% sequence identity, still more preferably at least about 89% sequence identity, still more preferably at least about 90% sequence identity, still more preferably at least about 91% sequence identity, still more preferably at least about 92% sequence identity, still more preferably at least about 93% sequence identity, still more preferably at least about 94% sequence identity, still more preferably at least about 95% sequence identity, still more preferably at least about 96% sequence identity, still more preferably at least about 97% sequence identity, still more preferably at least about 98% sequence identity, still more preferably at least about 99% sequence identity with (a) a DNA molecule encoding a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 having a full-length amino acid sequence, as described herein, an amino acid sequence that lacks the signal peptide as described herein, an extracellular domain of a transmembrane protein with or without a signal peptide, as described herein, or any other specifically defined fragment of the full-length amino acid sequence as described herein, or (b) the complement of the 7DNA molecule of part (a). In other aspects, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82%. % sequence identity, still more preferably at least about 83% sequence identity, still more preferably at least about 84% sequence identity, still more preferably at least about 85% sequence identity, still more preferably at least about 86% sequence identity, still more preferably at least about 87% sequence identity, still more preferably at least about 88% identity of sequence, still more preferably at least about 89% sequence identity, even more preferably at least about 90% sequence identity, still more preferably at least about 91% sequence identity, still more preferably at least about 92% sequence identity, still more preferably at least about 93% sequence identity, still more preferably at least about 94% sequence identity, still more preferably at least about 95% sequence identity, still more preferably at least about 96% sequence identity, still more preferably at least about 97% sequence identity, still more preferably at least about 98% sequence identity, still more preferably at least about 99% % sequence identity with (a) a DNA molecule comprising the coding sequence of a cDNA for the PRO201 polypeptide, PR0292, PR Full-length PR0127, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, as described herein, the sequence encoding a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 lacking a signal peptide as described herein, the coding sequence of an extracellular domain of a PRO201, PR0292, PR0327, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853, PR0853 or PR0882 transmembrane PR0882 polypeptide, with or without the signal peptide, as described herein, or the coding sequence of any other fragment defined specifically of the full-length amino acid sequence as described herein, or (b) the complement of the DNA molecule of part (a). In one aspect, the invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably preferably at least about 82% sequence identity, still more preferably at least about 83% sequence identity, still more preferably at least about 84% sequence identity, still more preferably at least about 85% sequence identity, still more preferably at least about 86% sequence identity, even more preferably at least t ^ a feki ^ j ^ A .. ^ approximately 87% sequence identity, still more preferably at least about 88% sequence identity, still more preferably at least about 89% sequence identity , still more preferably at least about 90% sequence identity, still more preferably at least about 91% sequence identity, still more preferably at least about 92% sequence identity, even more preferably at least about 93% sequence identity, still more preferably at least about 94% sequence identity, still more preferably at least about 95% sequence identity, still more preferably at least about 96% identity of sequence, still more preferably at least about 97% sequence identity, still more preferably at least about 98% sequence identity, still more preferably at least about 99% identity of "sequence with (a) a A DNA molecule encoding the same mature polypeptide encoded by any cDNA for human protein deposited with ATCC as described herein, or (b) the complement of the DNA molecule of part (a). Another aspect of the invention provides a molecule isolated nucleic acid comprising a sequence , -s ^^ ^^. t - ^^, a ?? i_. ^^^^ J, ^ _ nucleotide coding for a polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 which is deleted from the transmembrane or inactivated domain of the transmembrane domain, or is complementary to such a coding nucleotide sequence, wherein the transmembrane domain or domains of such polypeptide are described herein. Therefore, soluble extracellular domains of the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 described herein are contemplated. Another embodiment is directed to the fragments of a coding sequence for the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, or the complement thereof, which can be used, for example, as hybridization probes to encode fragments of a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0727, PR0717, PR01017, PR01112, PR0429, PR0853, PR0853 or PR0882 polypeptides which can optionally be encoded for a polypeptide comprising the binding site for an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PR0715, against PR01017, against PR01112, against PRO509, against PR0853 or against PR0882 or antisense oligonucleotide probes. Such nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, even more preferably at least about 50 nucleotides in length, even more preferably at least about 60 nucleotides in length, even more preferably at least about 70 nucleotides in length, even more preferably at least about 80 nucleotides in length , still more preferably at least about 90 nucleotides in length, even more preferably at least about 100 nucleotides in length, even more preferably at least about 110 nucleotides in length, even more so preferable of at least about 120 nucleotides d and length, even more preferably at least about 130 nucleotides in length, even more preferably at least about 140 nucleotides in length, even more preferably at least about 150 nucleotides in length, so even more preferably of at least about 160 nucleotides in length, still more preferably at least about 170 nucleotides in length, even more preferably at least about 180 nucleotides in length, most preferably at least about 190 nucleotides in length, even more preferably at least about 200 nucleotides in length, most preferably at least about 250 nucleotides in length, even more preferably of at least about 300 nucleotides in length, even more preferably at least about 350 nucleotides in length, even more preferably at least about 400 nucleotides in length, still more preferably at least about 450 nucleotides in length, even more preferably at least about 500 nucleotides in length, even more preferably at least about 600 nucleotides in length, even more preferably at least about 700 nucleotides in length, still more preferably at least about 800 nucleotides in length, even more preferably at least about 900 nucleotides in length and even more preferably at least about 1000 nucleotides in length, wherein, in this context, the term "approximately" means the length of the nucleotide sequence mentioned plus or minus 10% at that mentioned length. It is noted that the novel fragments of a nucleotide sequence encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, i ~ »* ^ ** * - .í r *. - j, kL .... = faith ... "" ... ..,.,. "^" ,,., "^ ^. m .. . ~ ^. ? ~ * *, *. & PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 can be determined in a systematic or routine manner by aligning the nucleotide sequence encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 with other known nucleotide sequences using any of many well-known sequence alignment programs, and determining which fragment or fragments of the nucleotide sequence that code for the polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are new. The totality of such nucleotide sequences encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are contemplated herein. Fragments of the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 polypeptides encoded by these fragments of nucleotide molecules are also contemplated.

Preferably those fragments of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 comprising a binding site for an antibody against PRO201, against PR0292, against PR0327 , against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, . * .. * »m * wi t **? ^? _ I_ ^ __? _ ^ _t ^ úi. -, -i-H- 1"-" imi MMÉl - i fcÉÉI. . * .. .....? _ ~ »« -A ^ ^ ((.) Against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882.In another embodiment, the invention provides a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 isolated encoded by any of the nucleic acid sequences identified in the above. In a certain aspect, the invention relates to a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0727, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0853 isolated PR0882 polypeptide comprising an amino acid sequence having at least one amino acid sequence. less about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, still more preferably at least about 83% sequence identity sequence identity, still more preferably at least about 84% sequence identity, still more preferably at least about 85% sequence identity, still more preferably at least about 86% identity of sequence, still more preferably at least about 87% sequence identity, still more preferably at least about 88% identity sequential ad, still more preferably at least about 89% of • ÍM "-t * - * - '-' ^" - * .- ^ »., ^ - ^. - .... ^.-..... ^^ a ^ ....... ".., .." ...-_. > j m- * mm ...? l.t. sequence identity, still more preferably at least about 90% sequence identity, still more preferably at least about 91% sequence identity, still more preferably at least about 92% identity of sequence, even more preferably at least about 93% sequence identity, still more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, still more preferably at least about 97% sequence identity, still more preferably at least about 98% sequence identity and so even more preferably at least about 99% sequence identity, sequence identity with a PRO201 polypeptide, PR0292, PR0 327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 having a full length amino acid sequence as described herein, an amino acid sequence that lacks the signal peptide as described herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as described herein or any other fragment defined specifically in the full-length amino acid sequence as described herein. In a further aspect, the invention relates to a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, even more preferably at least about 83% identity of sequence, still more preferably at least about 84% sequence identity, still more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, still more preferably at least about 88% sequence identity, still more preferably at least about 89% sequence identity, so even more preferably at least about 90% sequence identity, still more preferably at least about 91% sequence identity, still more preferably at least about 92% sequence identity, so even more preferably at least about 93% sequence identity, still more preferably at least about 94% sequence identity, still more preferably at least about 95% sequence identity, still more preferably at least about 96% sequence identity, still more preferably at least about 97% sequence identity, still more preferably at least about 98% sequence identity and even more preferably at least about 99% sequence identity, with an amino acid sequence encoded by any of the cDNAs for human protein deposited with ATCC, as described herein. In a further aspect, the invention relates to a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0853 isolated PR0882 polypeptide comprising an amino acid sequence that qualifies for at least about 80% positives, preferably at least about 81% positives, more preferably with at least about 82% positives, still more preferably with at least about 83% positives, even more preferably at least about 84% of positives, still more preferably at least about 85% of positives, still more preferably at least about 86% of positives, still more preferably at least about 87% positives, still more preferably at least about 88% positives, still more preferably at least about 89% positives, even more preferably at least about 90% of positives, still more preferably at least about 91% of positives, still more preferably at least about 92% of positives, still more preferably at least about 93% positives, still more preferably at least about 94% positives, still more preferably at least about 95% positives, still more preferably at least about 96% positives, so still more preferably at least about 97% positives, still more preferably at least about 98% positives and even more preferably at least about 99% positives when compared to the amino acid sequence of a PRO201 polypeptide , PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 that have an amino acid sequence Full length as described herein, an amino acid sequence that lacks the signal peptide as described herein, an extracellular domain of a transmembrane protein, with or without the signal peptide as described herein, or any specifically defined fragment of the full-length amino acid sequence, as described herein. In a specific aspect, the invention provides a PRO201, PR0292, PR0327, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 isolated PR0882 polypeptide, without an N-terminal signal sequence or methionine of start, and which is encoded by a nucleotide sequence that codes for such a sequence of amino acids as described above. Also described herein are processes for producing them, wherein the processes comprise culturing a host cell comprising a vector which comprises an appropriate nucleic acid coding molecule, under conditions suitable for the expression of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and recover the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 of the cell culture. Another aspect of the invention provides a polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 PR0882 isolated which is deleted from the transmembrane or inactivated domain of the transmembrane domain. Also described herein is a process for the preparation thereof, wherein the process comprises culturing a host cell comprising a vector which comprises the appropriate coding nucleic acid molecule, under conditions suitable for the expression of PRO201 polypeptide, PR0292 PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and recover the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 of the cell culture. In another embodiment, the invention relates to antagonists of a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or native PR0882 polypeptide antagonists, as defined herein. In a particular embodiment, the antagonist is an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882, or a small molecule. In a further embodiment, the invention relates to a method for identifying antagonists for a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, which comprises in contact with polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 with a candidate molecule and monitor the biological activity mediated by such PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Preferably the polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 , PRO1017, PR01112, PRO509, PR0853 or PR0882 native. In a further embodiment, the invention relates to a composition of matter comprising a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or an antagonist of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, as described herein, or an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PR0509, against PR0853 or against PR0882, in combination with a carrier. Optionally, the carrier is a pharmaceutically acceptable carrier. Another embodiment of the present invention is directed to the use of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or an antagonist thereof as described in > - ~ ** jk. -t, the above, or an antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 , for the preparation of a medicament useful in the treatment of a condition which responds to the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 an antagonist for the same or an antibody against PR0201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882. In other embodiments of the present invention, the invention provides vectors comprising DNA encoding any of the polypeptides described herein. The host cell comprising any such vector is also provided. By way of example, the host cells can be CHO cells, E. coli, yeast or insect cells infected with baculovirus. A process for producing any of the polypeptides described herein is further provided, and comprises culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture. i AtJb * m-- »» In other embodiments, the invention provides chimeric molecules comprising any of the polypeptides described herein fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules comprise any of the polypeptides described herein fused to an epitope tag sequence or to an Fc region of an immunoglobulin. In another embodiment, the invention provides an antibody which binds specifically to any of the polypeptides described above or in the following. Optionally, the antibody is a monoclonal antibody, a humanized antibody, an antibody fragment or a single chain antibody. In still further embodiments, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or antisense probes, wherein these probes can be derived from any of the nucleotide sequences described above or below. BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the nucleotide sequence (SEQ ID NO: 1) of a cDNA containing a nucleotide sequence encoding the native PRO201 sequence, wherein the nucleotide sequence (SEQ ID NO. NO: 1) is a clone designated herein as DNA30676-1223. As well it is presented in bold letters and underlined the positions of the respective start and stop codons. Figure 2 shows the amino acid sequence (SEQ ID NO: 2) of a PRO201 polypeptide of native sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 1 shown in Figure 1. Figure 3 shows the nucleotide sequence (SEQ ID NO: 5) of a cDNA containing the nucleotide sequence encoding the native PR0292 sequence, wherein the nucleotide sequence (SEQ ID NO: 5) is a clone designated herein as DNA35617. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 4 shows the amino acid sequence (SEQ ID NO: 6) of the native PR0292 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 5 shown in Figure 3. Figure 5 shows the nucleotide sequence (SEQ ID NO: 7) of a cDNA which contains a nucleotide sequence encoding the native PR0327 sequence, wherein the nucleotide sequence (SEQ ID NO: 7) is a clone designated herein as DNA38113-1230. It also appears in bold letters and underlined the positions of the respective start and stop codons.

Figure 6 shows the amino acid sequence (SEQ ID NO: 8) of the native PR0327 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 7 shown in Figure 5. Figure 7 shows the nucleotide sequence (SEQ ID NO: 12) of a cDNA containing a nucleotide sequence encoding the native sequence of PR01265, wherein the sequence nucleotide (SEQ ID NO: 12) is a clone designated herein as DNA60764-1533. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 8 shows the amino acid sequence (SEQ ID NO: 13) of the native PR01265 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 12 shown in Figure 7. Figure 9 shows the nucleotide sequence (SEQ ID NO: 14) of a cDNA containing a nucleotide sequence encoding the native sequence of PR0344 wherein the nucleotide sequence (SEQ ID NO: 14) is a clone designated herein as DNA40592-1242. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 10 shows the amino acid sequence (SEQ ID NO: 15) of the native polypeptide sequence PR0344 as derived from the coding sequence of SEC. FROM IDENT. NO: 14 shown in Figure 9. Figure 11 shows the nucleotide sequence (SEQ ID NO: 22) of a cDNA containing a 5 nucleotide sequence encoding the native PR0343 sequence, wherein the nucleotide sequence (SEQ ID NO: 22) is a clone designated herein as DNA43318-1217. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 12 shows the amino acid sequence (SEQ ID NO: 23) of the native PR0343 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 22 shown in Figure 11. Figure 13 shows the nucleotide sequence (SEQ ID NO: 27) of a cDNA containing a nucleotide sequence encoding the native PR0347 sequence, wherein the nucleotide sequence (SEQ ID NO: 27) is a clone designated herein as DNA44176-1244. It is also presented in bold letters and underlined the positions of the respective start and stop codons. Figure 14 shows the amino acid sequence (SEQ ID NO: 28) of the native PR0347 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 27 shown in figure 13.

Figure 15 shows the nucleotide sequence (SEQ ID NO: 32) of a cDNA containing a nucleotide sequence encoding the PR0357 native sequence, wherein the nucleotide sequence (SEQ ID NO: 32) is a clone designated herein as DNA44804-1248. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 16 shows the amino acid sequence (SEQ ID NO: 33) of the native PR0357 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 32 shown in Figure 15. Figure 17 shows the nucleotide sequence (SEQ ID NO: 39) of a cDNA containing a nucleotide sequence encoding the native PR0715 sequence, wherein the sequence nucleotide (SEQ ID NO: 39) is a clone designated herein as DNA52722-1229. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 18 shows the amino acid sequence (SEQ ID NO: 40) of the native PR0715 polypeptide sequence as derived from the coding sequence of SEQ. DE -IDENT. NO: 39 shown in figure 17. Figure 19 shows the nucleotide sequence (SEQ ID NO: 41) of a cDNA containing a nucleotide sequence encoding the native sequence of PRO1017, t.i 4 .i ú J. I saw it. wherein the nucleotide sequence (SEQ ID NO: 41) is a clone designated herein as DNA56112-1379. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 20 shows the amino acid sequence (SEQ ID NO: 42) of the native PRO1017 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 44 shown in Figure 19. Figure 21 shows the nucleotide sequence (SEQ ID NO: 43) of a cDNA containing a nucleotide sequence encoding the native PR01112 sequence, wherein the sequence nucleotide (SEQ ID NO: 43) is a clone designated herein as DNA57702-1476. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 22 shows the amino acid sequence (SEQ ID NO: 44) of the native PR01112 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 43 shown in Figure 21. Figure 23 shows the nucleotide sequence (SEQ ID NO: 45) of a cDNA containing a nucleotide sequence encoding the native PRO509 sequence, wherein the nucleotide sequence (SEQ ID NO: 45) is . . 1 ^ 11¡rt ^ í | ^ .J¿3, ».a" ..., a clone designated here as DNA50148. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 24 shows the amino acid sequence (SEQ ID NO: 46) of the native PRO509 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 45 shown in Figure 23. Figure 25 shows the nucleotide sequence (SEQ ID NO: 47) of a cDNA containing a nucleotide sequence encoding the native PR0853 sequence, wherein the sequence nucleotide (SEQ ID NO: 47) is a clone designated herein as DNA48227-1350. It also appears in bold letters and underlined the positions of the respective start and stop codons. Figure 26 shows the amino acid sequence (SEQ ID NO: 48) of the native PR0853 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 47 shown in Figure 25. Figure 27 shows the nucleotide sequence (SEQ ID NO: 52) of a cDNA containing a nucleotide sequence encoding the PR0882 native sequence, wherein the sequence nucleotide (SEQ ID NO: 52) is a clone designated herein as DNA58125. It also appears in bold letters and underlined the positions of the respective start and stop codons.

Figure 28 shows the amino acid sequence (SEQ ID NO: 53) of the native PR0882 polypeptide sequence as derived from the coding sequence of SEQ. FROM IDENT. NO: 52 shown in Figure 27. Figure 29 is a map of chromosome 19 showing the mapping regions of DNA 30676-1223, DNA38113 -1230 and DNA60764-1533. Figure 30 is a map of chromosome 11 showing the mapping regions of DNA35617. Figure 31 is a map of chromosome 16 showing the mapping regions of DNA43318-1217 and DNA58125. Figure 32 is a map of chromosome 7 showing the mapping regions of DNA56112-1379. Figure 33A is a map of chromosome 17 showing the mapping regions of DNA52722-1229. Figure 33B is a map of chromosome 17 showing the mapping regions of DNA48227-1350. Figure 34 is a map of chromosome 16 showing the mapping regions of DNA44804-1248.

DETAILED DESCRIPTION OF THE INVENTION I. Definitions The phrases "gene amplification" and "gene duplication" are used interchangeably to refer to processes by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as an "amplicon". Usually the amount of messenger DNA (mRNA) produced is, the level of gene expression, also increases in the proportion of the number of copies made from a particular expressed gene. As used herein, the term "tumor" refers to any growth or proliferation of neoplastic cells, either malignant or benign, and all precancerous and cancerous cells and tissues. The terms "cancer" and "cancerous" refer to or describe a physiological condition in mammals that is typically characterized by non-regular cell growth. Examples of cancer include but are not limited to carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, i? .?.? Í .. ... -,. . RréA4.r? r.-j .r. small cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometrial carcinoma, carcinoma of the glands salivary, kidney cancer, liver cancer, cancer of the vulva, thyroid cancer, hepatic carcinoma and various types of head and neck cancer. The term "treatment" is an intervention performed with the intention of avoiding the development or altering the pathology of a disorder. Accordingly, the term "treatment" refers to a therapeutic or prophylactic treatment or prevention measures. Those in need of treatment include those who already have the disorder as well as those in whom the disorder should be avoided. In the treatment of tumors (eg cancer) a therapeutic agent can directly decrease the pathology of the tumor cells, or make the tumor cells more susceptible to treatment by other therapeutic agents, for example radiation or chemotherapy, or both. The "pathology" of cancer includes all phenomena that compromise the well-being of the patient. These include, without limitation, abnormal and uncontrollable cell growth, metastasis, interference with the normal functioning of neighbor cells, release of cytokines and other secretory products to abnormal levels, suppression or aggravation of the inflammatory or immunological response, etc. For treatment purposes, the term "mammal" refers to any animal classified as a mammal, including humans, domestic farm animals, and zoo, caceric or pet animals, such as dogs, horses, cats, livestock, pigs, sheep, etc. Preferably the mammal is a human. Herein, the term "carriers" includes pharmaceutically acceptable carriers, excipients or stabilizers which are non-toxic to the cell or to the mammal to which it is exposed at the dosages and concentrations used. Frequently, the physiologically acceptable carrier is an aqueous solution buffered in terms of pH. Examples of physiologically acceptable physiologically acceptable carriers include buffers such as phosphate, citrate and other organic acids; antioxidants that include ascorbic acid; polypeptides of low molecular weight (less than about 10 residues); proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and nonionic surfactants such as TWEEN **, polyethylene glycol (PEG) and PLURONICS ^. The administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) or consecutive administration, in any order. The term "cytotoxic agent" as used herein, refers to a substance that inhibits or prevents the function of the cells or that causes the destruction of the cells, or both. The term is intended to include radioactive isotopes (e.g. I131, I125, Y90 and Re186), chemotherapeutic agents and toxins such as enzymatically active toxins of bacterial, mycotic, plant or animal origin, or fragments thereof. A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxine, taxoids, for example paclitaxel (Taxol)., Bristol-Myers Squibb Oncology, Princeton, NJ) and doxetaxel (Taxotere, Rhone-Poulenc, Antony, Rnace), taxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin, mitomycins, esperamycin (see U.S. Patent Number 4,675,187), 5-FU, 6-thioguanine, 6-mercaptopurine, actinomycin D, VP-16, chlorambucil, melphalan and other related nitrogen mustards. Hormone agents that act to regulate or inhibit hormone action in tumors such as tamoxifen and onapristone are also included in this definition. A "growth inhibitory agent", when used herein, refers to a compound or composition which inhibits the growth of a cell, especially a cancer cell that overexpresses any of the genes identified herein, whether in vitro or in vitro. alive. Therefore, the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in the S phase. Examples of growth inhibitory agents include agents that block the progress of the cell site (in a different place phase S), such as agents that induce Gl suppression and deletion in N phase. Classical M phase blockers include vinca (vincristine and vinblastine), taxol and topo II inhibitors, such as doxorubicin, epirubicin, daunorubicin, etoposide and bleomycin. Those agents that suppress Gl are also spread over the deletion in the S phase, for example DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, : .i, «ii¡a, s *! 3teJ.Jlfc & * A-«. ,. TkrL, ...... r,, methotrexate, 5-fluorouracil and ara-C. Additional information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1, entitled "Cell cycle regulation, oncogenes, and antineoplastic drugs" by Murakami et al. , (WB Saunders: Philadelphia, 1995), especially p. 13. "Doxorubicin" is an anthracycline antibiotic.

The complete chemical name of doxorubicin is ((S-cis) -10- [(3-amino-2, 3,6-trideoxy-aL-lixo-hexapyranosyl) oxy] -7, 8, 9, 10-tetrahydro- 6, 8, 11-trihydroxy-8- (hydroxyacetyl) -l-methoxy-5, 12-naphtacendione The term "cytokine" is a generic term for proteins released by a population of cells which act on another cell as intercellular mediators Examples of such cytokines are lymphokines, monokines and traditional polypeptide hormones .. Growth hormone such as human growth hormone, human growth hormone N-methionyl and bovine growth hormone, parathyroid hormone, are included among the cytokines, thyroxine, insulin, proinsulin, relaxin, prorrelaxin, glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH) and luteinizing hormone (LH), hepatic growth factor, fibroblast growth factor, prolactin; lactóg placental factor a and ß of tumor necrosis; inhibitory substance muleriana; peptide associated with ^^^^^ mouse gonadotropin; inhibin; activin; Vascular endothelial growth factor; integrin, thrombopoietin (TPO); nerve growth factors such as NGF-β; platelet growth factor; transforming growth factors (TGF) such as TGF-α and TGF-β; factor I and II of insulin-like growth; erythropoietin (EPO); osteoinductive factors; interferons such as interferon a, β and β; colony-stimulating factors (such as macrophage- (CSF) (M-CSF); granulocyte-macrophage-CSF (GM-CSF); and CSF granulocyte (G-CSF); interleukins (IL) such as IL-1, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; a tumor necrosis factor such as TNF-α or TNF-β and other polypeptide factors including LIF and the equipment ligand (KL). As used herein, the term "cytokine" includes proteins from natural sources or cultures of recombinant cells and biologically active equivalents of the native sequence cytokines. The term "precursor" as used in this application, refers to a precursor? a form derived from a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being activated enzymatically or converted into a more active parental form. See, for example Wilman. "Prodrugs in Cancer Chemotherapy", Biochemical Society Transactions. 14: 375-382, 61th Meeting, Belfast (1986) and Stella et al. , "Prodrugs: A Chemical Approach to Targeted Drugs Delivery", Directed Dru s Delivery, Borchardt et al. , (ed.), 147-267, Humana Press (1985). The precursors of this invention include, but are not limited to, phosphate-containing precursors, thiophosphate-containing precursors, sulfate-containing precursors, peptide-containing precursors, amino acid-modified precursors, glycosylated precursors, β-lactam-containing precursors, precursors that they contain optionally substituted phenoxyacetamides or optionally substituted phenylacetamide-containing precursors, 5-fluorocytokine or other 5-fluorouridine precursors which can be converted into a more active cytotoxic free medicament. Examples of cytotoxic drugs can be derivatized (forming derivatives) in a precursor form for use in this invention and include, but are not limited to, the chemotherapeutic agents described above. An "effective amount" of a polypeptide described herein or an antagonist thereof, with reference to the inhibition of neoplastic cell growth, tumor growth or growth of cancer cells, is an amount capable of inhibiting, to some extent, the growth of target cells. The term includes an amount capable of producing a growth inhibitory, cytostatic or cytotoxic effect or apoptosis of the target cells. An "effective amount" of _ "L; a PR0201, PR0292, PR0327, PR0127, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0853 PR0882 polypeptide for the purpose of inhibiting the growth of neoplastic cells, the growth of tumors or the growth of cancer cells it can be determined empirically and in a systematic or routine way. A "therapeutically effective amount" with reference to tumor treatment refers to an amount capable of producing one or more of the following effects (1) inhibition to some extent of tumor growth that includes, slows and suppresses growth completely (2) ) reduction in the amount of tumor cells; (3) reduction in tumor size (4) inhibition (i.e. reduction, braking or complete arrest) of the infiltration of tumor cells into peripheral organs; (5) inhibition (i.e. reduction, braking or complete arrest) of metastases; (6) improvement of the antitumor immune response which may, although need not, result in regression or rejection of the tumor, or (7) relief, to some extent, from one or more of the symptoms associated with the disorder. A "therapeutically effective amount" of a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0883 PR0882 or PR0882 antagonist for tumor treatment purposes can be determined empirically and from a systematic or routine way.

A "growth-inhibiting amount" of an antagonist of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 is an amount capable of inhibiting the growth of a cell, especially a tumor, for example a cancer cell, either in vitro or in vivo. A "growth inhibitory amount" of a PRO201 antagonist, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 for purposes of inhibiting the growth of neoplastic cells can be determined empirically and in a systematic or routine way. A "cytotoxic amount" of an antagonist PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, 'PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is an amount capable of causing the destruction of a cell, especially a tumor, for example a cancer cell, either in vitro or in vivo. A "cytotoxic amount" of a PRO201 antagonist, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 for purposes of inhibiting the growth of neoplastic cells can be determined empirically and in a systematic or routine way. The polypeptide terms "PRO201", "PR0292", "PR0327", "PR01265", "PR0344", "PR0343", "PR0347", "PR0357", "PR0715", "PRO1017", "PR01112", "PRO509" , "PR0853" and "PR0882" .-rM.íl * tÍá, L. r. LJ ». m? j? l? b? £? rrr .. - ^ Í * r. > H- - * »+. X«? ?, M or protein, when used herein, encompasses the native sequence of the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0727, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 polypeptides and the variants polypeptide of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 (which are further defined herein). The polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 may be isolated from various sources, such as from human tissue types or from another source, or they can be prepared by recombinant or synthetic methods. A "native sequence PRO201", "native sequence PR0292", "native sequence PR0327", "native sequence PR01265", "native sequence PR0344", "native sequence PR0343", "native sequence PR0347" "PR0357 native sequence", "native sequence of PR0715", "native sequence of PRO1017", "native sequence of PR01112", "native sequence of PRO509", "native sequence of PR0583" - or "native sequence of PR0882", it comprises a polypeptide having the same amino acid sequence as the polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 derived from nature. Such a native sequence of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, Item. r¡, .k., i..i ...

PR01112, PRO509, PR0853 and PR0882 can be isolated from nature or can be produced by recombinant or synthetic means. The term "native sequence" of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 specifically encompasses naturally occurring truncated or secreted forms (e.g. sequence of extracellular domain "of variant forms that occur naturally (for example alternatively spliced forms), and allelic variants that occur naturally of the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 In one embodiment of the invention, the native sequence of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is a full length native sequence of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 as shown in Figure 2 (SEQ ID. NO: 2), figure 4 (SEC. FROM IDENT. NO: 6), figure 6 (SEC.

IDENT. NO: 8), figure 8 (SEQ ID NO: 13), figure 10 (SEQ ID NO: 15), FIGURE 12 (SEQ ID NO: 23), FIGURE 14 (SEQ ID NO: 28), FIGURE 16 (SEQ ID.

NO: 33), FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEC. IDENT NO: 46), FIGURE 26 (SEQ ID NO: 48), FIGURE 28 (SEQ ID NO: 53), respectively. In addition, although the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 described in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), FIGURE 6 (SEQ ID NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), FIGURE 12 (SEQ ID NO: 23), FIGURE 14 (SEQ ID NO: 28), FIGURE 16 (SEQ ID NO: 33), FIGURE 18 (SEQ ID NO: 40) ), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO. : 48), Figure 28 (SEQ ID NO: 53), respectively, are shown to start with the methionine residue designated herein as the amino acid position 1, it is conceivable and possible that another methionine residue located either towards the N-terminal part or the C-terminal part of the position of amino acid 1 in Figure 2 (SEQ ID NO: 2), Figure 4 (SEC. AND IDENT. NO: 6), FIGURE 6 (SEQ.-DE IDENT NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), FIG. 12 (SEQ. DE IDENTIFIER NO: 23), FIGURE 14 (SEQ ID NO: 28), FIGURE 16 (SEQ ID NO: 33), FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (FIG. SECTION ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48), FIGURE 28 (SEQ ID.

NO: 53), respectively, can be used as the starting amino acid residue for the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The "extracellular domain" or "ECD" of a polypeptide described herein refers to a form of the polypeptide which is essentially free of the transmembrane and cytoplasmic domains. Typically, an ECD polypeptide will have less than about 1% of such transmembrane or cytoplasmic domains and will preferably have less than about 0.5% of such domains. It will be understood that any transmembrane domain identified for the polypeptides of the present invention are identified in accordance with the criteria commonly used in the art to identify that type of hydrophobic domain. The exact boundaries of the transmembrane domain may vary, but most likely at most about 5 amino acids towards either end of the domain as initially identified and as shown in the accompanying figures. Thus, in one embodiment of the present invention, the extracellular domain of a polypeptide of the present invention comprises amino acids 1 through X of the mature amino acid sequence, wherein X is the amino acid within the 5 amino acids on both sides of the amino acid sequence. limit of the extracellular domain / transmembrane domain.-mt tn-? > - • - • - The approximate location of the "signal peptides" of the various PRO polypeptides described herein are shown in the accompanying figures. It is noted, however, that the C-terminus of a signal peptide can vary, but most likely at most about 5 amino acids on both sides of the C-terminus of the signal peptide as initially identified herein, wherein the C-terminal limit of the signal peptide can be identified in accordance with the criteria commonly used in the art to identify this type of amino acid sequence element (eg Nielsen et al., Prot. Enq., .10: 1-6 (1997) and von Heinje et al., Nucí Acids Res., 14: 4683-4690 (1986)). In addition, it is also recognized that, in some cases, the separation of a signal sequence from the secreted polypeptide is not completely uniform, resulting in more than one secreted species. These mature polypeptides, wherein the signal peptide is separated within a maximum of about 5 amino acids on both sides of the C-terminus of the signal peptide as identified herein, and the polynucleotides encoding it, are contemplated by the present invention. The terms "PRO201 polypeptide variant", "PR0292 polypeptide variant", "PR0327 polypeptide variant", "PR01265 polypeptide variant", "PR0334 polypeptide variant", "PR0343 polypeptide variant", "PR0347 polypeptide variant". , "polypeptide variant PR0357"," PR0715 polypeptide variant "," PRO1017 polypeptide variant "," PR01112 polypeptide variant "," PRO509 polypeptide variant "," PR0853 polypeptide variant "or" PR0882 polypeptide variant "means an active PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 as defined above or below which have at least about 80% amino acid sequence identity with a full length native sequence of the PRO201 polypeptide sequence, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 as described herein, a PRO201 polypeptide sequence, PR0292, PR0327 PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 lacking the signal peptide as described herein, an extracellular domain of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR03 44, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, with or without the signal peptide, as described herein, or any other fragment of a PRO201 full-length polypeptide sequence, PR0292, PR0327 , PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 as described here. Such polypeptide variants of PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or ? & .vá, < . & t > & -.- PR0882 include, for example, the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 wherein one or more amino acid residues are added, they are deleted in the N or C terminal parts of the native full-length amino acid sequence. Usually, the PRO201 polypeptide variant, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 will have at least about 80% amino acid sequence identity, preferably at least about 81% amino acid sequence identity, more preferably at least about 82% amino acid sequence identity, more preferably at least about 83% amino acid sequence identity, more preferably preferably at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence identity, more preferably at least about 87% amino acid sequence identity, more preferably at least about 88% sequence identity amino acids, more preferably at least about 89% amino acid sequence identity, more preferably at least about 90% V ~ '- - S "- * -'« - * * = - amino acid sequence identity, more preferably at least about 91% amino acid sequence identity, more preferably at least about 92% of amino acid sequence identity, more preferably at least about 93% amino acid sequence identity, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity % amino acid sequence identity, more preferably at least about 96% amino acid sequence identity, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino acid sequence identity, and more preferably at least about 99% amino acid sequence identity, with one sequence full-length native sequence of the PRO201 polypeptide sequence, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 as described herein, a PRO201 polypeptide sequence, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 lacking the signal peptide as described herein, an extracellular domain of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343 , PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, L ^ r • H? M -? # ?? ?? "d» ái- * aá? fc «i *» ^ fcilaAi.

