MXPA01003764A - Site-directed dual pegylation of proteins for improved bioactivity and biocompatibility - Google Patents

Abstract

The present invention relates generally to the chemical modification of biologically active agents. More specifically, the invention relates to a novel approach to engineer, through mutagenesis and site-directed chemical conjugation, specific, well-defined dualPEGylated-protein bioconjugates, consisting of twopolyethylene glycol (PEG) macromolecules chemically conjugated to the protein at two specifically defined amino acid residues. The described dualPEGylated-protein bioconjugates show substantially improved bioefficacy and biocompatibility.

Description

DUAL PEGILATION DIRECTED TO THE PROTEIN SITE FOR IMPROVED BIOACTIVITY AND BIOCOMPATIBILITY FIELD OF THE INVENTION The present invention relates to a new engineering procedure, through site-specific chemical mutagenesis and site-specific conjugation, well-defined dual PEGylated protein bioconjugates, consisting of two chemically conjugated polyethylene glycol (PEG) macromolecules. to the protein to two specifically defined amino acid residues. The bioconjugates of dual PEGylated proteins described, show bioefficacy and biocompatibility substantially improved.

BACKGROUND OF THE INVENTION Due to recent advances in cellular and genetic engineering technologies, proteins known to exhibit various in vivo pharmacological actions are capable of being produced in large quantities for pharmaceutical applications. Such proteins include erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), interferons (alpha, beta, gamma, consensus), necrosis factor binding protein of the Ref: 128488 tumor (TNFbp), interleukin-1 receptor antagonist (IL-lra), brain-derived neurotrophic factor (BDNF), keratinocyte growth factor (KGF), stem cell or pluripotent factor (SCF) , megakaryocyte growth differentiation factor (MGDF), osteoprotegerin (OPG), neurotrophic factor derived from the Glial cell line (GDNF) and obesity protein (Protein OB). The OB protein can also be referred to herein as leptin. Leptin is active in vivo in both ob / ob mutant mice (obese mice due to a defect in the production of the OB gene product) as well as in normal, wild-type mice. The biological activity manifests itself among other things, in weight loss. See generally, Barinaga, "Obese" Protein Slims Mice, Science, 269: 75-476 (1995) and Friedman, "The Alphabet of Weight Control," Na ture, 385: 119-120 (1997). It is known, for example, that in ob / ob mutant mice, administration of leptin results in a decrease in serum insulin levels and serum glucose levels. It is also known that the administration of leptin results in a decrease in body fat. This was observed in both ob / ob mutant mice, as well as in normal non-obese mice. Pelleymounter et al., Science, 269: 540-543 (1995); Halaas et al., Science, 269: 543-546 (1995). See also, Camfield et al., Science, 269: 546-549 (1995) (Peripheral and central dose administration in micrograms of leptin, reduced feed intake and body weight of ob / ob and obese mice induced to diet but not in obese db / db mice). The OB protein, analogs, derivatives and uses thereof as modulators for the control of weight and adiposity of animals, including mammals and humans, have been described in great detail in WO 96/05309, supra. See also, PCT International Publication Numbers WO 96/40912, WO 97/06816, 97/18833, WO 97/38014, WO 98/08512 and WO 98/28427. The OB protein, or leptin, as it is called here, causes weight loss in humans; Greenberg et al., "Preliminary safety and efficacy of recombinant methionyl human leptin (rL) administered by SC injection in lean and obese subjects." Posters Presented in: 58th. Annual Meeting and Scientific Sessions of the American Diabetes Association; June 14, 1998; Chicago IL. In none of these reports have toxicities been observed, even at higher doses. The weight loss induced by the preliminary leptin experienced in animal models, predicts the need for a high concentration leptin formulation, with chronic administration to effectively treat human obesity. Dosages in milligram of protein per kilogram of body weight in ranges such as .5 or 1.0 mg / kg / day or per low, are desirable for the injection of therapeutically effective amounts in large mammals, such as humans. An increase in protein concentration is thus necessary to avoid the injection of large volumes, which can be unpleasant or possibly painful to the patient. Unfortunately, for preparations of a pharmaceutical composition for injection in humans, it has been observed that the amino acid sequence leptin is insoluble at physiological pH at relatively high concentrations, such as above about 2 mg of the active protein / milliliter of liquid. Poor or deficient solubility of leptin under physiological conditions appears to contribute to the formation of leptin precipitates at the injection site in a concentration dependent manner when high dosages are administered in a low pH formulation. Associated with the observed leptin precipitates is an inflammatory response at the site of injection which includes a mixed cellular infiltrate characterized by the presence of eosinophils, macrophages and large cells. To date, there are no reports of stable preparations of the human OB protein at concentrations of at least about 2 mg / ml at physiological pH, and in addition, there are no reports of stable concentrations of active human OB protein at least about 50 mg / ml or above. The development of leptin forms which could be allowed for high dosages without the aforementioned problems, could be of great benefit. It is therefore an object of the present invention to provide improved forms of leptin by means of chemical modification specific to the site of the protein. There are several methods of chemical modification of useful therapeutic proteins, which have been reported. For example, there is a long history of proteins chemically modified with polyethylene glycol that exhibit improved pharmacological properties. Among these properties are increased serum half-life, improved solubility and decreased immunogenicity. Chemical modification with a single 20 kDa polyethylene glycol (PE) polymer at the N-terminus of leptin results in a highly efficient molecule, which shows substantial dose reduction and increased solubility relative to the unmodified native protein; see for example, PCT WO 96/40912, supra, on page 8 and following. for a description of N-terminally derivatizing leptin (herein referred to as OB protein). Although the OB polymer extends the circulating half-life of the bioconjugates and can impart some reduced homogenicity, it has also been found to accumulate in kidney vacuoles when administered regularly at a high dose (10 mg / kg). This phenomenon has been reported with other preparations of PEGylated proteins; see for example, Conover et al., Artificial Organs, 2JL (5): 369-378 (1997); Bendele et al., Toxicological Sciences, 42: 152 (1997). Although it is not known whether such vacuoles are harmful to the th of an individual, it is preferable that the administration of the drug does not have associated anatomical abnormalities. It is thus an object of the present invention to produce a sufficiently large leptin conjugate to escape the glomerular filtration by the kidneys, and thus demonstrate little or no propensity to induce vacuolation of the kidney. The production of such conjugates is achieved using a course of rational mutagenesis combined with dual PEGylation directed to the site of leptins with polymers of appropriate sizes. Importantly, unlike strategies for the poly-PEGylation of proteins, which results in heterogeneous mixtures of positional isoforms, which are hard to separate and which vary in intrinsic bioactivity, the bioconjugates of dual PEGylated proteins The present invention contains specific conjugation sites which are designed to provide homogeneous preparations which maintain the intrinsic bioactivity of the conjugate, while exploiting the pharmacokinetic advantages of the conjugates of the PEGylated proteins.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to substantially homogeneous preparations of chemically modified proteins, for example, leptin, and methods therefor. Unexpectedly, the specific chemical modification of the leptin site demonstrates advantages in bioavailability and biocompatibility which are not observed in other leptin species. Importantly, the methods described herein are broadly applicable to other proteins (or analogs thereof), as well as to leptins. Thus, as described in more detail below, the present invention has a number of aspects that relate to chemically modified proteins (or analogs thereof) as well as to specific modifications of specific proteins. In another aspect, the present invention relates to a substantially homogeneous preparation of dual PEGylated leptin (or analogue thereof) and related methods. Importantly, the method described results in a high yield of the dual PEGylated protein, which is modified exclusively at two defined sites, thereby providing procedural advantages compared to other species that involve random modification. The present invention is based on the observation that, compared to unaltered native recombinant human leptin, dual PEGylated recombinant human leptin has substantially improved bioactivity and biocompatibility. It has been found, surprisingly and importantly, that dual PEGylated leptin bioconjugates prepared from PEG polymers of 20 kDa, 30 kDa and 40 kDa, confirm high efficacy, and demonstrate little or no propensity for vacuolation of the kidney. Significantly, when the dual PEGylated leptin bioconjugates are administered in a single dose, the weight loss was maintained for 7 days, at two times the level of an equivalent dose of unmodified leptin daily during the 7 day period. The recombinant human leptin used in the working examples below was first modified in such a way that the cysteine mutations were designed in the leptin protein sequence. The resulting recombinant human leptin analogues were recoverable in high yield and then used to prepare the dual PEGylated bioconjugates. Thus, in one aspect, the present invention relates to human leptin having cysteine mutations designed at positions 72 or 78 of the leptin protein sequence. The present invention also relates to bioconjugates of dual PEGylated human leptin, wherein PEG is conjugated at the N-terminus and at position 78 of the leptin protein sequence. Preferably, the PEG has a molecular weight of about 10 kDa to about 100 kDa. A particularly preferred PEG is about 20 kDa for each polymer chain. The present invention also relates to all bioconjugates of dual PEGylated human leptin as above, in a pharmaceutically acceptable carrier. The present invention also relates to processes for the preparation of the bioconjugates of the dual PEGylated protein as above. The main modality of the method for making the substantially homogeneous preparation of the dual PEGylated protein comprises: (a) engineering, a cysteine residue at a specific position of the amino acid within the amino acid sequence of said protein to provide an analog of said protein; (b) conjugate a polyethylene glycol to said analog to said cysteine residue to provide a monoPEGylated protein conjugate; (c) conjugating a second polyethylene glycol to the N-terminus of said conjugate to provide dual PEGylated bioconjugate; and (d) isolating said dual PEGylated bioconjugate. The present invention also relates to methods of treating individuals using dual PEGylated human leptin bioconjugates as described above.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a graph showing several response curves to leptin dose in a model where the mice were dosed daily with 0.1-10 mg / kg of protein with subcutaneous administration for 7 days. The curves represent averages of the three highest values of weight loss for each dose from daily, 7-day, multiple dose trials. The% weight loss was scored against the dose (mg / kg) and the% weight loss was calculated as the difference between the test group and the buffer control. Figure 2 is a graph showing percentages of weight loss induced by single doses for several leptin preparations in a model where the mice were dosed with an individual subcutaneous injection of 10 mg / kg of each preparation. The% of marked weight loss against # of days and% of weight loss were calculated with the difference between the test group and the buffer control. Figure 3 is a graph showing the pharmacokinetic profiles for 20 kDa dual PEGylated leptin in mice after intravenous injections of a single dose of 3 mg / kg. The concentration of leptin (ng / mL) was marked against time (hrs). Figure 4 is a graph showing pharmacokinetic profiles for 20 kDa dual PEGylated leptin in mice after subcutaneous injections of a single dose of 3 mg / kg. The concentration of leptin (ng / mL) was marked against time (hrs). Figure 5 is a bar graph showing comparison of kidney vacuole record for various leptin preparations. 1 = 2.5 mg / kg daily; 2 = 10 mg / kg daily; 3 = 10 mg / kg single dose. * = no statistically significant difference of the shock absorber. Figure 6 is a graph showing the% weight loss obtained using various preparations of the leptin conjugate at different dosages, after subcutaneous dosing on days 0, 7, 14 and 21 (X). The weight loss relative to a buffer control was monitored for 44 days. Figure 7 is a bar graph showing comparison of kidney vacuole record for various leptin preparations. l = Dual PEgilada (25 mg / kg); 2 = Dual PEGylated (10 mg / kg); 3 = Dual PEGylated (2.5 mg / kg); 4 = monoPEGylated (25 mg / kg). The Kidney Vacuum Record was plotted for each preparation at several time points (# of days).

