MXPA01005750A - Procollagen c-proteinase inhibitors - Google Patents

Abstract

This invention relates to compounds of Formula (I) wherein R1-R7, A, Z and n are as described in the summary of the invention that are inhibitors of procollagen C-proteinase, pharmaceutical compositions containing them, methods for their use and methods for their preparation.

Description

INHIBITORS OF PROCOLAGEN C-PROTEINASE Background of the Invention. The present invention relates to compounds that inhibit procollagen C-proteinase, to pharmaceutical compositions containing them, to methods for their use and to methods for preparing these compounds. Collagens are integral components of connective tissue. So far, nineteen types of collagens have been identified. Types I, II and II of interstitial collagen are the main components of tissue collagen. These collagens are synthesized as procollagen precursor molecules having amino- and carboxy-terminal peptide extensions also known as pro-regions are typically divided after the secretion of the procollagen molecule to give a mature collagen molecule that is capable of associating in highly structured collagen fibers (see, for example, Fessler and Fessler, Annu Rev. Biochem 47, 129 (1978), Kivirikko et al., "Extracellular Matrix Biochemistry" (1984) and Kuhn, "Structure and Function of Collagen types "(eds.

Ref: 129559 Mayne, R. and Burgeson, R.E.), Academic Press, Inc., Orlando, Florida, pages 1-42 (1987). Excessive collagen deposition is associated with a variety of fibrotic diseases such as interstitial pulmonary fibrosis, pericentral fibrosis, symmers fibrosis, perimuscular fibrosis, kidney fibrosis, endocardial sclerosis, hepatitis, acute respiratory distress syndrome, arthritis, cystic fibrosis, adhesions surgical, tendon surgery, corneal scars, scleroderma, chronic allograft rejection, shunt fibrosis by dialysis and restenosis. These diseases are characterized by excessive deposits of fibrillar interstitial collagens that are resistant to proteolytic degradation leading to fibrosis symptoms. Therefore, the inhibition of the pathological deposition of these collagens should help in the treatment of these diseases. Description of the invention. Recent studies suggest that procollagen C-proteinase is the essential enzyme that catalyzes the cleavage of C-propeptides from type I, II and III collagens and therefore contributes to the formation of functional collagen fibers (see Fertala et al. , J. Biol. Chem., 269, 11584. (1994)). It would be convenient, therefore, to provide inhibitors of the procollagen C-proteinase and thereby provide a means to combat diseases mediated by excessive deposition of these collagens. In a first aspect, this invention provides hydroxamic acids selected from the group of compounds represented by the formula (I): (I) wherein: R1 and R4 are, independently of one another, hydrogen or alkyl; R2 is: (i) cycloalkyl, cycloalkylalkyl, Aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocyclic or heterocycloalkyl; or (ii) - (alkylene) -B-X wherein B is -0-, -NR8-, -S (0) "- (where n is 0, 1 or 2), -C = 0, -. 25 -CONR8-, -NR8C02-, NR8S02- or -C (= NR8) NR8S02- (wherein R is H or alkyl) and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl heteroaryl or heteroaralkyl; or (iii) - (alkylene) -B-X- wherein B is -NR8CO- (wherein R8 is H or alkyl), and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl; or (iv) R2 and R3 form an alkylene or heteroalkylene chain; R3 is hydrogen or alkyl; R6 is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, or heteroaralkyl; R5 is: (i) hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroalkenyl, heterocycloalkyl, heteroalkyl, or - (alkylene) -CYOJ-X1 wherein X1 is alkyl, hydroxy, alkoxy , aryl, aralkyl, aryloxy, aralkyloxy, heteroaryl, heteroaryloxy, heteroaralkyloxy or NR'R "(wherein R 'and R" are independently H or alkyl, or R' and R "form an alkylene chain); or (ii) R and R4 form an alkylene chain; or (iii) R and R form an alkylene chain; n is 0 or 1; A is -C (= 0) -CH (R9) - (CH2) m-N (R, 1i0U) -, where: m is an integer of 0-5 inclusive; R9 is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocycloalkyl, heteroalkyl, or - (alkylene) -C (0) -X1, wherein X1 is alkyl, hydroxy, alkoxy, aryl, aralkyl, aryloxy , aralkyloxy, hateroaryl, heteroaryloxy, heteroaralkyloxy or NR'R "(wherein R 'and R" are independently H or alkyl, or R' and R "form an alkylene chain); and R 10 is hydrogen, alkyl, aralkyl, heteroaralkyl; Z is Y-B, where: Y is alkylene or a bond; and "B is -CO-, -C (0) 0-, -CONR8-, -S02-, or -S02NR8- (wherein R8 is hydrogen or alkyl), 'alkylene (optionally substituted by hydroxy, alkoxy, amino, monoalkylamino or dialkylamino) or a bond; R7 is cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl; as long as n = 0 and Z is S02, then R does not contain an imidazole group; and their pharmaceutically acceptable salts, prodrugs, individual isomers and mixtures of isomers. In a second aspect, this invention provides a method of treating a disease in a mammal that can be treated by administration of an inhibitor of the procollagen C-proteinase selected from the group of compounds represented by Formula (I). In a third aspect, this invention provides pharmaceutical compositions containing a therapeutically effective amount of a compound of Formula (I) or its pharmaceutically acceptable salt and a pharmaceutically acceptable excipient. In a fourth aspect, this invention provides a method for treating a disease by administering to a patient a selective inhibitor of the procollagen C-proteinase. In a fifth aspect, this invention provides a method for preparing compounds of formula (I). Unless otherwise indicated, the following terms used in the specification and the claims have the meaning given below: "Alkyl" means a linear saturated monovalent hydrocarbon radical of one to six carbon atoms or a branched saturated monovalent hydrocarbon radical of three to six carbon atoms, for example, methyl, ethyl, propyl, 2-propyl, pentyl, and the like. "Alkylene" means a linear saturated divalent hydrocarbon radical of one to six carbon atoms or a branched saturated divalent hydrocarbon radical of three to six carbon atoms, for example, methylene, ethylene, propylene, 2-methylpropylene, pentylene, and the like . "Heteroalkyllene" means an alkylene chain wherein a methylene group has been replaced by O, S or NR '(wherein R' is hydrogen or alkyl). "Alkenyl" means a linear monovalent hydrocarbon radical of two to six carbon atoms or a branched monovalent hydrocarbon radical of three to six carbon atoms, containing at least one double bond, for example, ethenyl, propenyl and the like.

"Alkenylene" means a linear divalent hydrocarbon radical of two to six carbon atoms or a branched monovalent hydrocarbon radical of three to six carbon atoms, containing at least one double bond, for example, ethenylene, 2-propenylene and the like . "Acyl" means a radical -C (0) R is where R is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroalkaryl, heteroaralkenyl, or heterocycle, eg, acetyl, benzoyl, tenoil and the like. "Acyloxy" means a radical -OC (0) R wherein R is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, aralkenyl or haloalkyl, for example, acetoxy, 3, 3, 3-t rifluoroacet oxy and the like . "Acylamino" means a radical -NRC (0) R 'wherein R is hydrogen or alkyl and R' is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, heteroalkyl, haloalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkenyl, or heteroaralkyl, for example, acetylamino, tri-fluoroacetylamino, benzoylamino, methylacetylamino, and the like.

"Sulfonylamino" means a radical -NRS02R 'wherein R is hydrogen or alkyl and R' is alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, heteroalkyl, haloalkyl, amino, monosubstituted amino, disubstituted amino, aryl, aralkyl, aralkenyl, heteroaryl, heteralkenyl or heteroaralkyl, for example, methylsulphonylamino, benzy 1-sulfoni lamino, N-methylaminosulfonylamino and the like. "Halo" means fluorine, chlorine, bromine or iodine, preferably fluorine and chlorine. "Haloalkyl" means alkyl substituted with one or more same or different halo atoms, for example, -CH2C1, -CF3, -CH2CF3, -CH2CC13 and the like. "Cycloalkyl" means a saturated monovalent cyclic hydrocarbon radical of three to six carbons of the ring, for example, cyclopropyl, cyclopentyl, cyclohexyl and the like. "Carbocycle" means a saturated, cyclic group of 3 to 8 ring atoms wherein all the ring atoms are carbon, for example, cyclopentyl, cyclohexyl and the like.