PR0853 or PR0882 with or without the signal peptide, as described herein, or any other fragment of a full-length polypeptide sequence PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509 , PR0853 or PR0882 as described here. Typically, the variant polypeptides of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are at least 10 amino acids in length, often of at least about 20 amino acids in length, most often at least about 30 amino acids in length, more often at least about 40 amino acids in length, more often at least about 50 amino acids in length, more preferably frequent of at least about 60 amino acids in length, more often at least about 70 amino acids in length, more frequently at least about 80 amino acids in length, more often at least about 90 amino acids in length, more frequently of at least about 100 amino acids in length, more frequently of at least about 150 amino acids in length, more often at least about 200 amino acids in length, so more frequent of at least about 300 amino acids in length, or greater. As shown in the following, Table 1 provides the complete source code for the ALIGN-2 sequence comparison computer program. This source code can usually be compiled for use in a UNIX operating system to provide the ALIGN-2 sequence comparison computer program. In addition, tables 2A-2D show hypothetical exemplifications for use of the method described in the following to determine% amino acid sequence identity (tables 2A-2B) and% nucleic acid sequence identity (tables 2C-2D) using the sequence comparison computer program ALIGN-2 where "PRO represents the amino acid sequence of the hypothetical PRO201 polypeptide, PR0292 , PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PR0509, PR0853 or PR0882 of interest, "comparison protein" represents the amino acid sequence of a polypeptide against which the "PRO" polypeptide is compared "of interest." PRO-DNA "represents a nucleic acid sequence of interest that codes for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or hypothetical PR0882." Comparison DNA "represents the nucleotide sequence of a nucleic acid sequence against which I d. ^. . . 4 r. ? . . r ^ m .. a "PRO-DNA" nucleic acid molecule of interest is compared, "X", "Y" and "Z" each represent different hypothetical amino acid residues and "N", "L" and "V" each represent different nucleotides hypothetical Table 1 * C-C increased from 12 to 15 * Z is the average of EQ * B is the average of ND * coincidence with stop is _M; high-high = 0; J (wildcard) match = 0 * / #define _M -8 / * value of a match with a stop * / int _day [26] [26] =. { / * A B C D E F G H I J K L M N O P Q R S T U V W X Y Z * / / * A * /. { 2, 0, -2, 0, 0, -4, 1, -1, -1, 0, -1 -2, -1 0, _M, 1, 0, -2, 1, 1, 0, 0, -6, 0, -3, 0.}. , / * B * /. { 0, 3, -4, 3, 2, -5, 0, 1, -2, 0, 0, -3, -2, 2, _M, -1, 1, 0, 0, 0, 0, -2, -5, 0, -3, 1.}. , / * C * /. { -2, -4, 15, -5, -5, -4, -3, -3, -2, 0, -5, -6, -5, -4, _M, -3, -5, -4 0, -2, 0, -2, -8, 0, 0, -5} , / * D * /. { 0, 3, -5, 4, 3, -6, 1, 1, -2, 0, 0, -4, -3, 2, _M, -1, 2, -1, 0, 0, 0, -2, -7, 0, -4, 2.}. , ai. ^ ta J4-3Í? .i.¿ija¿aaa. ^^^ - ^ * / * E * / 0, 2, -5, 3, 4, -5, 0, 1, -2, 0, 0, -3, -2, 1, _M, -1, 2, -1, 0, 0, -2, -7, 0, -4, 3.}. , / * F * / 4, -5, -4, -6, -5, 9, -5, -2, 1, 0, -5, 2, 0, -4, M-, -5, -5 , -4, -3, -3, 0, -1, 0, 0, 7, -5} , / * G * / 1, 0, -3, 1, 0, -5, 5, -2, -3, 0, -2, -4, -3, 0, M, -1, -1, - 3, 1, 0, 0, -1, -7, 0, -5,? } , / * H * / -1, 1, -3, 1, 1, -2, -2, 6, -2, 0, 0, -2, -2, 2, - M, 0, 3, 2, -1, -1, 0, -2, -3, 0, 0, 2.}. , / * I * / M, -2, -2, -2, -1, 0, 0, 4, -5, 0, -1, -2} , / * J * / 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, -M, 0, 0, 0, 0, 0, 0, 0 , 0, 0, 0, 0.}. , / * K * / -1, 0, -5, 0, 0, -5, -2, 0, -2, 0, 5, -3, 0, 1, _M, 1, 1, 3, 0, 0, 0, -2, -3, 0, -4, 0.}. , / * L * / -2, -3, -6, -4, -3, 2, -4, -2, 2, 0, -3, 6, 4, -3, _M, -3, -2 , -3, -3, -1, 0, 2, -2, 0, -1, -2} , / * M * / 1, -2, -5, -3, -2, 0, -3, -2, 2, 0, 0, 4, 6, -2, _M, -2, -1, 0 , -2, -1, 0, 2, -4, 0, -2, -l} , / * N * / 0, 2, -4, 2, 1, -4, 0, 2, -2, 0, 1, -3, -2, 2, _M, 1, 1, 0, 1, 0 , 0, -2, -4, 0, -2, l} , / * O * / M, M, M, M, M, M, M, M, M, M, M, M, M, _M, 0, _M, _M, _M, _M, _M, _M, _M, _MMM} , / * P * / 1, -1, -3, -1, -1, -5, -1, 0, -2, 0, -1, -3, -2, - 1, _M, 6, 0, 0, 1, 0, 0, -1, -6, 0, -5,? } , / * Q * / 0, 1, -5, 2, 2, -5, -1, 3, "-2, 0, 1, -2, -1, 1, _M, 0, 4, 1, - 1, -1, 0, -2, -5, 0, -4, 3.}., / * R * / 2, 0, -4, -1, -1, -4, -3, 2, - 2, 0, 3, -3, 0, 0, _M, 0, 1, 6, 0, -1, 0, -2, 2, 0, -4, 0.}., / * S * / 1, 0, 0, 0, 0, -3, 1, -1, -1, 0, 0, -3, -2, 1, _M, 1, -1, 0, 2, 1, 0, -1, - 2, 0, -3, 0.}., / * * / 1, 0, -2, 0, 0, -3, 0, -1, 0, 0, 0, -1, -1, 0, _M 0, -1, -1, 1, 3, 0, 0, -5, 0, -3, 0.}., isl ... * A • £. r. r i. i. tM xibÁi & Á / * u * /. { O, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, _M, 0, 0, o, o, o, o, o, o, o, o, or} , / * V * / 0, -2, -2, -2, -2, -1, -1, -2, 4, 0, -2, 2, 2, -2, _M, -1, -2, -2, -1, 0, 0, -4, -6, 0, -2, -2} / * w * /. { -6, -5, -8, -7, -7, 0, -7, -3, -5, 0, -3, -2, -4, - 4, _M, -6, -5, 2, -2, -5, 0, -6, 17, 0, 0, -6} , / * X * /. { O, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, _M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.}. , /* Y */ . { -3, -3, 0, -4, -4, 7, -5, 0, -1, 0, -4, -1, -2, -2, _M, -5, -4, -4, -3, -3, 0, -2, 0, 0, 10, -4} , / * z * /. { 0, 1, -5, 2, 3, -5, 0, 2, -2, 0, 0, -2, -1, 1, _M, 0, 3, 0, 0, 0, 0, -2, -6, 0, -4, 4.}. }; / • • / «Indude < stdio.h > «Ln ude < ct pe.b > «Define MAXJMP 16 / * max jutnps in a diag • /« define MAXGAP 24 / * do not continue to penalize gaps larger than t is * / «define JMPS 1024 / * max jmps in an paih • /« define MX 4 / * save if there is at least MX-1 bases since last jmp * / «define DMAT 3 / * valué of putehing bases * /« define DM1S 0 / • penalty for mismatched bases • / «define DINSO 8 / • penalty for a gap • / «Define DINS1 1 / • penalty per base * /« define PINSO 8 / * penalty for a gap • / «define PINS1 4 / * penalty for residue * / stn? Tjmp. { short n (MAXJMP]; / • size of jmp (neg for dely) • / unsigned short x [MAXJMP]; / • base no. or jmp in seo, x • / >; / • limiis seq to 2 * 16 - 1 * / stp? T diag { Int score: / * score at last jmp * / long offset; / * offset of prev block • / short ijmp; / • curren! jmp index * / struct jmp jp; / * list of jmps • /}; stpict path { int spe; / • number of leading spaces * / short nlJMPSl; / * size of jmp (gap) • / int xIJMPS]; / * loe of jmp (last elem before gap) • / >; char • ofile; • output file yam • / char * namex [2]; • seq Ñames: getseqs () • / char • prog: • prog ñame for err msgs • / char • seqx [2]; • seqs: getseqsO * 'int d ax; • best diag: n () • / int dpuxO; • final diag • / int dna; • set if dna: mainO • / int end gaps; • set if criminalizing end gaps • / int gapx, gapy; • total gaps in seqs • / int lepO, lenl; • seq lens • / int ngapx, ngapy; • to size of gaps * / int s ax; • max score: n () • / int • xbm; • bitmap for matching • / kong offset; • current offset in jmp file • / struct diag • dx; • holds diagonals * / struct path PPPI; • holds path for seqs • / cbar • callocO. • mallocO. * index0 • strcpyO; char • getseqO • g_calloc (); / * Needleman-Wunsch to the barn program * usage: progs filel f? Le2 * where file! and f? le2 are two dna or two protein sequences. • The sequences can be in upper- or fower-case an may contain ambiguity 5 • Any lines bcgin ng with ';'. '> 'or' < 'are ignored • Max file length is 65535 (limited by unsigned short x in the jmp strucí) • A sequence with 1/3 or more of the elements ACGTU is assumed to be DNA * Output is in the file "align.out" * The program may create a file in / imp to hold info about traceback. • Original version developed under BSD 4.3 on a vax 8650 * / «inchide" nw.h "10" include "day.h" static dbva! [26] -. { ? .14.2.13.0.0.4.11, 0.0.12.0.3.15.0,0.0.5,6,8,8,7.9.0, 10.0}; static _pbval [26] -. { I, 2 | (1 < < ('D' -, A,)) | (1 < -cCN '-' A ')). 4, 8, 16.32, 64. 128.256. OxFFFFFFF, 1 < < 10, 1 < < 11.1 < < 12, 1 < < 13, 1 < < 14, 15 1 < < 15, 1 < < 16.1 < < 17, 1 < < 18, 1 < < 19, 1 < < 20, 1 < < 21, 1 < < 22. 1 < < 23, 1 < < 24, 1 < < 25 | (1 < < (?, -? ')) | (1 < < (' Q'-? '))}; main (ac. av) mam int ac; char • av []:. { prog - av [0); 20 if (ac!! -3). { fprintf (stde? t, "usage:% s filel file2 \ n", prog):. fprintf (stderr, "where file] and file2 are two dna or two protein sequences. \ n"); fprimf (s? derr, "The sequences can be in upper- or lower-case \ n"): fprintf (stderr, "Any lines beginning with ';' or '<' are? gnored \ n"), fpr? mf (s? derr, "Ou ut is in the file \ 'al? gn.ou? \" \ n "); ex? t (l);.}. namex [0] = av | l]; 25 namex [I] - av [2J; seqx [? J = getseq (namex [0], AlenO); seqxjl] = getseq (namex [l], & lenl); xbm - (dna)? .dbval: _pbval; endgaps - 0; / • I to criminalize endgaps * / ofile •• "align.out"; / • output file • / nwO; / * fill in the matrix, get the possible jmps • / 0 readjmpsO; / • get the current jmps • / print (); / * print stats, aiign em * / cleanup (0); / • unlink any tmp files * / ri ^ ai; ^^^ M ^ fe '? "t ^ 8Í? f ^ 3 í., .s. j. i. ryr.,.,.,.,., ... r. *. r .i = Jto ^ * ^^^. *. * - ... 1 ..... *. rr.r ^ r? ^ ír. ik / * do the alignmem, retum best score: rnainO • dna: valúes in Fitch and Smith, PNAS 80, 1382-1386, 1983 • pro: PAM 250 valúes • When scores are equal, we prefer mismatches to any gap, prefeT • a new gap to extending an ongoing gap, and prefer to gap in seqx • to a gap in seq y. • / pwO nw { char * p? * p; / • seqs and ptrs • / int • ndely, * dely; / • keep track of dely • / int ndelx, delx; / • keep track of dclx • / int • tmp; / • for swapping rowO, rowl • / int mis; / • score for each type • / int insO, insl; / • insepion penalties • / register id; / • diagonal index * / register «j; / * jmp index • / register • coK), * col !; / • score for curr, last row • / register xx.yy; / • index into seqs * / dx - (stnict diag •) g_ca! loc ("to get diags", lenO + Ienl + 1, sizeoftstpict diag)); ndely - (in t *) g_calloc ("to get ndely", lenl + 1, sizeofflnt)); dely - (int *) g_caIloc ("to get dely", lenl + 1. sizeof (int)); colO - (int *) g ~ calloc ("to get colO", lenl + 1. sizeof (int)); coll «(int *) g calloc (" to get coll ", lenl + 1. sizeof (int)); insO - (dna)? DINSO: P1NS0; insl - (dna)? DINS1: P1NS1; smax - -10000; if (endgaps). { for (col0 [0J - dely [0] - -insO, yy - 1; y, < - lenl; yy + +). { col0 (yyj - delytyy] "eol0lyy-l] - msl; ndelylyy) - yy;.}. col0 [0J - 0; / • Waterroan Bull Math Biol 84 • / &else for (yy» 1; yy < lenl; yy + +) delyl y) - -insO; / • fill ip i match matrix • / for (px • seqx [0], xx «1;; xx < = lenO; px + +, XX + +) { / initialize first <: ntry in col • / go (endgaps) { ir (xx -. - 1) coll [01 - delx * - (insO + insl); else col 1 (0) - delx - col0 (01 - insl; nddx - • xx;.}. ebe { col 1 (0] - 0; delx - - sinO; ndelx - 0; ... nw for (py «seqxfll.yy - l; yy <" lenl; py + +, yy ++) { mis = colOlyy-lJ; go (dna) mis + - (xbm [* px-, A, J & xbm [* py-'A '])? DMAT: DM1S; ebe my + - _day (* px-, A'l [* py-'A, J; / • update penalty fbr of in x seq; * favor new overgong • ignore MAXGAP tf weighting endgaps 10 • / if (endgaps 11 nddy [yy] <MAXGAP) { if (colOlyyJ - insO > - delylyyj) { delylyyj «col0 [yyl - ( insO + insl); ndeiy [yy] = 1;.}. eise { delylyyj- "insl; ndely [yy) + +; } fifteen } be. { if (coK) [yyl - (insO + insl) > »Dely [yy]). { dely (yy] = colO [yy) - (insO + insl), ndely [yy] «1; } else ndely [yy) + +; / • update penalty for the in and seq; •? Q • favor new overgong • / if (endgaps 11 ndelx < MAXGAP). { if (coll [yy-H-? ns0> = delx). { delx = coll [yy-l) - (insO + msl); ndelx - 1; > ebe { delx - insl; ndelx + +; 25 > } else { if (coll [yy-l) - (insO + insí) > «= Delx). { delx-coll [yy-l] - (insO + insl); ndelx - 1; Jebe ndelx + +; / * pick the maximum score; we're favoring 30 * my over any of the delx over dely • / i i ..-..- A i .. ^, ..,; -. -., _. nw id - x - yy + lenl - 1; if (mis > - delx & mis > - dely [yyj) coll [yy) - mis; else if (delx > - dely [yy]). { coll [yy] - delx; ij - dx [id] .ijmp; R (dx [idJ.jp.n [0J & &(! Dna 1 1 (ndelx > - MAXJMP & xx &dt; dx [id] .jp.x [ijl + MX) 1 1 mis > dx [? d] .score + DINS0)). { dx [? J] .ijmp + +; go (+ + ij> - MAXJMP). { wptejmps (? d); ij - dx [? d].? jmp = 0; dx [id] .offset - offset; offset + «sizeof (struct jmp) + sizeof (offset); } } dx [id] .jp.n [ij] »ndelx; dx [idj.jp.x [ij] - xx; dx [idj. score • delx; } ebe { colllyy] «dely [yyl; ij - dx [id] .ijmp; If (dx [id] .jp.n [01 & (idna 1 1 (ndely [yy]> - MAXJMP && xx &dt; dx [? D] .jp.x [? J] + MX) |) mis &dt [? D] score + D1NS0)). { dx [id].? jmp + +; lT (+ + ij> MAXJMP). { wptejm? s (id); ij - dx. { id].? mp - 0; dx [id] .offset - offset; offset + »sizeof (stp? ct jmp) + sizeof (offset); } } dx [id] .jp.n [ij] - -ndely [yy]; dx [id] .jp.x [ij] - xx; dx [id]. score - delylyy]; if (xx - - lenO & &y < lenl). { / * last col lf (endgaps) coll [yy] - =? ns0 +? nsl * (lenl-yy), if (coll [yy] > smax). { smax • »colllyyl; dtnax - id; } } } go (endgaps &&xx < lenO) coll [yy-l] - «tnsO + insl 'flenO-xx), if (coll [yy-l) > smax). { smax «= coll [yy-ll; dmax - id; } tmp-coK); coK) - coll; coll - tmp; > (void) free «cbar *) ndely); (void) free ((char *) dely); (void) free ((char ») col0); (void) free ((char *) coll); * príntO - only routine visible outside this module • static: • geunatO - trace back best path, count of matches: príntO • pr_alignO - print alignment of described in array pD: ppntO • dumpblockO - dump to block of lincs with numbers, surs: pr_al ? gn () • pumsO - put out to nuinber line: dumpblockO • putlineO - put out to line (yam, [num], seq. [pum]): dumpblockO • starsO - -pta line of surs: dumpblockO • stripnameO - strip any path and prefix from to seq ñame • / "include" nw.h "« define SPC 3 «define P UNE 256 / • maximum output line * /« define P ~ SPC 3 / * space between ñame or num and seq • / extern _day [26] [26]; int olen; / • set output line length • / FILE * fx; / * output file • / príntO print. { int Ix, ly, firstgap, lastgap; / * overlap • / «f ((fx - fopeníofile," w ")) - = 0). { fpr? ntf (stdett, "% s: can not write% s \ n", prog. ofile); cleanupO); } fpriraf (fx, "< first sequence:% s (length =% d) \ n", namex [0], lenO); fppmf (fx, "< second sequence.% s (length -% d) \ n", namexj l], lenl), olen - 60; Ix - lenO; ly »lenl; firstgap - lastgap - 0; if (dmax < lenl - 1). { / * leading gap in x • / pp [0) .spc - firstgap «lenl - dmax - 1; ly - ppfOJ.spc; } else if (dmax > lenl - 1). { / * leading gap in and • / pp [l] .spc »firstgap« dmax - (lenl - 1); Ix - ppflj.spc; } if (d axO < lenO - 1). { / * trailing gap tn x • / lastgap - lepO • dmaxO -1; lx - »lastgap; } else if (dmaxO> lenO - 1). { / * trailing gap in and • / lastgap * dmaxO - (lenO - 1); ly - lastgap; } getmat (lx, ly, firstgap, lastgap); pr_align (); / • * trace back the best path, count matches • / static getmat (lx.l. firstgap, lastgap) getmat int Ix, ly; / • "core" (minus endgaps) • / int firstgap, lastgap; / • leading trailing overlap * /. { int pm, K). il.sizO, sizl; char outx [32]; double pa; register nO, ni; register char • pO. * pl; -. r. / * get toul matches, score J-U ^? ) - il - sizO - sizl - 0; pO »seqx (0] + pp [ll.spc; pl - seqx [l] + pp [0J.spc; nO - pp [l) .spc + 1; ni »pp [0] .spc + 1; nm «0; , q while (»p0 & * pl). { x :: > if (sizO). { pi ++; nl + +: sizO-; } ebe lf (sizl). { p0 + +; n0 + +; sizl-; 0 > ebe { if (xbm [• O- • A •] & b [• pl- • A •]) nm ++; if (n0 ++ --pp [0] .x [i0]) sizO - pp [0) .n (¡0 + -? -]; lf (nl + + --pp [l] .x [il]) sizl - pp [l] .n [il + +]; 5 PO + +: pl + +; / * pt homology: • if penalizing endgaps, base is the shorter seq • else, knock off overhangs and take shorter core • / 0 if (endgaps) Ix - (lenO <lnl) len0: lenl; else Ix - (Ix < ly)? Ix: ly; pa - 100. * (double) nm / (double) lx; fpriraffx. "\ n"); fpriraf (fx, "<% d match s in an overlap of% d:% .2f percent similarity \ n" nm, (nm - = 1)? ":" is ", Ix, pet); * J **. »«. **., ... »l ...., ¿. , ^ M, ^^ _ ^^, "., J _,, __ ^? t. fprintf (fx, "<gaps in first seq? en:% d". gapx); ... getmat if (gapx). { (void) sprintf (ou, "(% d * s% s) \ ngapx, (dna)?" base ":" res? Jue ". (ngapx = = IV" "" s "). fpr? mf (fx , "% s", outx); s ax, DMAT. DM1S. DINSO. DINS1); else fprimf (fx, "\ n < score:% d (Dayhoff PAM 250 matrix, gap penalty •»% d +% d for residue) \ n ". smax, P1NS0, PINSI); If (endgaps) rprintf (fx, "<endgaps penalized.) Left endgap:% d% s9.s, right endgap-% d% s% s \ n". Firstgap, (dna)? "Base": "residue" , (firstgap = = 1) ° "" "s", lastgap, (dna)? "base": "residue", (lastgap = = I) 9"". "s"). ebe fpriptf (fx, "<endgaps not penalized \ n"); static nm; / * matches in core - for checking • / static Imax; / • lengths of stpped file yams • / static ÜI2], / • jmp index for a path • / static nc [2]; / • nuraber ai surt of curren! line * / s sttaattiicc nn ?? [[22] 1;; / • current elem number - for gapping * / static s? Z [2); static char • ps [21; / • ptr to cunera element * / static char • po [2]; / * ptr to next output char slot * / static char out [2] [P LINE]; / • output line * / static char south [P L? NE]; / • set by starsO * '/ • • print aligpmept of described in struct path ppQ • / statk pr alignO pr_align . { "int nn; / • char coupt * / int more; register i; for (i - 0, Imax - 0; i <2; i + +) { nn - stripname (na? nex [i]); if (nn> Imax) Imax »nn; nc [i] - 1; ni [i] - 1; sizfi] - ij [i] - 0; ps [¡l - seqx [ij; po [i]« out [i); ? = * __ * i ^? 2 ^^ j for (nn «nm - O, more - 1; more;). { ... pr_allgn for (i «more» 0; i < 2; i + +). { / • • do we have more of this sequence? • / «f (! 'Ps [rj) continue; more + +; if (pp [i] .spc). { / • leading space • / Ii] + + - ''; pp [i] .spc-; > go go (siz [i]). { / • in a gap • / • po [i] + + - • - '; siz [i] -; } else { / • we're putting a seq element • / »po. { i] - • psM: if (islowet (»ps (¡l)) • ps [i] - toupper (» ps [i]); po { il + +; ps [i] + +; / • • are we at next gap for this seq? • / if (ni [i] - - pp [il.x (ij [il]) { / • • we need to merge all gaps * »'(is local ion • / siz [i] -? p [i] .n [ij [i] + +]; while (ni [i] "pp [¡) .x [ij [¡] l) siz [i] +« pp [ i] .n [ij [i) + +);.}. ni [i] + +;.}..}. if (+ + pn - »olen | | more & ¿c nn) { dumpblockO; for (i »0; i < 2; i + +) po [i] - out [i); nn« • 0;.}..}. '* • dump a block of lines, including numbers, surs : pr_al? gn () • / static dumpblockO dumpblock . { register i; for (i - 0; i <2; ¡+ +) • po [i] - - 'NO'; .dumpblock (void) putc (* \ n \ fx); for (i - 0; i <2; i ++). { if (* o? tfi] & (\ > ut [¡]. '. ll * (po [¡))! - ")) { if (i - O) nums (i); go (i - »0? A» out [l]) starsO: putline (i); if (i - 0 &?? »ot? t [l]) fpriptf (fx, south); if (i - 1) nums (i); * put out a number fine: dumpblockO • / static nums (ix) nums int ix; / * index in outQ holding seq line * /. { char nline [P_UNE]; register i, j; register char »pn, * px, * py; for (pn - nline, i - 0; i < Imax + P SPC; i ++, pn ++) • pn - ''; for (i ~ nc [ix], py = out [ix]; "py; py + +, pn-i- +) { tfcpy--" II * py - • - ") • pn - ''; ebe { if (¡% 10 - = »0 || (i - 1 & nc [ix]! = 1)) { j - (i <0)? -i: i; for (px «pn; j; j /» 10. px-) • px - j «10 + '0'; go < or • px - • - ';.}. ebe • pn i + +;.}. .}. • pn - * \ 0 '; ncfix] - i; for (pn - nline: »pn; pn ++) (void) putc (» pn, fx); (void) putc (' \ n ', fx); / • * put out a line (yam, [num]. Seq. [Pum]): dumpblockO • / static putline (ix) int ix; putline. { .put Une int i; register char • px; for (px - namex [ix], i - 0: * px? A • px! - px + +. i + +) (void) putc (»px. fx); for (; i < Imax + P SPC: i ++) (void) puC ', fie); / • these count from 1: • n00 is current element (from 1) • ncQ is number at sun of current line • / for (px - out [ix]; * px; px + +) (void) pu? C (»PxA0x7F, fe); (void) putcCVn ', fx); / • • put a line of surs (seqs always in out [0). out [l]): dumpblockO static sursO Stars . { int i; register char "pO, * pl, cx, * px; if (!» out [0] 11 (• out [0] - '• AA • (by [0J) «-' ') 11!» out [l ] || (»out [l]» - "??" (po [l]) - = ")) retum; p?" Fflr; for (i - lmax + P_SPC; i; i-) • px ++ ~ - "; for (pO - outfO], pl - outfl);» pO? «pl; p0 + +, pl + +) { ir ( isalpha ('p?)? A isalpha (»pl)) { If (xbm [, pO-, A,]? xbm [* pl-'A, J) { cx -' • '; pm ++; .}. ebeif (! dna ?? _ day [* pO-, A,] l »pl-'A ']> 0) cx - V; else cx"} ebe cx - * px ++ «cx; ) •? X ++ - '\ n *; • px - '\ 0'; * L¿ .., ... ,, ... / • • strip path or prefix fro pn, renirn len: pr alignO • / static stripna e n) char * pp; / • file yam (may be path) • / stripname. { register char * px. py py - 0; for (px - pn; »p?; px + +) ifCpx - V) i iir. (py,) py - p? + i; (void) strcpyfn, py); return (strlen (pp)); • cleanupO - cleanup any tmp file • geteqO - read in seq, set dna, len, maxlen • g_callocO - calloc () with error checkin • readjmpsO - 8 «the good jmps, from tmp file if necessary • writestemps - wpie a filled array of jmps to a tmp file. nwO • / «in ude" nw.h "« lndude < sys / f? le.h > char • jname «" / pnp / homgXXXXXX "; / • tmp file for jmps • / FILE • < j; tat cleanupO; / • cleanup tmp file • / looj IseekO; / • remove any tmp file if we blow • / cleanupO) cleanup int. { if (fj) (void) unlinkfjname); exit (i); / • • read, return ptr to seq, set dna, len, maxlen • skip lines suping with ';', '< ', or' > '• seq in upper or lower case • / char • getseq (file, len) getseq char * f? Le; / • file yña * / int * len; / • seq len • / cbar line [1024], * pseq; register char • px. »? And: int natgc, tien; FILE • fp; If ((fp - fopen (f? Le, "r")) - - 0). { fppntf (stdett, "s: can not read% s \ n", prog, file); ex? t (l); ) tien-natgc «0; while (fgets (line 1024, fp)). { if (»l? ne = - ';' 1 1 Mine = = '<' 1 1 * l? ne - - '>') continue; for (px - line; * px! «'\ n'; px + +) If (isupper (» px) 11 islower (»px)) tlen + +; } if ((pseq - malloc ((unsignedXtlen + 6))) - - 0). { fpr? n? f (stderr. *% s: malloc () failed to gei% d bytes for% s \ n ", prog, tlen + 6. file), ex? t (l);.}. pseq [0 ] - pseq [l] - pseq [2] - pseq (3) - O '; 1, .getseq py - pseq + 4; • leniency; rcwind (fp); while (fgetsfline, 1024. fp)). { if (»iine - - '; • | |" line - -' < "| | * I? ne • '> •) continue; for (px - line; * px! - '\ n'; px + +). { if (isupper (»px)) * py + + ™ * px; ebe if (blower (* px)) • py + + - toupper (* px); if (index ("ATGCU", »(py-l))) natgc + +; 10 > } • py + + -, \ 0 ,: • py - O'i (void) fclose (fp); dna - natgc > (tien / 3); return (pseq + 4); char • g_ca! Loc (msg, nx, sz) g_calloc char * msg; / • program, calling routine * / int nx, sz; / • number and size of elements • /. { char • px. "callocO; if ((px = calloc ((unsigned) nx, (unsigned) sz)) = = 0) { if Cmsg) {20 fprimf (stdert,"% s: g callocO failed% s ( n =% d. sz =% d) \ n ", prog, msg, nx, sz); exi? (l);.}..}. return (px); / • • get final jmps from dxQ or tmp file, set ppQ, reset dmax: ma? N () 25 readjmpsO readjmps. { int fd - -1; int siz, K), il; register i, j, xx; lf (fj). { 30 (void) fclose (f); If ((fd - openOname, 0_RDONLY. 0)) < 0). { fprintf (stderr, "% s: can not open () 96s \ n", prog, name); cleanu? (l); } > for (i iO - il - 0, drnaxO »dmax, xx - lenO;; i + +). { while (1) { for 0"dx [dmax] .ijmp; j>» 0 ?? dx (dmax] .jp.x [j] > - xx; j-) ^ ¿Fahfc ^, .. ^ - ... readjmps if 0 < O AA dx (dmax] .offset AA fj). { (void) lseek (fd. dx [dmax] .offset, 0); (void) read (fd, (char »)? dx [dmax] .jp, sizeof (stp? ct jmp)); (void) read (fd. (char *) Adx (dmaxj.offset, sizeof (dx [dmax]. offset)): dxldmax) .ijmp - MAXJMP- 1; } ebe break; } if (i> - JMPS) { fpríntf (stdert, "% s: too many gaps in alignment \ n", prog); cleanup (l); > lf (j> -0). { siz - dx [dmax] .jp.n [j]; xx - dx [dmax] .jp.x [j]; 10 dmax + - siz; if (siz <0) { / • gap in second seq • / pp [l] .n (il) - -siz; xx + «siz; / • id - xx - yy + lenl» I • / pp [l] .x [il] - xx - dmax -I- lenl • 1; gapy + +; 15 ngapy - siz; / • ignore MAXGAP when doing endgaps • / siz - (-siz <MAXGAP 1 1 endgaps)? -siz: MAXGAP, il + +; } ebe if (siz > 0). { / • gap in first seq * / pp [0) .n [K)) - siz; pp.0] .x [¡0] - xx; gapx + +; 20 ngapx + - siz; / • ignore MAXGAP when doing endgaps • / siz - (siz <MAXGAP 1 1 endgaps)? siz: MAXGAP:) + +; } > ebe break; 25 »/ * reverse the order of jmps • / for (j - 0. ¡0-; j < K); j + +, ¡0-). { i - ppIOJ.nül: pp [0] .n [j] = pp [0] .n [i0]; pp [0] .n [0] - i; '= PP | 0] .x [jl; PPlOJ.xD] = pp (0] .x [? 0]; pp [0J.x [i0] = i;.}. For 0 - 0. il-; j < il; j + +, il-). { , n • - PPPl.nÜJ: PPÍD-nÜ] - pp (l] .n [il); pp [l] .n [il] = i; - '? i - ppm-xl: PPlD-xÜ] - pplij.xlii]: pp [i].? [ii] - i; } if (fd > - 0) (void) close (fd); • f (fj). { (void) unlinkfjname); 0 - 0; offset - 0; } / • • write a filled jmp struct offset of the prcv one (if any): nwO • / writejmpsOx) writejmps int ix; . { char * mk? emp0; «F (! Fj) í if (m) emp (jnap? E) < 0). { fprintf (stdert, "% s: can not mktempO 56s \ n", prog, jname); cleanup (l); } if ((fj - fopenOna e, * w *)) - - 0). { fprintf (stderr, "% s: can not wpte% s \ n", prog, jname); exit (J); } } (void) fwrite ((char *) Adx [ix] .jp. sizeof (stn? ct jmp), 1, fj); (void) fwrite ((char *) Adx [ix] .offset. sizeof (dx [? x] .offset), 1, fj); . ^ a ^ s .. .. ^^^ g ^^^^^^ ^ ^. * * r Table 2A PRO XXXXXXXXXXXXXXX (length = 15 amino acids) Comparison protein XXXXXYYYYYYY (length = 12 amino acids) % identity in the amino acid sequence = (the number of amino acid residues that coincide identically between the two polypeptide sequences determined by ALIGN-2) divided by (the total number of amino acid residues of the PRO polypeptide) = divided by 15 = 33.3% Table 2B PRO XXXXXXXXXX (length = 10 amino acids) Comparison protein XXXXXYYYYYYZZYZ (length = 15 amino acids) % identity in the amino acid sequence = (the number of amino acid residues that coincide identically between the two polypeptide sequences determined by ALIGN-2) divided by (the total number of amino acid residues of the PRO polypeptide) = divided by 10 = 50% Table 2C PRO-DNA NNNNNNNNNNNNNN (length = 14 nucleotides) Comparison protein NNNNNNLLLLLLLLL (length = 16 nucleotides) % identity in the nucleic acid sequence = (the number of nucleotides that match identically between the two polypeptide sequences determined by ALIGN-2) divided by (the total number of nucleotides in the nucleic acid sequence of PRO-DNA) = 6 divided by 14 = 42.9% Table 2D PRO-DNA NNNNNNNNNNNN (length = 12 nucleotides) Comparison protein NNNNLLLW (length = 9 nucleotides) % identity in the nucleic acid sequence = (the number of nucleotides that match identically between the two polypeptide sequences determined by ALIGN-2) divided by (the total number of nucleotides in the nucleic acid sequence of PRO-DNA) = 4 divided by 12 = 33.3! The term "percent amino acid sequence identity" with respect to the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0727, PRO1017, PR01112, PRO509, PR0853 or PR0882 polypeptide sequences identified in present, is defined as the percentage of amino acid residues in a candidate sequence that are identical with amino acid residues in a sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 after aligning the sequences and inserting separations, if necessary, to obtain the maximum percent sequence identity, and without considering any conservative substitution as part of the identity of the sequence. Alignment for purposes of determining percent amino acid sequence identity can be obtained in various ways that are within the skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN software. , ALIGN-2 or Megalign (DNASTAR). Those skilled in the art can determine the appropriate parameters for measuring the alignment, including any algorithm necessary to obtain the maximum alignment over the full length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values are obtained as described in the following by using the ALIGN-2 sequence comparison computer program, wherein the complete source code for the program ALIGN-2 is provided in Table 1. The ALIGN-2 sequence comparison computer program is authorial property of Genentech, Inc., and the source code shown in Table 1 has been presented with user documentation in the office of Copyright of the United States, Washington, DC 20559, where it is registered under the United States Copyright Registry No. TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco California or can be compiled from the source code provided in Table 1. The ALIGN-2 program can be compiled for use in a UNIX operating system, preferably a UNIX V4 computer. Digital DO All sequence comparison parameters are set by the ALIGN-2 program and do not vary. For purposes herein, the% identity in the amino acid sequence of a given amino acid sequence A with a given amino acid sequence B (which alternatively can be phrased as a given amino acid sequence A having or comprising a certain% amino acid sequence identity with a given amino acid sequence B) is calculated as follows: 100 multiplied by the fraction X / Y where X is the number of amino acid residues qualified as identical matches by the sequence alignment program ALIGN-2 in that program-alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that when the length of amino acid sequence A is not equal to the amino acid length of sequence B, the% amino acid sequence identity of A relative to B will not be equal to the% amino acid sequence identity of B. B with respect to A. As examples of% identity calculations In the sequence of amino acid identity sequence, tables 2A-2B show how to calculate the% amino acid sequence identity of the amino acid sequence called "Comparison protein" with respect to the amino acid sequence called "PRO" . Unless specifically stated otherwise, all amino acid sequence identity% values used herein are obtained as described above using the ALIGN-2 sequence comparison computer program. However,% amino acid sequence identity can also be determined using the NCBI-BLAST2 sequence comparison program (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http: www.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search parameters, where all of these search parameters are set to implicit values that include, for example, unmasking = yes, string = all, expected occurrences = 10, minimum low complexity length = 15 / 5, multiple step e value = 0.01, constant for multiple step = 25, fall for alignment with final separation = 25 and rating matrix = BLOSUM62. In situations where NCBI-BLAST2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A relative to a given amino acid sequence B (which can be written alternately as a sequence A of amino acids given that it has or that comprises a certain% amino acid sequence identity with respect to a given amino acid sequence B) is calculated as follows: 100 multiplied by the fractions X / Y where X is the number of amino acid residues qualified as identical matches by the NCBI-BLAST2 sequence alignment program in the alignment of that program of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that when the length of sequence A of 'amino acids is not equal to the length of amino acid sequence B, the% amino acid sequence identity of A relative to B will not be equal to the% amino acid sequence identity of B In addition,% amino acid sequence identity can also be determined using the computer program WU-BLAST-2 (Altschul et al., Methods in Enzymoloqy, 226: 460-480 (1996)). Most of the WU-BLAST-2 search parameters are set as implicit values. Those not established as implicit values, that is, the adjustable parameters, are established with the following values: overlap range = 1, fraction of or".. *. r 3 &r & r. &ile &JllL. vk k ** .. .. r. £. . r J. Jrkt? I.% I r¿r, ¿t £ "" - * ~ ** - * * «- * * - 'superposition = 0.125, word threshold (T) = 11, and rating matrix = BLOSUM62. For purposes herein, a% amino acid sequence identity value is determined by dividing (a) the number of identical matches of amino acid residues among the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide. and the comparison amino acid sequence of interest (ie, the sequence against which the PRO polypeptide of interest which may be a variant PRO polypeptide is compared), determined by WU-BLAST-2 between (b) the total number of amino acid residues of the PRO polypeptide of interest. For example, in the sentence "a polypeptide comprising an amino acid sequence A which has at least 80% amino acid sequence identity with the amino acid sequence B", the amino acid sequence A is the amino acid sequence of comparison of interest and amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest. The terms "PRO201 polypeptide-variant", "PR0292 polypeptide variant", "PR0327 polypeptide variant", "variant polypeptide PR01265", "PR0344 polypeptide variant", "PR0343 polypeptide variant", "PR0347 polypeptide variant "," variant PR0357 polypeptide "," PR0715 variant polypeptide "," PRO1017 variant polypeptide "," variant PR01112 polypeptide ", ?? ^ t ¿..t r *? .J '? ..

"PRO509 variant polypeptide", "853" and "PR0882 variant polypeptide" or "variant nucleic acid sequence of PRO201", "variant nucleic acid sequence of PR0292", "variant nucleic acid sequence of PR0327", "sequence of variant nucleic acid of PR01265"," variant nucleic acid sequence of PR0344"," variant nucleic acid sequence of PR0343"," variant nucleic acid sequence of PR0347"," variant nucleic acid sequence of PR0357"," sequence of variant nucleic acid sequence of PR0347" of variant nucleic acid of PR0715"," variant nucleic acid sequence of PRO1017"" variant nucleic acid sequence of PR01112"," variant nucleic acid sequence of PRO509"," variant nucleic acid sequence of PR0853"and" sequence of PR0882 variant nucleic acid "means a nucleic acid molecule encoding a PRO201 polypeptide active, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882, as is defined in the following and which has at least about 80% nucleic acid sequence identity with a nucleotide acid sequence encoding a full-length native sequence of the PRO201 polypeptide sequence, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 as described herein, a native sequence full length sequence PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347 , PR0357, i-A - ..i. ^ J jaaifcla, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 lacking the signal peptide as disclosed herein, an extracellular domain of a polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 , PRO1017, PR01112, PRO509, PR0853 and PR0882 with or without the signal peptide, as disclosed herein or any other fragment of a sequence PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 , PRO1017, PR01112, PRO509, PR0853 and PR0882 full length, as described herein. Typically, a variant polynucleotide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 will have at least about 80% sequence identity nucleic acid so more preferable at least about 81% nucleic acid sequence identity, more preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity, more preferably at least about 84% identity of nucleic acid sequence, more preferably at least about 85% nucleic acid sequence identity, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% Acid sequence identity% nucleic acid, more preferably at least about 88% nucleic acid sequence identity, more preferably at least about 89% nucleic acid sequence identity, more preferably at least about 90% identity of nucleic acid sequence, more preferably at least about 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably at least about 98% nucleic acid sequence identity, and more preferably at least about 99% nucleic acid sequence identity, with the nucleic acid sequence encoding a full-length native sequence of the PRO201 polypeptide sequence, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882, as described in present, a full-length native sequence of the PRO201 polypeptide sequence, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 lacking the signal peptide, as described herein, an extracellular domain of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882, with or without the signal sequence, or is described herein, or any other PR201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853, PR0853, and PR0882 full-length PR0342 polypeptide sequences as described in the present. The variants do not cover the native nucleotide sequence. Typically, the variant polynucleotides of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 are at least about 30 nucleotides in length, often at least about 60 nucleotides in length, more often at least about 90 nucleotides in length, more often at least about 120 nucleotides in length, more often at least about 150 nucleotides in length, so most frequent of at least about 180 nucleotides in length, more frequently at least »*« - * - * about 210 nucleotides in length, more often at least about 240 nucleotides in length, more often at least about 270 nucleotides in length, most often at least about 300 nucleotides in length, more often at least about 450 nucleotides in length, more often at least about 600 nucleotides in length, and more frequently at least about 900 nucleotides in length or greater. The term percent (%) of nucleic acid sequence identity "with respect to the nucleic acid sequences encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112 , PRO509, PR0853 and PR0882 identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical to the nucleotides in a nucleic acid sequence encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882, after aligning the sequences and introducing separations, if necessary, to obtain the maximum percent of sequence identity . Alignment for purposes of determining percent nucleic acid sequence identity can be obtained in various ways that are within the skill in the art, for example using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign software (DNASTAR). Those skilled in the art can determine the appropriate parameters for measuring the alignment, including any algorithm necessary to obtain the maximum alignment over full length of the sequences being compared. However, for purposes herein, values of% nucleic acid sequence identity are obtained as described in the following by use of the sequence comparison computer program ALIGN-2, where the complete source code for the ALIGN-2 program is provided in table 1. The ALIGN-2 sequence comparison computer program is authorial property of Genentech, Inc., and the source code shown in Table 1 is has presented with user documentation before the Copyright Office of the United States, Washington, D.C. 20559, where it is registered under the United States Copyright Registry No. TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California or can be compiled from the source code provided in Table 1. The ALIGN-2 program can be compiled for use in a UNIX operating system, preferably a UNIX V4 computer. Digital DO All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

Jffi "TlW | M | 'Wt? Rr' *, M? I .t, ta .. J ...

For purposes herein, the% identity in the nucleic acid sequence of a given C sequence of C nucleic acid relative to a given nucleic acid sequence D (which alternatively can be phrased as a given C nucleic acid sequence). it has or that comprises a certain% nucleic acid sequence identity with respect to a given nucleic acid sequence D) is calculated as follows: 100 multiplied by the fraction W / Z where W is the number of nucleotides qualified as identical matches by the sequence alignment program ALIGN-2 in that program alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that when the length of nucleic acid sequence C is not equal to the length D of nucleic acid,% nucleic acid sequence identity of C to D will not be equal to% nucleic acid sequence identity of D to C As examples of% nucleic acid identity sequence identity calculations, tables 2C-2D show how to calculate the nucleic acid sequence identity% of the nucleic acid sequence called "comparison DNA" with respect to the sequence of nucleic acid called "PRO-DNA". Unless specifically stated otherwise, all values of% sequence identity of Nucleic acid used herein are obtained as described above using the sequence comparison computer program ALIGN-2. However,% nucleic acid sequence identity can also be determined using the NCBI-BLAST2 sequence comparison program (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://www.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search parameters, where all of these search parameters are set as implicit values and include, for example, unmasking = yes, string = all, expected presentations = 10, minimum complexity length = 15 / 5, multiple step value e = 0.01, constant for multiple step = 25, elimination for final separation alignment = 25 and rating matrix = BLOSUM62. In situations where NCBI-BLAST2 is used for nucleic acid sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C, relative to a given nucleic acid sequence D (which can be alternatively, as a C sequence of given amino acids having or comprising a certain% amino acid sequence identity with or against a given nucleic acid sequence D) is calculated as follows: 100 multiplied by the W / Z fractions where W is the number of nucleotides qualified as identical matches by the NCBI-BLAST2 sequence alignment program in the alignment of that program of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that when the length of the nucleic acid sequence C is not equal to the length of the nucleic acid sequence D, the% nucleic acid sequence identity of C with respect to D will not be equal to the% nucleic acid sequence identity of D with respect to C. In addition, the% of nucleic acid sequence identity values can also be generated using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzimolocrv, 226: 460-480 (1996)). Most of the WU-BLAST-2 search parameters are set as implicit values. Those that are not established as implicit values, that is, the adjustable parameters, are adjusted with the following values: overlap range = 1, overlap fraction = 0.125, word threshold (T) = 11, and rating matrix = BLOSUM62 . For purposes herein, a% nucleic acid sequence identity value is determined by ding (a) the number of identical nucleotide matches between the nucleic acid sequence of the nucleic acid molecule encoding the PRO polypeptide of interest having a sequence derived from the native nucleic acid sequence encoding the PRO polypeptide and comparing the nucleic acid molecule of interest (i.e., the sequence against which the nucleic acid molecule of interest encoding is compared) for the PRO polypeptide, which may be a PRO variant polynucleotide), determined by WU-BLAST-2, between (b) the total number of nucleotides of the nucleic acid molecule of interest encoding the PRO polypeptide. For example, in the statement "an isolated nucleic acid molecule comprising a nucleic acid sequence A which has or has had at least 80% nucleic acid sequence identity with the nucleic acid sequence B", the sequence A nucleic acid is the comparative nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the nucleic acid molecule encoding the PRO polypeptide of interest. In other embodiments, the variant polynucleotides of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 are nucleic acid molecules encoding a PRO201, PR0292, PR0327 polypeptide. , PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 active and which are able to hybridize, preferably under conditions of astringent and washed hybridization, with nucleotide sequences encoding the polypeptide full length PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), FIGURE 6 (SEQ ID NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), Fig. 12 (SEQ ID NO: 23), Fig. 14 (SEQ ID NO: 28), Fig. 16 (SEQ ID NO: 33), Fig. 18 (SEQ ID. NO: 40), figure 20 (SEC. FROM IDENT. NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48), FIGURE 28 (SEC. IDENT. NO: 53), respectively. The variant polypeptides of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be those that are encoded by a variant polynucleotide for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The term "positives" in the context of amino acid sequence identity comparisons performed as described above, includes amino acid residues in the compared sequences that are not only identical, but also have similar properties. The amino acid residues that qualify with a positive value for an amino acid residue of interest are those that are identical to the amino acid residue of interest or that are a preferred substitution (as defined in Table 3 below) of the amino acid residue of interest. For purposes in this, the% value of positives of a sequence A of amino acids given with respect to a given sequence B of amino acids ((which alternatively can be written as a sequence A of amino acids given that it has or that it comprises certain% of positives with respect to a sequence B of given amino acids) is calculated as follows: 100 multiplied by the fraction X / Y where X is the number of amino acid residues that qualify for a positive value as defined above by the sequence alignment program ALIGN-2 in the program alignment of A and B, and where Y is the total number of amino acid residues in B It will be appreciated that when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the% positive of A relative to B is not equal to the% positive of B relative to A. The term " "isolated" when used to describe the various polypeptides described herein, means a polypeptide that has been identified and separated or recovered from a component of its natural environment. Preferably, the isolated polypeptide is free of association with all the components with which it is naturally associated. The contaminating components of their natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide and may include enzymes, hormones and other proteinaceous or non-proteinaceous solutes. In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of the internal N-terminal amino acid sequence by use of a rotary cup sequencer, or (2) to homogeneity by SDS- PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver staining. The isolated polypeptide includes in itself polypeptide within recombinant cells, since at least one component of the natural environment of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 will not be present. Usually, however, the isolated polypeptide will be prepared by at least one purification step. An "isolated" nucleic acid molecule encoding PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or an "isolated" nucleic acid encoding a antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882, is a nucleic acid molecule that it is identified and separated from at least one contaminating nucleic acid molecule with which it is usually associated in the natural source of the nucleic acid encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017 , PR01112, PRO509, PR0853 or PR0882 or the acid coding for the antibody against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882. Preferably, the isolated nucleic acid is free of association with all the components with which it is naturally associated. An isolated nucleic acid molecule encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or an isolated nucleic acid molecule encoding antibodies against PRO201 , against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against "PR01112, against PRO509, against PR0853 or against PR0882 it is different in form or in its presentation as The isolated molecules of nucleic acid therefore differ from the nucleic acid molecule encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or the molecule of nucleic acid encoding antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 insofar as it exists in natural cells. However, an isolated nucleic acid molecule encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or for antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 includes nucleic acid molecules for PRO201, PR0292, PR0327, PR01265, PR0344 , PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and nucleic acid molecules for antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 contained in cells that usually express the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1 017, PR01112, PRO509, PR0853 or PR0882 or that express antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against mimi,.,,. , Í.r -. «.?.,. M ^ .. & , Í £.-R. ,,,. .-. .. ... .. -. . .. ^ ..._._ a ^ .- ^ - ^^ -... »... ... tj .._- - ..,.".,. .. ^. ^ fc. »J PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882, where, for example, the nucleic acid molecule is in a chromosomal position different from that of natural cells. The term "control sequences" refers to 7DNA sequences necessary for the expression of a coding sequence operably linked in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence and a ribosome binding site. It is known that eukaryotic cells use promoters, polyadenylation signals and enhancers. The nucleic acid is "operably linked" when placed in a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it alters the transcription of the sequence; A ribosome binding site is operably linked to a coding sequence if it is placed in a manner that facilitates translation. Generally, the term "operably linked" means that the DNA sequences that are linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, breeders do not need be contiguous Binding is carried out by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide or binder adapters are used according to conventional practice. The term "antibody" is used in the broadest sense and specifically covers, for example, monoclonal antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017 , against PR01112, against PRO509, against PR0853 or against PR0882 (which includes antagonistic and neutralizing antibodies), antibody compositions against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 with polyepitopic specificity, single chain antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 and fragments of antibodies against PRO201, against PR0292, against PR0327, against PR01 265, against PR0344, against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 (see below). The term "monoclonal antibody" as used herein, refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible mutations arising from natural way that may be present in smaller quantities. The "astringency" of the hybridization reactions can easily be determined by a person ordinarily skilled in the art, and is generally an empirical calculation that depends on the length of the probe, the wash temperature and the salt concentration. In general, longer probes require longer temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of the denatured DNA to anneal when complementary strands are present in an environment below the melting temperature. The greater the desired degree of homology between the probe and the hybridizable sequence, the higher the relative temperature which can be used. As a result, it is suggested that at higher relative temperatures the more stringent reaction conditions tend to be, while the lower temperatures tend to be less astringent. For additional details and an explanation of the astringency of the hybridization reactions, see Ausubel et al. , Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

The "astringent conditions" or "high stringency conditions" as defined herein, can be identified by those that: (1) use a low ionic strength and a high temperature for washing, for example 0.015 M sodium chloride / sodium citrate 0.0015 M / 0.1% sodium dodecyl sulfate at 50 ° C; (2) used during hybridization a denaturing agent, such as formamide, for example 50% formamide (v / v), with 0.1% bovine serum albumin / 0.1% ficol / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42 ° C; or (3) using 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, Denhardt's solution 5 x, Sperm DNA from sonicated salmon (50 μg / ml), SDS 0.1%, and dextran sulfate 10% at 42 ° C with washes at 42 ° C in 0.2 x SSC (sodium chloride / sodium citrate) and 50% formamide at 55 ° C , followed by a high stringency wash consisting of 0.1 x SSC containing EDTA at 55 ° C. The "moderately astringent conditions" can be identified as described by Sambrook et al. , Molecular Cloninq: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989 and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and% SDS) less astringent to those described above. An example of moderately astringent conditions is i »* Í. ? r? i., i. i.,. incubation overnight at 37 ° C in a solution comprising: formamide 20%, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, dextran 10% and 20 mg / ml of cut and denatured salmon sperm DNA, followed by washing the filters in 1 x SSC at about 35 ° C-50 ° C. Those skilled in the art will recognize how to adjust the temperature, ionic strength, etc., as necessary, to adapt factors such as the length of the probe and the like. The term "labeled epitope", when used herein, refers to a chimeric polypeptide comprising a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853. or PR0882 fused to a "polypeptide tag". The tag polypeptide has sufficient residues to provide an epitope against which an antibody can be made, although it is short enough so that it does not interfere with the activity of the polypeptide to which it is fused. The tag polypeptide is preferably also unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 amino acid residues (preferably between about 10 and 20 amino acid residues). The terms "active" or "activity" for purposes herein refers to the form or forms of polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 which retain the activity / biological or immunological property of a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0727, PR0715, PRO1017, PR01112, PRO509, PR0853, PR0853 or PR0882 polypeptide, native or naturally occurring, wherein the "biological" activity refers to a function (either inhibitory or stimulatory) caused by the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 native or occurring naturally in addition to the ability to induce the production of an antibody against an antigenic epitope possessed by a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509 , PR08 -53 or PR0882 native or occurring naturally and an "immunological" activity refers to the ability to induce the production of an antibody against an antigenic epitope possessed by a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 native or that occurs naturally.. t "¿.J.i. The term "biological activity" in the context of an antibody or other agonist molecule that can be identified by the test assays described herein (for example, a small organic or inorganic molecule, peptide, etc.), is used to refer to the ability of such molecules to bind or complex with the polypeptides encoded by the amplified genes identified herein, or to interfere in some other way with the interaction of the encoded polypeptides with other cellular proteins or to interfere in some other way with the transcription or translation of a polypeptide PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. A preferred biological activity is the inhibition of growth of a target tumor cell. Another preferred biological activity is the cytotoxic activity that results in the death of a target tumor cell. The term "biological activity" in the context of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROH12, PRO509, PR0853 or PR0882 means the ability of PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 to induce the growth of neoplastic cells or uncontrolled cell growth. í. ..., &¿... ¡¡¡¡¡¡¡¡¡¡¡¡¡¡The phrase "immunological activity" means immunological cross-reactivity with at least one epitope of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The term "immunological cross-reactivity", as used herein, means that the candidate polypeptide is capable of competitively inhibiting the qualitative biological activity of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 having this activity with polyclonal antisera generated against the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0343, PR0347, PR0357, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 polypeptide known active active. Such antisera are prepared in conventional manner by injecting goats or rabbits, for example subcutaneously with the known active analogue in complete Freund's adjuvant, followed by reinforcement with intraperitoneal or subcutaneous injection in incomplete Freund's adjuvant. Immunological cross-reactivity is preferably "specific", which means that the binding affinity of the immunologically reactive cross-reactive molecule (for example the antibody) is identified, with the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347 , PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 corresponding which is significantly higher (preferably at least about 2 times, preferably at least about 4 times, even more preferably at least about 8 times) times, and much more preferably at least about 10 times greater) than the binding affinity of that molecule with any other known native polypeptide. The term "antagonist" is used in the broadest sense and includes any molecule that blocks, inhibits or neutralizes, partially or completely, a biological activity of a polypeptide PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 native described herein or the transcription or translation thereof. Suitable antagonist molecules specifically include antagonist antibodies or antibody fragments, fragments, peptides, small organic molecules, antisense nucleic acids, etc. Methods for identifying antagonists of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are included with a candidate antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882.