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to substantially homogeneous preparations of chemically modified proteins, and to methods thereof. "Substantially homogeneous" as used herein means that only the chemically modified proteins observed are those that have a "modifying" portion (eg, PEG). The preparation may contain unreacted protein (i.e., lacking a modifier portion). As determined by peptide map formation and N-terminal sequencing, an example below is provided for a preparation which is at least 90% modified protein, and at least 10% unmodified protein. Preferably, the chemically modified material is at least 95% of the preparation and more preferably, the chemically modified material is 99% of the preparation or more. The chemically modified material has biological activity. The present "substantially homogeneous" dual PEGylated leptin preparations provided herein, are those which are sufficiently homogeneous to exhibit the advantages of a homogeneous preparation, eg, ease of clinical application in the batch to batch prediction ability of pharmacokinetics. As used herein, biologically active agents refer to recombinant or naturally occurring proteins, whether human or animal, used for prophylactic, therapeutic or diagnostic application. The biologically active agent can be natural, synthetic, semi-synthetic or derivatives thereof. In addition, the biologically active agents of the present invention may be perceptible. A wide range of biologically active agents is contemplated. These include but are not limited to hormones, cytokines, hematopoietic factors, growth factors, anti-obesity factors, trophic factors, anti-inflammatory factors, and enzymes (see also U.S. Patent No. 4,695,463 for additional examples of biologically active agents). One skilled in the art will readily be able to adapt a desired biologically active agent to the compositions of the present invention.

Such proteins could include but are not limited to interferons (see, U.S. Patent Nos. 5,372,808, 5,541,293, 4,897,471 and 4,695,623 incorporated herein by reference, including drawings), interleukins (see, U.S. Patent No. 5,075,222, incorporated herein by reference including drawings) , erythropoietins (see for example, U.S. Patent Nos. 4,703,008, 5,441,868, 5,618,698, 5,547,933, and 5,621,080 incorporated herein by reference including drawings), factors that stimulate the granulocyte colony (see, U.S. Patent Nos. 4,810,643, 4,999,291, 5,581,476, 5,582,823 , and PCT Publication No. 94/17185, incorporated herein by reference including drawings), stem cell growth factor (PCT Publication Nos. 91/05795, 92/17505 and 95/17206, incorporated herein by reference including drawings), osteoprotegerin (PCT Publication No. 97/23614, incorporated herein for reference including drawings) and lepti na (OB protein). The type of leptin used for the present dual PEGylated leptin preparations can be selected from those described in PCT International Publication Number WO 96/05309, as mentioned above and incorporated herein by reference in its entirety. Figure 3 of such publication (as cited in SEQ ID NO: 4), demonstrates the complete deduced amino acid sequence derived for human leptin (referred to as the human "OB" protein). The amino acids are numbered from 1 to 167. A sequence signal cleavage site is located after amino acid 21 (Ala) so that the mature protein extends from amino acid 22 (Val) to amino acid 167 (Cys). For the present description, a different numbering is used here, wherein the position of amino acid 1 is the valine residue, which is at the beginning of the mature protein. The amino acid sequence for mature recombinant methionyl human leptin is represented herein as SEQ ID NO: 1, wherein the first amino acid of the mature protein is valine (at position 1) and a methionyl residue is located at the position -1 (not included in the sequence below).