"Aryl" means a monovalent monocyclic bicyclic or monocyclic hydrocarbon radical of 6 to 10 'ring atoms, optionally fused to a carbocycle or heterocycle, and optionally independently substituted with one or more substituents, preferably one or two substituents selected from alkyl, heteroalkyl, haloalkyl, halo, nitro, acyloxy, cyano, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, heteroaryl, heteroaralkyl, -OR (wherein R is hydrogen, alkyl, haloalkyl, alkenyl, cycloalkyl, - cycloalkylalkyl, optionally substituted phenyl, heteroaryl, optionally substituted phenylalkyl, or heteroaralkyl), NRR '(wherein R and R' are independently hydrogen, alkyl, alkenyl, haloalkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, phenylalkenyl optionally substituted, heteroaryl, or heteroaralkyl), -C (0) R (wherein R is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, optionally substituted phenylalkenyl, heteroaryl, heteroaryl or heteroaralkenyl), -S (0) nR (wherein n is an integer from 0 to 2 and R is hydrogen (provided that n is 0), alkyl, haloalkyl, alkenyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, heteroaryl, phenylalkyl optionally substituted, or heteroaralkyl), -S02NRR '(wherein R and R' are independently hydrogen, alkyl, alken ilo, haloalkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, optionally substituted phenylalkenyl, heteroaryl or heteroaralkyl, or R and R 'together with the nitrogen to which they are attached form a cycloamino ring), -COOH, - (alkylene) -COOH, - (alkenylene) -COOH, COORa, (alkenylene) -COORa, - (alkylen) -COORa (wherein Ra is alkyl, optionally substituted phenylalkyl, or heteroaralkyl), -CNR 'R ", (alkylene) -CONR 'R' ', (wherein R' and R "are independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, phenylalkyl, optionally substituted, heteroaryl and heteroaralkyl, or R 'and R" together with the nitrogen to which they are attached form a cycloamino ring), -NRC (0) R '(wherein R is hydrogen or alkyl and R' is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl, optionally substituted phenyl, phenylalkyl opc optionally substituted, optionally substituted phenylalkenyl, heteroaryl, heteroaralkenyl, or heteroaralkyl), -NRS02R '(wherein R is hydrogen or alkyl and R' is alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, phenylalkenyl optionally substituted, heteroaryl, heteroaralkenyl or heteroaralkyl), or NRS02NR'R "(wherein R is hydrogen or alkyl and R 'and R" are independently hydrogen, alkyl, alkenyl, haloalkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, phenylalkyl optionally substituted or optionally substituted phenylalkenyl, or R 'and R "together with the nitrogen to which they are attached form a cycloamino ring). more specifically the term "aryl" includes, but is not limited to, phenyl, l-naphthyl, 2-naphthyl, tetrahydronaphthyl, methylenedioxyphenyl, indanyl, tetralyl, indolinyl, chromanyl, isochromanyl, and the like. "Heteroaryl" means a monovalent bicyclic or monocyclic aromatic radical of 5 to 10 ring atoms containing one, two or three ring heteroatoms selected from N, 0 or S, with the remaining atoms being ring C. The heteroaryl ring is optionally substituted , independently, with one or more substituents, preferably one or two substituents, selected from alkyl, haloalkyl, halo, nitro, cyano, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, -OR (wherein R is hydrogen, alkyl, haloalkyl, alkenyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, or optionally substituted phenylalkyl), -NRR '(wherein R and R' are independently hydrogen, alkyl, alkenyl, haloalkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, or optionally substituted phenylalkenyl, or R and R "together with the nitrogen to which they are attached form a cycloamino ring), -C ( 0) R (wherein R is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl, optionally substituted phenyl, optionally substituted phenylalkyl or optionally substituted phenylalkenyl), -S (0) nR (where n is an integer from 0 to 2 and R is hydrogen (provided that n is 0), alkyl, haloalkyl, alkenyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, or phenyl optionally substituted alkyl), -S02NRR '(wherein R and R' are independently hydrogen, alkyl, alkenyl, haloalkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, optionally substituted phenylalkyl or optionally substituted phenylalkenyl, or R and R "together with the nitrogen to which they are attached form a cycloamino ring), -COOH, - (alkylene) -COOH, - (alkenylene) -COOH, -COORa, (alkenylene) -COORa, - (alkylene) -COORa (wherein Ra is alkyl, or optionally substituted phenylalkyl), CONR'R ", - (alkylene) -CONR 'R", (wherein R' and R 'are independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, and optionally substituted phenylalkyl, or R' and R "together with the nitrogen to which they are attached form a cycloamino ring), NRC (0) R ' (wherein R is hydrogen or alkyl and R 'is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl, optionally substituted phenyl, optionally substituted phenylalkyl or optionally substituted phenylalkenyl), -NRS02R' (wherein R is hydrogen or alkyl and R 'is alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, or optionally substituted phenylalkenyl), -NRS02NR' R '' (wherein R is hydrogen or alkyl and R 'and R "are independently hydrogen , alkyl, alkenyl, haloalkyl, cycloalkyl, cycloalkylalkyl, optionally substituted phenyl, optionally substituted phenylalkyl or phenylalkenyl or optionally substituted, or R 'and R "together with the nitrogen to which they are attached form a cycloamino ring), or an amino protecting group. More specifically the term "heteroaryl" includes, but is not limited to, furyl, thienyl, pyrrolyl, pyridyl, purinyl, pyridinyl, pyrazolyl, thiazolyl, imidazolyl, thiazolyl, thiazide, zolyl, indolyl, azaindolyl, benzofuranyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, benzothiazolyl, benzopyranyl, 1, and the derivatives thereof. "Optionally substituted phenyl" means a phenyl ring that is optionally substituted with one or more substituents, preferably one or two substituents selected from alkyl, haloalkyl, halo, nitro, cyano, -NRR '(wherein R and R' are independently selected from hydrogen and alkyl, or R and R 'together with • nitrogen to which they are attached form a cycloamino ring), -OR (wherein R is hydrogen, alkyl or haloalkyl), -COOR3 (wherein Ra is hydrogen or alkyl) or -CNR 'R "(wherein R' and R "are independently selected from hydrogen and alkyl, or R 'and R" together with the nitrogen to which they are attached form a cycloamino ring). Representative examples include, but are not limited to, 4-fluorophenyl, 3,4-dibromophenyl, 4-chloro-2,5-dimethylphenyl, 2, 4, 5-t-riclorophenyl, 4-bromo-2-trifluoromethoxy phenyl, 2-chloro-4-trifluoromethyl, 4-tert-butylphenyl, 4-methoxyphenyl, 3-nitophenyl and the like. "Hetercycle" or "heterocycle" means a saturated cyclic radical of 3 to 8 ring atoms in which one or two ring atoms are heteroatoms selected from N, 0, or S (0) n (where n is an integer of 0 a 2), the remaining atoms of the C ring being, wherein one or two C atoms can be optionally replaced by a carbonyl group. The heterocycle ring can be optionally substituted independently with one, two or three substituents selected from alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaryl, heteroaralkyl, halo, cyano, acylamino, amino, monosubstituted amino, disubstituted amino, - OR (wherein R is hydrogen, alkyl, haloalkyl, alkenyl, cycloalkyl, cycloalkylalkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl), -C (0) R (wherein R is hydrogen, alkyl, alkenyl, cycloalkyl, cycloalkylalkyl, haloalkyl , aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl or heteroaralkenyl), -S (0) nR [where n is an integer from 0 to 2 and R is hydrogen (provided n is 0), alkyl, haloalkyl, alkenyl, cycloalkyl , cycloalkylalkyl, amino, monosubstituted amino, disubstituted amino, aryl, heteroaryl, aralkyl, or heteroaralkyl], -COOH, - (alkylene) -COOH, COORa, - (alkylene) -COORa (wherein Ra is alkyl, het eroalkyl, aralkyl or heteroaralkyl), CONR'R ", - (alkylene) -CONR 'R" (wherein R' and R "are selected independently between hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl and heteroaralkyl, or R 'and R "together with the nitrogen to which they are attached form a cycloamino ring) or an amino protecting group. More specifically, the term heterocycle includes, but is not limited to, tetrahydropyranyl, piperidino, piperazino, morpholino, and t-iomorphol, thiomorpholino-1-oxide, t-myomorpholino-1,1-dioxide, and the derivatives thereof. The term "cycloamino" means a heterocycle group in which at least one ring atom is nitrogen. Specific examples include piperidine, piperazine, morpholine, thiamorpholine, thiamorpholine sulfoxide and thiamorpholine sulfone.

"Heteroalkyl" means an alkyl, cycloalkyl or cycloalkylalkyl radical as defined above, bearing a substituent selected from -NR Rb, -0RC, or -S (0) nRd, wherein: n is an integer from 0 to 2, Ra is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkenyl or acyl; Rb is hydrogen, alkyl, aryl, aralkyl, acyl, -S02R (wherein R is alkyl, haloalkyl, amino, monosubstituted amino or disubstituted amino), -COOR (wherein R is alkyl, aralkyl or heteroaralkyl), -CONR'R '', - (alkylene) -CONR 'R' '(wherein R' and R "are independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl and heteroaralkyl, or R 'and R" together with the nitrogen to which they are attached form a cycloamino ring); or Ra and Rb together with the nitrogen atom to which they are attached form a cycloamino ring. Rc is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, acyl, CONR'R "(wherein R 'and R" are independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl and hateroaralkyl, or R 'and R "together with the nitrogen to which they are attached form a cycloamino ring). Rc is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, acyl, and further when n = 0, CONR'R "(wherein R 'and R" are independently selected) between hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl and heteroaralkyl, or R 'and R "together with the nitrogen to which they are attached form a cycloamino ring) and when n = 2, NR'R" where R 'and R "have the meanings given immediately above. Representative examples of heteroalk include, but are not limited to, 2-methoxyethylene, benzyloxymethyl, thiophen-2-ylthiomethyl and the like; "Cycloalkylalkyl" means a RaRb radical wherein Ra is an alkylene group and Rb is a cycloalkyl group as defined above, for example, cyclopropylmethyl, cyclohexylpropyl, 3-cyclohexyl-2-methylpropyl and the like. 'Aralkyl' means a radical • RaaDRb wherein Ra is an alkylene group and Rb is an aryl group as defined above, for example, benzyl, phenylethyl, 3- (3-chlorophenyl) -2-methylpentyl, and the like. " "Aralkenyl" means a radical -RaRb wherein Ra is an aryl group as defined above, for example, 3-phenyl-1-2 -propeni 1, and the like. "Heteroaralkyl" means a radical -RaRb wherein Ra is a group alkylene and Rb is a heteroaryl group as defined above, for example, pyridin-3-ylmethyl, 3- (benzofuran-2-yl) propyl and the like. "Heteroaralkenyl" means a radical -RaRb wherein Ra is an alkenyl group and Rb is a heteroaryl group as defined above, for example, 3-pyridin-3-ylpropen-2-yl, and the like. "Heterocycloalkyl" means a radical RaRb wherein Ra is an alkylene group and Rb is a heterocycle group as defined above, for example, tet rahydropyran-2-ylmethyl, 4-methylpiperazin-1-ylethyl and simil "Alkoxy", "aryloxy", "heteroaryloxy", "aralkyloxy" or "heteroaralkyloxy" means a radical -OR wherein R is an alkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl, respectively, as defined above, for example, methoxy, phenoxy, pyridin-2-yloxy, benzyloxy, and the like. "Optional" or "optionally" means that the subsequently described event or circumstance may occur, but not necessarily, and that the • description includes cases where the event or circumstance occurs and cases where it does not occur. For example, "heterocycle group optionally mono- or disubstituted with an alkyl group" means that alkyl may be present, but not necessarily, and the description includes situations wherein the heterocycle group is mono- or di-substituted with an alkyl group and situations wherein the heterocycle group is not substituted with the alkyl group. The term "protecting group" refers to a group of atoms that, when bound to a reactive group in a molecule, masks, reduces or prevents that reactivity. Examples of protecting groups can be found in T. W. Greene and P.G. Futs, "Protective Groups in Organic Chemistry" (Wiley, 2nd Ed. 1991) and Harrison and Harrison et al., "Compendium of Synthetic Organic Methods", Vols. 1-8 (John Wiley and Sons, 1971-1996). Representative amino protecting groups include formyl, acetyl, trifluoroacetyl, benzyl, benzyloxycarbonyl (CBZ), tert-butoxycarbonyl (Boc), trimethe ils i 1 i lo (TMS), 2-trimethylsilyl-ethanesulfonyl (SES), trifly and substituted trifyl groups, allyloxycarbonyl, 9-fluorenylmethyloxycarbonyl (FMOC), nitroveratryloxycarbonyl (NVOC) and the like. Representative hydroxy protecting groups include those wherein the hydroxy group is either acetylated or alkylated, such as benzyl and triphenyl ethers as well as alkyl ethers, tetrahydropyranyl ethers, trialkylsilyl ethers and allyl ethers. The term "protected hydroxylamine derivative" refers to a hydroxylamine whose nitrogen and / or hydroxyl groups are protected so that the nitrogen atom can be selectively monoacylated. Compounds that have the same molecular formula but differ in the nature or sequence of ligation of their atoms in space are termed "isomers". The isomers that differ in the configuration of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are termed "diastereomers" and those that are not mirror images that can be superimposed on one another are termed "enantiomers." When a compound has an asymmetric center, for example, it is linked to four different groups, a pair of enantiomers is possible. An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R and S sequencing rules of Cahn and Prelog, or by the way in which the molecule rotates the plane of polarized light and designated as dextrographic or levogyratory (that is, as isomers (+) or (-) respectively). A chiral compound can exist as a single enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is termed a "racemic mixture". The compounds of this invention may possess one or more asymmetric centers; such compounds can therefore be produced as individual (R) or (S) stereoisomers or as mixtures thereof. For example, if the substituents R1 and R2 in a compound of formula (I) are different, then the carbon to which they are attached is an asymmetric center and therefore the compound of formula (I) can exist as a stereoisomer (R) or (S). Unless otherwise indicated, the description or the name of a particular compound in the specification and the claims is intended to include both the individual enantiomers and the mixtures, racemic or otherwise, thereof. Methods for the determination of stereochemistry and the separation of stereoisomers are well known in the art (see discussion in Chapter 4 of "Advanced Organic Chemistry", 4th Edition, J. March, John Wiley and Sons, New York, 1992). ). A "pharmaceutically acceptable excipient" means an excipient that is useful for preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes an excipient that is acceptable for veterinary use as well as for human pharmaceutical use . A "pharmaceutically acceptable excipient" as used in the specification and claims includes both one and more than one of these excipients. A "pharmaceutically acceptable salt" of a compound means a salt that is pharmaceutically acceptable and that possesses the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or formed with organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopenti-propionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3- (4-hydroxybenzoyl) enzoic, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, acid-camphorsulfonic acid, 4-methylobicyclo [2.2.2] -oct-2-ene-l-carboxylic acid, glucoheptonic acid, 4,4'-methylene-bis- (3-hydroxy-2-ene-1-carboxylic acid), acid 3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid and the like; or (2) salts formed when an acidic proton present in the original compound is replaced by a metal ion, for example, an alkali metal ion, an alkaline earth metal ion, or an aluminum ion, or coordinated with an organic base such as ethanolamine, diethanolamine, triethanolamine, tromethamine, N-met ilglucamine, and the like. "Pro-drugs" means any compound that releases an active original drug according to formula (I) in vivo when such a prodrug is administered to a mammal. Prodrugs of a compound of formula (I) are prepared by modifying functional groups present in the compound of formula (I) in such a way that the modifications can be separated in vivo to liberate the original compound. Prodrugs include compounds of formula (I) wherein a hydroxy, amino or sulfhydryl group in a compound of formula (I) is linked to any group that can be removed in vivo to regenerate the free hydroxyl, amino or sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to, esters (e.g., acetate, formate and benzoate derivatives), carbamates - (for example, N, -dimethylaminocarbonyl) of hydroxy functional groups in compounds of formula (I) and the like. "Treating" or "treating" a disease includes: (1) preventing the disease, ie preventing the clinical symptoms of the disease from developing, but still not experiencing or showing symptoms of the disease, (2) inhibiting the disease , that is, stopping or reducing the development of the disease or its clinical symptoms, or (3) relieving the disease, that is, causing the regression of the disease or its clinical symptoms. A "therapeutically effective amount" means the amount of a compound that, when administered to a mammal to treat a disease, is sufficient to effect such treatment for the disease. The "therapeutically affective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the mammal to be treated. The compounds of this invention can conveniently be referred to with reference to their amino acid components according to the conventional nomenclature of the peptide field. For example, a dipeptide wherein n is 0, R 1 = R 3 = R 4 = R 6 = H, R 2 is 4-thiazole i lmet i lo, R 5 is (S, S) -1-methopropyl and ZR 7 is benzyloxycarbonyl, is termed Cbz-T le-4 -Taz-NHOH. With respect to the synthesis sch A and B which are presented subsequently, 4-Taz (4-t-yiazolilanine) represents AAi and lie represents AA2. A tripeptide where n is 1 and m is 0, R1 = R = R * = R < R = H, R is 4-thiazole methyl, R5 is (S, S) -1-methylpropyl, ZR7 is 4-chlorobenzoyl and R10 is 4-fluorobenzyl is called 4-chlorobenzoyl- (4-fluorobenzyl) Gly- I -Taz-NHOH. With respect to synthesis sch A and B which are presented subsequently, 4-Taz represents AAi, lie represents AA2 and (4-fluorobenzyl) Gly represents AA3. While the broader definition of this invention is presented in the first aspect of the present invention, some compounds of Formula (I) are preferred. One class of compounds are the dipeptide hydroxamic acids corresponding to compounds of Formula 1 wherein n is 0. Another class of compounds are the hydroxamic acids which are obtained by the compounds of Formula 1 wherein n is 1. For both, the dipeptide and tripeptide hydroxamic acid compounds of the invention, particularly those wherein R 2 is heteroaralkyl, particularly 4-thiazolylmethyl and R 5 is (S, S) -1-methylpropyl. Preferably, R2, R5 and R9 are present in the naturally occurring amino acid configuration, ie, derived from the (L) amino acids.

