MXPA01003946A - Pesticidal proteins - Google Patents

Abstract

The subject invention concerns new classes of pesticidally active proteins and the polynucleotide sequences that encode these proteins. In preferred embodiments, these pesticidal proteins have molecular weights of approximately 40-50 kDa and of approximately 10-15 kDa.

Description

PESTICIDE PROTEINS CROSS REFERENCE TO A RELATED APPLICATION This request is a continuation in part of the document of USA no. of series 09 / 378,088, filed on August 20, 1999.

BACKGROUND OF THE INVENTION Coleoptera are a significant group of agricultural pests that cause great damage to crops every year. Examples of coleopteran pests include corn rootworm and alfalfa weevils. The alfalfa weevil, Hypera postica, and the closely related Egyptian alfalfa weevil Hypera brunneipennis, are the most important insect pests of alfalfa that was grown in the United States, where 2.9 million hectares were infested in 1984. annual sum of 20 million dollars are spent to control these pests. The Egyptian alfalfa weevil is the predominant species in the southwestern United States where it remains in estivation (ie, hibernation) during the hot summer months. In all other aspects, it is identical to the alfalfa weevil, which predominates throughout the rest of the United States.

The larval stage is the most damaging in the life cycle of the weevil. Feeding on the tips that grow in the alfalfa plant, the larvae cause the skeletonization of the leaves, wilting, a reduction of the growth of the plants, and finally, reductions in the yield. Serious propagations can ruin a whole cut of hay. Adults, who also eat the leaves, cause additional, but less significant, deterioration. Approximately 10 million hectares of corn in the United States are infested with a complex of corn rootworm species each year. The complex of corn rootworm species includes the rootworm of northern corn, Diabrotica barben, the southern corn rootworm, D. undecimpunctata howardi, and the western rootworm, D. virgifera virgifera. The larvae that live in the soil of these Diabrotica species feed on the root of the corn plant, establishing themselves there. This establishment eventually reduces e! corn yield and often results in the death of the plant. By feeding on corn larvae, adult weevils reduce pollination and therefore detrimentally affect maize yield per plant. In addition, adults and larvae of the genus Diabrotica attack crops of cucurvitáceas (cucumbers, melons, squash, etc.) and many crops of vegetables and wild in commercial production, as well as those grown in home gardens.

Control of the corn rootworm has been partially solved by cultivation methods, such as crop rotation, and by applying high levels of nitrogen to stimulate the growth of an accidental root system. However, chemical insecticides are relied upon to guarantee a desired level of control. The insecticides are either watered on or incorporated into the soil. The problems associated with the use of some chemical insecticides are environmental pollution and the development of resistance among insect populations treated. The soil microbe Bacillus thuringiensis (B.t) is a Gram-positive spore-forming bacterium, characterized by inclusions for protein spores, which can appear microscopically as distinctly-shaped crystals. Some strains of B.t. they produce proteins that are toxic to specific pest orders. Some B.t. toxin genes have been isolated and sequenced, and B.t- have been produced based on recombinant DNA and have been suitable for use. In addition, with the use of genetic engineering techniques, new tests were performed to release these B.t. endotoxins. to agricultural environments that are under development, including the use of genetically engineered plants with endotoxin genes for insect resistance and the use of stabilized intact microbial cells such as vehicles for the release of B.t. endotoxins. (Gaertner, F.H., L. Kim [1998] TIBTECH 6: S4-S7). Therefore, the B.t. endotoxin genes isolated are increasingly valuable from a commercial point of view. Commercial use of pesticides B.t. it was originally limited to a narrow range of lepidoptera (caterpillars). The preparation of spores and crystals of B.t.huringiensis subsp. kurstaki has been used for many years in the form of commercial insecticides for lepidopteran pests. For example, B.t.huringiensis var. kurstaki HD-1 produces a crystalline d-endotoxin that is toxic to larvae of a number of lepidopteran insects. In recent years, however, researchers have discovered B.t. pesticides. with specificities for a much wider range of pests. For example, other species of B.t. that is, israelensis and tenebrionis (aka Bt M-7, aka Bt san diego), have been used commercially to control insects of the order of Diptera and Coleoptera respectively (Gaertner, FH [1989] "Cell Delivery Systems for Insecticidal Proteins: Living and Non-Living Microorganisms ", in Controlled Delivery of Crop Protection Agents, RM Wilkinm, ed., Taylor and Francis, New York and London, 1990, pp. 245-255). See also, Couch, T.L. (1980) "Mosquito Pathogenicity of Bacillus thuringiensis var. Israelensis", Developments in Industrial Microbiology 22: 61-67; Beegle, C.C. (1978) "Use of Entomogenous Bacteria in Agroecosystems", Developments in Industrial Microbiology 20: 97-104. Krieg A. A.M. Huger, G.A. Langenbruch, W. Schnetter (1983) Z. Ang. Ent. 96: 500-508, describes Bacillus thuringiensis var. tenebrionis, which was reported to be active against two weevils of the order Coleoptera. These are the Colorado potato weevil, Leptinotarsa decemlineata, and Agelastica alni. Recently, new species of B.t. have been identified, and the genes responsible for the active d-endotoxin proteins have been isolated (Hófte, H., H.R. Whiteley [1989] Microbiological Reviews 52 (2): 242-255). Hófte and Whiteley classified the B.t crystal protein genes into four main classes. The classes were Cryl (specific to leptidoptera), Cryll (specific to Lepidoptera and Diptera), Crylll (specific to Coleoptera) and CrylV (specific to Diptera). The discovery of strains specifically toxic for other pests has also been mentioned. (Feitelson, J.S., J. Payne, L. Kim [1992] Bio / Technology 10: 271-275). The 1989 nomenclature and the classification scheme of Hófte and Whiteley for crystalline proteins is based on both the deduced amino acid sequence and the host scale of the toxin. This system was adapted to cover fourteen different types of toxin genes that were divided into five main classes. As more toxin genes were discovered, this system became unmanageable, since there were genes with similar sequences that had significantly different insecticidal specificities. A revised nomenclature system based solely on amino acid identity has been proposed (Crickmore et al. [1996] Society for Invertebrate Pathology, 29th Annual Meeting, 3rd International Colloquium on Bacillus thuringiensis, University of Cordoba, Cordoba, Spain, September 1 -6, summary). The "cry" mnemonic has been retained for all toxin genes except cytA and cytB, which constitute a separate class. The Roman numerals have been exchanged for Arabic numerals in the primary range, and the parentheses of the tertiary range have been eliminated. The current limits represent approximately 95% (tertiary rank), 75% (secondary rank), and 48% (primary rank of sequence identity). Many of the original names have been withheld, with the exceptions indicated, although an amount of • 10 of them, have been reclassified. See also, N. Crickmore, D.R. Zeigler, J. Feitelson, E. Schnepf, J. Van Rie, D. Lereclus, J. Baum, and DH Dean (1998) "Revisions of the Nomenclature for the Bacillus thuringiensis Pesticidal Crystal Proteins" Microbiology and Molecular Biology Reviews Vol. 62 : 807-813; and Crickmore, Zeigler, Feitelson, Schnepf, Van Rie, Lereclus, Baum, and Dean, "Bacillus thuringiensis toxin nomenclature" (1999) http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html. This system %? use the freely obtainable software applications CLUSTAL W and PHYLIP. The NEIGHBOR application within the PHYLIP package uses an arithmetic averaging algorithm (UPGMA). 20 The cloning and expression of the crystal protein B.t. in Escherichia coli has been described in published literature (Schnepf, H.E., H.R. Whiteley [1981] Proc. Nati, Acad. Sci. USA 78: 2893: 2897). U.S. Patent Nos. 4,448,885 and 4,467,036 describe the expression of the crystal protein B.t. in E. coli. U.S. Patent Nos. 4,797,276 and 4,853,331 describe the tenebrionis strain of B.t.huringiensis (a.k.a. M-7, a.k.a. B.t. san diego) which can be used to control coleopterous pests in various environments. U.S. Patent No. 4,918,006 describe B.t. toxins. that have activity against diptera. U.S. Patent No. 4,849,217 describes isolates of B.t. that have activity against the alfalfa weevil. U.S. Patent No. 5,208,077 describes Bacillus thuringiensis isolates active against coleoptera. U.S. Patent No. 5,632,987 describes a 130 kDa toxin of PS80JJ1 as having activity against the corn rootworm. WO 94/40162, which is related to the present application, describes new classes of proteins that are toxic against the corn rootworm. U.S. Patent No. 5,151, 363 and U.S. Patent No. 4,948,734 describe some isolates of B.t. that have activity against nematodes. U.S. Patent No. 6,083,499 and WO 97/40162 describe "binary toxins". The present invention is distinct from the mosquitocidal toxins produced by Bacillus sphaericus. See European patent 454,885; Davidson et al. (1990), "Interaction of the Bacillus sphaericurs mosquito larvicidal proteins", Can. J. Microbiol. 36 (12): 870-8, Baumann et al. (1988), "Sequence analysis of the mosquitocidal toxin genes encoding 51.4-and 41.9-kilodaltons proteins from Bacillus sphaericus 2362 and 2297", J.

Bacteriol. 170: 2045-2050; Oei et al. (1992), "Binding of purified Bacillus sphaericus binary toxin and is deletion derivates to Culex quinquefasciatus gut: elucidation of functional binding domains", Journal of General Microbiology 138 (7): 1515-26.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to novel materials and methods for controlling non-mammalian pests. In a preferred embodiment, the present invention provides materials and methods for the control of coleopteran pests. In more preferred embodiments, the materials and methods described herein, are used to control corn rootworms, most preferably rootworms of the western corn. Lepidoptera pests (including the European corn borer insect and Helicoverpa zea) can also be controlled by the pesticidal proteins of the present invention. The present invention advantageously provides polynucleotides and pesticidal proteins encoded by the polynucleotides. In preferred embodiments, a 40-50 kDa and 10-15 kDa protein is used together, with the pesticidal proteins being in combination. Therefore, the two kinds of proteins of the present invention can be termed "binary toxins". As used herein, the term "toxin" or "pesticidal protein" includes any class of these proteins. The use of a 40-50 kDa protein with a 10-15 kDa protein is preferred but not necessarily required. A class of polynucleotide sequences, as described herein, encodes proteins having a total molecular weight of about 40-50 kDa. In a specific embodiment, these proteins have a molecular weight of approximately 43-47 kDa. A second class of polynucleotides of the present invention encodes pesticidal proteins of about 10-15 kDa. In a specific embodiment, these proteins have molecular weights of approximately 13-14 kDa. It is clear that each type of toxin / gene is an aspect of the present invention. In a particularly preferred embodiment, a 40-50 kDa protein of the present invention is used in combination with a 10-15 kDa protein. Therefore, the proteins of the present invention can be used to increase and / or facilitate the activity of other protein toxins. The present invention includes polynucleotides that encode 40-50 kDa toxins or 10-15 kDa toxins, polynucleotides that encode portions or fragments of the total length toxins that retain pesticidal activity (preferably when used in combination) and polynucleotides that They code both types of toxins. Novel examples of fusion proteins (a 40-50 kDa protein and a 10-15 kDa protein fused together) and polynucleotides encoding them are also described herein. In some embodiments, toxins B.t. which are useful according to the invention, include toxins that can be obtained from novel isolates of B.t. described here. It is clear that when a toxin of 40-50 kDa and a 10-15 kDa are used together, for example, together, one type of toxin can be obtained from one isolate and the other type of toxin can be obtained from another isolate. The present invention also includes the use of variants of isolates and toxins B.t. exemplified that have substantially the same active properties for coleoptera such as toxins and B.t. isolates. specifically exemplified. Such isolated variants would include, for example, mutants. The methods for preparing mutants are well known in the microbiological art. Ultraviolet light and chemical mutagens such as nitrosoguanidine are widely used for this purpose. In preferred embodiments, the present invention relates to plants and plant cells having at least one isolated polynucleotide of the present invention. Preferably the cells of transgenic plants express pesticide toxins in tissues consumed by the pests that constitute the target. • Alternatively, isolates B.t. of the present invention or the recombinant microbes expressing the toxins described herein can be used to control pests. In this sense, the invention includes the treatment of B.t. substantially intact and / or recombinant cells containing the expressed toxins of the invention treated in a manner to prolong the pesticidal activity when substantially intact cells are applied to the environment of a target pest. The treated cells act as a protective coating for the pesticide toxin. The toxins of the present invention are oral intoxicants which affect the cells of the insect's midgut when ingested by the insect which constitutes the target. Therefore, by consuming recombinant host cells, which express the toxins, the target insect therefore contacts the proteins of the present invention that are toxic to the pest. This results in the control of the target pest.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows three examples of pesticide toxins of 43-47 kDa, as well as consensus sequences for these pesticide toxins. Figure 2 shows the ratio of the sequences of 14 and 45 kDa of PS80JJ1 (SEQ ID NOS 31 and 10). Figure 3 shows a comparison of Cl50 values from the mixture study of Example 23. Figure 4 shows the protein alignment of toxins and Bacillus sphaericus genes of 51 and 42 kDa and the toxin and gene 149B1 of 45 kDa Figure 5 shows the alignment of nucleotide sequences of the toxins and genes of Bacillus sphaericus of 51 and 42 kDa and the toxin and gene 149 D1 of 45 kDa.

BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 is a N-terminal 5 amino acid sequence of the 80JJ1 toxin of approximately 45 kDa. SEQ ID NO: 2 is a 25 amino acid N-terminal sequence of the 80JJ1 toxin of approximately 45 kDa. SEQ ID NO: 3 is a 24-amino acid N-terminal sequence of the 80JJ1 toxin of approximately 45 kDa. SEQ ID NO: 4 is the N-terminal sequence of the approximately 47 kDa toxin of 149B1. SEQ ID NO: 5 is an N-terminal amino acid sequence of 50 amino acid for the purified protein of approximately 14 kDa of PS149B1. SEQ ID NO: 6 is an N-terminal sequence of the toxin of approximately 47 kDa of 167H2. SEQ ID NO: 7 is an N-terminal sequence of 25 amino acids for the purified protein of approximately 14 kDa of PS167H2.

SEQ ID NO: 8 is an oligonucleotide probe for the gene encoding the 44.3 kDa toxin of PS80JJ1 and is a forward primer for PS149B1 and PS167H2 which is used in accordance with the present invention. SEQ ID NO: 9 is an inverse primer for PS149B1 and PS167H2 which is used in accordance with the present invention. SEQ ID NO: 10 is the oligonucleotide sequence of the gene encoding the approximately 45 kDa toxin of PS80JJ1. SEQ ID NO: 11 is the amino acid sequence for the JS80JJ1 toxin of approximately 45 kDa. SEQ ID NO: 12 is the partial nucleotide sequence of the gene encoding the approximately 44 kDa toxin of PS149B1. SEQ ID NO: 13 is the partial amino acid sequence for the PS149B1 toxin of approximately 44 kDa. SEQ ID NO: 14 is the partial nucleotide sequence of the gene encoding the PS167H2 toxin of approximately 44 kDa. SEQ ID NO: 15 is the partial amino acid sequence for the PS167H2 toxin of approximately 44 kDa. SEQ ID NO: 16 is a peptide sequence used in the design of primer according to the present invention. SEQ ID NO: 17 is a peptide sequence used in the primer design according to the present invention. SEQ ID NO: 18 is a peptide sequence used in the primer design according to the present invention.

SEQ ID NO: 19 is a peptide sequence used in the design of initiator according to with the present invention. SEQ ID NO: 20 is a nucleotide sequence corresponding to the peptide of SEQ ID NO: 16. SEQ ID NO: 21 is a nucleotide sequence corresponding to the peptide of SEQ ID NO: 17. SEQ ID NO: 22 is a nucleotide sequence corresponding to the peptide of SEQ ID NO: 18. SEQ ID NO: 23 is a nucleotide sequence corresponding to the peptide of SEQ ID NO: 19. SEQ ID NO: 24 is an inverse initiator based on e! reverse complement of SEQ ID NO: 22. SEQ ID NO: 25 is an inverse primer based on the inverse complement of SEQ ID NO: 23. SEQ ID NO: 26 is a forward initiator based on the toxin of 44. 3 kDa of PS80JJ1. SEQ ID NO: 27 is an inverse primer based on the 44.3 kDa toxin of PS80JJ1. SEQ ID NO.28 is a generic sequence representing a new class of toxins according to the present invention. SEQ ID NO: 29 is an oligonucleotide probe used in accordance with the present invention.

SEQ ID NO: 30 is a generic sequence representing a new class of toxins according to the present invention. SEQ ID NO: 31 is the nucleotide sequence of the open reading frame of the PS80JJ1 toxin of 14 kDa. SEQ ID NO: 32 is an amino acid sequence deduced from the 14 kDa toxin of PS80JJ1. SEQ ID NO: 33 is reverse oligonucleotide primer used in accordance with the present invention. SEQ ID NO: 34 is the nucleotide sequence of the entire genetic locus that contains open reading frames of both the PS167H2 toxins of 14 and 44 kDa a and the flanking nucleotide sequences. SEQ ID NO: 35 is the nucleotide sequence of the gene encoding the PS167H2 toxin of approximately 14 kDa. SEQ ID NO: 36 is the amino acid sequence for the PS167H2 toxin of approximately 14 kDa. SEQ ID NO: 37 is the nucleotide sequence of the gene encoding the PS167H2 toxin of approximately 44 kDa. SEQ ID NO: 38 is the amino acid sequence for the PD167H2 toxin of approximately 44 kDa. SEQ ID NO: 39 is the nucleotide sequence of the entire genetic locus that encodes the open reading frames of PS149B1 toxins of 14 and 44 kDa and the flanking nucleotide sequences.

SEQ ID NO: 40 is the nucleotide sequence of the gene coding for the PS149B1 toxin of approximately 44 kDa. SEQ ID NO: 41 is the amino acid sequence for the PS149B1 toxin of approximately 14 kDa. SEQ ID NO: 42 is the nucleotide sequence of the gene coding for the PS149B1 toxin of approximately 44 kDa. SEQ ID NO: 43 is the amino acid sequence for the PS149B1 toxin of approximately 44 kDa. SEQ ID NO: 44 is an optimized gene sequence of corn that encodes the 80JJ1 toxin of approximately 14 kDa. SEQ ID NO: 45 is an optimized gene sequence of corn that encodes the 80JJ1 toxin of approximately 44 kDa. SEQ ID NO: 46 is the DNA sequence of an inverse primer used in Example 15 below. SEQ ID NO: 47 is the DNA sequence of a forward starter (see example 16). SEQ ID NO: 48 is the DNA sequence of a reverse primer (see Example 16). SEQ ID NO: 49 is the DNA sequence of a reverse primer (see Example 16). SEQ ID NO: 50 is the DNA sequence of a reverse primer (see example 16).

SEQ ID NO: 51 is the DNA sequence of PS131W2 that encodes the 14 kDa protein. SEQ ID NO: 52 is the amino acid sequence of the 14 kDa PS131W2 protein. SEQ ID NO: 53 is the partial DNA sequence of PS131W2 for the 44 kDa protein. SEQ ID NO: 54 is the partial amino acid sequence for the 44 kDa PS131W2 protein. SEQ ID NO: 55 is the DNA sequence of PS158T3 that encodes the 14 kDa protein. SEQ ID NO: 56 is the amino acid sequence of the 14 kDa protein of PS158T3. SEQ ID NO: 57 is a partial DNA sequence of PS158T3 for the 44 kDa protein. SEQ ID NO: 58 is a partial amino acid sequence for the 44kDa protein of PS158T3. SEQ ID NO: 59 is the DNA sequence of PS158X10 that encodes the 14 kDa protein. SEQ ID NO: 60 is the amino acid sequence of the 14 kDa protein of PS158X10. SEQ ID NO: 61 is the DNA sequence of PS185FF that encodes the 14 kDa protein.

SEQ ID NO: 62 is the amino acid sequence of the 14kDa protein ofPS185FF. SEQ ID NO: 63 is a partial DNA sequence of PS185FF for the 44 kDa protein. SEQ ID NO: 64 is a partial amino acid sequence for the 44 kDa protein of PS185FF. SEQ ID NO: 65 is a DNA sequence of PS185GG that encodes the 14 kDa protein. SEQ ID NO: 66 is the amino acid sequence of the 14kDa protein of PS185GG. SEQ ID NO: 67 is a DNA sequence of PS185GG for the 44 kDa protein. SEQ ID NO: 68 is the amino acid sequence for the 14kDa protein of PS185GG. SEQ ID NO: 69 is a DNA sequence of PS185L12 that encodes the 14 kDa protein. SEQ ID NO: 70 is the amino acid sequence of the 14kDa protein ofPS185L12. SEQ ID NO: 71 is a DNA sequence of PS185W3 that encodes the 14 kDa protein. SEQ ID NO: 72 is the amino acid sequence of the 14kDa protein of SP185W3.

SEQ ID NO: 73 is a DNA sequence of PS186FF that encodes the 14 kDa protein. SEQ ID NO: 74 is the amino acid sequence of the 14 kDa protein of PS186FF. SEQ ID NO: 75 is a DNA sequence of PS187F3 that encodes the 14 kDa protein. SEQ ID NO: 76 is the amino acid sequence of the 14 kDa protein of PS187F3. SEQ ID NO: 77 is a partial DNA sequence of PS187F3 for the 44 kDa protein. SEQ ID NO: 78 is a partial amino acid sequence for the 44 kDa protein of PS187F3. SEQ ID NO: 79 is the DNA sequence of PS187G1 which codes for the 14 kDa protein. SEQ ID NO: 80 is the amino acid sequence of the 14 kDa protein of PS187G1. SEQ ID NO: 81 is a partial DNA sequence of PS187G1 for the 44 kDa protein. SEQ ID NO: 82 is the partial amino acid sequence for the 44 kDa protein of PS187G1. SEQ ID NO: 83 is a DNA sequence of PS187L14 that encodes the 44 kDa protein.

SEQ ID NO: 84 is the amino acid sequence of the 14 kDa protein of PS187L14. SEQ ID NO: 85 is a partial DNA sequence of PS187L14 for the 44 kDa protein. SEQ ID NO: 86 is a partial amino acid sequence for the 44 kDa protein of PS187L14 SEQ ID NO: 87 is a DNA sequence of PS187Y2 encoding the 14 kDa protein. SEQ ID NO: 88 is the amino acid sequence of the 14 kDa protein of PS187Y2. SEQ ID NO: 89 is a partial DNA sequence of PS187Y2 for the 44 kDa protein. SEQ ID NO: 90 is the partial amino acid sequence for the 44 kDa protein of PS187Y2. SEQ ID NO: 91 is a DNA sequence of PS201G that encodes the 14 kDa protein. SEQ ID NO: 92 is the amino acid sequence of the 14 kDa protein of PS201G. SEQ ID NO: 93 is a DNA sequence of PS201 HH that encodes the 14 kDa protein. SEQ ID NO: 94 is the amino acid sequence of the PS201 HH protein of 14 kDa.

SEQ ID NO: 95 is a DNA sequence of PS201L3 that encodes the 4 kDa protein. SEQ ID NO: 96 is the amino acid sequence of the 14 kDa protein of PS201 L3. SEQ ID NO: 97 is a DNA sequence of PS204C3 that encodes the 14 kDa protein. SEQ ID NO: 98 is the amino acid sequence of the 14 kDa protein of PS204C3. SEQ ID NO: 99 is a DNA sequence of PS204G4 that encodes the 14 kDa protein. SEQ ID NO: 100 is the amino acid sequence of the 14 kDa protein of PS204G4. SEQ ID NO: 101 is a DNA sequence of PS204I11 that encodes the 14 kDa protein. SEQ ID NO: 102 is the amino acid sequence of the 14 kDa protein of PS204M 1. SEQ ID NO: 103 is a DNA sequence of PS204J7 that encodes the 14 kDa protein. SEQ ID NO: 104 is the amino acid sequence of the 14 kDa protein of PS204J7. SEQ ID NO: 105 is a DNA sequence of PS236B6 that encodes the 14 kDa protein.

SEQ ID NO :: 106 is the amino acid sequence of the 14 kDa protein of PS236B6. SEQ ID NO: 107 is a DNA sequence of PS242K10 that encodes the 14 kDa protein. SEQ ID NO: 108 is the amino acid sequence of the 14 kDa protein of PS242K10. SEQ ID NO: 109 is a partial DNA sequence of PS242K10 for the 44 kDa protein. SEQ ID NO: 110 is the partial amino acid sequence for the 44 kDa protein of PS242K10. SEQ ID NO: 111 is a DNA sequence of PS246P42 that encodes the 14 kDa protein. SEQ ID NO: 112 is the amino acid sequence of the 14 kDa protein of PS246P42. SEQ ID NO: 113 is a DNA sequence of PS69Q that encodes the 14 kDa protein. SEQ ID NO: 114 is the amino acid sequence of the 14 kDa protein of PS69Q. SEQ ID NO: 115 is a DNA sequence of PS69Q for the 44 kDa protein. SEQ ID NO: 116 is the amino acid sequence of the 14 kDa protein of PS69Q.

SEQ ID NO: 117 is the DNA sequence of KB54 that encodes the 14 kDa protein. SEQ ID NO: 118 is the amino acid sequence of the 14 kDa protein of KB54. SEQ ID NO: 119 is a DNA sequence of KR1209 that encodes the 14 kDa protein. SEQ ID NO: 120 is the amino acid sequence of the 14 kDa protein of KR1209. SEQ ID NO: 121 is the partial DNA sequence of KR1369 that encodes the 14 kDa protein. SEQ ID NO: 122 is the amino acid sequence of the 14 kDa protein of KR1369. SEQ ID NO: 123 is the DNA sequence of KR589 that encodes the 14 kDa protein. SEQ ID NO: 124 is the amino acid sequence of the 14 kDa protein of KR589. SEQ ID NO: 125 is a partial DNA sequence of KR589 for the 14 kDa protein. SEQ ID NO: 126 is the partial amino acid sequence for the 44 kDa protein of KR589. SEQ ID NO: 127 is a polynucleotide sequence for a gene designated 149B1-15-PO, which is optimized for expression in Zea mays.

This gene encodes an approximately 15 kDa toxin obtainable from PS149B1 which has been described in WO 97/40162. SEQ ID NO: 128 is a polynucleotide sequence for a gene designated 149B1-45-PO, which is optimized for expression in Zea mays. This gene encodes a toxin of about 45 kDa obtainable from PS149B1 which has been described in WO 97/40162. SEQ ID NO: 129 is a polynucleotide sequence for a gene designated 80JJ1-15-PO7, which is optimized for expression in corn. This is an alternative gene that encodes a toxin of approximately 15 kDa. SEQ ID NO: 130 is an amino acid sequence for a toxin encoded for the gene designated 80JJ1-15-PO7. SEQ ID NO: 131 is an oligonucleotide primer (15kfor1) used in accordance with the present invention (see example 20). SEQ ID NO: 132 is an oligonucleotide primer (45krev6) used in accordance with the present invention (see example 20). SEQ ID NO: 133 is the DNA sequence of PS201 L3 that encodes the 14 kDa protein. SEQ ID NO: 134 is an amino acid sequence for the 14 kDa protein of PS201L3. SEQ ID NO: 135 is a partial DNA sequence of PS201L3 for the 44 kDa protein. SEQ ID NO: 136 is a partial amino acid sequence for the 44 kDa protein of PS201 L3.

SEQ ID NO: 137 is a DNA sequence of PS187G1 that encodes the 14 kDa protein. SEQ ID NO: 138 is an amino acid sequence of the 14 kDa protein of PS187G1. SEQ ID NO: 139 is a DNA sequence of PS187G1 that encodes the 44 kDa protein. SEQ ID NO: 140 is an amino acid sequence of the 44 kDa protein of PS187G1. SEQ ID NO: 141 is a DNA sequence of PS201 HH2 that encodes the 14 kDa protein. SEQ ID NO: 142 is an amino acid sequence of the 14 kDa protein of PS201 HH2. SEQ ID NO: 143 is a partial DNA sequence of PS201HH2 for the 44 kDa protein. SEQ ID NO: 144 is a partial amino acid sequence for the 44 kDa protein of PS201 HH2. SEQ ID NO: 145 is the DNA sequence of KR1369 that encodes the 14 kDa protein. SEQ ID NO: 146 is the amino acid sequence of the 14 kDa protein of KR1369. SEQ ID NO: 147 is the DNA sequence of KR1369 that encodes the 44 kDa protein.

SEQ ID NO: 148 is an amino acid sequence of the 44 kDa protein of KR1369. SEQ ID NO: 149 is a DNA sequence of PS137A that encodes the 14 kDa protein. SEQ ID NO: 150 is an amino acid sequence of the 14 kDa protein of PS137A. SEQ ID NO: 151 is a DNA sequence of PS201V2 that encodes the 14 kDa protein. SEQ ID NO: 152 is an amino acid sequence of the 14 kDa protein of PS201V2. SEQ ID NO: 153 is a DNA sequence of PS207C3 that encodes the 14 kDa protein. SEQ ID NO: 154 is the amino acid sequence of the 14 kDa protein of PS207C3. SEQ ID NO: 155 is an oligonucleotide primer (F1 new) which is used according to the present invention (see example 22). SEQ ID NO: 156 is an oligonucleotide primer (R1new) which is used according to the present invention (see example 22). SEQ ID NO: 157 is an oligonucleotide primer (F2new) which is used according to the present invention (see example 22). SEQ ID NO: 158 is an oligonucleotide primer (R2new) which is according to the present invention (see example 22).

SEQ ID NO: 159 is a fusion protein of approximately 58 kDa. SEQ ID NO: 160 is a fusion gene that encodes the protein of SEQ ID NO: 159. SEQ ID NO: 161 is the 45kD5 'primer that is used according to the present invention (see example 27). SEQ ID NO: 162 is the 45 kD3'rc primer that is used in accordance with the present invention (see example 27). SEQ ID NO: 163 is the initiator 45 kD5'01 which is used according to the present invention (see example 27). SEQ ID NO: 164 is the initiator 45 kD5'02 that is used according to the present invention (see example 27). SEQ ID NO: 165 is the initiator 45 kD3'03 which is used according to the present invention (see example 27). SEQ ID NO: 166 is the initiator 45 kD3'04 that is used according to the present invention (see example 27).

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to two new classes of polynucleotide sequences as well as to novel pesticidal proteins encoded by these polynucleotides. In one embodiment, the proteins have a total length molecular weight of about 40-50 kDa. In specific embodiments exemplified here, these proteins have a molecular weight of approximately 43-47 kDa. In a second embodiment, the pesticidal proteins have a molecular weight of approximately 10-15 kDa. In specific embodiments exemplified here, these proteins have a molecular weight of 13-14 kDa. In preferred embodiments, a 40-50 kDa protein and a 10-15 kDa protein are used together, and the proteins in combination act as pesticides. Accordingly, the two kinds of proteins of the present invention can be defined as "binary toxins". As used herein, the term "toxin" includes any class of pesticidal protein. The present invention relates to polynucleotides that encode 40-50 kDa or 10-15 kDa toxins, polynucleotides that encode portions or fragments of total length toxins that retain pesticidal activity when used in combination, and polynucleotide sequences. that encode both types of toxins. In a preferred embodiment, these toxins are active against coleopteran pests, more preferably the corn rootworm and more preferably the western corn rootworm. Lepidoptera pests can also be targeted. Some specific toxins are exemplified here. For toxins that have a known amino acid sequence, the molecular weight is also known. Those skilled in the art will recognize that the apparent molecular weight of a protein, determined by gel electrophoresis, will sometimes differ from true molecular weight. Therefore, the reference herein to, for example, a 45 kDa protein or a 14 kDa protein will refer to proteins of about this size even if the true molecular weight is sometimes different. The present invention relates not only to the polynucleotides that encode these classes of toxins, but also to the use of these recombinant host polynucleotides that express the toxins. In another aspect, the present invention relates to the combined use of a toxin of about 40-50 kDa of the present invention, together with a toxin of about 10-15 kDa of the present invention to achieve highly effective control of pests, including coleoptera such as the rootworm of corn. For example, the roots of a plant can express both types of toxins. Therefore, pest control using the isolates, toxins and genes of the present invention can be achieved by a variety of methods known to those skilled in the art. These methods include, for example, the application of the B.t. to pests (or where they are), the application of recombinant microbes to pests (or the places where they are), and the transformation of plants with genes that code for the pesticide toxins of the present invention. The microbes that are used according to the present invention can be, for example, B.t., E. coli and / or Pseudomonas. Recombinant hosts can be prepared by those skilled in the art using conventional techniques. The materials necessary for these transformations have been described here or are, on the other hand, easily obtainable by those skilled in the art. The control of insects and other pests such as nematodes and mites can also be carried out by those skilled in the art using conventional techniques combined with the teachings provided herein. The novel classes of toxins and polynucleotide sequences provided herein are defined according to various parameters. A critical characteristic of the toxins described here is the pesticidal activity. In a specific modality, these toxins have activity against the coleopteran pests. Active toxins such as anti-lepidoptera are also covered. The toxins and genes of the present invention can be further defined by their amino acid and nucleotide sequences. The sequences of the molecules within each new class can be identified and defined in terms of their similarity or identity for certain exemplified sequences as well as in terms of the ability to hybridize with, or amplify with, certain probes and primers exemplified. The classes of toxins provided herein can also be identified based on their immunoreactivity with certain antibodies and based on their adherence to a generic formula. It is evident to one skilled in the art that the genes encoding the pesticidal proteins according to the present invention can be obtained by various means. The specific genes exemplified herein can be obtained from isolates deposited in a culture reservoir as described herein. These genes, and toxins of the present invention can also be constructed synthetically, for example, by the use of a gene synthesizer. The sequence of three 45 kDa exemplary toxins is provided as SEQ ID NOS: 11, 43 and 38. In preferred embodiments, toxins of this class have a sequence that fits the generic sequence presented as SEQ ID NO: 28. In preferred embodiments, toxins of this class will be adapted to the consensus sequence shown in Figure 1. With the teachings provided herein, those skilled in the art will be able to rapidly produce and use the various toxin and polynucleotide sequences of the classes novelties described here. The microorganisms useful in accordance with the present invention have been deposited in the permanent collection of the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, E.U.A. The crop replacement numbers of the strains deposited are the following: The insulated PS80JJ1 is available to the public by virtue of the granting of U.S. Patent No. 5,151,363 and other patents.