SEC ID N0: 1 V P I Q V T D T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T Q L D L S P G C However, as with any of the leptin portions present, the methionyl residue in position -1 may be absent. Alternatively, one can use a natural variant of human leptin, which has 145 amino acids, compared to the leptin rmetHu of SEQ ID NO: 1, it has a glutamine absent at position 28. Generally, the portion of leptin for human pharmaceutical use here it will be capable of therapeutic use in humans (see also, animal leptin, below). Thus, one can empirically test the activity to determine which portions of leptin can be used. As set forth in WO 96/05309, the leptin protein in its native form, or fragments (such as cleavage products of the enzyme) or other truncated and analogous forms, can retain all biological activity. Any of such forms can be used as a portion of leptin for the dual PEGylated leptin conjugates present, although such altered forms must be tested to determine the desired characteristics. See also, PCT International Publication Numbers WO 96/40912, WO 97/06816, 97/18833, WO 97/3814, WO 98/08512 and WO 98/28427, incorporated herein by reference in their entirety. One can prepare a recombinant human leptin analog by altering the amino acid residues in the recombinant human sequence, such as substituting the amino acids which diverge from the murine sequence. The murine leptin is substantially homologous to human leptin, particularly as a mature protein, and in addition, particularly at the N-terminus. Because the recombinant human protein has biological activity in mice, such an analogue may indistinctly be active in humans. For example, in the amino acid sequence of native human leptin as presented in SEQ ID NO: 1, one can substitute another amino acid, one or more of the amino acids at positions 32, 35, 50, 64, 68, 71, 74, 77, 89, 97, 100, 101, 105, 106, 107, 108, 111, 118, 136, 138, 142 and 145. One can select the amino acid at the corresponding position of the murine protein (see Zhang et al., 1994, supra) or another amino acid. One can also prepare "consensus" molecules based on the rat OB protein sequence, Murakami et al, m Biochem. Biophys. Res. Comm. , 209: 944-52 (1995) incorporated herein by reference. The rat OB protein differs from the human OB protein to the following positions (using the numbering of SEQ ID NO: 1): 4, _32, 33, 35, 50, 68, 71, 74_j_ 77 ^ 78,% _ 97 , 100, 101, 102, 105, 106, 107, 108, 111, 118, 136, 138 and 145. One can substitute another amino acid, one or more of the amino acids in these divergent positions. The underlined positions are those in which the murine OB protein as well as the rat OB protein are divergent from the human OB protein, and thus, are particularly suitable for alteration. In one or more of the positions, one can substitute an amino acid of the corresponding rat OB protein, or another amino acid. The positions from both murine and rat OB protein, which diverge from the mature human OB protein are: 4, 32, 33, 35, 50, 64, 68, 71, 74, 77, 78, 89, 97 , 100, 101, 102, 105, 106, 107, 108, 111, 118, 136, 138, 142 and 145. An OB protein according to SEQ ID NO: 1 having one or more of the amino acids replaced with another amino acid, such as the amino acid found in the corresponding murine or rat sequence, can also be effective. In addition, the amino acids found in the rhesus monkey OB protein, which diverge from the mature human OB protein (with identities noted in parentheses in a one-letter amino acid abbreviation): 8 (S), 35 (R), 48 ( V), 53 (Q), 60 (I), 66 (1), 67 (N), 68 (L), 89 (L), 100 (L), 108 (E), 112 (D) and 118 ( L). Since the recombinant human OB protein is active in cynomolgus monkeys, a human OB protein according to SEQ ID NO: 1 having one or more of the divergent amino acids of rhesus monkeys replaced with another amino acid, such as the amino acids in parentheses, They can be effective. It should be noted that certain rhesus divergent amino acids are also those found in the murine and rat anterior species (positions 35, 68, 89, 100, 108 and 118). Thus, one can prepare a murine / rat / rhesus / human consensus molecule (using the numbering of SEQ ID NO: l) having one or more of the amino acids replaced by another amino acid at the positions: 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145. The underlined positions are those in which three species are divergent from the human OB protein. A particularly preferred analog of human leptin is one wherein the amino acids in the 100 (Trp) or 138 (Trp) position, and more preferably both positions, are substituted with another amino acid, preferably Gln. Other analogs can be prepared by the deletion of a part of the amino acid sequence of the protein. For example, the mature protein lacks a leader sequence (-22 to -1). One can prepare the following truncated forms of the human OB protein molecules (using the numbering of SEQ ID NO: 1): (i) amino acids 98-146; (ii) amino acids 1-99 and (connected to) 112-146; (iii) amino acids 1-99 and (connected to) 112-146 having one or more of amino acids 100-111 sequentially placed between amino acids 99 and 112.

In addition, the truncated forms may also have altered one or more of the amino acids which are divergent (in the OB, murine, rat or rhesus protein) of the human OB protein. In addition, any alteration may be in the form of altered amino acids, such as peptidomimetics or D-amino acids. Also included are those proteins as set forth above with amino acid substitutions, which are "conservative" in accordance with acidity, charge, hydrophobicity, polarity, size or any other characteristic known to those skilled in the art. These are shown in Table 1 below. Proteins, passim (W. H. Freeman and Company, N. Y., 1984); Ford et al., Protein Expression and Purification 2 ^: 95-107 (1991), which are incorporated herein by reference.