Another class of preferred compounds of Formula I is that wherein Z is C (0) 0. Another class of preferred compounds of Formula I is that wherein Z is S (0) 2. Within each of these classes of compounds, those in which R7 is aryl, aralkyl or heteroaryl, particularly halophenyl (e.g., 3,4-dibromophenyl, 2,5-dichlorophenyl or 2,4,5-t-riclorophenyl) are especially preferred. ), benzyl (optionally substituted) (e.g., benzyl or 3,4-dichlorobenzyl) or halotienyl (e.g., 4,5-dibromot-ien-2-yl). When Z is C = 0, it is also preferred that R7 is aralkyl or heteroaralkyl, particularly benzyl or heteroarylmethyl substituted with halo, preferably one or two chloro. Another class of preferred compounds is that wherein R2 is aralkyl or heteroaralkyl. Within this class, those compounds are particularly preferred wherein R 2 is 3-indolylmethyl, 2-thienylmethyl, 4-imidazolylmethyl or 4-thiazolylmethyl, particularly 4-thiazolylmethyl. Another class of preferred compounds are those wherein R2 is (alkylene) -BX wherein B is -0-, -NR8-, -S-, -C = 0, -CONR8-, -NR8C02-, NR8S02- or -C (= NR8) NR8S02- (wherein R8 is independently H or alkyl) and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl. Particularly preferred are compounds wherein the alkylene group is methylene, B is -NR8C02- and X is aralkyl. A fourth class of preferred compounds are those wherein R5 is alkyl or phenyl, particularly propyl, 1-methyethyl, or (S, S) -1-methylpropyl. Within this class of compounds, those in which R 1 and R 4 are hydrogen and R 2 is heteroaralkyl, particularly 4-thiazolylmethyl, are particularly preferred. Further preferred compounds are those of group B, especially the compounds of formula I as defined in the first aspect of the present invention, wherein n is 0, or (1) compound B wherein R3 and R6 are hydrogen. (2) the compound of (1), wherein: R2 is aralkyl or heteroaryl. (3) the compound of (2) wherein: Z is -C (O) O- or -S (O) 2-. (4) the compound of (3) wherein: R2 is benzyl or optionally substituted heteroaralkyl (5) the compound of (4) wherein, R2 is 4-t-butoxybenzyl, 3-chlorobenzyl, 3-indolyl methyl, 2-t-ethylmethyl, 4-imidazolylmethyl or 4-thiazolylmethyl. (6) 'the compound of (5) wherein R 2 is 4-thiazolylmethyl (7) the compound of (6) wherein: R 7 is aryl, aralkyl, heteroaryl or heteroaralkyl. (8) the compound of (6) wherein: Z is -C (0) 0- and R7 is optionally substituted benzyl. (9) the compound of (7) wherein: Z is -S02- and R7 is aryl or heteroaryl. (10) the compound of (8) or (9), wherein: R1 and R4 are hydrogen and R5 is alkyl (11) the compound of (10) wherein R5 is (S, S) -1-methylpropyl. (12) the compound of (1), wherein: R2 is - (alkylene) -BX wherein B is -0-, NR8-, -S (0) n- (where n is 0, 1 or 2) , -C = 0, -CONR8-, -NR8C02-, NR8S02- or -C (= NR8) R8S02- (wherein R8 is H or alkyl) and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl heteroaryl or heteroaralkyl. (13) The compound of (12), wherein: Z is -C (O) O- or -S (O) 2-. (14) The compound of (13), wherein R2 is -CH2-B-X and B is -NHC02- and X is benzyl. (15) The compound of (14) wherein: R7 is aryl or aralkyl. (16) The compound of (15), wherein: R1 and R4 are hydrogen and R5 is alkyl. (17) The compound of (16), wherein R5 is (S, S) -1-metilpropyl. Further preferred compounds are • those of group C, mainly the compounds of formula I as defined in the first aspect of the present invention, wherein n is 1. (1) The compound of C, wherein m is 0 and R3 and R6 are hydrogen . (2) The compound of (1), wherein R 2 is aralkyl or heteroaralkyl (3) The compound of (2), wherein: Z is -C (O) O- or -S (O) 2 -. (4) The compound of (3) wherein: R is benzyl or optionally substituted heteroaralkyl (5) The compound of (4) wherein, R 2 is 4-t-butoxybenzyl, 3-chlorobenzyl, 3-indolyl methyl, 2-thienylmethyl, 4-imidazolylmethyl or 4-thiazolylmethyl. (6) The compound of (5) wherein R2 is 4-thiazolylmethyl. (7) The compound of (6) wherein: R7 is aryl, aralkyl, heteroaryl or heteroaralkyl. (8) The compound of (7) wherein: Z is -C (0) 0- and R7 is benzyl. (9) The compound of (7) wherein: Z is -S02- and R7 is aryl. (10) The compound of (8) or (9), wherein: R1 and R4 are hydrogen and R5 is alkyl (11) The compound of (10) wherein R5 is (S, S) -1-methylpropyl. (12) The compound gives (1), where: R2 is - (alkyl) -BX where B is -0-, - NR8-, -S (0) n- (where n is 0, 2) ), -C = 0, -CONR8-, -NR8C02-, NR8S02- or -C (= NR8) NR8S02- (wherein R8 is H or alkyl) and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl heteroaryl or heteroaralkyl. (13) The compound of (12), wherein: Z is -C (0) 0- or -S (0) 2-. (14) The compound of (13), wherein R2 is -CH2-B-X and B is -NHC02- and X is benzyl. (15) The compound of (14) wherein: R7 is aryl or aralkyl. (16) The compound of (15), wherein: R1 and R4 are hydrogen and R5 is alkyl. (17) The compound of (16), wherein R5 is (S, S) -1-metilpropyl. Representative compounds of this invention which were prepared according to the Schemes and Examples are as follows: I. Dipeptide hydroxamic acids of Formula (I) wherein n = 0, R1 = R3 = R4 = R6 = hydrogen and ZR7 is benzyloxycarbonyl and others Groups are as defined below: TABLE I St * - Stereochemistry in the carbon bound to R2 and the substituent of R2 (if it has an independent chiral center). St ** - Stereochemistry in the carbon bound to R5 and the substituent of R5 (if it has an independent chiral center). II. Hydroxamic dipeptide acids of Formula (I) where n = 0, R1 = R3 = R4 = R6 = hydrogen and R4 is (S, S) -1-methylpropyl and other groups are as defined below: TABLE II St * - Stereochemistry in carbon bound to R III. Dipeptide hydroxamic acids of Formula (I) wherein n = R1 = R3 = R6 = hydrogen and ZR7 is benzyloxycarbonyl and * other groups are as defined below: TABLE III IV. Hydroxamic dipeptide acids of Formula (I) wherein n = O, R 1 = R 3 = R 4 = hydrogen, R 2 is (S) 3-indolylmet yl and ZR 7 is benzyloxycarbonyl and other groups are as defined below: TABLE IV V. Tripeptide hydroxamic acids of Formula (I) wherein n = 1, m = 0, R 1 = R 3 = R 4 = R 6 = H, R 2 is (S) 4-thiazolylmethyl, R 5 is (S, S) -1- et ilpropilo and other groups are as defined below: TABLE V St * - Stereochemistry in the carbon bound to R9 and the substituent of R9 (if it has an independent chiral center). SAW. Miscellaneous tripeptide hydroxamic acid compounds of the invention wherein n = 1, m = 1, R 1 = R 3 = R 4 = R 6 = H, R 2 is (S) -4-thiazolylmethyl and R 5 is (S, S) -1-methylpropyl , and other groups are as defined below: TABLE VI Other miscellaneous compounds with R2 and R3 forming an alkylene or a heteroalkylene chain include CBz-Ile-Pro-NHOH (m / e = 378) and CBz-Ile-Thz-NHOH (m / e = 396). Thz is thiazolidin-4-carboxylic acid. Other miscellaneous compounds with R5 and R6 forming an alkylene chain include CBz-Pro-Trp-NHOH (m / e = 451). The compounds of this invention can be prepared by various synthetic methods as described below. The starting materials and reagents used to prepare these compounds can be obtained from commercial suppliers such as Aldrich Chemical Co., (Milwaukee, Wisconsin, USA), Bachem (Torrance, California, USA), Emka- Chemie, or sigma (St. Louis, Missouri-, USA) or are prepared by methods known to those skilled in the art following the procedures presented in references, such as "Fieser and Fieser 's Reagents for Organic Synthesis" , Volumes 1-15 (John Wiley and Sons, 1991); "Rodd 's Chemistry of Carbon Compounds", Volumes 1-5 and Supplements (Elsevier Science Publishers, 1989), "Organic Reactions", Volumes 1-40 (John Wiley and Sons, 1991), "March' s Advanced Organic Chemistry" (John Wiley and Sons, 4th edition) and "Larock 's Comprehensive Organic Transformation" (VCH Publishers Inc., 1989). In particular, a variety of natural and non-natural amino acids are available in various protected forms from specialty chemical suppliers such as Novabiochem Inc. (La Jolla, CA), Advanced Chemtech Inc. (Louisville, Ky.), Synthetech Inc. ( Albany, OR), Bachem Inc. (Torrance, CA). These schemes are merely illustrative of some methods by which the compounds of this invention can be synthesized and various modifications can be made to these reaction schemes which will be suggested to the person skilled in the art with reference to this presentation. The starting materials and intermediates of the reaction can be isolated and purified if desired using conventional techniques, including, but not limited to, distillation, crystallization, chromatography and the like. The compounds of the invention are C-terminal hydroxamic derivatives of natural and non-natural di- and tripeptides further functionalized at the N-terminus. They can be prepared by initially forming the peptide precursor followed by deprotection (if necessary) and functionalization of the C-termini. and N. Peptide precursors are prepared by methods known to those skilled in the art of peptide synthesis, including solution phase chemistries and solid phase synthesis, see "Solid Phase Peptide Synthesis: A Practical Approach" by E. Artherton and RC Sheppard (Oxford University Press, 1989). In general, as shown in reaction schemes A and B, an amino acid P? -AA? C-terminal protected is coupled to an N-protected AA2-P2 amino acid to give a compound P? -AA? ~ AA2-P2. The coupling is performed by activation of the C-terminus of AA2-P2 and condensation with the Pi-AAi amine. Activating reagents and coupling conditions are well known to those skilled in the art and include carbodiimide-mediated coupling or the formation of N-hydroxysuccinimide esters followed by acylation. For the synthesis of dipeptide hydroxamic acids, the removal of the protecting group and the N-terminal functionalization with R7-Z-L (in any order) is carried out to give a dipeptide precursor which is converted to a hydrxamic compound of the invention, typically by means of the hydroxylamine treatment. For the synthesis of the tripeptide hydroxamic acids, the compound P? -AA? -AA2-P2 is selectively N-deprotected to give P? -AA? ~ AA2 which is then coupled to an AA3-P N-protected amino acid. Deprotection, N-terminal functionalization and treatment with hydroxylamine as shown in Reaction Scheme B then gives the tripeptide hydroxamic acids of Formula I. Reaction Scheme A. Synthesis of dipeptide hydroxamic acids. 1) deprotection activation Pj-AA _ * _ PrAArAAr? 2 ÍZ ^ PrAA, -AA2 2) AA2-P2 R'-Z-L NH? OH HONII-AArAA2-Z-R7 PrAAr A Z-R7 Formula I where n = 0 Reaction Scheme B. Synthesis of tripeptide hydroxamic acids.