A "small molecule" is defined herein as having a molecular weight of less than about 500 Dalton units. The terms "antibodies" (Ab) and "immunoglobulins" (Ig) are glycoproteins that have the same structural characteristics. Although antibodies show binding specificity for a specific antigen, immunoglobulins include both antibodies and antibody-like molecules which lack antigen specificity. Polypeptides of this latter class are produced, for example, at low concentrations by the lymphatic system and at high concentrations by myelomas. The term "antibody" is used in its broadest sense and specifically covers, without limitation, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies (eg bispecific antibodies) formed from at least two intact antibodies, and antibody fragments too large in size. so that they show the desired biological activity. The "native antibodies" and "native immunoglobulins" are usually on heterotetrameric glycoproteins of approximately 150,000 Dalton units consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to a heavy chain by a covalent disulfide bond, although the number of disulfide bonds varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has intrachain chain disulfide bridges regularly separated. Each heavy chain has one end of a variable domain (VH) followed by a certain number of constant domains. Each light chain has a variable domain at one end (Vz) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the variable domain of the light chain is aligned with the variable domain of the heavy chain. The particular amino acid residues are considered to form an interase between the variable donminios of the light and heavy chains. The term "variable" refers to the fact that certain portions of the variable domains differ widely in sequence among the antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed across the variable domains of the antibodies. It is concentrated in three segments called complementarity determining regions (CDR) or hypervariable regions, both in the light chain and variable heavy chain domains. The most highly conserved portions of the variable domains are called the infrastructure regions (FR). The variable domains of the heavy and light native chains each comprise four FR regions, which mainly adopt a configuration, of ß-sheet connected by three CDRs, which form curls that are connected, and in some cases form part of the sheet structure H.H. The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs, form the other chain, and contribute to the formation of the antigen-binding site on the antibodies (see Kabat et al., NIH Publ. No. 91-3242, Vol. I, pages 647-669 (1991)). The constant domains are not directly involved in the binding of antibody to an antigen, but show several effector functions, such as the participation of antibody or antibody-dependent cellular toxicity. The term "hypervariable region" when used herein, refers to amino acid residues of an antibody which are responsible for the binding of the antigen. The hypervariable region comprises amino acid residues from the "complementarity determining region" or "CDR" (ie, residues 24-34 (-L1), 50-56 (L2), and 89-97 (L3) in the variable domain of the light chain and 31-35 (Hl), 50-65 (H2) and 95-102 (H3) in the variable domain of heavy chain; Kabat et al. , Seauences of Proteins of Immunological Interest, fifth edition Public Health Service, National Institute of Health, Bethesda, MD. [1991]) or those residues of a "hypervariable curl" (ie residues 26-32 (Ll), 50-52 (L2) and 91-96 (L3) in the variable domain of the light chain and 26-32 (Hl), 53-55 (H2) and 96-101 (H3) in the variable domain of the heavy chain, Clothia and Lesk, J. Mol. Biol., 196: 901-917 [1987]). The "infrastructure" or "FR" residuals are those variable domain residues different from the residues of the hypervariable region as defined herein. The term "antibody fragments" comprises a portion of an intact antibody, preferably the region that binds antigen or variable region of the intact antibody. Examples of the antibody fragment include the Fab, Fab ', F (ab') 2 and Fv fragments; diabodies; (diabodies); linear antibodies (Zapata et al., Protein Eng., 8 (10): 1057-1062 [1995]); single chain antibody molecules; and multispecific antibodies formed from antibody fragments. The papain digestion of the antibodies produces two identical antigen-binding fragments called "Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, a designation that reflects the ability to easily crystallize. The pepsin treatment provides an "F (ab ') 2 fragment that has two sites that combine antigen and that is still able to cross-link with the antigen.The" Fv "is the minimum antibody fragment which contains a complete site of recognition and union í .i ¿2J? ¿t. *. J »». a-kt.¿ antigen. This region consists of a dimer of a variable domain of the heavy chain and one of the lightly in a close, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define the antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer specificity for antigen binding to the antibody. However, even a single variable domain (half of a Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, albeit with a lower affinity than the entire binding site. The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. The Fab 'fragments differ from the Fab' fragments by the addition of some residues in the carboxy-terminal portion of the CH1 domain of the heavy chain, which include one or more cysteines from the hinge region of the antibody. Fab'-SH is the designation herein for Fab 'in which the cysteine residue or residues of the constant domains is a free thiol group. The F (ab ') 2 antibody fragments are originally produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

-. "I Á rí .. *. Uilí _. , .á "," • - • * - * • * The "light chains" of the antibodies (immunoglobulins) of any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda (? ), based on the amino acid sequences of their constant domains, depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned in different classes There are five main classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM and each of these can be further divided into subclasses (isotypes), for example IgGl, IgG2, IgG3, IgG4, IgA and IgA2 The constant domains of the heavy chain corresponding to the different classes of immunoglobulins are referred to as , d, e,? and μ, respectively Subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.The term "monoclonal antibody", as used in the present, refers to an antibody that is obtained from a population of substantially homogeneous antibodies, ie, the individual antibodies comprising the population are identical except for possible naturally occurring mutations which may be present in minor amounts. Monoclonal antibodies are highly specific, targeting a single antigenic site. In addition, in contrast to conventional preparations of antibodies (polyclonal), which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant in the antigen. In addition to their specificity, monoclonal antibodies are advantageous insofar as they synthesize by the hybridoma culture, without contamination by other immunoglobulins. The "monoclonal" modifier indicates the character of the antibody that is obtained from a substantially homogeneous population of antibodies, and the production of the antibody by some particular method should not be considered to be required. For example, monoclonal antibodies to be used according to the present invention can also be made by the hybridoma method first described by Kohier et al. , Nature, 256: 495 [1975], or can be made by recombinant DNA methods (see, for example, U.S. Patent No. 4,816,567). "Monoclonal antibodies" can also be isolated from phage antibody libraries using the techniques described in Clackson et al. , Nature, 352: 624-628 [1991] and Marks et al. , J. Mol. Biol., 222: 581-597 (1991), for example. The monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy or light chain or both is identical or homologous to corresponding sequences in k ^.?. í.? r .í .fa.At, A, j ¿., _ i. ^ -J ^ «" - '- "-. • - "- •• -" '-' • - • - > - »« »-... - ...; .. - - > ... ...? .. . .... antibodies derived from particular species or belonging to a particular class or subclass of antibody, while the rest of the chains are identical with, or homologous to, corresponding sequences in antibodies derived from other species or belonging to another class or subclass of antibody, as well as fragments of such antibodies, insofar as they show the desired biological activity (U.S. Patent No. 4,816,567; Morrison et al., Proc. Nati. Acad. Sci. USA, 81: 6851-6855 [1984] ). The "humanized" forms of non-human antibodies (eg mouse) are chimeric immunoglobulins, immunoglobulin chains or fragment thereof (such as Fv, Fab, Fab ', F (ab') 2 or other sub-sequences of antigen-binding antibodies (which contain a minimal sequence derived from non-human immunoglobulin.) For the most part, humanized antibodies are human immunoglobulins (receptor antibody) in which the residues of a CDR of the receptor are replaced by residues of a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit, having the specificity, affinity and capacity that is desired. In some cases, the Fv FR residues of human immunoglobulin are replaced by corresponding non-human residues. In addition, humanized antibodies may comprise residues which are not found in the recipient antibody or in the imported CDR or infrastructure sequences. These . Jt. *. ****. ***** - .. "...," .. ^ .. ^., ._., *.,. *. ..... ........-..- ^ J »^ ........" ........, ...... Jfc .... J..M8JJ modifications are made to further refine and maximize the performance of the antibody. In general, the humanized antibody will substantially comprise all of at least one, and typically two variable domains, in which all or substantially all of the CDR regions correspond to those of the non-human immunoglobulin and all or substantially all of the of the FR regions are those of a human immunoglobulin sequence. The humanized antibody optimally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For additional details, see Jones et al. , Nature, 321: 522-525 (1986); Reichmann et al. , Nature, 33.2: 323-329 [1988]; and Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992). The humanized antibody includes PRIMATIZED antibody, wherein the antigen binding region of the antibody is derived from an antibody produced by immunizing macaque monkeys with the antigen of interest.The "single chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which allows the sFv to form the desired structure of the binding of the antigen For a review of the sFv, see, Pluckthun in The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). The term "diabodies" refers to fragments of small antibodies with two antigen binding sites, fragments which comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH - VL). By using a linker that is too short to allow pairing between the two domains and the same chain, the domains are forced to pair with the complementary domains with other chains and create two sites that bind antigen. The diabodies are described more fully, for example, in EP 404,097; WO 93/11161; and Hollinger et al. , Proc. Nati Acad. Sci. USA, 90: 6444-6448 (1993). An "isolated" antibody is one which has been identified and separated or recovered from a component of its natural environment. The contaminating components of their natural environment are materials which could interfere with the diagnostic or therapeutic uses for the antibody and may include enzymes, hormones and other proteinaceous or non-proteinaceous solutes. In preferred embodiments, the antibody will be purified (1) by more than 95% by weight of the antibody, determined by the Lowry method, and more preferably ^ t ^? .? i i. "i. > ^ j? t. ^. . . . .._ .. "...." «« ^ n ».» ... ^ j ^, .. 'faith * »Jt t-Í» J by more than 99% by weight, (2) by a sufficient to obtain at least 15 residues of the N-terminal or internal sequence of the amino acids by using a rotary cup sequencer, or (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using blue Coomassie or, preferably, silver staining. The isolated antibody includes the antibody in itself within recombinant cells since at least one component of the antibody's natural environment will not be present. Without However, usually, the isolated antibody will be prepared by at least one purification step. The word "tag", when used herein, refers to a detectable compound or composition which is conjugated directly or indirectly to the way that generates a "marked" antibody. The label can be detectable in itself (eg radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, it can catalyze a chemical alteration of a compound substrate or composition which is detectable. - The radionuclides that can serve as detectable labels include, for example, 1-131, 1-123, 1-125, Y-90, Re-188, Re-186, At-211, Cu-67, Bi- 212 and Pd-109. . The brand can also be a non-detectable entity, such as a toxin. By the term "solid phase" you want means a non-aqueous matrix to which the antibody of the present invention. Examples of solid phases encompassed herein include those formed partially or completely of glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol, and silicones. In certain embodiments, depending on the context, the solid phase may comprise the well of a test plate; in others it is a purification column (for example an affinity chromatography column). This term also includes a discontinuous solid phase or separate particles, such as those described in U.S. Patent No. 4,275,149. A "liposome" is a small vesicle consisting of various types of lipids, phospholipids or surfactants which are useful for the delivery of a medicament (such as a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 polypeptides. , PRO1017, PR01112, PRO509, PR0853 or PR0882 or an antibody thereto) and, optionally, a chemotherapeutic agent) to a mammal. The components of the liposome are commonly distributed in a bilayer formation, similar to the lipid arrangement of biological membranes. As used herein, the term "immunoadhesins" designates antibody-like molecules which combine the binding specificity of a heterologous protein (an "adhesin") with the effector functions of the constant domains of the immunoglobulin. Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is different from the site of an antibody that recognizes and binds the antigen (ie, is "heterologous"), and a constant domain sequence of immunoglobulin. The adhesin part of an immunoadhesin molecule is typically a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand. The immunoglobulin constant domain sequence in the immunoadhesin can be obtained from any immunoglobulin, such as the IgG-1, IgG-2, IgG-3 or IgA-IgG-4 subtypes (including IgA-1 and IgA- 2), IgE, IgD or IgM.

II. Compositions and Methods of the Invention A. PRO-L1, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 full length PR0882 polypeptides The present invention provides polypeptides encoding newly identified isolated nucleotide sequences referred to in the present application as PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882. In particular, cDNA encoding the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0727, PRO1017, PR01112, PRO509, PR0853 and PR0882 polypeptides have been identified and isolated as described in further detail in the examples next. It is noted that the proteins produced in separate expression rounds can be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed. However, for purp of simplicity, in the present specification the proteins encoded by the nucleic acid sequences described herein, as well as all of the native homologs and additional variants included in the above definition of PRO201, PR0292, PR0327, PR01265, PR0344 , PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 will be referred to as "PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882"regardless of its origin or mode of preparation. As described in the following examples, cDNA clones have been deposited with ATCC. The actual nucleotide sequence of the clones can be easily determined by a person skilled in the art by sequencing the deposited clone using routine or routine methods in the art. The predicted amino acid sequences can be determined from the nucleotide sequences using standard skill. For the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and the coding nucleic acid described here, the applicants have identified 5 what are considered to be frames of better identifiable reading with the sequence information available so far.

B. Variants of PRO201, PR0292, PR0327, PR01265, 10 PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 In addition to the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 of full length native sequence described here, it is contemplated that variants of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 can be prepared and PR0882. The variants of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 can be prepared by introducing appropriate nucleotide changes within PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 , PRO1017, PR01112, PRO509, PR0853 and PR0882 or by synthesis of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 desired. Those skilled in the art will appreciate that amino acid changes can alter the post-translational process of PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 such as a change in the number or position of the glycosylation sites or by altering the characteristics of membrane anchoring. Variations in the native full length sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or in the various domains of PR0201, PR0292, PR0327, PR01265 , PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 described herein, can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations, for example those described in U.S. Patent Number 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons coding for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 resulting in a change in the amino acid sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 compared to the native sequence PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Optionally, the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 the guide to determine which amino acid residue can be inserted, replaced or deleted without adversely affecting the desired activity, can be found by comparing the sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 , PRO1017, PR01112, PRO509, PR0853 and PR0882 with that of known homologous protein molecules and by minimizing the number of amino acid sequence changes made in regions of high homology. The amino acid substitutions can be the result of the replacement of an amino acid with another amino acid having similar structural or chemical properties, such as the substitution of a leucine with a serine, ie, conservative amino acid substitutions. Optionally, the insertions or deletions may be in the range of about 1 to 5 amino acids. The allowed variation can be determined by systematically performing insertions, deletions or substitutions of amino acids in the sequence and by testing the resulting variants to determine the activity shown by the full-length or mature native sequence. ,,, i ^ ^ j ^. . ^. r r ^ ... The present fragments of the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 polypeptides are provided herein. and PR0882, such fragments may be truncated in the N-terminal or C-terminal part, or may lack internal residues, for example, when compared to a full-length native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The fragments of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, - PRO509, PR0853 or PR0882 can be prepared by any of many conventional techniques. The desired peptide fragments can be chemically synthesized. An alternative solution involves generating fragments of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 PR0882 by digestion enzymatic, for example by treating the protein with an enzyme known to separate the proteins at sites defined by particular amino acid residues or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment. Another suitable additional technique involves isolating and amplifying a fragment of DNA that codes for a fragment , A ^^ 3, ^ .- to. < . ^ ^. ^^. ^ E ^ .......... tf -t- * - nrt'f- J u t-á polypeptide desired by polymerase chain reaction (PCR). Oligonucleotides defining the desired terms of the DNA fragment are used in the 5 'and 3' primers in PCR. Preferably, the fragments of the PRO201, PR0292, PR0327, PR0327, PR0344, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 polypeptides share at least one biological or immunological activity with the native PRO201 polypeptide, PR0292 , PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. In particular embodiments, conservative substitutions of interest under the heading of preferred substitutions are shown in Table 3. If such substitutions result in a change in biological activity, then more substantial changes called exemplary substitutions are introduced in Table 3, or as further described below, with reference to amino acid classes, and the products are examined.

Table 3 Residual Substitutions Substitutions Original Preferred copies Wing (A) val; leu; ile val Arg (R) lys; gln; asn lys Asn (N) gln; his; lys; arg gln Asp < (D) glu glu Cys (Or be being Gly i G) pro; wing wing His i (H) asn; gln; lys; arg arg He 1: D leu; val; met; to; phe; norleucina leu Leu L) norleucine; ile; val met; to; phe ile Lys 1:?) Arg; gln; asn arg Met (: M) leu; phe; ile leu Phe (: F) leu; val; ile; to; tyr leu Pro (: P) wing wing Ser (: s) thr thr Thr (: t) be Trp (: w) tyr; phe tyr -a? t ^^^ S ^ A n H¿ ^ t ?.

Tyr (Y) trp; phe; thr; to be phe Val (V) ile; leu; met; phe; to; norleucina leu Substantial modifications in the function or immunological identity of the polypeptide are carried out by selecting substitutions that differ significantly in their effect by maintaining: (a) the main structure of the polypeptide in the area of the substitution, for example as a conformation sheet or helical, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the volume of the side chain. The residues that occur naturally are divided into groups in bases in the common properties of the side chain: (1) hydrophobic: norleucine, methyl ala, val, leu, ile. (2) neutral hydrophilic: cys, ser; thr; (3) acid: asp, glu; (4) basic: asn, gln, his, lys, arg; (5) residues that influence the orientation of the chain; gly, pro; and (6) aromatic: trp, tyr, phe.

Non-conservative substitutions will involve exchanging a member of one of these classes for another class. Such substituted residues can also be introduced at the conservative substitution sites or, more preferably, at the remaining (non-conserved) sites. Variations can be made using methods known in the art such as oligonucleotide-mediated mutagenesis (site-directed), alanine scanning and PCR mutagenesis. Site-directed mutagenesis [Cárter et al. , Nucí. Acids Res., 13 .: 4331 (1986); Zoller et al. , Nucí. Acids Res. , 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restriction selection mutagenesis [Wells et al., Philos Trans. R. Soc. London SerA, 317: 415 (1986)] or other known techniques, can be carried out on the cloned DNA to produce the variant DNA for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Scanning amino acid analysis can also be used to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are the relatively small neutral amino acids. Such amino acids include alanine, glycine, serine and cysteine. Alanine is typically referred to as the preferred scanning amino acid among this group because it removes the side chain that surpasses the beta carbon and is less likely to alter the main chain conformation of the variant [Cunningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine is also preferred f ^ a. »a¿.at. ^. *,! &. TJüdb. typically because it is the most common amino acid. In addition, he is often found in buried and exposed positions [Creighton, The Proteins, (W. H. Freeman &Co., N.Y.); Chothia, J. Mol. Biol., 150: 1 (1976)]. If the alanine substitution does not provide adequate amounts of variant, an isoteric amino acid may be used.

C. Modification of PRO201. PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715. PRO1017, PRQ1112, PRO509, PR0853 and PR0882 Included within the scope of this invention are the covalent modifications of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882. One type of covalent modification includes reacting the amino acid residues target polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 with an organic derivatizing agent that is capable of reacting with selected side chains or the N or C terminal of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Derivatization with bifunctional agents is useful, for example, for crosslinking PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, J t. ^ L.

PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 an insoluble support matrix or surface water for use in the method for purifying antibodies PRO201- against PR0292, PR0327 against against PR01265, PR0344 against against PR0343, against PR0347, against PR0375, against PR0715, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 and vice versa. Crosslinking agents commonly used include, for example, 1, 1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example esters of 4-azidosalicylic acid, homobifunctional imidoesters including disuccinimidyl esters such as 3, 3'-dithiobis (succinimidylpropionate), functional maleimides such as bis-N-maleimido-1,8-octane and agents' such as methyl-3- [(p-azidophenyl) dithio] propioimidate. Other modifications include the deamination of the glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, the hydroxylation of proline and lysine, the phosphorylation of the hydroxyl groups of the seryl or threonyl residues, the methylation of the alpha-amino groups of the side chains of lysine, arginine and histidine [TE Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co. , San Francisco, pp. 79-86 (1983)], the acetylation of the N-terminal amine and the amidation of any C-terminal carboxyl group.

Another type of covalent modification of the polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 included within the scope of this invention comprises altering the glycosylation pattern native polypeptide . The term "altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017 , PR01112, PRO509, PR0853 or PR0882 (either by removing the underlying glycosylation site or by suppressing glycosylation by chemical and / or enzymatic means), or by adding one or more glycosylation sites that are not present in the native sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. In addition, the phrase includes qualitative changes in the glycosylation of native proteins, which involves a change in the nature and proportions of the various carbohydrate moieties present. The addition of glycosylation sites to the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be carried out by altering the amino acid sequence. The alteration can be performed, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112 , PRO509, PR0853 or PR0882 (for 0-linked glycosylation sites). The 5 amino acid sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 can optionally be altered through changes at the DNA level particularly by DNA mutation encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in preselected bases such as codons that will generally be translated into the desired amino acids. Another means to increase the number of servings L5 of carbohydrate in the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example in WO 87/05330 published on September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem. , pp. 259-306 (1981). The removal of the carbohydrate moieties present in the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 can be carried out chemistry or t »,« íWííft l? < íf ^ ss * t > éi-i-i »-i kJ. ^?. ^,.! ^. mríSL. * enzymatically or alternatively, by mutational substitution of codons coding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and are described, for example, by Hakimuddin, et al. , Arch. Biochem. Biophvs., 259: 52 (1987) and by Edge et al., / Anal. Biochem., 118: 131 (1981). The enzymatic separation of carbohydrate moieties into polypeptides can be carried out by the use of various endoglycosidases and exoglycosidases, as described by Thotakura et al., Meth. Enzymol. , 138: 350 (1987). Another type of covalent modification of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 comprises the binding of PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343 , PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 to one of various non-proteinaceous polymers, for example polyethylene glycol (PEG), polypropylene glycol or polyoxyalkylenes, in the manner set forth in US Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337. The PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 of the present invention can also be modified in such a way as to form a chimeric molecule comprising PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 fused to another heterologous polypeptide or other amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 with a tag polypeptide, which provides an epitope at which can selectively bind the antibody against the tag. The tag epitope is generally placed in the amino or carboxyl terminal portion of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The presence of such epitope-tagged forms of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be detected using an antibody against the tag polypeptide. In addition, the provision of the tag epitope allows PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 to be easily purified by affinity purification using an antibody against the label or another type of affinity matrix that binds to the tag epitope. Various label polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his- go. í .ri. áL? ... lrÚ gly); the flu HA tag polypeptide and its 12CA5 antibody [Field et al. , Mol. Cell. Biol., 8: 2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies for them [Evan et al. , Molecular and Cellular Bioloqv, 5: 3610-3616 (1985)]; and the glycoprotein D (gD) label of the herpes simplex virus and its antibody [Paborsky et al. , Protein Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides include the Flag polypeptide [Hopp et al. , Bio Technology, 6: 1204-1210 (1988)]; the KT3 epitope peptide [Martin et al. , Science, 255: 192-194 (1992)]; an a-tubulin epitope peptide [Skinner et al. , J. Biol. Chem., 266: 15163-15166 (1991)]; and the peptide tag of protein 10 of the T7 gene [Lutz-Freyermuth et al. , Proc. Nati Acad. Sci. USA, 87: 6393-6397 (1990)]. In an alternative embodiment, the chimeric molecule may comprise a fusion of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 with an immunoglobulin or a particular region of an immunoglobulin . For a bivalent form of the chimeric molecule (also referred to as an "immunoadhesin"), such a fusion can be to the Fc region of an IgG molecule. Ig fusions preferably include the substitution of a soluble form (deleted or inactivated transmembrane domain) of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in place of at least one variable region within an Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CH1, CH2 and CH3 regions of an IgG1 molecule. For the production of immunoglobulin fusions see also U.S. Patent Number 5,428,130, filed June 27, 1995.

D. Preparation of the PRO201, PR0292 polypeptides, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 The description that follows is mainly related to the production of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 by cultured cells transformed or transfected with an acid-containing vector nucleic acid for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Of course, it is contemplated that alternative methods, which are well known in the art, can be used to prepare PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. . For example, the sequence for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 or portions thereof, can be produced by direct synthesis of peptides using solid phase techniques [see, for example, Stewart et al. , Solid-Phase Peptide Svnthesis, W. H. Freeman Co. , San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc., 85: 2149-2154 (1963)]. Protein synthesis in vi tro can be carried out using manual techniques or by automation. Automated synthesis can be carried out, for example, using Applied Biosystems Peptide Synthesizer (Foster City, CA) using the manufacturer's instructions. Several portions of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be chemically synthesized separately and can be combined using chemical or enzymatic methods to produce PRO201, PR0292 , PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 full length. to. Isolation of DNA encoding a polypeptide PRQ201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 v PR0882 DNA encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 from a cDNA library prepared from tissue that is considered to possess mRNA for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347 , PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and that express it at a detectable level. Accordingly, DNA for human Pro201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0883 can be conveniently obtained from a cDNA library prepared from human tissue , as described in the examples. The gene encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can also be obtained from a genomic library or by oligonucleotide synthesis. Libraries can be analyzed with probes (such as antibodies to PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or oligonucleotides of at least about 20- 80 bases) designed to identify the gene of interest or the protein encoded by it. When analyzing the cDNA or the genomic library with the selected probe it can be carried out using standard procedures, such as described in Sambrook, et al. , Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An alternative means to isolate a gene encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is to use the PCR methodology [Sambrook et al. , supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)] . The examples below describe techniques for analyzing a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous so as to minimize false positive results. The oligonucleotide is preferably labeled so that it can be detected by hybridization to the DNA in the library that is analyzed. Marking methods are well known in the art and include the use of radiolabels such as ATP labeled with 32P, biotination or labeling of enzymes. Hybridization conditions, including moderate astringency and high astringency, are provided in Sambrook et al., Supra. Sequences identified in such library analysis methods can be compared and aligned with other known sequences deposited and available in public databases such as GenBank or other databases of S-t t. mL? ^ Ím? t? .. private sequences. The sequence identity (either at the amino acid or nucleotide level) within defined regions in the molecule or through a full length sequence using methods known in the art and as described herein. The nucleic acid having a protein-coding sequence can be obtained by analyzing selected cDNA or genomic libraries using the deduced amino acid sequence described herein for first-time use LO and, if necessary, using conventional primer extension methods as described above. describe in Sambrook et al., supra, to detect precursors and process mRNA intermediates that have not been subjected to reverse transcription in cDNA. L5 Selection and transformation of host cells The host cells are transfected or transformed with expression or cloning vectors described herein for 0 the production of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and cultured in modified conventional nutrient medium as appropriate to produce promoters, select transformants or amplify the genes coding for the desired sequences. The growing conditions, such ^^ aa. ,, it ^ t kát ^ .. ^. A, such as medium, temperature, pH and the like, can be selected by those skilled in the art without undue experimentation. In general, the principles, protocols and practical techniques for maximizing the productivity of cell cultures 5 can be found in Mammalian Cell Biotechnology: A Practical Approach, M. Butler. ed. (IRL Press, 1991) and Sambrook et al. , supra. The methods of transfection of eukaryotic cells and transformation of prokaryotic cells are known for Those usually skilled in the art, for example CaCl2, CaP04 mediated by liposomes and electroporation. Depending on the host cell used, the transformation is performed using standard techniques appropriate for such cells. Generally a calcium treatment is used that uses calcium chloride, as described in Sambrook et al., Supra, or electroporation, are generally used for prokaryotes. Infection with Agrobacterium tumefaciens is used for the transport of certain plant cells, as described by Shaw et al., Gene; 23: 315 (1983) and WO 89/05859, published June 29, 1989. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb. Virology, 52: 456-457 (1978). The general aspects of the transformations of cell host systems mammal have been described in the United States patent £ ¿rkem, í Number 4,399,216. Transformations in yeast are typically carried out according to the method of Van Solingen et al. , J. Bact. , 130: 946 (1977) and Hsiao et al., Proc. Nati Acad. Sci. (USA), 76: 3829 (1979). However, other methods can also be used to introduce DNA into cells, for example by nuclear microinjection, electroporation, fusion of bacterial protoplasts with intact cells, or polycations, for example, polybrene, polyornithine. For the various techniques to transform mammalian cells see Keown et al., Methods in Enzvmology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (1988). Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryotic, yeast or higher eukaryotic cells. The Suitable prokaryotes include, but are not limited to eubacteria, such as gram-negative or gram-positive organisms, for example, enterobacteriaceae such as E. coli. Several strains of E. coli are publicly available such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli 3W110 (ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, for example E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, for example Salmonella typhymurium, Serra tia, for example Serratia. marcesans and Shigella, as well as Bacilli such as B. subtilis t * ¡M * < T * Éib ??, «, -.-.?e tA ... and B. licheniformis (for example, B. licheniformis 41P described in DD 266,710 published April 12, 1989), Pseudomonas such as P. aeruginosa and Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is a particularly preferred host or host because it is a common host strain for fermentations of recombinant DNA product. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, strain W3110 can be modified to carry out a genetic mutation in genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W3110 strain 1A2, which has the complete tonA genotype; E. coli W3110 strain 9E4, which has the complete genotype tonA ptr3; E. coli strain W3110 strain 27C7 (ATCC 55,244), which has the complete genotype topA ptr3 phoA E15 (argF-lac) 169 degP ompT kanr; E. coli W3110 strain 37D6 which has the complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ompT rbs7 ilvG kanr; E. coli W3110 strain 40B4, which is strain 37D6 with a deletion mutation degP not resistant to kanamycin; and an E. coli strain having a mutant periplasmic protease described in U.S. Patent No. 4,946,783 published August 7, 1990. Alternatively, in vitro cloning methods, e.g., PCR or other reactions, are suitable. of nucleic acid polymerase.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable for cloning or expression of hosts for vectors encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces pombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 193,383 published May 2, 1985); Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer et al., Bio / Technology, 1: 968-975 (1991)) such as, for example, K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al. ., J. Bacteriol., 737 [1983]), K. Fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. Wickeramii (ATCC 24,178); K. wal tii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Vanden Berg et al. , Bio / Technology, 8¡: 135 (1990), K. thermotolerans and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al. , J. Basic Microbiol., 28: 265-278

[1988]); Candida; Trichoderma reesia - (EP 244,234); Neurospora crassa (Case et al., Proc Nati Acad Sci USA, 76: 5259-5263 [1979]); Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538 published October 31, 1990); and filamentous fungi such as, for example, Neurospora, Penicillium, Tolypocadium (WO 91/00357 published January 10, 1991), and Aspergillus hosts such as A. nidulans (Ballance et al., Biochem Biophys., Res. Commun., 112: 284-289 [1983], Tilburn et al., Gene, 2j6: 205-221 [1983], Yelton et al., Proc. Nati, Acad. Sci. USA, 81: 1470-1474 [1984]] and A. niger (Kelly and Hynes, EMBO J., 4: 475-479 [1985]). Methylotropic yeasts are suitable herein and include, but are not limited to yeasts capable of growing in methanol and which are selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis and Rhodotorula. A list of specific species that are exemplary of this class of yeasts can be found in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982). Suitable host cells for the expression of glycosylated PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spdoptera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include the monkey kidney CV1 line transformed with SV40 (COS-7, ATCC CRL 1651); the human embryonic kidney line (293 cells or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen. Virol., 36: 59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Nati. Acad.

Sci. USA, 77: 4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23: 243-251 (1980)); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor (MMT 060562, ATCC CCL51). The selection of the appropriate host cell is considered within the skill in the art. 2. Selection and use of a replicable vector The nucleic acid (for example cDNA or genomic DNA) encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be inserted into a replicable vector for cloning (DNA amplification) or for expression. Various vectors are publicly available. The vector can be, for example, in the form of a plasmid, cosmid, viral particle or phage. The appropriate nucleic acid sequence can be inserted into the vector by various methods. In general, DNA is inserted into the site or appropriate restriction endonuclease sites using techniques known in the art. The vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter and a transcription termination sequence. The construction of suitable vectors containing one or more of these components utilizes standard ligation techniques which are known to those skilled in the art. Recombinantly PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be produced not only directly, but also as a fusion polypeptide with a heterologous polypeptide, the which may be a signal sequence or other polypeptide having a specific cleavage site in the N-terminal part of the mature protein or polypeptide. In general, the signal sequence can be a component of the vector, or it can be a part of the DNA encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 that is inserted inside the vector. The signal sequence may be a prokaryotic signal sequence that is selected, for example, from the group of alkaline phosphatase, penicillinase, Ipp or thermostable enterotoxin II leaders. For yeast secretion, the signal sequence may be, for example the yeast invertase leader, the alpha factor leader (which includes the a-factor leaders of Saccharomyces and Kluyveromyces, the latter described in US Patent No. 5,010,182) , or a leader of acid phosphatase, the leader of glucoamylase from C. albicans (EP 362,179, published April 4, 1990), or the signal described in WO 90/13646 published November 15, 1990. In the expression of mammalian cells, mammalian signal sequences can be used to direct the secretion of the protein, such as signal sequences from secreted polypeptides of the same species or related species, as well as viral secretory leaders. Both expression and cloning vectors contain a nucleic acid sequence that allows the vector to replicate in one or more selected host cells. Such sequences are well known for various bacteria, yeasts and viruses. The origin of replication of plasmid pBR322 is suitable for most gram-negative bacteria, the origin of plasmid 2 μ is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for vector cloning in mammalian cells. The expression and cloning vectors will typically contain a selection gene, also called a selectable marker. Typical selection genes encode proteins that: (a) confer resistance to other toxins to antibiotics, for example to ampicillin, neomycin, methotrexate or tetracycline, (b) supplement auxotrophic deficiencies, or (c) provide critical nutrients not available from complex media, for example, the gene encoding D-alanine racemase for Bacilli.

An example of selectable markers suitable for mammalian cells are those that allow the identification of cells competent to capture the nucleic acid encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509 , PR0853 or PR0882 such as DHFR or thymidine kinase. An appropriate host cell, when wild-type DHFR is used is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Nati Acad. Sci. USA. 77: 4216 (1980). A suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid YRp7 [Stinchcomb et al. , Nature, 282: 39 (1979); Kingsman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85: 12 (1977)]. The expression and -cloning vectors usually contain a promoter operably linked to the nucleic acid sequence encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 and PR0882 for direct the synthesis of mRNA. The promoters recognized by various potential host cells are well known. The promoters . ^^^ j ^ suitable for use with prokaryotic hosts include β-lactamase and lactose promoter systems [Chang et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [de Boer et al., Proc. Nati Acad. Sci. USA, 80: 21-25 (1983)]. Promoters for use in bacterial systems will also contain a Shine-Dalgarno (SD) sequence operably linked to DNA encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853. or PR0882. Examples of suitable promoter sequences for use in yeast hosts include promoters for 3-phosphoglycerate kinase [Hitzeman et al. , J. Biol. Chem., 255: 2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzv e Reg. , 7: 149 (1968); Holland, Biochemistry, 17: 4900 (1978)], such as enolase, glyceraldehyde-3-phosphatase, dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase. Other yeast promoters, which are inducible promoters that have the additional advantage of transcription controlled by growth conditions, are aA r¿ .a. n »j-.i .. * J .1 the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase and enzymes responsible for the use of maltose and galactose. Vectors and promoters suitable for use in the expression of yeast are further described in EP 73,657. The transcription of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 from vectors in mammalian host cells is controlled, for example, by promoters that are obtained of the genomes of viruses such as the polyoma virus, the smallpox virus (UK 2,211,504 published on July 5, 1989), adenoviruses (such as adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus of hepatitis B and simian virus 40 (SV40), from heterologous mammalian promoters, for example, the actin promoter or an immunoglobulin promoter, and heat shock promoters, with the proviso that the promoters are compatible with the host cell systems. The transcription of a DNA that codes for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 by higher eukaryotes can be increased by inserting an enhancer sequence into the vector. The enhancers are cis-acting elements of DNA, usually about 10 to 300 bp, which act on a promoter to increase its transcription. Many elongation sequences are known from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). However, typically one will use an eukaryotic cell virus extender. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the side The lateness of the origin of replication and adenovirus enhancers. The enhancer can be displayed on the vector in a position 5 'or 3' with respect to the coding sequence PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, but preferably is located at site 5 'from the promoter. Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans or nucleated cells of other multicellular organisms) will also contain sequences necessary for the transcription termination and for mRNA stabilization. Such sequences are commonly available from the 5 'and occasionally 3', untranslated regions of eukaryotic or viral DNA or cDNA. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO201, PR0292, -? Áíí? T. ? íá ^ .H.-Í.i.:. J ..., .. L. .HÉU * .- «» ... Jt.a.-Jj.t.tj.

PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Other methods, vectors and additional host cells, suitable for adaptation to the synthesis of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in cultures of recombinant vertebrate cells , are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058. LO d. Detection of amplification / expression of the gene The amplification or expression of the gene can be measured in a sample directly, for example, transfer L5 Southern conventional, Northern blotting to quantitate the transcription of .RNA [Thomas, Proc. Nati Acad. Sci. USA, 77: 5201-5205 (1980)], dot blotting (DNA analysis), or in-situ hybridization using an appropriately labeled probe, based on the sequences provided here. Alternatively, antibodies that recognize specific duplex chains, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes, can be used. At the same time, the antibodies can be labeled and the assay can be carried out where a duplex is attached to a surface, so that before the formation of the duplex in the surface, the presence of the antibody bound to the duplex chain can be detected. The expression of the genes, alternatively, can be measured by immunological methods such as immunohistochemical staining or tissue sections and cell culture assay of body fluids, to directly quantify the expression of the gene product. Antibodies useful for immunohistochemical staining or testing of sample fluid can be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibodies can be prepared against the native polypeptide sequence for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or against the synthetic peptide based on the sequences of DNA that are provided here, or against an exogenous sequence fused to DNA for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and coding for the epitope of specific antibody. e. Polypeptide purification You can recover the forms of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 of the culture medium or of the host cell lysates. If it is attached to ? J -, ^^ L membrane, can be released from the membrane using a suitable detergent solution (for example Triton-X 100) or by enzymatic separation. The cells used in the expression of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be broken by various physical or chemical means, such as freeze-reheat cycles, sonication, mechanical rupture or cell lysis agents. It may be desired to purify PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 from recombinant cell proteins or polypeptides. The following procedures are exemplary for suitable purification procedures: by fractionation on an ion exchange column; ethanol precipitation; Reversed phase CLAP: chromatography on silica or on a cation exchange resin such as DEAE: chromatofocusing; SDS-PAGE; precipitation with ammonium sulfate; gel filtration, using, for example, Sephadex G-75; Protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to join epitope tagged forms of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Various methods of protein purification can be used and such methods are known in the art and are described, for example, in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). The purification stage (s) selected will depend, for example, on the nature of the production process used and on PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. particular produced.