Table 1 Conservative amino acid substitutions Therefore, the present dual PEGylated leptin conjugates can be selected from (in accordance with the amino acid sequence as presented in SEQ ID NO: 1 here): (a) the amino acid sequence of SEQ ID NO: l, optionally lacking a glutaminyl residue at position 28, and optionally further having a methionyl residue at the N-terminus; (b) a sequence of amino acids of subpart (a) having a different amino acid substituted in one or more of the following positions: 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145; (c) an amino acid sequence of subpart (b) wherein the amino acids at positions 100 and 138 are substituted with Gln; (d) a truncated leptin protein analogue, selected from: (i) amino acids 98-146 (ii) amino acids 1-99 and 112-146 (iii) amino acids 1-99 and 112-146 having one or more of amino acids 100-111 sequentially placed between amino acids 99 and 112; (iv) the truncated leptin analog of subpart (i) having one or more of the amino acids 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145 substituted with another amino acid; (v) the truncated leptin analog of subpart (iii) having one or more of the amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 112, 118, 136, 138, 142 and 145 and replaced with another amino acid; (vi) the truncated leptin analog of subpart (iv) having one or more of the amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145 replaced with another amino acid; and (vii) the truncated leptin analog of any of subparts (i) - (vi) having an N-terminal methionyl residue; (e) a leptin protein of any of subparts (a) - (d) having one or more of the amino acid substitutions conserved. Leptin proteins, analogs and related molecules are also reported in the following publications; however, no representation is made regarding the activity of any reported composition: US Patent Nos. 5,521,283; 5,525,705; ,532,336; 5,552,522; 5,552,523, 5,552,524 5,554,727 5,559,208; 5,563,243; 5,563.24 5,563,245 5,567,678 5,567,803; 5,569,743; 5,569,744 5,574,133 5,580,954 5,594,101; 5,594,104; 5,605,886; 5,614,379 5,691,309; 5,719,266 (Eli Lilly and Company); PCT W096 / 23513; W096 / 23514; W096 / 23515; W096 / 23516; W096 / 23517; W096 / 23518; W096 / 23519; WO96 / 23520; W096 / 23815; W096 / 27385; W096 / 34111; W096 / 37517; WO97 / 00886; EP 725078; EP 725079; EP 744408; EP 744408; EP 745610; EP 835879 (Eli Lilly and Company); PCT WO96 / 22308 (Zymogenetics); PCT W096 / 31526 (Amylin Pharmaceuticals, Inc.); PCT W096 / 34885; W097 / 46585 (Smithkline Beecham PCL); PCT W096 / 35787 (Chiron Corporation); PCT WO97 / 16550 (Bristol-Myers Squibb); PCT WO97 / 20933 (Schering Corporation) EP 736599 (Takeda); EP 741187 (F. Hoffman LaRoche). In the extent of these references provided by useful or analogous leptin proteins, or associated compositions or methods, such compositions and / or methods, may be used in conjunction with the present conjugates of dual PEGylated leptin, such as for co-administration (together or separately in a selected dosing program). With the previous provisions, these publications are here incorporated for reference. In addition, biologically active agents may also include but are not limited to, insulin, gastrin, prolactin, adrenocorticotropic hormone (ACTH), thyroid stimulating hormone (TSH), luteinizing hormone (LH), follicle stimulating hormone (FSH) , human chorionic gonadotropin (HCG), motilin, interferons (alpha, betal range), interleukins (IL-1 to IL-12), tumor necrosis factor (TNF), tumor necrosis factor binding protein (TNF-bp) ), brain-derived neurotrophic factor (BDNF), neurotrophic factor derived from glial cells (GDNF), neurotrophic factor 3 (NT3), fibroblast growth factors (FGF), neurotrophic growth factor (NGF), growth factors bone such as osteoprotegerin (OPG), growth factors such as insulin (IGFs), macrophage colony stimulating factor (M-CSF), granulocyte macrophage colony stimulating factor (GM_CSF), growth factor Mitocariocyte-derived growth factor (MGDF), keratinocyte growth factor (KGF), thrombopoietin, platelet-derived growth factor (PGDF), growth factors that stimulate the colony (CSFs), bone morphogenetic protein (BMP), dismutase superoxide (SOD), tissue plasminogen activator (TPA), urokinase, streptokinase and kallikrein. The term "proteins" as used herein, includes peptides, polypeptides, consensus molecules, analogs, derivatives or combinations thereof. Whichever protein is used (or analogs thereof), said protein will be modified such that a selected cysteine mutation is designed in the protein sequence. The purpose of the cysteine point mutation is to allow a second conjugation site, which complements the preexisting technology for PEG conjugation specifically to the N-terminus. These "cysteine" protein analogues can be readily prepared using conventional methods well known to one of ordinary skill in the art. For example, a factor that stimulates the colony of granulocytes (GCSF), is a protein in a beam of 4 helices very similar in structure to leptin. While the GCSF is easily monoPEGylated at the N-terminus by reductive alkylation, the additional amine-specific PEGylations occur randomly at any of the four lysine residues (Lys16, Lys23, Lys34 and Lys40). This results in the heterogeneous preparations of diPEGylated GCSF composed of a mixture of at least 4 different positional isoforms. With difficulty, these positional isoforms can be isolated and have demonstrated a degree of residual activity widely variant. An attempt to topographically map a GCSF active site by the alanine scan identified at least 6 residues (Lys16, Glu19, Lys23, Glu46, Asp109 and Asp112) residing in the # 1 propellers &; 4, which when mutated to alanine, result in a loss of > 5 times in the GCSF activity (Young et al., Prot. Sci., 6: 1228-1236 (1997).) This could support the observation that PEGylation in Lys16 or Lys23 results in decreased GCSF activity. of dual PEGylation for GCSF, a cysteine residue could have been designed at a site which is distant to both the active site and the N-terminus, such mutation of cysteine could preferentially be placed on the surface of a secondary structure element, exposed to solvents, but not totally accessible to the formation of intermolecular disulfide.Proposed as examples of this procedure, are the mutations Ser53- »Cys53, Gly87-» Cys87 and Ser155- »Cys155 in the helices # 2, 3 &5 respectively Noting, however, that any other position can be judged adequate if GCSF activity is preserved, promotes effective PEG conjugation, while discouraging intermolecular protein cross-linking and It can be produced in high performance. In the case of certain proteins, one can alternatively use a cysteine residue already present in the native sequence as a site for PEGylation, thus preventing PEGylation at the N-terminus. Additionally, one could design two selected cysteine mutations in the native protein sequence and then use each of those cysteine residues in the dual PEGylation conjugation, again avoiding PEGylation at the N-terminus. The leptin analogues prepared in the present invention include selected cysteine mutations, Arg72- »Cys72? or Ser78? Cys78. These mutations are based on the topographic mapping of minor chemical modifications to a three-dimensional model of leptin and correlate these modifications to their impact on the in vi tro and in vivo activity of the protein. The sites were selected both to preserve the intrinsic bioactivity of leptin and allow alternating but compatible chemistries which allow discrimination between the two sites (ie, the N-terminus and the second cysteine site), thus providing for variation independent of PEG sizes and conformations to any site. Additional considerations are given to the placement of mutations distant to the N-terminus and on an exposed solvent surface to promote crosslinking chemistries. The Arg72- »Cys72 mutation was placed in a flexible loop to improve the accessibility of the solvent, while the Ser78? Cys78 mutation occurs in the lower part of the C helix, where the recovery of the fold can be increased by being juxtacolocated away from the cysteines native (Cys97 and Cys147) during the early phases of the folds. The new conjugation site Cys78 is both distant to the N-terminus and the interface of the putative receptor. Thus placed, Cys78 was postulated to help minimize steric interference with both conjugations of the second polymer and the receptor link, while maximizing the hydrodynamic volume of the conjugate. In addition, the Cys78 site was selected because of its location on helix C, from where it was proposed to resist spontaneous inter- or intra-disulfide formation, thereby improving analog stability and process recovery. This hypothesis is supported by the analogue Arg72- »Cys72, which occurs at the same time. The Arg72- »Cys72 site is in an adjacent flexible loop and when expressed in E.coli it is almost unrecoverable due to the high levels of inadequate aggregates and folds.