Another aspect of the present invention relates to novel isolates and to the toxins and genes obtainable from these isolates. The novel isolates have been deposited and are included in the previous list. These isolates have been deposited under conditions that ensure that access to crops will be available during the time that this patent application remains pending until it is determined by the Patent and Trademark Commissioner, for which it is authorized under 37 CFR 1.14 and 35 USC 122. Deposits are available if required by foreign patent laws in countries in which the counterparts of the present application, or their progeny, have been submitted. However, it should be understood that the availability of a deposit does not constitute a license to carry out the present invention by repealing the patent rights guaranteed by governmental action. In addition, the present crop deposits will be stored and made available to the public in accordance with the conditions of the Budapest Treaty for Deposits of Microorganisms, that is, they will be stored with all the necessary care to keep them viable and unpolluted for a period of at least five years after the most recent request for the provision of a sample of a deposit, and in any case, for a period of at least 30 (thirty) years after the date of deposit or during the life of any patent in force that could be granted by making the crops known. The depositor recognizes the duty to replace the deposit (s) if the depositary is unable to provide a sample upon being required, due to the condition of the deposit (s). All restrictions on the availability to the public of the present crop deposits will be irrevocably removed upon granting a patent that discloses them. Following is a table that provides characteristics of some isolates of B.t. which are useful in accordance with the present invention.

TABLE 1 Description of strains B.t. Toxic for Coleoptera Other isolates of the present invention can also be characterized in terms of the configuration and location of the toxin inclusions.

Toxins, genes and probes The polynucleotides of the present invention can be used to form complete "genes" for coding proteins or peptides in the desired host cell. For example, as one skilled in the art will recognize, some of the polynucleotides in the attached sequence listing are shown without interruption codons. Also, the present polynucleotides can be appropriately placed under the control of a promoter in a host of interest, according to what is known in the art in the art. As will be readily recognized by one skilled in the art, DNA typically exists in a double-stranded form. In this arrangement, one chain is complementary to another chain and vice versa. By replicating the DNA in a plant (for example) additional complementary strands are produced, the "coding strand" is often used in the art to refer to the strand that adheres with the antisense strand. The mRNA is transcribed from the "antisense" strand of the DNA. The "sense" or "coding" chain has a series of codons (a codon is three nucleotides that can be read three at a time to obtain a particular amino acid) that can be read as an open reading frame (ORF) to form a protein or a peptide of interest. In order to express a protein in vivo, a DNA strand is typically transcribed into a complementary strand of mRNA that is used as a model for the protein. Therefore, the present invention includes the use of the exemplified polynucleotides shown in the attached sequence listing and / or complementary strands. RNA and ANP (peptide nucleic acids) which are functionally equivalent to the exemplified DNA are included in the present invention.

The toxins and genes of the present invention can be identified and obtained for example by the use of oligonucleotide probes. These probes are detectable nucleotide sequences which can be detected by virtue of an appropriate tag or which can be made inherently fluorescent as described in the international application No. WO 93/16094. The probes (and the polynucleotides of the present invention) can be DNA, RNA or ANP. In addition to adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U); for RNA molecules), the synthetic probes (and polynucleotides) of the present invention may also have inosine (a neutral base capable of pairing with all four bases, sometimes used in place of a mixture of all four bases in probes synthetic). Therefore, when a degenerate, synthetic oligonucleotide is mentioned herein, and "n" is used generically, "n" can be G, A, T, C, or inosine. The ambiguity codes used herein are in accordance with standard IUPAC naming conventions such as those in the presentation of the present application (e.g., R means A or G, Y means C or T, etc.). As is well known in the art, if the probe and nucleic acid sample molecules hybridize to form a strong bond between the two molecules, it can reasonably be assumed that the probe and the sample have substantial homology / similarity / identity. Preferably, hybridization is carried out under stringent conditions, by techniques well known in the art, as described in, for example, Keller, G. H., M.M. Manak (1978) DNA Probes, Stockton Press, New York, NY, p. 169-170. For example, as indicated herein, high stringency conditions can be effected here by first washing with 2 x SSC (Standard Saline Citrate) /0.1% SDS (Sodium Dodecyl Sulfate) for 15 minutes at room temperature. Two washings are typically carried out. The highest stringency can be achieved by decreasing the salt concentration and / or raising the temperature. For example, the wash described above may be followed by two washes with 0.1 x SSC / 0.1% SDS for 15 minutes at room temperature followed by subsequent washes with 0.1 x SSC / 0.1% SDS for 30 minutes each at 55 ° C. These temperatures can be used with other hybridization and washing protocols set forth herein and known to those skilled in the art (SSPE can be used as the salt instead of SSC, for example). The 2 x SSC / 0.1% SDS can be prepared by adding 50 ml of 20 x SSC and 5 ml of 10% SDS to 445 ml of water. The 20 x SSC can be prepared by combining NaCl (175.3 g / 0.150 M), sodium citrate (88.2 g / 0.015 M), and water to complete 1 liter, followed by pH adjustment at 7.0 with 10 N NaOH. 10% SDS can be prepared by dissolving 10 g of SDS in 50 ml of autoclave water, diluting to 100 ml and forming aliquots. Detection of the probe provides a means to determine in a known manner whether hybridization has occurred. Said probe analysis provides a rapid method for identifying toxin-encoding genes of the present invention. The nucleotide segments that are used as probes according to the invention can be synthesized using a DNA synthesizer and conventional methods. These nucleotide sequences can also be used as PCR primers to amplify the genes of the present invention. Hybridization characteristics of a molecule can be used to define the polynucleotides of the present invention. Therefore, the present invention includes polynucleotides (and / or their complements, preferably their complements) that hybridize with a polynucleotide exemplified herein (such as the DNA sequences included in SEQ ID NOS 46-166). As used herein, "stringency" conditions for hybridization refer to conditions that achieve the same or nearly the same degree of hybridization specificity as the conditions employed by the present applicants. Specifically, hybridization of immobilized DNA in Southern blots with 32 P-labeled gene-specific probes was carried out with conventional methods (Maniatis, T., Fritsch EF, J. Sambrook (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). In general, hybridization and subsequent washings were carried out under conditions of stringency that allow the detection of target sequences (eg, with homology to the PS80JJ1 toxin genes). For the double-stranded DNA gene probes, hybridization was carried out overnight at 20-25 ° C below the melting temperature (Tm) of the DNA hybrid in 6 x SSPE, 5X of Denhardt's solution, 0.1% SDS, 0.1 mg / ml denatured DNA. The melting temperature is described by the following formula (Beltz, GA, KA Jacobs, TH Eickbush, PT Cherbas, and FC Kafatos [1983] Methods of Enzymology, R. Wuy, L. Grossman and K. Moldave [eds] Academic Press , New York 100: 266-285): Tm = 81.5 ° C + 16.6 Log [Na +] + 0.41 (% G + C) - 0.61 (% formamide) -600 / duplex length in base pairs. The washes are typically carried out in the following manner: (1) Twice at room temperature for 15 minutes in 1 X SSPE, 0.1% SDS (low stringency wash) (2) Once at Tm-20 ° C for 15 minutes in 0.2 X SSPE, 0.1% SDS (moderate stringency wash). For oligonucleotide probes, hybridization was carried out overnight at 10-20 ° C below the melting temperature (Tm) of the hybrid in 6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg / ml of denatured DNA. The Tm for the oligonucleotide probes was determined by the following formula: Tm (° C) = 2 (number of base pairs T / A) + (number of base pairs G / C) (Suggs, SV, T. Miyake, EH Kawahime, MJ Johnson, K.

Itakura, and R.B. Wallace [1981] ICN-UCLA Symp. Dev. Biol. Using Purified Genes, D.D. Brown [ed] Academic press, New York 23; 683-693).

Washes were typically carried out in the following manner: (1) Twice at room temperature for 15 minutes in 1 X SSPE, 0.1% SDS (low stringency wash). (2) Once at annealing temperature for 15 minutes in 1 X SSPE, 0.1% SDS (moderate stringency wash). The toxins obtainable from PS149B1 isolates, PS167H2, and PS80JJ1 have been characterized as having at least one of the following characteristics (novel toxins of the present invention can be characterized similarly with this and other identification information set forth herein): (a) said toxin is encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence selected from the group consisting of: DNA encoding SEQ ID NO: 2, DNA encoding SEQ ID NO: 4, DNA encoding SEQ ID No. 6, SEQ ID NO: 8, SEQ ID NO: 10, DNA encoding SEQ ID NO: 11, SEQ ID NO: 12, DNA encoding SEQ ID NO: 13, SEQ ID NO 14, DNA encoding SEQ ID NO 15 , DNA encoding SEQ ID NO: 16, DNA encoding SEQ ID NO: 17, DNA encoding SEQ ID NO: 18, DNA encoding SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO : 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, DNA encoding a plaguici portion. of SEQ ID NO: 28, SEQ ID NO, 37, DNA encoding SEQ ID NO: 38, SEQ ID NO: 42 and DNA encoding SEQ ID NO: 43; b) said toxin immunoreacts with an antibody to a pesticide toxin of about 40-50 kDa, or a fragment thereof, from the Bacillus thuringiensis isolate selected from the group consisting of PS80JJ1 having the identification characteristics of NRRL B- 18679, PS149B1 having the identification characteristics of NRRL B-21553 and PS167H2 having the identification characteristics of NRRL B-21544; c) said toxin is encoded by a nucleotide sequence in > to which a portion of said nucleotide sequence can be amplified by PCR using a pair of primers selected from the group consisting of SEQ ID NOS: 20 and 24 to produce a fragment of approximately 495 bp, SEQ ID NOS: 20 and 25 to produce a fragment of approximately 594 bp, SEQ ID NOS: 21 and 24 to produce a fragment of approximately 471 bp, and SEQ ID NOS: 21 and 25 to produce a fragment of approximately 580 bp; d) said toxin comprises a pesticide portion of the amino acid sequence shown in SEQ. ID NO: 28; e) said toxin comprises an amino acid sequence having at least about 60% homology with a pesticide portion of an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO : 15, SEQ ID NO: 38 and SEQ ID NO: 43; f) said toxin is encoded by a nucleotide sequence which hybridizes under stringent conditions with a nucleotide sequence selected from the group consisting of DNA encoding SEQ ID NO: 3, DNA encoding SEQ ID NO: 5, DNA encoding SEQ ID NO: 7, DNA encoding SEQ ID NO: 32, DNA encoding SEQ ID NO: 36, and DNA encoding SEQ ID NO: 41; g) said toxin immunoreacts with an antibody to a pesticidal toxin of about 10-15 kDa, or a fragment thereof, from the Bacillus thuringiensis isolate selected from the group consisting of PS80JJ1 having the NRRL-identifying characteristics B-18679, PS149B1 having the identification characteristics of NRRL B-21553 and PS167H2 having the identification characteristics of NRRL B-21554; h) said toxin is encoded by a nucleotide sequence in which a portion of said nucleotide sequence can be amplified by PCR using the primer pair of SEQ ID NO: 29 and SEQ ID NO: 33; and i) said toxin comprises an amino acid sequence having at least about 60% homology with an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 the pesticide portions of SEQ ID NO: 32, the pesticidal portions of SEQ ID NO: 36, and the pesticidal portions of SEQ ID NO: 41.

Modification of genes and toxins The genes and toxins useful according to the present invention include not only the full length sequences specifically exemplified, but also the portions and / or fragments (including internal and / or terminal deletions compared to full length molecules ) of these sequences, variants, mutants, chimerics and fusions thereof. The proteins of the present invention may have substituted amino acids provided they retain the characteristic pesticidal activity of the proteins specifically exemplified herein. "Variant" genes have nucleotide sequences that encode the same toxins or that encode toxins that have pesticidal activity equivalent to an exemplified protein. As used herein, the term "equivalent toxins" refers to toxins that have the same or essentially the same biological activity against target pests as the toxins exemplified. As used herein, with reference to "essentially the same" sequence refers to sequences having substitutions, deletions, additions, or amino acid insertions, which do not materially affect the pesticidal activity. Fragments that retain pesticidal activity are also included in this definition. Fragments and equivalents that retain the pesticidal activity of the exemplified toxins would be within the scope of the present invention. The toxins and / or equivalent genes that code for these equivalent toxins can be derived from the B.t. of wild type and / or of other wild-type recombinant organisms using the teachings provided herein. Other Bacillus species can be used, for example, as isolates of origin. Variations of genes can be easily constructed using conventional techniques to effect, for example, point mutations. Also, U.S. Patent No. 5,605,793, for example, discloses methods for generating additional molecular diversity by the use of DNA regeneration after random fragmentation. Variant genes can be used to produce variant proteins; recombinant hosts can be used to produce the variant proteins. Fragments of full length genes can be prepared using commercially available exonucleases or endonucleases or according to conventional procedures. For example, enzymes such as FIA / 31 or site-directed mutagenesis can be used to systematically cut nucleotides from the ends of these genes. Also, genes encoding active fragments can be obtained using a variety of restriction enzymes. Proteases can be used to directly obtain active fragments of these toxins. There are a variety of methods for obtaining the pesticidal toxins of the present invention. For example, the antibodies to the pesticidal toxins described and claimed herein may be used to identify and isolate other toxins from a mixture of proteins. Specifically, antibodies can be created for portions of the toxins that are more constant and more distinct from the other B.t. toxins. These antibodies can be used to specifically identify equivalent toxins with the characteristic activity by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), or Western blotting. Antibodies for the toxins described herein, or for equivalent toxins, or fragments of these toxins, can be easily prepared using conventional procedures. The genes that code for these toxins can then be obtained from the microorganisms of origin. Due to the redundancy of the genetic code, a variety of different DNA sequences can encode the amino acid sequences described herein. It is within the experience of one skilled in the art, the ability to create these alternative DNA sequences encoding the same, or essentially the same toxins. These variant DNA sequences are within the scope of the present invention. Some toxins of the present invention have been specifically exemplified herein. Because these toxins are simply examples of the toxins of the present invention, it will be readily apparent that the present invention comprises variant or equivalent toxins (and nucleotide sequences that encode equivalent toxins) that have the same or similar activity as that of the toxin. exemplified toxin. Equivalent toxins will have amino acid similarity (and / or homology) to an exemplified toxin. The amino acid identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80% and even more preferably higher than 90%, and may be higher than 95%. The preferred polynucleotides and proteins of the present invention can also be defined in terms of more particular identity and / or similar scales. For example, the identity and / or similarity can be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% compared to a sequence exemplified herein. Unless otherwise specified, as used herein, percent identity and / or sequence similarity of the two nucleic acids is determined using the algorithm of Karlin and Aitschul (1990), Proc. Nati Acad. Sci., USA 87: 2264-2268, modified as in Karlin and Altschul (1993), Proc. Nati Acad. Sci., USA 90: 5873-5877. Said algorithm is incorporated in the NBLAST and XBLAST programs of Altschul et al. (1990), J. Mol. Biol. 215: 402-410. The BLAST nucleotide investigations are carried out with the NBLAST program, result = 100, word length = 12, to obtain nucleotide sequences with the desired identity percentage. To obtain alignments for comparative purposes, Gapped BLAST is used as described in Altschul et al. (1997), Nucí. Acids Res. 25: 3389-3402. When the BLAST and Gapped BLAST programs are used, the default parameters of the respective programs (NBLAST and XBLAST) are used. See http: //www.ncbi.nih.qov. The results can also be calculated using the methods and algorithms of Crickmore and others described in the previous section of Background of the Invention. The amino acid homology will be the highest in critical regions of the toxin that count for biological activity or that are involved in the determination of the three-dimensional configuration, which ultimately is responsible for the biological activity. In this regard, certain amino acid substitutions are acceptable and can be expected if these substitutions are in regions that are not critical for activity or are conservative amino acid substitutions that do not affect the three-dimensional configuration of the molecule. For example, amino acids can be placed in the following classes: non-polar, polar non-charged, basic and acidic. Conservative substitutions by which an amino acid of one kind is replaced with another amino acid of the same type, come within the scope of the present invention with the proviso that the substitution does not materially alter the biological activity of the compound. Table 2 provides a list of the examples of amino acids that belong to each class.

TABLE 2 In some cases, non-conservative substitutions can also be made. The critical factor is that these substitutions should not deviate significantly from the biological activity of the toxin. As used herein, reference to "isolated" polynucleotides and / or "purified" toxins refers to these molecules when they are not associated with the other molecules with which they would be in nature; These terms would include their use in plants. Therefore, the reference to "isolated" and / or "purified" means that the "hand of man" is involved in the manner described here. Synthetic genes that are functionally equivalent to the toxins of the present invention can also be used to transform hosts. Methods for the production of synthetic genes can be found, for example, in US Pat. No. 5,380,831.

Transgenic Hosts The toxin-encoding genes of the present invention can be introduced into a wide variety of microbial or plant hosts. In preferred embodiments, expression of the toxin gene results, directly or indirectly, in the intracellular production and maintenance of pesticidal proteins. When transgenic / recombinant / transformed host cells are ingested by the pests, said pests will ingest the toxin. This is the preferred way in which the contact of the pest with the toxin occurs. The result is the control of (annihilating or sickening) the pest. Alternatively, suitable microbial hosts, for example Pseudomonas such as P. fluorescens, may be applied to the pest site where some of them may proliferate and be ingested by the target pests. The microbe that harbors the toxin gene can be treated under conditions that prolong the activity of the toxin and stabilize the cell. The treated cell, which retains the toxic activity, can then be applied to the environment of the target pest. In preferred embodiments, recombinant cells and plants are used. The preferred plants (and plant cells) are wheat and / or corn. When the toxin gene of B.t. through an appropriate vector in the microbial host, and said host is applied to the living environment, certain host microbes should be used. Host microorganisms that are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and / or rhizoplane) of one or more crops of interest are selected. Host microorganisms are selected that are capable of successfully competing in the particular environment (crops and other inhabitants of insects) with wild-type microorganisms, which provide stable maintenance and expression of the gene that expresses the polypeptide pesticide and, conveniently, provide improved protection of the pesticide against deactivation and environmental degradation.

It is known that there is a large number of microorganisms that inhabit the phylloplane (the surface of the leaves of plants) and / or the rhizosphere (the soil surrounding the roots of plants) of a wide variety of important crops. These microorganisms include bacteria, algae and fungi. Particularly interesting are microorganisms such as bacteria, for example, from the genera Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi, particularly yeasts, for example from the genera Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula and Aureobasidium. Species of phytosphere bacteria such as Pseudomonas syringae, Pseudomoans fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacterium tumefaciens, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus, and Azotobacter vinlandii are of particular interest.; and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces rosei, S.pretoriensis, S. cerevisiae, Sporobolomyces roseus, S. Odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of particular interest are pigmented microorganisms. A wide variety of forms of introduction of B.t. gene is available that encodes a toxin in the target host under conditions that allow for stable maintenance and expression of the gene.

These methods are well known to those skilled in the art and have been described, for example, in U.S. Patent No. 5,135,867, which is incorporated herein by reference.

Treatment of cells As mentioned above, B.t .. or recombinant cells expressing a B.t .. toxin can be treated to prolong the activity of the toxin and stabilize the cell. The pesticide microcapsule that is formed comprises the B.t. toxin within a cellular structure that has been stabilized and that will protect the toxin when the microcapsule is applied to the environment of the target pest. Suitable host cells can include prokaryotes or eukaryotes, normally limited to those cells that do not produce substances toxic to higher organisms, such as mammals. However, organisms that produce substances toxic to higher organisms, where the toxic substances are unstable or the level of application is sufficiently low could be used to avoid any possibility of toxicity to a mammalian host. As hosts, prokaryotes and lower eukaryotes, such as fungi, will be of particular interest. The cell will usually be intact and will have substantially the proliferative form when treated, although in some cases, spores may be employed.

The treatment of the microbial cell, for example a microbe containing the Bt toxin gene, can consist of chemical or physical means, or a combination of chemical and / or physical means, provided that the technique does not affect detrimentally the properties of the toxin, nor diminish the cellular capacity of protection of the toxin. Examples of chemical reagents are halogenating agents, particularly halogens of no. atomic 17-80. More particularly, iodine can be used under light conditions and for a sufficient period of time to obtain the desired results. Other suitable techniques include treatment with aldehydes, such as glutaraldehyde, antiinfectants, such as zephiran chloride and cetylpyridinium chloride; alcohols such as isopropyl alcohol and ethanol; several histological fixatives, such as Lugol's iodine, Bouin's fixative, various acids and Helly's fixative (See, Humason, Gretchen, L. Animal Tissue Techniques, W.H. Freeman and Company, 1967); or a combination of physical agents (heat) and chemicals that preserve and prolong the activity of the toxin produced in the cell when the cell is administered to the host environment. Examples of physical means are short wavelength radiation such as gamma radiation and X radiation, freezing, UV irradiation, lyophilization and the like. Methods for the treatment of microbial cells have been described in U.S. Patent Nos. 4,695,455 and 4,695,462, which are incorporated herein by reference. The cells will generally have improved structural stability that will improve resistance to environmental conditions. When the pesticide is in a proforma, the method of treating the cells should be selected so as not to inhibit the pro-forma process for the mature form of the pesticide by the target pest pathogen. For example, formaldehyde will cross-link proteins and could inhibit the process of the proforma of a polypeptide pesticide. The treatment method should retain at least a substantial portion of the bioavailability or bioactivity of the toxin. Among the characteristics that are of particular interest for selecting a host cell for production purposes, are the ease of introducing the Bt. Gene into the host, the availability of the expression systems, the efficiency of expression, the stability of the pesticide in the host, and the presence of auxiliary genetic capabilities. The characteristics of interest for use as a pesticide microcapsule include protective qualities for the pesticide, such as thick cell walls, pigmentation and packaging or intracellular formation of the inclusion bodies; survival in aqueous environments; lack of toxicity in mammals; attraction for the pests to ingest it; ease of extermination and fixation without deterioration for the toxin; and similar. Other considerations include ease of formulation and handling, economy, storage stability, and the like.

Cell development The cell host that contains the B.t. insecticide gene. it can be grown in any convenient nutrient medium, preferably one in which the DNA construct provides a selective advantage, providing a selective medium such that substantially all of the cells retain the B.t gene. These cells can then be harvested in a conventional manner. Alternatively, the cells can be treated before harvesting. The B.t. cells of the invention can be grown using conventional fermentation techniques and means in the art. Upon completion of the fermentation cycle the bacteria can be harvested by first separating the spores and the crystals from the fermentation broth by means well known in the art. The recovered B.t. spores and crystals can be formulated into a wettable powder, a liquid concentrate, granules or other formulations by the addition of surfactants, dispersants, inert carriers and other components to facilitate handling and application for particular target pests. All of these formulation and application procedures are well known in the art.

Formulations The granules that are used as formulated bait containing an attractant element and spores and crystals of the B.t. isolates, or recombinant microbes comprising the genes obtainable from the B.t. isolates described herein, can be applied to the soil. The formulated product can also be applied as a seed coat or root treatment or as a total treatment of the plant in later stages of the crop cycle. Treatments of plants and soil of Bt cells can be used as wettable powders, granules or powders, mixing with various inert materials, such as inorganic minerals (phyllosilicates, carbonates, sulphates, phosphates and the like) or botanical materials (tussa) of powdered corn, rice husks, walnut shells and the like). The formulations may include spreader-binding aids, stabilizing agents, other pesticidal additives or surfactants. The liquid formulations can be aqueous or non-aqueous based and can be used as foams, gels, suspensions, emulsifiable concentrates, or the like. The ingredients can include rheological agents, surfactants, emulsifiers, dispersants or polymers. As will be appreciated by those skilled in the art, the concentration of pesticide will vary widely depending on the nature of the particular formulation, especially if it is a concentrate if it is to be used directly. The pesticide will be present at least 1% by weight and can be 100% by weight. The dry formulations will have from about 1-95% by weight of the pesticide, while the liquid formulations will generally constitute from about 1-60% by weight of the solids in the liquid phase. The formulations will generally have from about 102 to about 10 4 cells / mg. These formulations may be administered at approximately 50 mg (liquid or dry) at a rate of 1 kg or more per hectare. The formulations can be applied to the environments where the pest is found, for example to the soil and foliage, by spraying, sprinkling, watering or the like.

Mutants Mutants of the isolates of the invention can be prepared by methods well known in the art. For example, an asporogenous mutant can be obtained through mutagenesis by ethylmethane sulfonate (EMS) from an isolate. Mutants can be prepared using ultraviolet light and nitrosoguanidine by methods that are well known in the art. A smaller percentage of the asporogenic mutants will remain intact and will not be used for prolonged fermentation periods; these strains are designated lysis minus (-). Less lysis strains can be identified by selection of asporogenic mutants in shaking flask media and those mutants that remain intact and contain toxin crystals at the end of fermentation can be selected. The less (-) lysis strains are appropriate for a cell treatment process that will provide an encapsulated toxin protein, protected. To prepare a phage-resistant variant of said asporogenic mutant, an aliquot of the phage lysate is disseminated on nutrient agar and allowed to dry. Then a phage-sensitive bacterial strain is deposited directly on the dried lysate and allowed to dry. The plates are incubated at 30 ° C. The plates are then incubated for 2 days and, in that time, numerous colonies develop on the agar. Some of these colonies are collected and subcultured on nutrient agar plates. These seemingly resistant cultures are tested to verify resistance by cross bands with the phage lysate. A line of phage lysate is deposited on the plate and allowed to dry. The presumably resistant cultures are then deposited in lines through the phage line after incubation overnight at 30 ° C. Phage resistance is then reconfirmed by depositing a layer of the resistant culture on a nutrient agar plate. The sensitive strain is also deposited in the same way to serve as a positive control. After drying, a drop of phage lysate is placed in the center of the plate and allowed to dry. The resistant cultures did not show lysis in the area in which the phage lysate had been placed after incubation at 30 ° C for 24 hours. Following are examples that illustrate the procedures for practicing the invention. These examples should not be considered as limiting. All percentages are given by weight and all proportions of solvent mixture are given by volume unless otherwise indicated.

EXAMPLE 1 Culture of B.t. isolates of the invention A subculture of the B.t. isolates, or mutants thereof, can be used to inoculate the following medium, a peptone, glucose, and salts. Bacto peptone 7.5 g / l Glucose 1.0 g / l KH2PO4 3.4 g / l K2HPO4 4.35 g / l Saline solution 5.0 ml / l CaCl2 solution 5.0 ml / l pH 7.2 Solution of salts (100 ml) MgSO47H2O 2.46 g MnSO4 H2O 0.04 g ZnSO47H2O 0.28 g FeSO47H2O 0.40 g CaCl2 solution (100 ml) CaCI22H2O 3.66 g The salt solution and the CaCl2 solution are sterilized by filtration and added to the autoclave and in broth at the time of inoculation. The flasks are incubated at 30 ° C on a rotary shaker at 200 rpm for 64 hours. The above procedure can be easily carried out on a larger scale to larger thermenators by methods that are known in the art. The spores and / or crystals of B.t., obtained in the above fermentation, can be isolated by methods that are well known in the art. A frequently used method consists in subjecting the harvested fermentation broth to separation techniques, for example, centrifugation.

EXAMPLE 2 Activity of the sporulated cultures of Bacillus thuringiensis on the corn rootworm Liquid cultures of PS80JJ1, PS149B1 or PS167H2 were grown for sporulation in shake flasks and granulated by centrifugation. Culture pellets were resuspended in water and tested for activity against the corn rootworm in top-loading bioassays as described above. The amounts of 14 kDa and 44.3 kDa proteins present in the culture granules were estimated by densitometry and used to calculate the specific activity expressed as Clso- The activity of each native B. thuringiensis strain is presented in Table 3 (Bioassay top loading WCRW of strains fí. _.).

TABLE 3 Bioensavo top load WCRW of strains B.t. orcenta e e morta a en os os m a ta is provided for the control.

EXAMPLE 3 Protein purification for the 80 kDa 80JJ1 protein One gram of lyophilized powder of 80JJ1 was suspended in 40 ml of pH buffer containing 80 mM Tris-Cl at pH 7.8, 5 mM EDTA, 100 μM PMSF, 0.5 μg / ml Leupeptin, 0.7 μg / ml Pepstatin, and 40 μg / ml of Bestatin. The suspension was centrifuged and the resulting supernatant was discarded. The granules were washed five times using 35-40 ml of the above pH buffer for each wash. The washed granules were resuspended in 10 ml of 40% NaBr, 5 mM EDTA, 100 μM of PMSF, 0.5 μg / ml of Leupeptin, 0.7 μg / ml of Pepstatin, and 40 μg / ml of Bestatin and placed on a Stirring platform for 75 minutes. The suspension of NaBr was centrifuged, the supernatant was extracted, and the granules were treated a second time with 40% Nabr, 5 mM EDTA, 100 μM PMSF, 0.5 μg / ml Leupeptin, 0.7 μg / ml Pepstatin, and 40 μg / ml Bestatin as above. The supernatants (40% soluble in NaBr) were combined and dialysed against 10 mM CAPS at pH 10.0 1 mM EDTA at 4 ° C. The dialyzed extracts were centrifuged and the resulting supernatant was extracted. The granules (40% dialysis granules with NaBr) were suspended in 5 ml of H2O and centrifuged. The resulting supernatant was extracted and discarded. The washed granules were washed a second time in 10 ml of H2O and centrifuged as before. The washed granules were suspended in 1.5 ml of H2O and contained mainly three protein bands with apparent mobilities of approximately 47 kDa, 45 kDa and 15 kDa, when analyzed using SDS-PAGE. In this purification step, the 40% suspended NaBr dialysis granules contained approximately 21 mg / ml protein, as determined by the Lowry assay. The proteins in the suspension of granules were separated using SDS-PAGE (Laemlli, R.U. [1970] Nature 227; 680) in 15% acrylamide gels. The separated proteins were then electrophoretically blotted onto a PVDF membrane (Millipore corp) in 10 mM CAPS at pH 11.0, 10% MeOH at a constant of 100 V. After one hour the PVDF membrane was rinsed briefly in water and it was placed for 3 minutes in 0.25% Coomassie blue R-250, 50% methanol, 5% acetic acid. The stained membrane is stained in 40% MeOH, 5% acetic acid. The faded membrane was air dried at room temperature (LeGendre et al. [1989] in A Practical Guide to Protein Purification for Microsequencing, P. Matsudira, ed., Academic Press, New York, NY). The membrane was sequenced using Edman automatic degradation in gas phase (Hunkapillar, M.W., R.M. Hewick, W.L. Dreyer, L.E. Hood [1983] Meth. Enzymol, 91: 399). The amino acid analysis revealed that the N-terminal sequence of the 45 kDa band was as follows: Met-Leu-Asp-Thr-Asn (SEQ ID NO: 1). The 47 kDa band was also analyzed and the N-terminal amino acid sequence which was the same 5-amino acid sequence as SEQ ID NO: 1 was determined. Therefore, the amino acid sequences The N-terminus of the 47 kDa peptide and the 45 kDa peptide were identical. This amino acid sequence also corresponds to a sequence obtained from a 45 kDa peptide obtained from spore / crystal powders of PS80JJI, using another purification protocol with the following N-terminal sequence: Met-Leu-Asp-Thr -Asn-Lys-Val-Tyr-Glule-Ser-Asn-Leu-Ala-Asn-Gly-Leu-Tyr-Thr-Ser-Thr-Tyr-Leu-Ser-Leu (SEQ ID NO: 2).

EXAMPLE 4 Purification of the 14 kDa peptide of PS80JJ1 0. 8 ml of the white dialysis suspension (approximately 21 mg / ml) containing the 47 kDa, 45 kDa peptides and the 15 kDa peptide, were dissolved in 10 ml of 40% NaBr, and 0.5 ml of 100 ml of EDTA. After about 18 hours (overnight), a white opaque suspension was obtained. This was collected by centrifugation and discarded. The supernatant was concentrated in a Centricon-30 (Amicon Corporation) to a final volume of approximately 15 ml. The filtered volume was washed with water by filtered dialysis and incubated on ice, eventually forming a milky white suspension. The suspension was centrifuged and the granules and the supernatant were separated and retained. The granules were then suspended in 1.0 ml of water (approximately 6 mg / ml). The granules contained substantially pure 15 kDa protein when analyzed by SDS-PAGE. It was determined that the N-terminal amino acid sequence was: Ser-Ala-Arg-Glu-Val-His-lle-Glu-lle-Asn-Asn-Thr-Arg-His-Thr-Leu-GIn-Leu-Glu-Ala-Lys-Thr-Lys-Leu (SEQ ID NO: 3).

EXAMPLE 5 Protein bioassay A preparation of the insoluble fraction of the 80JJI dialyzed NaBr extract containing the 47 kDa, 45 kDa and 15 kDa peptides was bioassayed against the western corn rootworm and found to exhibit significant toxin activity .