E. Amplification of genes encoding the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRQ1017, PR01112, PRO509, PR0853 or PR0882 polypeptides in tumor tissues and cell lines The present invention is based on the identification and characterization of genes that are amplified in certain cancer cells. The genome of prokaryotic and eukaryotic organisms undergoes two apparently conflicting requirements. One is the conservation and propagation of DNA as the genetic information in its original form, to guarantee a stable inheritance through multiple generations. On the other hand, cells or organisms must be able to adapt to resist environmental changes. Adaptive mechanisms may include qualitative or quantitative modifications of genetic material. Qualitative modifications include DNA mutations in which the coding sequences that result in a structural and / or functionally different protein are altered. Gene amplification is a quantitative modification, whereby the current number of the complete coding sequence, ie a gene, is increased, which leads to an increased number of templates available for transcription, an increased number of translatable transcripts, and finally at an increased abundance of the protein encoded by the amplified gene. The phenomenon of gene amplification and its underlying mechanisms have been investigated ip vi tro in several prokaryotic and eukaryotic culture systems. The best-characterized example of gene amplification involves culturing eukaryotic cells in medium containing varying concentrations of the cytotoxic drug methotrexate (MTX). MTX is a folic acid analog and interferes with DNA synthesis by blocking the enzyme dihydrofolate reductase (DHFR). During initial exposure to low concentrations of MTX, most of the cells (> 99.9%) will die. A small number of cells will survive and will be able to grow in increasing concentrations of MTX by producing large amounts of DHFR-RNA and protein. The basis of this overproduction is the amplification of the unique DHFR gene. Additional copies of the gene are found as copies extrachromosomics in the form of small supernumerary chromosomes (double minimums) or as integrated chromosomal copies. Amplification of the gene is most commonly found in the development of resistance to cytotoxic drugs (antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells) and neoplastic transformation. The transformation of a eukaryotic cell as a spontaneous phenomenon or due to a viral or chemical / environmental attack is typically associated with changes in the genetic material of that cell. One of the most common genetic changes observed in human malignant cancers are mutations of the p53 protein. The p53 protein controls the transition of cells from the stationary phase (Gl) to the replicative phase (S) and prevents this transition in the presence of DNA damage. In other words, one of the main consequences of inactivating p53 mutations is the accumulation and spread of DNA damage, that is, genetic changes. The common types of genetic changes in neoplastic cells are, in addition to point mutations, amplifications and gross structural alterations, such as translocation. The amplification of the DNA sequences may involve a specific functional requirement, as illustrated in the experimental DHFR system. Therefore, the amplification of certain oncogenes in malignant cancers points t.tjrlá sk.ra &. ? nAi.e, r. ... LL ?? ik. . _ ,,, _ ^ _ ^, ^ ^ .. ^ a ^ - -. ^ .... ^ ¿.aa. ^ ««. . ".. *. * =. towards a causal role of these genes in the process of malignant transformation and maintenance of the transformed phenotype. This hypothesis has acquired basis in recent studies. For example, it has been found that the bcl -2 protein is amplified in certain types of non-Hodgkin's lymphoma. This protein inhibits apoptosis and leads to progressive accumulation of neoplastic cells. It has been found that members of the gene family of growth factor receptors are amplified in various types of cancers suggesting that overexpression of these editors can make neoplastic cells less susceptible to limiting amounts of available growth factor . Examples include amplification of the handrogen receptor in recurrent prostate cancer during therapy with suppression of mannogens and amplification of the ERB2 homologue of the growth factor receptor in breast cancer. Finally, the genes involved in intracellular signaling and control of cell cycle progress may undergo amplification during a malignant transformation. This is illustrated by the amplification of the bcl-I and ras genes in various epithelial and lymphoid neoplasms. These initial studies illustrate the feasibility of identifying amplified DNA sequences in neoplasms, because this approach can identify genes important for malignant transformation. The case of ERB2 also demonstrates what is feasible from the therapeutic point of view, since transforming proteins can represent novel and specific targets for tumor therapy. Several different techniques can be used to demonstrate the amplified genomic sequences. The classical cytogenetic analysis of chromosome diffusions of cancer cells is adequate to identify general structural alterations such as translocations, deletions and inversions. The amplified genomic regions can only be visualized, if they involve large regions with a high number of copies or are present as extrachromosomal material. Although cytogenetics has been the first technique to demonstrate the consistent association of specific chromosomal changes with particular neoplasms, it is not suitable for the identification and isolation of DNA sequences that can be administered. The most recently developed technique of comparative genomic hybridization (CGH) has illustrated the widely disseminated phenomenon of genomic amplification in neoplasms. The tumor and normal DNA are hybridized simultaneously in metaphases of normal cells and the entire genome can be examined by means of image analysis to detect DNA sequences that are present in the tumor with an increased frequency (W093 / 18, 186; Gray et al. , Radiation Res., 137: 275-289, 1941). As an examination method, this type of analysis has shown a large number of recurrent amplicons (a stretch of amplified DNA) in various human neoplasms. Although CGH is more sensitive than classical cytogenetic analysis to identify amplified stretches of DNA, it does not allow rapid identification and isolation of the coding sequences within the amplicon by conventional or standard molecular genetic techniques. The most sensitive methods to detect gene amplification are tests based on polymerase chain reaction (PCR). These assays use a very small amount of tumor DNA as starting material, are extremely sensitive, provide DNA that is amenable to further analysis, such as sequencing, and are suitable for a high volume general analysis. The assays mentioned above are not mutually exclusive, but are often used in combination to identify amplifications in neoplasms. Although cytogenetic analysis and CGH represent examination methods to analyze the whole -genome for amplified regions, PCR-based assays are more suitable for the final modification of the coding sequences, ie, genes in amplified regions. In accordance with the present invention, such genes have been identified by quantitative PCR (S. Gelmini et al., Clin .. Chem., 43: 752 [1997]), by comparing DNA from various primary tumors including breast, lung. , colon, prostate, brain, liver, kidney, pancreas, vessel, thymus, testes, ovary, uterus, etc., as tumors or tumor cell lines, with accumulated DNA from healthy donors. Quantitative PCR is performed using the TaqMan instrument (ABI). The gene-specific primers and the fluorogenic probes are designed based on the coding sequences of the cDNAs. Human lung carcinoma cell lines include A549 (SRCC768), Calu-1 (SRCC769), Calu-6 (SRCC770), H157 (SRCC771), H441 (SRCC772), H460 (SRCC773), SKMES-1 (SRCC774). ), SW900 (SRCC775), H522 (SRCC832) and H810 (SRCC883), all available from ATCC. Primary human lung tumor cells are usually derived from adenocarcinomas, squamous cell carcinomas, large cell carcinomas, non-small cell carcinomas, small cell carcinomas and bronchoalveolar carcinomas and include, for example, SRCC724 (adenocarcinoma, abbreviated as "AdenoCa") (LT1), SRCC725 (squamous cell carcinoma, abbreviated as "SqCCa") (LTla), SRCC726 (adenocarcinoma) (LT2), SRCC727 (adenocarcinoma) (LT3), SRCC728 (adenocarcinoma) (LT4), SRCC729 (squamous cell carcinoma) (LT6), SRCC730 (adeno / squamous cell carcinoma) (LT7), SRCC731 (adenocarcinoma) (LT9), SRCC732 (squamous cell carcinoma) (LT10), SRCC733 (squamous cell carcinoma) (LT11), SRCC734 (adenocarcinoma) (LT12), SRCC735 OLÚ .i.rk LifatoA. AL (adeno / squamous cell carcinoma) (LT13), SRCC736 (squamous cell carcinoma) (LT15), SRCC737 (squamous cell carcinoma) (LT16), SRCC738 (squamous cell carcinoma) (LT17), SRCC739 (carcinoma of the squamous cell) squamous cells) (LT18), SRCC740 (squamous cell carcinoma) (LT19), SRCC741 (lung cell carcinoma, abbreviated as "LCCa") (LT21), SRCC811 (adenocarcinoma) (LT22), SRCC825 (adenocarcinoma) (LT8) ), SRCC886 (adenocarcinoma) (LT25), SRCC887 (squamous cell carcinoma) (LT26), SRCC888 (adenocarcinoma BAC) (LT27), SRCC889 (squamous cell carcinoma) (LT28), SRCC890 (squamous cell carcinoma) (LT29) ), SRCC891 (adenocarcinoma) (LT30), SRCC892 (squamous cell carcinoma) (LT31), SRCC894 (adenocarcinoma) (LT33). Also included are human lung tumors designated SRCC1125 [HF-000631], SRCC1127 [HF-000641], SRCC1129 [HF-000643], SRCC1133 [HF-000840], SRCC1135 [HF-000842], SRCC1227 [HF-001291], SRCC1229 [HF-001293], SRCC1230 [HF-001294], SRCC1231 [HF-001295], SRCC1232 [HF-001296], SRCC1233 [HF-001297], SRCC1235 [HF-001299] and SRCC1236 [HF-001300]. Colon cancer cell lines include, for example, cell lines ATCC SW480 (adenocarcinoma, SRCC776), SW620 (metastasis of lymph node of colon adenocarcinoma, SRCC777), Colo320 (carcinoma, SRCC778), HT29 (adenocarcinoma, SRCC779), HM7 (a high variant mucin producer of an ATCC colon adenocarcinoma cell line, SRCC780, obtained from Dr. Robert Warren, UCSF), CaWiDr (adenocarcinoma, SRCC781), HCT116 (carcinoma, SRCC782), SKCO1 (adenocarcinoma, SRCC783), SW403 (adenocarcinoma, SRCC784), LS174T (carcinoma, SRCC785), Colo205 (carcinoma, SRCC828), HCT15 (carcinoma, SRCC829), HCC2998 (carcinoma, SRCC830), and KM12 (carcinoma, SRCC831). Primary colon tumors include colon adenocarcinomas designated CT2 (SRCC742), CT3 (SRCC743), CT8 (SRCC744), CT10 (SRCC745), CT12 (SRCC746), CT14 (SRCC747), CT15 (SRCC748), CT16 (SRCC749), CT17 (SRCC750), CTl (SRCC751), CT4 (SRCC752), CT5 (SRCC753), CT6 (SRCC754), CT7 (SRCC755), CT9 (SRCC756), CT11 (SRCC757), CT18 (SRCC758), CT19 (adenocarcinoma, SRCC906 ), CT20 (adenocarcinoma, SRCC907), CT21 (adenocarcinoma, SRCC908), CT22 (adenocarcinoma, SRCC909), CT23 (adenocarcinoma, SRCC910), CT24 (adenocarcinoma, SRCC911), CT25 (adenocarcinoma, SRCC912), CT26 (adenocarcinoma, SRCC913) , CT27 (adenocarcinoma, SRCC914), CT28 (adenocarcinoma, SRCC915), CT29 (adenocarcinoma, SRCC916), CT30 (adenocarcinoma, SRCC917), CT31 (adenocarcinoma, SRCC918), CT32 (adenocarcinoma, SRCC919), CT33 (adenocarcinoma, SRCC920), CT35 (adenocarcinoma, SRCC921), CT36 (adenocarcinoma, SRCC922). human colon centers designated SRCC1051 [HF-000499], SRCC1052 [HF-000539], SRCC1053 [HF-000575], SRCC1054 [HF-000698], SRCC1142 [HF-000762], SRCC1144 [HF-000789], SRCC1146 [HF-000795] and SRCC1148 [HF-000811].

Lines of human breast carcinoma include, for example, HBL100 (SRCC759), MB435S (SRCC760), T47D (SRCC761), MB468 (SRCC762), MB175 (SRCC763), MB361 (SRCC764), BT20 (SRCC765), MCF7 (SRCC766) ) and SKBR3 (SRCC767), and a human breast tumor center 5 designated SRCC1057 [HF-000545]. Also included are human breast tumors designated SRCC1094, SRCC1095 SRCC1096, SRCC1097, SRCC1098, SRCC1099, SRC10OO, SRCC1101 and human breast-lung-methane-NS tumors designated SRCC893 [LT32]. Human kidney tumor centers include SRCC989 10 [HF-000611] and SRCC1014 [HF-000613]. The human testis tumor center includes SRCC1001 [HF-000733] and the testis tumor margin SRCC999 [HF-000716]. The human parathyroid tumor includes SRCC1002 [HF-15 000831] and SRCC1003 [HF-000832].

F. Fabric distribution The results of amplification assays of 20 genes herein can be verified by additional studies such as, for example, determination of mRNA expression in various human tissues. As indicated in the above, the amplification of the gene or the expression of the gene, or both, in various tissues can be measured by Southern blotting (Southern blotting), conventional, Northern blotting to quantify mRNA transcription (Thomas, Proc. Nati, Acad. Sci. USA, 77: 5201-5205 IA98Q]), DNA analysis (dot blotting), or Hybridization in if you are using an appropriately marked area, based on the sequences provided here. Alternatively, antibodies that can recognize specific duplex chains including duplex DNA, duplex RNA and hybrid DNA-RNA duplexes or DNA-protein duplexes can be used. The expression of the gene in various tissues, alternatively, can be measured by immunological methods such as immunostochemical staining or tissue sections and cell culture or body fluid assay, to directly quantify the expression of the gene product. Antibodies useful for immunohistochemical staining or testing of sample fluids may be monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies can be prepared against a native sequence of the PRO201 polypeptide, PR0292, PRG327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or against a synthetic peptide based on the DNA sequences that are provided here or against a hexagen sequence fused to the DNA sequence for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and that codes for a specific antibody epitope. General techniques for generating antibodies and special protocols for Northern blotting and hybridization in itself are provided in the following.

G. Chromosome mapping If the amplification of a given gene is functionally important, then that gene can be amplified more than the neighboring genomic regions which are not important for tumor survival. To test this, the gene can be mapped to a particular chromosome, by hybrid-radiation analysis. The level of amplification is then determined at the identified site and the neighboring genomic region. Selective or preferential amplification in the genomic region to which the gene has been mapped is consistent with the possibility that the amplification of the observed gene promotes growth or tumor survival. Chromosome mapping includes the mapping of both the infrastructure and the epicenter. For additional details see, for example Stewart et al. , Genome Research, 7: 422-433 (1997). j_ H. Antibody binding studies The results of the gene amplification study can be further verified by antibody binding studies, in which the ability of the antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, is tested. against PR0357, against PRO710, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 to inhibit the expression of the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509 , PR0853 or PR0882 in tumor cells (cancerous). Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies, the preparation of which will be described in the following. Antibody binding studies can be carried out in any known assay method, for example by competitive binding assays, interposition assays (sandwich) direct and indirect, and immunoprecipitation tests. Zola, Monoclonal Antibodies: A Manual of Techniques, PP. 147-158 (CRC Press, Inc., 1987). Competitive binding assays are based on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody. The amount of target protein (encoded by a gene amplified in a tumor cell) in the test sample is inversely proportional to the amount of standard that binds to the antibodies. To facilitate the determination of the amount of standard that binds, the antibodies are preferably insolubilized before or after the competition, so that the standard and the analyte that binds to the antibodies can be conveniently separated from the standard and the analyte which remains unbound. Interposition assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected. In an interposition assay, the analyte in the test sample is bound by a first antibody which is immobilized on a solid support, and subsequently a second antibody which binds to the analyte, thereby forming an insoluble complex of three parts. See, for example, U.S. Patent No. 4,376,110. The second antibody itself can be labeled with a detectable portion (direct interposition assays) or can be measured using an anti-immunoglobulin antibody that is labeled with a detectable portion (indirect interposition assay). For example, one type of interposition assay is the assay, ELISA, in which case the detectable portion is an enzyme. For immunohistochemistry, the tumor sample can be fresh or frozen, or it can be embedded in paraffin and can be fixed with a preservative such as formalin, for example.

I. Cell-based tumor assays Cell-based assays and animal models for tumors (eg, cancers) can be used to verify the findings of the gene amplification assay and further understand the relationship between the genes identified herein and the development and pathogenesis of neoplastic cell growth. The role of the gene products identified here in the development and pathology of tumor or cancer can be tested by using primary tumor cells or cell lines that have been identified to amplify the genes here. Such cells include, for example, breast, colon and lung cancer cells, and cell lines included therein. In a different approach, cells of a cell type known to be involved in a particular tumor are transfected with the cDNAs therein, and the ability of these cDNAs to induce excessive growth is analyzed. Suitable cells include, for example, stable tumor cell lines such as the B104-1-1 cell line (stable NIH-3T3 cell line transfected with the neu proto-oncogene), and ras-transfected NIH-3T3 cells, the which can be transfected with the desired gene, and can be monitored for tumorigenic growth. Such transfected cell lines can then be used to test the ability of polyclonal or monoclonal antibodies or antibody compositions to inhibit the growth of tumorigenic cells by exerting cytostatic or cytotoxic activity on the growth of transformed cells, or by means of cellular cytotoxicity. antibody dependent (ADCC). Cells transfected with the coding sequences of the genes identified herein may also be used to identify candidate drugs for the treatment of cancer. In addition, primary cultures derived from tumors in transgenic animals (as described below) can be used in cell-based assays herein, although stable cell lines are preferred. Techniques for deriving continuous cell lines from transgenic animals are well known in the art (see, for example, Small et al., Mol.Cell. Biol., 5: 642-648 [19851).

Models in animals Various models can be used in well-known animals to better understand the role of the genes identified here in tumor development and pathogenesis, jfe ¿«m .. Í? ? - & .. ^^^^^ .- »» »J. *? t. -.m to test the efficacy of the candidate therapeutic agents including antibodies and other antagonists of the native polypeptides, including small molecule antagonists. The in vivo nature of such models makes them particularly suitable as predictors of responses in human patients. Animal models of tumors and cancers (eg, breast cancer, colon cancer, prostate cancer, lung cancer, etc.) include non-recombinant and recombinant (transgenic) animals. Models of non-recombinant animals include, for example, rodents, ie, murine models. Such models can be generated by introducing tumor cells into syngeneic mice using standard techniques, for example subcutaneous injection, tail vein injection, vessel implantation, intraperitoneal implantation, implantation below the renal capsule or orthopne implantation, eg cells of colon cancer implanted in colonic tissue (see, for example, PCT publication No. W097 / 33551, published September 18, 1997). Probably the most widely used animal species in oncological studies are immunodeficient mice and, in particular, atypical mice. The observation that athymic mice with hypoplasia can successfully act as a host for human tumor xenografts has led to their widely disseminated use for this purpose. The autosomal pu recessive gene has been introduced in a very large amount of congenic strains other than athymic mice which include, for example, ASW, A / He, AKR, BALB / c B10.LP, C17, C3H, C57BL, C57, CBA, DBA, DDD, I / st, NC, NFR, NFS, NFS / N, NZB, NZC , NZW, P, RUI and SJL. In addition, a wide variety of different animals have been bred with inherited immunological defects in addition to athymic mice and have been used as tumor receptor genografts. for further details see, for example, The Nude Mouse in Oncology Research, E. Boven and B. Winograd, eds., CRC Press, Inc., 1991. Cells introduced into such animals can be derived from known tumor / cancer cell lines. such as any of the tumor cell lines included in the above and, for example, the B104-1-1 cell line (stable NIH-3T3 cell line transfected with the neu proto-oncogene), NIH-3T3 cells transfected with ras; Caco-2 (ATCC HTB-37); a moderately-well-differentiated, grade II human colon adenocarcinoma cell line, HT-29 (ATCCHTB-38) or tumors and cancers. Samples of tumor or cancer cells can be obtained from patients undergoing surgery, using conventional or standard conditions, involving freezing and storage in liquid nitrogen (Karmali et al., Br. J. Cancer, 48: 689- 696 [1983] ).

Tumor cells can be introduced into animals, such as nude mice, by various methods. The subcutaneous space (s.c.) in mice is very suitable for tumor implantation. Tumors can be transplanted s.c. as solid blocks, as a needle biopsy using a trocar or as cell suspensions. For implantation of a solid block or a trocar, fragments of tumor tissue of suitable size are introduced into the s.c. Cell suspensions are prepared fresh from primary tumors or stable tumor cell lines and injected subcutaneously. The tumor cells can also be injected as subdermal implants. In this place, the inoculum is deposited between the lower part of the dermal connective tissue and the s.c. Boven and Winograd (1991), supra. Models in breast cancer animals can be generated, for example, by implanting rat neuroblastoma cells (from which the neu oncogene was initially isolated) or NIH-3T3 cells transformed with neu within nude mice, essentially as described by Drebin et al. , PNAS USA, 83: 9129-9133 (1986). Similarly, animal models of colon cancer can be generated by passing colon cancer cells in animals, for example nude mice, which leads to the appearance of tumors in these animals. It has been r?, J m. .? > .TO ..! ???? . .. n iit "__ _! ..,., a. . . ".."? «. ^,, < .fc ». ^., m. ,, J .. ^ > J .. ^ ... j j. * ,. ~ - amA.a.t ¿. described a model of orthotopic human colon cancer transplantation in athymic mice, for example, by Wang et al. , Cancer Research, 54: 4726-4728 (1994) and Too et al. , Cancer Research, 55: 681-684 (1995). This model is based on what is called "METAMOUSE", sold by AntiCancer, Inc., (San Diego, California). Tumors that arise in animals can be removed and cultured in vi tro. The cells of the in vi tro cultures are then passed on to animals. Such tumors may serve as targets for further testing or for drug testing. Alternatively, the tumors resulting from the passage can be isolated and the RNA from the cells before the passage and the cells isolated after one or more passage rounds are analyzed to determine differential expression of genes of interest. Such passage techniques can be performed with any of the known tumor or cancer cell lines. For example, Meth A, CMS4, CMS5, CMS21 and WEHI-164 are chemically induced fibrosarcomas of BALB / c female mice (DeLeo et al., J. Exp. Med., 146: 720 [1977]), which provide a highly controllable model system for studying anti-tumor activities of several agents (Palladino et al., J. Immunol., 138: 4023-4032 [1987]). Briefly, tumor cells are propagated in vi tro in cell culture. / Before injection into these animals, cell lines are washed and suspended in buffer, at a cell density of about 10 x 10 5 to 10 x 10 7 cells / ml. The animals are then infected subcutaneously with 10 to 100 μl of the cell suspension, allowing one to three weeks for the tumor to appear. In addition, Lewis lung carcinoma (3LL) from mice, which is one of the most widely studied experimental tumors, can be used as a research tumor model. The efficacy in this tumor model has been correlated with the beneficial effects in the treatment of human patients diagnosed with small cell carcinoma of the lung (SCCL). This tumor can be introduced into normal mice by injection of tumor fragments from an affected mouse or from cells maintained in culture (Zupi et al., Br. J. Cancer, 41: suppl 4: 309 [1980]), and the evidence indicates that tumors can be initiated from injection and even a single cell and that a very high proportion of infected tumor cells survive. For additional information about this tumor model see Zacharski, Haemostasis, 16: 300-320 IA9861). One way to evaluate the effectiveness of a test compound in an animal model on an implanted tumor is to measure the size of the tumor before and after treatment. Traditionally, the size of implanted tumors has been measured with a slide gauge in two or three dimensions. x te.

The limit measured in two dimensions does not accurately reflect the size of the tumor, and therefore is usually converted to the corresponding volume by using a mathematical formula. However, the measurement of the size of the tumor is not precise. The therapeutic effects of a candidate drug can best be described as growth retardation induced by the treatment and specific delay in growth. Another important variable in the description of tumor growth is the time of duplication of tumor volume. Computer programs for calculating and describing tumor growth are also available, such as the program presented by Rygaard and Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Deficient Animáis, Wu and Sheng eds., Basel, 1989,301. It is noted, however, that necrosis and inflammatory responses after treatment actually result in an increase in tumor size, at least initially. Therefore, these changes need to be carefully monitored by a combination of a morphometric- and flow cytometric analysis. Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified here in the genome of animals of interest, using standard techniques to produce transgenic animals. The animals that can serve as a goal ai, -i r..ri. Í., Í MmjS & "¡¡¡.3tM ¿? ^. . .. .. .. «. . . ">" - "• * • - - - ^, .jkrr .. ...? .m .cj." ff for transgenic manipulation include, without limitation, mice, rats, rabbits, horses, sheep, goats, non-human primates and pigs, for example baboons, chimpanzees and monkeys, techniques known in the art for introducing a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U.S. Patent No. 4,873,191); by retroviruses within germ lines (for example Van der Putten et al., Proc. Nati, Acad. Sci. USA, 82: 6148-615 [1985]), gene targeting embryonic germ cells (Thomspon et al., Cell, 56: 313-321 [1989]), embryo electroporation (Lo, Mol. Cell Biol., 3 ^ .1803-1804 [1983]); sperm-mediated gene transfer (Lavitrano et al., Cell, 57: 717-73 [1989]). For a review see, for example, U.S. Patent No. 4,736,866. For the purpose of the present invention, the transgenic animals include those that present the transgene only in part of their cells ("mosaic animals"). The transgene can be integrated either as a single transgene or in concatamers, for example in chains head to head or head to tail. The selective introduction of a transgene into a particular cell type is also possible by monitoring, for example from the Lasko et al. , Proc. Nati Acad. Sci. USA, 89: 6232-636 (1992).

The expression of the transgene in transgenic animals can be monitored by standard techniques. For example, Southern blot analysis or PCR amplification can be used to verify the integration of the transgene. It can then be analyzed at the level of mRNA expression using techniques such as in-situ hybridization, Northern blot analysis, PCR or immunocytochemistry. The animals are further examined for signs of tumor or cancer development. Alternatively, animals can be built "agénicos" which have a defective or altered gene and which encodes the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 polypeptides identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal. For example, cDNA encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be used to clone genomic DNA coding for that polypeptide according to with the established techniques. A portion of the genomic DNA encoding a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. l l ai t r.?,? . ^ iS & Particular J can be deleted or substituted with another gene, for example a gene encoding a selectable marker which can be used to monitor the integration. Typically, several kilobases of undisturbed franking DNA (at both ends, 5 'and 3') are included in the vector [see, for example, Thomas and Capecchi, Cell, 51: 503 (1987) for a description of the vectors of homologous recombination]. The vector is introduced into a line of embryonic germ cells (for example by electroporation) and the cells in which the introduced 7DNA has been recombined in an endogenous DNA are selected [see, for example, Li et al. , Cell, 69: 915 (1992) 1. The selected cells are then injected into a blastocyst of an animal (eg a mouse or rat) to form aggregation chimeras [see for example, Bradley, in Teratocarcinomas and Embrvonic Stem Cells: A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then be implanted into a suitable pseudopregnancy female host animal and the embryo is brought to term to create an "aghenic" animal. The progeny presenting the homologously recombined DNA in their germ cells can be identified by standard techniques and can be used to create animals in which all cells in animals contain homologously recombined DNA. Agénic animals can be characterized, for example, by their ability to defend against certain pathological conditions and for their development of pathological conditions due to the absence of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The effectiveness of antibodies that bind specifically to the polypeptides identified herein and other candidate drugs can also be tested in the treatment of tumors of spontaneous animals. A suitable target for such studies is oral-feline squamous cell carcinoma (SCC). Feline oral SCC is a highly invasive malignant tumor that is the most common oral malignant cancer of cats, constituting more than 60% of oral tumors reported in this species. They rarely metastasize to distant sites, although this low incidence of metastasis may simply be a reflection of the short survival times for cats with this tumor. These tumors are usually not amenable to surgery, mainly due to the anatomy of the feline oral cavity. To date, there is no effective treatment for this tumor. Before entering the study, each cat undergoes a complete clinical examination, biopsy and is examined by computed tomography (CT). Cats diagnosed with sublingual oral squamous cell tumors are excluded from the study. The tongue may be paralyzed as a result of such a tumor, What if the treatment destroys the tumor? The animals are no longer able to feed themselves. Each cat is treated repeatedly, for a prolonged period of time. The photographs of the tumors are taken daily during the treatment period, at each subsequent revision. After the treatment, each cat undergoes another CT scan. CT scans and chest radiograms are evaluated every 8 weeks thereafter. Data are evaluated for differences in survival, response and toxicity compared to control groups. The positive response may require evidence of tumor regression, preferably with an improvement in quality of life or a prolonged life span. In addition, other tumors of spontaneous animals can also be tested, such as fibrosarcoma, adenocarcinoma, lymphoma, crondoma, leiomyosarcoma of dogs, cats or baduinos. From this, mammary adenocarcinoma in dogs and cats is the preferred model since its appearance and behavior is very similar to that of humans. However, the use of this model is limited by its rare presentation of this type of tumor in animals. • é j. . ? ^ ¿.

K. Examination tests for candidate drugs Testing assays for candidate drugs are designed to identify compounds that bind or complex with polypeptides encoded by the genes identified herein, or that otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such screening assays will include assays capable of high throughput screening of chemical libraries, rendering them particularly suitable for identifying small molecules of candidate drugs. The contemplated small molecules include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, fusions of (poly) peptides-immunoglobulin, and in particular, antibodies including, without limitation, polyclonal and monoclonal antibodies and fragments of antibodies, chain antibodies simple, anti-idiotypic antibodies and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. The assays can be carried out in various formats, including protein-protein binding assays, biochemical assay assays, immunoassays and cell-based assays, which are well characterized in the art.

All assays are common insofar as they require contact of the candidate medicament with a polypeptide encoded by a nucleic acid identified herein under conditions and for a sufficient time to allow these two components to interact. In binding assays, the interaction is the binding and complex that are formed which can be isolated or detected in the reaction mixture. In a particular embodiment, the polypeptide encoded by the gene identified herein or the candidate medicament is immobilized on a solid phase, for example in a microtiter plate, by covalent or non-covalent linkages. The non-covalent binding is generally carried out by coating the solid surface with a solution of the peptide and drying. Alternatively, an immobilized antibody, for example a monoclonal antibody specific for the polypeptide to be immobilized, can be used to anchor it to a solid surface. The test is performed by adding the non-immobilized component, which may be marked by a detectable label, to the immobilized component, for example on the coated surface containing the anchored component. When the reaction is complete, the unreacted components are removed, for example by washing and the complexes anchored to the solid surface are detected. When the originally non-immobilized component presents a detectable mark, the detection of the immovable mark in the surface indicate that the formation of a complex has occurred. When the originally non-immobilized component does not present a label, complex formation can be detected, for example, by the use of a labeled antibody that specifically binds to the immobilized complex. If the candidate compound interacts but does not bind to a PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0853 PR0853 or PR0882 polypeptide, particularly encoded by a gene identified herein, its interaction with that polypeptide can be assayed by well-known methods to detect protein-protein interactions. Such assays include traditional approaches such as crosslinking, coinmunoprecipitation and copurification through gradients or chromatographic columns. In addition, protein-protein interactions can be monitored through the use of a yeast-based genetic system described by Fiéis et al [Fields and Song, Nature, 340: 245-246 (1989), Chien et al. , Proc. Nati Acad. Sci. USA, 88: 9578-9582 [1991]], as described by Chevray and Nathans, Proc. Nati Acad. Sci, USA, 89: 5789-5793 ri991) 1. Many transcriptional activators, such as yeast GAL4, consist of two physically separate modular domains, one that acts as a DNA binding domain, while the other functions as an activation domain. of transcription. The yeast expression system described in previous publications (generally referred to as a "two-hybrid system") takes advantage of this property and uses two hybrid proteins, one of which is the target protein that is fused to a DNA binding domain of GAL4 and another, in which the adjuvant proteins candidates are merged into the activation domain. The expression of a GALl-lacZ reporter gene under the control of a promoter activated by GAL4 depends on the reconstitution of GAL4 activity via protein-protein interaction. Colonies that contain interacting polypeptides are detected with a chromogenic substrate for β-galactosidase. A complete kit (MATCHMAKER ") to identify protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Contech.This system can also be extended to map protein domains involved in specific protein interactions as well as to obtain amino acid residues that are crucial for these interactions Compounds that interfere with the interaction of a gene encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 identified herein and other intracellular or extracellular components may be tested as follows: usually a reaction mixture containing the amplified gene product and the component is prepared .- TO . n .. - ... intracellular or extracellular under conditions and for a time that allows the interaction of union of the products. To test the ability of the test compound to inhibit binding, the reaction is carried out in the absence and in the presence of the test compound. In addition, a placebo can be added to a third reaction mixture to serve as a positive control. The binding (complex formation) between the test compound and the intracellular or extracellular component present in the mixture is monitored as described above. The formation of the complex in one or more control reactions but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner. To test for antagonists, the polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be added to a cell together with the compound to be examined for a particular activity and the ability of the compound to inhibit the activity of interest in the presence of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 indicates that the compound is an antagonist for the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Alternatively, antagonists can be detected by combining the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and a potential antagonist with PRO201 polypeptide receptors, PR0292, PR0327 , PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 bound to membrane or to recombinant receptors under conditions appropriate for a competitive inhibition assay. The polypeptide PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be labeled, for example by radioactivity, so that the number of PRO201 polypeptide molecules, PR0292 , PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 bound to the receptor can be used to determine the effectiveness of the potential antagonist. The gene encoding the receptor can be identified by numerous methods known to those skilled in the art, for example, ligand screening and FACS classification. Coligan et al., Current Protocols in Immun., 1 (2): chapter 5 (1991). Preferably, the cloning expression is used when the polyadenylated RNA is prepared from a cell responsive to the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. and a cDNA library created for this RNA is divided into pools and is used to transfect COS cells or other cells that do not respond to the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Transfected cells growing on glass plates are exposed to PR201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PR0715, PR01017, PR01112, PRO509, PR0853 or labeled PR0882 polypeptides. PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be labeled by various means including iodination or inclusion of a recognition site for a specific protein kinase of site. After fixation and incubation, the sections are subjected to autoradiographic analysis. Positive accumulations are identified and subcutaneously prepared and re-transfected using interactive subacumulation and reexamination processes, which ultimately provides a single clone that encodes the putative receptor. As an alternative solution for the identification of the receptor, PR201, PR0292, PR0327, PR01265, PR03465, PR0344, PR0343, PR0347, PR0357, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853, PR0853 or PR0883 labeled polypeptide can be attached by photoaffinity with cell membrane preparations or extract that express the receptor molecule. The crosslinked material separates PAGE and is exposed to an X-ray film. The complex labeled that contains the receptor can be cut, separated into peptide fragments and subjected to protein microsequencing. The amino acid sequence obtained from the microsequencing can be used to design a set of degenerate oligonucleotide probes to examine a DNA library to identify a gene encoding the putative receptor. In another assay for antagonists, mammalian cells or a membrane preparation expressing the receptor incubated with the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 can be incubated. or PR0882 labeled in the presence of the candidate compound. The ability of the compound to improve or block this interaction can then be measured. More specific examples of potential antagonists include an oligonucleotide that binds immunoglobulin fusions with the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and, in particular, antibodies including, without limitation, polyclonal and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idiotypic antibodies and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. Alternatively, a potential antagonist may being a closely related protein, for example a mutated form of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 which recognizes the receptor but does not impart effect, so that it competitively inhibits the action of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Another potential antagonist of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is an antisense RNA or DNA construct that is prepared using antisense technology where, for example, an antisense RNA or DNA molecule acts to directly block the translation of mRNA by hybridizing target mRNA and preventing translation of the protein. Antisense technology can be used to control the expression of the gene by forming a triple helix of DNA or antisense RNA, both methods which are based on the binding of a polypeptide to DNA or RNA. For example, the 5 'coding portion of the polynucleotide sequence which encodes the PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853, or PR0882 polypeptide PR0292, PR0327 or PR0882 polypeptide mature in the present, is used to design an antisense RNA oligonucleotide from about 10 to 40 base pairs of Item_".,.; .2 ri .., "i, r.-... length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see, Lee et al., Nucí Acids Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 (1988), Dervan et al., Science, 251: 1360 (1991)), whereby transcription and production of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The antisense 7ARN oligonucleotide hybridizes to the mRNA in vivo and blocks the translation of the RNA molecule into the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882. (antisense - Okano, Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988.) Oligonucleotides described above can also be delivered to cells so that antisense RNA DNA can be expressed in vivo to inhibit the production of PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. When antisense DNA is used, the derived oligodeoxyribonucleotides of the translation start site, for example between about -10 and +10 positions of the nucleotide sequence of the target gene, are those that are preferred.

The antisense RNA or DNA molecules are generally about 5 bases in length, about 10 bases in length, about 15 bases in length, about 20 bases in length, about 25 bases in length, about 30 bases in length, about 35 bases in length. length, approximately 40 bases in length, approximately 45 bases in length, approximately 50 bases in length, approximately 55 bases in length, approximately 60 bases in length, approximately 65 bases in length, approximately 70 bases in length, approximately 75 bases in length, approximately 80 bases in length, approximately 85 bases in length, approximately 90 bases in length, approximately 95 bases in length, approximately 100 bases in length or greater. Potential antagonists include small molecules that bind to the active site, the receptor binding site or the growth factor or other important binding site of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, whereby they block the normal biological activity of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Examples of small molecules include, but are not limited to, small peptides or molecules similar to peptides, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific separation of AR ?. The ribozymes act by sequence-specific hybridization with the AR? complementary objective, followed by endonucleolytic separation. The specific sites of ribozyme separation within an AR? Target potential can be identified by known techniques. For additional details see, for example, Rossi, Current Biology, 3: 469-471 (1994), and PCT publication. WO 97/33551 (published September 18, 1997). The nucleic acid molecules in triple helix formation used to inhibit transcription can be single chain and consist of deoxynucleotides. The base composition of these oligonucleotides is designed in a way that promotes triple helix formation via Hoogsteen base matching rules, which generally requires size establishment tracts of purines or pyrimidines in a chain of a duplex. For additional details see, for example, the PCT publication? O. WO 97/33551, supra. These small molecules can be identified by any of one or more examination tests discussed in --- »* - .Í .. ?? i above or by any other examination technique well known to those skilled in the art.

L. Compositions and methods for the treatment of tumors Compositions useful in the treatment of tumors associated with the amplification of genes identified herein include, without limitation, antibodies, small organic and inorganic molecules, peptides, phosphopeptides, antisense molecules and ribozymes, triple helical molecules, etc. that inhibit expression or activity. of the product of the target gene. For example, antisense RNA and RNA molecules act to directly block the translation of mRNA by hybridizing to the target mRNA and preventing translation to the protein. When antisense DNA is used, oligodeoxyribonucleotides derived from the translation start site are preferred, for example, between positions about -10 and +10 of the nucleotide sequence of the target gene. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific separation of RNA. The ribozymes act by sequence specific hybridization with complementary target RNA, followed by endonucleolytic separation. You can identify the sites of Separation of specific ribozyme with target potential RNA, by known techniques. For further details see, for example, Rossi, Current Biology, 4: 469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997). Nucleic acid molecules in triple helix formation used to inhibit transcription must be in single chain and consist of deoxynucleotides. The base composition of these oligonucleotides is designed to promote triple helix formation via the Hoogsteen base pairing rules, which generally require size establishment tracts of purines or pyrimidines in a chain of a duplex. For further details see, for example, PCT publication No. WO 97/33551 supra. These molecules can be identified by any or any combination of the test assays discussed above or by any other screening technique well known to those skilled in the art.

M. Antibodies Some of the most promising candidate drugs according to the present invention are antibodies and fragments of antibodies which can Íim? It.í.¿- Jr j? T.% «> ,,., ..? s t. .. ~? » J. *. *. *. s ^ a. inhibit the production of the gene product of the amplified genes identified herein or reduce the activity of the gene products. 1. Polyclonal antibodies Methods for preparing polyclonal antibodies are known to those skilled in the art, polyclonal antibodies can be generated in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent or adjuvant will be injected into the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal that is immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trialose dicorinomycolate). The immunization protocol can be .?. t -J.AjJ. = A «ÉMfa i ^, ¿4,. ^ l» »r.» - > ,. selected by a person skilled in the art without undue experimentation. 2. Monoclonal antibodies Alternatively, antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PRO710, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 can be monoclonal antibodies. Monoclonal antibodies can be prepared using hybridoma methods such as those described by Kohier and Milstein, Nature, 256: 495 (1975). In a hybridoma method, a mouse, hamster or other appropriate host animal is typically immunized with an immunizing agent to induce lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, lymphocytes can be immunized in vi tro. The immunizing agent will typically include the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, which includes fragments, or a fusion protein of such protein or fragment Of the same. Generally, any of the peripheral blood lymphocytes ("PBL") are those that are used if cells of human origin are desired, or vessel cells or lymph node cells are those that are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusion agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monocolonal Antibodies: Principles and Practice, Academic Press, (1986) p. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are used. Hybridoma cells can be grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of immortalized cells that have not been fused. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridomas will typically include hypoxanthine, aminopterin and thymidine ("HAT medium"), substances which prevent the growth of deficient cells. in HGPRT. Preferred immortalized cell lines are those that fuse efficiently, support a high level of stable expression of antibodies by the selected antibody producing cells and are sensitive to a medium such as the HAT medium. The cell lines More preferred immortalized are murine myeloma lines which can be obtained, for example, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection (ATCC) Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies [Kozbor, J. Immunol. , 133: 3001 (1984); Brodeur et al. , Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) p. 51-63]. The culture medium in which the hybridoma cells are cultured can be tested for the presence of monoclonal antibodies directed against PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can be determined, for example, by the Scatchard analysis of Munson and Pollard, Anal. Biochem. , 107: 220 (1980) After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and can be grown by standard methods [Goding, supra]. Suitable culture medium for this purpose includes, for example, Eagle's medium modified by Dulbecco and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal. The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification methods such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity. Monoclonal antibodies can also be made by DNA methods. recombinant, such as those described in U.S. Patent No. 4,816,567. The DNA encoding the monoclonal antibodies of the invention can be easily isolated and sequences using conventional methods (for example by the use of oligonucleotide probes that are capable of specifically binding to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA can be placed in expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells or myeloma cells that do not otherwise produce protein. immunoglobulin to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA can also be modified, for example, by substituting the coding sequence for the constant domains of the human heavy and light chain in place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison et al. , supra] or by covalently joining to the immunoglobulin coding sequence of all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be replaced by the constant domains of an antibody of the invention, or it can be substituted by the variable domains of a site that combines antigen of an antibody of the invention to create a chimeric bivalent antibody. The antibodies can be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art, for example, one method involves the recombinant expression of the immunoglobulin light chain and the modified heavy chain. The heavy chain is generally truncated at any point in the Fc region so as to prevent cross-linking of the heavy chain. Alternatively, the important cysteine residues are substituted with another amino acid residue or are deleted so as to prevent cross-linking.

In vi tro methods are also suitable for preparing monovalent antibodies. The digestion of the antibodies to produce fragments thereof, particularly Fab fragments, can be carried out using systematic or routine techniques known in the art. 3. Humanized and humanized antibodies Antibodies PR0201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PRO710, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 may also comprise humanized antibodies or human antibodies . Humanized forms of non-human (eg murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab ', F (ab') 2 or other sequences of the antibodies which bind to antigens) which contain a minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (receptor antibody) in which the residues of a receptor complementarity determining region (CDR) are replaced by residues of a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit that It has the desired specificity, affinity and capacity. In some cases, the Fv infrastructure residues of human immunoglobulin are replaced by the corresponding non-human residues. Humanized antibodies can also comprise residues which are not found in the recipient antibody or in the imported CDR or in the infrastructure sequences. In general, the humanized antibody will substantially comprise all or at least one, and typically two variable domains in which all, or substantially all, of the CDR regions correspond to those of non-human immunoglobulin and all or substantially all of the FR regions are those of a consensus sequence of human immunoglobulin. The humanized antibody optimally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al. , Nature, 321: 522-525 (1986); Riechmann et al. , Nature, 332: 323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992) 1. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced therein from a source which is non-human. These non-human amino acid residues are often referred to as "imported" residues which are typically taken from an "imported" variable domain. Humanization can be carry out essentially following the method of Winter and collaborators [Jones et al. , Nature, 321: 522-525 (1986); Riechmann et al. , Nature, 332: 323-327 (1988); Verhoeyen et al. , Science, 239: 1534-1536 (1988)], by replacing the CDR of the rodent or the CDR sequences with the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact variable domain has been replaced by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al. , J. Mol Biol., 222: 581 (1991)]. The techniques of Colé et al. , and Boerner et al. , also available for the preparation of human monoclonal antibodies (Colé et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p.77 (1985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991).] Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, by example, mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon exposure, human antibody production is observed, which closely resembles that seen in humans in all aspects, including gene rearrangement, assembly and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5, 661, 016 and in the following scientific publications: Marks et al. , Bio / Technology, 10: 779-783 (1992); Lonberg et al. , Nature, 368: 856-859 (1994); Morrison Nature, 368: 812-13 (1994); Fishwild et al. , Nature Biotechnology, 14: 845-51 (1996); Neuberger, Nature Biotechnology, 14; 826 (1996); Lonberg and Huszar, Intern. • Rev. Immunol., 13: 65-93 (1995). 4. Antibody-dependent enzyme-mediated precursor therapy (ADEPT) The antibodies of the present invention can also be used in ADEPT by conjugation of the antibody to a precursor activating enzyme which converts a precursor (eg a peptidyl chemotherapeutic agent, see WO 81/01145) to an active anticancer drug. See, for example, WO 88/07378 and U.S. Patent No. 4,975,278.

The enzyme component of the immunoconjugate useful for ADEPT includes any enzyme capable of acting on a precursor in such a way as to convert it into a more active cytotoxic form. Enzymes that are useful in the method of this invention include, but are not limited to, glycosidase, glucose oxidase, human lysosim, human glucuronidase, alkaline phosphatase useful for converting phosphatase containing precursors into free drugs, aryl sulphatase useful for converting precursors containing sulfate in free medications; cytosine deaminase useful for converting non-toxic 5-fluorocytosine into an anti-cancer drug 5-fluorouracil; proteases such as serratia protease, thermolysin, subtilisin, carboxypeptidases (e.g. carboxypeptidase G2 and carboxypeptidase A). and captasins (such as captasins B and L) that are useful for converting precursors containing peptides into free drugs; D-alanylcarboxypeptidases, useful for converting precursors containing D-amino acid substituents; enzymes that separate carbohydrates such as β-galactosidase and neuraminidase useful for converting glycocylated precursors into free drugs; ß-lactamase useful for converting drugs derivatized with ß-lactams into free medicines; and penicillin amidases such as penicillin V amidase or penicillin G amidase, useful for converting derivatized drugs into their amine nitrogens with phenoxyacetyl or phenylacetyl groups, respectively, into free drugs. Alternatively, antibodies with enzymatic activity, also known in the art as "abzymes" (abzymes) can be used to convert the precursors of the invention into free active drugs (see, eg, Massey, Nature, 328: 457- 458 (1987)). The antibody-abzyme conjugates can be prepared as described herein for delivery of the abzyme to a population of tumor cells. The enzymes of this invention can be covalently linked to antibodies against PRO201, against PR0292, against PR0327, against PR01265, against PR0344, against PR0343, against PR0347, against PR0357, against PRO710, against PRO1017, against PR01112, against PRO509, against PR0853 or against PR0882 by techniques well known in the art such as the use of heterobifunctional crosslinking agents discussed above. Alternatively, fusion proteins comprising at least one region of the antibody of the invention that binds to the antigen, bound by at least one functionally active portion of an enzyme of the invention, can be constructed using well known recombinant DNA techniques. in art (see, for example, Neuberger et al., Nature, 312: 604-608 (1984). . %, *, * & * - 5. Bispecific antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized, which have 5 binding specificities for at least two different antigens. In the present case, one of the binding specificities is by PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and the other is by any other antigen, and preferably by a LO cell surface protein or by a receptor or receptor subunit. Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the L5 coexpression of two heavy chain / immunoglobulin light chain pairs, wherein the two heavy chains have different specificities (Milstein and Cuello, Nature, 305: 537-53 [1983]). Due to the random assignment of heavy and light immunoglobulin chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only has the correct bispecific structure. The purification of the correct molecule is usually carried out by affinity chromatography steps. Procedures are described - ^ & Í * Á. ? ^ íí í .. ^ •! .- .. > :,:. similar in WO 93/08829, published May 13, 1993 and in Traunecker et al. , EMBO J., 10: 3655-3659 (1991). The variable domains of antibody with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant-domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain comprising at least part of the hinge, CH2 and CHE3 regions. It is preferred to have a first heavy chain constant region (CH1) containing the site necessary for light chain binding present in at least one of the fusions. The DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details of the generation of bispecific antibodies see, for example, Suresh et al. , Methods in Enzymology, 121: 210 (1986). According to another approach described in WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from a culture of recombinant cells. The preferred interface comprises at least part of the CH3 region of an antibody constant domain. In this method, one or more side chains of small amino acids from the interface of the first antibody molecule are replaced with larger side chains (for example tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the chain or large side chains are generated at the interface of the second antibody molecule by replacing side chains of large with small amino acids (for example alanine or threonine). This provides a mechanism to increase the performance of the heterodimer on the unwanted end products such as homodimers. Bispecific antibodies such as full-length antibodies or antibody fragments can be prepared (for example, bispecific antibodies F (ab ') 2. The techniques for generating bispecific antibodies from fragments antibodies have been described in the literature. For example, bispecific antibodies can be prepared using chemical bonding. Brennan et al. , Science, 229: 81 (1985) describe a method wherein the intact antibodies are proteolytically separated to generate F (ab ') 2 fragments. These fragments are reduced in the presence of a dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent the formation of intermolecular disulfide. The Fab 'fragments generated afterwards are converted to thionitrobenzoate derivatives (TNB). One of the derivatives of Fab '-TNB then converts back to Fab'- This is followed by reduction with mercaptoethylamine and mixing with an equimolar amount of another Fab '-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes. Fab 'fragments can be recovered directly from E. coli and can be chemically coupled to form bispecific antibodies. Shalaby et al. , J. Exp. Med., 175: 217-225 (1992) describe the production of a fully humanised F (ab ') 2 molecule of bispecific antibody. Each Fab 'fragment is secreted separately from E. coli and subjected to directed chemical coupling in vi tro to form the bispecific antibody. The bispecific antibody that is thus formed is capable of binding to cells overexpressing the ErbB2 receptor and normal human T cells, as well as activating the lytic activity of human cytotoxic lymphocytes against human breast tumor targets. Various techniques for making and isolating bispecific antibody fragments directly from a recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol. 148 (5): 1547-1553 (1992). The leucine zipper peptides of the Fos and Jun proteins are bound to the portions ÍJI Í J. Í- ^ -i-. ». or" ...