Because the two conjugation chemistries are mutually compatible and relatively site specific, the resulting conjugates typically have a high degree of homogeneity and are easily purified by conventional chromatographic methods. The "cysteine" protein analogs described above are then used to prepare the bioconjugates of the dual PEGylated protein. The dual PEGylated leptin bioconjugates prepared in the present invention use the leptin analogue Ser78-Cys78 in a simple two-step synthesis to produce the dual PEGylated leptin bioconjugate. The resulting bioconjugates have the PEGylated leptin analogue at the opposite ends of the 4-helices package by the site-directed coupling to Cys78 and the N-terminus. The polymer molecules used can be selected from water-soluble polymers. (For the reductive alkylation process, the polymers should have a unique reactive aldehyde). The selected polymer should be soluble in water so that the protein to which they are bound, do not precipitate in an aqueous environment, such as a physiological environment. For reductive alkylation, the selected polymer should have a unique reactive aldehyde, so that the degree of polymerization can be controlled as provided for the present methods. The polymer can be branched or unbranched. Preferably, for therapeutic use of the preparation of the final product, the polymer will be pharmaceutically acceptable. One skilled in the art will be able to select the desired polymer based on such considerations as if the polymer / protein conjugate were to be used therapeutically, and if so, the desired dosage, circulation time, resistance to proteolysis, and other considerations. The water-soluble polymer can be selected from the group consisting of for example, polyethylene glycol, dextran or poly (n-vinylpyrrolidone) polyethylene glycol, homopolymers of propropylene glycol, polypropylene oxide / ethylene oxide copolymers, polyoxyethylated polyols and polyvinyl alcohol. Subject to considerations for optimization as discussed above, the polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 10 kDa and about 100 kDa (the term "approximate" indicates that in the polyethylene glycol preparations, some molecules will weigh more, some less, than the stated molecular weight). Various sizes can be used, depending on the desired therapeutic profile (for example, the duration of the desired sustained release, the effects, if any, with biological activity, the ease of handling, the degree or lack of antigenicity, and other known effects of the polyethylene glycol to a therapeutic or analogous protein). A variety of media have been used to bind the polyethylene glycol molecules to the protein. Generally, the polyethylene glycol molecules are connected to the protein via a reactive group found in the protein. Amino groups, such as those in the lysine or N-terminal residues, are suitable for such linkages. For example, Royer (U.S. Patent No. 4,002,531, supra) states that the reductive alkylation was used for the attachment of the polyethylene glycol molecules to an enzyme. EP 0 539 167, published on April 28, 1993, by Wrigth, "Peg Imidates and protein Derivatives Thereof" declares that peptides and organic compounds with free amino group (s) are modified with an immediate derivative of PEG or organic polymers water soluble related. U.S. Patent No. 4,904,584, by Shaw, published Febr 27, 1990, refers to the modification of the number of lysine residues in the proteins for the binding of the polyethylene glycol molecules via the reactive amine groups. PCT WO 96/40912, supra, on page 8 and sec., describes a method of N-terminal derivation of leptin (here referred to as OB protein). In a preferred embodiment of the present invention, the binding of the PEG molecule to the protein in the cysteine residue, involves the binding of the PEG molecule to the cysteine residue using a reaction at ~ pH 6.5 to maximize the selectivity of the maleimide for the thiol Cys78 on the amines lysine (this pH also minimizes the oxidation of the thiol); while the binding of the second PEG molecule to the N-terminus of the protein involves the binding of the PEG molecule to the leptin portion under reducing conditions to form an amine bond, at a sufficiently acidic pH so that the amino-terminal amine does not is still protonated while the amine groups in other positions in the leptin protein are protonated. In general, comprised by the invention are pharmaceutical compositions comprising effective amounts of chemically modified protein, or products thereof, together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers necessary for administration. (See PCT 97/01331 herewith incorporated by reference). The optimal pharmaceutical formulation for a desired biologically active agent will be determined by one skilled in the art depending on the route of administration and the desired dosage. Exemplary pharmaceutical compositions are described in Remington's Pharmaceutical Sciences (Mack Publishing Co., 18th Ed., Easton, PA, pages 1435-1712 (1990) .The pharmaceutical compositions of the present invention can be administered by oral and non-oral preparations ( example, intramuscular, subcutaneous, transdermal, visceral, IV (intravenous), IP (intraperitoneal), intraarticular, placed in the ear, ICV (intracerebralventricular), IP (intraperitoneal), intraarterial, intrathecal, intracapsular, intraorbital, injectable, pulmonary, nasal , rectal and transmucosal uterine preparations.) The therapeutic uses of the compositions of the present invention, depend on the biologically active agent used, One skilled in the art will readily be able to adapt to a biologically active agent desired for the present invention for its therapeutic uses. Therapeutic uses for such agents are set forth in great detail in the following s publications, thereby incorporated by reference, including drawings. Therapeutic uses include but are not limited to uses for proteins such as interferons (see, U.S. Patent Nos. 5,372,808, 5,541,293, thereby incorporated by reference including drawings), interleukins (see U.S. Patent No. 5,075,222, thereby, incorporated by reference, including dibukos), erythropoietins (see US Pat. Nos. 4,703,008, 5,441,868, 5,618,698, 5,547,933, and 5,621,080 thereby incorporated, by reference, including drawings), the stimulation factors of the granulocyte colony (see, US Patent Nos. 4,999,291 , 5,581,476, 5,582,823, 4,810,643 and PCT Publication No. 94/17185, hereby incorporated by reference including drawings), factor cells of origin (PCT Publication Nos. 91/05795, 92/17505 and 95/17206, thereby incorporated by reference including drawings), and the OB protein (see PCT Publication Nos. 96/40912, 96/05309, 97/00128, 97/01010 and 97/06816 co n it incorporated herein by reference including figures). In addition, the present compositions can also be used for the manufacture of one or more drugs for the treatment or amelioration of the conditions the biologically active agent is proposed to treat. One skilled in the art will be able to propose effective dosages by administration and observation of the desired therapeutic effect. Preferably, the formulation of the conjugate will be such that between about 0.01 μl of the leptin / body weight kg / day and 10 mg of leptin / body weight kg / day will provide the desired therapeutic effect. Effective dosages can be determined using diagnostic tools over time. For example, a diagnosis for measuring the amount of leptin in the blood (or plasma or serum) can first be used to determine the endogenous levels of the leptin protein. Such diagnostic tool can be in the form of an antibody assay, such as an antibody sandwich assay. The amount of endogenous leptin protein is initially quantified, and a baseline is determined. The therapeutic dosages are determined as the quantification of the portion of the exogenous and endogenous leptin protein (ie, protein, analogue derivative found within the body, either self produced or administered) is continued during the course of therapy. Dosages may therefore vary over the course of therapy, with, for example, a relatively high dosage being used initially, until the therapeutic benefit is observed, and lower dosages to maintain the therapeutic benefits. The therapeutic uses of dual PEGylated leptin include weight modulation, the treatment or prevention of diabetes, reduction of blood lipids (and the treatment of related conditions), increasing non-fat body mass and increasing sensitivity to insulin. Weight modulation The present compositions and methods can be used for weight reduction. Revised in another way, the present compositions can be used for the maintenance of a desired weight or adiposity level. As demonstrated in murine models (see infra), administration of the present dual PEGylated leptin conjugates results in weight loss. The loss of body mass is mainly adipose tissue, or fat. Such weight loss can be associated with the treatment of concomitant conditions, such as those before, and therefore, constitute a therapeutic application. In addition, therapeutic uses are provided herein if weight modulation is only for the improvement in appearance. Treatment of diabetes. The present compositions and methods can be used in the prevention or treatment of Type II diabetes. As type II diabetes, can be correlated with obesity, the use of the present invention to reduce weight (or maintain a desired weight, or reduce or maintain a level of adiposity) can also alleviate or prevent the development of diabetes. However, even in the absence of sufficient dosages to result in weight loss, the present compositions can be used to prevent or lessen diabetes. Modulation of blood lipids. The present compositions and methods can be used in the modulation of lipid levels in the blood. Hyperlipidemia (also called lipemia); dyslipidemia) is the presence of an abnormally large amount of circulating blood lipids. Ideally, in situations where only the reduction in blood lipid levels is desired, or where the maintenance of blood lipid levels is desired, the dosages will be insufficient to result in weight loss. Thus, during an initial course of therapy of an obese patient, dosages can be administered, thereby achieving weight loss and reduced blood lipid level concomintant. Once sufficient weight loss is achieved, a sufficient dosage to prevent re-gain of weight, still sufficient to maintain blood lipid levels, or other conditions as set forth herein, for example, can be administered. The dosages can be determined empirically, as the effects of the leptin protein are reversible. For example, Campfield et al., Science, 269: 546-549 (1995) to 547. Thus, if a dosage resulting in weight loss is observed when weight loss is not desired, one could administer a low dose for reach the desired blood lipid levels, still maintaining the desired weight. See, for example, PCT Publication WO 97/06816, incorporated herein by reference. Increase in fat-free mass or insulin sensitivity. Ideally, in situations where only an increase in non-fat body mass is desired, the dosage will be insufficient to result in weight loss. Thus, during an initial therapy course of an obese person, dosages can be administered, thereby achieving weight loss and decreasing concomitant fat tissue / fat-free mass increase. Once sufficient weight loss is achieved, a sufficient dosage to prevent weight regain, can still be administered sufficient to maintain the desired fat-free mass increase (or prevention of fat-free mass suppression). To increase the sensitivity of an individual to insulin, similar dosages can be taken into account. The increase in fat-free mass without weight loss can be achieved enough to decrease the amount of insulin (or, potentially, amylin, amylin antagonists or agonists, or thiazolidinediones, or other drugs that treat potential diabetes), a Individual may be administered for the treatment of diabetes. To increase total firmness, there may be considerations of similar dosages. The increase in fat-free mass with the concomitant increase in total firmness can be achieved with insufficient doses that result in weight loss. Other benefits, such as an increase in red blood cells (and oxygenation in the blood) and a decrease in bone resorption or osteoporosis can also be achieved in the absence of weight loss. See, for example, PCT Publication No. WO 97/18833 incorporated herein by reference. Combination Therapies The present compositions and methods can be used in conjunction with other therapies, such as altered diet and exercise. Other medicaments such as those used for the treatment of diabetes (for example insulin and possibly amylin, antagonists or agonists thereof, thiazolidinediones (see for example, PCT Publication No, WO 98/08512 incorporated herein by reference), or other drugs that treat potential diabetes), cholesterol and medications that lower blood pressure (such as those which reduce blood lipid levels or other cardiovascular drugs), medications that increase activity (eg, amphetamines), diuretics (for elimination of fluid), and appetite suppressants (such as agents which act on the neuropeptide Y receptors or serotonin reuptake inhibitors.) Such administration may be simultaneous or may be serious., the present methods can be used in conjunction with surgical procedures, such as cosmetic surgeries designed to alter the overall appearance of a body (for example, liposuction or laser surgeries designed to reduce body mass, or major surgeries designed to increase the appearance of body mass, such as bypass surgeries or other surgeries designed to alleviate a harmful condition caused by blockage of blood vessels by the deposition of fats, such as arterial plaque, may be increased with the concomitant use of the compositions and methods of the present invention The methods for removing the stones in the heel, such as ultrasonic or laser methods, can also be used prior to, during or after a course of the present therapeutic methods.In addition, the present methods can be used as an auxiliary to surgeries or therapies for bone fracture, muscle damage, or other s therapies which could be improved by an increase in fat-free tissue mass. In addition, the present compositions can be used for the manufacture of one or more drugs for the treatment or amelioration of the above conditions.