EXAMPLE 6 Protein purification and characterization of the 45 kDa PS149B1 protein The granule P1 was resuspended with two volumes of deionized water per unit of wet weight, and to this was added nine volumes of aqueous sodium bromide at 40% (w / w). This and the subsequent operations were carried out on ice at 4-6 ° C. After 30 minutes, the suspension was diluted with 36 volumes of cold water and centrifuged at 25,000 x g for 30 minutes to provide a granule and a supernatant. The resulting granule was resuspended in 1-2 volumes of water and a layer was deposited on a 20-40% (w / w) sodium bromide gradient at 8,000 x g for 100 minutes. The layer band of approximately 32% (w / w) of sodium bromide (the "inclusions", or INC) was recovered and dialysed overnight against water using a dialysis membrane with a molecular weight cutoff. 6-8 kDa. The particulate material was recovered by centrifugation at 25,000 x g, resuspended in water, and aliquoted and tested for the protein by the Lowry method and by SDS-PAGE. The resulting supernatant was concentrated 3 to 4 times using Centricon-10 concentrators, and then dialyzed overnight against water using a dialysis membrane with a cut of P.M. of 6-8 kDa. The particulate material was recovered by centrifugation at 25,000 x g, resuspended in water, and aliquoted and tested for the protein by the Lowry method and by SDS-PAGE. This fraction was called P1. P2 Peptides in the granule suspension were separated using SDS-PAGE (Laemlli, R.U. supra), in 15% acrylamide gels. The separated proteins were then electrophoretically blotted onto a PVDF membrane (Millipore Corp.) in 10 mM CAPS at pH 11.0, 10% MeOH at a constant of 100 V. After one hour the PVDF membrane was briefly rinsed in water and it was placed for 3 minutes in 0.25% Coomassie blue R-250, 50% methanol, 5% acetic acid. The stained membrane was destined in 40% MeOH, 5% acetic acid. The faded membrane was air dried at room temperature (LeGendre et al., Supra). The membrane was sequenced using Edman automatic gas phase degradation (Hunkapillar, et al., Supra).

The analysis of the proteins indicated the presence of two main polypeptides, with molecular weights of 47 kDa and 14 kDa. Molecular weights were measured against conventional polypeptides of known molecular weight. This process provides only an estimate of true molecular weight. The 47 kDa band of PS149B1 migrated on SDS-PAGE in an indistinguishable manner from the 47 kDa protein of PS80JJ1. Also, the 14 kDa band of PS149B1 migrated in SDS-PAGE in an indistinguishable manner from 14kDa bands of PS167H2 and PS80JJ1. Apart from these two polypeptides, which were considered to constitute 25-35% (47 kDa) and 33-55% (15 kDa) of the Coomassie dye material respectively, there may be minor bands, including those of a PM estimated at 46 kDa, and 70 kDa. Protein analysis indicated that the INC fraction contained a single polypeptide with a MW of 47 kDa, and that the P1.P2 fraction contained a single polypeptide with a MW of 14 kDa. These polypeptides were recovered in yields greater than 50% from P1. The N-terminal amino acid sequence for the purified 47 kDa protein of PS149B1 is: Met-Leu-Asp-Thr-Asn-Lys-Val-Tyr-Glu-lle-Ser-Asn-His-Ala-Asn-Gly- Leu-Tyr-Ala-Ala-Thr-Tyr-Leu-Ser-Leu (SEQ ID NO: 4). The N-terminal amino acid sequence for the 14 kDa purified protein of PS149B1 is: Ser-Ala-Arg-Glu-Val-His-lle-Asp-Val-Asn-Asn-Lys-Thr-Gly-His-Thr- Leu-Gln-Leu-Glu-Asp-Lys-Thr-Lys-Leu-Asp-Gly-Gly-Arg-Trp-Arg-Thr-Arg-Thr-Ser-Pro-Xaa-Asn-Val-Ala-Asn- Asp-GIn-lle-Lys-Thr-Phe-Val-Ala-Glu-Ser-Asn (SEQ ID NO: 5).

EXAMPLE 7 Amino acid sequence for toxins of PS167H2 of 45 kDa and 14 kDa The N-terminal amino acid sequence for the 45 kDa purified protein of PS167H2 is: Met-Leu-Asp-Thr-Asn-Lys-lle-Tyr-Glu-lle-Ser-Asn-Tyr-Ala-Asn-Gly- Leu-His-Ala-Ala-Thr-Tyr-Leu-Ser-Leu (SEQ ID NO: 6). The N-terminal amino acid sequence for the 14kDa purified protein of PS167H2 is: Ser-Ala-Arg-Glu-Val-His-lle-Asp-Val-Asn-Asn-Lys-Thr-Gly-His-Thr-Leu -Gln-Leu-Glu-Asp-Lys-Thr-Lys-Leu (SEQ ID NO: 7). These amino acid sequences can be compared to the sequence obtained for the 47 kDa peptide obtained from spore / crystal powders of 80JJ1 with the N-terminal sequence (SEQ ID NO: 1) and to the sequence obtained for the 14 kDa peptide. obtained from spore / crystal powders of 80JJ1 with the N-terminal sequence (SEQ ID NO: 3). Clearly, 45-47 kDa proteins are highly related, and 14 kDa proteins are highly related.

EXAMPLE 8 Protein bioenzyme Protein fractions purified from PS149B1 were bioassayed against the western corn rootworm and found to exhibit significant toxin activity when combined. Actually, the combination restored the activity to that observed in the original preparation (P1). The following bioassay data set presents the percentage of mortality and demonstrates this effect.

TABLE 4 Concentration (μg / cm2) P1 INC P1. P2 INC + P1. P2 300 88, 100, 94 19 13 100 100 94, 50, 63 31 38 94 33.3 19, 19.44 38 13 50 11.1 13.56.25 12 31 13 3.7 0, 50, 0 0 31 13 1.2 13.43, 12 0 12 19 0.4 6, 12, 6 25 19 EXAMPLE 9 Molecular cloning, expression and DNA sequence analysis of a novel d-endotoxin gene from Bacillus thurinpiensis strain PS80JJ1 Total cellular DNA was prepared from Bacillus thuringiensis (B.t.) cells grown at an optical density, at 600 nm, of 1.0. The cells were granulated by centrifugation and resuspended in protoplast pH buffer (20 mg / ml lysozyme in 0.3 M sucrose, 25 mM Tris-CI [pH 8.0], 25 mM EDTA). After incubation at 37 ° C for 1 hour, the protoplasts were used by two cycles of freezing and thawing. Nine volumes of a solution of 0.1 M NaCl, 0.1% SDS, 0.1 M Tris-CI were added to complete the lysis. The used rinse was extracted twice with phenol: chloroform (1: 1). The nucleic acids were precipitated with two volumes of ethanol and granulated by centrifugation. The granule was resuspended in TE pH buffer and RNase was added to a final concentration of 50 μg / ml. After incubation at 37 ° C for 1 hour, the solution was extracted once with phenol: chloroform (1: 1) and chloroform saturated with TE. The DNA was precipitated from the aqueous phase by the addition of one tenth volume of 3 M NaOAc and two volumes of ethanol. The DNA was granulated by centrifugation, washed with 70% ethanol, dried and resuspended in TE pH buffer.

An oligonucleotide probe was designed for the gene encoding the 45 kDa PS80JJ1 toxin from the N-terminal peptide sequence data. The sequence of the 29-base oligonucleotide probe was: 5'-AGT YTW GAT ACW AAT AAA GTW TAT GAA AT-3 '(SEQ ID NO: 8) This oligonucleotide was mixed in four positions as sample. This probe was radiolabelled with 32P and used in hybridization of standard Southern blots conditions of the total cellular DNA of PS80JJ1 digested with various restriction endonucleases. Autoradiographic data representative of these experiments showing the sizes of the DNA restriction fragments containing the sequence homology for the oligonucleotide probe of the 44.3 kDa toxin of SEQ ID NO: 8 are presented in Table 5.

TABLE 5 RFLP of PS80JJI cellular DNA fragments in Southern blots which hybridized under standard conditions with the oligonucleotide probe of a 44.3 kDa toxin gene (SEQ ID NO: 8) Restriction enzyme Approximate fragment size (pkb) EcoR \ 6.0 Hind \\ 8.3 Kpn \ 7.4 Psfl 111.5 Xba \ 9.1 These DNA fragments identified in these analyzes contain all or a segment of the 45 kDa PS89JJ1 toxin gene . The approximate sizes of the hybridization DNA fragments in Table 5 are reasonably in accordance with the sizes of a subset of the PS80JJ1 fragments that hybridize with a probe of a subgene of the 45 kDa PS89JJ1 toxin used in separate experiments, as predicted (see table 6, below). A library was constructed from PS80JJ1 DNA partially digested with Sau3A. The partial restriction digests were fractionated by agarose gel electrophoresis. DNA fragments of size 9.3 to 23 pkb were excised from the gel, electroeluted from the gel slice, purified on an Elutip-D ion exchange column (Schleicher and Schuell, Keene, NH), and recovered. by precipitation with ethanol. The Saa3AI inserts were ligated in LambdaGem-11 (Promega, Madison, Wl) digested with pill. The recombinant phage were packaged and deposited on E. coli KW251 cells. The plates were screened by hybridization with the oligonucleotide probe described above. The hybridization phage was plaque purified and used to infect liquid cultures of E. coli KW251 cells to isolate the DNA by conventional methods (Maniatis et al, supra). Southern blot analysis revealed that one of the recombinant phage isolates contained a band of X £ > a / -Sacl of approximately 4.8 pkb that hybridized with the toxin gene probe PS80JJ1. The Sacl site flanking the PS8JJ1 toxin gene is a phage vector cloning site, while the Xba flanking site is located within the PS8JJ1 DNA insert. This DNA restriction fragment was subcloned by standard methods into pBluescript S / K (Stratagene, San Diego, CA) for sequence analysis. The resulting plasmid was designated pMYC2421. The DNA insert was also subcloned in pHTBIuell (an E. coli / B. thuringiensis transporter vector constituted by pBluescript S / K [Stratagene, La Jolla, CA] and the replication origin of a resident Bt plasmid [D. Lereclus et al. ai (1989) FEMS Microbiology Letters 60: 211-218]) to produce pMYC2420. An oligo-nucleotide probe for the gene coding for the PS80JJI toxin of 14 kDa was designed from the sequence data. N-terminal peptide. The sequence of the 28 base oligonucleotide probe was: 5 'GW GAA GTW CAT ATW GAA ATW AAT AC 3' (SEQ ID NO: 29). This oligonucleotide was mixed in four positions as shown. The probe was radio-labeled with 32P and used in hybridizations of standard condition, Southern blots of total cell PS80JJ1 and DNA of pMYC2421 digested with several restriction endonucleases. These RFLP mapping experiments demonstrated that the gene coding for the 14 kDa toxin is located in the same genomic EcoRI fragment containing the N-terminal coding sequence for the 44.3 kDa toxin. To test the expression of the PS80JJ1 toxin genes in B.t., pMYC2420 was transformed into the acryliferous host (Cry-) B.t., CryB (A. Aronson, Purdue University, West Lafayette, IN), by electroporation. The expression of both PS80JJ1 toxins of approximately 14 and 44.3 kDa encoded by pMYC2420 was demonstrated by SDS-PAGE analysis. Toxin crystal preparations from the recombinant strain CryB [pMYC2420], MR536, were tested and shown to be active against the western corn rootworm. The PS90JJ1 toxin genes encoded by pMYC2421 were sequenced using the AB1373 automatic sequencing system and associated software. The sequence of the entire genetic site containing both open reading frames and the flanking nucleotide sequences are shown in SEQ ID NO 30. The stop codon of the 14 kDa toxin gene is 121 base pairs towards the 5 'end of the gene. the initiation codon of the 44.4 kDa toxin gene) (Figure 2). The sequence (SEQ ID NO: 31) of the open reading frame nucleotide of the 14 kDa toxin PS80JJ1, the sequence (SEQ ID NO: 10) nucleotide of the open reading frame of the 44. kDa toxin, and the respective sequences (SEQ ID NO 32 and SEQ! D NO: 11) deduced amino acid are new compared to other toxin genes encoding pesticidal proteins. Therefore, the nucleotide sequence coding for the 14 kDa toxin of PS80JJ1 is shown in SEQ ID NO 31. The deduced amino acid sequence of the 14 kDa toxin of PS80JJ1 is shown in SEQ ID NO 32. The sequences nucleotides coding for both toxins, the 14 and 45 kDa of PS80JJ1 as well as the flanking sequence is shown in SEQ ID NO 30. The relationship of these sequences is shown in Figure 2. A subculture of NM522 of E was deposited. .coli containing plasmid pMYC2421 in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Peoria, IL 61604 USA on March 28, 1996. The access number is NRRL B-21555.

EXAMPLE 10 RFLP and PCR analysis of additional new d-endotoxin genes from strains PS149B1 and PS167H2 from Bacillus thurinqiensis Two additional strains that are also active against the corn rootworm, PS149B1 and PS167H2, also produce the protein crystals for spores that are in part made up of polypeptides of approximately 14 and 45 kDa in size. Southern hybridization and partial DNA sequence analysis were used to examine the relationship of these toxins with the 80JJ1 toxins. DNA was extracted from these strains B.t. as described above, and conventional Southern hybridizations were performed using the 14 kDa oligonucleotide probe (SEQ ID NO 29) and a PCR fragment of approximately 800 bp of the coding sequence of the 80JJ1 toxin gene of 44.3 kDa. The RFLP data from these experiments showing the sizes of these DNA restriction fragments containing sequence homology for the 44.3 kDa toxin are presented in Table 6. The RFLP data from these experiments showing the sizes of the fragments of Restriction of DNA containing sequence homology to the toxin of approximately 14 kDa are presented in table 7.

TABLE 6 RFLP of cellular DNA fragments of PS80JJ1, PS149B1. and PS167H2 in Southern blots that hybridize with the subtilic probe of the 44.3 kDa toxin of 800 bp PS80JJ1, under conventional conditions Each of the three strains exhibited unique RFLP patterns. Hybridizing DNA fragments of PS149B1 or PS167H2 contain all or part of the toxin genes with sequence homologies for the PS80JJ1 toxin of 44.3 kDa.

TABLE 7 Polymorphism of the length of restriction fragments of cellular DNA fragments of PS80JJ1. PS149B1. and PS167H2 in Southern blots that hybridize with the oligonucleotide probe of the 14 kDa toxin of PS80JJ1 under standard conditions Each of the three strains exhibited unique RFLP patterns. Hybridizing DNA fragments of PS149B1 or PS167H2 contain all or part of the toxin genes with sequence homology for the PS80JJ1 toxin gene of 14 kDa. Portions of the toxin genes were amplified in PS149B1 or PS167H2 by PCR using pairs of forward and reverse oligonucleotide primers based on the gene sequence of the PS80JJ1 toxin of 44.3 kDa. For PS149B1 the following pair of primers was used: Forward: 5'-ATG YTW GAT ACW AAT AAA GTW TAT GAA AT 3 '(SEQ ID NO: 8) Inverse: 5'-GGA TTA TCT ATC TCT GAG TGT TCT TG-3 '(SEQ ID NO: 9) For PS167H2 the same pair of primers was used. These fragments derived from PCR were sequenced using the automatic sequencing system AB1373 and the associated software. The peptidic sequences and the partial genes obtained are shown in SEQ ID NO. 12-15. These sequences contain portions of the nucleotide coding sequences and the peptide sequences for the new activating toxins of the corn rootworm in lae B.t strains. PS149B1 or PS167H2.

EXAMPLE 11 Molecular relationship and DNA sequence analysis of new d-endotoxin genes from strains PS149B1 and PS167H2 of Bacillus thuringiensis Total cellular DNA was extracted from strains PS149B1 and PS167H2 as described for PS80JJ1. Libraries of partial restriction fragments Sau3A of fractionated size in Lambda-Gemm11 were constructed for respective strain as previously described. Recombinant phages were loaded and deposited in KW251 cells of E. coli. Plates were screened by hybridization with the oligonucleotide probe specific for the 44 kDa toxin gene. The hybridization phages were plaque purified and used to infect liquid cultures of E. coli KW251 cells to isolate DNA by conventional methods. (Maniatis et al., supra). For PS167H2, Southern blot analysis revealed that one of the recombinant phage isolates contained a band of approximately 4.0 and 4.4 pkb of HndlII and hybridized with the 5 'oligonucleotide probe of the 44 kDa PS80JJ1 toxin gene (SEQ ID NO: 8). This DNA restriction fragment was sub-cloned by conventional methods in pBluescript S / K (Stratgene, San Diego, CA) for sequence analysis. The fragment was also subcloned into the high copy number transporter vector pHT370 (Arantes, O., D. Lereclus [1991] Gene 108: 115-119) for the analysis of expression in Bacillus thuringiensis (see below). The resulting high copy number recombinant bifunctional plasmid was designated PMYC2427. The genes of the PS167H2 toxins encoded by pHYC2427 were sequenced using the ABI automatic sequencing system and the associated software. The sequence of the entire genetic site containing both the open reading frames and the flanking nucleotide sequences are shown in SEQ IN NO: 34. The stop codon of the 14 kDa toxin gene is 107 base pairs towards the end 5 'from the initiation codon of the 44 kDa toxin gene. The coding sequence of the 14 kDa PS167H2 toxin (SEQ ID NO: 35), the 44 kDa toxin coding sequence (SEQ ID NO: 37), and the respective deduced amino acid sequences, (SEQ ID NO: 36 and SEQ ID NO: 38), are new compared to other known toxin genes that code for pesticide proteins. The toxin genes are similarly arranged and have some homology to the PS80JJ1 toxins of 14 and 44 kDa. An NM522 subculture of E. coli containing plasmid pMY2427 was deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Peoria, Illinois 61604 USA on March 26, 1997. Access number is NRRL B-21672. For PS149B1, Southern blot analysis using the 5 'oligonucleotide probe PS80JJ1 of 44 kDa (SEQ ID NO: 8) demonstrated hybridization of a C / al DNA fragment of approximately 4.9 pkb. The C / al digests of PS149B1 genomic DNA were fractionated by size on agarose genes and cloned in pHTBIuell. The fragment was also subcloned into the high copy number transporter vector pHT370 (Arantes, O., D. Lereclus [1991] gene 108: 115-119) for the analysis of expression in Bacillus thuringiensis (see below). The resulting high copy number recombinant bifunctional plasmid was designated pMYC2429. The PS149B1 toxin genes encoded by pMYC2429 were sequenced using the automatic ABI sequence system and associated software. The sequence of the entire genetic site containing both the open reading frames and the flanking nucleotide sequences are shown in SEQ ID NO: 39. The stop codon of the 14 kDa toxin is 108 base pairs towards the 5 'end from the initiation codon of the 44 kDa toxin gene. The sequence (SEQ ID NO: 40) encoding the PS149B1 toxin of 14 kDa, the sequence (SEQ ID NO: 42) encoding the 44 kDa toxin, and the respective deduced amino acid sequences (SEQ ID NO: 41 and 43) ) are new compared to known toxin genes that code for known proteins. The toxin genes are similarly arranged and have some homology to the PS80JJ1 and PS167H2 toxins of 14 and 44 kDa. Together these three toxin operons comprise a new family of pesticide toxins. An NM522 subculture of E. coli containing plasmid pMYC2429 was deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Peoria, Illinois 61604 USA on March 26, 1997. Access number is NRRL B-21673.

EXAMPLE 12 Amplification of PCR for the identification and cloning of new toxins active against the corn rootworm The peptide and DNA sequences of the three new toxins active against the corn rootworm, approximately 45 kDa of PS80JJ1, PS149B1 and PS167H2 (SEQ ID NOS 12-15) were aligned with the Pileup analysis program of the sequence of Genetic Computer Group, using a gap of a weight of 3.00 and a weight of the gap length of 0.10. Sequence alignments were used to identify the peptide sequences used for which oligonucleotide primers were designated which are likely to hybridize to genes encoding members of this new family of toxins. Such primers can be used in PCR to amplify the DNA fragments for diagnosis for these genes and related toxins. Numerous primer designs are possible for several sequences, four of which are described herein to provide an example: Asp-lle-Asp-Asp-Tyr-Asn-Leu (SEQ ID NO: 16) Trp-Phe-Leu-Phe- Pro-lle-Asp- (SEQ ID NO: 17) Gln-Ue-Lys-Thr-Thr-pro-Tyr-Tyr- (SEQ ID NO: 18) Tyr-Glu-Trp-Gly-Thr-Glu (SEQ ID NO: 19) The corresponding nucleotide sequences are: S'-GATATWGATGAYTAYAAYTTR-S1 (SEQ ID NO: 20) 5'-TGG lllll RTTTCCWATWGAY-3 '(SEQ ID NO: 21) 5'-CAAATHAAAACWACWCCATATTAT-3' (SEQ ID NO. : 22) 5'-TAYGARTGGGGHACAGAA-3 '(SEQ ID NO: 23) Forward primers were designed for polymerase amplification in thermocycle reactions based on the nucleotide sequences of SEQ ID NOS: 20 and 21. Inverse primers were designed. based on the inverse complement of SEQ ID NOS: 22 and 23: d-ATAATATGGWGTWGTTTTDATTTG-S '(SEQ ID NO: 24) 5'-TTCTGTDCCCCAYTCRTA-3' (SEQ ID NO: 25) These primers can be used in combination to amplify the DNA fragments of the s next sizes (table 8) that identify the genes that code for new corn rootworm toxins.

TABLE 8 Diagnosed sizes of DNA fragments for diagnosis of (base pair DNA) amplifiable with specific primers for new active tooxins against the corn rootworm Similarly, whole genes coding for new toxins active against the corn rootworm can be isolated by polymerase amplification in thermocycle reactions using designed primers based on the DNA sequence flanking the open reading frames. For the 44.3 kDa PS80JJ1 toxin, one such primer pair was designed, synthesized and used to amplify a DNA fragment for diagnosis of 1613 bp that included the entire toxin coding sequence. These initiators were: Forward: d-CTCAAAGCGGATCAGGAG-S '(SEQ ID NO: 26) Inverse: 5'-GCGTATTCGGATATGCTTGG-3' (SEQ ID NO: 27) For the PCR amplification of the PS80JJ1 toxin of 14 kDa, the Oligonucleotide encoding the N-terminal peptide sequence (SEQ ID NO: 29) can be used in combination with several inverse oligonucleotide primers based on the sequences in place of the PS80JJ1 toxin genes. One of said reverse primers has the following sequence: 5 'CATGAGATTTATCTCCTGATCCGC 3' (SEQ ID NO: 33) When used in conventional PCR reactions, this pair of primers amplifies a diagnosis of a DNA fragment of 1390 bp including the entire coding sequence of the 14 kDa toxin, and certain 3 'flanking sequences corresponding to the ether spacer of 121 bases and a portion of the 44.3 kDa toxin gene. When used in combination with the forward 14 kDa primer, the PCR will generate a DNA diagnostic fragment of 322 base pairs.

EXAMPLE 13 Bioassays in response to the dose of clones The toxin operon PS80JJ1 was subcloned from pMYC2421 in pHT370 for direct comparison of the bioactivity with the recombinant toxins cloned from PS149B1 and PS167H2. The resulting high copy number recombinant bifunctional plasmid was designated pMYC2426. A subculture of NMK522 from E. coli containing the plasmid pMYC2426 was deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center 1815 North University Street, Peoria, Illinois 61604 on March 26, 1997. The access number is NRRLB-21671. To verify the expression of the toxin genes PS80JJ1 and PS149B1 and PS167H2 in Bt, they were transformed separately into pMYC2427 and pMYC2429 at the Bt host, acryrystalline (Cry-), CryB (Aronson, Purdue University, West Lafayette, IN), by electroporation. The recombinant strains were designated MR543 (CryB) [pMYC2426]), MR544 (CryB [pMYC2427]) and MR546 (Cry [pMYC2429]), respectively. The expression of both toxins, approximately 14 and 44 kDa, was demonstrated by SDS-PAGE analysis for each recombinant strain. The toxin crystal preparations from the recombinant strains were tested against the western wheat rootworm. His diet was modified with sorbic acid and pen-strep-ampho-B. The material was loaded in the upper part at a rate of 50 μl of suspension per cm2 of surface area of diet. The bioassays were carried out with larvae of the western neonate corn rootworm for four days at approximately 25 ° C. Estimates of the percentage of mortality and of the LC50 of higher loading for the clones (granules) are indicated in table 9. A control dH2O produced 7% mortality.

TABLE 9 Percentage of mortality at a given protein concentration (μg / cm2) Sample 50 μg / cm 5 μg / cm 0.5 μg / cm Granule of MR543 44% 19% 9% Granule of MR544 72% 32% 21% Granule of MR546 52% 32% 21% The amounts of 14 kDa and 44.3 kDa proteins present in the crystal preparations were estimated by densitometry and used to calculate the specific activity expressed as LC50-LC50 estimates for the clones (granules) indicated in Table 10 (Bioassay top loading WCRW of Bt clones).

TABLE 10 Wellsay of top load WCRW of clones B.t.

* Percentage of mortality is provided at the highest dose for the controls ** 90% CL EXAMPLE 14 Mutational analysis of the 14 and 44 kDa peptides in the binary toxin operon PS80JJ1 The binary toxin genes of the present invention are, in their wild-type state, typically arranged in an operon in which the 14kDa protein gene is transcribed first, followed by the 45 kda protein gene. These genes are separated by a relatively short noncoding region. Representative ORFs are shown in SEQ ID NO: 30, SEQ ID NO: 34, and SEQ ID NO: 39. In order to investigate the contribution of individual crystal proteins of 14 and 44.3 kDa to the activity of the corn rootworm, each gene in the PS80JJ1 operon was mutated in separate experiments to abolish the expression of one of the proteins. The intact gene was then expressed in B.t and the recombinant proteins were tested for activity against the corn rootworm. First, the 44.3 kDa gene encoded in pMYC2421 was mutated, truncating it at the EcoRI site at base position 387 of the open reading frame. This truncation and the subsequent linker with the vector sequences resulted in an open reading frame encoding a hypothetical fusion protein of approximately 24 kDa.

The resulting operon encoding the intact 14 kDa gene and the truncated 45 kDa gene was subcloned into the high copy number transporter vector, pHTT370 (Arantes, O., D. Lereclus [1991] Gene 108: 115-119 ) for the analysis of expression in Bacillus thuringiensis. The resulting plasmid pMYC2424 was transformed into the acristaliferous host B.t. (Cry-), CryB (A. Aronson, Purdue University, West Lafayett, IN), by electroporation. The resulting recombinant strain was designated MR541. Only the 14 kDa PS80JJ1 protein was detectable by SDSPAGE analysis of MR541 sporulated cultures. No mortality was observed for MR5412 preparations expressing only the 14 kDa PS80JJ1 protein in the top-loading bioassays against the corn rootworm. Then, the 14 kDa gene encoded in pMYC2421 was mutated by inserting an oligonucleotide linker containing termination codons in all possible reading frames at the Nrul site at the base position 11 of the open reading frame. The sequence of this linker is 5 * TGAGTAACTAGATCTATTCAATTA 3 '. The linker introduces a fígr / ll site for the confirmation of the insertion by digestion of the fíg / ll restriction. The plasmid clones containing the mutagenic linker were identified with fíg / ll, and sequenced for verification. The operon insert encoding the 14 kDa nonsense mutations was subcloned into pHT370, which resulted in plasmid pMYC2425. This plasmid was transformed into CryB by electroporation to produce the recombinant B.t strain MR542. Only the PS80JJ1 protein of 44.3 kDa was expressed in sporulated cultures of MR542 as shown by the SDSPAGE analysis. No mortality against the corn rootworm was observed for MR542 preparations expressing only the PS80JJ1 protein of 44.3 kDa.

EXAMPLE 15 Single gene heterologous expression, purification and bioenzyme of 14 and 44.3 kDa polypeptides from PS149B1 in Pseudomonas fluorescens The 14 kDa and 44.3 kDa polypeptide genes of PS149B1 were manipulated separately in plasmid vectors by conventional DNA cloning methods, and transformed into Pseudomonas fluorescens. The recombinant Pseudomonas fluorescein strain expressing only the PS149B1 gene of 14 kDa was designated MR1253. The recombinant Pseudomonas fluorescens strain expressing only the 44.3 kDa PS149B1 gene was designated MR1256. Each of MR1253 and MR1256 that individually expresses one of the two binary proteins were cultured in one liter fermentation tanks. A portion of each culture was then granulated by centrifugation, lysozyme-treated and treated with DNAse I to obtain semi-pure protein inclusions. These inclusions were then solubilized in 50 mm sodium citrate (pH 3.3) by gently stirring at 4 ° C for one hour. The 14 kDa protein quickly dissolved in this pH regulator while the 44.3 kDa protein was partially soluble. The solubilized fractions were then centrifuged at 15,000 x g for 20 minutes and the supernatants were retained. The 14 kDa protein was further purified through ion exchange chromatography. The solubilized protein of 14 kDa was bound to an Econo-S column and eluted with a gradient of 0-1 M Sodium Chloride. The MR1253 of chromatographically pure protein (14 kDa protein) and the solubilized preparation of Sodium Citrate ( pH 3.3) of MR1256 (45 kDa protein), were then tested to determine the activity on corn rootworm individually or together in a molar ratio of 1 to 10 (45 kDa protein to 14 kDa protein). The observed mortality for each of the proteins alone was not above base levels (of the water / control sample) but resulted in 87% mortality when combined in the previous relationships (Table 11).

TABLE 11 EXAMPLE 16 Identification of additional genes of additional toxins of 14 kDa and 44.3 kPa by hybridization of total B.t genomic DNA v by RFLP The total genomic DNA of each isolate was prepared using the Quiagen DNEasy 96-well tissue kit. The DNA in the 96-well plates was denatured before forming the plot by adding 10 μl of each DNA sample and 10 μl of each 4 M NaOH to 80 μl of sterilized distilled water. The samples were incubated at 70 ° C for one hour after which 100 ul of 20 X SSC was added to each of the wells. Total PS149B1 genomic DNA was included with each group of 94 samples as positive hybridization control, and total cryB- genomic DNA was included with each set of 94 samples as a negative hybridization control. Each set of 96 samples was applied to Magnacharge nylon membranes using the two collectors with 48-well slot blots (Hoefer Scientifíc), followed by two washes with 10 x SSC. The membranes were baked at 80 ° C for one hour and then kept dry until the time of use. The membranes were pre-hydrated, and hybridized in formamide solution (50% formamide, 5 X SSPE, 5 X Denhardt's solution, 2% SSD, 100 ug / ml single-stranded DNA at 42 ° C). The membranes were washed under two conditions: 2X SSC / 0.1% SDS at 42 ° C (low stringency) and 0.2X SSC / 0.1% SDS at 65 ° C (moderate to high stringency). The membranes were probed with approximately a 1.3 kb pair PCR fragment of the 44.3 kDa PS149B1 gene amplified from pMYC2429 using the forward primer of SEQ ID No: 8 and an inverse primer with the 5 'sequence GTAGAAGCAGAACAAGAAGGTATT 3' ( SEQ ID NO: 46). The probe was labeled radioactively using the Prime-it II (Stratagene) and purified 32-P dCTP on Sephadex columns., denatured at 94 ° C and added to a fresh hybridization solution. Strains containing homology genes for the PS149B1 probe were identified by exposure of a membrane to an X-ray film. Strains were identified as positive hybridization reactions: PS184M2, PS185GG, PS187G1, PS187Y2, PS201G, PS201 HH2, PS242K10, PS69Q, KB54A1-6, KR136, KR589, PS185L12, PS185W3, PS185Z11, PS186L9, PS187L14, PS186FF, PS131W2, PS147U2, PS158T3, PS158X10, PS185FF, PS188F3, PS198H3, PS201 H2, PS201 L3, PS203G2, PS203J1, PS204C3, PS204G4, PS204I11, PS204J7, PS210B, PS213E8, PS223L2, PS224F2, PS236B6, PS246P42, PS247C16, KR200, KR331, KR625, KR707, KR1209, KR1369, KB2C-4, KB10H-5, KB456, KB42C17-13, KB45A43-3, KB54A33-1, KB58A10-3, KB59A54-4, KB59A54-5, KB53B7-8, KB53B7-2, KB60F5-7, KB60F5-11, KB59A58-4, KB60F5-15, KB61A18-1, KB65A15-2, KB65A15- 3, KB65A15-7, KB65A15-8, KB65A15-12, KB65A14-1, KB3F-3, T25, KB53A71-6, KB65A11-2, KB68B57-1, KB63A5-3, and KB71A118-6.

The identification and additional classification of the new toxin genes in the preparations of the total genomic DNA was carried out using the probes labeled with 32P and under the conditions of hybridization such as those described above in this example. Total genomic DNA was prepared as previously or with Quiagen Genomic-Tip 20 / G and Genomic DNA Set pH Regulator according to the protocol for Gram-positive bacteria (Quiagen Inc., Valencia, CA), was used in Southern analyzes . For Southern blots, approximately 1-2 μg of total genomic DNA from each strain identified by the blot slot analysis was digested with Dral and Ndel enzymes, subjected to electrophoresis on a 0.8% agarose gel and immobilized on a nylon membrane. supported using conventional methods (Maniatís et al.,). After hybridization, the membranes were washed with low stringency (2 X SCC / 0.1 SDS at 42 ° C) and exposed to the film. DNA fragment sizes were estimated using the BioRad Chemidoc software system. Restriction fragment length polymorphisms were used to (arbitrarily) classify genes that code for the 44 kDa toxin. These classifications are shown in table 12.