AA3-P3 deprotection P AAj -AA ^ - y-- r Pj, -? A? At-? A? Aj, -? A? Aj? - rPj, coupling reagents 1) R7-ZL PrAArAA2-AA3 HONSI-AArAA2-AA3-Z-R7 2) NH2OH Formula I where n = 1 With reference to the nomenclature of Formula I, AAi corresponds to -C (= 0) -CR1R2-NR3 -, AA2 corresponds to -C (= 0) -CR4R5-NR6 and AA3 corresponds to -C (= 0) -CH (R9) - (CH2) m-NR10. Plf P2 and P3 represent protecting groups. In particular, the compounds of this invention can be prepared by solid phase synthesis. Initially, a protected N-protected P1-A amino acid is attached to a solid phase resin via its C-terminus. Typical solid phase resins include chloromethylated and hydroxylated resins such as the 4-hydroxymethyl-phenylacetamidomethyl resin. (Pam resin) and the 4-benzyloxybenzyl alcohol resin (Wang resin) obtainable from Advanced Chemtech, Louisville, Kentucky, USA. and the pegylated polystyrene resin, ArgoGel-OHMR, resin from Argonaut Technologies Inc. (Belmont, CA). Preferred chloromethyl resins include the styrene / divinylbenzene resins known as Merrifield resins which can be obtained from Aldrich Chemical Company, Milwaukee, Wisconsin, USA. The amino acid forming blocks AA2 and AA3 are then linked sequentially using iterative and deprotection coupling steps well known to the person skilled in the art. The conventional peptide coupling reactions, typically in an anhydrous inert polar aprotic solvent (eg, dimethylformamide, acetonitrile, tetrahydrofuran, dichloromethane, etc.) using auxiliary coupling reagents, eg, carbodiimides such as l-ethyl-3- ( 3-dimethylaminopropyl) carbodiimide (EDAC), diisopropyl-carbodiimide (DIC), diimidazoles such as carbonyl-diimidazole, triazoles, such as hydroxybenzotriazole (HOBT) or other carboxyl activating groups such as N-hydroxysuccinimide, in the presence of a tertiary organic base such as 4-dimethylaminopyridine, N-methylmorpholine or triethylamine. The protecting groups employed depend on the group that is protected and are also known to those skilled in the art. Representative protecting groups can be found in "Protective Groups in Organic Chemistry", J.F.W. McOmie (London, Plenum Press, (1973)) and "Protective Groups in Organic Chemistry", T.W. Greene and P.G. Wuts (John Wiley and Sons (1991)). A preferred N-protecting group is the fluorenylmethoxycarbonyl group (FMOC). After forming the entire peptide backbone, the protecting group is removed at the N-terminus. In some cases the N-terminal protecting group may correspond to ZR7, obviating the need for the removal of the protecting group. Functionalization at the N-terminus is effected by means of the subsequent treatment with a compound R7-Z-L, wherein L is a leaving group under conditions of nucleophilic displacement. The conditions used for the removal of the protecting group vary depending on the protecting group. Acid-sensitive protective groups such as tert-butoxycarbonyl (t-BOC) are removed with mild acid (eg, trifluoroacetic acid) while the base-sensitive protective groups, such as 9-fluorenylmethoxycarbonyl (FMOC) are removed with soft organic bases. Typical L-leaving groups include halo, tosylate and mesylate. Finally, the division of the solid phase is achieved by means of treatment with hydroxylamine to give compounds of Formula I. As indicated above, both natural and non-natural amino acids can be used to prepare the compounds of this invention. Natural amino acids and their abbreviations are well known and will not be repeated here. Some examples of non-natural amino acids and their abbreviations include homoserine (hSer), homoserine lactone (hSerlac), Homocysteine (Hcy), homoarginine (hArg), homoci truline (Hci), penicillamine (Pen), Na-methylarginine (N-MerArg), norleucine (Nle), novalin (Nval), norisoleucine (Nile), N-methyl isoleucine (N-Melle), phenylglycine (PhG), t-butylglycine (Tie), hydroxyproline (Hyp), 3,4-dehydroproline (? -Pro), pyroglutamine (Pyr, Glp), ornithine (Orn), 2,3-diaminopropionic acid (2,3-DAP), 1-aminoisobutyric acid (1-Aib), acid 2-aminoisobutyrate (2-Aib), 2-aminobutyric acid (2-Abu), 4-aminobutyric acid (4-Abu), 2,4-diaminobutyl acid (A2bu), α-aminosuberic acid (Asu) ), albizine (Abz), ß-cyclohexylalanine (Cha), 3- (l-naphthyl) alanine (I-Nal), 3- (2-naphthyl) alanine (2-Nal), citrulline (Cit), pipecolinic acid ( Pip), 4-chlorophenylalanine (4-ClPhe), 4-fluorophenylalanine (4-Fphe), sarcosine (Sra), 4-thiazolylalanine (4-Taz), homophenylalanine (Hpa or Hphe), 2-thienylalanine (2-Thi) , 3-benzothienylalanine (3-Bal), and 1-aminopropanecarboxylic acid (1-NCPC). A variety of non-natural amino acids are commercially available. The compounds of this invention are useful for treating diseases associated with excessive deposition of interstitial collagens, such as fpol iterative diseases exemplified by interstitial pulmonary fsis, pericentral fsis, Symmers fsis, perimuscular fsis, kidney fsis, endocardial sclerosis, hepatitis, acute respiratory distress syndrome, arthritis, cystic fsis, surgical adhesions, tendon surgery, corneal scars, scleroderma, chronic allograft rejection, shunt fsis due to hemodialysis and restenosis. The compounds of this invention are inhibitors of the procollagen C-proteinase and thus inhibit the C-terminal processing of the type I, II and III collagens necessary for their ability to form insoluble collagen fls. In addition, selected compounds of the invention selectively inhibit the procollagen C-proteinase with respect to other collagen-degrading enzymes such as collagenase-1, collagenase-2 and collagenase-3. As a result, the compounds of this invention practically do not affect the natural resolution of collagen mediated by the enzymes collagenase-1, collagenase-2 and collagenase-3. Due to this selectivity such compounds have greater therapeutic efficacy than non-selective inhibitors. In particular, the preferred compounds of this invention inhibit procollagen C-proteinase with a selectivity greater than 100 with respect to collagenase-1 and collagenase-2 and the more selective compounds are more than a thousand times more selective. The selective inhibition of the procollagen C-proteinase with respect to collagenase-1 and collagenase-2 was demonstrated by means of the assays described in the examples. Therefore, this invention allows the treatment of ftic diseases by administering to a patient an agent that selectively inhibits the procollagen C-proteinase with respect to the enzymes collagenase-1, collagenase-2 and collagenase-3. The inhibition can be 10 times more selective and more preferably 1000 times more selective. The capacity of the compounds of the Formula (I) of inhibiting the activity of the procollagen C-proteinase, can be demonstrated by a variety of in vitro assays known to those skilled in the art, such as the assay described in greater detail in Example XIII. The selectivity with respect to the collagenase enzymes can be determined by means of assays as described in Example XIV. The in vivo efficacy of the compounds of Formula (I) against ftic disease and overproduction and deposition of collagen can be shown by various animal models including the model of pulmonary fsis induced by bleomycin in the mouse (SHPhan et al., "Bleomycin"). induced Pulmonary Fsis ", Am. Rev.