The following examples are offered to more fully illustrate the invention, but are not constructed as limiting the scope thereof.

EXAMPLE 1 This example describes the preparation of the leptin analogue Arg72? Cys72 and the leptin analogue Ser78? Cys78. Human methionyl leptin recombinants (rmetHu-leptin) was used for the present experiments. The portions of leptin used here can be made in the prokaryotic or eukaryotic cells, although, for the portions of leptin used in the following working examples, bacteria are preferred for ease in commercial manufacture. One can also use the leptin made in human cells, such as those made by controlling an introduced or native regulatory element, which affects the regulation of an endogenous gene that encodes the desired protein. Two analogs of human leptin containing unpaired cysteine residues were expressed and purified from E. coli to serve as substrates in the PEGylation reaction. These were the peptin analogue Arg72- »Cys72 and the leptin analog Ser78- > Cys78 (mutations relative to amino acid positions in the SEQ ID NO: 1). Analogs were constructed by a site-specific mutegénesis of SEQ ID NO: 1, using standard PCR technology. The mutagenic oligonucleotides used are shown in Table 2 below: Table 2 1735-46 TCCATGCCGTCCTGTAACGTTATCCAGATC SEQ ID NO: 2 (sense) 1735-47 GATCTGGATAACGTTACAGGACGGCATGGAG SEQ ID NO: 3 (antisense) 1735-48 GTTATCCAGATCTGTAACGACCTGGAGAAC SEQ ID NO: 4 (sense) 1735-49 GTTCTCCAGGTCGTTACAGATCTGGATA SEQ ID NO: 5 (antisense) 1216-52 AACATAAGTACCTGTAGGATCG SEQ ID NO: 6 1200-54 GTTATTGCTCAGCGGTGGCA SEQ ID NO: 7 The antisense primer of each pair (1735-47 for Arg72? Cys72; 1735-49 for Ser78- »Cys78) was used in a PCR reaction with the universal sense primer 1216-52 of the vector pAMG21 (ATCC # 98113) to generate the 5 'end of the leptin gene that contains the desired mutation. The sense primer of each pair (1735-46 for Arg72- »ys72; 1735-48 for Ser78? Cys78) was used in a PCR reaction with the universal antisense primer 1200-54 of the vector pAMG21 to generate the 3 'end of the gene of leptin that contains the desired mutation. The two middle molecules were then combined in a third PCR reaction using only the universal primers to generate the full length product containing each mutation. Each PCR product was digested with the restriction endonucleases Xbal and BaniHI, and then ligated into the vector pAMG21, also digested with Xbal and BajnHI. The ligated DNA was transformed into the competent host cells of E strain 2596. coli Host strain # 2596 of E. coli is a strain K-12 of E. coli derived from strain # 393 'of Amgen (ATCC # 202173 is the hsdR version of this strain). It has been modified to contain both the lamba repressor cI857s7 sensitive to temperature in the early ebg region and the lacIQ repressor in the late ebg region (68 minutes). The clones were selected for the ability to produce the recombinant protein product and to possess the gene having the correct oligonucleotide sequence. A single clone containing the Arg72-Cys72 mutation was selected and strain # 3559 from Amgen was designated, while another containing the mutation Ser78-Cys78 was designated strain # 3561 from Amgen. Recombinant expression of the leptin analogs was performed as described, for example, in WO 96/40912, incorporated herein by reference.

EXAMPLE 2 This example describes the preparation of a dual PEGylated leptin bioconjugate. Starting with the leptin analogue Ser78- »Cys78 prepared as described in Example 1, the following two-step process was used: Step 1: The analog was taken at 2-3 mg / ml in 20-50 mM NaHP04 buffer , 5 mM EDTA, pH 6.5. Then methoxy-PEG-maleimide (PEGA) (Shearwater Polymers) was added at a molar excess of 1-3 times and allowed to react 2-24 hours at 4 ° C to conjugate the Cys78 site. Step 2. The pH of the reaction mixture from step 1, was decreased to pH 4-6 and 5-7 times of excess methoxy-PEG-aldehyde (PEGB) (Shearwater Polymers) was added with enough sodium cyanoborohydride (Sigma) to make 15 mM NaBH3CN. This reaction proceeds overnight at 4 ° C with stirring. After completion, the reaction is dialyzed against 20 mM NaOAc, pH 4, diluted to <1 mg / ml protein concentration, and the pH is just at pH 3.5. This material is then purified by cation exchange chromatography using a High Resolution Sepharose SP resin (Pharmacia) in 20 mM NaOAc, pH 4, with a gradient of 0-200 mM NaCl. Due to the discrimination of the conjugation chemistries, it is possible independently to vary the polymers bound to any site. Up to now, linear 20 kDa and 30 kDa PEGs and a branched 40 kDa PEG have been evaluated and the resulting conjugates characterized inter alia, by SDS-PAGE, SEC-HPLC, light scattering, peptide mapping, linkage assay of the receptor in vi tro and bioassay in vivo.