TABLE 12 EXAMPLE 17 DNA sequencing of additional binary toxin genes Degenerate oligonucleotides were designed to amplify all or part of the 14 and 44.3 kDa genes of the B.t strains identified by hybridization with the 149B1 PCR product described above. The oligonucleotides were designed for the blocking of conserved sequences identified by alignment of the 14 kDa or 44.3 kDa genes of PS149B1, PS167H2 and PS80JJ1. Front primers were designed for both genes to begin at the ATG start codon. Reserve primers were designed as close as possible to the 3 'end of each respective gene. The primers designed to amplify the 14 kDa gene are the following: 149DEG1 (forward) 5'-ATG TCA GCW CGY GAA GTW CAY ATTG-3 '(SEQ ID NO: 47) 149DEG2 (inverse): 5'-GTY TGA ATH GTA TAH GTH ACÁ TG-3 '(SEQ ID NO: 48) These primers amplified a product of approximately 340 base pairs. The primers designed to amplify the 44.3 kDa gene are as follows: 149DEG3 (forward): 5'-ATG TTA GAT ACW AAT AAA RTW TAT G-3 '(SEQ ID NO: 49) 149DEG4 (inverse): 5'GTW ATT TCT TCW ACT TCT TCA TAH GAA G-3 '(SEQ ID NO: 50). These initiators amplify a product of approximately 1, 100 base pairs. The PCR conditions used to amplify the gene products are the following: 95 ° C, 1 min., One cycle. 95 ° C, 1 min. 50 ° C, 2 min., This was repeated 35 cycles. 72 ° C. 2 min. 72 ° C, 10 min., One cycle. The PCR products were fractionated on a 1% agarose gel, and purified from a gel matrix using the Qiaexll (Qiagen) kit. The resulting purified fragments were ligated into the pCR-TOPO cloning vector using the TOPO TA cloning kit (Invitrogen). After ligating, half of the ligament reaction was transformed into ultracomponent cells (Stratagene). Transformants were then screened by PCR with vector primers 1212 and 1233. Clones containing inserts were grown in an LB / carbenicillin medium for the preparation of plasmids using the Qiagen plasmid DNA miniprep kit (Qiagen). The cloned PCR fragments were then sequenced using Applied Biosystems automated sequencing systems and associated software. The sequences of new binary toxin genes and the polypeptides related to holotype 14 and 44.3 kDa toxins of PS80JJ1 and PS149B1 were listed with SEQ ID No: 51-126. The previous section entitled "Brief Description of the Sequences" provides an additional explanation of these sequences. The genes and toxins of type 14 kDa of three additional strains of B.t. PS137A, PS201V2 and PS207C3, were also sequenced using the above procedures (indicating any difference below). A PCR was performed using the primers 149DEG1 (forward) and 149DEG2 (reverse). These initiators amplify a product of approximately 340 base pairs. The PCR was carried out with the following conditions: 1. 95 ° C3 min. 2. 94 ° C, 1 min 3. 42 ° C, 2 min. 4. 72 ° C, 3 min. + 5 sec./cycle. 5. Stages two to four were repeated 29 times. The PCR products were purified with the gel using the gel extraction equipment (QiaQuick kít (Quiagen), the purified fragment was ligated into the pCR-TOPO cloning vector using TOPO-TA equipment (Invitrogen), and subsequently transformed into XL 10-Gold Ultracompetent E. coli cells (Strategene) The transforming DNA preparation has been described above The sequences of the 14 kDa toxin gene for each of the three new strains were obtained as before. Nucleotide sequences are provided. and polypeptides in the attached sequence listing as follows: PS137A (SEQ ID NOS: 149 and 150), PS201V2 (SEQ ID NOS 151 and 152), and PS207C3 (SEQ ID NO: 153 and 154).

EXAMPLE 18 Transgenes of PS149B1 toxins and transformation of plants Separate synthetic transgenes optimized for use with corn codons were designed for both toxin components, 14 and 44.3 kDa. Synthetic versions were designed to modify the inclination of the guanine codon and cytosine to a more typical level for plant DNA. Transgenes optimized for preferred plants have been described in SEQ ID NOS: 127-128. The promoter region used for the expression of both transgenes was the ubiquinin promoter Zea mays plus exon 1 from Z. Mays and intron 1 from Z. Mays. (Christensen, A.H. et.al., (1992) Plant Mol. Biol. 18-675-689). The transcription terminator used for both transgenes was the potato proteinase inhibitor II (Pill) (An, G. et al., 1989 Plant Cell 1: 115-22). Phosphinothricin acetyltransferase (PAT) was used as a selectable marker for plant transformation. The phosphinothricin acetyltransferase gene (pat) was isolated from the bacterium Streptomyces viridochromogenes (Eckes P. et al., 1989). Protein acetylates phosphinothricin, or its dimethylphosphinothricin precursor confer tolerance to a chemically synthesized phosphinothricin such as the glufosinate-ammonium herbicide. Acetylation converts phosphinothricin to an inactive form that is no longer toxic to corn plants. Glufosinate ammonium is a non-selective, non-systemic, broad-spectrum herbicide. The regeneration of the maize tissue or tolerant to individual maize plants for the glufosinate ammonium herbicide can be easily identified through the incorporation of PAT in regeneration medium or by spray application of the herbicide on the leaves. The synthetic version of the pat gene was produced in order to modify the inclination of the guanine condom to a more typical level for plant DNA. The promoter for the pat gene is the CaMV promoter of transcription 35S of the cichloro mosaic virus (Pietrzak et al., 1986). The transcriptional terminator is the CaMV 35 S terminator. For the transformation of corn tissues, a linear portion of DNA, which contains both PS149B1 14 kDa and 44.3 kDa and the coding sequences of the pat selectable marker, and the regulatory components necessary for expression, was extracted from a complete plasmid. This linear portion, called an insert, was used in the transformation process. Corn plants containing PS149B1 14 kDa and 44.3 kDa transgenes were obtained by bombardment with microprojectiles using the Biolistics® OR PDS-100He particle gun manufactured by Bio-Rad, essentially as described by Klein et al., (1987).

Immature embryos isolated from ears of corn harvested approximately 15 days after pollination, were cultured in a medium of callus initiation for three to eight days. On the day of transformation, microscopic tungsten particles were coated with purified DNA and accelerated in cultured embryos, where the DNA insert was incorporated into the chromosome of the cells. Six days after the bombardment, the bombarded embryos were transferred to a callus initiation medium containing glufosinate (Bialaphos) as a selection agent. Healthy, resistant callus tissues were obtained and repeatedly transferred to a fresh selection medium for approximately 12 weeks. The plants were regenerated and transferred to the greenhouse. A total of 436 regenerated plants were obtained. Samples of leaves were taken for the molecular size in order to verify the presence of transgenes from PCR and to confirm the expression of the foreign protein by ELISA. The plants were then subjected to a complete bioassay of the plant using the worm from the western corn. Positive plants were crossed with inbred lines to obtain seeds from the initial transformed plants. It was found that these plants are resistant to damage by the corn rootworm both in the greenhouse and in field trials.

EXAMPLE 19 Additional bioassays Protein preparations of the strains identified in Example 16 were tested for activity against western corn rootworm using basic top loading assay methods, as described in Example 13. The results they are shown in table 13.

TABLE 13 EXAMPLE 20 Molecular cloning, expression and DNA sequencing analysis of a new endotaxin gene from Bacillus thurinpiensis strain PS20H3 PS201 L3 genomic DNA was prepared from cells cultured in shake flasks using a Qiagen Genomic-tip 500 / G kit and a pH Regulator Group for Genomic DNA according to the Gram-positive bacteria protocol (Qiagen Inc. Valencia, CA). A library was constructed from PS201L3 DNA partially digested with Sau3AI. Partial restriction digests were fractionated by electrophoresis with agarose gel. DNA fragments in size 9.3 to 23 pkb were extracted from the gel, electroeluted from the gel slice, purified on an Elatip-D exchange column (Schleícher and Schuell, Keene, NH), and recovered by precipitation with ethanol. The Sau3AI inserts in LambdaGen-11 digested with Bamlll (Promega, Madison, Wl) were ligated. Recombinant phage were loaded using Gigapack III XL Packaging Extract (Stratagene, La Jolla, CA) and deposited on E. coli KW251 cells. Plates were raised on Nytran Nylon Transfer Membranes (Schleicher &Schuell, Keene, NH) and probed with a 32 P-dCTp labeled gene probe for the binary toxin coding sequence. This gene probe was a PCR product of approximately 1.0 kb, which was amplified using a genomic PS201L3 DNA model and the oligonucleotides "15kfor1" and "45krev6".

The sequences of the oligonucleotides used for PCR and sequencing follow: 15kfor1 (SEQ ID NO: 131) ATGTCAGCTCGCGAAGTACAC 45krev6 (SEQ ID NO: 132) GTCCATCCCATTAATTGAGGAG Membranes were hybridized with the probe overnight at 65 ° C and then washed three times with 1XSSPE and 0.1% SDS. Thirteen plates were identified by autoradiography. These plates were subsequently chosen and soaked overnight in a 1 ml pH regulator SM + 10uL CHCl3. Phages were deposited for confluent lysis on KW251 host cells; 6 confluent plates were soaked in SM and used for phage DNA preparations on a larger scale. Purified phage DNA was digested with several enzymes and passed on 0.7% agarose gels. The gels were transferred to Nytran membranes by Southern blot and probed with the same DNA fragment amplified by PCR as before. A hybrid Xbal band of approximately 6.0 kb was identified and subcloned in pHT370, an E. coli / Bacillus thuringiensis transport vector (Arantes, O., D. Lereclus [1991] Gene 108: 115-119) to generate pMYC2476. E. coli XL10 Gold Ultracompetent cells (Strategene) transformed with pMYC2476 were designated MR1506. Subsequently, PMYC2476 was transformed into acryrystalline CryB cells by electroporation and selection on DM3 + erythromycin plates (200 ug / ml) at 30 ° C. The CryB [pMYC2476] was designated MR561. It was deposited with MR1506 culture in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Peoria, Illinois 61604 E.U.A. on June 1, 2000. The access number is B-30298. The strain of B.t MR561 was examined for the expression of binary toxin proteins PS201L3 by immunoblotting. The cells were cultured in liquid NYS-CAA medium + erythromycin (10 ug / ml) overnight at 30CC. The culture was then granulated by centrifugation and a portion of the cell pellets were resuspended and run on SDS-PAGE gels. Both proteins, those of 14 kDa and 44 kDa, were apparent by Western blot analysis when probed with specific antibodies for any of the 14 kDa or 44 kDa PS149B1 toxins., respectively. The sequencing of the toxin genes encoded in pMYC2476 was carried out using an AB1377 automatic sequencer. The DNA sequence for the PS201L3 gene of 14 kDa is shown in SEQ IN NO: 133. The deduced peptide sequence, the PS201L3 toxin of 14 kDa is shown in SEQ ID NO: 134. The DNA sequence for the gene PS201L3 of 44 kDa is shown in SEQ ID NO. 135. The deduced peptide sequence for the 44 kDa PS201 L3 toxin is shown in SEQ ID NO: 136.

The following table shows the similarity of sequence and identity of the binary genes and proteins of 201 L3 and 149B1. The BESTFIT program (part of the GCG software package) was used for these comparisons. BESTFIT uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2: 482-489 (1981)).

TABLE 14 201 L3 vs 149B1% similarity% identity 14 kDa nucleotide Sec. - 71.1 14 kDa peptide Sec. 63.9 54.1 45 kDa nucleotide Sec. - 76.1 45 kDa peptide Sec. 70.9 62.7 EXAMPLE 21 Molecular cloning and DNA sequence analysis of new d-endotoxin genes from Bacillus thuringiensis strains PS187G1, PS201HH2 V KR1369 Total cellular DNA was prepared from the strains of Bacillus thuringensis PS187G1. PS201 HH2 and KR1369 grown to an optical density of 0.5-1.0 at a visible light of 600 nm in Luria Bertani broth (LB). DNA was extracted using the Qiagen Genomic-tip 500 / G and the Group of pH Regulators for Genomic DNA according to the protocol for Gram-positive bacteria (Qiagen Inc., Valencia, CA). Cosmid libraries PS187G1, PS201 HH2 and KR1369 were constructed in the SuperCosI vector (Stratagene) using total cellular DNA inserts PS187G1, PS201 HH2 and KR1369, respectively, partially digested with Nde II. XL1-Blue MR (Stratagene) cells were transfected with charged cosmids to obtain clones resistant to carbenicillin and kanamycin. For each strain, 576 colonies of cosmids were cultured in blocks of 96 receptacles in ml of LB + carbenicillin (100 ug / ml) + kanamycin (50 ug / ml) at 37 ° C for 8 hours and the replicas were deposited on water filters. nylon for selection by hybridization. A PCR amplicon containing approximately 1000 bp of the toxin operon of PS187G1, PS201 HH2 or KR1369 was amplified from genomic DNA PS187G1, PS201 HH2 or KR1369 using primers designed to amplify the binary homologs: 15kfor1: 5'-ATG TCA GCT CGC GAA GTA CAC-3 '(SEQ ID NO: 131) 45krev6: 5'GTC CAT CCC ATT AAT TGA GGA G-3' (SEQ ID NO: 132) The DNA fragment was gel purified using QiaQuick extraction (Qiagen) . The probe was radiolabelled with 32P-dCTP using Prime-it II (Stratagene) and used in aqueous hybridization solution (6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg / ml denatured DNA) with raised filters of colonies at 65 ° C for 16 hours. The raised colony filters were washed briefly once in 0.5 x SSC / 0.1% SDS at room temperature followed by two additional washes for ten minutes at 65 ° C in 0.5XSSC / 0.1% SDS. Then the filters were exposed to an x-ray film for 20 minutes (PS187G1 and PS2011 H2) or for 1 hour (KR1369). A cosmid clone that hybridized strongly with the probe was selected for further analysis for each strain. It was confirmed that these cosmid clones contained the target gene of 14 kDa toxin and 44 kDa of approximately 1000 bp, by PCR amplification with the primers listed above. The cosmid clone of PS187G1 was designated pMYC1306; recombinant E. coli XL1-Blue MR cells containing pMYC1306 were designated MR1508. The cosmid clone of PS201 HH2 was designated pMYC1307; recombinant E. coli XL1-Blue MR cells containing pMYC3107 were designated MR1509. The cosmid clone of KR1369 was designated pMYC3108; recombinant E. coli XL1-Blue MR cells containing pMYC3108 were designated MR1510. Subcultures of MR1509 and MR1510 were deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Peoria, Illinois 61604 E.U.A. on August 8, 2000. The access numbers are NRRL B-30330 and NRRL-B 30331, respectively. The toxin genes PS187G1, PS201HH2 and KR1369 of 14 kDa and 44 kDa encoded by pMYC3106, pMYC3107 and pMYC3108, respectively, were sequenced using the automatic sequencing system AB1377 and the associated software.

The nucleotide sequences PS187G1 of 14 kDa and 44 kDa and deduced polypeptides are shown in SEQ ID NO: 137-140. Both 14 and 44 kDa toxin gene sequences are complete open reading frames. The open reading frame nucleotide sequence of the PS187G1 toxin of 14 kDa, the open reading frame nucleotide sequence of the 44 kDa toxin, and the respective deduced amino acid sequences are novel compared to other toxin genes encoding pesticide proteins. The nucleotide sequences PS201 HH2 of 14 kDa and 44 kDa and deduced polypeptides are shown as SEQ ID NO: 141-144. The 14 kDa toxin gene sequence is the complete open reading frame. The 44 kDa toxin gene sequence is a pair-wise sequence! of the gene. The open reading frame nucleotide sequence of PS201 HH2 toxin of 14 kDa, the partial open reading frame nucleotide sequence of the 44 kDa toxin, and the respective deduced amino acid sequences are new compared to other toxin genes that code for pesticide proteins. The KR1369 14 kDa and 44 kDa nucleotide sequences and deduced polypeptides are shown in SEQ ID NO: 145-148. Both 14 kDa and 44 kDa toxin gene sequences are complete open reading frames. The open reading frame nucleotide sequence with the 14 kDa KR1369 toxin, the open reading frame nucleotide sequence of the 44 kDa toxin and the respective deduced amino acid sequence are novel compared to other toxin genes encoding proteins pesticides EXAMPLE 22 Construction and fusion expression of hybrid genes containing the PS149B1 binary toxin genes of 14 kDa and 44 kDa Oligonucleotide primers were designed for the 5 'and 3' ends of both the 14 kDa and 44 kDa genes from PS149B1. These oligonucleotides were designed to create gene fusions using SOE-PCR ("Gene Splicing By Overlap Extension: Tailor-made Genes Using PCP" Biotechniques 8: 528-535, May 1990). The two genes were fused together in the reverse order found in the native binary toxin operon (ie, first the 44 kDa gene, followed by the 14 kDa gene). The sequences of the oligonucleotides used for SOE PCR were: F1 new: AAATATTATTTTTGTCAGCACGTGAAGTACACATTG (SEQ ID NO: 155) r1new: tetetGGTACCttaTTAtgtttatgeeeatategtagg (SEQ ID NO: 156) F2new: agagaACTAGTaaaaaggagataaccATGttagatactaataaag (SEQ ID NO: 157) r2new: CTGTGCTGACATAAAATAATATTTTTTTAATTTTTTTAGTGTACTTT (SEQ ID NO: 158) Oligo "F1 new" was designed to direct the amplification of the 5 'end of the 14 kDa gene and to hybridize with the 3' end of the 44 kDa gene. Oligo "R1 new" was designed to direct the amplification of the 3 'end of the 14 kDa gene. This primer was designed with two interruption codons in order to ensure translation completion. It was also designed with a Kpnl site for directional cloning in an expression vector. Plasmid Pseudomonas fluorescens. Oligo "F2new" was designed to direct the amplification of the 5 'end of the 44 kDa gene. It also includes a ribosome binding sequence and a Spel cloning site. AND! Oiigo "R2new" was designed to direct amplification from the 3 'end of the 44 kDa gene and to hybridize with the 5' end of the 14 kDa gene. The two genes were first amplified independently from PS149B1 genomic DNA; the 14 kDa gene using "F1 new" and "R1new", and the 44 kDa gene using "F2new" and "R2new". The products were then combined in a PCR tube and amplified together using "R1 new" and "F2new". At this point Herculase ™ Enhanced Polymerase Blend (Stratagene, La Jolla, CA) was used at a warm temperature of 48 ° C to amplify a ~ 1.5 kb DNA fragment, which contained the gene fusion. This fraction of DNA was subsequently digested using Kpnl and Spel, it was fractionated on agarose gels and purified by electroelusion. The plasmid vector was also digested with Kpnl and Spel, fractionated on agarose gels, purified by electroelusion and treated with phosphatase. Then the vector and the insert were ligated together overnight at 14 ° C. The ligated DNA fragments were transformed into MB214 P.f cells by electroporation and selection overnight in LB + tetracycline plates (30 ug / mL). The strains containing the gene fusion were identified by PCR diagnosis and sequenced for verification of a successful gene splice. A representative strain containing the cloned gene fusion was designated MR1607; the recombinant plasmid was designated pMYC2475. A subculture of MR1607 was deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Illinois Peoria 61604 USA &, August 8, 2000. Accession number is NRRL B-30302. MR1607 was cultured and protein production was verified by SDS-PAGE and immunoblotting. A ~ 58 Kda protein band representing the fusion product of 44 kDa + 14 kDa was identified which was identified when Western blots were probed with antibodies specific for either 14 kDa or 44 kDa toxins. The sequences of the 58 kDa protein are provided in SEQ ID NO: 159. The DNA sequence for gene fusion is provided in SEQ ID NO: 160.

EXAMPLE 23 Binary homologous mixture study Development of homologous strains Four strains were selected, one from each major family of binary toxins - 149B1, 80JJ1, 201 L3, and 167H2. In order to reduce the time consumed in purifying proteins from individual toxins, the following Pseudomonas fluorescens (P.f) clones were cultured instead: MR1253, (14 kDa from 149B1) and MR1256 (44 kDa from 149B1). In a similar manner, the clones of B.t. MR541 (expressing 14 kDa of 80JJ1) and MR542 (44 kDa of 80JJ1). Strains of B.t. were cultured as described in Example 1. The granules were washed three times with water and stored at 20 ° C until needed. Strains P.f. in batches of 10 L in Biolafitte termendores using conventional procedures. The granules were stored at 80 ° C until needed.

Extraction and purification of toxins Purification of 167H2, MR541, MR542, 201L3. Extractions of cell granules were performed using 100 mM sodium citrate pH regulator at pH comprised from 3.0 to 5.5. In a typical extraction, granules were extracted in a pH regulator volume of 1/10 to 1/3 X of the original culture volume. The granules were suspended in the pH regulator and placed on a stirred platform at 4 ° C for periods ranging from 2.5 hours to one night. The extracts were then centrifuged and the supernatants were retained. This procedure was repeated with each strain until approximately 10 mg of each protein was obtained. SDS-PAGE confirmed the presence / absence of protein toxins in the extracts through the use of the NuPAGE Bis / Tris gel system (Invitrogen). Samples were prepared according to the manufacturer's instructions and loaded onto 4-12% gels and electrophotograms were developed with MES pH regulator. The exception for this procedure was the preparation of all 201 L3 samples. These samples were prepared by dilution of? X with pH regulator sample BioRad Laemmli and heated at 95 ° C for four minutes. The quantification of proteins was carried out by densitometry by ge! with laser scanning with BSA as a model (Molecular Dynamics Personal Densitometer SI). The extracts were clarified by filtration through a 0.2 m membrane filter and stored at 4 ° C. Purification of MR1253 & MR1256. The recombinant proteins MR1253 and MR1256 correspond to the 14 and 44 kDa proteins of 149B1 respectively and were prepared as solubilized inclusions. The inclusion bodies were prepared using conventional procedures. The inclusion bodies were solubilized in 1 mM EDTA, 50 mM sodium citrate at pH 3.5. Purification of individual toxins, 167H2 & 201 L3. All extracts that were known to contain 14 or 44 kDa or both were combined. This combined extract was dialyzed against 100 mM sodium citrate, 150 mM NaCl, pH4. The dialysis tube was from Pierce (Snakeskin 10k MWCO). Usually the samples were dialyzed for about 6 hours and then again overnight at the fresh pH regulator. The extracts were then concentrated with Centriprep 10 or Centricon Plus-20 (Biomax - 5.5000 NMWL) centrifugal filter devices (Millipore), quantified for the 14 kDa and 44 kDa proteins and subjected to gel filtration chromatography. In the preparation for chromatography, all samples and pH regulators were filtered through a 0.2μm filter and degassed. The samples were then applied to a HiPrep 26/60 Sephacryl S-100 gel filtration column which had been equilibrated with two bed volumes of the separation pH buffer, 100 mM sodium citrate, 150 mM NaCl, pH 4.0 . The sample volumes were between 5 - 10 ml. An AKTA purifier from the 100 FPLC system (Amersham Pharmacia) controlled the assays. Chromatography was carried out at room temperature. The pH regulator flow through the column during the test was maintained at 0.7 ml / min. Proteins were detected by UV absorbance monitoring at 280 nm. Fractions were collected and stored at 4 ° C. Fractions that contained the 14 or 44 kDa protein, were pooled and the purity was monitored by SDS-PAGE as described above.

For samples 167H2, two large peaks were detected and separated well from each other at the baseline. The SDS-PAGE of the fractions showed that each peak represented one of the protein toxins. In the 201 L3 sample, three well-defined peaks and a steep peak were detected. SDS-PAGE revealed that the first peak represented the 100 kDa protein in addition to an 80 kDa protein. The second peak represented the 44 kDa protein, while the tilted peak was a 40 kDa protein. The third peak was the 14 kDa protein. Fractions with 44 kDa from both samples were combined, as well as all fractions containing 14 kDa. The 149B1 proteins had been obtained individually through Pf MR1253 and MR1256 clones and therefore no further purification was necessary. Similarly, the recombinants of 80JJ1, MR541 and MR542 produced the individual 14 and 44 kDa proteins thus obviating further purification.

Preparation of the sample for the wCRW bioemsavo LCm Dialysis. Protein samples of individual binary toxins were dialyzed against 6 L of 20 mM sodium citrate at pH 4.0. The first dialysis proceeded for several hours and the samples were transferred to fresh pH regulator and left to dialyze overnight. Finally, the samples were transferred to a fresh pH regulator and dialyzed several more hours.

The protein sample sources were either the combined gel filtration fractions (167H2, 201 L3), granule extracts (MR541, MR542), or inclusion granule extracts (MR1253, MR1256). All samples were filtered through 0.2 um membranes to sterilize. Concentration: The samples were concentrated with centrifugal filter devices Centrícon Plus-20 (Biomax-5,5000 NMWL) (Millipore). Quantification: Samples were quantitated for the protein as before. To comply with the CL5o bioassay requirements, a minimum of 6 mg of each toxin protein was required at a concentration range of 0.316-1.36 mg / ml for the different combinations. If necessary, the samples were concentrated as before or diluted with a pH regulator (20 mM sodium citrate, pH 4.0) and quantified again. Binary Mixtures / CLso Bioassay - For each of the four strains, 14 kDa was combined with an amount of 44 kDa from each strain to obtain a mass ratio of 1/1. The upper dose was 50 μg / cm2 for the mixtures, with the exception of mixtures with the 14 kDa protein of 203J1. The higher doses of mixture with these proteins were only 44 μg / cm2. For the controls, each protein was subjected individually, as well as the extract pH regulator, 20 mM sodium citrate, 4.0 sodium citrate. Native combinations were also tested (ie 14 kDa + 44 kDa of 149B1). All toxin combinations and pH regulator controls were evaluated three times by biosensing against the western corn rootworm, while the individual toxins were tested only once. The results are reported below in Table 15 (Results of LC50 for combinations of toxins) and Table 16 (Comparison of potencies of strains for 149B1).

TABLE 15 TABLE 16 Comparison of strain strengths for 149B1 The results are also shown graphically in figure 3. The native combinations were highly active against the western corn rootworm, except for 201 L3. However, the 44 kDa of 201 L3 was active when combined with either 14 kDa of 16712 or 149B1. Other active combinations were 149B1 14 kDa with either 80JJ1 or 167H2 44 kDa, the latter being more active than the native 149B1 mixture. No dose response was observed for any of the individual proteins, or for the pH regulator and water controls.

EXAMPLE 24 Southern corn root worm control with PS149B1 14kDa proteins A powder containing approximately 50% (w / w) of a 14 kDa d-endotoxin originally discovered in strain PS149B1 of Bacillus thuringiensis, was isolated from a recombinant strain of Pseudomonas fluorescens (MR1253). This powder was evaluated for its insecticidal activity using the following procedure. An artificial diet for insects was provided (R. Rose and J.

M. McCabe (1973), "Laboratory rearíng techniques for rearing corn rootwom" J. Econ. Entomol 66 (2): 398-400) at a rate of -0.5 mUreceptance in 128 receptacle tray bioassay trays (C-D International, Pilman, NJ) to produce a surface area of -1.5 cm2. PH buffer suspensions (10 mM potassium phosphate, pH 7.5) of the 14 kDa powder protein were applied to the surface of the artificial diet for insects at a rate of 50 μl / well and the surface of the powder was allowed to dry. diet. PH regulator controls were also included in each trial. A single root worm of the southern neonate, Diabrotica undecimpunctata howardi, was placed in each of the receptacles and the receptacles with caps that were provided along with the trays were covered. The bioassays were maintained for 6 days at 28 ° C, after which the live larvae were weighed as a group for treatment. The percentage of growth inhibition was calculated by subtracting the weight of the live insects from each of the weight treatments of the live control insects and then dividing it among the control weight. This result was multiplied by 100 to convert the quantity to a percentage. Growth inhibition was calculated for each of five trials, each containing 16 insects per treatment and inhibition of growth was averaged through the tests. The results showed that the 14 kDa protein inhibited the growth of southern corn rootworms in a manner that depended on concentration. Table 17 shows the growth inhibition of the southern corn rootworm with the 14 kDa PS149B1 protein.

TABLE 17 ia = active ingredient EXAMPLE 25 Control of European corn borer insect and corn cob worm with PS149B1 binary toxin.

A powder containing 54% of a 14 kDa d-endotoxin, and another powder containing 37% of a 44 kDa d-endotoxin, both originally discovered in Bacillus thuringiensis strain PS149B1 were isolated from strains Pseudomonas fíuorescens MR1253 and MR1256, respectively. Mixtures of such powders were evaluated for insecticidal activity using the following procedure: An artificial diet for insects was provided (Rl Rose and JM McCabe (1973), "Laboratory rearing techniques for rearing with rootworm," J. Econ. Entomol. 66 (2): 398-400 a - 0.5 mL in 128 receptacle bioassay trays (CD Internartional, Pitman, NJ), - 1.5 cm2 to produce a surface area of ~ 1.5 cm2 pH regulator suspensions were mixed ( 10 mM potassium phosphate, pH 7.5) of the powdered proteins, and then applied to the artificial insect diet surface at 50 μl / well, the surface of the diet was allowed to dry. pH in each trial A single neonatal larva was placed in each receptacle, and the receptacles were sealed with caps that were provided with the trays The tests were carried out with the European corn borer insect Ostrinia nubilalis, and the corn cob worm Helicoverpa zea (both are lepidoptera). The bioassays were carried out for six days at 28 ° C after which time the live larvae were weighed as a group for each treatment. Percent growth inhibition was calculated by subtracting the weight of live insects in each treatment from the weight of live control insects, and then dividing by weight control. This result was multiplied by 100, to convert the number to a percentage. Growth inhibition was calculated for each of the four assays each containing 14 to 16 insects per treatment, and inhibition of growth was averaged across the tests. The results showed that the 14 kDa protein inhibited the growth of European corn borer insects and corn cob worms in a concentration dependent manner. Table 18 shows the growth inhibition of corn cob worm (CEW) and European corn borer insect (ECB) with mixtures of PS149B1 protein.

TABLE 18 Protein concentration of 14% growth inhibition kDa + 44-kDa in μg ai / cm2 CEW ECB 3.7 + 11 42 59 11 + 33 57 77 33 + 100 61 89 ia = active ingredient EXAMPLE 26 Additional characterization of 45 kDa proteins and primer design to identify additional polynucleotides and proteins The present invention includes not only the sequences specifically exemplified. Portions of the present genes and toxins may be used to identify other genes and related toxins. Therefore, the present invention includes polynucleotides that encode proteins or polypeptides comprising at least 10 contiguous amino acids, for example of any of the proteins or polypeptides of the binary type, included in the list of sequences annexed and described herein. Other embodiments include polynucleotides that encode for example at least 20, 30, 40, 50, 60, 70, 80, 90 and 100 contiguous amino acids of a protein exemplified herein; and these amounts are also applied in a manner similar to the contiguous nucleotides of an exemplified polynucleotide. The proteins encoded by said polynucleotides are included in the present invention. Likewise, polynucleotides comprising contiguous nucleotides (which code for proteins or polypeptides comprising polypeptides of these approximate sizes) are included in the present invention. Although still very different, toxins more "close" to those of the present invention are believed to be the 51 and 42 kDa mosquitocidal proteins of Bacillus sphaericus. Figures 4 and 5 of protein alignments and nucleotide sequence alignments of the 51 and 42 kDa toxin and sphaericus genes and toxins and 149 kb 45 kDa genes are attached. Two blocks of the sequences are highlighted in the nucleotide alignment in which primers could be prepared. A PCR primer pair given as an example is included below, and in the 5'-3 'orientation (45 kDa3're shown as the complement). These initiators have been used successfully to identify additional members of the 45 kDa binary family. Fully redundant sequences and a prophetic pair are also included below. 45 kD5 ': GAT RAT RAT CAA TAT ATT ATT AC (SEQ ID NO: 161) 45 kD3're: CAA GGT ART AAT GTC CAT CC (SEQ ID NO: 162). The sequences would be useful as a written sequence and as an inverse complement (03 and 04 are complementary for 45 kD3're, the inverse initiator exemplified). 45 kD5'01: GAT GATGrTmrAk ww ATTATTrC A (SEQ ID NO: 163). 45kD3'03: GAT GATGrTmrAT ATATTATTrC A (SEQ ID NO: 164). 45kD3'04: GGAwG krCdyTwdTm CCwTGTAT (SEQ ID NO: 165). 45kD3'04: GGAwG kACryTAdTA CCTTGTAT (SEQ ID NO: 166). With reference to the manner in which sphaericus toxins were identified, a BLAST database research (Altschut et al., (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein datbase search programs," Nucleic Acids Res. 25: 3389-3402) using the 149 kDa protein of 45 kDa, found matings with the crystal inclusion protein of f. Spahericus of 42 kDa (result of expectation 3 * 10"14) and the inclusion protein of crystals of Sphaericus of 51 kDa (result of expectation 3+ 10" 9). An alignment of the peptide sequence of 149B1 of 45 kDa with the inclusion alignment of crystals of f. Sphaericus of 42 kDa resulted in an alignment that had 26% identity over 325 residues. The alignment result is 27.2 sd above the average result of 100 random alignments. A similar analysis of the peptide sequence 149B1 of 45 kDa for the inclusion of crystals of fí. Sphaericus of 42 kDa results in an alignment that has 29% identity over 229 residues. The result of alignment is 23.4 sd above the average result of 100 random alignments. The results of the alignments > 10 sd above the average of the random alignments have been considered significant (Lipman, D.J. and Pearson, W.R. (1985), "Rapid and sensitive similarity searches," Science 227: 1435-1441; Doolíttle, R.F. (1987), Of URFs and ORFs: a first on how to analyze derived amino acid sequences, University Science Books, Mili Valley, CA). As a reference, sequences of structurally similar proteins CrylAa, Cry2Aa and Cry3Aa were compared in the same manner. Cry2Aa vs. CryAa and Cry2Aa vs. Cry3Aa share 29% and 7% identity over 214 and 213 residues, respectively, with alignment results of 32.2 sd and 29.5 sd above the average result of 100 random alignments. An alignment of the 149 kDa protein sequence of 45 kDa and the sequence of the Cry2Aa protein resulted in an alignment within 1 sd of the average of 100 random alignments. The following comparisons were also observed: TABLE 19 * based on 100 random alignments. For additional comparative purposes, and for an additional initiator design, the following references are indicated: Oeí et al. (1992), "Bindíng of purified Bacillus sphaericus binary toxin and its deletíon derivatives to Culex quinquefasciatus gut: elucidation of functional binding domains," Journal of General Microbiology 138 (7): 1515-26. For the 51 kDa: 35-448 is active; 45-448 is not; 4-396 is active; 4-392 it is not. For the 42 kDa; 18-370 is active; 35-370 is not; 4-358 is active; 4-349 no! Or is. The work was carried out with purified GST fusions and dissociated with thrombin. All truncations were tested with = other intact units. All deletions had some loss of activity. The P51 deltaC56, joins but does not incorporate 42. P51 delta N45 does not join. Only 45 kDa + 51 kDa are incorporated. Both 42 kDa non-toxic N-terminal proteins did not bind to the 51 kDa protein or the 51 IDa receptor complex. Davidson et al., 81990), "Interaction of the Bacillus sphaericus mosquito larvicidal proteins," Can J. Microbiol. 36 (12): 870-8. N-protein terms purified with SDS-PAGE obtained from f. sphaericus S29 and N31 of 51 kDa and S9 of 42 kDa in complexes of 68-74 kDa (not reduced).