Breathe Dis., 124: 428-434 (1981) and P.F. Piguet et al., "Effective Treatment of the Pulmonary Fsis Elicited in Mice by Bleomycin or Silica with anti-CD-11 Antibodies", Am. Rev. Resp. Dis., 147: 435-441 (1993)), the sponge implant model (EN Unemori et al., "Human Relaxin Decreases Collagen Accumulation In Vivo in Two Rodent Models of Fibrosis", J. Invest. Dermatol., 101: 280-285 (1993), the model of renal fibrosis induced by carbon tetrachloride or NDMU, as well as other animal models mentioned in WO 97/05865 ("C-Proteinase Inhibitors for the Treatment of Disorders Relating to the Overproduction of Collagen ") In general, the compounds of this invention will be administered in a therapeutically effective amount by any of the accepted administration forms for agents having a similar utility The actual amount of the compound of this invention, that is, the active ingredient, will depend on other factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and manner of administration and other factors. The drug can be administered more than once a day, preferably once or twice a day. Therapeutically effective amounts of the compounds of Formula I may range from about 0.05-35 mg per kilogram of receptor body weight per day; preferably about 0.3-20 mg / kg / day. Therefore, for administration to a 70 kg person, the dose range would preferably range from about 21 mg to 1.4 g per day. In general, the compounds of this invention will be administered as pharmaceutical compositions by any of the following routes of administration: oral, systemic (e.g., transdermal, intranasal, pulmonary or suppository), or parenteral (e.g., intramuscular, intravenous or subcutaneous) ). The preferred form of administration is systemic using a convenient daily dosage regimen that can be adjusted according to the degree of the condition. Intranasal administration is typically performed with dry powder formulations, liquid solutions or suspensions suitable for nebulization or with aerosol propellants suitable for use in a medium dose inhaler. Alternatively, the substance of the drug can be associated with microspheres made of materials such as gelatin, dextran, collagen or albumin. The microspheres are conveniently supplied in lyophilized form with a nasal insufflation device or a "pressurized aerosol container" Penetration enhancers such as amphiphilic steroids can also be used as additives to increase the systemic absorption of the drug in the tissue. Effective administration can also be achieved by pulmonary or respiratory administration since the polypeptides are rapidly absorbed through the cellular coating of the alveolar region of the mammalian lung Advantageously, such administration does not frequently require the use of penetration enhancers as additives. and methods for pulmonary administration deep into the lung are described in U.S. Patent Nos. 5,780,014 and 5,814,607.

Finally, the compounds can be administered systemically by transdermal administration, typically comprising placing the drug on the surface of the skin and allowing it to penetrate through the skin. The transdermal delivery devices employ a structure such as an adhesive patch or the like which serves as a reservoir for the drug and puts the drug in a diffusive contact with the skin. In a general type, the structure is a stable three-dimensional matrix known as a monolithic matrix. Such matrices are described in greater detail in U.S. Patent Nos. 5,804,214, "5,149,538 and 4,956,171 which disclose matrices made with acrylic latex polymers and copolymers, acrylic esters, methacrylic esters and vinyl acetates. the formulation depends on several factors such as the mode of administration of the drug (for example, for oral administration, formulations in the form of tablets, pills or capsules are preferred) and the bioavailability of the substance of the drug Recently pharmaceutical formulations have been developed especially for drugs that exhibit poor bioavailability based on the principle that bioavailability can be increased by increasing the surface area, i.e., decreasing particle size For example, U.S. Patent No. 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10 to 1000 nm where the matte Active rial is supported in a reticulated matrix of macromolecules. U.S. Patent No. 5,145,684 describes the production of a pharmaceutical formulation wherein the substance of the drug is sprayed to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formulation that presents a remarkably high bioavailability. The compositions generally comprise a compound of Formula (I) in combination with at least one pharmaceutically acceptable excipient. Acceptable excipients are non-toxic, aid administration and do not adversely affect the therapeutic benefit of the compound of Formula (I). Such excipient can be any solid, liquid, semi-solid excipient or, in the case of a gaseous aerosol composition, which is generally available to the person skilled in the art. Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, skimmed milk powder and Similar. The liquid and semi-solid excipients can be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of animal, vegetable or synthetic origin, or petroleum, such as, for example, peanut oil, soybean oil, mineral oil, oil of sesame, etc. Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose and glycols. The compressed gases can be used to disperse a compound of this invention in the form of an aerosol. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc. Other suitable pharmaceutical excipients and their formulations are described in "Remington's Pharmaceutical Sciences", edited by E.W. Martin (Marck Publishing Company, 18th Ed., 1990). The amount of the compound in a formulation can vary within the range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent basis (% by weight), from about 0.01-99.99% by weight of a compound of Formula I based on the total formulation, the remainder being one or more excipients suitable pharmacists. Preferably, the compound is present at a level of about 1-80% by weight. Representative pharmaceutical formulations containing a compound of Formula I are described in Example 30. EXAMPLES Solution that removes the Ac20 cap - 19 ml of Ac20, 9 ml of DIPEA, 0.8 equivalents of HOBt, 400 ml of NMP. Abbreviations Ac20 - acetic anhydride DIPEA - diisopropylethylamine HOBt - hydroxybenzotriazole NMP - N - met ilpyrrolidinone FMOC - fluorenylmethoxycarbonyl BOC - t - butoxycarbonyl DIC - diidopropylcarbodiimide DMAP - 4 - dimet and laminopyridine HATU - 0 - (7 - azabenzotriazol - l - il) -1 , 1, 3, 3-tetramethexurynium hexafluorophosphate) HOAT-l-hydroxy-7-azabenzotriazole TFA - trifluoroacetic acid DMF - dimethylformamide TIS - triisopropylsilane CBz - benzyloxycarbonyl THF - tetrahydrofuran Taz - 4 - t - aiazolylalanine lie - isoleucine Su - succinimidyl TEA - triethylamine Trp - tryptophan DMSO - dimethylsulfoxide TMS - trimethylsilyl DMEM - HG - Dulbeccos Modified Eagle Medium (Dulbeccos Modified Eagle Medium), high glucose concentration. G418 - Genetikin SYNTHESIS OF COMPOUNDS OF FORMULA I Compounds of Formula (I) were prepared by solid phase synthesis using conventional methods as generally described in the following Examples. If necessary, the compounds prepared as described in Examples I-X were purified by reverse phase high pressure liquid chromatography on silica gel linked to. columns of diisopropylfenet ilsilane (Zorbax SB-phenyl) using a gradient elution with a solvent system of acetonit rilo-mixed water (1% TFA) at flow rates of approximately 1.5-2.0 ral / minute. They were tested directly in the PCP and collagenase assays described in Examples XIII and XIV without further purification. The compounds can be characterized using conventional means, including physical constants and spectral data. In particular, they were analyzed by mass spectrometry using ionization by electron spray. Example I General Experimental for CBz-AA2-AA? -NHOH (Dipeptide Compounds of Formula I wherein ZR7 is benzyloxycarbonyl) To Argogel-OH MR (Argonaut Technologies, Belmont, CA) in an empty solid phase extraction flask, equipped with one tap, 3 equivalents of AAi BOC- or FMOC-protected, 3 equivalents of diisopropylcarbodiimide and 0.05 equivalents of a 0.166 M solution of dimethylaminopyridine in THF were added. Sufficient CH2C12 was added to expand the resin (~12.5 ml / g resin). [Alternatively, 3 equivalents of AAi BOC- or FMOC-protected, 3 equivalents of HATU, 3 equivalents of HOAt and 6 equivalents of DIPEA were added to the resin. Sufficient NMP was added to expand the resin (~ 12.5 ml / g resin)]. The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 and dried to give the BOC-AAi resin. or FMOS-AAi. Resin sites that did not react were removed with a solution that removed the Ac20 cap (19 ml of Ac20, 9 ml of DIPEA, 0.8 g of HOBt, 400 ml of NMP) in an amount sufficient to expand the resin ( ~ 12.5 ml / g of resin). The resin was filtered and washed as indicated above. 2 . Re s i na H2N -AAX 2a. For BOC Protected Material - The resulting resin indicated above (BOC-AAi resin) was treated with a solution of 95 / 2.5 / 2.5 TFA / H20 / trisopropylsilane (TIS) for two hours. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH and then three times with CH2C12 to give the resin H2N-AA ?. 2b. For FMOC-protected material - The resulting resin indicated above (FMOC-AAi resin) was first washed with DMF, then treated with a 20% piperidine solution in DMF for 20 minutes. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12, to give the H2N-AA resin ? 3. Resin CBz-AA2-AA? To the resin H2N-AA? 3 equivalents of a 0.166 M solution of dimethylaminopyridine in TFH were added. Sufficient CH2C12 was added to expand the resin (~12.5 ml / g resin). [Alternatively, 3 equivalents of AA2 CBz-protected, 3 equivalents of HOAt and 6 equivalents of DIPEA were added to the resin. Sufficient NMP was added to expand the resin (~ 12.5 ml / g resin)]. The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin CBz-AA2-AAi . 4. Removal of protecting groups If AAi or AA2 contain an acid labile side chain protecting group that must be removed, the resulting resin (CBz-AA2-AA? Resin) was treated with a 95 / 2.5 / 2 solution. , 5 TFA / H20 / trisopropylsilane (TIS) for 2 hours. The reaction was then filtered by suction filtration- and washed three times with CH2C12, three times with MeOH and then three times with CH2C12. 5. CBz-AA2-AA? -NHOH The resin C'Bz-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (~12.5 ml / g resin), then 25 equivalents of 50% aqueous NH20H were added and the reaction was rotated for two days. The reaction was filtered by suction filtration and washed with CH2C12, MeOH and then CH2C12. The filtrate was concentrated under vacuum to obtain CBz-AA2-AA? ~ NHOH. EXAMPLE II General Experimental for R7-S02-AA2-AA-NHOH (Dipeptide Compounds of Formula I where Z is -S02-) 1. Resin FMOC-AA2-AA To the resin H2N-AA? 3 equivalents of FM2-protected AA2, 3 equivalents of diisopropylcarbodiimide and 0.05 equivalents of a 0.116 M solution of 4-dimethylaminopyridine in THF were added. Sufficient CH2C12 was added to expand the resin (~12.5 ml / g resin). The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin FMOC-AA2-AA ? . 2. Resin H2N-AA2-AA? Resin FMOC-AA2-AA? washed first with DMF, then treated with a 20% solution of piperidine in DMF for 20 minutes. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, 3 times with MeOH and finally 3 times with CH2C12, to give the resin H2N-AA2 -AA ?. 3. Resin R7-S02-AA2-AA? The resin H2N-AA2-AA? it was washed first with aqueous dioxane, then 10 equivalents of the desired sulfonyl chloride, R7-S02C1, were added. Sufficient 90% aqueous dioxane was added to expand the resin (~ 12.5 ml / g resin). Then 20 equivalents of diisopropylethylamine were added. The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, 3 times with MeOH and finally 3 times with CH2C12., to give the resin R7-S02-AA2-AA? . 4. Resin R7-S02-AA2-AA? -NHOH Resin R7-S02-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH were added and rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and then with CH2C12. The filtrate was concentrated under vacuum to obtain R7-S02-AA2-AA? -NHOH. EXAMPLE III General Experimental for R7-NHCO-AA2-AA? -NHQH (Dipeptide Compounds of Formula I wherein z is -CONH-) - 1. Resin R7-NHCO-AA2-AA! The resin H2N-AA2-AA? it was first washed with THF, then 3 equivalents of the desired isocyanate, R7N = C = 0, were added. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin). The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, 3 times with MeOH and finally 3 times with CH2C12, to give the R7-NHCO resin -AA2-AAi. 2. Removal of protecting groups If AAi or AA2 contained an acid labile side chain protecting group that had to be removed, the resulting resin (R7-NHCO-AA2-AA? Resin) was treated with a 95 / 2.5 solution. / 2.5 TFA / H20 / triisopropylsilane (TIS) for 2 hours. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH and then three times with CH2C12. 3. R7-NHCO-AA2-AA? -NHOH The resin R7-NHCO-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (-12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH was added and the reaction was rotated by suction filtration and washed with CH 2 C 12, MeOH and then with CH2C12. The filtrate was concentrated under vacuum to obtain R7-NHCO-AA2-AA? -NHOH. The dipeptide hydroxamic acids in Table II and Table V where Z is -CONH- were prepared using the procedure of Example 3. General Experimental Example IV for R7-CO-AA2-AA? -NHOH (Dipeptide Compounds of Formula I in where Z is -CO-) 1. Resin R7-CO-AA2-AA? To the resin H2N-AA2-AA? enough CH2C12 was added to expand the resin (~ 12.5 ml / g resin). Then 3 equivalents of the desired acid chloride, R7C0C1 and 3 equivalents of Et3N were added. A second alternative was to add to the expanded resin with CH2C12 3 equivalents of the desired carboxylic acid, R7C02H, 3 equivalents of diisopropylcarbodiimide and 0.05 equivalents of a 0.160 M solution of dimethylaminopyridine in THF. A third alternative was to expand the resin (~12.5 ml / g resin) with sufficient CH3CN and attach the desired acid chloride, R7C0C1 (3 equivalents) in the presence of 6 equivalents of trimethylsilylcyanide. In all cases the reaction was then placed in a centrifuge and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7-CO-AA2 -AA ?. 2. Removal of protecting groups If AAi or AA2 contained an acid labile side chain protecting group that had to be removed, the resulting resin (resin R7-CO-AA2-AA?) Was treated with a 95 / 2.5 solution. / 2.5 TFA / H20 / triisopropylsilane (TIS) for 2 hours. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH and then three times with CH2C12. 3. R7-CO-AA2-AA? -NHOH The resin R7-CO-AA2-AAx was first washed with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH were added and the reaction was rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and then with CH2C12. The filtrate was concentrated under vacuum to obtain R7-CO-AA2-AA? -NHOH. EXAMPLE V General Experimental for. R7-OC (= 0) -AA2-AA ~ NHOH (Dipeptide Compounds of Formula I wherein Z is -C (0) 0-) 1. Resin R7-OCO-AA2-AA? To the H2N-AA2-AA resin was added 3 equivalents of the desired succinimidylcarbonate, R7OC (= 0) NHS, 3 equivalents of Et3N and 0.05 equivalents of a 0.116 M solution of 4-dimethylaminopyridine in THF. Sufficient CH2C12 was added to expand the resin (~12.5 ml / g resin). Another alternative was to add to the resin 10 equivalents of the desired chloroformate, R7OCOCl and 20 equivalents of diisopropylethylamine, followed by sufficient 90% aqueous dioxane to expand the resin (~ 12.5 ml / g resin). In all cases, the reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7-OCO-AA2 -AA? . 2. Removal of the protecting groups If AAi or AA2 contained an acid labile side chain protecting group that had to be removed, the resulting resin (R7-OCO-AA2-AA? Resin) was treated with a 95 / 2.5 solution. / 2.5 TFA / H20 / triisopropylsilane (TIS) for 2 hours. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH and then three times with CH2C12. 3. R7-OCO-AA2-AA? -NHOH The resin R7-OCO-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH were added and the reaction was rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and then with CH2C12. The filtrate was concentrated under vacuum to obtain R7-0C0-AA2-AA? -NH0H. EXAMPLE VI Experimental General for CBz-NR6-CH2CO-AA? -NHOH 1. Resin BrCH2CO-AA? To the resin H2N-AA? 12 equivalents of bromoacetic acid and 13 equivalents of diisopropylcarbodiimide were added. Sufficient CH2C12 was added to expand the resin (~12.5 ml / g resin). The reaction was then placed in a centrifuge and rotated for 2 hours.