Fab 'of two different antibodies by gene fusion. The antibody homodimers are reduced in the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be used for the production of antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Nati Acad. Sci. USA 90 .: 6444-6448 (1993) has been shown to be an alternative mechanism for making bispecific antibody fragments. The fragments comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) by a linker which is too short to allow pairing between the two domains of the same chain. Accordingly, the VH and VL domains of one fragment are bound to pair with the VL and VH domains complementary to another fragment, thereby forming two antigen binding sites. Another strategy for making bispecific antibody fragments by the use of single chain Fv dimers (sFv) has also been reported see Gruber et al., J. Immunol. 152: 5368 (1994). - Antibodies with more than two valences are contemplated. For example, trispecific antibodies can be prepared Tutt et al., J. Immunol. 147: 60 (1991). Exemplary bispecific antibodies can bind to two different epitopes of a polypeptide given herein. Alternatively, you can combine an arm of polypeptide against an arm which binds to an activation molecule in a leukocyte such as a T cell receptor molecule (e.g., CD2, CD3, CD28, or B7), or Fc receptors for IgG (Fc? R), such as Fc? RI (CD64), Fc? RII (CD32) and Fc? RIII (CD16), so that they focus the cellular defense mechanisms on the cell expressing the particular polypeptide. Bispecific antibodies can also be neutralized to localize cytotoxic agents to cells which express a particular polypeptide. These antibodies possess a polypeptide binding arm and an arm which binds to a cytotoxic agent or a radionuclide chelator such as EOTUBE, DPTA, DOTA or TETA. Another bispecific antibody of interest binds to the polypeptide and binds additionally to tissue factor (TF). 6. Heteroconjugate Antibodies Heteroconjugate antibodies are constituted by two covalently bound antibodies. Such antibodies, for example, have been proposed to target cells of the immune system to unwanted cells [U.S. Patent No. 4,676,980], and for the treatment of HIV infection [WO 91/00360].; WO 92/200373; EP 03089)]. It is contemplated that the antibodies can be prepared in vi tro using known methods in synthetic protein chemistry including those involving crosslinking agents. For example, immunotoxins can be constructed using a disulfide exchange reaction or by the formation of a thioether linkage. Examples of reagents suitable for this purpose include iminothiolate and methyl 4-mercaptobutyrimidate and are described, for example, in U.S. Patent No. 4,676,980. 7. Engineering for the Effector Function It may be desirable to modify the antibody of the invention with respect to effector function so as to improve the effectiveness of the antibody to treat cancer, for example. In this manner, cysteine residues or residues can be introduced into the Fc region, whereby the formation of a cross-linked sulfide bond in this region is allowed. The homodimeric antibody generated in this way may have an improved internalization capacity or cell destruction mediated by increased complement and antibody-dependent cellular cytotoxicity (ADCC). See Carón et al., J. EXP Med .. 176: 1191-1195 (1992) and Shopes, J. Immunol. , 148. = 2918-2922 (1992). Homodimeric antibodies with improved antitumor activity can also be prepared using heterobifunctional crosslinkers as described in Wolff et al. Cancer Research, .53: 2560-2565 (1993). By way of Alternatively, an antibody that has double Fc regions can be engineered and therefore can have enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Desiqn, 3: 219-230 (1989). 8. Immunocon ugados The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxins (for example an enzymatically active toxin of bacterial, fungal, fungal or animal origin, or a fragment thereof), or a toxin of the small molecule or a radioactive isotope (ie, a radioconjugate). Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above. The enzymatically active protein toxins and fragments thereof that have been used include the diphtheria A chain, the non-binding active fragments of the diphtheria toxin, the cholera toxin, the botulinus toxin, the exotoxin A chain (from Pseudomonas aeruginosa), the ricin A chain, the abrin A chain, the modeccin A chain, alpha-sarcin, Aleuri tes fordii proteins, diantine proteins, Phytolaca americana proteins (PAPI, PAPII and PAP-S ), inhibitor of momordica carantia, curcinia, crotina, inhibitor of sapaonaria oficinalis, gelonin, saporin, mitogeline, restrictocin, phenomycin, enomycin and trichothecenes. The toxins of molecules include, for example, caleamyamycins, maytansinoids, palitoxin and CC1065. Various radionuclides are available for the production of radioconjugated antibodies. Examples include 212Bi, 131l, 131In, 90Y and 186Re. The conjugates of the cytotoxic antibody agent are made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as hydrochloride dimethyl adipimidate), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehydes), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis- (p. diazonium benzoyl) -ethylenediamine), diisocyanates (such as 2,6-toluene diisocyanate), and fluoro bis-active compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, a castorium immunotoxin can be prepared as described in Vitetta et al., Science, 238: 1098 (1987). Carbon-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See WO 94/11026. i * H? ¡k £ A.í. &traJ. go.. ". In another embodiment, the antibody can be conjugated to a "receptor" (such as streptavidin) for use in the pre-targeting of tumors wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then the administration of a "ligand" (e.g., avidin) that is conjugated to a cytotoxic agent (e.g., a radionucleotide). 9. Immunoliposomes The antibodies described herein may also be formulated as immunoliposomes. Liposomes that contain the antibody are prepared by methods known in the art, such as those described in Epstein et al., Proc. Nati Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Nati Acad. Sci. USA, 77: 4030 (1980); and U.S. Patent Nos. 4,485,045 and 4,544,545. Liposomes with improved circulation time are described in U.S. Patent No. 5,013,556. Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and phosphatidyletalonamine derivatized with PEG (PEG-PE). Liposomes are extruded through pore size filters T i. rt - »^ ¿. | 1 ^ defined to provide liposomes with the desired diameter. The Fab 'fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al., J. Biol. Chem., 257: 286-288 (1982) via a disulfide exchange reaction. A chemotherapeutic agent (such as doxorubicin) is optionally contained within the liposome. See Gabizon et al., J. National Cancer Inst. , 81 (19): 1484 (1989).

N. Pharmaceutical Compositions Antibodies that specifically bind the product of an amplified gene identified herein, as well as other molecules identified by the test assays described in the foregoing, may be administered for the treatment of tumors, including cancers, in the form of pharmaceutical compositions. If the protein encoded by the amplified gene is intracellular and the complex antibodies are used as inhibitors, internalizing antibodies are preferred. However, lipofections or liposomes can also be used to deliver the antibody or an antibody fragment within the cells. When antibody fragments are used, the smaller inhibitory fragment that binds specifically to the binding domain of the target protein is which is preferred. For example, based on the variable region sequences of an antibody, peptide antibody molecules can be designed to retain the ability to bind the target protein sequence. Such peptides can be chemically synthesized or can be produced by recombinant DNA technology. See, for example, Marasco et al., Proc. Nati Acad. Sci. USA, 90.7889-7893 (1993). Therapeutic formulations of the antibody are prepared for storage by mixing the antibody having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. [1980]) in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients or stabilizers are non-toxic to the recipient at the dosages and concentrations used and include buffers such as phosphate, citrate and other organic acids; antioxidants that include ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzylammonium chloride, hexamethoxide chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propylparaben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol); polypeptides of low molecular weight (less than about 10 residues); proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; Salt-forming counterions such as sodium; metal complexes (eg, Zn-protein complexes) or non-ionic surfactants such as TWEEN ™, PLURONICS "or polyethylene glycol (PEG) The non-antibody compounds identified by the test assays of the present invention can be formulated in a manner Analogously, using standard techniques well known in the art The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities and which do not adversely affect each other. Alternatively or additionally, the composition may comprise a cytotoxic agent, cytokine or growth inhibitory agent.The molecules are usually present in combination in amounts that are effective for the purpose they are designed in. The active ingredients may also be entrapped in prepared microcapsules, for example, by conservation techniques n or by interfacial polymerization, for example hydroxymethylcellulose or gelatin microcapsules and poly- (methyl methacrylate) microcapsules respectively, in colloidal drug delivery systems (e.g., liposomes, microemulsion microspheres, microemulsions, nanoparticles and nanocapsules) or in microemulsions. Such techniques are described in Remington's Pharmaceutical Sciences, 16th edition, Osol. A. ed. (1980). The formulations to be used for in vivo administration must be sterile. This is easily carried out by filtration through sterile filtration membranes. Sustained release preparations can be prepared. Suitable examples of sustained release preparation include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, for example films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels, for example poly (2-hydroxyethyl methacrylate) or polyvinyl alcohol), polylactides (U.S. Patent 3,773,919), L-glutamic acid copolymers and L Ethylglutamate, ethylene vinyl acetate, non-degradable, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOTm (injectable microspheres consisting of copolymer of lactic acid-glycolic acid and leuprolide acetate) and poly-D- (- -3-hydroxybutyric. Although polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow the release of molecules for more than 100 days, certain hydrogels release proteins for shorter periods of time. When the encapsulated antibodies remain in the body for a long time, they can be denatured or added as a result of exposure to humidity at 37 ° C, resulting in a loss of biological activity and possible changes in immunogenicity. Reasoning strategies can be designed for stabilization based on the mechanisms involved. For example, if it is discovered that the aggregation mechanism is the formation of an SS intermolecular bond by a thio-disulfide exchange, the stabilization can be carried out by modifying the sulfhydryl residues, lyophilizing from acid solutions, controlling the content of moisture, using appropriate additives and developing specific polymer matrix compositions.

O. Methods of treatment It is contemplated that antibodies and other antitumor compounds of the present invention can be used to treat various conditions, including those characterized by overexpression or activation of amplified genes. j. * aha??, you. ^^ £ ^ ¡¡^ j ^ > «** tx ..« .tj? J identified here. Exemplary conditions or disorders to be treated with such antibodies and other compounds include but are not limited to small organic and inorganic molecules, peptides, antisense molecules, which include benign or malignant tumors (eg, renal, hepatic, renal, renal carcinoma). bladder, breast, gastric, ovarian colorectal, prostate, pancreatic, pulmonary, bulbous, thyroid, liver carcinoma, sarcoma, glioblastomas and various tumors of the head and neck); leukemias and malignant lymphoid cancers; other disorders such as neuronal, glial, astrocytal, hypothalamic and other glandular disorders, of macrophages, epithelial, stromal and blastocoelic disorders; as well as inflammatory, angiogenic and immunological disorders. The antitumor agents of the present invention, for example, the antibodies are administered to a mammal, preferably a human, according to known methods, such as intravenous administration as a bolus or as a continuous infusion over a period of time, intramuscularly, intraperitoneal, intracerebroespinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical or by inhalation. Intravenous administration of the antibody is preferred. Other therapeutic regimens may be combined with the administration of anticancer agents, for example antibodies of the present invention. For example, the patient who is to be treated with such anti-cancer agents may also receive radiation therapy. Alternatively or additionally, a chemotherapeutic agent may be administered to the patient. The preparation and dosing protocols for such chemotherapeutic agents can be used according to the manufacturer's instructions or can be determined empirically by persons skilled in the art. Preparation and dosing protocols for such chemotherapy are also described in Chemoteraphy Service, ed., M.C. Perry, Williams & Wiikins, Baltimore, MD (1992). The chemotherapeutic agent can precede or follow the administration of an antitumor agent, for example, the antibody or it can be administered simultaneously with the same. The antibody can be combined with an anti-estrogen compound, such as tamoxifen or an anti-progesterone agent such as onapristone (see EP 616812) in known dosages for such molecules. It may also be desirable to administer antibodies against tumor-associated antigens, such as antibodies which bind to factor ErbB2, EGFR, ErbB3, ErbB4 or vascular endothelial factor (VEGF). Alternatively or additionally, two or more antibodies that bind to the same or two or more different antigens described herein may be co-administered to a patient. Sometimes it can be beneficial rr ..,?,. m ... ..... ",,, .., ..,.,., r .. ^. ^ ...,,. * .. * «Í. ^?. ^ < Íltk.áií.? also administer one or more cytokines to the patient. In a preferred embodiment, the antibodies herein are co-administered with a growth inhibitory agent. For example, the growth inhibitory agent can be administered first, followed by an antibody of the present invention. However, simultaneous administration or administration of the antibody of the present invention first is also contemplated. Suitable dosages for the growth inhibitory agent are those currently used and may be decreased due to the combined action (synergy) of the growth inhibitory agent and the antibody therein. For the prevention or treatment of diseases, the appropriate dosage of an antitumor agent, for example an antibody in the present will depend on the type of disease to be treated, as defined above, the severity and development of the disease, whether the agent is administered for preventive or therapeutic purposes, the previous therapy, the background of the patient and the response to the agent as well as the opinion of the attending physician. The agent is suitably administered to the patient once over a series of treatments. For example, based on the type and severity of the disease, about 1 μg / kg to 15 mg / kg (for example 0.1-20 mg / kg) of antibody is an initial candidate dosage for administration to the patient, eg, already either for one or more separate administrations or by continuous infusion. A typical daily dosage may vary from about 1 μg / kg to 100 mg / kg or greater, based on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until the desired suppression of the symptoms of the disease occurs. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and trials.

K. Articles of Manufacture In another embodiment of the invention, there is provided an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above. The article of manufacture comprises a package and a label. Suitable containers include, for example, bottles, flasks, syringes and test tubes. The containers can be made of different materials such as glass or plastic. The package maintains a composition which is effective for the diagnosis or treatment of the condition and may have a hole for sterile access (for example, the container containing an intravenous solution bag or a vial having a stopper that can be pierced by a needle for hypodermic injection). The active agent in the composition is usually an antitumor agent capable of interfering with the activity of a gene product identified herein, for example an antibody. The label on, or associated with, the container indicates that the composition is used for diagnosis or treatment of the condition of choice. The article of manufacture may further comprise a second container comprising a pharmaceutically acceptable buffer, such as phosphate buffered saline, Ringer's solution and dextrose solution. It may also include other desirable materials from a commercial and user's point of view, including other dampers, diluents, filters, needles, syringes and package inserts with instructions for use.

Q. Diagnosis and Prognosis of Tumors Although cell surface proteins such as growth receptors are overexpressed in certain tumors are excellent targets for tumor treatment candidate drugs (eg cancer), the same proteins together with secreted proteins encoded by the amplified genes in tumor cells find Additional use in the diagnosis and prognosis of tumors. By For example, antibodies directed against the protein products of genes amplified in tumor cells can be used as diagnostic or prognostic elements of tumors. For example, antibodies, including antibody fragments, can be used to qualitatively or quantitatively detect the expression of proteins encoded by the amplified genes ("marker gene products"). The antibody is preferably equipped with a fluorescent label, for example detectable, and the binding can be monitored by light microscopy, flow cytometry, fluorimetry or other techniques known in the art. These techniques are particularly suitable if the amplified gene encodes a cell surface protein, for example a growth factor. Such binding assays are performed essentially as described in section 5 above. The detection in si of the antibody that binds the marker gene products can be carried out, for example, by immunofluorescence or microscopy -inmunoelectronics. For this purpose, the histological sample is removed from the patient, a labeled antibody is applied thereto, preferably by superimposing the antibody on a biological sample. This procedure also allows determining the distribution of the marker gene product in the examined tissue. It will be apparent to those skilled in the art that they are available easily a wide variety of histological methods for detection in si tu. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. All patent and literature references mentioned in the present specification are incorporated herein by reference in their entirety.

EXAMPLES The commercially available reagents referred to in the examples are used according to the manufacturer's instructions, unless otherwise indicated. The source of the cells identified in the following examples and through the specification by the ATCC access numbers is the American Type Culture Collection, 10801 University BIvd., Manassas, VA 20110-2209. All the original deposits referred to in the present invention are made under the provisions of the Budapest Treaty with respect to the international recognition of the deposit of microorganisms for the purpose of patent procedure and the regulations thereof (Budapest Treaty) . This ensures the maintenance of a viable culture of the deposit for 30 years from the date of deposit.

The deposit will be made available by ATCC under the terms of the Budapest Treaty and will be subject to an agreement between Genentech Inc. and ATCC, which ensures the permanent and unrestricted availability of the progeny of the deposit to the public before the publication of the relevant United States patent or before the opening to the public of any United States or foreign patent application, whichever comes first, and ensures the availability of the progeny to one determined by the Commissioner of the United States.

United States of Patents and Trademarks who are qualified for it, in accordance with 35 USC § 122 and the rules of the commissioner in accordance with the same (which includes 37 CFR § 1.14, with particular reference to 886 OG 638). Unless otherwise indicated, this The invention uses conventional or standard methods of recombinant DNA technology, such as those described above, in the following textbooks: Sambrook et al. , Molecular Cloning: A Laboratorv Manual, Cold Spring Harbor Press N.Y. , 1989; Ausubel et al. , - Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y., 1989; Innis et al. , PCR Protocols: A Guide to Methods and Applications. Academic Press. Inc., N.Y. , 1990; Harlow et al. , Antibodies: A Laboratory Manual Cold Spring Harbor Press. Cold Spring Harbor, 1988; Gait, Oliqonucleotide Synthesis, IRL Press, Oxford, 1984; R. I. Freshney, Animal Cell Culture, 1987, Coligan et al. , Current Protocols in Immunoloqy, 1991.

EXAMPLE 1 Extracellular domain homology test to identify novel polypeptides and cDNA encoding them Extracellular domain (ECD) sequences (which include the secretion signal sequence, if any) from approximately 950 known secreted proteins from the Swiss-Prot public database are used to investigate EST databases. EST databases include public databases (for example Dayhoff, GenBank), and registered databases (for example LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The search is performed using the BLAST or BLAST-2 computer program (Altschul et al., Methods in Enzvmology 266 .: 460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons with a BLAST score of 70 (or, in some cases, 90) or higher that do not code for known proteins are grouped and assembled into consensus DNA sequences with the "phrap" program (Phil Green, University of Washington, Seattle, Washington).

Using this extracellular domain homology test, consensus DNA sequences are assembled in relation to the other EST sequences identified using phrap. In addition, the consensus DNA sequences obtained frequently (but not always) are extended using repeated cycles of BLAST or BLAST-2 and phrap to extend the consensus sequences as much as possible using the sources of EST sequences discussed above. Based on the consensus sequences that are obtained as described above, the oligonucleotides are then synthesized and used to identify by PCR a cDNA library containing the sequence of interest and for use as probes, to isolate a clone from the sequence that codes for the full length for a PRO polypeptide. The direct and reverse PCT primers generally range from 20 to 30 nucleotides and are often designed to provide a PCR product of approximately 100-1000 bp in length. Probe sequences are typically 40-55 bp in length. In some cases additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. In order to analyze several libraries for a full-length clone, the DNA of the libraries is examined by PCR amplification, as established by Ausubel et al., Current Protocols in Molecular Biology, with the PCR primer pair. Then a positive library is used to isolate l aa a A gj. ^ a. ^ = i aaí.Aa.i ia ^ rf clones that code for the gene of interest using the oligonucleotide probe and one of the primer pairs. The cDNA libraries used to isolate cDNA clones are constructed by standard or conventional methods using commercially available reagents such as those from Invi trogen, San Diego, CA. The cDNA is primed with oligo dT containing a NotI site, blunt-ended to Sali hemicinized adapters, separated with NotI, sized appropriately by gel electrophoresis and cloned in an operation defined in a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al., Science, 253 .: 1278-1280 (1991) at the unique sites Xhol and Notl.

EXAMPLE 2: Isolation of cDNA clones using signal algorithm analysis Several nucleic acid sequences encoding polypeptides have been identified by applying a recorded signal sequence finding algorithm developed by Genentech, Inc., (South San Francisco, CA) on ESTs as well as on clustered and assembled fragments of ESTs. of public databases (for example GenBank) or private databases , J, ^, ^ A - .¿: .-?.,.,,,,,,,,,,,,,,,,,, (LIFESECAX Incyte Pharmaceuticals, Inc., Palo Alto, CA) . The signal sequence algorithm calculates a secretion signal qualification based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codons (ATG) at the 5 'end of the sequence or sequence fragment. under consideration Nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required amino acids, the second one is not examined. If none satisfies the requirement, the candidate sequence is not qualified. In order to determine if the EST sequence contains an authentic signal sequence, the DNA corresponding to the amino acid sequences surrounding the ATG codon is scored using a set of seven detectors (evaluation parameters) known to be associated with the secretion signals. The use of this algorithm results in the identification of numerous nucleic acid sequences encoding polypeptide.

EXAMPLE 3 Isolation of cDNA clones encoding human PRO201 An expressed sequence tag (EST) DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) is examined and an EST (1328938, also designated DNA28710) which is found in a fetal pancreas library is identified. and which shares significant identity with the Shc adapter protein. A full-length cDNA corresponding to the EST isolated from a human fetal kidney library is cloned using an in vivo cloning technique in pRK5. The cDNA libraries used to isolate the cDNA clones encoding human PRO201 are constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The DNA is primed with oligo dT containing a NotI site, bound with the blunt part to the hemicinized SalI adapters, separated with NotI, sized appropriately by gel electrophoresis and cloned in a defined orientation in a vector suitable cloning (such as pRKB or pRKD; pRK5B is a precursor of pRK5D not containing the SfiJ site; see Holmes et al., Science, 253: 1278-1280 (1991)) in unique Xhol and Notl. EST Incyte-based probes number 1328938 are used to examine a cDNA library derived from a human fetal kidney library: cloning primer: 5 '-ACTGAGGCCTGTTGAAAGTGCAGAGCTCAG-3' (SEQ ID NO: 3) Enrichment primer: 5'-GCTGAAGAAGAGCTTCAG-3 '(SEQ ID NO: 4) A full-length clone [DNA30676-1223] containing a single open reading frame with an apparent translation start site at nucleotide positions 152-154 and a stop signal at nucleotide positions 1880-1882 is identified (FIG. 1, SEC. FROM IDENT. NO: 1). The predicted polypeptide precursor is 576 amino acids in length, has a calculated molecular weight of approximately 63,094 dalton units and an estimated pl of approximately 7.26. Analysis of the full length PRO201 sequence shown in Figure 2 (SEQ ID NO: 2) makes evident the presence of a variety of important polypeptide domains, as shown in Figure 2, where the positions provided for these important polypeptide domains are approximate, as described above. Analysis of the full-length PRO201 polypeptide shown in Figure 2 makes the presence of the following apparent: An AMPc and cGMP-dependent protein kinase phosphorylation site from about amino acid 142 to about amino acid 146; N-myristoylation sites from about amino acid 41 to about amino acid 47, from about amino acid 107 to about amino acid 111, from about amino acid 164 to about amino acid 170, from about amino acid 203 to about amino acid 209, from about amino acid 243 to about amino acid 249, from about amino acid 343 to about amino acid 349, from about amino acid 460 to about amino acid 466, from about amino acid 546 to about amino acid 552, and from about amino acid 551 to about amino acid 557; an amidation site from about amino acid 97 to about amino acid 101; a prokaryotic membrane lipoprotein lipid binding site from about amino acid 371 to about amino acid 382; and a leucine zipper pattern from about amino acid 184 to about amino acid 206. The clone DNA20676-1223 has been deposited with ATCC on September 23, 1997 and has been assigned ATCC deposit number 209567. Based on the analyzes of BLAST and FastA sequence alignment of the full-length sequence shown in Figure 2 (SEQ ID NO: 2), PRO201 shows an amino acid sequence identity with the Sck and Shc proteins.

EXAMPLE 4 Isolation of cDNA clones encoding human PRQ292 PR0292 is identical to the DAP-7 protein associated with human death, also called cathepsin D. The amino acid sequence of this protein of 412 amino acids is present in the public Dayhoff database under the accession numbers CATD_HUMAN and P_R74207 and is shown in Figure 4 (SEC.

IDENT. NO 6) . The nucleotide sequence of DNA encoding PR0292 is shown in Figure 3 (SEQ ID NO: 5). The analysis of the full-length sequence PR0292 shown in Figure 4 (SEQ ID NO: 6) evidences the presence of a variety of important polypeptide domains, as shown in Figure 4, where the Given positions for those polypeptide domains are approximate, as described above. Analysis of the full length PR0292 polypeptide shown in Figure 4 makes evident the presence of the following: a signal peptide from about amino acid 1 to about the amino acid , N-glycosylation sites from about amino acid 134 to about amino acid 138, and from about amino acid 263 to about tABl .. r. "i, s.S, r.r, amino acid 267; a tyrosine kinase phosphorylation site from about amino acid 72 to about amino acid 81; N-myristoylation sites from about amino acid 145 to about amino acid 151, from about amino acid 248 to about amino acid 254, and from about amino acid 282 to about amino acid 288; and a leucine zipper pattern from about amino acid 335 to about amino acid 357. DAP-7 has also been described in WO 95/10630 published April 20, 1995 and in Faust et al. , Proc. Nati Acad. Sci. USA, 82: 4910-4914 (1985).

EXAMPLE 5 Isolation of cDNA clones that encode human PR0327 A DNA database of expressed sequence tag (EST) (LIFESEOJ ", Incyte Pharmaceuticals, Palo Alto, CA) and various EST sequences are identified which show certain degrees of homology with the human prolactin receptor protein. A consensus DNA sequence is assembled in relation to other EST sequences that use phrap as described in Example 1 above. This consensus sequence is designated herein as DNA38110. Based on the DNA38110 consensus sequence, oligonucleotides are synthesized: 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) for use as probes to isolate a clone in the full-length coding sequence for PR0327 . A pair of PCR primers is synthesized (direct and inverse): 'direct PCR primer -CCCGCCCGACGTGCACGTGAGCC-3' (SEQ ID NO: 9) reverse PCR primer 5"-TGAGCCAGCCCAGGAACTGCTTG-3 '(SEQ ID NO: 10) Additionally, a synthetic oligonucleotide hybridization probe of the DNA38110 consensus sequence is constructed which has the following nucleotide sequence: Hybridization probe: 5 '-CAAGTGCGCTGCAACCCCTTTGGCATCTATGGCTCCAAGAAAGCCGGGAT-3' (SEQ ID NO: 11).

In order to examine several libraries for a source of a full-length clone, the DNA of the libraries is examined by PCR amplification with the PCR primer pair identified above. A positive library is then used to isolate clones encoding the PR0327 gene using the oligonucleotide probe and one of the PCR primers. RNA for construction of cDNA libraries is isolated from human fetal lung tissue (LIB26). DNA sequencing of the isolated clones, which are isolated as described above, provides the full-length DNA sequence for DNA38113-1230 [FIG. 5, SEQ. FROM IDENT. NO: 7) and the derived protein sequence for PR0327. The entire coding sequence of DNA38113-1230 is included in Figure 5 (SEQ ID NO: 7). The clone DNA38113-1230 contains a single open reading frame with a traditional apparent start site at nucleotide positions 131-133 and an apparent stop codon at nucleotide positions 1397-1399. The predicted polypeptide precursor is 422 amino acids in length. The analysis of the full length PR0327 sequence shown in Figure 6 (SEQ ID NO: 8) makes evident the presence of a variety of important polypeptide domains, where the positions provided for these important polypeptide domains are approximate , as described in the above. Analysis of the full-length PR0327 polypeptide shown in Figure 6 makes evident the presence of the following: A signal peptide from about amino acid 1 to about 5 amino acid 30; N-glycosylation sites from about amino acid 92 to about 96 amino acid, from about amino acid 104 to about amino acid 108, from about amino acid 140 to about amino acid 144, from about amino acid 168 to about amino acid 172, from about amino acid 292 to about amino acid 296, and from about amino acid 382 to about amino acid 386; an AMPc and cGMP-dependent protein kinase phosphorylation site from to amino acid 413 to approximately amino acid 417; phosphorylation sites of casein kinase II from about amino acid 44 to about amino acid 48, from about amino acid 183 to about amino acid 187, and from about amino acid 205 to approximately amino acid 209; N-myristoylation sites from about amino acid 30 to about amino acid 36, from about amino acid 37 to about amino acid 43 and from about amino acid 73 to about amino acid 79, from about amino acid 121 to ^ t .ij.A & flinsfc, * »'' *" - '.. .. SSJ ^^ ** Mß., mrrr® ... M * t¡,? i; -r ¡i.-,, r, m ^^ ". M > - &, L '?? approximately amino acid 127, from about amino acid 179 to about amino acid 185, from about amino acid 218 to about amino acid 224, from about amino acid 300 to about 5 amino acid 306, from about amino acid 317 to about amino acid 323, from about amino acid 320 to about amino acid 326, from about amino acid 347 to about amino acid 353, from about amino acid 355 to about amino acid 361, and from about amino acid 407 to about amino acid 413; amidation sites from about amino acid 3 to about amino acid 7, from about amino acid 79 to about amino acid 83 and from about amino acid 411 to about amino acid 415; and a signature of the growth factor family and the cytokine receptor 2, from about amino acid 325 to about amino acid 332. The clone DNA38113-1230 has been deposited with ATCC on September 10, 1997 and has been assigned ATCC deposit number 209530. The full-length protein PR0327 shown in Figure 6 has an estimated molecular weight of approximately 46302 Dalton units and a Pl of approximately 9.42.

An analysis of the full length sequence of PR0327, shown in Figure 6 (SEQ ID NO: 8), suggests that it has significant homology to the human prolactin receptor binding protein, indicating that PR0327 may be a novel prolactin-binding protein .

EXAMPLE 6 Isolation of cDNAs encoding human PR01265 DNA60764-1533 is identified by the application of an algorithm to find a registered signal sequence, described in Example 3 above. The use of the signal sequence algorithm described above allows the identification of an EST group sequence from the LIFESEQ ™ database, designated Incyte EST group number 86995. This EST group sequence is then compared to various tag databases from expressed sequence (EST) which includes public EST database (for example GenBank) and a registered EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search is performed using the BLAST or BLAST2 computer program (Altshul et al., Methods in Enzvmology, 266-460-480 (1996)). Those comparisons that result in a BLAST score of 70 (or in some cases ÍÍSÍ4.LL, J ... ÍT, .A of 90), or greater and that do not code for known proteins are grouped and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom is referred to herein as DNA55717. In light of the sequence homology between the sequence of DNA55717 and Incyte EST number 20965, Incyte EST number 20965 is acquired and the cDNA insert is obtained and sequenced. The sequence of this cDNA insert is shown in Figure 7 (SEQ ID NO: 12) and is referred to herein as DNA60764-1533. The entire coding sequence of DNA60764-1533 is included in Figure 7 (SEQ ID NO: 12). Clone DNA60764-1533 contains a single open reading frame with an apparent translational start site at nucleotide positions 79-81 and terminates at the stop codon at nucleotide positions 1780-1782 (Figure 7). The predicted polypeptide precursor is 567 amino acids long (Figure 8; SEQ ID NO: 13). The full-length protein PR01265 shown in Figure 8 has an estimated molecular weight of approximately 62,881 dalton units and a pl of approximately 8.97. The analysis of the full length sequence of PR01265 shown in Figure 8 (SEQ ID NO: 13) makes evident the presence of several important polypeptide domains, where the positions given for these important polypeptide domains are approximate, as described above. The analysis of the full length sequence of PR01265 shown in Figure 8 makes evident the presence of the following: a signal peptide from about amino acid 1 to about amino acid 21; a transmembrane domain from about amino acid 59 to about amino acid 75; N-glycosylation sites from about amino acid 54 to about amino acid 58, from about amino acid 134 to about amino acid 138, from about amino acid 220 to about amino acid 224, and from about amino acid 559 to about amino acid 563; tyrosine kinase phosphorylation sites from about amino acid 35 to about amino acid 43, and from about amino acid 161 to about amino acid 169; a D-amino acid oxidase protein site from about amino acid 61 to about amino acid 81. The clone DNA60764-1533 has been deposited with ATCC on November 10, 1998 and has been assigned ATCC deposit number 203452. The base analysis Dayhoff data (version 35.45, SwissProt 35), using the sequence alignment analysis WU-BLAST2 of the full-length sequence shown in Figure 8 (SEQ ID NO: 13), makes t¿.-Aa.¿ ^ i ^ ii ^. «í .. an important sequence identity between the amino acid sequences PR01265 and the Dayhoff sequence number MMU70249_I is evident. It is also found that there is homology between the full length sequence shown in Figure 8 (SEQ ID NO: 13) and the following Dayhoff sequences: BC542A_1, E69899, S76290, MTV014_14, AOFB_HUMAN, ZMJ002204_1, S45812_l, DBRNAPD_1 and CRT1_S0YBN.

EXAMPLE 7 Isolation of cDNA clones encoding human PR0344 A consensus DNA sequence is assembled relative to other EST sequences using phrap as described in Example 1 above. This assembled consensus sequence is identified herein as DNA34398. Based on the consensus sequence of DNA34398, oligonucleotides are synthesized: 1) to identify - by PCR - a cDNA library containing the sequence of interest, and 2) for use as probes to isolate a clone from a full-length coding sequence for PR0344. PCR primers (direct and inverse) are synthesized: direct PCR primer (34398. fl): 'ft 5' -TACAGGCCCAGTCAGGACCAGGGG-3 '(SEQ ID NO: 16) Direct PCR primer (34398.f2): 5' -AGCCAGCCTCGCTCTCGG-3 '(SEQ ID NO: 17) direct PCR primer () 34398.f3): 5 '-GTCTGCGATCAGGTCTGG-3' (SEQ ID NO: 18) Reverse PCR primer (34398. rl): 5'-GAAAGAGGCAATGGATTCGC-3 '(SEQ ID NO: 19) PCR primer Inverse (34398-r2): 5 '-GACTTACACTTGCCAGCACAGCAC-3' (SEQ ID NO: 20) Additionally, a synthetic oligonucleotide hybridization probe is constructed from the DNA34398 consensus sequence which has the following nucleotide sequence: hybridization probe (34398.pl): 5 '-GGAGCACCACCAACTGGAGGGTCCGGAGTAGCGAGCGCCCCGAAG-3' (SEQ.

IDENT. NO: 21) In order to examine several libraries to find a source of a full-length clone, DNA from the libraries is examined by PCR amplification with the PCR primer pairs identified above. A positive library is then used to isolate clones that encode the PR0344 gene using the probe oligonucleotide and one of the PCR primers. RNA for the construction of cDNA libraries is isolated from human fetal kidney tissue. DNA sequencing of the isolated clones, which are isolated as described above, provides a full-length DNA sequence for DNA40592-1242 [FIG. 9, SEQ. FROM IDENT. NO: 14]; and the protein sequence derived for PR0344. The whole of the coding sequence for DNA40592-1242 is included in Figure 9 (SEQ ID NO: 14). Clone DNA40592-1242 contains a single open reading frame with an apparent translation start site at nucleotide positions 227-229, and an apparent stop codon at nucleotide positions 956-958. The predicted polypeptide precursor is 243 amino acids in length. The analysis of the full-length sequence of PR0344 is shown in Figure 10 (SEQ ID NO: 15) and makes the presence of several important polypeptide domains evident, where the positions given for these important polypeptide domains are approximate, as described before. Analysis of the full length polypeptide of PR0344 shown in Figure 10 makes evident the presence of the following: a signal peptide from about amino acid 1 to about amino acid 15; N-myristoylation sites from about amino acid 11 to about amino acid 17, from about j?.?.?.? 1? i? jj?! jjjiiii «- - amino acid 68 to about amino acid 74, and from about amino acid 216 to about amino acid 222; and a cell binding sequence from about amino acid 77 to about amino acid 80; clone DNA40592-1242 has been deposited with ATCC on November 21, 1997 and has been assigned ATCC deposit number 209492. The full length protein of PR0344 shown in Figure 10 has an estimated molecular weight of approximately 25, 298 Dalton units and a pl of approximately 6.44. An analysis of the full-length sequence of PR0344 shown in Figure 10 (SEQ ID NO: 15) suggests that portions of it possess significant homology with human and murine complement proteins, indicating that PR0344 can be a novel complement protein.

EXAMPLE 8 Isolation of cDNA clones encoding human PR0343 A consensus DNA sequence is assembled relative to other EST sequences using phrap, as described in Example 1 above. This consensus sequence assembled is identified here as DNA30895. Based on the DNA30895 consensus sequence, oligonucleotides are synthesized: 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) for use as probes to isolate a clone from a full-length coding sequence for PR0343. A pair of PCR primers (forward and reverse) are synthesized: direct PCR primer: 10 5 '-CGTCTCGAGCGCTCCATACAGTTCCCTTGCCCCA-3' (SEQ ID NO: 24) Reverse PCR primer: 5 TGGAGGGGGAGCGGGATGCTTGTCTGGGCGACTCCGGGGGCCCCCTCATGTGCCAGGTGG L5 A-31- (SEQ. FROM ID: NO: 25). Additionally, a synthetic oligonucleotide hybridization probe is constructed from the consensus sequence of DNA30895: 5'-20 CCCTCAGACCCTGCAGAAGCTGAAGGTTCCTATCATCGACTCGGAAGTCTGCAGCCATCT GTACTGGCGGGAGCAGGACAGGGACCATCACTGAGGACATGCTGTGTGCCGGCACT- 3 ' (SECTION OF IDNET, NO: 26).

In order to examine several libraries for a source of a full-length clone, DNA from ^ tké t? á m .. * ^ - i ^ kJtÍi¿UM »-l¿? Mt.J.U» -. libraries by PCR amplification with the PCR primer pair identified above. A positive library is then used to isolate clones encoding the PR0343 gene using the oligonucleotide probe and one of the PCR primers. RNA for the construction of cDNA libraries is isolated from human fetal lung tissue (LIB26). DNA sequencing of isolated clones that are isolated as described above provides a full-length DNA sequence for DN43318-1217 (Figure 11, SEQ ID NO: 22); and the derived protein sequence for PR0343. The entire coding sequence of DN43318-1217 is included in Figure 11 (SEQ ID NO: 22). Clone DNA43318-1217 contains a single open reading frame with an apparent translation start site at nucleotide positions 53-55, and an apparent stop codon at nucleotide positions 1004-1006. The predicted polypeptide precursor is 317 amino acids in length. The analysis of the full-length sequence of PR0343 shown in Figure 12 (SEQ ID NO: 23) makes evident the presence of several important polypeptide domains, where the positions given for these important polypeptide domains are approximate , as described in the above. Analysis of the full-length polypeptide PR0343 shown in Figure 12 makes evident the presence of the follg: a signal peptide from about amino acid 1 to about amino acid 32; an N-glycosylation site from about amino acid 70 to about amino acid 74; a glycosaminoglycan binding site from about amino acid 178 to about amino acid 182; N-myristoylation sites from about amino acid 5 to about amino acid 11, from about amino acid 12 to about amino acid 18, from about amino acid 13 to about amino acid 19, from about amino acid 16 to about amino acid 22, from about amino acid 52 to about amino acid 58, from about amino acid 71 to about amino acid 77, from about amino acid 77 to about amino acid 83, from about amino acid 112 to about amino acid 118, from about amino acid 273 to about approximately amino acid 279, and from about amino acid 310 to about amino acid 316; a prokaryotic membrane lipoprotein lipid binding site from about amino acid 4 to about amino acid 15; and an active histidine site from the trypsin family of serine proteases from about amino acid 86 to about amino acid 92. Clone DNA43318-1217 has been deposited with ATCC on November 21, 1997 and assigned ATCC deposit number 209481. The full length protein of PR0343 shown in Figure 12 has an estimated molecular weight of approximately 33,732 dalton units and a pl of approximately 7.90.

EXAMPLE 9 Isolation of cDNA clones encoding human PR0347 A consensus DNA sequence is assembled relative to other EST sequences using phrap as described in Example 1 above. This assembled consensus sequence is designated in the present "< consen01 >" and as DNA39499. Based on "<consen01>" and the consensus sequences of DN39499, oligonucleotides are synthesized: 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) for use as probes to isolate a clone from the full-length coding sequence for PR0347. A pair of PCR primers (direct and inverse) are synthesized: direct PCR primer: 5 '-AGGAACTTCTGGATCGGGCTCACC-3' (SEQ ID NO: 29) reverse PCR primer: '-GGGTCTGGGCCAGGTGGAAGAGAG-3' (SEQ ID NO: 30) Additionally, a synthetic oligonucleotide hybridization probe is constructed from the consensus sequence of DNA39499: 5'-GCCAAGGACTCCTTCCGCTGGGCCACAGGGGAGCACCAGGCCTTC-3 '(SEQ ID NO: 31).

To examine several libraries to determine a full-length clone source, the DNA of the libraries is examined by PCR amplification, with the PCR primer pair identified above. A positive library is then used to isolate clones encoding the PR0347 gene using the oligonucleotide probe and one of the PCR primers. RNA for construction of cDNA libraries is isolated from human fetal kidney tissue (LIB228). DNA sequencing of isolated clones, which are isolated as described above, provides the full-length DNA sequence for DNA44176 -1244 [Figure 13, SEC. FROM IDENT. NO: 27) and the derived protein sequence for PR0347. The entire coding sequence of DNA44176-12440 is included in Figure 13 (SEQ ID NO: 27). Clone DNA44176-1244 contains a single open reading frame with an apparent translation start site in the positions nucleotides 123-125 and an apparent stop codon at nucleotide positions 1488-1490. The predicted polypeptide precursor is 455 amino acids in length. The analysis of the full length sequence PR0347 shown in Figure 14 (SEQ ID NO: 28) makes evident the presence of a variety of important polypeptide domains, where the positions provided for these important polypeptide domains are approximate , as described in the above. Analysis of the full length PR0347 polypeptide shown in Figure 14 makes evident the presence of the following: A signal peptide from about amino acid 1 to about amino acid 26; N-glycosylation sites from about amino acid 144 to about amino acid 148, and from about amino acid 243 to about amino acid 247; an AMPc and cGMP-dependent protein kinase phosphorylation site from about amino acid 45 to about amino acid 49; N-myristoylation sites from about-amino acid 22 to about amino acid 28, from about amino acid 99 to about amino acid 105, from about amino acid 131 to about amino acid 137, from about amino acid 201 to about amino acid 207, from about amino acid 214 to about amino acid 219, from approximately amino acid 287 to about amino acid 293, from about amino acid 288 to about amino acid 294, from about amino acid 331 to about amino acid 337 and from about amino acid 398 to about amino acid 404; a prokaryotic membrane lipoprotein lipid binding site from about amino acid 204 to about amino acid 215; cysteine pattern signatures of EGF-like domain from about amino acid 249 to about amino acid 261, and from about amino acid 280 to about amino acid 292; and a C-type lectin domain form from about amino acid 417 to about amino acid 442. The clone DNA44176-1244 has been deposited with ATCC on December 10, 1997 and has been assigned ATCC deposit number 209532. The protein length complete PR0347 shown in Figure 14 has an estimated molecular weight of approximately 50,478 dalton units and a pl of approximately 8.44. The analysis of the amino acid sequence of the full-length polypeptide PR0347 suggests that the portions thereof possess important homology with various secretory proteins rich in cysteine, by which they indicate that PR0347 can be a novel secretory protein, rich in cysteine.