S9 and S29 of 51 and N31 of 42 of the 51 kDa band (not reduced). In reduced gels, the 45 kDa band had S29 and N31 of the 51 kDa band and the 39 kDa band contained S9 of the 42 kDa protein. Baumann et al., (1988), "Sequence analysis of the mosquitocidal toxin genes encodin 51, 4- and 41, 9-kilodalton proteins from Bacillus sphaericus 2362 and 2297," J. Bacteriol. 17: 2045-2050. The N-terms of 41, 9 kDa in D5 of the protease f. sphaericus and 111 of crimotripsina; C-term after R349 with trypsin. Regions of enhanced similarity were identified that correspond to many of the precedents. Blocks of similar sequences from A to D between the proteins of 51 to 42 kDa. In summary, the toxins discussed above are intended to be included in the scope of the present invention (in fact they are specifically excluded). In this sense, divergent contiguous sequences, such as those exemplified in the alignments (Figures 4 and 5) discussed above, can be used as primers to identify toxins that are suggested but not specifically exemplified herein. However, conserved contiguous sequences as shown in the alignments, can also be used in accordance with the present invention to identify other new binary toxins of the 15/45 kDa type (which are active against the corn rootworm and others). pests).

EXAMPLE 27 Insertion and expression of toxin genes in plants One aspect of the present invention is the transformation of plants with polynucleotides of the present invention that express proteins of the present invention. The transformed plants are resistant to the attack of the target pests. The new genes active against the corn rootworm described here can be optimized to be expressed in other organisms. For example, the optimized gene sequences of the corn encoding PS80JJ1 toxins of 14 and 44 kDa have been described in SEQ ID NO: 44 AND SEQ ÍD NO: 45, respectively. The genes encoding pesticidal toxins, as described herein, can be inserted into plant cells using a variety of techniques that are well known in the art. For example, a large number of cloning vectors comprising a replication system in E. coli and a marker allowing the selection of transformed cells are available for the preparation of the insertion of foreign genes into higher plants. The vectors include, for example, the series pBR322, pUC, series M13mp, pAYC184, etc. Accordingly, the sequence coding for the B.t. toxin. it can be inserted into the vector at an appropriate restriction site. The resulting plasmid is used for transformation in E. coli. E. coli cells are grown in an appropriate nutrient medium, and then they are harvested and used. The plasmid is recovered. Sequence analysis, restriction analysis, electrophoresis and other biological, biochemical and / or molecular methods are generally carried out as methods of analysis. After each manipulation, the DNA sequence used can be dissociated and linked to the next DNA sequence. Each plasmid sequence can be cloned in the same or in other plasmids. Depending on the method for inserting the desired genes into the plant, other DNA sequences may be necessary. For example, if the plasmid Tí or Ri is used for the transformation of the plant cell, then at least the right boundary but often the right and left boundary of the T-DNA plasmid, Ti or Rí, must be bound as a region flanking the genes that must be inserted. The use of T-DNA for the transformation of plant cells has been intensively researched and sufficiently described in EP 120 516; Hoekema (1985); The Binary Plant Vector System, Offset-durkkerij Kanters B.B., Alblasserdam, Chapter 5; Fraley et al., Crit. Rev. Plant Sci. 4: 1-46; and An et al. (1985) EMBO J. 4: 277-287. Once the inserted DNA has been integrated into the genome, it is relatively stable there and generally does not disintegrate again. It usually contains a selection marker that confers on the cells of the transformed plant resistance to a biocide or an antibiotic, such as kanamycin, G. 418, bleomycin, hrythromycin, or chloramphenicol, among others. The individually used marker should therefore allow the selection of transformed cells instead of cells that do not contain the inserted DNA. A large number of techniques are available to insert DNA into a plant host cell. These techniques include transformation with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation, fusion, injection, biolistic (bombardment of microparticles) or electroporation agent, as well as other possible methods. If agrobacteria are used for transformation, the DNA to be inserted must be cloned into specific plasmids, that is, into an intermediate vector or a binary vector. Intermediary vectors can be integrated in e! Ti or Rl plasmid by homologous combination because the sequences are homologous to the sequences in the T-DNA. The Ti or Ri plasmid also comprises the vir region necessary for the transfer of the T-DNA. Intermediary vectors can not replicate themselves in Agrobacteria. The intermediate vector can be transferred to Agrobacterium tumefaciens by means of an auxiliary plasmid (conjugation). Binary vectors can replicate themselves in both E. coli and Agrobacteria. They comprise a selection marker gene and linker or polylinker that is configured by the right and left border regions of the T-DNA. They can be transformed directly into Agrobacteria (Holsters et al. [1978] Mol. Gen. Genet 163: 181-187). The Agrobacterium used as a host cell comprises a plasmid carrying a viral region. The vir region is necessary for the transfer of T-DNA into the cell of the plant. It may contain additional T-DNA. The bacteria thus transformed is used for the transformation of plant cells. Plant explants can be advantageously grown with Agrobacterium tumefaciens or Agrobacterium rhizogenes for the transfer of DNA into plant cells. Whole plants can be regenerated from an infected plant material (e.g., piece of leaves, stem segments, roots, but also in cells grown in protoplasts or suspensions) in an appropriate medium, which may contain antibiotics for selection. The plants thus obtained can then be tested to determine the presence of the inserted DNA. No special requirements are needed for plasmids in the case of injection and electroporation. It is possible to use common plasmids such as for example pUC derivatives. The transformed cells develop inside the plants in the usual manner. They can form germinating cells and transmit transformed traits to progeny plants. Said plants can be grown in a normal way and can be crossed with plants that have the same transformed hereditary factors or other hereditary factors. The resulting hybrid individuals have the corresponding phenotypic properties. In a preferred embodiment of the present invention, plants transformed with genes where codon usage has been optimized for plants. See, for example, the U.S. Patent. No. 5,380,831, which is incorporated herein by reference. Also, advantageously, plants coding for a truncated toxin will be used. The truncated toxin will typically code about 55% to about 80% of total length. The methods for creating B.t. genes Synthetics for use in plants are known in the art.

EXAMPLE 28 Cloning of B.t genes in insect viruses A number of viruses that infect insects are known. These viruses include, for example, baculoviruses and entomopoxviruses. In one embodiment of the present invention, the genes encoding the insecticidal toxins described herein, can be placed within the genome of the insect virus thereby improving the pathogenicity of the virus. Methods for the construction of the insect virus that comprise B.t. toxin genes. they are well known and can be easily implemented by those skilled in the art. These procedures have been described for example in Merryweather ef al. (Merryweather, A.T., U. Weyer, M.P.G. Harris, M. Hirst, T.

Booth, R.D. Possee (1990) J. Gen. Virol. 71: 1535-1544) and Martens et al.

(Martens, J.W.M. G. Honee, D. Zuidema, J.W.M. van Lent, B. Visser, J.M. Vlak (1990) Appl. Environmental Microbiol. 56 (9): 2764-2770). All patents, patent applications, provisional applications and publications referenced or cited herein are incorporated by reference in their entirety to the extent that they are not inconsistent with the explicit teachings of this specification. It should be understood that the examples and embodiments described herein are given for illustrative purposes only and that various modifications or changes in view thereof may be suggested by experts in the art and may be included within the spirit and competence of this application and the scope of the invention. the attached claims.