The reaction was then filtered by suction filtration and washed three times with CH2C12 / three times with DMSO and finally 3 times with CH2C12, to give the resin BrCH2CO-AA ?. 2. Resin R6-NHCH2CO-AA? The resin BrCH2CO-AA? washed first with DMSO. Sufficient DMSO was added to expand the resin (~12.5 ml / g resin) followed by the addition of 40 equivalents of the desired primary amine, R6NH2. The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R6-NHCH2CO- AA? . 3. Resin CBz-NR6-CH2CO-AA? To the resin R6-NHCH2CO-AA? 3 equivalents of CBzOSu, 3 equivalents of Et3N and 0.05 equivalents of a 0.116 M solution of 4-dimethylaminopyridine in THF were added, enough CH2C12 was added to expand the resin (~12.5 ml / g resin). The reaction was then placed in a spinner and rotated overnight, then the reaction was filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin CBz-NR6-CH2CO-AA? 4. Removal of the protecting groups If AAi or AA2 contained an acid labile side chain protecting group that had to be removed, the resulting resin ( CBz-NR6-CH2CO-AA resin?) was treated with a solution of 95 / 2.5 / 2.5 TFA / H20 / triisopropylsilane (TIS) for 2 hours.The reaction was then filtered by suction filtration and washed three times. times with CH2C12, three times with MeOH and then three times with CH2C12. 5. CBz-NR6-CH2CO-AA? -NHOH CBz-NR6-CH2CO-AA resin? it was washed first with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin) and then added equivalents of 50% aqueous NH 2 OH and the reaction was rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and finally with CH2C12. The filtrate was concentrated under vacuum to obtain CBz-NR6-CH2CO-AA? -NHOH. EXAMPLE VII General Experimental for R7NHCO-AA2-AA? -NHOH (dipeptide compounds of Formula I wherein Z is -C (O) NH-) 1. To the resin ArOCO-AA2-AA? (Ar = Ph) enough DMF was added to expand the resin (~ 12.5 ml / g resin). 20 equivalents of R7NH2 were added and the reaction mixture was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7NHCO-AA2- AA? . 2. The resin R7NHCO-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH were added and the reaction was rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and then with CH2C12. The filtrate was concentrated in vacuo to obtain R7NHCO-AA2-AA? -NHOH. EXAMPLE VIII General Experimental for CBz-AA3-AA2-AA? -NHOH (Tripeptide Compounds of Formula I where n = 1 and ZR7 is benzyloxycarbonyl) 1. Resin CBz-AA3-AA2-AA? To the resin H2N-AA2-AA? Three equivalents of AA3 protected with CBz, three equivalents of diisopropylcarbodiimide and 0.05 equivalents of a 0.160 M solution of dimethylaminopyridine in THF were added. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin). [An alternative is to add to the resin three equivalents of AA3 protected with CBz, three equivalents of HATU, three equivalents of HOAt and six equivalents of DIPEA. Sufficient NMP was added to expand the resin (~ 12.5 ml / g resin)]. The reaction was placed in a spinner and rotated overnight. The reaction was filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin CBz-AA3-AA2-AA ?. 2. Removal of protecting groups If AAi, AA2 or AA3 contained an acid labile side chain protecting group that had to be removed, the resulting resin (CBz-AA3-AA2-AA resin) was treated with a 95/2 solution, 5 / 2.5 TFA / H20 / triisopropyl silane (TIS) for 2 hours. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH and then three times with CH2C12. 3. CBz-AA3-AA2-AA? -NHOH The resin CBz-AA3-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH were added and the reaction was rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and finally with CH2C12. The filtrate was concentrated in vacuo to obtain CBz-AA3-AA2-AA? -NHOH. EXAMPLE IX General Experimental for R7Z-AA3-AA2-AA? ~ NHOH (Tripeptide Compounds of Formula I wherein Z is -S02- or -C (O) NH-) 1. Resin FMOC-AA3-AA2-AAx To the resin H N-AA2-AA? three equivalents of FM3-protected AA3, three equivalents of diisopropylcarbodiimide and 0.05 equivalents of a 0.116 M solution of 4-dimethylaminopyridine in THF were added. Sufficient CH2C12 was added to expand the resin (~12.5 ml / g resin). [An alternative is to add to the resin three equivalents of AA3 protected with FMOC, three equivalents of HATU, three equivalents of HOAt and six equivalents of DIPEA. Sufficient NMP was added to expand the resin (~ 12.5 ml / g resin)]. The reaction was placed in a spinner and rotated overnight. The reaction was filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin FMOC-AA3-AA2 -AA? . 2 . Re s ina H2N-AA3 -AA2 -AA? Resin FMOC-AA3-AA2-AA? washed first with DMF, then treated with a 20% piperidine solution in DMF for 20 minutes. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin H2N-AA3- AA2-AA ?. 3 . Re s ina R7 Z -AA3-AA2-AA 3a. For Z = S02: The resin H2N-AA3-AA2-AA? it was washed first with aqueous dioxane, then 10 equivalents of the desired sulfonyl chloride, R7S02C1, was added, followed by sufficient 90% aqueous dioxane to expand the resin (~12.5 ml / g resin). Then 20 equivalents of diisopropylethylamine were added. The reaction was placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7S02-AA3- AA2-AA? . 3b For Z NHCO: The resin H2N-AA3-AA2-AA? it was first washed with THF and then three equivalents of the desired isocyanate, R7N = C = 0, were added followed by sufficient THF to expand the resin (~12.5 ml / g resin). The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7NHCO-AA3- AA2-AA? . 4. R7Z-AA3-AA2-AA? -NHOH The resin R7Z-AA3-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH were added and the reaction was rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and then with CH2C12. The filtrate was concentrated in a Speed Va c to obtain R7-AA3-AA2-AAi-NHOH. EXPERIMENTAL EXAMPLE X for R7Z-NR10C (O) CH2-AA2-AAX ^ NHOH (Tripeptide Compounds of Formula I where n = 1, m = 0, R9 is hydrogen (A is C (0) CH2NR10) and Z is a bond, -S02- -C = 0 or -C (O) NH-) 1. Resin BrCH2CO-AA2-AA? To the resin H2N-AA2-AA? Twelve equivalents of bromoacetic acid and twelve equivalents of diisopropylcarbodiimide were added. Sufficient CH2C12 was added to expand the resin (~12.5 ml / g resin). The reaction was then placed in a centrifuge and rotated for 2 hours. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with DMSO and finally 3 times with CH2C12, to give the resin BrCH2CO-AA2-AA? . 2. Resin R10-NHCH2CO-AA2-AA? The resin BrCH2CO-AA2-AA? washed first with DMSO. Sufficient DMSO was added to expand the resin (~ 12.5 ml / g resin) followed by the addition of 40 equivalents of the desired amine, R10NH2 or 7R10R NH. The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give a re Si Na Ri? HCH2CO-AA2 -AA? or l a re s ina R7R10HCH2CO-AA2-AA? (If R7R10NH is used, which corresponds to Z as a link, go directly to step 4). 3. Resin R7Z-NR10CH2CO-AA2-AA? 3a. For Z = S02: The resin R10NHCH2CO-AA2-AA? it was washed first with aqueous dioxane, then 10 equivalents of the desired sulfonyl chloride, R7S02C1, were added. Sufficient 90% aqueous dioxane was added to expand the resin (~ 12.5 ml / g resin). Then 20 equivalents of diisopropylethylamine were added. The reaction was placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7SO2-NR10CH2CO- AA2-AA? . 3b. For Z = -CO-: To the resin R10NHCH2CO-AA2-AA? enough CH2C12 was added to expand the resin (~ 12.5 ml / g resin). Then three equivalents of the desired acid chloride, R7C0C1 and three equivalents of Et3N were added. [A first alternative was to add enough CH2C12 to the resin to expand the resin (~ 12.5 ml / g resin) followed by 3 equivalents of the desired carboxylic acid, R7COOH, 3 equivalents of diisopropylcarbodiimide and 0.05 equivalents of a 0.116 solution. M of dimethylaminopyridine in THF. A second alternative is to add to the resin 3 equivalents of the desired carboxylic acid, R7COOH, 3 equivalents of HATU, 3 equivalents of HOAt and 6 equivalents of DIPEA, followed by sufficient NMP to expand the resin (~ 12.5 ml / g of resin )]. The reaction was then placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7CO-NR10CH2-AA2 -AA? . 3c. For Z = -CONH-: The resin R10NHCH2CO-AA2-AA? washed first with THF, then 3 equivalents of the desired isocyanate were added, R7N = C = 0, followed by sufficient THF to expand the resin (~ 12.5 ml / g resin). The reaction was placed in a spinner and rotated overnight. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH, once with HOAc / CH2Cl2 1: 1, three times with MeOH and finally three times with CH2C12 to give the resin R7NHCO-NR10CH2- AA2-AA? . 4. Removal of protecting groups If AAi or AA2 contained an acid labile side chain protecting group that had to be removed, the resulting resin (resin R7Z-NR10CH2CO-AA2-AA?) Was treated with a 95 / 2.5 solution. / 2.5 TFA / H20 / triisopropyl silane (TIS) for 2 hours. The reaction was then filtered by suction filtration and washed three times with CH2C12, three times with MeOH and then three times with CH2C12. 5. R Z-NR10C (O) CH2-AA2-AA? -NHOH The resin R Z-NR10CH2CO-AA2-AA? it was washed first with THF. Sufficient THF was added to expand the resin (~ 12.5 ml / g resin), then 25 equivalents of 50% aqueous NH 2 OH were added and the reaction was rotated for two days. The reaction was then filtered by suction filtration and washed with CH2C12, MeOH and then with CH2C12. The filtrate was concentrated under vacuum to obtain R7Z-NR10C (O) CH2-AA2-AA? -NHOH. * It should be noted in all cases, that all solid reagents are added followed by the solvent. If the reagents are not solid, the solvent is added followed by the liquid reagents. For AAi or AA2 with side chain that requires deprotection, this was done just before the NH2OH separation reaction. Typical amino acids with side chains that require deprotection include Glu (OtBu), His (Bock) and Ser (OtBu). Example XI Isolation and preparation of procollagen C-proteinase Cloning of human PCP and construction of HT-1080 vector. Human procollagen C-proteinase (PCP, also known as bone morphogenetic protein-1 or BMP-1) was cloned by a cDNA collection of human fibroblasts (Stratagene, San Diego, CA). Cloning was performed by PCR based on the nucleotide sequence reported (Wozney, J.M., Rosen, V., Celeste, A.J., Mitsock, L.M., Whitters, M.J., Kriz, R.W., Hewick, R.M., and Wang, E.A. (1989) direct presentation of GenBank Accession No. M22488, site HUMBMPl) using Taq polymerase, the 5 'primer GCGCGCGGTACCCGCCCCGCCAGCATGCCCGGCGTGGCCCGCCTGCCGCGGCTGCTGCTGCTGCTCCCGCGTCCCGGCCGGCCGCTGGACTTGGCCGACTACACCTATGACCTGGC (SEQ ID NO: 1) (Oligo Therapeutics, Inc., Winsonville, OR), and the reverse strand 3 'CCGCTCGAGCCTCACTGGGGGGTCCGGTTTCTTTTCTGCACTCGGAATTT GAGCTGGTG (SEQ ID NO: 2) (Gibco) to give the full-length nucleotide encoding the signal sequence, propeptide, catalytic domain and all C-terminal domains to the natural translation termination site. The PCR product was purified by gel electrophoresis using the Wizard DNA purification kit (Promega, Madison, Wl) and ligated directly to the mammalian expression vector pCR3.1 (Invitrogen, Carlsbad, CA) by the TA cloning method . The ligated product was used to transform the E. coli strain TOP10F '(Invitrogen, Carlsbad, CA) by a standard heat shock method and the transformants were selected by restriction analysis of purified plasmid using the HindIII and BamHI enzymes. The transformants that tested positive for the PCP insert were subjected to sequencing using the Per kin-Elmer / ABI system. Two clones were selected which, when combined, encoded the entire amino acid sequence identical to that predicted by Wozney et al. The two clones were recombined by restriction using the Bbrl enzymes, which were divided into an internal site that occurs naturally, and EcoRV, which was split at the junction of the insert and the vector. The separated fragments were ligated again into pCR3.1 treated with EcoRV. The resulting construct contained the entire coding sequence identical to that reported by Wozney et al. With the exception of two silent mutations in the signal sequence, G- > A in both positions 39 and 45 counting from the translation initiation site (ATG). The completed plasmid construct was amplified in the E.Coli DH5a and purified using anion exchange chromatography (MaxiPrep columns from Qiagen (Valencia, CA) catalog # 12162). Transfection of HT-1080 and selection of the clone expressing PCP The HT-1080 human fibrosarcoma line (ATCC) was cultured in highly concentrated DMEM (DMEM-HG) supplemented with 10% heat inactivated fetal bovine serum (HI- FBS) in 100 mm culture dishes (Falcon, Becton Dickenson, Franklin, NJ) and transfected with 2 μg of purified plasmid using the standard method for Lipofectamine (Gibco, Bethesda, MD) in serum-free medium. Stable transfectants were selected by treating the culture on plates with 400 μg / ml of G418 (Gibco). After a selection for 10 days, the adherent simple colonies were taken from the plate, placed again in plates of 12 cavities and cultivated until they came together. Individual stable colonies were screened for PCP expression by TaqMan analysis (Perkin-Elmer, Foster City, CA) using equivalent amounts of total RNA, the 5 'primer GACGAAGAGGACCTGAGGGCCTT (SEQ ID NO: 3) (Perkin-Elmer, Foster City, CA), the 3 'reverse strand primer TTCCTGGAACTGCAGCTTTGA (SEQ ID NO: 4) (Perkin-Elmer, Foster City, CA) and the reverse-strand probe TGCCGTCTGAGATCCACAGCCTGCT (SEQ ID NO: 5) (Perkin-Elmer). A stable line, HT-1080 / hpcp-23 was chosen based on the maximum expression level of PCP mRNA in the TaqMan tracing. Stocks of the HT-1080 / hPCP-23 stable line were transferred to DMEM-HG supplemented with 5% HI-FBS and 10% DMSO (G418 was not added) and they were slowly frozen at -70 ° C overnight. transferred to a liquid nitrogen bath for long-term storage. HT-1080 / hPCP-23 assays were maintained in DMEM-HG supplemented with 10% HI-FBS and 250 μg / ml of G418 for no more than 7 passages. PCP expression for harvest was performed by replacing plates and culturing HT-1080 / hPCP-23 on plates coated with rat tail type I collagen (Falcon) in OptiMEM serum free medium (Gibco) without G418 for 24 hours . Production of PCP in HT1080 cells HT1080 cells that were transformed to produce PCP were adapted for suspension culture in OptiMEM medium (GIBCO) supplemented with fetal bovine serum 5% and 4 ml / 1 of G418 (Gibco) The culture was maintained at 37 ° C and 30% oxygen was dissolved. Batch sizes of 10 liters were typically produced. When the density of the cells reached 4-6 x 10 5 cells / ml, the culture fluid was collected and filtered through 0.2 μm membranes. Alternatively, the cell culture was perfused with fresh medium at a rate of 0.8 to 1.0 culture volume / day. The density of the perfused cultures reached 1-2.5 x 106 cells / ml and was maintained up to two weeks with continuous harvests. Purification of PCP from HT1080 cells A column packed with Dyematrex Gel Green A (Millipore, Bedford, MA) was equilibrated against 50 mM HEPES, pH 7.2, containing 6 mM CaCl2 and 0.3 M NaCl. loaded the HT1080 cell culture, the column was washed with 10 column volumes of the equilibrium buffer solution containing 1.0 M NaCl. PCP was eluted with 50 mM HEPES pH 7.2 containing 3 M NaCl, 2 M urea and 6 mM CaCl2. The eluate fractions were pooled and concentrated at 150-200 ml and dialyzed against 4.0 liters of 50 mM HEPES, 6 mM CaCl2, pH 7.2 overnight. The material was then centrifuged at 5000 g for 15 minutes to eliminate precipitates. The sample containing PCP was stored at -20 ° C until it was ready for further processing. The sample containing PCP was thawed and diluted with 50 mM HEPES pH 7.2 containing 6 mM CaCl2, if necessary to bring the NaCl concentration to 0.1-0.15 M. The pH was adjusted to 6.7. with 2 N HCl. The protein solution was filtered through a 0.45 μm filter to remove any precipitate. This preparation was then loaded onto a column packed with Q-Sepharose High Performance (Pharmacia, Piscataway, NJ) which had been equilibrated with 50 mM HEPES pH 6.7 containing 6 mM CaCl2 and 0.15 M NaCl. The PCP was not retained in the column and therefore was in the flow through the fractions. The PCP was concentrated at 1 mg / ml and used to trace. Production of PCP in Drosophila cells Drosophila cells that had been transformed to produce PCP were cultured in bioreactors at a typical batch volume of 10 liters in SF900 II SF medium (Gibco). The temperature was maintained at 30 ° C and the oxygen was dissolved at 30%. Periodically the cells were fed with a cocktail composed of glutamine, lipids and yeast autolysate. When the cell densities reached 30-50 x 10 6 cells / ml, the supernatants were harvested by centrifugation and concentrated by ultrafiltration using a 30 Kd membrane. Purification of PCP from the fluid of the Drosophila cell culture The culture fluid of the Drosophila cells was concentrated 8 times and the pH was adjusted to 7.1-7.2 if necessary. The culture fluid was centrifuged at 3000 g for 10 minutes and filtered through 0.45 μm filters. The culture fluid was then loaded onto columns packed with carboxy-sulfone packaging material (JT Baker / Mallinckrodt, Phillipsburg, NJ) which had been equilibrated with 0.1 M NaCl, 50 mM HEPES, 6 mM CaCl 2, pH 7.2. After loading, the column was washed with 10 column volumes of the equilibrium buffer solution. The retained proteins were eluted with a gradient of 0.1 to 1.0 M NaCl in 9 column volumes. Fractions that had PCP activity were pooled for further purification. The PCP eluted from the carboxy-sulfone column was loaded onto a Dyematrex Gel Green A column (Millipore, Bedford, MA) that had been equilibrated with 50 mM HEPES, pH 7.4 containing 0.3 M NaCl and 6 mM CaCl 2 . The column was then washed with the equilibrium buffer solution containing 1 M NaCl. The retained proteins were eluted with 50 mM HEPES, pH 7.4, 3 M NaCl, 2 M urea, 6 mM CaCl 2. The elution maximum was concentrated and dialyzed against 50 M HEPES, pH 7.4 containing 0.3 M NaCl, 6 mM CaCl 2. The preparation was centrifuged at 3000 g for 10 minutes. Added Brij 35 (Sigma, Madison, Wl) to the supernatant at a final concentration of 0.02%. This preparation was used to track. Example XII Isolation of collagenase enzymes The catalytic domain of human collagenase-1 was expressed as a fusion protein with ubiquitin in E.coli as described in Gehring, E.R. et al., J. Biol. Chem., 270, 22507, (1995). After purification of the fusion protein, the catalytic domain collagenase-1 was released by treatment with 1 mM aminophenyl mercuric acetate (APMA) for 1 hour at 37 ° C and then purified by chromatography on zinc chelate. Collagenase-2 and human gelatinase B were isolated in active form from coatings of floating layers of leukocytes as described in Mookhtiar, K.A. et al., Biochemistry, 29, 10620, (1990).