EXAMPLE 10 Isolation of cDNA clones encoding human PR0357 The expression tag of the sequence "2452972" by Incyte Pharmaceuticals, Palo Alto, CA, is used to start a database search for ESTs which overlap with a portion of "2452972". A consensus DNA sequence is assembled relative to other EST sequences using phrap as described in Example 1 above. This assembled consensus sequence is designated herein as DNA37162. Based on the consensus sequence of DNA37162, oligonucleotides are synthesized: 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) for use as probes to isolate a clone from the full-length coding sequence for PR0357. PCR primers are synthesized (direct and inverse): direct PCR primer 1: 5 '-CCCTCCACTGCCCCACCGACTG-3' (SEQ ID NO: 34) 5 'inverse PCR primer 1 -CGGTTCTGGGGACGTTAGGGCTCG-3' (SEQ ID NO: 35) direct PCR primer 2 : 5 '-CTGCCCACCGTCCACCTGCCTCAAT-3' (SEQ ID NO: 36) Additionally, two synthetic oligonucleotide hybridization probes are constructed from the consensus sequence DNA37162: Hybridization probe 1: 5'-AGGACTGCCCACCGTCCACCTGCCTCAATGGGGCACATGCCACC-3 '(SEQ ID NO: 37) Hybridization probe 2: 5' - ACGCAAAGCCCTACATCTAAGCCAGAGAGAGACAGGGCAGCTGGG-3 '(SEQ ID NO: 38) In order to examine several libraries for a source of a full-length clone, DNA from the libraries is examined by PCR amplification with the PCR primer pairs identified above. A positive library is then used to isolate the clones that code for the gene for PR0357 using the oligonucleotide probe and one of the PCR primers. RNA for the construction of cDNA libraries is isolated from human fetal liver tissue. DNA sequencing of isolated clones that are isolated as described above provides the full-length DNA sequence for DN44804-1248 [FIG. 15, SEQ. FROM IDENT. NO: 32]; and the derived protein sequence for PR0357. The entire coding sequence of DNA44804-1248 (SEQ ID NO: 32) is included in Figure 15.

Clone DNA44804-1248 contains a single open reading frame with an apparent translation start site at nucleotide positions 137-139, and an apparent stop codon at nucleotide positions 1931-1933- The predicted polypeptide precursor has 598 amino acids of length. The analysis of the full length sequence of PR0357 shown in Figure 15 (SEQ ID NO: 33) makes evident the presence of a variety of important polypeptide domains, where the positions given for these important polypeptide domains are approximate, as described in the above. Analysis of the full length polypeptide PR0357 shown in Figure 16 makes evident the presence of the following: a signal peptide from about amino acid 1 to about amino acid 23; a transmembrane domain from about amino acid 501 to about amino acid 520; N-glycosylation sites from about amino acid 198 to about amino acid 202, from about amino acid 425 to about amino acid 429, and from about amino acid 453 to about amino acid 457; a tyrosine kinase phosphorylation site from about amino acid 262 to about amino acid 270; N-myristoylation sites from about amino acid 23 to about amino acid 29, from about amino acid 27 to about amino acid 33, from about amino acid 112 to about amino acid 118, from about amino acid 273 to about amino acid 279, from about amino acid 519 to about amino acid 525, and from about amino acid 565 to about amino acid 571; a prokaryotic membrane lipoprotein lipid binding site from about amino acid 14 to about amino acid 25; a cysteine pattern signature of domain similar to EGF from about amino acid 355 to about amino acid 367; and leucine zipper patterns from about amino acid 122 to about amino acid 144, and from about amino acid 194 to about amino acid 216. Clone DNA44804-1248 has been deposited with ATCC on December 10, 1997 and assigned ATCC deposit number 209527. The full length protein of PR0357 shown in Figure 16 has an estimated molecular weight of approximately 63,030 dalton units and a pl of approximately 7.24. Analysis of the amino acid sequence of the full length polypeptide of PR0357 suggests that the portions thereof possess significant homology with ALS, thus indicating that PR0357 may be a protein of repeated sequence rich in novel leucine related to ALS.

EXAMPLE 11 Isolation of cDNA clones that code for human PR0715 An expressed sequence tag (EST) DNA database (LIFESEQJ, Incyte Pharmaceuticals, Palo Alto, CA) is investigated and several EST sequences are identified which show homology with human TNF-α. This investigation results in the identification of Incyte EST number 2099855. A consensus DNA sequence is assembled in relation to other EST sequences using phrap as described in example 1 above. This consensus sequence is designated herein as DNA52092. Based on the alignment of the various EST clones described above, a single clone (725887, access number AA292358) is identified and the sequence is established. DNA sequencing of the isolated clone, which is isolated as described above, provides the full-length DNA sequence for DNA52722-1229 [FIG. 17, SEQ. FROM IDENT. NO: 39]; and the protein sequence derived for PR0715.

. ..The. -AJ?, Í-IÁÁ. The complete coding sequence of DNA52722-1229 is included in Figure 17 (SEQ ID NO: 39). The clone DNA52722-1229 contains a single open reading frame with an apparent translation start site at positions of 5 nucleotides 114-116 and an apparent stop codon at nucleotide positions 864-866. The predicted polypeptide precursor is 250 amino acids in length. The analysis of the full length sequence of PR0715 shown in Figure 18 (SEQ ID NO: 40) makes the presence of a variety of important polypeptide domains, wherein the positions given for these important polypeptide domains are approximate, as described above. The analysis of the full-length polypeptide PR0715 shown in Figure 18 makes evident the presence of the Next: a signal peptide from about amino acid 1 to about amino acid 40; an N-glycosylation site from about amino acid 124 to about amino acid 128; a tyrosine kinase phosphorylation site from about amino acid 156 to about amino acid 164; N-myristoylation sites from about amino acid 36 to about amino acid 42, from about amino acid 40 to about amino acid 46, from about amino acid 179 to about amino acid 185, and from about amino acid 242 up approximately amino acid 248; and a prokaryotic membrane lipoprotein lipid binding site from about amino acid 34 to about amino acid 45. Clone DNA52722-1229 has been deposited with 5 ATCC on January 7, 1998 and assigned ATCC deposit number 209883. The full length protein of PR0715 shown in Figure 18 has an estimated molecular weight of about 27,433 Dalton units and a Pl of about 9.85. LO An analysis of the full-length sequence of PR0715, which is shown in Figure 18 (SEQ ID NO: 40), suggests that it has important homology with members of the protein tumor necrosis factor family, indicating that PR0715 is a novel protein of the factor of tumor necrosis factor. tumor necrosis.

EXAMPLE 12 Isolation of cDNA clones encoding human PRO1017 A consensus DNA sequence is assembled relative to other EST sequences using phrap, as described in Example 1 above. This consensus sequence Assembly is referred to herein as "< consen01" > , some sometimes called DNA53235. Based on the assemblies presented here and the consensus sequences, the sequence is additionally examined from EST AA243086 (Merck clone 664402). DNA sequencing of the isolated clone, which is isolated as described above, provides a full-length DNA sequence for DNA56112-1379 [FIG. 19, SEQ. FROM IDENT. NO: 41]; and the protein sequence derived for PRO1017. The entire coding sequence of DNA56112-1379 is incl in Figure 19 (SEQ ID NO: 41). Clone DNA56112-1379 contains a single open reading frame with an apparent translation start site at nucleotide positions 128-130, and an apparent stop codon at nucleotide positions 1370-1372. The predicted polypeptide precursor is 414 amino acids in length. The analysis of the full length sequence of PRO1017 shown in Figure 20 (SEQ ID NO: 42) makes evident the presence of several important polypeptide domains, where the positions given for these important polypeptide domains are approximate, as described in the above. Analysis of the PRO1017 full-length polypeptide shown in Figure 20 makes the presence of the following evident: a signal peptide from about amino acid 1 to about amino acid 31; N-glycosylation sites ÁdAiÁ £ Árr3Xi. ^ LL í. from about amino acid 134 to about amino acid 138, from about amino acid 209 to about amino acid 213, from about amino acid 280 to about amino acid 284, and from about amino acid 370 to about amino acid 374; AMPc and cGMP-dependent protein kinase phosphorylation sites from about amino acid 85 to about amino acid 89, and from about amino acid 236 to about amino acid 240; and N-myristoylation sites from about amino acid 77 to about amino acid 83, from about amino acid 164 to about amino acid 170, and from about amino acid 295 to about amino acid 301. Clone DNA56112-1379 has been deposited with ATCC on May 20, 1998 and has been assigned ATCC deposit number 209883. The full length PRO1017 protein shown in Figure 20 has an estimated molecular weight of approximately 48,414 dalton units and a pl of approximately 9.54. Analysis of the amino acid sequence of the PRO1017 full-length polypeptide suggests that the portions thereof possess sequence identity with sulfon transferase HNK-1, thus indicating that PRO1017 may be a novel sulfotransferase.

Ano * ¡.j »,.

EXAMPLE 13 Isolation of cDNA clones encoding human PR01112 DNA57702-1476 is identified by applying the signal sequence finding algorithm recorded in example 3 above. The use of the signal sequence algorithm described above allows the identification of an EST group sequence of public databases (for example GenBank) or private LIFESEQJA Incyte Pharmaceuticals, Palo Alto, CA). The grouping and assembly of public and private ESTs into one or more consensus sequences to create a candidate sequence is done using repeated cycles of the phrap computer program (Phill Green, University of Washington, Seattle Washington). Candidate sequences with sufficient rating are examined further. The homology search is performed using the BLAST or BLAST2 computer program (Altshul et al., Methods in Enzymology, 266: 460-480 (1996)). Those comparisons that result in a BLAST comparison of 70 (in some cases 90) or greater and that do not code for known proteins are grouped and assembled into a consensus DNA sequence. The consensus sequence from it is defined herein as DNA56108.

Based on the findings and information provided herein, Merck EST AA223646, clone 650953 from library 318, a human neuroepithelial tissue library, is further examined. DNA sequencing of the clone provides DNA57702-1476 (Figure 21, SEQ ID NO: 43), which includes the full length DNA sequence for PR01112. The entire coding sequence of DNA57702-1476 is included in Figure 21 (SEQ ID NO: 43). Clone DNA57702-1476 contains a single open reading frame with an apparent translation start site at nucleotide positions 20-22 and terminates at a stop codon at nucleotide positions 806-808 (Figure 21). The predicted polypeptide precursor is 262 amino acids in length, (Figure 22; SEQ ID NO: 44). The full-length protein PR01112 shown in Figure 22 has an estimated molecular weight of about 29379 Dalton units and a Pl of about 8.93. The analysis of the full length sequence of PR01112 shown in Figure 22 (SEQ ID NO: 44) evidences the presence of several important polypeptide domains, where the positions given for these important polypeptide domains are approximate, as described before. The analysis of the full length sequence of PR01112 shown in Figure 22 makes evident the presence of the following: a signal peptide from about amino acid 1 to about amino acid 13; transmembrane domains from amino acid 58 to about amino acid 76, from about amino acid 99 to about amino acid 113, from about amino acid 141 to about amino acid 159, and from about amino acid 203 to about amino acid 222; and N-myristoylation sites from about amino acid 37 to about amino acid 43, from about amino acid 42 to about amino acid 48 and from about amino acid 229 to about amino acid 235. Clone DNA57702-1476 has been deposited with ATCC on June 9, 1998, and ATCC is assigned deposit number 209951. An analysis of the Dayhoff database (version . 45 Swissprot 35), using a WU-BLAST2 sequence alignment analysis of the full-length sequence shown in Figure 22 (SEQ ID NO: 44) makes the important sequence identity between the amino acid sequence evident of PR01112 and the following Dayhoff sequences: MTY20B11_13 (a peptide of mycobacterium tuberculosis) ,. F64471, AE000690_6, XLU16364_I, E43259 (ATP synthase carrying HJ and PIGSLADRXE_1 (histocompatibility class II antigen of the major histocompatibility complex).

EXAMPLE 14 Isolation of cDNA clones that encode human PRO509 To isolate cDNA for PRO509 (also called HVEM), a human retinal cDNA bacteriophage library (commercially available from Clontech) is screened by hybridization with a synthetic oligonucleotide probe based on an EST sequence (GenBank locus AA021617), which shows some degree of homology with members of the TNFR family. Five positive clones (containing 1.8-1.9 kb cDNA inserts) are identified in the cDNA library, and positive clones are confirmed as specific by PCR using the above hybridization probe as a PCR primer. Single phage plaques containing each of the five positive clones are isolated by limiting dilution and the DNA is purified using the Wizard Lambda Prep DNA purification kit (commercially available from Promega). The cDNA inserts of three to five bacteriophage clones are cut from the vector arms by digestion with EcoRI, gel purified and subcloned into pRK5 and sequenced on both strands. The three clones contain an identical open reading frame (with the exception of an intron found in one of the clones). _.l .j. "a.m.m j. j The complete sequence of DNA50148 (HVEM) (SEQ ID NO: 45) is shown in Figure 23. The cDNA contains an open reading frame with a translational start site assigned to the ATG codon at nucleotide positions 82-84. The open reading frame terminates at a TGA stop codon at nucleotide positions 931-933. The predicted amino acid sequence of full length PRO509 (HVEM) contains 283 amino acids as shown in Figure 24 (SEQ ID NO: 46). The full-length PRO509 protein shown in Figure 24 has an estimated molecular weight of approximately 30,420 dalton units and a pl of approximately 7.34. The analysis of the full length PRO509 sequence shown in Figure 24 (SEQ ID NO: 46) makes evident the presence of several important polypeptide domains, where the positions given for these important polypeptide domains are approximate, as It is described before. The analysis of the full length sequence of PRO509 shown in Figure 24 makes evident the presence of the following: a signal peptide from about amino acid 1 to about amino acid 36; a transmembrane domain from about amino acid 203 to about amino acid 222; N-glycosylation sites from about amino acid 110 to about amino acid 114, and from about amino acid 173 to approximately amino acid 177; and N-myristoylation sites from about amino acid 81 to about amino acid 87, from about amino acid 89 to about amino acid 95, from about amino acid 104 to about amino acid 110, and from about amino acid 120 to about amino acid 126 , from about amino acid 153 to about amino acid 159, from about amino acid 193 to about amino acid 199, from about amino acid 195 to about amino acid 201, and from about amino acid 220 to about amino acid 226. The sequence differs from the PRO509 sequence (HVEM) presented in Montgomery et al., supra, in at least two amino acids: codon 108 codes for a serine and codon 140 codes for an alanine. An alignment (using the ALIGN computer program) of a 58 amino acid-length cytoplasmic region of PRO509 (HVEM) with other known members of the human TNF-receptor family shows some similarity, particularly with CD40 receptors (12 identities). ) and LT-ß (11 identities).

? Sa ... ¿JÍ.Í ... J ..

EXAMPLE 15 Isolation of cDNA clones encoding human PR0853 A consensus DNA sequence is assembled relative to other EST sequences using phrap as described in Example 1 above. The analysis identifies the single Incyte clone number 2645134. The Incyte 2645134 sequence is then extended using repeated cycles of BLAST and phrap to extend the sequence as much as possible using the sources of the EST sequences discussed above. This assembled and extended consensus sequence is designated herein as "< consen01 >" or DNA43050. Based on the DNA43050 consensus sequence, oligonucleotides are synthesized: 1) to identify by PCR a cDNA library containing the sequence of interest, and (2) for use as probes to isolate a clone from a full-length coding sequence for PR0853. A pair of PCR primers (direct and inverse) are synthesized: direct PCR primer (43050.f): 5 '-CTTCATGGCCTTGGACTTGGCCAG-3' (SEQ ID NO: 49) reverse PCR primer (43050. rl): '-ACGCCAGTGGCCTCAAGCTGGTTG-3' (SEQ ID NO: 50) .É.M j «AJLl..t it. «... MJAi .. U £ a Additionally, a synthetic oligonucleotide hybridization probe is constructed from the consensus sequence DNA43050: 5 '-CTTTCTGAGCTCTGAGCCACGGTTGGACATCCTCATCCACAATGC- 3' - (IDNET SECTION NO: 51) In order to examine several libraries for a source of a full-length clone, the DNA of the libraries is examined by PCR amplification with the PCR primer pair identified above. A positive library is then used to isolate clones encoding the PR0853 gene using the oligonucleotide probe and one of the PCR primers. RNA for construction of cDNA libraries is isolated from human fetal kidney tissue (LIB228). The establishment of the DNA sequence of the isolated clones that are isolated as described above, provides a full-length DNA sequence for DNA48227-1350 [FIG. 25, SEQ. FROM IDENT. NO: 47]; and the derived protein sequence for PR0853. The entire coding sequence of DNA48227-1350 is included in Figure 25 (SEQ ID NO: 47). The clone DNA48227-1350 contains a single open reading frame with an apparent translational start site at nucleotide positions 128-130, an apparent stop codon at nucleotide positions 1259-1261. He tAAAtt, .- predicted polypeptide precursor is 377 amino acids in length. The analysis of the full length sequence of PR0853 shown in Figure 26 (SEQ ID NO: 48) makes evident the presence of several important polypeptide domains, where the positions given for these important polypeptide domains are approximate, as described before. Analysis of the PR0853 full-length polypeptide shown in Figure 26 makes the presence of the following evident: a signal peptide from about amino acid 1 to about amino acid 16; a glycosamino glycan binding site from about amino acid 46 to about amino acid 50; N-myristoylation sites from about amino acid 9 to about amino acid 15, from about amino acid 29 to about amino acid 35, from about amino acid 32 to about amino acid 38, from about amino acid 43 to about amino acid 49, from approximately amino acid 124 to about amino acid 130, and from about amino acid 312 to about amino acid 318; a prokaryotic membrane lipoprotein lipid binding site from about amino acid 118 to about amino acid 129; and sites of the short-chain dehydrogenated alcohol family from about amino acid 37 to about amino acid 50, and from about amino acid 114 to about amino acid 125. Clone DNA48227-1350 has been deposited with ATCC on April 28, 1998 and is assigned ATCC deposit number 209812. The full-length protein PR0853 shown in figure 26 it has an estimated molecular weight of approximately 40,849 dalton units and a pl of approximately 7.98.

EXAMPLE 16 Isolation of cDNA clones encoding human PR0882 PR0882 (DNA58125) is identical to cardiotropin-1. The amino acid sequence of this protein of 201 amino acids is present in the public Dayhoff database under the accesses numbers P_R83967, P_W29238 and CTF1_HUMAN, among others. The nucleotide sequence of DNA58125 encoding PR0882 is shown in Figure 27 (SEQ ID NO: 52). The analysis of the full length sequence of PR0882 shown in Figure 28 (SEQ ID NO: 53) makes evident the presence of various important polypeptide domains, where the positions given for these important polypeptide domains are approximate, as described above. Analysis of PR0882 polypeptide length The complete sequence shown in Figure 28 makes the presence of the following evident: N-myristoylation sites from about amino acid 166 to about amino acid 172, and from about amino acid 174 to about amino acid 180; and a leucine zipper pattern from about amino acid 37 to about amino acid 59. The full-length PR0882 protein shown in Figure 28 has an estimated molecular weight of approximately 21,227 Dalton units and a Pl of approximately 9.30. Cardiotropin-1 has also been described in WO9730146, published on August 21, 1997 and WO 9529237, published on November 2, 1995.

EXAMPLE 17 Gene amplification This example shows that the genes encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are amplified in the genome of certain cancers or human lung cell lines , colon or breast. Amplification is associated with overexpression of the gene product, indicating that polypeptides are useful targets for therapeutic intervention in certain cancers such as colon, lung, breast and other cancers. The therapeutic agents can take the form of antagonists of the PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0737, PRO1017, PR01112, PRO509, PR0853 or PR0883 polypeptides, for example chimeric murine-human, humanized or antibodies against the polypeptides PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The initial material for the examination is genomic DNA isolated from various cancers. The DNA is quantified accurately, for example fluorometrically. As a negative control, DNA is isolated from the cells of ten normal healthy individuals which accumulates and is used as assay controls for gene copy in healthy individuals (not shown). The 5 'nuclease assay (eg TaqMan), and the real-time quantitative PCR (eg AB1 Prizm 7700 Sequence Detection System ™ (Perkin Elmer, Applied Biosystems Division, Foster, City, CA)), are used to find genes potentially amplified in certain -canceres. The results are used to determine whether the DNA encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is represented in excess in any of the primary cancers of lung or colon or cancer cell lines or breast cancer cell lines that were examined. Lung cancers Primary tumors are obtained from individuals with tumors of the type and stage as indicated in Table 4. An explanation of the abbreviations used for the designation of the primary tumors included in Table 4 and the primary tumors and cell lines to which they belong. referenced through this example are provided below. TaqMan ™ results are reported in delta (?) Ct units. One unit corresponds to 1 PCR cycle or approximately 2 times amplification in relation to normal, two units correspond to 4 times, 3 units to 8 times of amplification and so on. Quantitation is obtained using primers and a TaqMan ™ fluorescent probe derived from a gene encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The regions of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 which are more likely to contain unique nucleic acid sequences and which are probably at least Separated from introns are preferred for the primer and the probe derivation, eg, the 3 'untranslated regions. The sequences for the primers and the probes (direct, inverse and probes) used for the gene amplification analysis of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are as follows: PRO201 (DNA30676-1223): 30676. tm.f 5 '-CGCAGACACCCTTCTTCACA-3' (SEQ ID NO: 54) 30676. tm.r 5 '-CGACTCCTTTGGTCTCTTCTGG-3' (SEQ ID NO: 55) ) 30676. tm.p 5 '-CCGGGACCCCCAGGTTTTTGC-3' (SEQ ID NO: 56) PRQ292 (DNA35617): 35617. tm.f 5 '-GATCCTGGGCGACGTCTTC-3' (SEQ ID NO: 57) 35617. tm.p 5 '-TCGGCCGCTACTACACTGTGTTTGACC-3' (SEQ ID NO: 58) 35617 tm.r 5 '-GCCCACCCTGTTGTTGTCA-3' (SEQ ID NO: 59) PRQ327 (DNA38113-1230): 38113.tm.f 5 '-CTCAAGAAGCACG CGTACTGC-3' (SEQ ID NO: 60) 38113.tm.p 5 '-CCAACCTCAGCTTCCGCCTCTACGA-3' (SEQ ID NO: 61) 38113. tm.r '-CATCCAGGCTCGCCACTG-3' (SEQ ID NO: 62! PRQ1265 (DNA60764-1533): 60764. tm.fl 5 '-TGACCTGGCAAAGGAAGAA-3' (SEQ ID NO: 63) 60764. tm.pl 5 '-CAGCCACCCTCCAGTCCAAGG-3 (SEQ ID NO: 64) 60764. tm.Rl 5 '-GGGTCGTGTTTTGGAGAGA-3' (SEQ ID NO: 65) THE PRQ344 (DNA40592-1242): 40592. tm.fl 5 '-TGGCAAGGAATGGGAACAGT-3' (SEQ ID NO: 66) 40592. tm.pl L5 5'-ATGCTGC CAGACCTGAT CGCAGACA-3 '(SEQ ID NO: 67) 40592. tm.rl 5 '-G GGCAGAAATC CAGCCACT-3' (SEQ ID NO: 68) PRQ343 (DNA43318-1217): 20 43318. m.fl 5 '-TCTACATCAGCCTCTCTGCGC-3' [SEC. FROM IDENT. NO: 69) 43318. tm.pl 5 '-CGATCTTCTCCACCCAGGAGCGG-3' (SEQ ID NO: 70) 43318. tm.pl 25 5 '- GGAGCTGCACCCCTTTGC - 3' (SEQ ID NO: 71) PRQ347 (DNA44176-1244): 44176. tm.fl 5 '-CCCTTCGCCTGCTTTTGA-3' (SEQ ID NO: 72) 44176.tm.pl 5 '-GCCATCTAATTGAAGCCCATCTTCCCA-3' (SEQ ID NO: 73 44176. tm.rl 5 '- CTGGCGGTGT CCTCTCCTT-3' (SEQ ID NO: 74) PRQ357 (DNA44804-1248): 44804. tm.fl 5 '-CCTCGGTCTCCTCATCTGTGA-3' (SEQ ID NO: 75) 44804.tm.pl 5 '-TGGCCCAGCTGACGAGCCCT-3' (SEQ ID NO: 76) ) 44804.tm.rl 5 '- CTCATAGGCACTCGGTTCTGG- 3' (SEQ ID NO: 77) PR0715 (DNA52722-1229): 52722. tm.fl 5 '-TGGCTCCCAGCTTGGAAGA-3' (SEQ ID NO: 78) 52722.tm.pl 5 '-CAGCTCTTGGCTGTCTCCAGTATGTACCCA-3' (SEQ ID NO: 79) ) 52722. tm.rl 5 '-GATGCCTCTGTTCCTGCACAT-3' (SEQ ID NO: 80) ^ me & PRO1017 (DNA56112-1379): 56112. tm.fl 5 '-CCTCCTCCGAGACTGAAAGCT-3' (SEQ ID NO: 81) 56112.tm.pl 5'-TCGCGTTGCTTTTTCTCGCGTG-3 '(SEQ ID NO: 82 ) 56112.tm.rl 5 '-GCGTGCGTC AGGTTCCA-3' (SEQ ID NO: 83) PRQ1112 (DNA57702-1476): 57702. tm.fl 5 '-GTCCCTTCACTGTTTAGAGCATGA-3' (SEQ ID NO: 84) 55702.tm.pl 5 '-ACTCTCCCCCTCAACAGCCTCCTGAG-3' (SEQ ID NO: 85) ) 55702.tm.rl 5'-GTGG TCAGGGCAGA TCCTTT-31 (SEQ ID NO: 86) PRO509 (DNA50148): 50148. tm.fl 5 '-GGAGGAGACAATACCCTCATTCA-3' - (SEQ ID NO: 87) 50148.tm.pl 5 '-AGCAGCCGTCGCTCCAGGTATCTC-3 (SEQ ID NO: 88) 50148. tm.rl 5 '-CCA GGTGGACAGCCTCTTTC-3' (SEQ ID NO: 89) PR0853 (DNA48227-1350): 48227. tm.fl 5 '-GGCACTTCATGGTCCTTGAAA-3' (SEQ ID NO: 90) 48227.tm.pl 5 '-CGGATGTGTGTGAGGCCATGCC-3' (SEQ ID NO: 91 ) 48227. tm.rl 5 '-GAAAGTA ACCACGGAGG TCAAGAT-3' (SEQ ID NO: 92) PRQ882 (DNA58125) 58125. tm.fl 5 '-TTCCCAGCCTCTCTTTGCTTT-3' (SEQ ID NO: 93) 58125.tm.pl 5 '-TGCCCCGTTCTCTTAACTCTTGGACCC-3' (SEQ ID NO: 94) 58125. tm.rl 5 '-TCAGACGGAGTTACCATGCAGA-3' (SEQ ID NO: 95) The 5 'nuclease assay reaction is a fluorescent PCR-based technique which utilizes the 5' exonuclease activity of the Taq DNA polymerase enzyme to monitor amplification in real time. Two oligonucleotide primers are used to generate an Amplicon typical of a PCR reaction. A third oligonucleotide, or probe is designed to detect the nucleotide sequence that is located between the two PCR primers. The probe is not extendable by the Taq DNA polymerase enzyme, and is labeled with a fluorescent dye indicator and a fluorescent dye eliminator. Any laser-induced emission of the indicator dye is suspended by the suspension dye when the two dyes are located nearby as found in the probe. During the 5 amplification reaction, the enzyme Taq DNA polymerase separates the probe in a manner dependent on the template. The resulting probe fragments are dissociated in solution, and a signal from the released indicator dye is free from the suspension effect of the second fluorophore. A molecule of The indicator dye is released for each newly synthesized molecule and the detection of the indicator dye without suspending provides the basis for the quantitative interpretation of the data. The 5 'nuclease procedure is carried out in L5 a quantitative real-time PCR device such as ABl Prism 7700TM Sequence Detection. The system consists of a thermal cycler, laser, charge coupled device (CCD) camera and computer. The system amplifies samples in a 96-well format in a thermal cycler. During the amplification, collects the laser-induced fluorescent signal in real time through optical fiber cables for all 96 wells and is detected in the CCD. The system includes software to operate the instrument and to analyze the data.

The 5 'nuclease assay data is initially expressed as Ct or threshold cycle. This is defined as the cycle in which the indicator signal accumulates above the fluorescence background level. The? Ct values are used as quantitative measurement of the relative number of initial copies of a particular target sequence in a nucleic acid sample when the cancer DNA results are compared to normal human DNA results. Table 4 describes the stage, stage T and stage N of different primary tumors which are used to examine the compounds PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 of the invention.

TABLE 4 Primary profiles of lung and colon tumor Elana of primary tumor Eta na Other et? na - Stage Du is Stage T Stage N TI NI T3 NO T2 NO TI N2 T2 NO T2 NO TI NO T2 NO ? p i? i? ?? ll ^^^^^ lÍifa ^ .ii ^, ¿A. > aa ,. > . TO .

Lysis of Cell Culture: Cells are washed and tripzinized at a concentration of 7.5 x 10 8 per tip and pelleted by centrifuging at 1000 rpm for 5 minutes at 4 ° C, followed by washing against 1/2 volume recentrifugation of PBS. The pellets are washed a third time, the suspended cells are harvested and washed 2 × with PBS. The cells are then suspended in 10 ml of PBS, equilibrated at 4 ° C in Cl buffer. Quiagen # 19155 protease is diluted in 6.5 ml of cold ddH20 to a final concentration of 20 mg / ml and equilibrated at 4 ° C. 10 ml of G2 buffer is prepared by diluting a concentrate of Quiagen RNAse A (100 mg / ml) to a final concentration of 200 μg / ml. Then the Cl buffer is added (10 ml, 4 ° C) and ddH20 (40 ml, 4 ° C) to 10 ml of cell suspension, mix by inverting and incubate on ice for 10 minutes. The nuclei of the cells are pelleted by centrifugation in a Beckman oscillating bowl rotor at 2500 rpm at 4 ° C for 15 minutes. The supernatant is discarded and the nuclei are suspended with a swirl in 2 ml of Cl buffer (at 4 ° C) and 6 ml of ddH20, followed by a second centrifugation at 4 ° C at 2500 rpm during ? 15 minutes. The cores are then resuspended in residual buffer using 200 μl per tip. 10 ml of G2 buffer is added to the suspended cores while a gentle swirl is applied. Upon completion of the shock absorber addition, a vigorous swirl is applied for 30 seconds. Quiagen protease (200 μl, prepared as indicated above) is added and incubated at 50 ° C for 60 minutes. Incubation and centrifugation are repeated until the lysates are clear (for example, incubating an additional 30-60 minutes, sedimenting 3000 x g for 10 min, 4 ° C).

Preparation and lysis of solid human tumor sample: Tumor samples are weighed and placed in 50 ml conical tubes and kept on ice. Processing is limited to a maximum of 250 mg of tissue per preparation (1 tip / preparation). The protease solution is prepared fresh by diluting in 6.25 ml of cold ddH20 to a final concentration of 20 mg / ml and stored at 4 ° C. 20 ml of G2 buffer is prepared by diluting DNase A to a final concentration of 200 mg / ml (from 100 mg / ml concentrate). The tumor tissue is homogenized in 19 ml of G2 buffer for 60 seconds using a large Polytron tip in a laminar flow TC hood in order to avoid inhalation of aerosols, and keeping it at room temperature. Between the samples, the polytron is cleaned by spinning 2 x 30 seconds each at 2 1 ddH20, followed by 50 ml of G2 buffer. If the tissue is still present at the tip of the generator, the device is disassembled and cleaned. The Qiagen protease (prepared as above, 1.0 ml) is added followed by swirl formation and incubation at 50 ° C for 3 hours. Incubation and centrifugation are repeated until the lysates are clear (eg, incubating additional 30-60 minutes, and sedimenting at 3000 x g for 10 min, 4 ° C).

Preparation and lysis of human blood: Blood is drawn from healthy volunteers using standard infectious agent protocols and citrated in 10 ml samples per tip. The Quiagen protease is prepared fresh by dilution in 6.25 ml of cold ddH20 to a final concentration of 20 mg / ml and stored at 4 ° C. The G2 buffer is prepared by diluting RNAse A to a final concentration of 200 μg / ml from 100 mg / ml concentrate. 10 ml of blood are placed in a 50 ml conical tube and 10 ml of Cl buffer and 30 ml of ddH20 (both pre-equilibrated at 4 ° C) are added, and the components are mixed by inverting and keeping on ice for 10 minutes. . The nuclei are t? ? r?., i, A i? 4-mi r MMÍ *! ¡l. -. ,. »^ T ... * ..,.-... '. ..-. -. . ....... ^^^^^^ - ^ .-. ^^ -....... ¿^ M. ^ .J -. * .. ~ ... ^ * A ».? J ^ l | i ^» ». T-, i» sediment with a Beckman oscillating vessel rotor at 2500 rpm, 4 ° C for 15 minutes and the supernatant is discarded. With a vortex, the cores are suspended in 2 ml of Cl buffer (4 ° C) and 6 ml of ddH20 (4 ° C). The formation of the swirl is repeated until the sediment is white. The nuclei are then suspended in residual buffer using a 200 μl tip. 10 ml of G2 buffer is added to the suspended cores while gently vortexing, followed by vigorous vortex for 30 seconds. 200 μl of Quiagen protease is added and incubated at 50 ° C for 60 minutes. Incubation and centrifugation is repeated until the lysates are clear (for example, when incubated 30-60 additional minutes, sediment at 3000 x g for 10 min, 4 ° C).

Purification of the clarified lysates: (1) Isolation of genomic DNA: The genomic DNA is equilibrated (1 sample per maxiput preparation) with 10 ml of QBT buffer. The elution buffer QF is balanced at 50 ° C. The samples are swirled for 30 seconds, then loaded on balanced tips and drained by gravity. The tips are washed with 2 x 15 ml of QC buffer. The DNA is eluted in 30 ml Corex tubes subjected to autoclaving, silanized 30 ml with 15 ml of QF buffer (50 ° C). 10.5 ml of isopropanol are added to each sample, the tubes are covered with paraffin and mixed by repeated inversion until the DNA precipitates. The samples are pelleted by centrifugation in a SS-34 rotor at 15,000 rpm for 10 minutes at 4 ° C. The location of the sediment is marked, the supernatant is discarded and 10 ml of 70% ethanol are added at 4 ° C. The samples are pelleted again by centrifugation in the SS-34 rotor at 10,000 rpm for 10 minutes at 4 ° C. The location of the sediment is marked and the supernatant is discarded. The tubes are then placed on their side in a drying rack and left to dry for 10 minutes at 37 ° C, being careful not to over-dry the samples. After drying, the pellets are dissolved in 1.0 ml of TE (pH 8.5) and placed at 50 ° C for 1/2 hour. The samples are kept overnight at 4 ° C and dissolution is continued. The DNA solution is then transferred to 1.5 ml tubes with a 26 gauge needle in a tuberculin syringe. The 5x transfer is repeated in order to cut the DNA samples and then placed at 50 ° C for 1/2 hour. (2) Quantification of genomic DNA and preparation of a gene amplification assay: The DNA levels in each tube are quantified by standard spectrophotometry A260, A280 in a 1:20 dilution (5 μl DNA + 95 μl ddH20) using 0.1 ml quartz cuvettes in a Beckman DU640 spectrophotometer. The A260 / A280 ratios are in the interval of 1.8-1.9. Each of the DNA samples is then further diluted to approximately 200 mg / ml in TE (pH 8.5). If the original material is highly concentrated (approximately 700 mg / μl), the material is placed at 50 ° C for several hours until it is resuspended. Fluorometric DNA is then quantified in the diluted material (20-600 ng / ml) using the manufacturer's guide lines as modified in the following. This is done by allowing a Hoeffer DyNA Quant 200 flowmeter to warm up for approximately 15 minutes. The working solution of the Hoechst dye (# H33258, 10 μl, prepared in the following 12 hours of use) is diluted in 100 ml of TNE buffer lx. A 2 ml cuvette is taken with the fluorometer solution, placed in the machine and the machine set to zero. PGEM 3Zf (+) (2 μl, lot # 360851026) is added to 2 ml of fluorometer solution and calibrated to 200 units. 2 μl of pGEM 3Zf (+) DNA are further tested and the reading is confirmed at 400 +/- 10 units. Each sample is then read at least in triplicate. When it is found that three samples are within 10% of each other, it takes its average and this value is used as the quantification value. The concentration determined fluorometrically is then used to dilute each sample to 10 ng / μl in ddH20. This is done simultaneously on all template samples for a single TaqMan assay plate, and with enough material to perform 500-1000 assays. Samples are diluted in triplicate with TaqManM primers and a probe for both B-actin and GAPDH in a single plate with normal human DNA and controls without template. Diluted samples are used with the proviso that the CT value of normal human DNA subtracted from the test DNA is +/- 1 Ct. Titrated genomic DNA per diluted batch is stored in 1.0 ml aliquots at -80 ° C. The aliquots which are subsequently used in the amplification assay of the gene are stored at 4 ° C. Each aliquot of 1 ml is sufficient for 8-9 plates or 64 tests.

Gene amplification assay: The compounds PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0537, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 of the invention are examined in the following primary tumors and the resulting? Ct values as reported in table 5.

TABLE 5 ACt Values in Primary Lung and Colon Tumor and Cell Line Models [, i »é < Ü? .l .. i i- ^? dfc »» i ^ i- PRO201. PR0327 and PR01265: PRO201 (DNA30676-1223), PR0327 (DNA38113-1230) and PR01265 (DNA60764-1533) are also retested together with the tumors selected from the previous initial examination with infrastructure mapping. Figure 29 and Table 6 indicate the chromosomal mapping of the infrastructure markers that were used in the present example. Infrastructure markers are located approximately every 20 megabases and are used to control aneuploidy. PRO201 (DNA30676-1223), PR0327 (DNA38113-1230) and (PR060764 - 1533) with epicenter mapping are also retested. The markers indicated in Tables 7A, 7B and 7C are located in close proximity (in the genome) to DNA30767, DNA38113 and DNA60764, respectively, and are used to determine the relative amplification in the immediate vicinity of chromosome 19 where the respective molecule. The distance between the individual markers is measured in lightning rods (cR), which is a unit of radiation breakage approximately equal to an opportunity of 1% of a break between two markers. A cR is very generally equivalent to 20 kilobases. The SHGC-35441 marker is the marker that is closest to the position on chromosome 19 where DNA30676 maps, and SHGC-33698 is closest to DNA60764.

TABLE 6 Markers of ifratructure on chromosome 19 TABLE 7A Epicenter markers on chromosome 19 used for DNA30676 TABLE 7B Epicenter markers on chromosome 19 used for DNA38113 TABLE 7C Epicenter markers on chromosome 19 used for DNA60764 The Δt values of the infrastructure markers described above on chromosome 19 in relation to PRO201, PR0327 and PR01265 are indicated for tumors selected in Table 8A, 8B and 8C, respectively. 10 TABLE 8A Amplification of infrastructure markers in relation to DNA30676 (ACt) fifteen twenty TABLE 8b Amplification of infrastructure markers in relation to DI \ IA30676 (ACt) TABLE 8C Amplification of infrastructure markers in relation to DNA60764 (ACt) Tables 9A, 9B and 9C indicate the? Ct values for epicenter mapping results in relation to DNA30676, DNA38113 and DNA60764, respectively, indicating the relative amplification in the region closest to the current position of DNA30676, DNA38113 and DNA60764 in the chromosome 19.

TABLE 9A Amplification of epicenter markers of DNA30676 (ACt) Í.? - Í? .A ?? - '-? R ~ "t.i- * ^ r TABLE 9B Amplification of epicenter markers of DNA381 13 (ACt) • ^ im -Tt Table 9C indicates the? Ct values for the epicenter mapping results in relation to DNA60764, indicating the relative amplification in the region closest to the current position of DNA60764 on chromosome 19. DNA34353, DNA40620 and DNA54002 are other independently identified molecules which have been observed to map in the same region of chromosome 19 as DNA60764.

TABLE 9C Amplification of epicenter markers in relation to DNA60764 (ACt) Epicenter markers Éái ^^. . Í ..

PR0292: PR0292 (DNA35617) is also examined with the infrastructure mapping. Figure 30 and Table 10 indicate the chromosomal mapping of the infrastructure markers that were used in this analysis. Infrastructure markers are located approximately every 20 megabases and are used to control aneuploidy.

TABLE 10 . ^. ^ rr..l. ^ r5 ^ .. ^ "¿¿¿.i ^! Infrastructure markers used on chromosome 1 1 for DNA35617 The? Ct values of the infrastructure markers described earlier on chromosome 11 in relation to PR0292 are indicated for tumors selected in Table 11.

TABLE 11 Amplification of the epicenter markers in relation to DÍMA35617 15 PR0343 and PR0882: PR0343 (DNA43318-1217) and PR0882 (DNA58125) are also re-examined with both infrastructure and epicenter mapping. Figure 31 and Table 12 indicate the chromosomal mapping of the infrastructure markers used in this analysis. Infrastructure markers are located approximately every 20 megabases and are used to control aneuploidy. Tables 13A and 13B indicate the epicenter markers used for the mapping of DNA43318 and DNA58125. The markers shown in Tables 13A and 13B are located in close proximity (in the genome) to the DNAs DNA43318 and DNA58125, respectively, and are used to determine the relative amplification in the immediate vicinity of chromosome 16 where the molecules are mapped. respective. The distance between individual markers is measured in lightning rods (cR), which is equivalent to 20 kilobases. The markers AFMa061yb5 and SHGC-36123 are located closest to the position on chromosome 16 where they map, respectively, DN43318 and DNA58125.

TABLE 12 Infrastructure markers used on chromosome 16 for DNA43318 and DNA58125. ..4 -, TABLE 13A Epicenter markers on chromosome 16 used for DIMA43318 TABLE 13B Epicenter markers on chromosome 16 used for DNA58125 The? Ct values of the infrastructure markers of Table 12 along chromosome 16 in relation to PR0343 and PR0882 are indicated for tumors selected in Table 14.

Table 14 Amplification of infrastructure markers in relation to DNA43318 and DNA58125 Jh?.? Jtá.í iiá, t¡ ..tíS.r ^. ^ -. * t¡¡¡? JL¡ Tables 15A and 15B indicate the? Ct values of the epicenter mapping in relation to DNA43318 and DNA58125 indicating the relative amplification in the region closest to the current position of the respective molecules along chromosome 16.

Table 15A Amplification of the epicenter markers in relation to DNA43318 (? Ct) ... j ..faajtj.il afc. j ütaü Table 15B Amplification of the epicenter markers in relation to DNA58125 (? Ct) .t & A a t .. t. , lr ~ * '> ~ * * • * * - PRO1017 PRO1017 (DNA56112-1379) is also examined again with the infrastructure mapping. Figure 32 and Table 16 indicate the chromosomal mapping of the infrastructure markers used in this analysis. Infrastructure markers are located approximately every 20 megabases and are used to control aneuploidy. PRO1017 (DNA56112-1379) is also re-examined with the mapping of the epicenter. Table 17 indicates the epicenter markers which are located in close proximity with DNA56112 which are used to determine the relative amplification in the immediate vicinity of chromosome 7 where DNA56112 is located. The distance between individual markers is measured in lightning rods (cR), which is a unit of radiation breakage approximately equal to an opportunity for a marker to be closer to the position on chromosome 7 where DNA56112 is established.