LIST OF SEQUENCES < 110 > Mycogen Corporation < 120 > Pesticide proteins < 130 > MA-703C3 < 140 > < 1_1 > < 150 > 09 / 378,088 < 151 > 1999-08-20 < 160 > 166 < 170 > Patentln Ver. 2.1 < 210 > 1 < 211 > 5 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 1 10 Met Leu Asp Thr Asn 1 5 < 210 > 2 < 211 > 25 < 212 > PRT 213 > Bacillus thurin > jiensis < 400 > 2 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn Leu Wing Asn Gly 1 5 10 15 ? C Leu Tyr Thr Ser Thr Tyr Leu Ser Leu 20 25 < 210 > 3 < 211 > 2 < 212 > PRT < 213 > Bacill us thuringi ensis < 00 > 3 Be Ala Arg Glu Val His He Glu He Asn Asn Thr Arg His Thr Leu 1 5 10 15 Gln Leu Glu Ala Lys Thr Lys Leu 0 20 < 210 > 4 < 211 > 25 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 4 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Ala Ala Thr Tyr Leu Ser Leu 20 25 < 210 > 5 < 211 > 50 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT SECURE 222 > (35) < 223 > Amino acid not determined < 400 > 5 Be Wing Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His Thr 1 5 10 15 Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg Thr 20 25 30 Ser Pro Xaa Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing Glu 35 40 45 Ser Asn 50 < 210 > 6 < 211 > 25 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 6 Met Leu Asp Thr Asn Lys He Tyr Glu He Ser Asn Tyr Wing Asn Gly 1 5 10 15 Leu His Ala Ala Thr Tyr Leu Ser Leu 20 25 < 210 > 7 < 211 > 25 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 7 Be Wing Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His Thr 1 5 10 15 Leu Gln Leu Glu Asp Lys Thr Lys Leu 20 25 < 210 > 8 < 211 > 29 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (4) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (6) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (12) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 22 > (21) < 223 > Any nucleotide < 400 > 8 ar.gntngata cnaataaagt ntatgaaat 29 < 210 > 9 < 211 > 26 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 9 ggattatcta tctctgagtg ttcttg 26 < 210 > 10 < 211 > 1158 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 10 atgttagata ctaataaagt ttatgaaata agcaatcttg ctaatggatt atatacatca 60 gtcttgatga acttatttaa agtttaatga ttcaggtgtt gtaaaaagga tgaagatatt 120 atttaaaatg gatgattaca cctattgata gtttttattt tattattaca ataatcaata 180 agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat aaatgtttca 240 caacaaactc acttattctt tgtacaaaaa tggcaaataa aagctaaaga ttcttcatat 300 ataatacaaa gtgataatgg aaaggtctta acagcaggag taggtcaatc tcttggaata 360 gtacgcctaa ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta 420 caaacaattc aactcccaca atagatgaaa aaaacctaaa aattaaaaga tcatcctgaa 480 tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgattcaaaa atagataaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atataaatac tggaatctag caaaaggaag taatgtatct 660 ttacttccac atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720 acaactatta ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa 780 gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga agaattaaaa 840 gttgaatata gcactga aac caaaataatg acgaaatatc aagaacactc agagatagat 900 atcaaccaat aatccaacta gaattctata ggacttctta tttagaatta tttatacttc 960 acggtacaga tatcgatata aattaagata atggacatag aaacttcaga tcatgatact 1020 tacactctta cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattcg 1080 tatgaagaag tagaagaaat aacaaaaata cctaagcata attgaaaaaa cacttataaa cattatttta aaaaataa 1140 1158 < 210 > 11 < 211 > 385 < 2i2 > PRT < 213 > Bacillus thuringiensis < 400 > 11 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn Leu Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Ser Lys Lys Asp Glu Asp He Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 _, ea Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 50 55 60 Asn _sn Cys Lys Val Trp Asn Val Lys Asn Asp Lys He Asn Val Ser 65 70 75 30 Thr Tyr Being Ser Thr Asn Being Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asp Being Ser Tyr He He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Val Gly Gln Ser Leu Gly He Val Arg Leu Thr Asp Glu Phe Pro 115 120 125 Glu Asn As Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Glu Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Asn Pro Lys Thr Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Ser Lys He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 195 200 205 Lys Tyr Trp Asn Leu Wing Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Arg Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Val Gly Leu Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp He Lys 260 265 270 Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu Thr Lys 275 280 285 He Met Thr Lys Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Pro Met Asn Ser He Gly Leu Leu He Tyr Thr Ser Leu Glu LPU 305 310 315 320 Tyr Arg Tyr Asn Gly Thr Glu He Lys He Met Asp He Glu Thr Ser 325 330 335 Asp His Asp Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 365 Lys He Pro Lys His Thr Leu He Lys Leu Lys Lys His Tyr Pb Lys 370 375 380 Lys 385 < 210 > 12 < 211 > 834 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 12 ggactatatg cagcaactta tttaagttta gatgattcag gtgttagttt aatgaataaa 60 aatgatgatg atattgatga ttataactta aaatggtttt tatttcctat tgatgatgat 120 caatatatta ttacaagcta tgcagcaaat aattgtaaag tttggaatgt taataatgat 180 aaaataaatg tttcgactta ttcttcaaca aattcaatac aaaaatggca aataaaagct 240 aatggttctt catatgtaat acaaagtgat aatggaaaag tcttaacagc aggaaccggt 300 caagctcttg gattgatacg tttaactgat gaatcctcaa ataatcccaa tcaacaatgg 360 aatttaactt ctgtacaaac aattcaactt ccacaaaaac tacaaaatta ctataataga 420 aaagattatc ccaaatattc accaactgga aatatagata atggaacatc tcctcaatta 480 atgggatgga cattagtacc ttgtattatg gtaaatgatc caaatataga taaaaatact 540 ctactccata caaattaaaa ttatatttta aatattggca aaaaaatatc acgagcagta 600 ggaagtaatg tagctttacg tccacatgaa aaaaaatcat atggggcaca atacttatga 660 gaaatagatc aaaaaacaac aattataaat acattaggat ttcaaatcaa tatagattca 720 ggaatgaaat ttgatatacc agaagtaggt ggaggtacag atgaaataaa aacacaacta 780 aatgaagaat taaaaataga atatagtcat gaaactaaaa taatggaaaa atat 834 < 210 > 13 < 211 > 278 < 212 > PRT < 213- Bacillus thuringi ensis < 400 > 13 Gly Leu Tyr Ala Ala Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser 1 5 10 15 Leu Met Asn Lys Asn Asp Asp Asp He Asp Asp Tyr Asn Leu Lys Trp 20 25 30 Phe Leu Phe Pro He Asp Asp Asp Gln Tyr He He Thr Ser Tyr Wing 35 40 45 Wing Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val 50 55 60 Ser Thr Tyr Ser Ser Thr Asn Ser He Gln Lys Trp Gln He Lys Wing 65 70 75 80 Asn Gly Be Ser Tyr Val He Gln Be Asp Asn Gly Lys Val Leu Thr 85 90 95 Wing Gly Thr Gly Gln Wing Leu Gly Leu He Arg Leu Thr Asp Glu Be 100 105 110 Being As Asn Pro Asn Gln Gln Trn Asn Leu Thr Ser Val Gln Thr He 115 120 125 Gln Leu Pro Gln Lys Pro He He Asp Thi Lys Leu Asp Tyr Pro 130 135 140 Lys Tyr Ser Pro Thr Gly Asn He Asp Asn Gly Thr Ser Pro Gln Leu 145 150 155 160 Met Gly Trp Thr Leu Val Pro Cys He Met Val Asn Aso Pro Asn He 165 170 175 Asp Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys 180 185 190 Tyr Gln Tyr Trp Gln Arg Wing Val Gly Ser Asn Val Wing Leu Arg Pro 195 200 205 His Glu Lys Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu He Asp Gln 210 215 220 Lys Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser 225 230 235 240 Gly Met Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He 245 250 255 Lys Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser His Glu Thr 260 265 270 Lys He Met Glu Lys Tyr 275 < 210 > 14 < 211 > 829 < 212 > DNA < 213 > Bacill us thuringiensis < 400 > 14 acttatttaa acatgcagca ttcaggtgtt gtttagatga ataaaaatga agtttaatga 60 tgatgatatt gatgactata atttaaggtg gtttttattt cctattgatg ataatcaata 120 tattattaca agctacgcag cgaataattg taaggtttgg aatgttaata atgataaaat 180 aaatgtttca acttattctt gatacagaaa caacaaactc tggcaaataa aagctaatgc 240 ttcttcgtat gtaatacaaa gtaataatgg gaaagttcta acagcaggaa ccggtcaatc 300 atacgtttaa tcttggatta cggatgaatc accagataat cccaatcaac aatggaattt 360 caaacaattc aactcctgta aactcccacc aaaacctaca atagatacaa agttaaaaga 420 ttaccccaaa tattcacaaa ctggcaatat agacaaggga acacctcctc aattaatggg 480 ataccttgta atggacatta ttatggtaaa tgatcccaat atagataaaa acactcaaat 540 ccatattata caaaactact ttttaaaaaa atatcaatat tggcaacaag cagtaggaag 600 taatgtagct ttacgtccgc atgaaaaaaa atcatatgct tatgagtggg gtacagaaat 660 acaactatca agatcaaaaa ttaatacatt aggatttcag attaatatag attcgggaat 720 gaaatttgat ataccagaag taggtggagg tacagatgaa ataaaaacac aattaaacga 780 atagaatata agaattaaaa gccgtgaaac caaaataatg gaaaaatat 829 < 210 > 15 < 211 > 276 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 15 His Ala Ala Thr Tyr Leu Ser Leu Asp Aso Ser Gly Val Ser Leu Met 1 5 10 15 Asn Lys Asn Asp Asp Asp Asp Asp Tyr Asn Leu Arg Trp Phe Leu 20 25 30 Phe Pro As Asp Asn Asn Gln Tyr He He Thr Ser Tyr Ala Wing Asn 35 40 45 Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser Thr 50 55 60 Tyr Ser Ser Thr Asn Ser He Gln Lys Trp Gln He Lys Wing Asn Wing 65 70 75 80 Be Ser Tyr Val He Gln Ser Asn Asn Gly Lys Val Leu Thr Wing Gly 85 90 95 Thr Gly Gln Ser Leu Gly Leu He Arg Leu Thr Asp Glu Ser Pro Asp 100 105 110 Asn Pro Asn Gln Gln Trn Asn Leu Thr Pro Val Gln Thr He Gln Leu 115 120 125 Pro Pro Lys Pro Thr He Asp Thr Lys Leu Lys Asp Tyr Pro Lys Tyr 130 135 140 Ser Gln Thr Gly Asn He Asp Lys Gly Thr Pro Pro Gln Leu Met Gly 145 150 155 160 Trp Thr Leu He Pro Cys He Met Val Asn Asp Pro Asn He Asp Lys 165 170 175 Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr Gln 180 185 190 Tyr Trp Gln Gln Wing Val Gly Ser Asn Val Ala Leu Arg Pro His Glu 195 200 205 Lys Lys Ser Tyr Wing Tyr Glu Trp Gly Thr Glu He Asp Gln Lys Thr 210 215 220 Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly Met 225 230 235 240 Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys Thr 2 5 250 255 Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser Arg Glu Thr Lys He 260 265 270 Met Glu Lys Tyr 275 < 210 > 16 < 211 > 7 < 212 > PRT < 213 > Unknown Body < 220 > < 223 > Description of Unknown Organism: Peptide < 400 > 16 Asp He Asp Asp Tyr Asn Leu 1 5 210 > 17 < 211 > 7 < 212 > PRT < 213 > Unknown Body < 220 > < 223 > Description of Unknown Organism: Peptide < 400 > 17 Trp Phe Leu Phe Pro He Asp 1 5 < 210 > 18 < 211 > 8 < 212 > PRT < 213 > Unknown Body < 220 > < 223 > Description of Unknown Organism: Peptide < 400 > 18 Gln He Lys Thr Thr Pro Tyr Tyr 1 5 < 210 > 19 < 211 > 6 < 212 > PRT < 213 > Unknown Body < 220 > < 223 > Description of Unknown Organism: Peptide < 400 > 19 Tyr Glu Trp Gly Thr Glu 1 5 < 210 > 20 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (6) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (12) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (21) < 223 > Any nucleotide < 400 > 20 gatatngatg antayaaytt n 21 < 210 > 21 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (9) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (15) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (18) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (21) < 223 > Any nucleotide < 400 > 21 tggtttttnt ttccnatnga n 21 < 210 > 22 < 211 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (6) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (12) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (15) < 223 > Any nucleotide < 400 > 22 caaatnaaaa cnacnccata ttat 24 < 210 > 23 < 211 > 18 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (3) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (6) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (12) < 223 > Any nucleotide < 400 > 23 tangantggg gnacagaa < 210 > 24 < 211 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (10) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (13) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (19) < 223 > Any ucleotide < 400 > 24 ataatatggn gtngttttna tttg 24 < 210 > 25 < 211 > 18 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (7) < 223 > Any nucleotide 220 > < 221 > misc_feature < 222 > (13) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (16) < 223 > Any nucleotide < 400 > 25 ttctgtnccc cantcnta 18 < 210 > 26 < 211 > 18 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 26 ctcaaagcgg atcg < 210 > 27 < 211 > 20 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 27 gcgtattcgg atatgcttgg 20 < 210 > 28 < 211 > 386"'12> PRT < 213 > Organism Unknown <; 220 > < 223 > Description of Unknown Organism: Frotein < 220 > < 221 > OR IT IS SAFE < 222 > (1) .. (20) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (34) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (36) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (38) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (46) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (54) .. (55) < 223 > Any amino acid < 220 > < 221 > IS NOT SAFE < 222 > (63) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (73) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (88) < 223 > Any amino acid < 220 > < 22i > IT IS NOT INSURANCE < 222 > (96) .. (97) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (101) < 223 > Any amino acid < 220 > ^ 221 > IT IS NOT INSURANCE < 222 > (105) * 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (114) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (117) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (120) .. (121) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (127) .. (129) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (131) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (139) < 223 > Any amino acid < 220 > < 221 > IS NOT SAFE < 222 > (147) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (150) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (153) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (158) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (160) < 223 > Any amino acid < 220 < 221 > IT IS NOT INSURANCE < 222 > (163) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (168) .. (170) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (172) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (181) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (189) .. (190) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (205) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (209) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (212) .. (213) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (215) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (220) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (222) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (225) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (227) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (230) < 223 > Any amino acid < 220 > < 221 ^ IT IS NOT INSURANCE < 222 > (237) .. (238) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (247) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (249) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (260) .. (261) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (269) .. (270) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (276) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (281) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (285), - < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (291) < 223 > Any amino acid < 220 > < 221 > IT IS NOT INSURANCE < 222 > (294) .. (386) < 223 > Any amino acid < 400 > 28 Xaa Xaa Xaa Xaa Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Xaa Lys Xaa Asp Xaa Asp Asp Tyr Asn Leu Xaa Trp Phe 35 40 45 Leu Phe Pro He Asp Xaa Xaa Gln Tyr He H <; Thr Ser Tyr Xaa Ala 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Xaa Asn Asp Lys He Asn Val Ser 65 70 75 80? Thr Tyr ger Ser Thr Asn geaa Q? N Lyg Tj-p gln jg Lyg £] _ £ Jgg 85 90 95 Xaa Ser Ser Tyr Xaa He Gln Ser Xaa Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Xaa Gly Gln Xaa Leu Gly Xaa Xaa Arg Leu Thr Asp Glu Xaa Xaa 115 120 125 Xaa Asn Xaa Asn Gln Gln Trn Asn Leu Thr Xaa Val Gln Thr He Gln 130 135 140 Leu Pro Xaa Lys Pro Xaa He Asp Xaa Lys Leu Lys Asp Xaa Pro Xaa 1 5 150 155 160 Tyr Ser Xaa Thr Gly Asn He Xaa Xaa Xaa Thr Xaa Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Xaa Pro Cys He Met Val Asn As Xaa Xaa He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Xaa Lys Lys Tyr 195 200 205 Xaa Tyr Trp Xaa Xaa Ala Xaa Gly Ser Asn Val Xaa Leu Xaa Pro His 210 215 220 Xaa Lys Xaa Ser Tyr Xaa Tyr Glu Trp Gly Thr Glu Xaa Xaa Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Xaa Gly Xaa Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Xaa Xaa Pro Glu Val Gly Gly Gly Thr Xaa Xaa He Lys 260 265 270 Thr Gln Leu Xaa Glu Glu Leu Lys Xaa Glu Tyr Ser Xaa Glu Thr Lys 275 280 285 He Met Xaa Lys Tyr Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 290 295 300 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 305 310 315 320 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 325 330 335 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 340 345 350 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 355 360 365 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 370 375 380 Xaa Xaa 385 < 210 > 29 < 211 > 28 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 220 > < 221 > misc_feature < 222 > (2) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (8) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (14) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (20) < 223 > Any nucleotide < 400 > 29 gngaagtnca tatngaaatn aataatac 28 < 210 > 30, - < 211 > 2015 ^ < 212 > DNA < 213 > Baci ll us thuringiensis < 400 > 30 attaatttta tggaggttga tatttatgtc agctcgcgaa gtacacattg aaataaacaa 60 taaaacacgt catacattac aattagagga taaaactaaa cttagcggcg gtagatggcg 120 aacatcacct acaaatgttg ctcgtgatac aattaaaaca tttgtagcag aatcacatgg 180 ttttatgaca ggagtagaag gtattatata ttttagtgta aacggagacg cagaaattag 240 tttacatttt gacaatcctt atataggttc taataaatgt gatggttctt ctgataaacc 300 tgaatatgaa gttattactc aaagcggatc aggagataaa tctcatgtga catatactat 360 tcagacagta tctttacgat tataaggaaa atttataaaa actgtatttt ttactaaaat 420 accaaaaaat acatatttat tttttggtat tttctaatat gaaatatgaa ttataaaaat 480 attaataaaa aaggtgataa aaattatgtt agatactaat aaagtttatg aaataagcaa 540 0 tcttgctaat ggattatata catcaactta tttaagtctt gatgattcag gtgttagttt 600 aatgagtaaa aaggatgaag atattgatga ttacaattta aaatggtttt tatttcctat 660 tgataataat caatatatta ttacaagcta tggagctaat aattgtaaag tttggaatgt 720 taaaaatgat aaaataaatg tttcaac ta ttcttcaaca aactctgtac aaaaatggca 780 aataaaagct aaagattctt catatat at acaaagtgat aatggaaagg tcttaacagc 840 aggagtaggt caat ctcttg gaatagtacg cctaactgat gaatttccag agaattctaa 900 ccaacaatgg aatttaactc ctgtacaaac aattcaactc ccacaaaaac ctaaaataga 960 tgaaaaatta aaagatcatc ctgaatattc agaaaccgga aatataaatc ctaaaacaac 1020 atgggatgga tcctcaatta cattagtacc ttgtattatg gtaaatgatt caaaaataga 1080 caaattaaaa taaaaacact ttatattttt ctactccata aaaaaatata aatactggaa 1140 tctagcaaaa ggaagtaatg tatctttact tccacatcaa aaaagatcat atgattatga 1200 atggggtaca gaaaaaaatc aaaaaacaac tattattaat acagtaggat tgcaaattaa 1260 tatagattca ggaatgaaat ttgaagtacc agaagtagga ggaggtacag aagacataaa 1320. j. aacacaatta actgaagaat taaaagttga atatagcact gaaaccaaaa taatgacgaa 1380 '^ atatcaagaa cactcagaga tagataatcc aactaatcaa ccaatgaatt ctataggact 1440 tcttatttat acttctttag aattatatcg atataacggt acagaaatta agataatgga 1500 catagaaact tcagatcatg atacttacac tcttacttct tatccaaatc ataaagaagc 1560 attattactt ctcacaaacc attcgtatga agaagtagaa gaaataacaa aaatacctaa 1620 ataaaattga gcatacactt aaaaacatta ttttaaaaaa taaaaaacat aatatataaa 1680 tgactgatta atatctctcg aaaaggttct ggtgcaaaaa tagtgggata tgaaaaaagc 1740 aaaagattcc taacggaatg gaacattagg ctgttaaatc aaaaagttta ttgataaaat 1800 atatctgcct ttggacagac ttctcccctt ggagagtttg tccttttttg accatatgca 1860 tagcttctat tccggcaatc atttttgtag ctgtttgcaa ggattttaat ccaagcatat 1920 ccgaatacgc tttttgataa ccgatgtctt gttcaatgat attgtttaat attttcacac 1980 ctgtgcggta gaattggcta tcctgtctcc tttat 2015 0 210 > 31 < 211 > 360 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 31 gcgaagtaca atgtcagctc aacaataaaa cattgaaata attacaatta cacgtcatac 60 gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt 180 atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa tccttatata 240 ggttctaata aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc 300 ataaatctca ggatcaggag actattcaga tgtgacatat acgattataa cagtatcttt 360 < 210 > 32 < 211 > 119 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 32 Met Ser Wing Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Cys Asp Gly Ser Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln Thr Val Ser Leu? Rg Leu 115 < 210 > 33 «._11 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 33 catgagattt atctcctgat ccgc 24 < 210 > 34 < 211 > 2230 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 34 actatgacaa tgattatgac tgctgatgaa ttagctttat caataccagg atattctaaa 60 taacaggaga ccatcaaata taaaagtaaa catacattat ttactaatat aattggagat 120 attcaaataa aagatcaagc aacatttggg gttgtttttg atccccctct taatcgtatt 180 tcaggggctg aagaatcaag taagtttatt gatgtatatt atccttctga agatagtaac 240 cttaaatatt atcaatttat aaaagtagca attgattttg atattaatga agattttatt 300 aattttaata atcatgacaa tatagggata tttaattttg ttacacgaaa ttttttatta 360 atgattaata aataatgaaa aaaaatttaa tttgtataat atgtttattt tttgaaaatt 420 gaatgcatat attaatcgag tatgtgtaat aaattttaat tttatggagg ttgatattta 480 tgtcagcacg tgaagtacac attgatgtaa ataataagac aggtcataca ttacaattag 540 aagataaaac aaaacttgat ggtggtagat ggcgaacatc acctacaaat gttgctaatg 600 aacatttgta atcaaattaa gcagaatcac atggttttat gacaggtaca gaaggtacta 660 tatattatag tataaatgga gaagcagaaa ttagtttata ttttgacaat ccttattcag 720 atatgatggg gttctaataa cattccaata aaaatcaata tgaagttatt acccaaggag 780 tcaatctcat gatcaggaaa gttacgtata ctattcaaac tgtatcttca cgatatggga 840 ataattcata aaaaaa tatt tttttttacg aaaataccaa aaaaattttt ttggtatttt 900 ctaatataat tcataaatat tttaataata aaattataag aaaaggtgat aaatattatg 960 ataaaattta ttagatacta tgaaataagt aattatgcta atggattaca tgcagcaact 1020 tatttaagtt tagatgattc aggtgttagt ttaatgaata aaaatgatga tgatattgat 1080 gactataatt taaggtggtt tttatttcct attgatgata atcaatatat tattacaagc 1140 ataattgtaa tacgcagcga ggtttggaat gttaataatg ataaaataaa tgtttcaact 1200 tattcttcaa caaact gat acagaaatgg caaataaaag ctaatgcttc ttcgtatgta 1260 atacaaagta ataatgggaa agttctaaca gcaggaaccg gtcaatctct tggattaata 1320 cgtttaacgg atgaatcacc agataatccc aatcaacaat ggaatttaac tcctgtacaa 1380 tcccaccaaa acaattcaac acctacaata gatacaaagt taaaagatta ccccaaatat 1440 gcaatataga tcacaaactg caagggaaca cctcctcaat taatgggatg gacattaata 1500 tggtaaatga ccttgtatta gataaaaaca tccaaatata aactactcca ctcaaatcaa 1560 tattatattt taaaaaaata tcaatattgg caacaagcag taggaagtaa tgtagcttta 1620 cgtccgcatg aaaaaaaatc atatgcttat gagtggggta tcaaaaaaca cagaaataga 1680 actatcatta atacattagg att tcagatt aatatagatt atttgatata cgggaatgaa 1740 ccagaagtag gtggaggtac agatgaaata aaaacacaat taaacgaaga attaaaaata 1H00 gaatatagcc gtgaaaccaa aataatggaa aaatatcagg aacaatcaga gatagataat 1860 ccaactga c aatcaatgaa ttcctcacta ttctatagga ttacttcttt agaattatat 1920 cgatataatg gttcggaaat tagtgtaatg aaaattcaaa cttcagataa tgatacttac 1980 cttatccaga aatgtgacct tcatcaacaa gctctattac ttcttacaaa tcattcatat 2040 gaagaagtag aags.aataac aaatattccc aaaatatcac tgaaaaaatt aaaaaaatat 2100 tatttttaaa acataattat attttgatag ctttttaaaa ataaagattg ttcaaagtaa 2160 aatgaaagaa aatcttttat gaaactttaa tacaataaaa gaggaatatt ttcttataag 2220 tacttccttg 2230 < 210 > 35 < 211 > 372 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 35 gtgaagtaca atgtcagcac aataataaga cattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact 180 atatattata gtataaatgg agaagcagaa attagtttat tccttattca attttgacaa 240 ggttctaata aatatgatgg gcattccaat aaaaatcaat atgaagttat tacccaagga 300 atcaatctca ggatcaggaa tgttacgtat actattcaaa ctgtatcttc acgatatggg aataattcat 360 aa 372 < 210 > 36 < 211 > 123 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 36 Met Ser Wing Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Asn Gln Tyr Glu Val 85 90 95 He Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln Thr Val Ser Ser Arg Tyr Gly Asn Asn Ser 115 120 < 210 > 37 < 211 > 1152 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 3 'atgttagata ctaataaaat ttatgaaata agtaattatg ctaatggatt acatgcagca 60 gtttagatga acttatttaa agtttaatga ttcaggtgtt ataaaaatga tgatgatatt 120 gatgactata atttaaggtg gtttttattt cctattgatg ataatcaata tattattaca 180 agctacgcag cgaataattg taaggtttgg aatgttaata atgataaaat aaatgtttca 240 acttattctt caacaaactc gatacagaaa tggcaaataa aagctaatgc ttcttcgtat 300 gtaatacaaa gtaataatgg acagcaggaa gaaagttcta ccggtcaatc tcttggatta 360 atacgtttaa cggatgaatc accagataat cccaatcaac aatggaattt aactcctgta 420 caaacaattc aactcccacc atagatacaa aaaacctaca agttaaaaga ttaccccaaa 480 tattcacaaa ctggcaatat agacaaggga acacctcctc aattaatggg atggacatta 540 ttatggtaaa ataccttgta tgatccaaat atagataaaa acactcaaat caaaactact 600 ttttaaaaaa ccatattata atatcaatat tggcaacaag cagtaggaag taatgtagct 660 ttacgtccgc atgaaaaaaa atcatatgct tatgagtggg gtacagaaat agatcaaaaa 720 acaactatca ttaatacatt aggatttcag attaatatag attcgggaat gaaatttgat 780 ataccagaag taggtggagg tacagatgaa ataaaaacac aattaaacga agaattaaaa 840 atagaatata gccgtg AAAC caaaataatg gaaaaatatc aggaacaatc agagatagat 900 aatccaactg atcaatcaat ggattcctca gaattctata tttagaatta ctattacttc 960 atggttcgga tatcgatata aattagtgta atgaaaattc aaacttcaga taatgatact 1020 tacaatgtga cctcttatcc agatcatcaa caagctctat tacttcttac aaatcattca 1080 tatgaagaag tagaagaaat aacaaatatt cccaaaatat attaaaaaaa cactgaaaaa tattattttt aa 1140 1152 < 210 > 38 < 211 > 383 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 38 Met Leu Asp Thr Asn Lys He Tyr Glu He Ser Asn Tyr Wing Asn Gly 1 5 10 15 Leu His Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Asp Tyr Asn Leu Arg Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asn Gln Tyr He He Thr Ser Tyr Ala Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Wing Being Ser Tyr Val He Gln Ser Asn Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Thr Gly Gln Ser Leu Gly Leu He Arg Leu Thr Asp Glu Ser Pro 115 120 125 Asp Asn Pro Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Pro Lys Pro Thr He Asp Thr Lys Leu Lys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Gln Thr Gly Asn He Asp Lys Gly Thr Pro Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu He Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 I.ys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Gln Wing Val Gly Ser Asn Val Wing Leu Arg Pro His 210 215 220 Glu Lys Lys Ser Tyr Wing Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser Arg Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Ser Met Asn Be He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 tyr Ar9 tr Asn G1 Ser Qiu Ile Ser Val Met LYS Iie Gln thr Ser 325 330 335 Asp Asn Thr Tyr Asn Val Thr Ser Tyr Pro Asp His Gln Gln Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 365 Asn He Pro Lys He Ser Leu Lys Lys Leu Lys Lys Tyr Tyr Phe 370 375 380 < 210 > 39 < 211 > 2132 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 39 gtatttcagg gggtgaagat tcaagtaagt ttattgatgt atattatcct tttgaagata 60 gtaattttaa atattatcaa tttataaaag tagcaattga ttttgatatt aatgaagatt 120 ttattaattt taataatcat gacaatatag ggatatttaa ttttgttaca cgaaattttt 180 tattaaataa tgaaaatgat gaataaaaaa tttaatttgt ttattatgtt tattttttga 240 aaattgaatg catatattaa tcgagtatgt ataataaatt ttaattttat ggaggt ^ gat 300 atttatgtca gcacgtgaag tacacattga tgtaaataat aagacaggtc atacattaca 360 attagaagat aaaacaaaac ttgatggtgg tagatggcga acatcaccta caaatgttgc 420 taatgatcaa attaaaacat ttgtagcaga atcaaatggt tttatgacag gtacagaagg 480 tactatatat tatagtataa atggagaagc agaaattagt ttatattttg acaatccttt 540 tgcaggttct aataaatatg atggacattc caataaatct ttattaccca caatatgaaa 600 aggaggatca ggaaatcaat ctcatgttac gtatactatt caaaccacat cctcacgata 660 tcataacaaa tgggcataaa taatttttta cgaaaatacc aaaaaataaa tattttttgg 720 tattttctaa tataaattac aaatatatta ataataaaat tataagaaaa ggtgataaag 780 attatgttag atactaataa agtttatgaa ataagcaatc atgctaatgg actatatgca 840 gcaacttatt taagttt aga tgattcaggt gttagtttaa tgaataaeaa tgatgatgat 900 attgatgatt ataacttaaa atggttttta tttcctattg atgatgatca atatattatt 960 acaagctatg cagcaaataa ttgtaaagtt tggaatgtta ataatgataa aataaatgtt 102C tcgacttatt cttcaacaaa aaatggcaaa ttcaatacaa tggctcttca taaaagctaa 1080 tatgtaatac aaagtgataa tggaaaagtc ttaacagcag gaaccggt to agctcttgga 1140 ttgatacgtt taactgatga atcctcaaat aatcccaatc aacaatggaa tttaacttct 1200 gtacaaacaa ttcaacttcc acaaaaacct ataatagata caaaattaaa ac.attacccc 1260 aaatattcac caactggaaa tatagataat ggaacatctc ctcaattaat gggatggaca 1320 ttagtacctt gtattatggt aaatgatcca aatatagata aaaatactc aattaaaact 1380 atattttaaa actccatatt aaaatatcaa tattggcaac gagcagtagg aagtaatgta 1440 cacatgaaaa gctttacgtc aaaatcatat acttatgaat ggggcacaga aatagatcaa 1500 aaaacaacaa ttataaatac attaggattt caaatcaata tagattcagg aatgaaattt 1560 gatataccag aagtaggtgg aggtacagat gaaataaaaa tgaagaatta cacaactaaa 1620 atagtcatga aaaatagaat aactaaaata atggaaaaat atctgaaata atcaagaaca 1680 gataatccaa ctgatcaatc aatg aattct ataggatttc ttactattac ttccttagaa 1740 ttatatagat ataatggctc agaaattcgt ataatgcaaa ttcaaacctc agataatgat 1800 acttataatg ttacttctta tccaaatcat caacaagctt tattacttct tacaaatcat 1860 aagtagaaga tcatatgaag aataacaaat attcctaaaa gtacactaaa aaaattaaaa 1920 tttaaatatt aaatattatt gaaattagaa attatctaaa acaaaacgaa agataattta 1980 atctttaatt atttgtaaga taatcgtatt ttatttgtat taatttttat acaatataaa 2040 gtaatatctg tacgtgaaat tggtttcgct tcaatatcta atctcatctc atgtattaca 2100 tgcgtaatac cttcttgttc tgcttctaca AG 2132 < 210 > 40 < 211 > 372 < 212 > DNA < 213 > Bacillus thuríngiensis < 400 > 40 gtgaagtaca atgtcagcac cattgatgta aataataaga attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 aaacatttgt gatcaaatta agcagaatca aatggtttta tgacaggtac agaaggtact 180 atatattata gtataaatgg agaagcagaa attagtttat tccttttgca attttgacaa 240 ggttctaata aatatgatgg acattccaat aaatctcaat atgaaattat tacccaagga 300 atcaatctca ggatcaggaa tgttacgtat actattcaaa ccacatcctc acgatatggg cataaatcat 360 aa 372 < 210 > 41 < 211 > 123 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 41 Met Ser Wing Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Being Asn Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Phe Wing 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Ser Gln Tyr Glu He 85 90 95 He Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Th_: Tyr Thr He 100 105 110 Gln Thr Thr Ser Ser Arg Tyr Gly His Lys Ser 115 120 < 210 > 42 < 211 > 1241 < 212 > DNA < 213 > Bacillus thuringiensis < 220 > < 22l > misc_feature < 222 > (53) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (61) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (68) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (73) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (81) < 223 > Any nucleotide < 220 > < 221 > misc_feature < 222 > (18) < 223 > Any nucleotide < 400 > 42 wcdmtkdvrm ahkcmdndb ygtrawbmkg c tkctgyhd cywagmawtd cvnwmhasrt 60 nchhtmsn r manrgarcrr nwrgarhatg ttagatacta ataaagttta tgaaataagc 120 atggactata aatcatgcta tgcagcaact tatttaagtt tagatgattc aggtgttagt 180 ttaatgaata aaaatgatga tgatattgat gattataact taaaatggtt tttatttcct 240 attgatgatg atcaatatat tattacaagc tatgcagcaa at attgtaa agtttggaat 300 gttaataatg ataaaataaa tgtttcgact tattcttcaa caaattcaat acaaaaatgg 360 caaataaaag ctaatggttc ttcatatgta atacaaagtg ataatggaaa agtcttaaca 420 gcaggaaccg gtcaagctct tggattgata cgtttaactg atgaatcctc aaataatccc 480 aatcaacaat ggaatttaac ttctgtacaa acaattcaac ttccacaaaa acctataata 540 gatacaaaat taaaagatta tcccaaatat tcaccaactg taatggaaca gaaatataga 600 tctcctcaat taatgggatg ccttgtatta gacattagta tccaaatata tggtaaatga 660 ctcaaattaa gataaaaata aactactcca tattatattt taaaaaaata tcaatattgg 720 caacgagcag taggaagtaa tgtagcttta cgtccacatg aaaaaaaatc atatacttat 780 cagaaataga gaatggggca acaattataa tcaaaaaaca atacattagg atttcaaatc 840 eatatagatt caggaatg aa atttgatata ccagaagtag gtggaggtac agatgaaata 900 aaaacacaac taaatgaaga attaaaaata gaatatagtc atgaaactaa aataatggaa 960 aaatatcaag aacaatctga aatagataat ccaactgatc .atcaatgaa ttctatagga 1020 . ttcttacta ttacttcctt agaattatat agatetaatg gctcagaaat tcgtataatg 1080 caaattcaaa cctcagataa tgatacttat aatgttactt cttatccaaa tcatcaacaa 1140 gctttattac ttcttacaaa tcattcatat gaagaagtag aagaaataac aaatattcct 1200 aaaagtacac taaaaaaatt aaaaaaatat tatttttaav v 1241 < 210 > 43 < 211 > 383 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 43 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asp Gln Tyr He He Thr Ser Tyr Ala Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Gly Being Ser Tyr Val He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Thr Gly Gln Wing Leu Gly Leu He Arg Leu Thr Asp Glu Be Ser 115 120 125 Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro He He Asp Thr Lys Leu Lys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Pro Thr Gly Asn He Asp Asn Gly Thr Ser Pro Gln Leu Met r- 165 170 175 O Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Ty "Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Arg Wing Val Gly Ser Asn Val Ala Leu Arg Pro His 210 215 220 Glu Lys Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 0 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser His Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Ser Met Asn Be He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Gln He Gln Thr Ser 325 330 335 Asp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asn His Gln Gln Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 365 Asn He Pro Lys Ser Thr Leu Lys Lys Leu Lys Lys Tyr Tyr Phe 370 375 380 < 210 > 44 < 211 > 360 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 44 atgtccgccc gcgaggtgca catcgagatc aacaacaaga cccgccacac cctccagctc 60 gaggacaaga ccaagctctc cggcggcagg tggcgcacct ccccgaccaa cgtggcccgc 120 gacaccatca agacgttcgt ggcggagtcc cacggcttca tgaccggcgt cgagggcatc 180 atctacttct ccgtgaacgg cgacgccgag atctccctcc acttcgacaa cccgtacatc 240 ggctccaaca agtgcgacgg ctcctccgac aagcccgagt acgaggtgat cacccagtcc 300 acaagtccca ggctccggcg accatccaga cgtgacctac ccgcctctga ccgtgtccct 360 < 210 > 45 < 211 > 1158 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 45 atgctcgaca ccaacaaggt gtacgagatc tccaacctcg ccaacggcct ctacacctcc 60 acctacctct ccctcgacga ctccggcgtg tccctcatgt ccaagaagga cgaggacatc 120 gacgactaca acctcaagtg gttcctcttc ccgatcgaca acaaccagta catcatcacc 180 tcctacggcg ccaacaactg caaggtgtgg aacgtgaaga acgacaagat caacgtgtcc 240 acctactcct ccaccaactc cgtgcagaag tggcagatca aggccaagga ctcctcctac 300 atcatccagt ccgacaacgg caaggtgctc accgcgggcg tgggccagtc cctcggcatc 360 gtgcgcctca ccgacgagtt cccggagaac tccaaccagc aatggaacct caccccggtg 420 cagaccatcc agctcccgca gaagccgaag atcgacgaga agctcaagga ccacccggag 480 tactccgaga ccggcaacat caacccgaag accaccccgc agctcatggg ctggaccctc 540 tcatggtgaa gtgccgtgca cgactccaag atcgacaaga acacccagat caagaccacc 600 tcttcaagaa ccgtactaca atacaay ac tggaacctcg ccaagggctc caacgtgtcc 660 ctcctcccgc accagaagcg cagctacgac tacgagtggg gcaccgagaa gaaccagaag 720 accaccatca tcaacaccgt gggcctgcag atcaacatcg actcggggat gaagttcgag 780 gtgccggagg tgggcggcgg caccgaggac atcaagaccc agctcaccga ggagctgaag 840 gtggagtact ccaccga gac caagat.catg accaagtacc aggagcactc cgagatcgac 900 aacccgacca accagccgat gaactccatc ggcctcctca tctacacctc cctcgagctg 960 acggcaccga taccgctaca gatcaagatc atggacatcg agacctccga ccacgacacc 1020 tacaccctca cctcctaccc gaaccacaag gaggcgctgc tgctgctgac caaccactcc 1080 tacgaggagg tggaggagat caccaagatc ccgaagcaca ccctcatcaa gctcaagaag cactacttca agaagtga 1140 1158 < 210 > 46 < 211 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 46 gtagaagcag aacaagaagg tatt 24 < 210 > 47 < 211 > 25 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 47 atgtcagc c gygaagtwca yattg 25 < 210 > 48 < 211 > 23 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 48 gtytgaathg tatahgthac atg 23 < 210 > 49 < 211 > 25 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 49 atgttagata cwaataaart tatg 25 < 210 > 50 < 211 > 29 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 50 gtwatttctt c acttcttc atahgaatg 29 < 210 > 51 < 211 > 341 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 51 gagaagtaca atgtcaggtc aacaataaaa tattgaaata attacaatta cacgtcatac 60 gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt 180 atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa tccttatata 240 ggttctaata aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc 300 ggatcaggag ataaatctca tgtaacatat actattcaga c 341 < 210 > 52 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (389) < 223 > Not determined in the deduced amino acid sequence < 400 > 52 Met Ser Gly Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Cys Asp Gly Ser As Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 53 < 211 > 1103 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 53 atgttagata caaataaagt ttatgaaata agcaatcttg ctaatggatt atatacatcm 60 gtcttgatga acttatttaa agtttaatga ttcaggtgtt gtaaaaagga tgaagatatt 120 atttaaaatg gatgattaca cctattgata gtttttattt tattattaca ataatcaata 180 agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat aaatgtttca 240 caacaaactc acttattctt tgtacaaaaa tggcaaataa aagctaaaga ttcttcatat 300 ataatacaaa gtgataatgg aaaggtctta acagcaggag taggtcaatc tcttggaata 360 gtacgcctaa ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta 420 caaacaattc aactcccaca atagatgaaa aaaacctaaa aattaaaaga tcatcctgaa 480 tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgattcaaaa atagataaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atataaatac tggaatctag caaaaggaag taatgtatct 660 ttacttccac atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720 acamctatta ttaatacagt aggattgcaa attaatatag actcaggaat gaaatttgaa 780 gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga agaattaaaa 840 gttgaatata gcactga aac caaaataatg acgaaatatc aagaacactc agagatagat 900 aatccaacta atcaaccaat gaattctata ggacttctta tttacacttc tttagaatta 960 tatcgatata acggtacaga aattaagata atggacatag aaacttcaga tcatgatact 1020 tacactctta cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattca 1080 tatgaagaag tagaagaaat aac 1103 < 210 > 54 < 211 > 367 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (43) < 223 > Not determined in the deduced amino acid sequence < 220 > < 221 > IT IS NOT SECURE, - < 222 > (365) < 223 > Not determined in the deduced amino acid sequence < 400 > 54 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn Leu Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Ser Lys Lys Asp Glu Asp He Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 0 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asp Being Ser Tyr He He Gln Ser Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Va] Gly Gln Ser Leu Gly He Val Arg Leu Thr Asp Glu Phe Pro 115 120 125 'or Glu Asn As Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Glu Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Asn Pro Lys Thr Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Ser Lys He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 0 195 200 205 Lys Tyr Trp Asn Leu Wing Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Arg Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys 225 230 235 240 Thr Xaa He He Asn Thr Val Gly Leu Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp He Lys 260 265 270 Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu Thr Lys 275 280 285 He Met Thr Lys Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Pro Met Asn Ser He Gly Leu Leu He Tyr Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Thr Glu He Lys He Met Asp He Glu Thr Ser 325 330 335 A.'p His Asp Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He 355 360 365 < 210 > 55 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 55 gtgaagtaca atgtcagctc aataataaga tattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtc t 180 atatattata gtataaatgg agaagcagaa attagtttat atttcgataa tccttatt ^ 240 ggttctaata aatatgatgg ggattccaat aaacctcaat atgaagttac tacccaagga 300 atcaatctca ggatcaggaa tgtaacatat acgattcaaa c 341 < 210 > 56 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 56 Met Ser Wing Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly His He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly Asp Ser Asn Lys Pro Gln Tyr Glu Val 85 90 95 Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 57 < 211 > 1103 < 212 > DNA < 213 > Bacillus thuringiensis < 220 > < 221 > misc_feature < 222 > (1028) < 223 > Any nucleotide < 400 > 57 atgttagata ctaataaagt ttatgaaata agtaatcatg ctaatggact atatgcagca 60 gtttagatga acttatttaa ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 120 gatgattaca acttaaaatg gtttttattt cctattgatg tattattaca atgatcaata 180 agctatgcag caaataattg taaagtttgg aatgttaata atgataaaat aaatgtttcg 240 acttattctt taacaaattc aatacaaaaa tggcaaataa aagctaatgg ttcttcatat 300 gtaatacaaa gtgataatgg aaaagtctta acagcaggaa ccggtcaagc tcttggattg 360 atacgtttaa ctgatgaatc ttcaaataat cccaatcaac aatggaattt aacttctgta 420 caaacaattc aacttccaca atagatacaa aaaacctata ttatcccaaa aattaaaaga 480 tattcaccaa ctggaaatat agataatgga acatctcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgatccaaat atagataaaa atactcaaat tayaactact 600 ttttaaaaaa ccatattata atatcaatat tggcaacgag cagtaggaag taatgtagct 660 tcacgtccac atgaaaaaaa atcatatact tatgaatggg gaacagaaat agatcaaaaa 720 acaacaatca taaatacatt aggatttcaa atcaatatag attcaggaat saaatttgat 730 ataccagaag taggtggagg tacagatgaa ataaaaacac aactaaatga agaattaaaa 840 atagaatata gtcgtga aac taaaataatg gaaaaatatc aagaacaatc tgaaatagat 900 aatccaactg atcaaccaat gaattctata ggatttctta ctattacttc tttagaatta 960 tatagatata atggctcaga aattcgtata atgcaaattc aaacctcaga taatgatact 1020 tataatgnta cttcttatcc agatcatcaa caagctttat tacttcttac aaatcattca 1080 tatgaagaac tagaagaaat aac 1103 < 210 > 58 < 211 > 367 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (389) < 223 > Not determined in the deduced amino acid sequence < 400 > 58 Met Leu AsP thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asp Gln Tyr He He Thr Ser Tyr Ala Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Leu Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Gly Being Ser Tyr Val He Gln Being Asp Asn Gly Lys Val Leu Thr Wing c 100 105 110 O Gly Thr Gly Gln Wing Leu Gly Leu He Arg Leu Thr Asp Glu Be Ser 115 120 125 Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro He He Asp Thr Lys Leu Lys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Pro Thr Gly Asn He Asp Asn Gly Thr Ser Pro Gln Leu Met 165 170 175 0 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Arg Wing Val Gly Ser Asn Val Wing Leu Arg Pro His 210 215 220 Glu Lys Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 5 Met Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Be Arg Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Pro Met Asn Ser He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 tYr Ar9 tYr Asn G1y Ser Glu Ile Ar9 Ile Met Gln Ile Gln thr Ser 325 330 335 Asp Asn Thr Tyr Asn Xaa Thr Ser Tyr Pro Asp His Gln Gln Wing 340 345 350 Leu Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Leu Glu Glu He 355 360 365 <; 210 > 59 < 211 > 340 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 59 gtgaagtaca atgtcagcag aataataaga tattgatgca attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtcat 180 atatattata gtataaatgg agaagcagaa attagtttat tccttattca attttgataa 240 ggttctaata aatatgatgg ggattccaat aaacctcaat atgaagttac tacccaagga 300 atcaatctca ggatcaggaa acaattcaaa tgttacttat 340 < 210 > 60 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringi ensis < 400 > 60 Met Ser Wing Gly Glu Val His He Asp Wing Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly His He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Foot Asp As Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly Asp Ser Asn Lys Pro Gln Tyr Glu Val 85 90 95 Thr Thr Gln Gly Gly Ser Gly Asn Gm Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 61 < 211 > 340 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 61 tgtcagcacg tgaagtacat attgaaataa acaataaaac acgtcataca ttacaattag 60 aggataaaac taaacttagc ggcggtagat ggcgaacatc acctacaaat gttgctcgtg 120 aacatttgta atacaattaa gcagaatcac atggttttat gacaggagta gaaggtatta 180 tatattttag tgtaaacgga ttagtttaca gacgcagaaa ttttgacaat ccttatatag 240 atgtgatggt gttctaataa tcttctgata aacctgaata actcaaagcg tgaagttatt 300 gatcaggaga taaatctcat gtgacatata cgattcagac 340 < 210 > 62 < 211 > 112 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 62 Be Ala Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His Thr 1 5 10 15 Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg Thr 20 25 30 Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Ala Glu 35 40 45 Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser Val 50 55 60 Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He Gly 65 70 75 80 Be Asn Lys Cys Asp Gly Ser As Asp Lys Pro Glu Tyr Glu Val He 85 90 95 Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val rhr Tyr Thr He Gln 100 105 110 < 210 > 63 < 211 > 1114 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 63 atgttagata ctaataaaat ttatgaaata agcaatcttg ctaatggatt atatacatca 60 gtcttgatga acttatttaa agtttaatga ttcaggtgtt gtaaaaagga tgaagatatt 120 atttaaaatg gatgattaca cctattgata gtttttattt tattattaca ataatcaata 180 agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat aaatgtttca 240 caacaaactc acttattctt tgtacaaaaa tggcaaataa aagctaaaga ttcttcatat 300 ataatacaaa gtgataatgg aaaggtctta acagcaggag taggtcaatc tcttggaata 360 gtacgcctaa ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta 420 caaacaattc aactcccaca atagatgaaa aaaacctaaa aattaaaaga tcatcctgaa 480 tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgattcaaaa atagataaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atataaatac tggaatctag caaaaggaag taatgtatct 660 ttacttccac atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720 acaactatta ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa 780 gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga agaattaaaa 840 gttgaatata gcactga aac caaaataatg acgaaatatc aagaacactc agagatagat 900 aatccaacta atcaaccaat gaattctata ggacttctta tttatacttc tttagaatta 960 tatcgatata acggtacaga aattaagata atggacatag aaacttcaga tcatgatact 1020 tacactctta cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattct 1080 tatgaagaac tagaacaaat tacaagggcg aatt 1114 < 210 > 64 < 211 > 371 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (43) < 223 > Not determined in the deduced amino acid sequence < 220 > < 221 > IS NOT SAFE . < 222 > (365) < 223 > Not determined in the deduced amino acid sequence < 400 > 64 Met Leu Asp Thr Asn Lys He Tyr Glu He Ser Asn Leu Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Ser Lys Lys Asp Glu Asp He Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 0 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asp Being Ser Tyr He He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 GLy Val Gly Gln Ser Leu Gly He Val Arg Leu Thr Asp Glu Phe Pro 115 120 125 ° Glu Asn Ser Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Glu Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Asn Pro Lys Thr Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Ser Lys He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 0 195 200 205 Lys Tyr Trp Asn Leu Wing Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Arg Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Val Gly Leu Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp He Lys 260 265 270 Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu Thr Lys 275 280 285 He Met Thr Lys Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Pro Met Asn Ser He Gly Leu Leu He Tyr Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Thr Glu He Lys He Met Asp He Glu Thr Ser 325 330 335 Asp His Asp Thr Tyr Thr X.eu Thr Ser Tyr Pro Asn His Lys Glu Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Leu Glu Gln He Thr 355 360 365 Arg Ala Asn 370 < 210 > 65 < 211 > 360 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 65 atgtcagctc gcgaagtao * aacaataaaa cattgaaata attacaatta cacgtcatac 60 gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt 180 atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa tccttatata 240 ggttctaata aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc 300 ggatcaggag ataaatctca tgtgacatat actattcaga acgattataa cagtatcttt 360 < 210 > 66 < 211 > 119 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 66 Met Ser Wing Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Cys Asp Gly Ser Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln Thr Val Ser Leu Arg Leu 115 < 210 > 67 < 211 > 1158 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 67 atgttagata ctaataaagt ttatgaaata agcaatcttg ctaatggatt atatacatca 60 gtcttgatga acttatttaa agtttaatga ttcaggtgtt gtaaaaagga tgaagatatt 120 atttaaaatg gatgattaca cctattgata gtttttattt tattattaca ataatcaata 180 agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat aaatgtttca 240 caacaaactc acttattctt tgtacaaaaa tggcaaataa aagctaaaga ttcttcatat 300 ataatacaaa gtgataatgg aaaggtctta acagcaggag taggtcaatc tcttggaata 360 gtacgcctaa ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta 420 caaacaattc aactcccaca atagatgaaa aaaacctaaa aattaaaaga tcatcctgaa 480 tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgattcaaaa atagataaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atataaatac tggaatctag caaaaggaag taatgtatct 660 ttacttccac atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720 acaactatta ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa 780 gtaccasaag taggaggagg tacagaagac ataaaaacac aattaactga agaattaaaa 840 gttgaatata gcactga aac caaaataatg acgaaatatc aagaacactc agagatagat 900 atcaaccaat aatccaacta gaattctata ggacttctta tttagaatta tttatacttc 960 acggtacaga tatcgatata aattaagata atggacatag aaacttcaga tcatgatact 1020 tacactctta cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattcg 1080 tatgaagaag tagaagaaat aacaaaaata cctaagcata attgaaaaaa cacttataaa cattatttta aaaaataa 1140 1158 < 210 > 68 < 211 > 385 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (389) < 223 > Not determined in the deduced amino acid sequence < 400 > 68 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn Leu Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Ser Lys Lys Asp Glu Asp He Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Ser Ser Thr Asn Ser Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asp Be Ser Tyr He He Gln Be Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Val Gly Gln Ser Leu Gly He Val Arg Leu Thr Asp Glu Phe Pro 115 120 125 Glu Asn As Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Glu Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Asn Pro Lys Thr Thr Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Ser Lys He Asp 180 185 190 Lys? Sn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 195 200 205 Lys Tv r Trp Asn Leu Wing Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Arg Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Val Gly Leu Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Gl_ Val Pro Glu Val Gly Gly Gly Thr Glu Asp He Lys 260 265 270 Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu Thr Lys 275 280 285 He Met Thr Lys Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Pro Met Asn Be He Gly Leu Leu He Tyr Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Thr Glu He Lys He Met Asp He Glu Thr Ser 325 330 335 AsP His AsP Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Ala 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 365 Lys He Pro Lys His Thr Leu He Lys Leu Lys Lys His Tyr Phe Lys 370 375 380 Lys 385 < 210 > 69 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 69 gagaagtaca atgtcagcac aataataaga cattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 aaacatctgt gatcaaatta agcagaatca aatggtttta tgacaggtac agaaggtact 180 aratattata gtataaatgg agaagcagaa attagtttat tccttttgca attttgacaa 240 gg tctaata aatatgatgg acattccaat aaatctcaat atgaaattat tacccaagga 300 atcaatctca ggatcaggaa tgttacttat acaattcaga c 341 < 210 > 70 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 70 Met Ser Wing Arg Olu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Ser Val Wing 35 40 45 Glu Be Asn Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Phe Wing 6S 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Ser Gln Tyr Glu He 85 90 95 He Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 71 < 211 > 340 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 71 gcgaagttca atgtcagcag aataataaga tattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 aaacatttgt gatcaaatta agcagaatca aatggtttta tgacaggtac agaaggtact 180 atatattata gtataaatgg agaagcagaa attagtttat tccttttgca attttgacaa 240 ggttctaata aatatgatgg acattccaat aaatctcaat atgaaattat tacccaagga 300 atcaatctca ggatcaggaa acaattcaaa tgtaacgtat 340 < 210 > 72 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 72 Met Ser Wing Gly Glu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Being Asn Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Phe Wing 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Ser Gln Tyr Glu He 85 90 95 He Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 73 < 211 > 340 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 73 gcgaagtwca atgtcagctc aacaataaaa tattgaaata attacaatta cacgtcatac 60 gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt 180 atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa tccttatata 240 ggttctaata aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc 300 ggatcaggag ataaatctca tgtgacatat accattcaaa 340 < 210 > 74 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 74 Met Ser Wing Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 25 30 Thr Ser Pro Thr Asn Val Wing Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Cys Asp Gly Ser As Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 75 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 75 gcgaagttca atgtcagctc aataataaaa tattgaaata attacaatta cacgtcatac 60 ctaaacttac gaggataaaa cagtggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacajgaat agaaggtatt 180 atatatttta gcgtaaacgg agaagcagaa attagtttac attttgacaa tccttatgta 240 ggttctaata aatatgatgg ttcttctgat aaagctgcat acgaagttat tgctcaaggt 300 ggatcagggg atatatctca tgtaacttat acaattcaaa c 341 < 210 > 76 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 76 Met Ser Wing Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Thr Ser Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly He Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Glu Wing Glu He Ser Leu His Phe Asp Asn Pro Tyr Val 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly Be Ser Asp Lys Wing Wing Tyr Glu Val 85 90 95 He Wing Gln Gly Gly Ser Gly Asp He Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 77 < 211 > 1175 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 77 atgttagata ctaataaagt ttatgaaata agcaatcatg ctaatggatt atatacatca 60 gtctggatga acttatttaa ttcaggtgtt agtttaatgg tgaggatata gtcaaaatga 120 atttaaagtg gatgaatmca gttcttattt ccaatagata ataatcaata tattattaca 180 agctatggag cgaataattg taaagtttgg aatgttaaaa atgataaagt aaatgtttca 240 caacaaactc acgtattctc agtacaaaaa tggcaaataa -. Gctaaaaa ttcttcatat 300 ataatacaaa gtgagaatgg aaaagtctta acagcaggaa taggtcaatc tcctggaata 360 gtacgcttaa ccgatgaatc atcagagagt tctaaccaac aatggaattt aatccctgta 420 cactcccaca caaacaattt aaaacctaaa atagataaaa tcatcctgaa aattaaaaga 480 tattcagaaa ccggaaatat agctactgga acaattcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta atagataaaa tgatccaaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atatcaatac tggaaacgag caataggaag taatgtatct 660 ttacttccac atcaaaaaaa atcatatgat tatgagtggg gtacagaaga aaatcaaaaa 720 acaactatta ttaatacagt aggatttcaa attaatgtag attcaggaat gaagtttgag 780 gtaccagaag taggaggagg tacagaagaa ataaaaacac aattaaatga agaattaaaa 840 gttgaatata gcactg acac caaaataatg aaaaaatatc aagaacactc agagatagat 900 atcaaacaat aatccaacta ggatttctta gaattctata tttagaatta cttttacttc 960 acggttcgga tatcgatata aattcgtata atgagaatg aaacttcaga taatgatact 1020 tatactctga cctcttatcc aaatcataga gaagcatta- tacttctcac aaatcattca 1080 tatcaagaag tacmagaaat tacaagggcg aattcLtgca gatatccatc acactggcgg 1140 gccggtcgag ccttgcatct agaggggccc CAATT 1175 < 210 > 78 < 211 > 391 < 212 > PRT < 213 > Bacillus thuripgiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (43) < 223 > Not determined in the deduced amino acid sequence < 220 > < 221 > IT IS NOT INSURANCE < 222 > (365) < 223 > Not determined in the deduced amino acid sequence < 400 > 78 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Gly Gln Asn Asp Glu Asp He Asp Glu Xaa Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys Val Asn Val Ser 65 70 75 80 Thr Tyr Ser Pro Thr Asn Ser Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asn Be Ser Tyr He He Gln Ser Glu Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly He Gly Gln Ser Pro Gly He Val Arg Leu Thr Asp Glu Ser 115 120 125 Glu Ser As Asn Gln Gln Trp Asn Leu He Pro Val Gln Thr He Ser 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Lys Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Wing Thr Gly Thr He Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Lys He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 195 200 205 Gln Tyr Trp Lys Arg Wing He Gly Ser .Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Lys Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Glu Asn Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Val Gly Phe Gln He Asn Val Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Tfal Gly Gly Gly Thr Glu Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys Val Glu Tyr Ser Thr Asp Thr Lys 275 280 285 He Met Lys Lys Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Thr Met Asn Be He Gly Phe Leu Thr Phe Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Arg Met Glu Thr Ser 325 330 335 AsP Asn Asp Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Arg Glu Wing 340 345 350 Leu Leu Leu Leu Thr Asn His Ser Tyr Gln Glu Val Xaa Glu He Thr 355 360 365 Arg Wing Asn Ser Cys Arg Tyr Pro Ser His Trp Arg Wing Gly Arg Wing 370 375 380 Leu His Leu Glu Pro Gln 385 390 < 210 > 79 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 79 gtgaagttca atgtcagcag aataataaaa tattgaaata attacaatta cacgtcatac 60 ctaaacttac gaggataaaa cagtggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggaat agaaggtatt 180 atatatttta gcgtaaacgg agaagcagaa attagtttac attttgacaa tccttatgta 240 ggttctaata aatatgatgg ttcttctgat aaagctgcat acgaagttat tgctcaaggt 300 ggatcagggg atatatctca tctaacatat acaattcaaa c 341 < 210 > 80 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 80 Met Ser Wing Gly Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Thr Ser Gly Arg Trp Arg 20 25 .30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Giy He Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Glu Wing Glu He Ser Leu His Phe Asp Asn Pro Tyr Val 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly Be Ser Asp Lys Wing Wing Tyr Glu Val 85 90 95 He Wing Gln Gly Gly Ser Gly Asp He Ser His Leu Thr Tyr Thr He 100 105 110 Gln < 210 > 81 < 211 > 1410 < 212 > DNA < 213 > Bacill us thuringiensis < 400 > 81 atgttagata ctaataaaat ttatgaaata agcaatcatg ctaatggatt atatacatca 60 gtctggatga acttatttaa ttcaggtgtt agtttaatgg tgaggatata gtcaaaatga 120 atttaaagtg gatgaataca gttcttattt ccaatagata ataatcaata tattattaca 180 agctatggag cgaataattg taaagtttgg aatgttaaaa atgataaagt aaatgtttca 240 acgtattctc caacaaactc agtacaaaaa tggcaaataa aagctaaaaa ttcttcatat 300 ataatacaaa gtgagaatgg aaaagtctta acagcaggaa taggtcaatc tcttggaata 360 gtacgcttaa ccgatgaatc atcagagagt tctaaccaac aatggaattt aatccctgta 420 caaacaattt cactcccaca aaaacctaaa aattaaaaga atagataaaa tcatcctgaa 480 tattcagaaa ccggaaatat agctactgga acaattcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta ataggtaaaa tgatccaaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atatcaatac tggaaacgag caataggaag taatgtatct 660 ttacttccac atcaaaaaaa atcatatgat tatgagtggg gtacagaaga aaatcaaaaa 720 acaactatta ttaatacagt aggatttcaa attaatgtag attcaggaat gaagtttgag 780 gtaccagaag taggaggagg tacagaagaa ataaaaacac aattaaatga agaattaaaa 840 gttgaatata gcactg acac caaaataatg aaaaaatatc aagaacactc agagatagat 900 atcaaacaac aatccaacta ggatttctta gaattctata tttagaatta cttttacttc 960 acggttcgga tatcgatata aattcgtata atgagaatgg aaacttcaga taatgatact 1020 tatactctga cctcttatcc aaatcataga gaagcattat tacttctcac aaatcattct 1080 tatcaagaag taagccgaat tccagcacac tggcggccgt tactagtgga tccgagctcg 1140 gtaccaagct tggcgtaatc atggtcatag stgtttcctg tgtgaaattg ttatccgctc 1200 acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga 1260 gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 1320 tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 1380 cgctcttccg cttcctcgct cactgactcg 1410 < 210 > 82 < 211 > 462 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (389) < 223 > Not determined in the deduced amino acid sequence < 400 > 82 Met Leu Asp Thr Asn Lys He Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Gly Gln Asn Asp Glu Asp He Asp Glu Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys Val Asn Val Ser 65 70 75 80 Thr Tyr Ser Pro Thr Asn Ser Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asn Being Ser Tyr He He Gln Ser Glu Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly He Gly Gln Ser Leu Gly He Val Arg Leu Thr Asp Glu Be Ser 115 120 125 Glu Be As Asn Gln Gln Trp Asn Leu He Pro Val Gln Thr He Ser 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Lys Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Wing Thr Gly Thr He Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Lys He Gly 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 195 200 205 Gln Tyr Trp Lys Arg Wing He Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Lys Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Glu Asn Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Val Gly Phe Gln He Asn Val Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys Val Glu Tyr Ser Thr Asp Thr Lys 275 280 285 He Met Lys L / s Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Thr Thr Asn Ser He Gly Phe Leu Thr Phe Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Arg Met Glu Thr Ser 325 330 335 Asp Asn Asr Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Arg Glu Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Gln Glu Val Ser Arg He Pro 355 360 365 Wing His Trp Arg Pro Leu Leu Val Asp Pro Ser Val Pro Ser Leu 370 375 380 Wing Ser Trp Ser Xaa Phe Pro Val Asn Cys Tyr Pro Leu Thr He Pro 385 390 395 400 His Asn He Arg Wing Gly Ser He Lys Cys Lys Wing Trp Gly Wing Val 405 410 415 Ser Leu Thr Leu He Wing Leu Arg Ser Leu Pro Wing Phe Gln Ser Gly 420 425 430 Asn Leu Ser Cys Gln Leu His He Gly Gln Arg Wing Gly Arg Gly Gly 435 440 445 Leu Arg He Gly Arg Ser Ser Ala Be Ser Leu Thr Asp Ser 450 455 460 < 210 > 83 < 211 > 340 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 83 tgtcagcacg tgaagtacat attgatgtaa ataataagac aggtcataca ttacaattag 60 aagataaaac aaaacttgat ggtggtagat ggcgaacatc acctacaaat gttgctaatg 120 aacatttgta atcaaattaa atggttttat gcagaatcaa gacaggtaca gaaggtacta 180 tatattatag tataaatgga gaagcagaaa ttagtttata ttttgacaat ccttttgcag 240 atatgatgga gttctaataa aatctcaata cattccaata tgaaattatt acccaaggag 300 gatcaggaaa tcaatctcat gtgacatata ctattcaaac 340 < 210 > 84 < 211 > 112 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 84 Be Ala Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His Thr 1 5 10 15 Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg Thr 20 25 30 Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing Glu 35 40 45 Being Asn Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Being He 50 55 60 Asn Cly Glu Wing Glu He Being Leu Tyr Phe Asp Asn Pro Phe Wing Gly 65 70 75 80 Being Asn Lys Tyr Asp Gly His Being Asn Lys Being Gln Tyr Glu He He 85 90 95 Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He Gln 100 105 110 < 210 > 85 < 211 > 1114 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 85 atgttagata ctaataaagt ttatgaaata agcaatcatg ctaatggact atatgeagea 60 gtttagatga acttatttaa ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 120 gatgattata acttaaaatg gtttttattt cctattgatg atgatcaata tattattaca 180 agetatgeag caaataattg taaagtttgg aatgttaata atgataaaat aaatgtttcg 240 caacaaatte acttattctt aatacaaaaa tggcaaataa aagctaatgg ttcttcatat 300 gtaatacaaa gtgataatgg aaaagtctta acagcaggaa ccggtcaagc tcttggattg 360 atacgtttaa ctgatgaatc ctcaaataat cccaatcaac aatggaattt aacttctgta 420 aacttccacg caaacaatte aaaacctata atagatacaa aattaaaaga ttatcccaaa 480 tattcaccaa ctggaaatat agataatgga acatctcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgatccaaat atagataaaa atactcaaat taaaactact 600 ttttaaaaaa ccatattata atatcaatat tggcaacgag cagtaggaag taatgtagct 660 ttacgtccac atgaaaaaaa atcatatact tatgaatggg gcacagaaat agatcaaaaa 720 acaacaatta taaatacatt aggatttcaa atcaatatag attcaggaat gaaatttgat 780 ataccagaag taggtggagg tacagatgaa ataaaaacac aactaaatga agaattaaaa 840 atagaatata gtcatgaaac taaaataatg gaaaaatatc aagaacaatc tgaaatagat 900 aatccaactg atcaatcaat gaattctata ggatttctta ctattacttc cttagaatta 960 atggctcaga tatagatata aattcgtata atgcaaattc aaacctcaga taatgatact 1020 tataatgtta cttcttatcc aaatcatcaa caagctttat tacttcttac aaatcattca 1080 tatgaagaag ttgaagaaat aacaagggcg 1114 TAs < 210 > 86 < 211 > 371 < .- 'L2 > PRT < 213 > Bacillus thuringiensis < 400 > 86 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asp Gln Tyr He He Thr Ser Tyr Ala Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Gly Being Ser Tyr Val He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Thr Gly Gln Wing Leu Gly Leu He Arg Leu Thr Asp Glu Be Ser 115 120 125 Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr He Gln 130 1.35 140 Leu Pro Arg Lys Pro He He Asp Thr Lys Leu Lys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Pro Thr Gly Asn He Asp Asn Gly Thr Ser Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Arg Wing Val Gly Ser Asn Val Wing Leu Arg Pro His 210 215 220 Glu Lys Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Asp He Pro Glu Val Gly Oly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser His Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Ser Met Asn Ser He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Gln He Gln Thr Ser 325 330 335 Asp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asn His Gln Gln Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 36í Arg Ala Asn 370 < 210 > 87 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 87 gcgaagttca atgtcagctg aacaataaaa tattgaaata attacaatta cacgtcatac 60 gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt 180 atatatttta gtgtaaacgg agacgcagaá attagtttac attttgacaa tccttatata 240 ggttctaata aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc 300 ggatcaggag ataaatctca tgtcacttat acaattcaaa c 341 < 210 > 88 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 88 Met Ser Wing Gly Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Cys Asp Gly Ser As Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 89 < 211 > 1186 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 89 atgttagata caaataaagt ttatgaaata agcaatcttg ctaatggatt atatacatca 60 gtcttgatga acttatttaa agtttaatga ttcaggtgtt gtaeaaagga tgaagatatt 120 atttaaaatg gacgattaca cctattgata gtttttattt tattattaca ataatcaata 180 agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat aaatgtttca 240 caacaaactc acttattctt tgtacaaaaa tggcaaataa aagctcsaaga ttcttcatat 300 ataatacaaa gtgataatgg aaaggtctta acagcaggag taggtcaatc tcttggaata 360 gtacgcctaa ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta 420 caaacaattc aactcccaca atagatgaaa aaaacctaaa tcatcctgaa aattaaaaga 480 tactcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta atagataaaa tgattcaaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atataaatac tggaatctag caaaaggaag taatgtatct 660 ttacttccac atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720 acaactatta ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa 780 gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga agaattaaaa 840 gttgaatata gcactgaaac caaaataatg acgaaatatc aagaacactc agagatagat 900 aatccaacta atcaaccaat ggacttctta gaattctata tttatacttc tttagaatta 960 acggrcagaa tatcgatata attaagataa tggacataga aacttcagat catgatactt 1020 ttcttatcca acactcttac aatcataaag aagcattatt acttctcaca aaccattctt 1080 atgaagaagt agaagaaatt acaagggcga attccagcac actggcggcc gttactagtg 1140 gatccgagct cggtaccaag cttggcgtgt caggtcaaag ggttca 1186 < 210 > 90 < 211 > 392 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 90 Me Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn Leu Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Ser Lys Lys Asp Glu Asp He Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asp Being Ser Tyr He He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Val Gly Gln Ser Leu Gly He Val Arg Leu Thr Asp Glu Phe Pro 115 120 125 Gl? Asn As Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Glu Lys Leu l.ys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Asn Pro Lys Thr Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Ser Lys He Asp 180 185 190 0 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tvr He Phe Lys Lys Tyr 195 200 205 Lys Tyr Trp Asn Leu Wing Lys Gly Ser Asn Ve2 Ser Leu Leu Pro His 210 215 220 Gln Lys Arg Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Val Gly Leu Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp He Lys 260 265 270 I c Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu Thr Lys 275 280 285 He Met Thr Lys Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Pro Met Asn Ser He Gly Leu Leu He Tyr Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Gln Lys Leu Arg Trp Thr Lys Leu Gln He Met 325 330 335 0 Ile Leu Thr Leu Leu Leu He Gln He He Lys Lys His Tyr Tyr 340 345 350 Phe Ser Gln Thr He Leu Met Lys Lys Lys Lys Leu Gln Gly Arg He 355 360 365 Pro Wing His Trp Arg Pro Leu Leu Val Asp Pro Ser Ser Val Pro Ser 370 375 380 Leu Ala Cys Gln Val Lys Gly Phe 385 390 < 210 > 91 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 91 ccgaagtaca atgtcagcag tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa tggattatta acatggtgaa cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac tccttatgca attttgacaa 240 ggttctaata aatattctgg acgttctagt gatga.gatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtaactt 341 < 210 > 92 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 92 Met Ser Wing Wing Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn A = Sn Being As Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr < 210 > 93 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 93 gcgaagtaca atgtcagatc tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa tggattatta acatggtgaa cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac tccttatgca attttgacaa 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtaactt 341 < 210 > 94 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (43) < 223 > Not determined in the deduced amino acid sequence < 220 > < 221 > IT IS NOT INSURANCE < 222 > (365) < 223 > Not determined in the deduced amino acid sequence < 400 > 94 Met Ser Asp Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr < 210 > 95 < 211 > 353 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 95 gtgaagtaca atgtcagcac tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa acatggtgaa tggattatta cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac tccttatgca attttgacaa 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtaacat atacgattca aac 353 < 210 > 96 < 211 > 117 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 96 Met Ser Wing Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr Tyr Thr He Gln - 115 < 210 97 < 211 > 353 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 97 gtgaagtaca atgtcagctc tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa tggattatta acatggtgaa cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtgacat atacaattca aac 353 < 210 > 98 < 211 > 117 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 98 Met Ser Wing Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10"15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Be Ser Asp Leu Phe Gln Wing 35 40 45 Gly Be Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Ala 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr Tyr Thr He Gln 115 < 210 > 99 < 211 > 353 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 99 gcgaagttca atgtcaggtc tattgaaata ataaatcata caggtcatac cttacaaatg 60 ftagacttgc gataaaagaa acatggtgaa tggattatta cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtaacat atacgattca aac 353 < 211 > 117 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 100 Met Ser Gly Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr Tyr Thr He Gln 115 < 210 > 101 < 211 > 353 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 101 gtgaagtaca atgtcagctc tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa acatggtgaa tggattatta cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgttacgt atacaattca aac 353 < 210 > 102 < 211 > 117 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (43) < 223 > Not determined in the deduced amino acid sequence < 220 > < 221 > IT IS NOT INSURANCE < 222 > (365) < 223 > Not determined in The deduced amino acid sequence < 400 > 102 Met Ser Wing Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Tnr Ty Thr He Gln 115 < 210 > 103 < 211 > 353 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 103 gcgaagtaga atgtcaggtc tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa acatggtgaa tggattatta cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac tccttatgca attttgacaa 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagcg 300 agagcagaac atagagctaa taatcatgat catgtaacat atactattca gac 353 < 210 > 104 < 211 > 117 < 212 > PRT < ? 13 > Bacillus thuringiensis < 400 > 104 Met Ser Gly Arg Glu Val Asp He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr Tyr Thr He Gln 115 < 210 > 105 < 211 > 353 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 105 gtgaagtaca atgtcagcac tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa tggattatta acatggtgaa cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtaacat ataccattca aac 353 < 210 > 106 < 211 > 117 < 212 > PRT < 213 > Bacill us thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (389) < 223 > Not determined in the deduced amino acid sequence < 400 > 106 Met Ser Wing Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He c- 20 25 30 O He Thr Pro Val Asn Val Pro Asn Asn Be Ser Asp Leu Phe Gln Wing 35 40 45 Gly Be Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 0 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr Tyr Thr He Gln 115 < 210 > 107 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 107 5 gcgaagttca atgtcaggtc aataataaga tattgatgta attacaauta caggtcatac 60 caagacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact 180 atatattata gtataaatgg agaagcagaa attagtttat attttgacaa tccttattca 240 ggttctaata aatatgatgg gcattccaat aaaaatcaat atgaagttat tacccaagga 300 atcaatctca ggatcaggaa tctgacgtat acaattcaaa c 341 < 210 > 108 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 108 Met Ser Gly Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Arg Leu Asp Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Asn Gln Tyr Glu Val 85 90 95 He Thr Gln Gly Gly Ser Gly Asn Gln Ser His Leu Thr Tyr Thr He 100 105 110 Gln < 210 > 109 < 211 > 1114 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 109 atgttagata ctaataaagt atatgaaata agtaattatg ctaatggatt acatgcagca 60 gtttagatga acttatttaa ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 120 gatgactata atttaaggtg gtttttattt cctattgatg ataatcaata tattattaca 180 agctacgcag cgaataattg taaggtttgg aatgttaata atgataaaat aaatgtttca 240 acttattctt caacaaactc gatacagaaa tggcaaataa aagctuatgc ttcttcgtat 300 gtaatacaaa gtaataatgg gaaagttcta acagcaggaa tcttggatta ccggtcaatc 360 atacgtttaa cggatgaatc accagataat cccaatcaac aatggaattt aactcctgta 420 caaacaattc aaaacctaca aactcccacc atagatacaa agttaaaaga ttaccccaaa 480 tattcacaaa ctggcaatat agacaaggga acacctcctc aattaatggg atggacatta 540 ttatggtaaa ataccttgta tgatccaaat atagataaaa acactcaaat caaaactact 600 ttttaaaaaa ccatattata atatcaatat tggcaacaag cagtaggaag taatgtagct 660 ttacgtccgc atgaaaaaaa atcatatgct tatgagtggg gtacagaaat agatcaaaaa 720 acaactatca ttaatacatt aggatttcag attaatatag attcgggaat ggaatttgat 780 ataccagaag taggtggagg tacagatgaa ataaaaacac aattaaacga agaattaaaa 840 atagaatata gccgtg aaac caaaataatg gaaaaatatc aggaacaatc agagatagat 900 aatccaactg atcaatcaat gaattctata ggattcctca ctattacttc tttagaatta 960 tatcgatata atggttcgga aattagtgta atgaaaattc aaacttcaga taatgatact 1020 tacaatgtga cctcttatcc agatcatcaa caagctctat tacttcttac aaatcattca 1080 tatgaacaag tacaagaaat aacaagggcg aatt 1114 < 210 > 110 < 211 > 371 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 110 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn Tyr Wing Asn Gly 1 5 10 15 Leu His Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Asp Tyr Asn Leu Arg Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asn Gln Tyr He He Thr Ser Tyr Ala Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Wing Being Ser Tyr Val He Gln Ser Asn Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Thr Gly Gln Ser Leu Gly Leu He Arg Leu Thr Asp Glu Ser Pro 115 120 125 Asp Asn Pro Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Pro Lys Pro Thr He Asp Thr Lys Leu l.ys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Gln Thr Gly Asn He Asp Lys Gly Thr Pro Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu He Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Gln Wing Val Gly Ser Asn Val Ala Leu Arg Pro His 210 215 220 Glu Lys Lys Ser Tyr Ala Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 Met Glu Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser Arg Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Ser Met Asn Be He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Ser Val Val Lys He Gln Thr Ser 325 330 335 AsP Asn AsP T r Tyr Asn Val Thr Ser Tyr Pro Asp His Gln Gln Ala 340 345 350 Leu Leu Leu Leu Thr Asn His Ser Tyr Glu Gln Val Gln Glu He Thr 355 360 365 Arg Ala Asn 370 < 210 > 111 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 111 gtgaagtaca atgtcagctc aacaataaaa tattgaaata attacaatta cacgtcatac 60 gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt 180 atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa tccttatata 240 ggttctaata aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc 300 ggatcaggag ataaatctca tgttacatat acaattcaga c 341 < 210 > 112 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 112 Met Ser Wing Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30 Thr Ser Fro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Jjeu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Cys Asp Gly Ser As Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 113 < 211 > 360 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 113 gcgaagtaca atgtcagctc aacaataaaa cattgaaata attacaatta cacgtcatac 60 gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt 180 atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa tccttatata 240 ggttctaata aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc 300 ggatcaggag ataaatctca actattcaga tgtgacatat cagtatcttt acgattataa 360 < 210 > 114 < 211 > 119 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 114 Met Ser Wing Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr G_y Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Cys Asp Gly Ser Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln Thr Val Ser Leu Arg Leu 115 < 210 > 115 < 211 > 1158 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 115 atgttagata ctaataaagt ttatgaaata agcaatcttg ctaatggatt atatacatca 60 gtcttgatga acttatttaa agtttaatga ttcaggtgtt gtaaaaagga tgaagatatt 120 atttaaaatg gatgattaca cctattgata gtttttattt tattattaca ataatcaata 180 agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat aaatgtttca 240 caacaaactc acttattctt tgtacaaaaa tggcaaataa aagctaaaga ttcttcatat 300 ataatacaaa gtgataatgg aaaggtctta acagcaggag taggtgaatc tcttggaata 360 gtacgcctaa ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta 420 caaacaattc aactcccaca atagatgaaa aaaacctaaa aattaaaaga tcatcctgaa 480 tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgattcagga atagataaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atataaatac tggaatctag caaaaggaag taatgtatct 660 ttacttccac atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720 acatctatta ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa 780 gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga agaattaaaa 840 gttgaatata gcactg AAAC caaaataatg acgaaatatc aagaacactc agagatagat 900 atcaaccaat aatccaacta ggacttctta gaattctata tttagaatta tttatacttc 960 acggtacaga tatcgatata aattaagata atggacatag aaacttcaga tcatgatact 1020 tacactctta cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattcg 1080 tatgaagaag tagaagaaat cctaagcata aacaaaaata attgaaaaaa cacttataaa cattatttta aaaaataa 1140 1158 < 210 > 116 < 211 > 385 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 116 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn Leu Ala Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Ser Lys Lys Asp Glu Asp Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asn Gln Tyr He He Thr Ser Tyr Gly Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95? Sp Being Ser Tyr He He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Val Gly Glu Se1. Leu Gly He Val Arg Leu Thr Asp Glu Phe Pro 115 120 125 Glu Asn As Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Glu Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Asn Pro Lys Thr Thr Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Ser Gly He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 195 200 205 Lys Tyr Trp Asn Leu Wing Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Arg Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys 225 230 235 240 Th Ser He He Asn Thr Val Gly Leu Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp He Lys 260 265 270 Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu Thr Lys 275 280 285 He Met Thr Lys Tyr Gln Glu His Ser Glu He Asp Asn Pro Thr Asn 290 295 300 Gln Pro Met Asn Be He Gly Leu Leu He Tyr Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Thr Glu He Lys He Met Asp He Glu Thr Ser 325 330 335 Asp His Asp Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 365 Lys He Pro Lys His Thr Leu He Lys Leu Lys Lys His Tyr Phe Lys 370 375 380 Lys 385 < 210 > 117 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 117 gccaacttca atgtcagcac aataataaga tattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact 180 atatattate gtataaatgg agaagcagaa attagtttat tccttattca attttgacaa 240 ggttctaata aatatgatgg gcattctaat aaaaatcaat atgaagttat tacccaagga 300 ggatcaggaa atcaatctca tgtgacttat acgattcaca c 341 < 210 > 118 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (43) < 223 > Not determined in the deduced amino acid sequence < 220 > < 221 > IT IS NOT INSURANCE < 222 > (365) < 223 > Not determined in the deduced amino acid sequence < 400 > 118 Met Being Wing Arg Gln Leu His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Asn Gln Tyr Glu Val 85 90 95 He Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 His < 210 > 119 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 119 gtgaagttca atgtcaggtc aataataaga tattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggcact 180 atatattata gtataaatgg agaagcagaa attagtttat tccttattca attttgataa 240 ggttctaata aatatgatgg gcattccaat aaacctcaat atgaagttac tacccaagga 300 GGAT .aggaa atcaatctca tgtaacgtat actattcaaa c 341 < 210 120 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 4C0 120 Met Ser Gly Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Pro Gln Tyr Olu Val 85 90 - 95 Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 121 < 211 > 341 < 212 > DNA < 213 > Bacill us thuringiensis < 400 > 121 gcgaagttga atgtcaggtc aataataaga cattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact 180 atatattata gtataaatgg agaagcagaa attagtttat tccttattca attttgataa 240 ggttctaata aatatgatgg gcattccaat aaacctcaat atgaagttac tacccaagga 300 atcaatctca ggatcaggaa tgtcacatat acgattcaaa c 341 < 210 > 122; 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (389) < 223 > Not determined in the deduced amino acid sequence -JO < 400 > 122 Met Ser Gly Arg Glu Val Asp He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arj 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Pro Gln Tyr Glu Val 85 90 95 Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln 0 < 210 > 123 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 123 gtgaagtaga atgtcagcac aataataaga tattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact 180 atatattata gtataaatgg agaagcagaa attagtttat tccttattca attttgataa 240 ggttctaata aatatgatgg gcattccaat aaacctcaat atgaagttac tacccaagga 300 atcaatctca ggatcaggaa tgtaacgtat acgattcaaa c 341 < 210 > 124 < 211 > 113 < 212 > PRT < 213 Bacillus thuringiensis < 400 > 124 Met Ser Wing Arg Glu Val Asp He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Asn Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Pro Gln Tyr Glu Val 85 90 95 Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln < 210 > 125 < 211 > 1103 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 125 atgttagata ctaataaagt ttatgaaata agtaatcatg ctaatggact atatgcagca 60 gtttagatga acttatttaa agtttaatga ttcaggtgtt ataaaaatga tgatgatatt 120 gatgattata acttaaaatg gtttttattt cctattgatg tattattaca atgatcaata 180 agctatgcag caaataattg taaagtttgg aatgttaata atgataaaat aaatgtttcg 240 acttattctt caacaaattc aatacaaaaa tggcaaataa aagctaatgg ttcttcatat 300 gtaatacaaa gtgataatgg aaaagtctta acagcaggaa ccggtcaagc tcttggattg 360 atacgtttaa ctgatgaatc ctcaaataat cccaatcaac aatggaattt aacttctgta 20 caaacaattc aacttccaca atagatacaa aaaacctata ttatcccaaa aattaaaaga 480 tattcaccaa ctggaaatat agataatgga acatctcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgatccaaat atagataaaa atactcaaat taaaactact 600 ttttaaaaaa ccatattata atatcaatat tggcaacgag cagtaggaag taatgtagct 660 ttacgtccac atgaagaaaa atcatatact tatgaatggg gaacagaaat agatcaaaaa 720 acaacaatca taaatacatt aggatttcaa atcaatatag attcaggaat gaaatttgat 780 ataccagaag taggtggagg tacagatgaa ataaaaacac aactaaatga agaattaaaa 840 atagaatata gtcgtga aac taaaataatg gaaaaatatc aagaacaatc tgaaatagat 900 aatccaactg atcaaccaat gaattctata ggatttctta ctattacttc tttagaatta 960 tatagatata atggctcaga aattcgtata atgcaaattc aaacctcaga taatgatact 1020 tataatgtta cttcttatcc agatcatcaa caagctttat tacttcttac aaatcattca 1080 tatgaagaac ttgaagaaat tag 1103 < 210 > 126 < 211 > 367 < 212 > PRT < 213 > Bacillus thuringiensis c < 400 > 126 3 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asp Gln Tyr He He Thr Ser Tyr Wing Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser 0 65 70 75 80 Thr Tyr Being Ser Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Gly Being Ser Tyr Val He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Thr Gly Gln Wing Leu Gly Leu He Arg Leu ihr Asp Glu Be Ser 115 120 125 Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr He Gln 130 135 140 ^ * 1 Leu Pro Gln Lys Pro He He Asp Thr Lys Leu Lys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Pro Thr Gly Asn As Asn Gly Thr Ser Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Arg Wing Val Gly Ser Asn Val Wing Leu Arg Pro His 210 215 220 Glu Glu Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser Arg Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Pro Met Asn Ser He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Gln He Gln Thr Ser 325 330 335 Asp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asp His Gln Gln Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Leu Glu Glu He 355 360 365 < 210 > 127 < 211 > 369 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Sequence Description A. cificial: synthetic DNA < 400 > 127 atgtccgccc gcgaggtgca catcgacgtg aacaacaaga ccggccacac cctccagctg 60 ccaagctcga gaggacaaga cggcggcagg ggcgcacct ccccgaccaa cgtggccaac 120 gaccagatca agaccttcgt ggccgaatcc aacggcttca tgaccggcac cgagggcacc 180 atctactact ccatcaacgg cgaggccgag atcagcctct acttcgacaa cccgttcgcc 240 ggctccaaca aatacgacgg ccactccaac aagtcccagt acgagatcat cacccagggc 300 accagtccca ggctccggca cgtgacctac accatccaga ccacctcctc ccgctacggc cacaagtcc 360 369 < 210 > 128 < 211 1149 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 128 atgctcgaca ccaacaaggt gtacgagatc agcaaccacg ccaacggcct ctacgccgcc 60 acctacctct ccctcgacga ctccggcgtg tccctcatga acaagaacga cgacgacatc 120 gacgactaca acctcaagtg gttcctcttc ccgatcgacg acgaccagta catcatcacc 180 tcctacgccg ccaacaactg caaggtgtgg aacgtgaaca acgacaagat caacgtgtcc 240 acctactcct ccaccaactc catccagaag tggcagatca aggccaacgg ctcctcctac 300 gtgatccagt ccgacaacgg caaggtgctc accgccggca ccggccaggc cctcggcctc 360 atccgcctca ccgacgagtc ctccaacaac ccgaaccagc aatggaacct gacgtccgtg 420 cagaccatcc agctcccgca gaagccgatc atcgacacca agctcaagga ctacccgaag 480 tactccccga ccggcaacat cgacaacggc acctccccgc agctcatggg ctggaccctc 540 tcatggtgaa gtgccgtgca atcgacaaga cgacccgaac acacccagat caagaccacc 600 tcctcaagaa ccgtactaca gtaccagtac tggcagaggg ccgtgggctc caacgtcgcg 660 ctccgcccgc acgagaagaa gtcctacacc tacgagtggg gcaccgagat cgaccagaag 720 accaccatca tcaacaccct cggcttccag atcaacatcg acagcggcat gaagttcgac 780 atcccggagg tgggcggcgg taccgacgag atcaagaccc agctcaacga ggagctcaag 840 atcgagtact cccac gagac gaagatcatg gagaagtacc aggagcagtc cgagatcgac 900 aacccgaccg accagtccat gaactccatc ggcttcctca ccatcacctc cctggagctc 960 acggctccga taccgctaca gatccgcatc atgcagatcc agacctccga caacgacacc 1020 tacaacgtga cctcctaccc gaaccaccag caggccctgc tgctgctgac caaccactcc 1080 tacgaggagg tggaggagat caccaacatc ccgaagtcca ccctcaagaa gctcaagaag tactacttc 1140 1149 < 210 > 129 < 211 > 357 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 129 atgtccgccc gcgaggtgca catcgagatc aacaacaaga cccgccacac cctccagctc 60 gaggacaaga ccaagctctc cggcggcagg tggcgcacct ccccgaccaa cgtggcccgc 120 gacaccatca agacgttcgt ggcggagtcc cacggcttca tgaccggcgt cgagggcatc 180 atctacttct ccgtgaacgg cgacgccgag atctccctcc acttcgacaa cccgtacatc 240 ggctccaaca agtccgacgg ctcctccgac aagcccgagt acgaggtgat cacccagtcc 300 ggctccggcg acaagtccca cgtgacctac accatccaga ccgtgtccct ccgcctc 357 < 210 > 130 < 211 > 119 < 212 > PRT < 213 > Artificial Sequence < 220? < 223 Description of Artificial Sequence: Synthetic protein < 400 > 130 Met Ser Wing Arg Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Val Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Asp Ala Glu He Ser Leu His Phe Asp Asn Pro Tyr He 65 70 75 80 Gly Ser Asn Lys Ser Asp Gly Ser Asp Lys Pro Glu Tyr Glu Val 85 90 95 He Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr He 100 105 110 Gln Thr Val Ser Leu Arg Leu 115 < 210 > 131 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 221 > IT IS NOT INSURANCE < 222 > (43) < 223 > Not determined in the deduced amino acid sequence < 220 > < 221 > IT IS NOT INSURANCE < 222 > (365) < 223 > Not determined in the deduced amino acid sequence < 400 > 131 atgtcagctc gcgaagtaca c 21 < 210 > 132 < 211 > 22 < 212 > DNA < 213 > Artificial Sequence < 400 > 132 gtccatccca ttaattgagg ag 22 < 210 > 133 < 211 > 399 < 213 > Bacillus thuringiensis < 220 > < 221 > IT IS NOT INSURANCE < 222 > (389) < 223 > Not determined in the deduced amino acid sequence < 400 > 133 gtgaagtaca atgtcagcac cattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa tggattatta acatggtgaa cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attcccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtaacat atacagttca aagaaacata 360 tcacgatata ccaataaatt atgttctaat aactcctaa 399 < 210 134 < 211 > 132 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 134 Met Ser Wing Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Pro Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr Tyr Thr Val Gln? Rg Asn He Ser Arg Tyr Thr Asn Lys Leu Cys 115 120 125 Ser Asn Asn Ser 130 < 210 > 135 < 211 > 1164 < 212 > DNA 213 > Baci lus thuringiensis < 400 > 135 atgatagaaa ctaataagat atatgaaata agcaataaag ctaatggatt atatgcaact 60 gttttgataa acttatttaa ttcaggtgtt: agtttattaa atctgatatt ataaaaatga 120 atttgaaatg aatgattata gtttttattt cctattgata tattattaca ataatcagta 180 agttatggag taaataaaaa taaggtttgg actgctaatg g aataaaat aaatgttaca 240 acatattccg cagaciaattc agcacaacaa tggcaaataa gaaacagttc ttctggatat 300 ataatagaaa ataataatgg gaaaatttta acggcaggaa attaggttta caggccaatc 360 ttatatttaa ctgatgaaat acctgaagat tctaatcaac aatggaattt aacttcaata 420 cacttccttc caaacaattt acaaccaata attgatacaa ttaccctaaa cattagtaga 480 tattcaacga ccggtagtat aaattataat ggtacagcac ttcaattaat gggatggaca 540 ctcataccat gtattatggt atacgataaa acgatagctt ctacacacac tcaaattaca 600 acaacccctt attatatttt gaaaaaatát caacgttggg tacttgcaac aggaagtggt 660 ctatctgtac ctgcacatgt caaatcaact ttcgaatacg aatggggaac agacacagat 720 gtgtaataaa caaaaaacca tacattaggt tttcaaatta atacagatac aaaattaaaa 780 gctactgtac cagaagtagg tggaggtaca gaacacaaat acagatataa cactgaagaa 840 cttaaagtag aat atagtag gaaatgcgaa tgaaaataaa aatataaaca aagctttgac 900 taaattatga gtagacaact tgaagcacta aatgctgtag gatttattgt tgaaacttca 960 ttcgaattat atcgaatgaa tggaaatgtc cttataacaa gtataaaaac tacaaataaa 1020 gacacctata atacagttac ttatccaaat cataaagaag ttttattact tcttacaaat 1080 cattcttatg aagaagtaac agcactaact ggcatttcca aagaaagact tcaaaatctt 1140 aaaaacaatt ggaaaaaaag ataa 1164 < 210 > 136 < 211 > 387 < 212 > PRT < 213 > Bacillus thuringiensis < 00 > 136 Met He Glu Thr Asn Lys He Tyr Glu He Ser Asn Lys Wing Asn Gly 1 5 10 15 Leu Tyr Wing Thr Thr Tyr Leu Ser Phe Asp Asn Ser Gly Val Ser Leu 20 25 30 Leu Asn Lys Asn Glu Be Asp He Asn Asp Tyr Asn Leu Lys Trp Phe 35 0 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Val 50 55 60 Asn Lys Asn Lys Val Trp Thr Wing Asn Gly Asn Lys He Asn Val Thr 65 70 75 80 Thr Tyr Ser Ala Glu Asn Ser Ala Gln Gln Trp Gln He Arg Asn Ser 85 90 95 Being Ser Gly Tyr He He Glu Asn Asn Asn Gly Lys He Leu Thr Wing 100 105 110 Gly Thr Gly Gln Being Leu Gly Leu Leu Tyr Leu Thr Asp Glu He Pro 115 120 125 Glu Asp Being Asn Gln Gln Trp Asn Leu Thr Ser He Gln Thr He Ser 130 135 140 Leu Pro Ser Gln Pro He He Asp Thr Thr Leu Val Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Thr Thr Gly Ser He Asn Tyr Asn Gly Thr Ala Leu Gln Leu 165 170 175 Met Gly Uncle Thr Leu He Pro Cys He Met Val Tyr Asp Lys Thr He 180 185 190 Wing Being Thr His Thr Gln He Thr Thr Pro Tyr Tyr He Leu Lys 195 200 205 Lys Tyr Gln Arg Trp Val Leu Wing Thr Gly Ser Gly Leu Ser Val Pro 210 215 220 Wing His Val Lys Ser Thr Phe Glu Tyr Glu Trp Gly Thr Asp Thr Asp 225 230 235 240 Gln Lys Thr Ser Val He Asn Thr Leu Gly Phe Gln He Asn Thr Asp 245 250 255 Thr Lys Leu Lys Wing Thr Val Pro Glu Val Gly Gly Gly Thr Thr Thr Asp 260 265 270 He Arg Thr Gln He Thr Glu Glu Leu Lys Val Glu Tyr Ser Ser Glu 275 280 285 Asn Lys Glu Met Arg Lys Tyr Lys Gln Ser Phe Asp Val Asp Asn Leu 290 295 300 Asn Tyr? Sp Glu Ala Leu Asn Ala Val Gly Phe He Val Glu Thr Ser 305 310 315 320 Phe Glu Leu Tyr Arg Met Asn Gly Asn Val Leu He Thr Ser He Lys 325 330 335 Thr Thr Asn Lys Asp Thr Tyr Asn Thr Val Thr Tyr Pro Asn His Lys 340 345 350 Glu Val Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Thr Wing 355 360 365 Leu Thr Gly He Ser Lys Glu Arg Leu Gln Asn Leu Lys Asn Asn Trp 370 375 380 Lys Lys Arg 385 < 210 > 137 < 211 > 341 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 137 gtgaagttca atgtcagcag aataataaaa tattgaaata attacaatta cacgtcatac 60 ctaaacttac gaggataaaa cagtggtaga tggcgaacat cacctacaaa tgttgctcgt 120 gatacaatta aaacatttgt agcagaatca catggtttta tgacaggaat agaaggtatt 180 atatatttta gcgtaaacgg agaagcagaa attagtttac attttgacaa tccttatgta 240 ggttctaata aatatgatgg ttcttctgat aaagctgcat acgaagttat tgctcaaggt 300 ggatcagggg atatatctca tctaacatat acaattcaaa c 341 < 210 > 138 < 211 > 113 < 213 > Bacill us thuringiensis < 400 > 138 Mut Ser Wing Gly Glu Val His He Glu He Asn Asn Lys Thr Arg His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Thr Ser Gly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Ala Arg Asp Thr He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly He Glu Gly He He Tyr Phe Ser 50 55 60 Val Asn Gly Glu Wing Glu He Ser Leu His Phe Asp Asn Pro Tyr Val 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly Be Ser Asp Lys Wing Wing Tyr Glu Val 85 90 95 He Wing Gln Gly Gly Ser Gly Asp He Ser His Leu Thr Tyr Thr He 100 105 110 Gln < 210 > 139 < 211 > 1158 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 139 atgttagata ctaataaaat ttatgaaata agcaatcatg ctaatggatt atatacatca 60 gtctggatga acttatttaa ttcaggtgtt agtttaatgg tgaggatata gtcaaaatga 120 atttaaagtg gatgaataca gttcttattt ccaatagata ataatcaata tattattaca 180 agctatggag cgaataattg taaagtttgg aatgttaaaa atgataaagt aaatgtttca 240 acgtattctc caacaaactc agtacaaaaa tggcaaataa aagctaaaaa ttcttcatat 300 ataatacaaa gtgagaatgg aaaagtctta acagcaggaa taggtcaatc tcttggaata 360 gtacgcttaa ccgatgaatc atcagagagt tctaaccaac aatggaattt aatccctgta 420 caaacaattt cactcccaca aaaacctaaa aattaaaaga atagataaaa tcatcctgaa 480 tattcagaaa ccggaaatat agctactgga acaattcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta ataggtaaaa tgatccaaaa acactcaaat taaaactact 600 tttttaaaaa ccatattata atatcaatac tggaaacgag caataggaag taatgtatct 660 ttacttccac atcaaaaaaa atcatatgat tatgagtggg gtacagaaga aaatcaaaaa 720 acaactatta ttaatacagt aggatttcaa attaatgtag attcaggaat gaagtttgag 780 gtaccagaag taggaggagg tacagaagaa ataaaaacac aattaaatga agaattaa_a 840 gttgaatata gcactg acac caaaataatg aaaaaatatc aagaacactc agagatagat 900 atcaaacaac aatccaacta ggatttctta gaattctata tttagaatta cttttacttc 960 acggttcgga tatcgatata aattcgtata atgagaatgg aaacttcaga caatgatact 1020 tatactctga cctcttatcc aaatcataga gaagcattat tacttctcac aaatcattct 1080 tatcaagaag taagccgaat tccagcacac tggcggccgt tactagtgga tccgagctcg 1140 1158 tggcgtaa gtaccaagct < 210 > 140 < 211 > 385 212 > PRT < 213 > Bacillus thuringiensis 400 > 140 Met Leu Asp Thr Asn Lys He Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25, 30 Met Gly Gln Asn Asp Glu Asp He Asp Glu Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys Val Asn Val Ser 65 70 75 80 Thr Tyr Ser Pro Thr Asn Ser Val Gln Lys Trp Gln He Lys Wing Lys 85 90 95 Asn Being Ser Tyr He He Gln Ser Glu Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly He Gly Gln Ser Leu Gly He Val Arg Leu Thr Asp Glu Ser Ser 115 120 125 Glu Ser Ser Asn Gln Gln Trp Asn Leu He Pro Val Gln Thr He Ser 130 135 140 Leu Pro Gln Lys Pro Lys He Asp Lys Lys Leu Lys Asp His Pro Glu 145 150 155 160 Tyr Ser Glu Thr Gly Asn He Wing Thr Gly Thr He Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Lys He Gly 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Phe Lys Lys Tyr 195 200 205 Gln Tyr Trp Lys Arg Wing He Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220 Gln Lys Lys Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Glu Asn Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Val Gly Phe Gln He Asn Val Asp Ser Gly 245 250 255 Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys Val Glu Tyr Ser Thr Asp Thr Lys 275 280 285 He Met Lys Lys Tyr Gln Glu His Ser Glu He Asp Asp Pro Thr Asn 290 295 300 Gln Thr Thr Asn Ser He Gly Phe Leu Thr Phe Thr Ser leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Arg Met Glu Thr Ser 325 330 335 Asp Asn Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Arg Glu Wing 340 345 350 Leu Leu Leu Thr Asn His Ser Tyr Gln Glu Val Ser Arg He Pro 355 360 365 Wing His Trp Arg Pro Leu Leu Val Asp Pro Ser Ser Val Pro Ser Leu 370 375 380 Wing 385 < 210 141 < 211 > 399 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 141 gcgaagtaca atgtcagatc ataaatcata tattgaaata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa acatggtgaa tggattatta cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac tccttatgca attttgacaa 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtaacat atacagttca aagaaacata 360 tcacgatata ccaataaatt atgttctaat aactcctaa 399 < 210 > 142 < 211 > 132 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 142 Met Ser Asp Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Ala 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr Tyr Thr Val Gln Arg Asn He Ser Arg Tyr Tlir Asn Lys Leu Cys 115 120 125 Ser Asn Asn Ser 130 < 210 > 143 < 211 > 871 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 143 atgatagaaa ctaataagat atatgaaata agcaataaag ctaatggatt atatgcaact 60 gttttgataa acttatttaa agtttattaa ttcaggtgtt atctgatatt ataaaaatga 120 atttgaaatg aatgattata gtttttattt cctattgata ataatcagta tattattaca 180 agttatggag taaataaaaa taaggtttgg actgctaatg gtaataaaat aaatgttaca 240 acatattccg cagaaaattc agcacaacaa tggcaaataa gaaacagttc ttctggatat 300 ataatagaaa ataataatgg acggcaggaa gaaaatttta caggccaatc attaggttta 360 ttatatttaa ctgatgaaat acctgaagat tctaatcaac aatggaattt aacttcaata 420 caaacaattt cacttccttc attgatacaa acaaccaata ttaccctaaa cattagtaga 480 tattcaacga ccggtagtat aaattataat ggtacagcac ttcaattaat gggatggaca 540 ctcataccat gtattatggt atacgataaa acgatagctt ctacacacac tcaaattaca 600 acaacccctt attatatttt gaaaaaatat caacgttggg tacttgcaac aggaagtggt 660 ctatctgtac ctgcacatgt caaatcaact ttcgaatacg aatggggaac agacacagat 720 gtgtaataaa caaaaaacca tacattaggt tttcaaatta atacagatac aaaattaaaa 780 gctactgtac cagaagtagg tggaggtaca gaacacaaat acagatataa cactgaagaa 840 cttaaagtag aatata gtag tgaaaataaa 9 871 < 210 > 144 < 211 > 290 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 144 Met He Glu Thr Asn Lys He Tyr Glu He Ser Asn Lys Wing Asn Gly 1 5 10 15 Leu Tyr Ala Thr Thr Tyr Leu Ser Phe Asp Asn Ser Gly Val Ser Leu 20 25 30 Leu Asn Lys Asn Glu As Asp He Asn Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asn Asn Gln Tyr He He Thr Ser Tyr Gly Val 50 55 60 Asn Lys Asn Lys Val Trp Thr Wing Asn Gly Asn Lys He Asn Val Thr 65 70 75 80 Thr Tyr Ser Ala Glu Asn Ser Ala Gln Gln Trp Gln He Arg Asn Ser 85 90 95 Being Ser Gly Tyr He He Glu Asn Asn Asn Gly Lys He Leu Thr Wing 100 105 110 Gly Thr Gly Gln Being Leu Gly Leu Leu Tyr Leu Thr Asp Glu He Pro 115 120 125 Glu Asp Being Asn Gln Gln Trp Asn Leu TI r Ser He Gln Thr He Ser 130 135 140 Leu Pro Ser Gln Pro He He Asp Thr Thu Leu Val Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Thr Thr Gly Ser He Asn Tyr Asn Gly Thr Ala Leu Gln Leu 165 170 175 Met Gly Trp Thr Leu He Pro Cys He Met Val Tyr Asp Lys Thr He 180 185"190 Wing Ser Thr His Thr Gln He Thr Thr Pro Tyr Tyr He Leu Lys 195 200 205 Lys Tyr Gln Arg Trp Val Leu Wing Thr Gly Ser Gly Leu Ser Val Pro 210 215 220 Wing His Val Lys Ser Thr Phe Glu Tyr Glu Trp Gly Thr Asp Thr Asp 225 230 235 240 Gln Lys Thr Ser Val He Asn Thr Leu Gly Phe Gln He Asn Thr Asp 245 250 255 Thr Lys Leu Lys Wing Thr Val Pro Glu Val Gly Gly Gly Thr Thr Thr Asp 260 265 270 He Arg Thr Gln He Thr Glu Glu Leu Lys Val Glu Tyr Ser Ser Glu 275 280 285 Asn Lys 290 < 210 > 145 < 211 > 372 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 145 gtgaagtaca atgtcagcac aataataaga cattgatgta attacaatta caggtcatac 60 caaaacttga gaagataaaa tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120 gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact 180 atatattata gtataaatgg agaagcagaa attagtttat tccttattca attttgataa 240 ggttctaata aatatgatgg gcattccaat aaacctcaat atgaagttac tacccaagga 300 atcaatctca ggatcaggaa tgttacgtat actattcaaa ctgcatcttc acgatatggg aataactcat 360 aa 372 < 210 > 146 < 211 > 123 < 212 > PRT < 213 > Bacill us thuringiensis < 400 > 146 Met Ser Wing Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His 1 5 10 15 Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Oly Arg Trp Arg 20 25 30 Thr Ser Pro Thr Asn Val Wing Hand Asp Gln He Lys Thr Phe Val Wing 35 40 45 Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser 50 55 60 He Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 75 80 Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Pro Gln Tyr Glu Val 85 90 95 Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He 100 105 110 Gln Thr Ala Ser Ser Arg Tyr Gly Asn Asn Ser 115 120 < 210 > 147 < 211 > 1152 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 147 atgttagata ctaataaagt ttatgaaata agtaatcatg ctaatggact atatgcagca 60 gtttagatga acttatttaa ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 120 gatgattata acttaaaatg gtttttattt cctattgatg tattattaca atgatcaata 180 agctatgcag caaataattg taaagtttgg aatgttaata atgataaaat aaatgtttcg 240 acttattctt caacaaattc aatacaaaaa tggcaaataa aagctaatgg ttcttcatat 300 gtaatacaaa gtgataatgg aaaagtctta acagcaggaa ccggtcaagc tcttggattg 360 atacgtttaa ctgatgaatc ctcaaataat cccaatcaac aatggaattt aacttctgta 420 caaacaattc aacttccaca atagatacaa aaaacctata ttatcccaaa aattaaaaga 480 'tattcaccaa ctggaaatat agataatgga acatctcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgatccaaat atagataaaa atactcaaat taaaactact 600 ttttaaaaaa ccatattata atatcaatat tggcaacgag cagtaggaag taatgtagct 660 ttacgtccac atgaaaaaaa atcatatact tatgaatggg gaacagaaat agatcaaaaa 720 acaacaatca taaatacatt aggatttcaa atcaatatag attcaggaat gaaatttgat 780 ataccagaag taggtggagg tacagatgaa ataaaaacac aactaaatga agaattaaaa 840 atagaatata gtcg tgaaac taaaataatg gaaaaatatc aagaacaatc tgaaatagat 900 aatccaactg atcaaccaat gaattctata ggatttctta ctattacttc tttagaatta 960 atggctcaga tatagatata atgcaaattc aattcgtata aaacctcaga taatgatact 1020 tataatgtta cttcttatcc agatcatcaa caagctttat tacttcttac aaatcattca 1080 tatgaagaag tagaagaaat aacaaatatt cctaaaagta attaaaaaaa cactaaaaaa tattattttt aa 1140 1152 < 210 > 148 < 211 > 383 < 212 > PRT < 213 > Baci llus thuringí ensis < 400 > 148 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asp Gln Tyr He He Thr Ser Tyr Wing Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Aen Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Gly Being Ser Tyr Val He Gln Being Asp Asn Gly Lys Val Leu Thr Wing 100 105 110 Gly Thr Gly Gln Wing Leu Gly Leu He Arg Leu Thr Asp Glu Be Ser 115 120 125 Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro He He Asp Thr Lys Leu Lys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Pro Thr Gly Asn He Asp Asn Gly Thr Ser Pro Gln Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Arg Wing Val Gly Ser Asn Val Wing Leu Arg Pro His 210 215 220 Glu Lys Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser Arg Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Pro Met Asn Ser He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Gln He Gln Thr Ser 325 330 335? Sp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asp His Gln Gln Wing 340 345 350 Leu Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 365 Asn He Pro Lys Ser Thr Leu Lys Lys Leu Lys Lys Tyr Tyr Phe 370 375 380 < 210 > 149 < 211 > 354 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 149 gcgaagttca atgtcagctc tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa tggattatta acatggtgaa cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtgacat aaca atacaattca 354 < 210 > 150 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 150 Met Ser Wing Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr < 210 > 151 < 211 > 353 < 212 > DNA < 213 > Bacillus thuringiensis < 400 > 151 gtgaagttca atgtcagctc ataaatcata tattgaaata caggtcatac cttacaaatg 60 gataaaagr_a ctagacttgc acatggtgaa tggattatta cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 30? agagcagaac atagagctaa taatcatgat catgtaacat atacaattca aac 353 < 210 > 152 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 152 Met Ser Wing Arg Glu Val His He Glu He He Asn His Thr Gly His 1 5 10 15 Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Ser Being Asp Leu Phe Gln Wing 35 40 45 Gly Being Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Wing 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr < 210 > 153 < 211 > 353 < 212 > DNA < 213 > Bacill us thuringiensis < 400 > 153 gcgaagtaga atgtcagcac tattgaaata ataaatcata caggtcatac cttacaaatg 60 ctagacttgc gataaaagaa tggattatta acatggtgaa cacccgtgaa tgttccaaat 120 atttatttca aattcttctg agcaggttct gatggagttt tgacaggagt agaaggaata 180 ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa tccttatgca 240 ggttctaata aatattctgg acgttctagt gatgatgatt ataaagttat aactgaagca 300 agagcagaac atagagctaa taatcatgat catgtgactt atacaattca aac 353 < 210 > 154 < 211 > 113 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 154 Mee Ser Wing Arg Glu Val Asp He Glu He He Asn His Thr Gly "is 1 5 10 15 Inr Leu Gln Met Asp Lys Arg Thr Arg Leu Wing His Gly Glu Trp He 20 25 30 He Thr Pro Val Asn Val Pro Asn Asn Be Ser Asp Leu Phe Gln Wing 35 40 45 Gly Be Asp Gly Val Leu Thr Gly Val Glu Gly He He He Tyr Thr 50 55 60 He Asn Gly Glu He Glu He Thr Leu His Phe Asp Asn Pro Tyr Ala 65 70 75 80 Gly Ser Asn Lys Tyr Ser Gly Arg Ser As Asp Asp Asp Tyr Lys Val 85 90 95 He Thr Glu Wing Arg Wing Glu His Arg Wing Asn Asn His Asp His Val 100 105 110 Thr < 210 > 155 < 211 > 37 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 155 aaatattatt ttatgtcagc acgtgaagta cacattg 37 < 210 > 156 < 211 > 40 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 156 tctctggtac cttattatga tttatgccca tatcgtgagg 40 < 210 > 157 < 211 > 45 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 157 agagaactag taaaaaggag ataaccatgt tagatactaa taaag 45 < 210 > 158 < 211 > 46 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 158 cgtgctgaca taaaataata tttttttaat ttttttagtg tacttt < 210 > 159 < 211 > 506 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic protein < 400 > 159 Met Leu Asp Thr Asn Lys Val Tyr Glu He Ser Asn His Wing Asn Gly 1 5 10 15 Leu Tyr Wing Wing Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30 Met Asn Lys Asn Asp Asp Asp Asp Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45 Leu Phe Pro He Asp Asp Asp Gln Tyr He He Thr Ser Tyr Ala Wing 50 55 60 Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys He Asn Val Ser 65 70 75 80 Thr Tyr Being Ser Thr Asn Being He Gln Lys Trp Gln He Lys Wing Asn 85 90 95 Gly Ser Ser Tyr Val He Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110 Gly Thr Gly Gln Wing Leu Gly Leu He Arg Leu Thr Asp Glu Being 115 115 125 Asn Asn Pro Asn Gln Gln Trn Asn Leu Thr Ser Val Gln Thr He Gln 130 135 140 Leu Pro Gln Lys Pro He He Asp Thr Lys Leu Lys Asp Tyr Pro Lys 145 150 155 160 Tyr Ser Pro Thr Gly Asn He Asp Asn Gly Thr Ser Pro G1Ü Leu Met 165 170 175 Gly Trp Thr Leu Val Pro Cys He Met Val Asn Asp Pro Asn He Asp 180 185 190 Lys Asn Thr Gln He Lys Thr Thr Pro Tyr Tyr He Leu Lys Lys Tyr 195 200 205 Gln Tyr Trp Gln Arg Wing Val Gly Ser Asn Val Wing Leu Arg Pro His 210 215 220 Glu Lys Lys Ser Tyr Tnr Tyr Glu Trp Gly Thr Glu He Asp Gln Lys 225 230 235 240 Thr Thr He He Asn Thr Leu Gly Phe Gln He Asn He Asp Ser Gly 245 250 255 Met Lys Phe Asp He Pro Glu Val Gly Gly Gly Thr Asp Glu He Lys 260 265 270 Thr Gln Leu Asn Glu Glu Leu Lys He Glu Tyr Ser His Glu Thr Lys 275 280 285 He Met Glu Lys Tyr Gln Glu Gln Ser Glu He Asp Asn Pro Thr Asp 290 295 300 Gln Ser Met Asn Be He Gly Phe Leu Thr He Thr Ser Leu Glu Leu 305 310 315 320 Tyr Arg Tyr Asn Gly Ser Glu He Arg He Met Gln He Gln Thr Ser 325 330 335 Asp Asn Thr Tyr Asn Val Thr Ser Tyr Pro Asn His Gln Gln Wing 340 345 350 Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu He Thr 355 360 365 Asn He Pro Lys Ser Thr Leu Lys Lys Leu Lys Lys Tyr Tyr Phe Met 370 375 380 Ser Wing Arg Glu Val His He Asp Val Asn Asn Lys Thr Gly His Thr 385 390 395 400 Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg Thr 405 410 415 Ser Pro Thr Asn Val Ala Asn Asp Gln He Lys Thr Phe Val Wing Glu 420 425 430 Ser Asn Gly Phe Met Thr Gly Thr Glu Gly Thr He Tyr Tyr Ser He 435 440 445 Asn Gly Glu Wing Glu He Ser Leu Tyr Phe Asp Asn Pro Phe Wing Gly 450 455 460 Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Ser Gln Tyr Glu He He 465 470 475 480 Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr He Gln 485 490 495 Thr Thr Ser Ser Arg Tyr Gly His Lys Ser 500 505 < 210 > 160 < 211 1521 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 160 atgttagata ctaataaagt ttatgaaata agcaatcatg ctaatggact atatgcagca 60 acttatttaa gtttagatga ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 120 gatgactata acttaaaatg gtttttattt cctattgatg tattattaca atgatcaata 180 agctatgcag caaataattg taaagtttgg aatgttaata atgataaaat aaatgtttcg 240 acttattctt caacaaattc aatacaaaaa tggcaaataa aagctaatgg ttcttcatat 300 gtaatacaaa gtgataatgg aaaagtctta acagcaggaa ccggtcaagc tcttggattg 360 atacgtttaa ctgatgaatc ctcaaataat cccaatcaac aatggaattt aacttctgta 420 aacttccaca caaacaattc aaaacctata atagatacaa aattaaaaga ttatcccaaa 480 tattcaccaa ctggaaatat agataatgga acatctcctc aattaatggg atggacatta 540 ttatggtaaa gtaccttgta tgatccaaat atagataaaa atactcaaat taaaactact 600 ttttaaaaaa ccatattata atatcaatat tggcaacgag cagtaggaag taatgtagct 660 ttacgtccac atgaaaaaaa atcatatact tatgaatggg gcacagaaat agatcaaaaa 720 acaacaatta taaatacatt aggatttcaa atcaatatag attcaggaat gaaatttgat 780 ataccagaag taggtggagg tacagatgaa ataaaaacac aactaaatga agaattaaaa 840 atagaatata gtcatgaaac taaaataatg gaaaaatatc aagaacaatc tgaaatagat 900 aatccaactg atcaatcaat gaattctata ggatttctta ctattacttc cttagaatta 960 atggctcaga tatagatata aattcgtata atgcaaattc aaacctcag to taatgatact 1020 tataatgtta cttcttatcc aaatcatcaa caagctttat tacttcttac aaatcattca 1080 tatgaagaag tagaagaaat aacaaatatt cctaaaagta attaaaaaaa cactaaaaaa 1140 tattatttta tgtcagcacg tgaagtacac attgatgtaa ataataagac aggtcataca 1200 ttacaattag aagataaaac aaaacttgat ggtggtagat ggcgaacatc acctacaaat 1260 atcaaattaa gttgctaatg aacatttgta gcagaatcaa atggttttat gacaggtaca 1320 tatattatag gaaggtacta gaagcagaaa tataaatgga ttagtttata ttttgacaat 1380 gttctaataa ccttttgcag atatgatgga cattccaata aatctcaata tgaaattatt 1440 acccaaggag gatcaggaaa tcaatctcat gttacgtata ctattcaaac cacatcctca 1500 cgatatgggc ataaatcata to 1521 <; 210 > 161 < 211 > 23 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 161 gatratratc aatatattat tac 23 < 210 > 162 < 211 > 20 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 162 caaggtarta atgtccatcc 20 < 210 163 < 211 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 163 gatgatgrtm rak wattat trca 24 < 210 > 164 < 211 > 24 < 212 > DNA < 213 ^ > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 164 gatgatgrtm ratatattat trca 24 < 210 > 165 < 211 > 23 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 165 ggawgkrcdy twdt ccwtg tat 23 < 210 > 166 < 211 > 23 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic DNA < 400 > 166 ggawgkacry tadtaccttg tat 23