The propeptide and the catalytic domain portion of human collagenase-3 was expressed in E. coli as an N-terminal fusion protein with ubiquitin. After purification, the catalytic domain was released by treatment with 1 mM APMA for 1 hour at 37 ° C and then purified by chromatography on zinc chelate. Rat collagenase-3 was actively purified from the culture medium of uterine smooth muscle cells as described in Roswit, W.T. and collaborators, Arch. Biochem. Biophys. 225, 285-295 (1983). Example XIII Inhibition of the activity of the procollagen C-proteinase The ability of the compounds to inhibit PCP was demonstrated in the following in vitro assays using a synthetic peptide as a substrate. Assay A A continuous assay was performed using 20 μM substrate (Dabcyl-Pro-Tyr-Tyr-Gly-Asp-Glu-Pro-n-Leu-Edans) (SEQ ID NO: 6). The final assay conditions were 20 μM substrate, 50 mM HEPES pH 7.5, 50 mM NaCl, 3% DMSO, 37 ° C and PCP enzyme. Product formation was monitored by fluorescence spectroscopy, Ex. = 335 nm, Em. = 490 nm. The IC50 was calculated from the graphs of the initial velocity against the concentration of the compound. Test B Eighty μL of buffer solution A (20 mM HEPES) containing the desired concentrations of the test compound in DMSO or carrier vehicle were mixed with 10 μl of approximately 1 mg / ml of PCP enzyme and 10 μl of substrate of 0 , 1 mM both in 20 mM of HEPES. The contents were mixed, incubated at room temperature for 1-2 hours and the fluorescent readings were taken with a Víctor plate reader (Ex. 405 nM, Em 460 nM at 2000-40,000 lamp energy, 0.1-1 sec / cavity). The substrate was DACM-Cys-Pro-Tyr-Gly-Asp-Glu-Pro-nLeu-Lys-FITC-OH (SEQ ID NO: 7) (DACM dimethylamino-coumarylmaleimide, FITC = fluorescein isothiocyanate). The IC 50 was calculated from the graphs of the initial velocity against the concentration of the compound. Additional in vitro assays using native procollagen can also be used as the substrate and these assays are described in greater detail in WO 97/05865 ("C-Proteinase inhibitors for the treatment of disorders related to collagen overproduction"). The compounds of Tables I-III, V and VI had CI5o in the range of 0.02 to 200 μM. The compounds of Table IV had an IC 50 in the range of 10-1000 μM. Example XIV Measurement of collagenase activity The inhibitory activity of collagenase-1, collagenase-2 and collagenase-3 of the compounds of this invention in vitro was determined based on the hydrolysis of MCA-Pro-Leu-Gly-Leu -DPA-Ala-Arg-NH2 (SEQ ID NO: 8) (Bachem, Inc.) at 37 ° C as described in Knight, CG, et al., FEBS Lett., 296 (3): 263-266 (1992 ). The collagenase enzyme was diluted with assay buffer (50 mM tricine pH 7.5, 200 mM NaCl, 10 mM CaCl 2 and 0.005% Brij-35) containing 10 μmol of the substrate indicated above dissolved in DMSO. The compounds of the invention were dissolved in DMSO or only DMSO (control samples) was added so that the final concentration of DMSO in all the assays was 2.5%. Changes in fluorescence were monitored with a Perkin-Elmer LS-50B fluorimeter using an excitation wavelength of 328 nM and an emission wavelength of 393 nm. The compounds selected from Tables I-VI were 10-1000 more selective with respect to the inhibition of PCP than with respect to human collagenase enzymes. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (44)