Table 16 Infrastructure markers used on chromosome 7 for DNA56112 Table 17 Epicenter markers along chromosome 7 used for DNA56112 Table 18 indicates the values? Ct for the results of the epicenter mapping in relation to DNA56112, which indicate the relative amplification in the region closest to the current location of DNA56112 along chromosome 7.

Table 18 Amplification of the epicenter markers in relation to DNA56112 (? Ct) .... Ar r. ^ ....

The? Ct values of the infrastructure markers described above along chromosome 7 in relation to DNA56112 are indicated for the tumors selected in Table 19.

Table 19 Amplification of infrastructure markers in relation to DNA56112 Infrastructure markers Tumor DNA Gi l G54 G1 13 G164 G205 G254 G358 561 12 PR0715 and PR0853 They are also re-examined at PR0715 (DNA52722-1229) and PR0853 (DNA48227 - 1350) with both infrastructure and epicenter mapping. Figures 33A and 33B in Table 20 indicate the chromosomal locations of the infrastructure markers that were used for the procedure. Infrastructure markers are located approximately every 20 bases and are used to control aneuploidy. Tables 21A and 21B indicate the epicenter mapping markers that are used in the method. The epicenter markers are located in close proximity to DNA52722 and DNA48226, respectively and are used to determine the relative amplification of DNA in the immediate vicinity of DNA52722 and DNA48226. The distance between the individual markers is measured in lightning rods, which is the unit of radiation breakage approximately equal to a 1% chance of a break between two markers. A cR is very generally equivalent to approximately 20 kilobases. In both Tables 21A and 21B, "BAC" means a bacterial artificial chromosome. The ends of a BAC clone 3 &h £, aíl.? ? i'tr L. AádLéri, ^ .. which contains the gene of interest are sequenced. TaqManMR primers and probes are made from this sequence, which are indicated in the respective Tables. BAC clones are typically 100 to 150 Kb, so these primers and probes can be used as proximity markers for probe DNA for tumors. In Figure 33A, it is found that the marker SHGC-31370 is the closest marker to the location on chromosome 17 where DNA52722 maps. In Figure 33B, the SHGC-37126 marker is the marker that is closest to the position of chromosome 17 where DNA48227 maps.

Table 20 Infrastructure markers used along chromosome 17 for DNA52722 and DNA48227 Table 21A Epicenter markers used on chromosome 17 in the vicinity of DNA52722 Table 2IB Epicenter markers used on chromosome 17 in the vicinity of DNA48227 Table 22 indicates the? Ct values of the infrastructure markers described above along chromosome 17 in relation to DNA52722 and DNA48227 for selected tumors.

Although not shown, similar? Ct values are presented for the infrastructure markers in the DNA48227 analysis. ttitf J.AJfa .tAK. r- .ii ^ t, ... J .. -. ... ~~ i * .. * ,. ikA ^ ií Table 22 Amplification of infrastructure markers in relation to DNA52722 fifteen Table 23 indicates the? Ct values for the indicated epicenter markers, indicating the relative amplification along chromosome 17 in the immediate vicinity of DNA52722. * • - * ^ te ^ tiA -? Á dmks &i. ,, ...

Table 23 Amplification of the epicenter markers in relation to DNA52722 - -. .i, ± LÍ.i.L. 24A and 24B indicate the? Ct values for the indicated epicenter markers, which indicate the relative amplification of the selected lung and colon tumors, respectively, along chromosome 17 in the immediate vicinity of DNA48227.

Table 24A Amplification of epicenter markers in the vicinity of DNA48227 on chromosome 17 in selected lung tumors .ta -í? ... .2 ^. ± d *. - > . t¡? ¡l.m ...

Table 24B Amplification of epicenter markers in the vicinity of DNA48227 on chromosome 17 in selected colon tumors PR0357 PR0357 (DNA44804-1248) is re-examined with the tumors selected from the previous initial screening with the infrastructure mapping. Figure 34 and Table 25 indicate the chromosomal mapping of the infrastructure markers that were used in the present example. Infrastructure markers are located approximately every 20 megabases and are used to control aneuploidy. PR0357 (DNA44804-1248) is also examined with epicenter mapping. The markers indicated in Table 26 are located in close proximity (in the genome) to DNA44804 and are used to determine the relative amplification in the immediate vicinity of chromosome 16 where DNA44804 is located. The distance between the individual markers is measured in lightning rods (cR), which is a unit of radiation breakage approximately equal to an opportunity of 1% of a break between two markers. A cR is very generally equivalent to 20 kilobases. The SHGC-6154 marker is the marker that is closest to the position on chromosome 16 where DNA44804 maps.

Table 25 Infrastructure markers for DNA44804 Table 26 Epicenter markers for DNA44804 along chromosome 16 ? l ..? áuástMA j ^^ ._ bAl * ......? , .r ^ Jtjm .. "A.fc > ..i ... Ml..1 ..... ^. m, ... ^ -njiifl The? cT values of the infrastructure markers described above along chromosome 16 in relation to DNA44804 are described in the Table 27 Table 27 Amplification of infrastructure markers in relation to DNA44804 (? Ct) , -? ííéÉ? t ^ í ^ ,, - ^^^ * ^ .éi? Table 28 indicates the values? Ct for the results of the epicenter mapping in relation to DNA44804, indicating the relative amplification in the region closest to the current position DNA44804 along chromosome 16.

Table 28 Amplification of the epicenter markers in relation to DNA44804 Infrastructure markers XA Á.Á? L & Snár "**» - .. aSftAA »*» **. -a ^ a ~ ».? **?, T.

DISCUSSION AND CONCLUSION: PRO201 (DNA30676-1223) The values of? Ct for DNA30676-1223 in various tumors is presented in Table 5. A? Ct of > 1 is typically used as the threshold value for amplification rating, and this represents a duplication of the copy of the gene. Table 5 indicates that significant amplification of DNA nucleic acid DNA30676-1223 coding for PRO201 occurs: (1) in primary lung tumors: LTla, LT3, LT6, LT7, LT9, LT10, LTll, LT13, LT15, LT16 , LT17, LT18, LT19 and LT21; (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT1, CT4, CT5, CT6, CT7, CT9, CTII and CT18; (3) in the lung tumor cell lines: Calu-1, Calu-6, H157, H441, SKMES-1, H522 and H810 and (4) colo-tumor cell lines Colo320 and Colo205. Amplification was confirmed by infrastructure mapping for DNA30676-1223: (1) in primary lung tumors: LT3, LT15, LT16, LT17 and LT18; and (2) in tumors of Primary colon: CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16 and CT17. The epicenter mapping for DNA30676-1223 results in the confirmation of significant amplification: (1) in primary lung tumors: LT3, LT13, LT15, LT16 and LT18; and (2) in 5 primary colon tumors: CTl, CT3, CT4, CT5, CT6, CT7, CT8, CT9, CT10, CTll, CT12, CT14, CT15, CT16, CT17 and CT18. In contrast, the amplification of the closest known infrastructure markers (with one exception, ie, S50) (Table 8A) or the epicenter markers (Table 9A) LO is not produced to a greater degree compared to DNA30676-1223. This strongly suggests that DNA30676-1223 is the gene responsible for the amplification of the particular region on chromosome 19. Because the amplification of DNA30676-1223 is L5 occurs in several tumors, it is highly likely that it plays an important role in tumor formation or growth. As a result, antagonists (for example antibodies) directed against the DNA encoded with DNA30676-1223 (PRO201) can be expected to have utility in cancer therapy.

PR0292 (DNA35617): The values of? Ct for DNA35617 in various tumors are reported in Table 5. A? Ct of > 1 is typically used as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA35617 encoding PR0292 has been produced: (1) in primary lung tumors: LT1, LTla, LTll, LT12, LT13, LT15, LT17, LT19 and LT21; (2) in primary colon tumors: CT2, CT8, CT10 and CT14; in lung tumor cell lines: H441 and H810; and (4) in colon tumor cell lines: S 620, Col? 320, HT29 and LS174T. The amplification has been confirmed by infrastructure mapping for DNA35617: (1) in primary lung tumors: LT12, LT13, LT15 and LT16; and (2) in primary colon tumors: CT2, CT8, CT10 and CT14. In contrast, the amplification of the closest known infrastructure markers (Table 11) does not occur to a greater degree than in that of DNA35617. This strongly suggests that DNA35617 is the gene responsible for the amplification of the particular region on chromosome 11. Because the amplification of DNA35617 occurs in several tumors, it is highly likely that it plays an important role in the formation or growth of tumors. . As a result, antagonists (for example antibodies) directed against the protein encoded by DNA65617 (PR0292) can be expected to have utility in cancer therapy.

PR0327 (DNA38113-1230): The values of? Ct for DNA38113-1230 in various tumors is reported in Table 5. Typically a? Ct of > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA38113-1230 coding for PR0327 occurs: (1) in primary lung tumors: LTla, LT3, LT6, LT10, LTll, LT12, LT13, LT15, LT16, LT17 and LT19; (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12, CR14, CT15, CT16, CT17, CT1, CT4, CT5, CT6, CT9, CTll and CT18; (3) in lung tumor cell lines; H157, H441, H460 and SKMES-1; and (4) in colon tumor cell lines: S 620, Colo320, HCC2998 and KM12. Amplification was confirmed by infrastructure mapping for DNA38113-1230 (Table 8B): (1) in LT10 primary lung tumor; and (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12, CT14 and CT16. In epicenter mapping for DNA38113-1230 results in the confirmation of significant amplification (Table 9B): (1) in primary lung tumors: LT12, LT13, LT15, LT16 and LT17; and (2) in primary colon tumors: CTl, CT2, CT3, CT4, CT5, CT6, CT8, CT9, CT10, CTll, CT12, CT14, CT16 and CT18. i &i.?. ii a? .I.lJI ~ ... í .. * r L ,, ¿-i.? ... . .-: .. ..-. -. -..., -j ..., -., .....?, ^.? -... «, B, ^, i ....» tJ «» ^ - < ^ .. ^: ... á .... a ..ti., a ^.? .. ^^ < . ^, iJJ..Í .. ^ With the exception of S41, the amplification of the markers closest to DNA38113-1230 does not occur to a greater degree than with DNA38113-1230 itself. This substantiates the notion that DNA38113 is the gene which drives the amplification of this particular region of chromosome 19. However, the amplification of the S41 marker (which does not closely map to DNA38113) can be an independent amplification event or even an error in the ordering of the markers. Because the amplification of DNA38113-1230 occurs in several tumors, it is highly likely that it plays an important role in the formation or growth of tumors. As a result, antagonists (ie, antibodies) directed against the protein encoded by DNA38113-1230 (PR0327) can be expected to have utility in cancer therapy.

PR01265 (DNA60764-1533): Table 5 reports the values? Ct for DNA60764-1533 in various tumors. Typically a? Ct > 1 as a threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA60764-1533 that codes for PR01265: in primary lung tumors: LT3, LT12, LT13, LT15, LT16 and LT17. The amplification was confirmed by infrastructure mapping for DNA60764-1533 (Table 8C) in LT16 primary lung tumor. An epicenter mapping for DNA60764-1533 also results in confirmation of significant amplification (Table 9C): (1) in primary lung tumors: LT12, LT13, LT15 and LT16; and (2) in primary colon tumors: CTl, CT4, CT5, CT7 and CTll. In contrast, amplification of the closest known infrastructure markers, epicenter markers and comparison sequences are not produced to a greater degree than with DNA60764-1533. This strongly suggests that DNA60764-1533 is the gene responsible for the amplification of a particular region on chromosome 19. Because the amplification of DNA60764-1533 occurs in several lung and colon tumors, it is highly likely to play an important role in the formation or growth of tumors. As a result, antagonists (e.g., antibodies) directed against the protein encoded by DNA60764 -1533 (PR01265) can be expected to have utility in cancer therapy.

PR0344 (DNA40592-1242): Table 5 reports the values? Ct for DNA40592-1242 in various tumors. Typically a? Ct of >is used; 1 as the threshold value for amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of DNA nucleic acid DNA40592-1242 coding for PR0344 occurs: (1) in primary lung tumors: LTll, LT12, LT13, LT15, LT16, LT17, LT19 and LT21; and (2) in primary colon tumors: CT2, CT14, CT15, CT1, CT4, CT5 and CT1. Because the amplification of DNA40592-1242 occurs in several lung and colon tumors, it is highly likely that it plays an important role in the formation or growth of tumors. As a result, antagonists (for example antibodies) directed against the protein encoded by DNA40592-1242 (PR0344) would be expected to have utility in cancer therapy.

PR0343 (DNA43318-1217): Table 5 reports the values of? Ct for DNA43318-1217 in different tumors. Typically, a ? Ct of > 1 as the threshold value for amplification rating, as this represents a duplication of the copy Í .... A. . "*. **,.?,. SL¿I ,, .. Í ...., J ^ U. * ....... ,,. ...." .¡ .. ., ..A- "•• '- ^ - iiriniÉ ilhii of the gene Table 5 indicates that a significant amplification of the nucleic acid DNA43318-1217 encoding PR0343 has been produced: (1) in primary lung tumors: LTll, LT12, LT13, LT15, LT16, LT17, LT18 and LT19; and (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT4, CT5, CT7 and The amplification was confirmed by infrastructure mapping for DNA43318-1217 (Table 14): (1) in primary lung tumors: LT12, LT13, LT15, LT16 and LT18, and (2) in primary colon tumors: CT2 , CT4, CT5, CT8, CT10, C14, CT15 and CT16 The epicenter mapping for DNA43318-1217 also results in confirmation of significant amplification (Table 15A): (1) in primary lung tumors: LT12, LT13, LT15 and LT16; and (2) in primary colon tumors: CT4, CT5, CT6, CTll and CT2. In contrast, the amplification of the closest known markers of infrastructure and the epicenter markers (with one exception, ie, P107) do not occur to a greater degree than that of DNA43318-1217. This strongly suggests that DN43318-127 is the gene responsible for the amplification of the particular region on chromosome 16. Because the amplification of DNA43318-1217 occurs in several lung and colon tumors, it is highly likely that it plays an important role in the formation or growth of tumors. As a result, antagonists (for example antibodies) directed against the protein encoded by DNA43318-1217 (PR0343) have utility in cancer therapy.

PR0347 (DNA44176-1244): Table 5 reports the values of? Ct for DNA44176-1244 in various tumors. Typically a? Ct of > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA44176-1244 coding for PR0347 has been produced: (1) in primary lung tumors: LT1, LTla, LT3, LT6, LT9, LT10, LTll, LT12, LT13, LT15 , LT17, LT19 and LT21; and (2) in primary colon tumors: CTl, CT2, CT3, CT5, CT8, CTll, CT14, CT15 and CT16. Because the amplification of DNA44176-1244 occurs in various lung and colon tumors, it is highly likely to play an important role in the formation or growth of tumors. As a result, antagonists (e.g., antibodies) directed against the protein encoded by DNA44176-1244 (PR0347) would be expected to have utility in cancer therapy. í ^ -tA.Á? * ± > ? * J¡ *? .- j ~ ¿PR0357 (DNA44804-1248): The values of? Ct for DNA44804-1248 in various tumors are reported in Table 5. A? Ct of > 1 is typically used as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA44804-1248 coding for PR0357 has been produced: (1) in primary lung tumors: LTla, LT3, LT6, LT9, LT10, LTll, LT12, LT13, LT15, LT16 , LT17, LT18, LT19 and LT21; (2) in primary colon tumors: CT2, CT8, CT10, CT14, CT15, CT16, CT1, CT4, CT5, CT6, CT7 and CT11. The amplification was confirmed by infrastructure mapping for DNA44804-1248 (Table 27) in primary lung tumors: LT3, LT10, LTll, LT12, LT13, LT15, LT17, LT19 and LT21. In epicenter mapping to DNA44804-1248 it has also resulted in the confirmation of significant amplification (Table 28) in primary lung tumors: LTll, LT12, LT13, LT15, LT17 and LT19. In contrast, the amplification of the closest known markers of infrastructure and epicenter markers does not occur to a greater degree than in DNA44804-1248. This strongly suggests that DNA44804-1248 is the gene responsible for the amplification of the particular region on chromosome 16.

Because amplification of DNA44804-1248 occurs in several lung tumors, it is highly likely to play an important role in the formation or growth of tumors. As a result, antagonists (eg antibodies) directed against the protein encoded by DNA44804-1248 (PR0357) can be expected to have utility in cancer therapy.

PR0715 (DNA52722-1229): The values of? Ct for DNA52711-1229 in various tumors is reported in Table 5. Typically a? Ct of > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA52711-1229 coding for PR0715 occurs: (1) in primary lung tumors: LT1, LTla, LT9, LT10, LTll, LT12, LT13, LT15, LT16, LT17, LT18 and LT19; (2) in primary colon tumors: CT2, CT3, CT8, CT10, CR14, CT15, CT16, CT17, CT1, CT4, CT5, CT6, CT7, CTII and CT18. The amplification was confirmed by infrastructure mapping for DNA52711-1229 (Table 22): (1) in primary lung tumor LTll, LT13, LT15, LT16, LT17 and LT18; and (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16 and CT17. In epicenter mapping for DNA52711-1229 it also results in confirmation of significant amplification (Table 23): (1) in primary lung tumors: LTll, LT13, LT15, LT16, LT17 and LT18; and (2) in primary colon tumors: CTl, CT3, CT4, CT5, CT6, CT7, CT10, CTll, CT14, CT15, CT16 and CT18. In marked contrast, the amplification of the closest known infrastructure markers and epicenter markers does not occur to a greater degree than in DNA52711-1229.

This strongly suggests that DNA52711-1229 is the gene responsible for the amplification of the particular region on chromosome 17. Because the amplification of DNA52711-1229 occurs in several lung and colon tumors, it is highly likely to play an important role in the formation or growth of tumors. As a result, antagonists (ie, antibodies) directed against the protein encoded by DNA52711-1229 (PR0715) can be expected to have utility in cancer therapy.

PRO1017 (DNA56112-1379) Table 5 shows the values of? Ct for DNA56112-1379 in different tumors. Typically, a ? Ct of > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that an amplification occurs ? AA - * fe - ** - "'-" * •' - * - - - * - * Jt 'important nucleic acid DNA56112-1379 encoding PRO1017: (1) in primary lung tumors: LTla, LT3 , LT6, LT7, LT9, LT10, LTll, LT12, LT13, LT15, LT16, LT17, LT18, LT19 and LT21; (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT4, CT5, CT6, CT9 and CTll. Amplification was confirmed by infrastructure mapping for DNA56112-1379 (Table 19) in primary lung tumors: LT3, LT4, LT7, LT9, LT10, L511, LT12, LT13, LT15, LT16, LT18 and LT22. The epicenter mapping for DNA56112-1379 also results in confirmation of significant amplification (Table 18): (1) in primary lung tumors: LT12, LT13, LT15, LT16 and LT18; and (2) in primary colon tumors: CT5, CT8, CT10, CT12, CT14, CT16 and CT17. In marked contrast, the amplification of the closest known infrastructure markers and epicenter markers does not occur to a greater degree than in DNA56112-1379. This strongly suggests that DNA56112 -1379 is the gene responsible for the amplification of the particular region on chromosome 7. Because the amplification of DNA56112-1379 occurs in several tumors, it is highly likely that it plays an important role in the formation or growth of tumors. As a result, antagonists (e.g., antibodies) directed against the encoded protein can be expected by DNA56112-1379 (PRO1017) have utility in cancer therapy.

PR01112 (DNA57702-1476): Table 5 shows the values of? Ct for DNA57702-1476 in various tumors. Typically a? Ct of > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA57702-1476 encoding PR01112 occurs: (1) in primary lung tumors: LT10, LTll, LT12, LT13, LT15, LT17 and LT18; (2) in primary colon tumors: CT2, CT8, CT10, CT12, CT14, CT15, CT16, CTl, CT4, CT5, CT6 and CTll. Because the amplification of DNA57702-1476 occurs in several tumors, it is highly likely that it plays an important role in the formation or growth of tumors. As a result, antagonists (e.g., antibodies) directed against the protein encoded by DNA57702-1476 (PR01112) would be expected to have utility in cancer therapy.

PRO509 (DNA50148): Table 5 shows the values of? Ct for DNA50148 in various tumors. Typically a? Ct of > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA50148 coding for PRO509 occurs: (1) in primary lung tumors: LT1, LTla, LT3, LT4, LT9, LT12, LT13, LT15, LT16, LT17 and LT19; (2) in primary colon tumors: CT15, CT17, CT6, CTll, CT18. Because the amplification of DNA50148 occurs in various lung and colon tumors, it is highly likely that it plays an important role in the formation or growth of tumors. As a result, antagonists (e.g., antibodies) directed against the protein encoded by DNA50148 (PRO509) would be expected to have utility in cancer therapy.

PR0853 (DNA48227-1350): Table 5 shows the values of? Ct for DNA48227-1350 in different tumors. Typically, a ? Ct of > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy OR.???? L ^? , of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA48227-1350 occurs which codes for PR0853: (1) in primary lung tumors: LTll, LT12, LT13, LT15 and LT16; (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT1, CT4, CT5, CT7 and CT11; and (3) in lung tumor cell lines: H441 and H522. Amplification has not been confirmed by epicenter mapping for DNA48227 in primary lung tumors, but is observed in primary colon tumors (Table 24B): CTl, CT2, CT3, CT4, CT5, CT6, CT8, CT9, CT10, CTll , CT12, CT14, CT15 and CT17. In marked contrast, the amplification of the closest known epicenter markers does not occur to a greater degree than in DNA48227. This strongly suggests that DNA48227 is the gene responsible for the amplification of the particular region on chromosome 17. Because the amplification of DNA48227-1350 occurs in several tumors, it is highly likely that it plays an important role in the formation or growth of tumors. As a result, antagonists (e.g., antibodies) directed against the protein encoded by DNA48227-1350 (PR0853) can be expected to have utility in cancer therapy. t jtM.jtA ^ - * - > * < É ^ ** - PR0882 (DNA58125): Table 5 shows the values of? Ct for DNA58125 in various tumors. Typically a? Ct of 5 > 1 as the threshold value for the amplification rating, as this represents a duplication of the copy of the gene. Table 5 indicates that a significant amplification of the nucleic acid DNA58125 coding for PR0882 occurs: (1) in primary lung tumors: LTla, LT3, LT6, LT9, LT10, LTll, LT12, LT13, LT15, LT16, LT17, LT18, LT19 and LT21; (2) in colon tumors: CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT1, CT4, CT5 and CT1; (3) in lung tumor cell lines; and (4) in colon tumor cell lines: S 620, Colo320, HT29, SKCOl, S 403, LS174T, Col? 205, HCT15, HCC2998, and KM12.

Amplification has been confirmed by infrastructure mapping for DNA58125 (Table 14) in primary lung tumors: LT3, LT12, LT13, LT15, LT16 and LT18; (2) in primary colon tumors: CTl, CT2, CT3, CT4, CT5, CT6, CT8, CT10, CT12, CT14, CT15 and CT18. The epicenter mapping for DN58125 also results in confirmation of significant amplification (Table 15B): (1) in primary lung tumors: LT12, LT13, LT15, LT16 and LT17; and (2) in primary colon tumors: CTl, CT4, CT6, CT7, CT9, CTll, CT2, CT8, CT10 and CT16. In stark contrast, the amplification of infrastructure markers closest known and the epicenter markers are not produces to a greater degree than in DNA58125. This strongly suggests that DNA58125 is the gene responsible for the amplification of the particular region on chromosome 16. Because the amplification of DNA58125 occurs in several tumors, it is highly likely to play an important role in the formation or growth of tumors. . As a result, antagonists (e.g., antibodies) directed against the protein encoded by DNA58125 (PR0882) can be expected to have utility in cancer therapy.

EXAMPLE 18 Hybridization in if you Hybridization in itself is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations. It may be useful, for example, to identify gene expression sites, analyze the distribution of transcription in tissue, identify and localize viral infection, track changes in specific mRNA synthesis and assist in chromosome mapping. Hybridization in itself has been done following an optimized version of Lu and Gillett's protocol, Cell Vision. 1. : 169-176 (1994), using riboprobes labeled with 33P generated by PCR. Briefly, human tissues embedded in paraffin and fixed with formalin are cut, deparaffinized, deproteinized in proteinaceous K (20 g / ml) for 15 minutes at 37 ° C and further processed for hybridization in itself as described by Lu. And Gillett supra. An antisense riboprobe labeled with (33-P) UTP is generated from a product in PCR and is hybridized at 55 ° C overnight. The slices are immersed in Kodak NTB2MR nuclear tracking emulsion and exposed for 4 weeks.

Synthesis of the 33P riboprobe An amount of 6.0 μl (125 mCi) of 33P-UTP (Amersham BF 1002, SA <2000 Ci / mmol) is dried by vacuum at speed. To each tube containing dry 33P-UTP, the following ingredients are added: 2.0 μl of transcription buffer 5x 1.0 μl of DTT (100 mM) 2.0 μl of NTP mixture (2.5 mM: 10 μl of each of GTP, CTP and ATP + 10 μl H20) 1.0 μl of UTP (50 μM) 1.0 μl of RNAsin 1.0 μl of DNA template (1 μg) 1.0 μl of H20 1. 0 μl of RNA polymerase (for PCR products T3 = AS, T7 = S, usually). The tubes are incubated at 37 ° C for one hour. A total of 1.0 μl of DNase RQ1 is added followed by incubation at 37 ° C for 15 minutes. A total of 90 μl of TE (10 mM Tris, pH 7.6 / 1 mM EDTA, pH 8.0) are added and the mixture is pipetted onto DE81 paper. The remaining solution is loaded in a MICROCON-SO ^ ultrafiltration unit and subjected to centrifugation using a program 10 (6 minutes). The filtration unit is inverted over a second tube and subjected to centrifugation using program 2 (3 minutes). After a final recovery centrifugation, a total of 100 μl of TE is added and then 1 μl of the final product is pipetted into DE81 paper and counted in 6 ml of BIOFLUOR 11"". The probe is run on a TBE / urea gel. A total of 1.3 μl of the probe or 5 μl of RNA Mrk III is added to 3 μl of loading buffer. After charging at 95 ° C heat block for 3 minutes, the gel is immediately placed on ice. The gel wells are washed by discharging and the sample is charged and runs at 180-250 volts for 45 minutes. The gel is rolled up in plastic wrap (brand SARAN1) and exposed to an XAR film with an intensification screen in a freezer at -70 ° C for one hour, overnight.

Hybridization with 33P A. Preliminary treatment of frozen cuts The slices are removed from the freezer, placed on aluminum trays and reheated at room temperature for five minutes. The trays are placed in an incubator at 55 ° C for 5 minutes to reduce condensation. The cuts are fixed for 10 minutes in paraformaldehyde 4% on ice in a fume hood and wash in 0.5 x SSC for 25 minutes at room temperature (25 ml 20 x SSC + 975 ml SQ H20). After deproteinization in 0.5 μg / ml of proteinase K for 10 minutes at 37 ° C (12.5 μl of concentrate 10 mg / ml in 250 ml of RNase preheated, RNase-free) buffer), the sections are washed in 0.5 x SSC for 10 minutes at room temperature. The cuts are dehydrated in 70%, 95% and 100% ethanol, 2 minutes each Auno.

B. Preliminary screening of embedded cuts in 20 paraffin The slices are deparaffinized, placed in SQ H20 and rinsed twice in 2 x SSC at room temperature, during minutes each time. The sections are deproteinized at 20 μg / ml proteinase K (500 μl 10 mg / ml in 250 ml buffer) RNAse-free RNAase; 37 ° C, 15 minutes) for human embryo tissue, or K 8 x proteinase (100 μl of RNase buffer 250 ml, 37 ° C, 30 minutes) for formalin tissues. Subsequent rinsing in 0.5 x SSC and dehydration is performed as described above.

C. Prehybridization The cuts are placed in a plastic box filled with Box cushion (4 x SSC, formamide 50%), saturated filter paper. The tissue is recovered with 50 μl of hybridization buffer (3.75 g of dextran sulfate + 6 ml of SQ H20), swirled and heated in a microwave for 2 minutes with the lid loosened. After cooling on ice, 18.75 ml of formamide, 3.75 ml of 20 x SSC and 9 ml of SQ H20 are added and the tissue is well vortexed and incubated at 42 ° C for 1-4 hours.

D. Hibri da ci ón An amount of 1.0 x 106 cpm of probe and 1.0 μl of TRNA (50 mg / ml concentrate) per cut is heated at 95 ° C for 3 minutes. The slices are cooled in ice, and 48 μl of hybridization buffer is added by cutting. After vortexing, 50 μl of a 33P mixture is added to 50 μl of prehybridization in the cut. The sections are incubated overnight at 55 ° C.

E. Washes Washing is carried out for 2 x 10 minutes with 2 x SSC, EDTA at room temperature (400 ml 20 x SSC + 16 ml 0.25 M EDTA, Vf = 4 1), followed by treatment with RNase A at 37 ° C for 30 minutes (500 μl of 10 mg / ml in 250 ml of Rnasa buffer = 20 μg / ml). The sections are washed 2 x 10 minutes with 2 x SSC, EDTA at room temperature. The stringency washing conditions are as follows: 2 hours at 55 ° C, O.l x SSC, EDTA (20 ml 20 x SSC + 16 ml EDTA, Vf = 41).

F. Oligonucleotides In-situ analysis is performed on two of the DNA sequences described here. The oligonucleotides used for these analyzes are as follows: (1) PR0292 (DNA35616Q (Cathepsin D) DNA35616-pl: 5 '-GGA TTC TAA TAC GAC TCA CTA TAG GGC TCT TCG ACA CGG GCT CCT CCA A-31 (SEQ ID NO: 96) DNA35616-p2: '-CTA TGA AAT TAA CCC TCA CTA AAG GGA CAG CTC GCG CAC CTC ATC CAC-3' (SEQ ID NO: 97) DNA35616 (Cathepsin D), an astrogenic inducible lysosomal aspart ilprot easa, shows expression in widely disseminated tissue. It has been reported that the expression correlates with the result in breast and lung cancer. In normal tissues, widely disseminated expression is observed in macrophages and cells of the macrophage line, especially osteoclasts. Expression is observed in epithelial cells of the lung, liver, gallbladder, stomach (basal glands), kidney, gallbladder and prostate. Expression has also been observed in adult cardiac myocytes, cartilage and cellular neurons. In the fetus, the expression is stronger in osteoclasts, but it is also observed in the thymus, splenic red pulp, fetal liver (hepatocytes and Kupffer cells), bronchial epithelium, choroid plexus, neurons and spinal ganglia. Extra noticeable expression is observed in diseased tissues: DNA35617 is widely expressed in macrophages at sites of damage; in tumor tissues, expression is observed at varying levels in malignant epithelium and all lung cancers. In nine out of fifteen tumors, expression is higher in the malignant epithelium than in the benign epithelium-a finding that is consistent with amplification. The expression is always higher in tumor-associated macrophages than that seen in malignant epithelium and in one case the expression is surprising in multinucleated giant cells. (2) PR0327 (DNA38113 -1230) (Prolactin receptor homolog DNA38113-pl: 5 '-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC CCT GAG CTC TCC CGT GTA-3' (SEQ ID NO: 98) 5 '-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG CTC GCC ACT GGT CGT AGA-3 '(SEQ ID NO: 99) High expression is observed in developing mice and human fetal lung, whereas in normal adult lung, including bronchial epithelium, it is negative. Expression in human fetal trachea is also observed, which includes with high probability smooth muscle cells. Expression is also observed in non-trophoblastic cells in human placenta. These data are consistent with a potential role in bronchial development. In addition, DNA38113 has been identified as amplified in a panel of lung cancers. Accordingly, its expression is examined in a series of lung cancers: eight squamous carcinomas and eight adenocarcinomas are examined. In AaM «? T ^. ^,. B, M ^» M ... ^ M,.? ? ? Based on the observation of a strong expression on the radiographic film, three tumors are examined after a two-week exposure, all other cuts are examined after a 4-week exposure. DNA38113 is highly expressed in three of eight adenocarcinomas. More focal, moderate expression is observed in four other adenocarcinomas. None of the squamous carcinomas shows significant expression on the malignant epithelium, although low level expression is detected. The expression is not restricted to malignant epithelium; additional sites of expression include: benign bronchiolar epithelium; expression in cells shaped as stromal uses; expression in the smooth muscle of the arteries (in one sample the expression is in the outer third of the wall); and in bronchial nerves and small nerves). The expression of DNA38113 is consistent with the amplification data (shown above). The expression is especially prominent in three tumors studied. Based on the expression data, this may be a therapeutic goal for lung adenocarcinomas. The pattern of expression in the fetal lung suggests a possible role in the growth and repair of the lungs. (3) PR01265 (DNA60764-1533) (Homolog of Figure 1) DNA60764-pl: 5 '-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGC GCT CTG CTG TCA CCA-3' (SEQ ID NO: 100) DNA60764-p2: 5 '-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTT CCC CTC CCC GAG AAG ATA-3 '(SEQ ID NO: 101) Fifteen of the sixteen lung tumors examined were adequate for analysis (eight adenocarcinomas and seven squamous adenocarcinomas). Most of the tumors showed some expression of DNA60764. The expression is confined largely to mononuclear cells adjacent to the infiltrating tumor. In a squamous carcinoma, expression is seen by the malignant epithelium. Expression is also observed on fetal thymic cells and marrow of certain histogenesis. Expression is observed on mononuclear cells in damaged renal interstitium and in interstitial cells in a renal cell carcinoma. The expression on cells in a germinal center is also observed, consistent with the fact that most of the positive cells of figure 1 are probably of inflammatory origin. - i aUÍrrte¡ tá.m .. ^ d¿. ^,? rk ... .... *. . *, ***** .- ............ "», ^ .. í, J., -,. ~. > ... ~ l ~ * .. ~ * ~ J * ml. *. ~ ^ .. A.-m .. * .. ^ ~ ..lSrt (4) PR0343 (DNA43318-1217) (Prostasin counterpart human) '-GGA TTC TAA TAC GAC TCA CTA TAG GGC GCG GCG AGG ACA GCA CTG ACA G-3' (SEQ ID NO: 102) DNA43318-p2: 5 '-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCG GGC CCC CAG AGG TAG AGG-3 '(SEQ ID NO: 103) Expression is observed in lung carcinomas as well as in normal fetal and benign adult tissue. Expression is observed in five of eight adenocarcinomas, and three of seven squamous carcinomas. The expression on the malignant epithelium is observed. The expression in cells adjacent to areas of necrosis is accentuated, which suggests that this gene can be activated by hypoxia or that it can be associated with cell death or cell division. Expression is also observed in two sarcomas and in renal cell carcinoma. In benign tissues, expression on the esophageal epithelium and gastric development is observed, with greater expression in superficial cells. No specific expression is observed in adult gastric epithelium, but expression is observed in basal glands of the chimpanzee stomach. A low level of expression is observed in fetal and adult epithelium SS? Itt? bronchial as well as in bronchial cartilage. The fetal limbs show expression adjacent to bone formation sites. Placenta expression is also observed. The stromal cells in the wall of the penis of the rhesus monkey shows expression and regional expression is observed on the neurons in the monkey brain. (5) PR0357 (DNA44804-1248) (Homolog of ALS): DNA44804-pl: 5 '-GGA TTC TAA TAC GAC TCA CTA TAG GGC TGC CCG CAA CCC CTT CAA CTG-3 '(SEQ ID NO: 104) DNA44804-p2: 5' - CTA TGA AAT TAA CCC TCA CTA AAG GGA CCG CAG CTG GGT GAC CGT GTA-3 '(SEQ ID NO: 105) Low to moderate expression is observed at sites of bone formation in fetal tissues and in malignant cells of an osteosarcoma. Low-level expression is also seen in the placenta and umbilical cord. (6) PRQ715 (dna52722-1229) (TNF counterpart) DNA52722-pl: '-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGC CCC GCC ACC TCC T-31 (SEQ ID NO: 106) DNA52722-p2: 5' -CTA TGA AAT TAA CCC TCA CTA AAG GGA CTC GAG ACA CCA CCT GAC CCA-3 '(SEQ ID NO: 107) DNA52722-p3: 5' -GGA TTC TAA TAC GAC TCA CTA TAG GGC CCA AGG AAG GCA GGA GAC TCT-3 '(SEQ ID NO: 108) DNA52722-p4 5 '-CTA TGA AAT TAA CCC TCA CTA AAG GGA CTA GGG GGT GGG AAT GAA AAG-3' (SEQ ID NO: 109) A high level of generalized expression is observed in many tissues: the highest signals are observed on placenta, osteoblasts, damaged renal tubules, damaged liver, colorectal liver metastasis and gallbladder. The samples tested show liver damage induced by acetaminophen and liver cirrhosis. The tissues also examined include eight adenocarcinomas and eight squamous carcinomas in the lung. Strong expression is observed on macrophages in all tumors examined. In one case, there is a weak to moderate expression on benign bronchial epithelium. Expression is also observed in a lung sample that does not contain tumor with moderate inflammatory changes. - * fc., j? l, ^? ¡? ^ i «« B, A. ^ »« AtJ ^ r? .a *, i? »iZi.á. ? (7) PRO1017 (DNA56112 - 1379) (Homologue of sulf otransfrasase) DNA56112-pl: 5 '-GGA TTC TAA TAC GAC TCA CTA TAG GGC GCA GCA GGC GGA GCG GAG GAG-3' (SEQ ID NO: 110) DNA56112-p2: 5 '-CTA TGA AAT TAA CCC TCA CTA AAG GGA CAC GGC GAA CTT GCG GTA GAA-3 '(SEQ ID NO: 111) A positive signal is observed in a multiple tumor block: expression is observed in squamous carcinoma, sarcoma and hepatocellular carcinoma. In lung cancers: two of the eight adenocarcinomas and two of the seven squamous carcinomas show a positive signal on the malignant epithelium. A positive signal is also observed on the cortical and hippocampal neurons in the adult rhesus monkey brain. A possible signal is observed in the epithelium of the fetal small intestine. (8) PR0853 (DNA48227-1350) (Reductase homolog): DNA48227-pl: 5 '-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCA ACA GCG GCA TCG GAA AGA-3' (SEQ ID NO: 112) DNA48227-p2: '-CTA TGA AAT TAA CCC TCA CTA AAG GGA GGA GCA CCA GCC AAG CCA ATG-3' (SEQ ID NO: 113) Elevated expression is observed in the mucus of the chimpanzee's stomach.

EXAMPLE 19 The use of PRO201. PRQ292, PRQ327. PR01265, PRQ344. PR0343, PR0347. PRQ357. PRQ715, PRO1017. PRQ1112, PRO509. PR0853 or PRQ882 as a hybridization probe The following method describes the use of a nucleotide sequence encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 as a hybridization probe. The DNA comprising the coding sequence for a polypeptide "PRO201", "PR0292", "PR0327", "PR01265", "PR0344", "PR0343", "PR0347", "PR0357", "PR0715", "PRO1017" , "PR01112", "PRO509", "PR0853" or "PR0882" of full length or mature as described herein or fragments thereof may be used as a probe for examination for homologous DNA (such as those encoding for variants that occur naturally PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882) in human tissue cDNA libraries or human tissue genomic libraries. The hybridization and washing of the filters containing either the library DNA is carried out under the following conditions of high stringency. Hybridization of a probe derived from PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 radiolabeled to the filters is done in a 50% formamide solution, 5x SSC , SDS 0.1% 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, Denhardt 2x solution and 10% dextran sulfate at 42 ° C for 20 hours. The filters are washed in an aqueous solution of 0.1 x SSC and 0.1% SDS at 42 ° C. DNAs having a desired sequence identity with the DNA encoding the full-length native sequence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 are can identify using conventional or standard techniques, known in the art.

EXAMPLE 20 Expression of the PRO201, PR0292, PR0327, PR01265, PR0344 polypeptides. PR0343, PR0347, PR0357, PR0715, PRO1017, 5 PR01112. PRO509, PR0853 or PR0882 in E. coli This example illustrates the preparation of a non-glycosylated form of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 by recombinant expression in E. coli. The DNA sequence encoding the PRO polypeptide of interest is initially amplified using the selected PCR primers. The primers may contain restriction enzyme sites corresponding to the sites of restriction enzyme in the selected expression vector. A variety of expression vectors can be used. An example of a suitable vector is pBR322 (derived from E. coli, see Bolivar et al., Gene. 2:95 (1977)) which contains genes for ampicillin and tetracycline resistance.

The vector is digested with restriction enzyme and dephosphorylated. The sequences amplified by PCR are then ligated into the vector. The vector preferably will include sequences which code for an antibiotic resistance gene, a TRP promoter, a poly-His leader (which includes the first six STII codons, the poly-His sequence and the enterokinase separation site), the coding region for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, the lambda transcriptional terminator and an argU gene. The ligation mixture is then used to transform a selected E. coli strain using the methods described in Sambrook et al. , supra. Transformants are identified by their ability to grow on LB plates and antibiotic-resistant colonies are then selected. The plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing. The selected clones can grow overnight in liquid culture medium such as LB broth supplemented with anbitiotics. The overnight culture can subsequently be used to inoculate a culture on a larger scale. The cells are then grown to the desired optical density, during which the expression promoter is activated. After culturing the cells for several additional hours, the cells can be harvested by centrifugation. The cell pellet obtained by centrifugation can be solubilized using various agents known in the art, and the protein PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 solubilized after can be purified the & ti AA- t »-M -« .... < i ¿* ». using a metal chelating column under conditions that allow tight binding of the protein. PR0327 has been successfully expressed in E. coli, in a poly-His tagged form using the following procedure. Initially the DNA encoding PR0327 is amplified using selected PCR primers. The primers contain restriction enzyme sites which respond to the restriction enzyme sites in the selected expression vector, and other useful sequences that provide efficient and reliable translation initiation, rapid purification on a metal chelation column and proteolytic removal with enterokinase. Poly-His-tagged and PCR-amplified sequences are then ligated into an expression vector which is used to transform E. coli hosts into base in strain 52 (3110 fuhA (tonA) Ion galE rpoHts (htpRts) clpP ( The transformants are first grown in LB containing 50 mg / ml carbenicillin at 30 ° C with stirring until an OD of 3-5 at 600 nm is obtained.The cultures are then diluted 50-100 times in medium CRAP (which is prepared by mixing 3.57 g of (NH4) 2S04, 0.71 g of sodium citrate- 2H20, 1.07 g of KCl, 5.36 g of Difco yeast extract, 5.36 g of hycase Sheffield SF in 500 ml of water, as MPOS 110 mM, pH 7.3, glucose 0.55% (w / v) and MgSO4 7 mM) and is grown for approximately 20-30 hours at 30 ° C with shaking. they are removed to verify expression by SDS-PAGE analysis and the volume culture is centrifuged to pellet the cells. The cell pellets are frozen until purification and renatured. The paste of E. coli from 0.5 to 1 1 of fermentations (6-10 g of sediments) is resuspended in 10 volumes (w / v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and tetrathionate sodium are added to make final concentrations of 0.1 M and 0.02 M respectively, and the solution is stirred overnight at 4 ° C. This step results in a denatured protein with all the cysteine residues blocked by sulfitolization. The solution is centrifuged at 40,000 rpm in a Beckman ultracentrifuge for 30 min. The supernatant is diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and filtered through 0.22 micron filters to clarify. The clarified extract is loaded onto a 5 ml Qiagen Ni2 + -NTA metal chelate column equilibrated with a metal chelate column buffer. The column is washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The proteins are eluted with buffer containing 250 mM imidazole. The fractions containing the desired protein are accumulated and stored at 4 ° C. The protein concentration is estimated by its absorbance at l .-. L-i? .É.jír í.í. ^ ...?. .-Handle..*... 280 nm using the extension coefficient calculated based on its amino acid sequence. The protein is refolded by diluting the sample slowly in freshly prepared renaturation buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine, and 1 mM EDTA. The renaturation volumes are chosen so that the final protein concentration is between 50 and 100 micrograms / ml. The renaturation solution is gently stirred at 4 ° C for 12-36 hours. The renaturation reaction is suspended by the addition of TFA to a final concentration of 0.4% (pH of about 3). Prior to further purification of the protein, the solution is filtered through a 0.22 micron filter and acetonitrile is added to a final concentration of 2-10%. The renatured protein is chromatographed on a Poros Rl / H reversed phase column using a mobile buffer of 0.1% TFA with elution with an acetonitrile gradient of 10 to 80%. The aliquots of the fractions with absorbance A280 are analyzed in SDS-polyacrylamide gels and the fractions containing the homogeneous renatured protein accumulate. Generally, appropriately renatured species of most proteins are eluted at the lowest concentrations of acetonitrile since these species are more compact with their hydrophobic interiors covered by the interaction with the reverse phase resin. Aggregated species usually elute at higher concentrations of acetonitrile. In addition to separating the misfolded forms of proteins from the desired form, the reverse phase step also eliminates the endotoxin from the samples. Fractions containing the folded PR0327 protein accumulate and the acetonitrile is removed using a gentle stream of nitrogen directed at the solution. The proteins are formulated in 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or gel filtration using GF Superfine resins (Pharmacia) equilibrated in the formulation buffer and sterilized by filtration.