EXAMPLE 3 The dose reductions achieved with the bioconjugates of dual PEGylated leptin were estimated from daily dosages of mice with 0.1-10 mg / kg of protein with subcutaneous administration for 7 days. For each conjugate at a given dose, the three largest values of weight loss achieved during the 7th day of the study were averaged. This average weight loss value was then plotted as a function of the dose for each dose tested (Figure 1). The data in Figure 1 show that dual PEGylated leptin provides a dose reduction of 13-20 times. Because Figure 1 includes data from several studies, it is defined as a response curve to compound doses. Fixing the data for each conjugate to a logarithmic curve provides a linear equation which can be solved to predict the dose required to achieve a certain percentage of weight loss. In this case, 4% is a mid-range weight loss value that is well represented by the data. Solving for 4% of the weight loss yields of predicted doses and dose reductions relative to a native leptin given in Table 3 below.

Table 3 Predicted dose Dose reduction Sample (native / conjugated) 4.4 N / A Native leptin 0. 1 44 - MonoPEG 20 kDa Leptin 0.33 13.3 Dual 20 kDa Leptin 20 kDa 0.21 21 30 kDa Dual PEG Leptin EXAMPLE 4 The in vivo efficacy of the dual PEGylated leptin bioconjugates was tested in wild-type mice by the administration of a single subcutaneous dose to 10 mg / kg and monitoring the weight loss relative to a buffer control. As a control the unmodified rhu-leptin was administered daily at 10 mg / kg. The weight loss for the 20 kDa monoPEG leptin group had a maximum at 12% in 3 days and was recovered at day 5 (Figure 2). The 20 kDa dual PEGylated leptin induces 13% weight loss at day 6, which was recovered at day 10. Even better, the 30 kDa dual PEGylated leptin induces 16% weight loss at day 7, which does not it was recovered until day 14. The data in figure 2 clearly show that the dual PEGylation of leptin promotes substantially increased efficacy which are sustainable from a single dose for up to 14 days. This is an unexpected and enormously beneficial property of dual PEGylated leptin, as such it offers the opportunity to administer weekly single injections of ~ 10X less than the total material than native leptin.

EXAMPLE 5 The pharmacokinetic profiles for the 20 kDa dual PEGylated leptin were determined in normal mice, after subcutaneous or intravenous administration of a single dose of 3 mg / kg. The concentration of the 20 kDa dual PEGylated leptin in the serum samples taken at regular intervals was determined by ELISA. With intravenous administration, the 20 kDa dual PEG leptin conjugate rapidly reaches a maximum concentration of ~104 ng / ml and persists for 7 days, where it is still detectable at ~ 200 ng / ml (Figure 3). With subcutaneous administration, the 20 kDa dual PEGylated leptin bioconjugate reaches a maximum concentration of ~ 4 x 103 ng / ml after ~ 15 hours and persists for at least 6 days (Figure 4). Together, these data illustrate the extraordinary increase in in vivo pharmacokinetic half-life achieved by dual PEGylated leptin relative to native rhu leptin. In addition, this bioconjugate appears to have good bioavailability when administered subcutaneously.

EXAMPLE 6 Accumulation of renal vacuoles in the epithelium of the proximal microtubule has been observed with the administration of 20 p.sup.PEGylated leptin and is dose dependent. Although the doses required to induce vacuolation are also in excess of the therapeutic dose required and several vacuolations are still observed in order not to cause renal dysfunction, this apparent toxicity is considered undesirable. One hypothesis applied in the design of the dual PEGylated leptin was that the dynamic properties of two independent polymers at the opposite ends of the leptin molecule can both increase the total hydrodynamic volume of the conjugate and resist the polymer collapses and thus, the penetration of renal microtubules. In this study, female C57BL / 6 mice (8-12 weeks of age) weighing 18-21 g were dosed with either buffer (PBS), 20 kDa monoPEG leptin, 20 kDa dual PEGylated leptin or dual PEGylated 30 kDa leptin. Each preparation was administered by subcutaneous injection of either 2.5 mg / kg / day or 10 mg / kg / day for 7 days or a single dose of 10 mg / kg followed by a recovery period of 7 days. Three animals from each dosage group were necrosed at day 7 and the kidneys were subjected to histological examination to ensure the degree of vacuolation induced by the conjugate. Figure 5 illustrates a dramatic reduction in the propensity of dual PEGylated leptin to induce kidney vacuoles relative to the 20 kDa monoPEGylated leptin control, even at levels 30-45 times above the effective dose. This observation is particularly impressive considering that dual PEGylated leptin bioconjugates currently provide 2-3 times the total PEG / dose mass as the monoPEGylated leptin conjugate. In addition, the extended pharmacokinetics observed with the dual PEGylated leptin bioconjugates demonstrated in Figures 3 and 4 suggest considerable accumulation of these conjugates in a daily dosage setting relative to the monoPEGylated leptin conjugate.

EXAMPLE 7 This example describes a study in which dosing regimens were compared once a week for dual PEGylated leptin against monoPEGylated leptin. Mice were dosed subcutaneously with 25 mg / kg, 10 mg / kg or 2.5 mg / kg of 20 kDa dual PEGylated leptin or 25 mg / kg or 2.5 mg / kg of monopegylated leptin of 20 kDa per day 0.7. 14 and 21. The weight loss relative to a control buffer was monitored for 44 days. The data in Figure 6 show a 10-fold approximate dose reduction for dual PEGylated leptin relative to the monoPEGylated leptin when applied in a once-a-week dosing regimen. These data are consistent with the pharmacokinetic data presented in Figure 3 and 4, they also demonstrate that dual PEGylated leptin is able to induce and maintain substantial weight loss (~ 20%).

EXAMPLE 8 This example describes a study designed to further evaluate the pathology of the kidney associated with the dual PEGylated leptin preparations compared with the preparations of the monoPEGylated leptin. Female C57BL / 6 mice, 12-week-old adults, weighing 18 to 21 grams, received subcutaneous injections of a leptin formulation once weekly for three weeks, except for a control group, which received buffered saline with phosphate (PBS).