Claims (21)

NOVELTY OF THE INVENTION CLAIMS

1. - An isolated polynucleotide encoding a pesticidal protein wherein said protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO : 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92 , SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ D NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO.134, SEQ ID NO.136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO.146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 159, and variants thereof.

2. An isolated polynucleotide encoding a pesticidal protein wherein the complement of said polynucleotide is hybridized to a nucleotide sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID N0: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO.107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO.H9, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO.137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ I D NO.151, SEQ ID NO.153, SEQ ID MO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO-160, SEQ ID NO.161, SEQ ID NO : 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, and SEQ ID NO: 166.

3. An isolated pesticidal protein wherein said protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO.104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO.H8, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 159, and variants thereof.

4. A transgenic host cell comprising an isolated polynucleotide, wherein said cell is a plant cell or a microbial cell, and wherein said protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO72, SEQ ID MO.74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 32, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO.110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO.124, SEQ ID NO: 126, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO.154, SEQ ID NO: 159, and variants of the same.

5. The transgenic host cell according to claim 4, further characterized in that said cell expresses an isolated pesticidal protein of approximately 10-15 kDa and an isolated pesticidal protein of approximately 40-50 kDa.

6. - The transgenic host cell according to claim 4, further characterized in that said cell is a plant cell.

7. The transgenic host cell according to claim 4, further characterized in that said host cell is a maize cell.

8. The transgenic host cell according to claim 4, further characterized in that said host cell is a corn root cell.

9. The transgenic host cell according to claim 4, further characterized in that said host cell is a microbial cell.

10. A method for controlling a non-mammalian pest wherein said method comprises contacting said pest with an isolated pesticide protein wherein said protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO. : 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70 , SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO : 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120 , SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID N0.126, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 159, and variants of the same.

11. The method according to claim 10, further characterized in that said method comprises contacting said pest with a pesticidal protein of approximately 10-15 kDa and a pesticidal protein of 40-50 kDa where at least one of said proteins comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO : 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80 , SEQ ID NO: 82, SEQ ID NO: 8, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO : 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 134, SEQ ID NO: 136 , SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ I D NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 159, and variants thereof.

12. The method according to claim 10, further characterized in that said pest is a coleoptera.

13. - The method according to claim 10, further characterized in that said pest is worm root of corn.

14. The method according to claim 10, further characterized in that said pest is a worm of the western corn root.

15. The method according to claim 10, further characterized in that said pest is lepidopteran.

16. An isolated pesticidal protein wherein said protein is obtained from a Bacillus thuringiensis isolate selected from the group consisting of PS185GG, PS187G1, PS187Y2, PS201G, PS201 HH2, PS242K10, PS69Q, KB54A1-6, KR589, PS185L12, PS185W3, PS187L14, PS186FF, PS131W2, PS158T3, PS158X10, PS185FF, PS187F3, PS201 H2, PS201L3, PS203G2, PS203J1, PS204C3, PS204G4, PS204I11, PS204J7, PS236B6, PS246P42, KR1209, and KR1369.

17. An isolated polynucleotide that encodes a pesticide protein, wherein said protein is obtained from a Bacillus thuringiensis isolate selected from the group consisting of PS185GG, PS187G1, PS187Y2, PS201G, PS201HH2, PS242K10, PS69Q, KB54A1-6, KR589, PS185L12, PS185W3, PS187L14, PS186FF, PS131W2, PS158T3, PS158X10, PS185FF, PS187F3, PS201H2, PS201L3, PS203G2, PS203J1, PS204C3, PS204G4, PS204I11, PS204J7, PS236B6, PS246P42, KR1209, and KR1369.

18. - A biologically pure culture of a Bacillus thuringiensis isolate selected from the group consisting of PS185GG, PS187G1, PS187Y2, PS201G, PS201 HH2, PS242K10, PS69Q, KB54A1-6, KR589, PS185L12, PS185W3, PS187L14, PS186FF, PS131W2, PS158T3, 5 PS158X10, PS185FF, PS187F3, PS201 H2, PS201L3, PS203G2, PS203J1, PS204C3, PS204G4, PS204I11, PS204J7, PS236B6, PS246P42, KR1209, and KR1369. 19. An isolated polynucleotide that encodes a pesticide protein wherein said protein comprises at least ten amino acids. 10 contiguous of an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO : 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86,

SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: D4, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO : 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID 20 NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO : 154, and SEQ ID NO: 159.

20. - An isolated polynucleotide encoding a pesticidal protein wherein said polynucleotide comprises at least ten contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO : 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79 , SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO.107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO : 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ OD NO: 125, SEQ ID NO: 131, SEQ ID NO: 132 , SEQ ID NO: 133, SEQ ID NO: 135, SEQ OD NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ OR D NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO : 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, and SEQ ID NO: 166.

21. An isolated pesticidal protein wherein said protein comprises at least ten contiguous amino acids of an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ OD NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, and SEQ ID NO: 159.