EXAMPLE 21 Expression of PRO201, PR0292, PR0327, PR01265, PR0344. PR0343, PR0347. PR0357. PR0715, PRO1017, PR01112, PRO509. PR0853 or PR0882 in mammalian cells This example illustrates the preparation of a potentially glycosylated form of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 by recombinant expression in mammalian cells. jÉÉ i f r. HJ Huí - -f * fr-? The vector pRK5 (see EP 307,247, published March 15, 1989) is used as the expression vector. Optionally, bind PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 within pRK5 with the restriction enzymes selected to allow DNA insertion for PRO201, PR0292 , PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 using ligation methods such as those described in Sambrook et al., Supra. The resulting vector is designated pRK5-pRK5-PRO201, pRK5-PR0292, pRK5-PR0327, pRK5-PR01265, pRK5-PR0344, pRK5-PR0343, pRK5-PR0347, pRK5-PR0357, pRK5-PR0715, pRK5-PRO1017, pRK5-PR01112 , pRK5-PRO509, pRK5-PR0853 or pRK5-PR0882. In one embodiment, the selected host cells may be 293 cells. Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal bovine serum and optionally with nutritional components or antibiotics, or both. The DNA of about 10 μg is mixed for pRK5-PRO201, pRK5-PR0292, pRK5-PR0327, pRK5-PR01265, pRK5-PR0344, pRK5-PR0343, pRK5-PR0347, pRK5-PR0357, pRK5-PR0715, pRK5-PRO1017, pRK5 -PR01112, pRK5-PRO509, pRK5-PR0853 or pRK5-PR0882 with approximately 1 μg of DNA encoding for the VA RNA [Thimmappaya et al., Cell, 31: 543 (1982)] and 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl2. 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, NaP04 is added dropwise to this mixture. 1.5 mM and a precipitate is allowed to form for 10 minutes at 25 ° C. The precipitate is suspended and added to 293 cells and allowed to settle for about 4 hours at 37 ° C. The culture medium is removed by aspiration and 2 ml of 20% glycerol in PBS are added for 30 seconds. The 293 cells are then washed with serum free medium, fresh medium is added and the cells are incubated for approximately 5 days. Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or with culture medium containing 200 μCi / ml of 35S-cysteine and 200 μCi / ml of 35S-methionine. After 12 hours of incubation, the conditioned medium is collected, concentrated on a rotary filter and loaded on a 15% SDS gel. The processed gene is then dried and exposed to the film for a selected period of time to show the presence of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Cultures containing transfected cells may undergo additional incubation (in serum-free medium) and the medium is tested in selected bioassays.

In an alternative technique, DNA for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853, or PR0882 can be introduced transiently in 293 cells using the dextran sulfate method described by Somparyrac et al. , Proc. Nati Acad. Sci., 12: 7575 (1981). 293 cells are grown to maximum density in a rotating flask and 700 μg of DNA are added for pRK5-PRO201, pRK5-PR0292, pRK5-PR0327, pRK5-PR01265, pRK5-PR0344, pRK5-PR0343, pRK5-PR0347, pRK5- PR0357, pRK5-PR0715, pRK5-PRO1017, pRK5-PR01112, pRK5-PRO509, pRK5-PR0853 or pRK5-PR0882. The cells are first concentrated from the spinning flask by centrifugation and washed with PBS. The DNA-dextran precipitate is incubated on the cell pellet for 4 hours. Cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium and reinserted into the spinner flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days, the conditioned medium is centrifuged and filtered to remove the cells and debris. The samples containing PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 expressed afterwards can be concentrated and purified by any selected method, such as dialysis or column chromatography . - ^ v ^ a i ß uam In another embodiment, it can be expressed PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in CHO cells. The vector pRK5-PRO201, pRK5-PR0292, pRK5-PR0327, pRK5-PR01265, pRK5-PR0344, pRK5-PR0343, pRK5-PR0347, pRK5-PR0357, pRK5-PR0715, PRO1017, PR01112, pRK5-PRO509, pRK5-PR0853 or pRK5-pRK5-PR0882 can be transfected into CHO cells using known reagents such as CaP04 or DEAE-dextran. As described above, cell cultures can be incubated and the medium replaced with culture medium (alone) or with media containing a radiolabel such as 35S-methionine. After determining the presence of PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, the culture medium can be replaced with serum free medium. Preferably, the cultures are incubated for about 6 days and the conditioned medium is harvested. The medium containing PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 expressed below can be concentrated and purified by any selected method. PR201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 labeled with epitope can also be expressed in host CHO cells. The PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be subcloned from the pRK5 vector. The subclone insert may undergo PCR to fuse in frame with a selected epitope kit such as the poly-His tag within a baculovirus expression vector. The insert of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 tagged with poly-His can then be subcloned into an SV40 driven vector containing a selection marker such as DHFR for selection of stable clones. Finally, the CHO cells can be transfected (as described above) with the SV40 driven vector. The marking can be done as described above, to verify the expression. The culture medium containing PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 labeled with poly-His expressed afterwards can be concentrated and purified by any selected method, for example by affinity chromatography of Ni2 + -chelate. Expression in CHO or COS cells, or both, can also be carried out by a transient expression method. PR01265, PRO1017 and PRO509 are expressed in CHO cells by a stable expression method, while PR0292, PR0715 and PRO509 are expressed in CHO cells by a transient method. Stable expression in CHO cells is performed using the following procedure. The proteins are ld ?? ± á ^ l * ???. I * .iM * ¿i .a. ,. t »* ~. ? ~ ....,. ^ * - ^ > ... ^ saa ^ aÉÉfcÉ *. »^» ». ^^^ express as an IgG construct (immunoadhesin) in which the coding sequences for the soluble forms (eg, extracellular domains) of the respective proteins are fused to an IgG1 constant region sequence containing the hinge, CH2 and CH2 and in a tagged form with poly-His. After PCR amplification, the respective DNAs are subcloned into a CHO expression vector using standard techniques as described in Ausubel et al. , Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression vectors are constructed to have compatible restriction sites 5 'and 3' of the DNA of interest to allow convenient transfer of the cDNAs. The vector used for expression in CHO cells is as described in Lucas et al. , Nucí. Acids Res. . 24: 9 (1774-1779 (1996)) and utilizes the SV40 early promoter / enhancer to activate expression of the cDNA of interest and dihydrofolate reductase (DHFR) .The DHFR expression allows selection for stable maintenance of the plasmid after transfection. introduce 12 μg of the desired plasmid DNA in approximately 10 million CHO cells using commercially available transfection reactions Superfect ^ (Qiagen), Dosper "or Fugene ™ (Boehringer Mannheim) .The cells are grown as described in Lucas et al., supra Approximately 3 x 107 cells are frozen in an ampoite for further growth and production, as described below. The vials containing the plasmid DNA are reheated by placing them in a water bath and mixing when swirled. The contents are pipetted into a centrifuge tube containing 10 ml of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated and the cells are resuspended in 10 ml of selective medium (PS20 filtered at 0-2 μm with 5% diafiltered fetal bovine serum 0.2 μm). Aliquots of the cells are then taken in a 100 ml centrifugal extractor containing 90 ml of selective medium. After 1-2 days, the cells are transferred to a 250 ml centrifuge extractor which is filled with 150 ml of means of selective growth and incubated at 37 ° C. After another 2-3 days, 250 ml, 500 ml and 2000 ml centrifuge extractors are seeded with 3 x 10 5 cells / ml. Cell media is exchanged with fresh medium by centrifugation and resuspension in production medium. Although you can use any The appropriate CHO medium is in fact a production medium described in U.S. Patent No. 5,122,469 published on June 16, 1992. The 3 1 centrifugal production extractor is seeded at 1.2 x 10 6 cells / ml. On day 0, the number of cells and the pH. On day 1, the centrifugal extractor was *? v &* * $ * .. t i? á A ± s-íuM ± * * fa ~ ...... . . *. . . r ... ^. -r Mtfgjjflj ^ ffflffi ^ j ^^ sample and purge with filtered air starts. On day 2, the centrifugal extractor is sampled and the temperature is shifted to 33 ° C and 30 ml of 500 g / 1 of glucose and 0.6 ml of 10% antifoam (for example a 35% emulsion of polydimethylsiloxane, Dow Corning 365 Medical Grade Emulsion) is added. During production, the pH is adjusted as necessary to maintain it at approximately 7.2. After 10 days or until the viability decreases below 70%, the cell culture is harvested by centrifugation and filtered through a 0.22 μM filter. The filtrate is stored at 4 ° C or immediately loaded into columns for purification. For constructs labeled with poly-His, proteins are purified using a Ni2 + -NTA column (Qiagen). Before purification, imidazole is added to the conditioned medium to a concentration of 5 mM. The conditioned medium is pumped into a 6 ml Ni2 + -NTA column equilibrated with 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml / min at 4 ° C . After loading, the column is washed with additional equilibration buffer and the protein is eluted with equilibrium buffer containing 0.25 M imidazole. The highly purified protein subsequently extracts the salt in storage buffer containing 10 mM Hepes, 0.14 M NaCl. and 4% mannitol, pH 6.8 with 25 ml of a G25 Superfine column (Pharmacia) and stored at -80 ° C.

Immunoadhesin constructs are purified (containing Fc) from the conditioned medium, as follows. The conditioned medium is pumped into a protein column A 5 ml (Pharmacia) which has been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column is extensively washed with equilibrium buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately neutralized by collecting 1 ml fractions in tubes containing 275 μl of 1 M Tris buffer, pH 9. The highly purified protein subsequently extracts the salt in the storage buffer as described above for labeled proteins with poly-His. It is determined in homogeneity by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation. PR0292, PR0327, PR0344, PR0347, PR0357 and PR0853 are also produced by transient expression in COS cells.

EXAMPLE 22 Expression of PRO201. PR0292. PR0327. PR01265. PR0344.

PR0343. PR0347, PR0357. PR0715. PRO1017. PR01112, PRO509, PR0853 or PR0882 in yeast The following method describes the recombinant expression of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in yeast. First, expression vectors are constructed in yeast for production or intracellular secretion of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 from the ADH2 promoter. GAPDH. The DNA encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and the promoter are inserted into suitable restriction enzyme sites in the selected plasmids to direct the intracellular expression of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. For secretion, the DNA encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be cloned into the selected plasmid, along with DNA encoding the promoter PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 a native signal peptide of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715 , PRO1017, PR01112, PRO509, PR0853 or PR0882 or other mammalian signal peptide, or, for example, yeast alpha factor or a secretory signal / invertase leader sequence and linker sequences (if needed) for the expression of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. 5 Yeast cells, such as the yeast strain Then they can be transformed with the expression plasmids described above and cultured in selected fermentation medium. Transformed yeast supernatants can be analyzed by acid precipitation % trichloroacetic and separation by SDS-PAGE followed by staining of the gels with Coomassie blue staining. PR201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or recombinant PR0882 can subsequently be isolated and Purify by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 can be further purified using chromatography resins in selected columns.

EXAMPLE 23 Expression of PRO201. PRQ292, PRQ327, PRQ1265, PRQ344. PRQ343, PRQ347, PRQ357. PRQ715, PRO1017. PR01112, PRO509. PRQ853 or PR0882 in insect cells infected with baculovirus The following method describes recombinant expression in insect cells infected with baculovirus. The sequence that codes for PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 is fused towards the N-terminal part of an epitope tag contained within a baculovirus expression vector. Such epitope tags include poly-His tags and immunoglobulin tags (such as the Fc regions of IgG). Various plasmids can be used, which include plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the sequence encoding PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or the desired portion of the coding sequence of PRO201, PR0292, PR0327, PR01265 , PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 [such as the sequence coding for the extracellular domain of a protein ít A? Ld. *? * - i? I ... «, .., r, ^ **.,. ^ *. . ... . ...... m. ^ r ^, ^. ^^ ... ^. ^^ t ^^^^ j ^ j transmembranal or the sequence that codes for the mature protein if the protein is extracellular] is amplified by PCR with primers complementary to the 5 'and 3' regions. The 5 'primer can be incorporated by flanking (selecting) the restriction enzyme sites. The product is then digested with those selected restriction enzymes and subcloned into the expression vector. The recombinant baculovirus is generated by cotransfecting the previous plasmid in BaculoGold virus DNA " (Pharmingen) in Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using lipofectin (commercially available from GIBCO-BRL). After 4-5 days of incubation at 28 ° C, the released viruses are harvested and used for additional amplifications. Viral infection and protein expression are L5 performed as described by O'Reilley et al. , Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford University Press (1994). The PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 labeled with poly-His and expressed can then be purified, for example, by affinity chromatography with Ni2 + -chelate, as follows. Extracts are prepared from Sf9 cells infected with recombinant virus as described by Rupert et al. , Nature, 362: 175-179 (1993). Briefly, it wash Sf9 cells, resuspend in sonication buffer (25 ml of Hepes, pH 7.9, 12.5 mM MgCl2, 0.1 mM EDTA, 10% glycerol, 0.1% NP-40, 0.4 M KCl) and sonicated twice for 20 seconds on ice. The sonicates are clarified by centrifugation and the supernatant is diluted 50-fold in charge buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8 and filtered through a 0.45 μm filter.) An agarose column is prepared Ni2 + -NTA (commercially available from Qiagen) with a bed volume of 5 ml, washed with 25 ml of water and equilibrated with 25 ml of charge buffer.The filtered cell extract is loaded onto the column at 0.5 ml per minute The column is washed to the A280 baseline with charge buffer, at which point the fraction recollection is started, then the column is washed with secondary wash buffer (50 mM phosphate, 30 mM NaCl, 10% glycerol). , pH 6.0), which elutes the protein that does not bind specifically.After re-attaining baseline A280 again, the column is developed with an imidazole gradient from 0 to 500 mM in a secondary wash buffer. Fractions of 1 ml are collected and analyzed by SDS-PAGE and silver stain or Western blot (Western blot) with Ni2 + -NTA conjugated to alkaline phosphatase (Qiagen). The fractions containing PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 labeled with His10, respectively, accumulate and dialyze against charged buffer.

Alternatively, the purification of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 labeled with IgG (or labeled with Fc) can be performed using known chromatography techniques that they include, for example, protein A or G protein column chromatography. Although the expression is currently performed on a scale of 0.5-2 1, it can be easily increased for larger preparations (for example 8 1). The proteins are expressed as an IgG construct (immunoadhesin) in which the extracellular protein region is fused to an IgG1 constant region sequence containing the hinge, CH2 and CH3 domains or the poly-His tagged forms. After PCR amplification, the respective coding sequences are subcloned into a baculovirus expression vector (pB PH IgG for IgG fusions and pb.pH.His.c for proteins labeled with poly-His) and the vector and DNA of baculovirus Baculogold ™ (Pharmingen) are cotransfected in 105 Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His are modifications of commercially available baculovirus expression vectors pVL1393 (Pharmingen), with modified polylinker regions to include the His or Fc tag sequences. The cells are grown in Hink TNM-FH medium supplemented with 10% FBS (Hyclone). The cells are incubate for 5 days at 28 ° C. The supernatant is harvested and subsequently used for the first viral amplification by infecting Sf9 cells in Hink TNM-FH medium supplemented with 10% FBS at a multiplicity of infection (MOI) of about 10. The cells are incubated for 3 days at 28 ° C. The supernatant is harvested and the expression of the constructs in the baculovirus expression vector is determined by binding of batches of 1 ml of supernatant to 25 ml of Ni2 + -NTA (QIAGEN) spheres for histidine-tagged proteins or CL spheres. 4B Protein-A Sepharose (Pharmacia) for proteins labeled with IgG, followed by analysis with SDS-PAGE comparing with a known concentration of protein standard by Coomassie blue staining. The first viral amplification supernatant is used to infect a centrifuge culture (500 ml) culture of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an MOI of approximately 0.1. The cells are incubated for 3 days at 28 ° C. The supernatant is harvested and filtered. The batch that is bound and analyzed by SDS-PAGE is repeated, as necessary, until the expression of the centrifugal extractor culture is confirmed. The conditioned medium of the transfected cells (0.5 to 3 1) is harvested by centrifugation to remove the cells and filtered through 0.22 micron filters. For constructions labeled with poly-His, the Protein construction is purified using the Ni2 + -NTA column (Qiagen). Imidazole is added to the conditioned medium at a concentration of 5 mM before purification. The conditioned medium is pumped over a 6 ml column of Ni2 + -NTA equilibrated with 20 mM Hepes, buffer pH 7.4 containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml / min, at 4 ° C. After loading, the column is washed with additional equilibration buffer and the protein is eluted with equilibrium buffer containing 0.25 M imidazole. The highly purified protein subsequently removes the salt in a storage buffer containing 10 mM HEPES, 0.14 M NaCl. and 4% mannitol, pH 6.8, with 25 ml of a G25 Superfine column (Pharmacia) and stored at -80 ° C. The immunoadhesin constructs (containing Fc) of proteins are purified from conditioned medium as follows. The conditioned medium is pumped into a 5 ml column of protein A (Pharmacia) which has been equilibrated with 20 mM Na phosphate buffer, pH 6.8. After loading, the column is extensively washed with equilibration buffer before elution with 100 mM citric acid. The eluted protein is immediately neutralized by collecting 1 ml fractions in tubes containing 275 ml of 1 M Tris buffer, pH 9. The highly purified protein is subsequently extracted the salt in storage buffer as described above for the proteins labeled poly-His. The homogeneity of the proteins is verified by electrophoresis in SDS and polyacrylamide gel (PEG) and N-terminal amino acid sequencing by Edman degradation. PR0327, PR0344 and PRO509 are expressed in Sf9 insect cells infected with baculovirus by the above procedure. Alternatively, a modified baculovirus method incorporating high 5 cells can be used. In this procedure, the DNA encoding the desired sequence is amplified with suitable systems such as Pfu (Stratagene) or fused to the 5 'part of a label of epitope contained with baculovirus expression vector. Such epitope tags include poly-His tags and immunoglobulin tags (such as Fc regions of IgG). Various plasmids can be used which include plasmids derived from commercially available plasmids such as pIEl-1.

(Novagen). The pIEl-1 and pIEl-2 vectors are designed for constitutive expression of recombinant proteins from the ia baculovirus promoter in stably transformed insect cells. The plasmids differ only in the orientation of the multiple cloning sites and contain all the promoter sequences known to be important for the expression of the iel-mediated gene in uninfected insect cells as well as the enhancer element hr5. pIEl-1 and pIEl-2 include the translation start site and can be used to produce fusion proteins. Briefly, the desired sequence or the desired portion of the sequence (such as the sequence encoding the extracellular domain of a transmembrane protein) is amplified by PCR with primers complementary to the 5 'and 3' regions. The 5 'primer can incorporate flanking restriction enzyme sites (selected). The product is then digested with those selected restriction enzymes and subcloned into the expression vector. For example, pIEl-1 derivatives can include the Fc region of human IgG (pb.PH.IgG) or a 8 histidine tag (pb.PH.His) towards the 3 'end of the desired sequence. Preferably, the construction of the vector is sequenced for confirmation. High cells are grown to 50% confluence under the conditions of 27 ° C C02, NO pen / strep. for each 150 mm plate, 30 μg of vector based on pIE containing the sequence are mixed and mixed with 1 ml of Ex-Cell medium (Media: Ex-Cell 401 + 1/100 L-Glu JRH Biosciences # 14401- 78P (note: this medium is sensitive to light)) and in a separate tube 100 μl of CellFectin (CellFECTIN (GibcoBRL # 10362-010) (swirled to mix)) is mixed with 1 ml of Ex-Cell medium. The two solutions are combined and allowed to incubate at room temperature for 15 minutes. 8 ml of Ex-Cell medium is added to the 2 ml of the DNA / CellFECTIN mixture and this is stratified into high 5 cells that have been washed once with Ex-Cell medium. The plate is then incubated in the dark for 1 hour at room temperature. The DNA / CellFECTIN mixture is then aspirated and the cells washed once with Ex-Cell to remove excess CellFECTIN, 30 ml of fresh Ex-Cell medium is added and the cells are incubated for 30 days at 28 ° C. The supernatant is harvested and expression of the sequence in the baculovirus expression vector is determined by batch binding of 1 ml of supernatant to 25 ml of Ni2 + -NTA (QIAGEN) spheres for histidine-tagged proteins or protein spheres -A Sepharose CL-4B (Pharmacia) for proteins labeled with IgG followed by analysis by SDS-PAGE compared to a known concentration of protein standard by assie blue staining. The conditioned medium of the transfected cells (0.5 to 3 1) is harvested by centrifugation to remove the cells and filtered through 0.22 micron filters. For the poly-His tagged constructs, the protein comprising the sequence is purified using the Ni2 + -NTA column (Qiagen). Imidazole is added to the conditioned medium at a concentration of 5 mM before purification. The conditioned medium is pumped to a 6 ml column of Ni2 + -NTA equilibrated in 20 mM Hepes buffer pH 7.4 containing 0.3 M NaCl and 5 mm imidazole at a flow rate of 4- ml / min at 48 ° C. After loading, the column is washed with additional equilibration buffer and the protein is eluted with equilibrium buffer containing 0.25 M imidazole. The highly purified protein is then subsequently removed from the salt in storage buffer containing 10 mM HEPES, 0.14 NaCl. M and 4% mannitol, pH 6.8, with a 25 ml column of G25 Superfine (Pharmacia) and stored at -80 ° C. The immunoadhesin constructs (containing Fc) of the proteins are purified from the conditioned medium as follows. The conditioned medium is pumped onto a 5 ml column of protein A (Pharmacia) which has been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column is extensively washed with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately neutralized by collecting 1 ml fractions in tubes containing 275 ml of 1 M Tris buffer, pH 9. The highly purified protein is subsequently removed from the salt in the storage buffer as described above for proteins labeled poly-His. The homogeneity of the sequence is determined by polyacrylamide gels and SDS and by N-terminal amino acid sequencing by Edman degradation and other analytical procedures, as desired or necessary. u * * - ** .. «* ~ ^ .- .. r» ~~~ ».-. ^, ^^ íM ^ js« ^ í ^^ cold ^ g ^ j = ^ PR0327, PR01265, PR0344 and PR0882 are successfully expressed by the modified anterior baculovirus procedure that incorporates high 5 cells.

EXAMPLE 24 Preparation of antibodies that bind to PRO201, PR0292, PR0327, PR01265. PR0344, PR0343, PR0347, PR0357, PR0715. PRO1017. PR01112. PRO509. PR0853 or PR0882 This example illustrates the preparation of monoclonal antibodies which can bind specifically to PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Techniques for producing monoclonal antibodies are known in the art and are described, for example in Goding, supra. Immunogens that may be used include PR201, PR0292, PR0297, PR0327, PR01265, PR0344, PR0343, PR0347, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853, PR0853 or PR0882 purified PRO01, PR0292, PR0327, PR01265, PR0344 fusion proteins. , PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 and cells that express PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 recombinant on the cell surface. The Selection of the immunogen can be performed by a person skilled in the art without undue experimentation. Mice such as Balb / c are immunized with the immunogen PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 emulsified in complete Freund's adjuvant and injected subcutaneously. or intraperitoneal in an amount of 1-100 micrograms. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the hind paws of the animal. The immunized mice are then boosted 10 to 12 days thereafter with additional immunogen emulsified in the selected adjuvant. Subsequently, for several weeks, the mice can also be boosted with additional immunization injections. Serum samples can be obtained periodically from mice by retro-orbital bleeding to perform tests in ELISA assays to detect anti-PR0201 antibodies, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against PR0347, against-PR0357, against-PR0715, against-PRO1017, against-PROll12, against-PR0509, against-PR0853 or against-PR0882. After a suitable antibody titer has been detected, animals with "positive" antibody results can be injected with a final intravenous injection of PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. Three to four days later, the mice are sacrificed and the spleen cells harvested. Spleen cells are then fused (using 35% polyethylene glycol to a selected murine myeloma cell line such as P3X63AgU.l, available from ATCC, No. CRL 1597. The fusions generate hybridoma cells which are then coated onto plates of 96-well tissue cultures containing HAT medium (hypoxanthine, aminopterin and thymidine) to inhibit proliferation of unfused cells, myeloma hybrids and spleen cell hybrids Hybridoma cells will be examined in an ELISA test to determine reactivity against PRO201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882. The determination of "positive" hybridoma cells that secrete the desired monoclonal antibodies against PRO201, PR0292, PR0327. , PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, are within the skill in the art. A positive can be injected intraperitoneally in syngeneic Balb / C mice to produce ascites containing monoclonal antibodies against PRO-201, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against-PR0347, against-PR0357 , Contra¬ PR0715, against-PR01017, against-PR01112, against-PRO509, against-PR0853 or against-PR0882. Alternatively, the hybridoma cells can be grown in tissue culture flasks or spinning bottles. The purification of the monoclonal antibodies produced in the ascites can be carried out using ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography can be used based on the binding of the antibody to protein A or protein G.

Deposit of material The following materials have been deposited with the American Type Culture Collection, 10801 University BIvd., Manassas, VA 20110-2209, USA (ATCC): Material ATCC Deposit No. Date of deposit DNA30676-1223 209567 12/23/97 DNA38113-1230 209530 12/10/97 DNA60764-1533 203452 11/10/98 DNA40592-1242 209492 11/21/97 DNA43318-1217 209481 11 / 21/97 DNA44176-1244 209532 12/10/97 DNA44804-1248 209527 12/10/97 DNA52722-1229 209570 1/7/98 will go :, »i 4 _ .. i .; Aril, DNA56112-1379 209883 5/20/98 DNA57702-1476 209951 6/9/98 DNA48227-1350 209812 4/28/98 These deposits were made under the provisions of the Budapest Treaty regarding the international recognition of the deposit of microorganisms for the purpose of patent procedure and related regulations (Budapest Treaty). This ensures the maintenance of a viable culture of the deposit for 30 years from the date of deposit. The deposit will be made available by the ATCC under the terms of the Budapest treaty, and is subject to an agreement between Genentech, Inc. and ATCC that ensures the permanent and unrestricted availability of the progeny of the deposit culture to the public before the publication of the relevant United States patent or before the opening to the public of any US application or foreign patent, whichever comes first, and ensures the availability of the progeny to a determined by the United States commissioner of patents and trademarks who is qualified for the same, in accordance with 35 USC § 122 and the rules of the commissioner in accordance with it (which includes 37 C.F.R. § 1.14 with particular reference to 886 OG 638). The assignee of the present application agrees that if a culture of the materials on deposit is killed or and ^ - > tmkt i i ^ s atatsat loses or destroys when cultivated under suitable conditions, the material will be replaced expeditiously upon notification, with another equal. The availability of the deposited material should not be considered as a license for the practice of the invention in contravention of the rights granted under the authority of any government, in accordance with its patent laws. The specification written in the above is considered sufficient to allow a person skilled in the art to carry out the invention. The present invention is not limited in scope by the deposited construct, since the deposited mode is considered as a simple illustration of some aspects of the invention and any construction that is functionally equivalent is within the scope of this invention. The deposit of material herein does not constitute an admission that the written description contained herein is inadequate to carry out the practice of any aspect of the invention, including the best mode thereof, nor should it be construed as limiting the scope of the claims for the specific illustrations that it represents. In fact, various modifications of the invention, in addition to those shown and described here, will become apparent to those skilled in the art.

In the art, from the preceding description, they will be within the scope of the appended claims. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. tv ??? é ?? ** ..- ü J f, ^ * n ¿? JM ** A .-? ~ + *. - ^^ .. ^. ^ - ^ fc ^^ - ^. ^., ^^^ .. ^ .. .......

Claims

CLAIMS Having described the invention as above, the content of the following claims is claimed as property: 1. An isolated antibody that binds to a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112 , PRO509, PR0853 or PR0882.
2. The antibody according to claim 1, characterized in that it binds specifically to such a polypeptide.
3. The antibody according to claim 1, characterized in that it induces the death of a cell expressing such a polypeptide.
4. The antibody according to claim 3, characterized in that the cell is a cancer cell that overexpresses the polypeptide without comparison with a normal cell of the same tissue type.
5. The antibody according to claim 1, characterized in that it is a monoclonal antibody.
6. The antibody according to claim 5, characterized in that it comprises a non-human complementarity determining region (CDR) or a human infrastructure (FR) region.
7. The antibody according to claim 1, characterized in that it is labeled.
8. The antibody according to claim 1, characterized in that it is an antibody fragment or a single chain antibody.
9. A composition of matter, characterized in that it comprises an antibody according to claim 1, in admixture with a pharmaceutically acceptable carrier.
10. The composition of matter according to claim 9, characterized in that it comprises a therapeutically effective amount of the antibody.
11. The composition of matter according to claim 9, characterized in that it further comprises a cytotoxic or chemotherapeutic agent.
12. An isolated nucleic acid molecule, characterized in that it encodes the antibody according to claim 1.
13. A vector, characterized in that it comprises the nucleic acid molecule according to claim 12.
14 A host cell, characterized in that it comprises the vector according to claim 13. L5
15. A method for producing an antibody that binds to the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882, the method is characterized in that it comprises cultivating 0 the host cell according to claim 14 under conditions sufficient to allow the expression of such antibody and recover the antibody from the cell culture. i.i Í ?? A, tA¡kAáu * .-.
16. An antagonist of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882.
17. The antagonist according to claim 16, characterized in that the antagonist inhibits the growth of tumor cells.
18. An isolated nucleic acid molecule, characterized in that it hybridizes to a nucleic acid sequence encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, or a complement of it.
19. The isolated nucleic acid molecule according to claim 18, characterized in that the hybridization is under conditions of astringent hybridization and washing. 0
20. A method for determining the presence of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in a sample suspected of containing the polypeptide, the method is characterized in that it comprises exposing the shows an anti-PRO201 antibody, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against-PR0347, against-PR0357, against-PR0715, against-PRO1017, against-PR01112, against PR0509, against-PR0853 or against-PR0882 and 5 determine the binding of the antibody to the polypeptide in the sample.
21. The method according to claim 20, characterized in that the sample comprises 10 a cell suspected of containing the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882.
22. The method according to claim 21, characterized in that the cell is a cancer cell.
23. A method for diagnosing a tumor in a mammal, the method is characterized in that it comprises To detect the level of expression of a gene encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of 25 normal tissue cells known from the same cell type, in where a higher level of expression in the test sample, compared to the control sample, is indicative of the presence of a tumor in the mammal from which the test tissue cells are obtained.
24. A method for diagnosing a tumor in a mammal, the method is characterized in that it comprises: (a) contacting an anti-PRO201 antibody, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against -PR0347, against-PR0357, against-PR0715, against-PR01017, against-PR01112, against-PRO509, against-PR0853 or against-PR0882 with a test sample of tissue cells obtained from the mammal, and (b) detect the formation of a complex between the antibody and a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in the test sample, wherein the formation of a complex is indicative of the presence of a tumor in the mammal.
25. The method according to claim 24, characterized in that the antibody is detectably labeled.
26. The method according to claim 24, characterized in that the test sample of tissue cells is obtained from an individual suspected of having growth or proliferation of neoplastic cells.
27. A team for diagnosing cancer, characterized in that it comprises an anti-PRO201 antibody, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against-PR0347, against-PR0357, against-PR0715, against PR01017, against-PR01112, against-PRO509, against-PR0853 or against-PR0882 and a carrier in a suitable container. OR
28. The equipment according to claim 27, characterized in that it further comprises instructions for using the antibody to detect the presence of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in a sample suspected of containing it.
29. A method to inhibit the growth of tumor cells, the method is characterized in that it comprises exposing the tumor cells expressing the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 to an effective amount of an agent that inhibits an activity of the polypeptide, wherein the growth of the tumor cells is inhibited in this way.
30. The method according to claim 29, characterized in that the tumor cells overexpress the polypeptide in comparison with normal cells of the same type of tissue.
31. The method according to claim 29, characterized in that the agent is an anti-PRO201 antibody, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against-PR0347, against-PR0357, against PR0715, against-PR01017, against-PR01112, against-PRO509, against-PR0853 or against-PR0882.
32. The method according to claim 31, characterized in that the anti-PRO201 antibody, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against-PR0347, against-PR0357, against-PR0715, against -PRO1017, against-PR01112, against-PRO509, against-PR0853 or against-PR0882 induces cell death.
33. The method according to claim 29, characterized in that the tumor cells íá, m.-í .LA-. -.ilrAt. r are further exposed to radiation treatment, a cytotoxic agent or a chemotherapeutic agent.
34. A method for inhibiting the growth of tumor cells, the method comprises exposing the tumor cells expressing a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 to a effective amount of an agent that inhibits the expression of the polypeptide, wherein the growth of the tumor cells is inhibited in this manner.
35. The method according to claim 34, characterized in that the tumor cells are overexpressed to the polypeptide in comparison with normal cells of the same tissue type.
36. The method according to claim 34, characterized in that the agent is an antisense oligonucleotide that hybridizes with a nucleic acid encoding the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 or a complement thereof.
37. The method according to claim 36, characterized in that the tumor cells they are further exposed to radiation treatment, a cytotoxic agent or a chemotherapeutic agent.
38 A manufacturing article, characterized in that it comprises: a package; a label on the package; and a composition comprising an active agent contained within the container, wherein the composition is effective to inhibit the growth of tumor cells and wherein the label on the container indicates that the composition is effective to treat conditions characterized by overexpression of a PRO201 polypeptide. , PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in tumor cells, compared to normal cells of the same type of tissue.
39. The article of manufacture according to claim 38, characterized in that the active agent inhibits the biological activity or the expression of the PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882.
40. The article of manufacture according to claim 39, characterized in that the active agent is an anti-PR0201 antibody, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against-PR0347, against-PR0357, against-PR0715, against-PR01017, against-PR01112, against-PR0509, against-PR0853 or against-PR0882.
41. The article of manufacture according to claim 39, characterized in that the active agent is an antisense oligonucleotide.
42. A method for identifying a compound that inhibits a biological or immunological activity of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, the method is characterized in that it comprises contacting a candidate compound with the polypeptide under conditions and for a time sufficient to allow the two components to interact and determine whether the biological or immunological activity of the polypeptide is inhibited.
43. The method according to claim 42, characterized in that the candidate compound is an anti-PR0201 antibody, against-PR0292, against-PR0327, against-PR01265, against-PR0344, against-PR0343, against-PR0347, against-PR0357, against -PR0715, against-PR01017, against-PR01112, against-PRO509, against-PR0853 or against-PR0882. A.í¿.ád.? É ÍM ?,?, I? Ái * ... t ^ ... ,, ^ * ........, r < ^. ^. ^ .... ^., .-. ^ M ^. ^ ....- ^ ..... ".... faith" ¡i ^ ifiA 1 | ^
44. The method according to claim 42, characterized in that the candidate compound or PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PRO509, PR0853 or PR0882 is immobilized on a solid support .
45. The method according to claim 44, characterized in that the non-immobilized component is detectably marked.
46. A method to identify a compound that inhibits the activity of a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, the method comprises the steps of: ) contacting cells and a candidate compound to be examined in the presence of the polypeptide under conditions suitable for the induction of a cellular response normally induced by the polypeptide, and (b) determining the induction of the cellular sequence to determine whether the test compound is an effective antagonist, wherein the lack of induction of the cellular response is indicative that the compound is an effective antagonist.
47. A method for identifying a compound that inhibits the expression of PRO201 polypeptide, PR0292, PR0327, Aíík í, ¿i¡? ± í .. L - «fc ** - * PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882 in cells expressing the polypeptide, where the method comprises contacting the cells with a candidate compound and determining whether the expression of the polypeptide is inhibited.
48. The method according to claim 47, characterized in that the candidate compound is an antisense oligonucleotide.
49. Isolated nucleic acid, characterized in that it has at least 80% nucleic acid sequence identity with a nucleotide sequence coding for an amino acid sequence that is selected from the group consisting of the amino acid sequence shown in Figure 2 ( SECTION ID NO: 2), FIGURE 4 (SEQ ID NO: 6), FIGURE 6 (SEQ ID NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), FIGURE 12 (SEQ ID NO: 23), FIGURE 14 (SEQ ID NO: 28), FIGURE 16 (SEQ ID NO: 33) , FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO. 46), Figure 26 (SEQ ID NO: 48) and Figure 28 (SEQ ID NO: 53).
50. Isolated nucleic acid, characterized in that it has at least 80% nucleic acid sequence identity with a nucleotide sequence of the group consisting of the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1) , FIGURE 3 (SEQ ID NO: 5), FIGURE 5 (SEQ ID NO: 7), FIGURE 7 (SEQ ID NO: 12), FIGURE 9 (SEQ ID NO. 14), FIGURE 11 (SEQ ID NO: 22), FIGURE 13 (SEQ ID NO: 27), FIGURE 15 (SEQ ID NO: 32), FIGURE 17 (SEQ ID. NO: 39), FIGURE 19 (SEQ ID NO: 41), FIGURE 21 (SEQ ID NO: 43), FIGURE 23 (SEQ ID NO: 45), FIGURE 25 (SEC. IDENT NO: 47) and Figure 27 (SEQ ID NO: 52).
51. Isolated nucleic acid, characterized in that it has at least 80% nucleic acid sequence identity with a nucleotide sequence that is selected from the group consisting of the full length coding sequence of the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1), FIGURE 3 (SEQ ID NO: 5), FIGURE 5 (SEQ ID NO: 7), FIGURE 7 (SEQ ID NO: 12), FIGURE 9 (SEQ ID NO: 14), FIGURE 11 (SEQ ID NO: 22), FIGURE 13 (SEQ ID NO: 27), FIGURE 15 (SEQ ID NO: 32) ), Figure 17 (SEQ ID NO: 39), Figure 19 (SEQ ID NO: 41), Figure 21 (SEQ ID NO: 43), Figure 23 (SEQ ID NO. : 45), figure 25 (SEQ ID NO: 47) and figure 27 (ID SECTION NO: 52).
52. Isolated nucleic acid, characterized in that it has at least 80% nucleic acid sequence identity with a full-length DNA coding sequence deposited under ATCC accession number 209567, 209530, 203452, 209492, 209481, 209532, 209527, 209570, 209883, 209951 or 209812.
53. A vector, characterized in that it comprises the nucleic acid according to any of claims 49 to 52.
54. The vector according to claim 53, operably linked to control sequences recognized by a host cell transformed with the vector.
55. A host cell, characterized in that it comprises the vector according to claim 53.
56. The host cell according to claim 55, characterized in that the cell is a CHO cell.
57. The host cell according to claim 55, characterized in that the cell is an E. coli cell.
58. The host cell according to claim 55, characterized in that the cell is a yeast cell.
59. The host cell according to claim 55, characterized in that the cell is an insect cell infected with baculovirus.
60. A process for producing a PRO201 polypeptide, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1017, PR01112, PRO509, PR0853 or PR0882, characterized in that it comprises culturing the host cell according to claim 55, under suitable for expression of the polypeptide and recovering the polypeptide from the cell culture.
61. An isolated polypeptide, characterized in that it has at least 80% amino acid sequence identity with an amino acid sequence that is selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO: 2) ), FIGURE 4 (SEQ ID NO: 6), FIGURE 6 (SEQ ID NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO. : 15), Figure 12 (SEQ ID NO: 23), Figure 14 (SEQ ID NO: 28), Figure 16 (SEQ ID NO: 33), Figure 18 (SECTION IDENTI NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ. DE IDENTITY NO: 48) and FIGURE 28 (SEQ ID NO: 53).
62. An isolated polypeptide, characterized in that it qualifies with at least 80% positives when compared to an amino acid sequence that is selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO. 2), FIGURE 4 (SEQ ID NO: 6), FIGURE 6 (SEQ ID NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID. NO: 15), FIGURE 12 (SEQ ID NO: 23), FIGURE 14 (SEQ ID NO: 28), FIGURE 16 (SEQ ID NO: 33), FIGURE 18 (SEC. IDENT NO: 40), Figure 20 (SEQ ID NO: 42), Figure 22 (SEC. IDENT. NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48) and FIGURE 28 (SEQ ID NO: 53).
63. An isolated polypeptide, characterized in that it has at least 80% amino acid sequence identity to an amino acid sequence encoded by the full length coding sequence of the DNA deposited under ATCC No. of CCESO 209567, 209530, 203452, 209492, 209481, 209532, 209527, 209570, 209883, 209951 or 209812.
64. A chimeric molecule, characterized in that it comprises a polypeptide according to any of claims 61 to 63 fused to a heterologous amino acid sequence.
65. The chimeric molecule according to claim 64, characterized in that the heterologous amino acid sequence is an epitope tag sequence.
66. The chimeric molecule according to claim 64, characterized in that the sequence of A heterologous amino acid is an Fc region of an immunoglobulin.
67. An antibody which binds specifically to a polypeptide, according to any of claims 61 to 63.
The antibody according to claim 67, characterized in that the antibody is a monoclonal antibody, a humanized antibody or an antibody of simple chain. 25
69. An isolated nucleic acid, characterized in that it has at least 80% nucleic acid sequence identity for: (a) a nucleotide sequence encoding the polypeptide shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID. NO: 8), Figure 8 (SEQ ID NO: 13), Figure 10 (SEC. IDENT. NO: 15), figure 12 (SEQ ID NO: 23), figure 14 (SEQ ID NO: 28), FIGURE 16 (SEQ ID NO: 33), FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48) and FIGURE 28 (SEQ ID NO: 53) ), which lacks its associated signal peptide; (b) a nucleotide sequence coding for an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ. DE IDENTIFIER NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), FIGURE 12 (SEQ ID NO: 23), FIGURE 14 (FIG. ID SECTION NO: 28), figure 16 (SEQ ID NO: 33), FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID. NO: 44), Figure 24 (SEQ ID NO: 46), Figure 26 (SEC. IDENT. NO: 48) and Figure 28 (SEQ ID NO: 53), with its associated signal peptide; or (c) a nucleotide sequence coding for an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEC. DE IDENT NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), FIGURE 12 (SEQ ID NO: 23), FIGURE 14 (SEQ ID NO: 28), FIGURE 16 (SEQ ID NO: 33), FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48) and FIGURE 28 (SEQ ID NO: 53) ), which lacks its associated signal peptide.
70. An isolated polypeptide, characterized in that it has at least 80% amino acid sequence identity to: (a) the polypeptide shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID. NO: 6), FIGURE 6 (SEQ ID NO: 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), FIGURE 12 (SEQ. DE IDENTIFIER NO: 23), Figure 14 (SEQ ID NO: 28), Figure 16 (SEC. IDENT. NO: 33), figure 18 (SEQ ID NO: 40), figure 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48) and Figure 28 (SEQ ID NO: 53), which lacks its associated signal peptide; (b) an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8) ), Figure 8 (SEQ ID NO: 13), Figure 10 (SEQ ID NO: 15), Figure 12 (SEQ ID NO: 23), Figure 14 (SEQ ID NO. 28), FIGURE 16 (SEQ ID NO: 33), FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEQ ID. NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48) and FIGURE 28 (SEQ ID NO: 53), with its associated signal peptide; or (c) an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO. 8), FIGURE 8 (SEQ ID NO: 13), FIGURE 10 (SEQ ID NO: 15), FIGURE 12 (SEQ ID NO: 23), FIGURE 14 (SEQ ID. NO: 28), FIGURE 16 (SEQ ID NO: 33), FIGURE 18 (SEQ ID NO: 40), FIGURE 20 (SEQ ID NO: 42), FIGURE 22 (SEC. IDENT NO: 44), FIGURE 24 (SEQ ID NO: 46), FIGURE 26 (SEQ ID NO: 48) and FIGURE 28 (SEQ ID NO: 53), which lacks its associated signal peptide.