1. Claims Having described the invention as above, the content of the following claims is claimed as property. 1. A compound selected from the group of compounds represented by Formula (I): (I) characterized in that: R1 and R2 are, independently of one another, hydrogen or alkyl; R2 is: (i) cycloalkyl, cycloalkylalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocycle or heterocycloalkyl; or (ii) - (alkylene) -BX wherein B is -O-, -NR8-, -S (0) n- (where n is 0, 1 or 2), -C = 0, -CONR8-, -NR8C02-, or -C (= NR8) NR8S02- (where8 R is H alkyl) X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl heteroaryl or heteroaralkyl; or (iii) - (alkylene) -B-X- wherein B is -NR8CO- (wherein R8 is H or alkyl), and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl; or (iv) R2 and R3 form an alkylene or heteroalkylene chain; R3 is hydrogen or alkyl; R6 is hydrogen, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl; R5 is: (i) hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocycloalkyl, heteroalkyl, or - (alkylene) -CYOJ-X1 wherein X1 is alkyl, hydroxy, alkoxy, aryl , aralkyl, aryloxy, aralkyloxy, heteroaryl, heteroaryloxy, heteroaralkyloxy or NR'R "(wherein R 'and R" are independently H or alkyl, or R' and R "form an alkylene chain); or (ü) R- R "form an alkylene chain, or (iii) R5 and R6 form an alkylene chain, n is 0 or 1, A is -C (= 0) -CH (R9) - (CH2) mN ( R10) -, wherein: m is an integer of 0-5 inclusive, R9 is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocycloalkyl, heteroalkyl, or - (alkylene) -C (O) - X1, wherein X1 is alkyl, hydroxy, alkoxy, aryl, aralkyl, aryloxy, aralkyloxy, heteroaryl, heteroaryloxy, heteroaralkyloxy or NR'R "(wherein R 'and R" are independently H or alkyl, or R' and R ') R "form an alkylene chain) and R10 is hydrogen, alkyl, aralkyl or heteroaralkyl; Z is YB, wherein: Y is alkylene or a bond, and B is -CO-, -C (0) 0-, - CONR8-, -S02- or -S02NR8- (wherein R8 is hydrogen or alkyl), alkylene (optionally substituted by hydroxy, alkoxy, amino, monoalkylamino or dialkylamino) or a bond; R7 is cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl; as long as n = 0 and Z is S02, then R2 does not contain an imidazole group; and their pharmaceutically acceptable salts, prodrugs, individual isomers and mixtures of isomers.
2. 2. The compound according to claim 1, characterized in that: n = 0.
3. 3. The compound according to claim 2, characterized in that R3 and R6 are hydrogen.
4. 4. The compound according to claim 3, characterized in that: R2 is aralkyl or heteroaralkyl.
5. 5. The compound according to claim 4, characterized in that: Z is -C (0) 0- or -S (0) 2-.
6. 6. The compound according to claim 5, characterized in that: R2 is optionally substituted benzyl or heteroaralkyl.
7. 7. The compound according to claim 6, characterized in that R2 is 4-t-butoxybenzyl, 3-chlorobenzyl, 3-indolyl-methyl, 2-thienylmetyl, 4-imide zolylmethyl or 4-thiazolylmethyl.
8. 8. The compound according to claim 7, characterized in that R2 is 4-thiazolylmetyl.
9. 9. The compound according to claim 8, characterized in that: R7 is aryl, aralkyl, heteroaryl or heteroaralkyl.
10. 10. The compound according to claim 8, characterized in that: Z is -C (0) 0- and R7 is optionally substituted benzyl.
11. 11. The compound according to claim 9, characterized in that: Z is -S02- and R7 is aryl or heteroaryl.
12. 12. The compound according to claim 10 or claim 11, characterized in that: R1 and R4 are hydrogen and R5 is alkyl.
13. 13. The compound according to claim 12, characterized in that R5 is (S, S) -1-methylpropyl.
14. 14. The compound according to claim 3, characterized in that R2 is (alkylene) -BX wherein B is -0-, NR8-, -S-, -C = 0, -CONR8-, -NR8C02-, -NR8S02 - or -C (= NR8) NR8S02- (wherein R8 is H or alkyl) and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl.
15. 15. The compound according to claim 14, characterized in that: Z is -C (O) O- or -S (O) 2-.
16. 16. The compound according to claim 15, characterized in that R2 is -CH2-B-X and B is -NHC02- and X is benzyl.
17. 17. The compound according to claim 16, characterized in that: R7 is aryl or aralkyl.
18. 18. The compound according to claim 17, characterized in that: R1 and R4 are hydrogen and R5 is alkyl.
19. 19. The compound according to claim 18, characterized in that R5 is (S, S) -1-methylpropyl.
20. 20. The compound according to claim 1, characterized in that: n is l.
21. 21. The compound according to claim 20, characterized in that m is 0 and R3 and R6 are hydrogen.
22. 22. The compound according to claim 21, characterized in that: R2 is aralkyl or heteroaralkyl.
23. 23. The compound according to claim 24, characterized in that: Z is -C (0) 0- or -S (0) 2-.
24. 24. The compound according to claim 23, characterized in that: R2 is optionally substituted benzyl or heteroaralkyl.
25. The compound according to claim 24, characterized in that R 2 is 4-t-butoxybenzyl, 3-chlorobenzyl, 3-undolium 1-methyl, 2-t-butylmethyl, 4-imidazolyl-methyl or 4-thiazolyl-methyl.
26. 26. The compound according to claim 25, characterized in that R2 is 4-thiazolylmethyl.
27. 27. The compound according to claim 26, characterized in that: R7 is aryl, aralkyl, heteroaryl or heteroaralkyl.
28. 28. The compound according to claim 27, characterized in that: Z is -C (0) 0- and R7 is benzyl.
29. 29. The compound according to claim 27, characterized in that: Z is -S02- and R7 is aryl.
30. 30. The compound according to claim 28 or 29, characterized in that: R1 and R4 are hydrogen and R5 is alkyl.
31. 31. The compound according to claim 30, characterized in that R5 is (S, S) -1-methylpropyl.
32. 32. The compound according to claim 21, characterized in that: R2 is (alkylene) -BX wherein B is -NR8-, S, -C = 0, -CONR8-, -NR8C02-, NS02- or -C ( = NR8) NS02- (where R8 is H or alkyl) and X is cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl or heteroaralkyl.
33. 33. The compound according to claim 32, characterized in that: Z is -C (0) 0- or -S (0) 2-.
34. 34. The compound according to claim 33, characterized in that R2 is -CH2-B-X and B is -NHC02- and X is benzyl.
35. 35. The compound according to claim 34, characterized in that: R7 is aryl or aralkyl.
36. 36. The compound according to claim 35, characterized in that: R: and R4 are hydrogen and R5 is alkyl.
37. 37. The compound according to claim 35, characterized in that R5 is (S, S) -1-met i lpropi lo.
38. 38. A pharmaceutical composition characterized in that it comprises the compound according to any of claims 1 to 37 and a pharmaceutically acceptable excipient.
39. 39. A process for preparing the compounds according to claim 1, characterized in that it comprises: (i) treating a compound of Formula II wherein L is a leaving group and R1-R7, A, n and Z are as defined in the claim 1 with hydroxylamine or a protected derivative thereof, and (ii) deprotecting as necessary and isolating the compound according to claim 1. OT)
40. 40. The compound according to claim 1, characterized in that it is prepared according to a process as claimed in claim 39.
41. 41. The compound according to any of claims 1 to 37, characterized in that it is a therapeutically active substance.
42. 42. The use of a compound according to any of claims 1 to 37, for the preparation of a medicament comprising a compound as an active ingredient as claimed in any of claims 1 to 37 for the treatment of a fibrotic disease, preferably acute respiratory distress syndrome.
43. 43. A method for treating fibrosis, characterized in that it comprises administering to a patient in need thereof, an inhibitor of the procollagen C-proteinase which is at least ten times more selective with respect to the procollagen C-proteinase as compared to collagenase-1, collagenase-2 and collagenase-3.
44. 44. The invention as described so far