Necropsy was performed on the day of the last injection, during which the livers and kidneys were examined for bulky abnormalities and then immersed in neutral buffered 10% formalin. After fixation, the kidneys, livers, lymphoma nodes and vessels were dehydrated in graded alcohols, emptied into xylene and embedded in paraffin. For each organ, a block of tissue was processed together for three mice from each group, providing one section per animal. Thick sections of 6 μm were stained with hematoxylin and eosin (HE), and the multiple fields were examined at amplifications of 40 x, 10x and 400x. The severity of cytoplasmic vacuolar changes in liver, lymphatic, and splenic macrophages as well as the renal tubular epithelium was semiquantitatively graded using a 5-row scale: + = questionable (very rare, small vacuoles in some cells); 1+ = minimal (rare, small vacuoles in some cells); 2+ = medium (modest numbers of vacuoles ~ 3 μm in diameter); 3+ = moderate (large numbers of vacuoles from ~ 3 μm to ~ 5 μm in diameter); or 4+ = marked (thousands of> 5 μm in diameter, large coalescent vacuoles). In rare example, an equivocal degree (+) was applied if the vacuoles were present but were rarely exceeded. This scale combines an assessment of the severity of the lesion for individual functional units (eg, a renal tubule) with the extent of the lesion within the entire tissue section. The results of the study are shown in Figure 7. The initial dose of the 20 kDa monoPEGylated leptin (positive control) resulted in a moderate (3+) lesion (consisting of thousands of small, clear cytoplasmic vacuoles) in most the epithelial cells of many proximal renal tubules. The severity of this change was increased to marked (4+) with subsequent injections. After one to three weeks of recovery, the renal epithelium contains a few but slightly larger vacuoles. All doses of the 20 kDa dual PEGylated leptin resulted in a very minimal (+) to medium (2+) vacuolation in the renal proximal tubules at some point during the experiment. During the three-week treatment phase, the vacuoles were generally small and originated slightly or in pairs within the cells, usually in an apical location. Most were located in the supranuclear cytoplasm and separated from the apical line of small vacuoles (presumably endocytotic) that are present in many renal tubular cells as a normal physiological structure. The extent of vacuolation was dose-dependent at all time points. The minimum number (1+) of the vacuoles were observed for the dose of 10 mg / kg at all time points, while a very minimal (+) lesion occurred for the 2.5 mg / kg dose only after the third injection. The middle class (2+) was observed for the 25 mg / kg dose after the second injection and ending throughout the rest of the study. The lesion regressed completely within a week at the dose of 2.5 mg / kg. At the doses of 10 mg / kg and 25 mg / kg, the number of vacuoles decreased slightly during the recovery phase and the individual vacuoles became larger, suggesting that the vacuoles and their contents were consolidated in large vacuoles or deposits. The data in Figure 7 show that leptin PEGylated dual presents significant reduction in the accumulation of kidney vacuoles in relation to monoPEGylated leptin.

None of the leptin compounds (including positive control material) induces vacuoles in liver macrophages, lymph nodes, or spleens of C57BL / 6 mice after a once-weekly administration at 2.5, 10 or 25 mg / kg for three weeks.

It is noted that in relation to this date, the best method known by the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

SEQUENCE LIST < 11 C > G? GG. COL? K XINSTLER. OLAF < 120 > DUAL PEG ATION DIRECTED TO THE PROTEIN SITE FOR BATTERY AND BIOCOMPATIBN IMPROVED S < 13 C > A- 567 < 4 C > EVEN NOT ALLOCATED < 141 > 1998 - 10 - 14 < IóO > 7 < 17C > Patentln Ver. 2.0 < 210 > 1 < 211 > 146 < 212 > ? RT < 213 > Human Leptin < 400 > 1 Val Pro He Gln Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn? Sp He Ser His Thr Gn Ser Val Ser Ser 20 25 30 Lys Glr. Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He 35 40 45 Leu Thr Leu Ser Lys Mee? Sp Gln Thr Leu Ala Val Tyr Gln Gn He 50 55 60 Leu Thr Ser Met Pro Ser? Rg? Sn Val He Gln He Ser? Sn? Sp Leu 65 70 75 80 Glu? Sn Leu Arg Asp Leu Leu His Val Leu? The Phe Ser Lys Ser Cys 85 90 95 His Leu Pro Trp? The Ser Giy Leu Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser? Rg US 120 125 Leu Gln Gly Ser Leu Gln? Sp Met Leu Trp Gln Leu? Sp Leu Ser Pro 1 130 135 140 Gly Cys 145 < 2l0 > 2 < 211 > 30 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic Oligonucleotide < 400 > 2 tcca gccgt cctgtaacgt tatccagatc 30 < 210 > 3 < 211 > 31 < 212 > DNA 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Oligonucfiéotido Synthetic < 400 > 3 gatctggata acgttacagg acggcatgga g 31 < 210 > 4 < 211 > 30 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic Oligonucleotide < 400 > 4 gttatccaga tctgtaacga cctggagaac 30 < 210 > 5 < 211 > 28 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic Oligonucleotide < 400 > 5 grtccccagg tcgtcacaga tctggata 28 < 2 ¿0 > 6 < 211 > 22 < 212 > DNA < 2i3 > Artificial sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic Oligonucleotide < 400 > 6 aacaeaagta cctgtaggat cg 22 < 210 > 7 < 211 > 20 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Synthetic Oligonucleotide < 400 > 7 gttatcgctc agcggtggca 20

Claims (6)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. A dual PEGylated leptin bioconjugate, characterized in that it comprises two portions of polyethylene glycol specifically linked to the site in two locations to one portion of leptin.

2. The dual PEGylated leptin bioconjugate of claim 1, characterized in that said portion of leptin is selected from the group consisting of (in accordance with the amino acid sequence of SEQ ID NO: 1): (a) the amino acid sequence of the SEC ID NO: l, optionally lacking a glutaminyl residue at position 28, and optionally further having a methionyl residue at the N-terminus; (b) an amino acid sequence of subpart (a) having a different amino acid substituted in one or more of the following positions: 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145; (c) an amino acid sequence of subpart (b) wherein the amino acids at positions 100 and 138 are substituted with Gln; (d) a truncated leptin protein analog, selected from: (i) amino acids 98-146 (ii) amino acids 1-99 and 112-146 (iii) amino acids 1-99 and 112-146 having one or more of the amino acids 100-111 sequentially placed between amino acids 99 and 112; (iv) the truncated leptin analog of subpart (i) having one or more of the amino acids 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145 substituted with another amino acid; (v) the truncated leptin analog of subpart (iii) having one or more of the amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 112, 118, 136, 138, 142 and 145 and replaced with another amino acid; (vi) the truncated leptin analog of subpart (iv) having one or more of the amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145 replaced with another amino acid; and (vii) the truncated leptin analog of any of subparts (i) - (vi) having an N-terminal methionyl residue; (e) a leptin protein of any of subparts (a) - (d) having one or more of the amino acid substitutions conserved.

3. The dual PEGylated leptin bioconjugate of claim 1, characterized in that said polyethylene glycol portions have a molecular weight of about 20 kDa to about 40 kDa.

4. A dual PEGylated protein bioconjugate produced by the method characterized in that it comprises: (a) engineering a cysteine residue at a specific amino acid position within the amino acid sequence of said protein to provide an analogue of said protein; (b) conjugate a polyethylene glycol to said analog in said cysteine residue to provide a monoPEGylated protein conjugate; (c) conjugating a second polyethylene glycol at the N-terminus of said conjugate to provide dual PEGylated bioconjugate; and (d) collecting said dual PEGylated protein bioconjugate.

5. A pharmaceutical composition characterized in that it comprises a dual PEGylated leptin bioconjugate according to any of claims 1 to 3 in a pharmaceutically acceptable carrier.

6. A method of treating an individual for a condition selected from: obesity, diabetes and hyperlipidemia, said method characterized in that it comprises: administering an effective amount of a dual PEGylated leptin bioconjugate according to any of claims 1 to 3. DUAL PEGILATION DIRECTED TO THE PROTEIN SITE FOR IMPROVED BIOACTIVITY AND BIOCOMPATIBILITY SUMMARY OF THE INVENTION The present invention relates generally to the chemical modification of biologically active agents. More specifically, the invention relates to a new method for engineering through mutagenesis and chemical conjugation directed to the site, bioconjugates of protein PEGIlada dual, well defined, specific, consisting of two macromolecules of polyethylene glycol (PEG) chemically conjugated to the protein a two amino acid residues specifically defined. The bioconjugates of the dual PEGylated protein show bioefficacy and substantially improved diocompatibility.