MXPA01003704A - Specificgenetic modification of the activity of trehalose-6-phosphate synthase and expression in a homologous or heterologous environment - Google Patents

Abstract

The present invention relates to a method for the preparation of a eukaryotic organism, for example selected from plants, animals and fungi, showing constitutive, inducible and/or organ specific expression of a specifically modified TPS gene, which comprises the steps of providing a TPS gene;designing a suitable modification to the TPS gene by aligning the gene with the corresponding gene of yeast and establishing which part of the gene extends beyond the 5'terminus of the yeast gene;deleting or inactivating a part of the N-terminal region of the TPS gene extending beyond the 5'terminus of the yeast gene, preferably the complete extending part thereof, in order to achieve an increased trehalose-6-phosphate synthase activity;cloning the thus modified gene into an expression vector under the control of a constitutive, inducible and/or organ-specific promoter;transforming a plant cell or tissue with the thus obtained expression vector;and regenerating a complete plant from the transformed plant cell or tissue.

Description

GENETIC MODIFICATION SPECIFIC OF THE ACTIVITY TREHALOSA- 6-PHOSPHATE-SYNTHASE AND EXPRESSION IN AN ENVIRONMENT HOMOLOGOUS OR HETEROLOGIST DESCRIPTION OF THE INVENTION The present invention relates to a method for obtaining eukaryotic organisms - for example plants, animals or fungi, with high activity and / or altered regulatory capacity of trehalose-6-phosphate synthase. The invention also relates to specifically modified alleles of trehalose-6-phosphate synthase genes that show unexpected changes in catalytic activity and / or regulatory capacity, and to transformed plants, or other eukaryotic organisms containing these buildings. The invention is also related to novel methods for measuring the level of trehalose-6-phosphate and the activity of trehalose-6-phosphate synthase. The biosynthesis of trehalose consists of two enzymatic steps catalyzed by trehalose-6-phosphate synthase (TPS), which synthesizes trehalose-6-phosphate, and by trehalose-6-phosphate-phosphatase (TPP), which forms trehalose The genes of trehalose metabolism have been discovered first in yeast and bacteria, Ref: 128711 organisms that were long known to accumulate trehalose. Recently, homologs of these genes have been found in higher plants and animals in which trehalose levels have never been detected. However, until now it has not been possible to demonstrate the enzymatic activity of trehalose-β-phosphate synthase of these TPS gene products in any in vitro system. Its expression in heterologous systems also does not result in the high accumulation of trehalose. No successful use of these plant or animal TPS genes has been reported to improve commercially important properties in homologous or heterologous systems. In addition to its classic role in the accumulation of storage sugar, it is known that the metabolism of trehalose plays important roles in resistance to stress or tension, control of glucose influx towards glycolysis and glucose-induced signaling. As described below, these phenotypic properties are of high industrial importance. A surprising ability to adapt to survival under strong or even complete dehydration, is present in yeast cells, fungal spores, certain species of invertebrates and plants of resurrection, which resume their vital functions as soon as they again enter into contact with water. These anhydrobotic organisms also resist freezing, high vacuum, high doses of ionizing radiation, high pressure and extreme temperatures without suffering damage and many of them accumulate the non-reducing disaccharide trehalose, as a protector of proteins and membranes. The protective function of trehalose has also been demonstrated in vi tro. The addition of trehalose to cells, organisms, antibodies and food is preserved under total dehydration for prolonged periods. It also protects us against a variety of other stress conditions, such as high temperature, high pressure and freezing. In vascular plants, very few species are known where the presence of trehalose has been convincingly demonstrated. However, a high level of trehalose is present in the so-called Desert Resurrection Plant (Selaginella lepidophylla). This plant is able to resist dehydration completely, successfully, as opposed to all higher plants including harvest plants. Deletion mutants in the TPS gene in bacteria and yeast are unable to synthesize trehalose and lose osmotolerance, thermotolerance and tolerance to high pressure. This suggests that TPS is involved in various forms of tolerance. It could be highly desirable to be able to express the activity of trehalose-6-phosphate synthase in plants, animals, microorganisms or specific parts of them, in order to make them tolerant to stress. In this way, the harvest plants could be grown in regions that occasionally or continuously suffer from heat, drought or freezing. The perishable foods of vegetable or animal origin could be preserved by simple dehydration, making possible the storage in a prolonged period of time and the transport in long distances. The present invention for the first time allows high trehalose-6-phosphate synthase activity and high accumulation of trehalose in organisms where trehalose is not normally processed or not accumulated to appreciable levels, such as most plants and higher animals. Therefore, it allows for the first time the highly efficient and controlled use of trehalose accumulation in higher plants and animals to increase resistance to stress. This is achieved in the invention by means of a method for the preparation of a eukaryotic organism, for example selected from plants, animals and fungi, which exhibit constitutive, inducible and / or specific expression of an organ of a specifically modified TPS gene, which includes the steps of: a) the provision of a TPS gene; b) the designation of an appropriate modification to the TPS gene by aligning the gene with the corresponding yeast gene, and establishing which part of the gene extends beyond the 5 'end of the yeast gene; c) the deletion or inactivation of a portion of the N-terminal region of the TPS gene extending beyond the 5 'end of the yeast gene, preferably the entire extension part thereof, in order to achieve increased activity of the trehalose-6-phosphate synthase of the gene; d) cloning the gene modified in this way in an expression vector under the control of a constitutive, inducible and / or organ-specific promoter; e) the transformation of a plant cell or tissue with the expression vector obtained in this way; and f) the regeneration of a whole plant from the transformed plant cell or tissue. Inactivation of the part of the N-terminal region of the TPS gene that extends beyond the 5 'end of the yeast gene can be achieved by mutagenesis. It has been found according to the invention that the truncation of the various genes that originate from plants can increase their functionality when they are expressed in yeast. An increased accumulation of trehalose and high trehalose-6-phosphate synthase activity compared to the non-truncated gene was observed. Through the use of a constitutive, inducible or organ-specific promoter, expression in various ways can be modified and controlled. The induction may be tissue-specific, for example for fruits, specific to time, or induced by changes in environmental conditions. In the last category, heat induction, induction by drought, etc. may be included. The functionality of the TPS gene modified to infer the thermotolerance can be verified in the following test system. Trehalose is required for the acquisition of thermotolerance in yeast. The deletion mutants of yeast tpsl? and tpsl? tps2? they are thermosensitive and the phenotype is restored by complementation with the corresponding homologous gene. To determine whether vegetable or animal TPS is functionally similar to yeast TPS1, the yeast mutants tpsl? and tpsl? tps2? transformed with a plasmid that harbors the desired gene, they are tested for the acquisition of thermotolerance. The ability of cells to acquire thermotolerance is measured by lethal shock with heat. In yeast, the metabolism of trehalose is essential for growth on glucose. The suppression of the TPS gene causes uncontrolled influx of glucose towards glycolysis, resulting in the hyper-oxidation of sugar phosphates and loss of free phosphate and ATP. It is known that trehalose-6-phosphate inhibits the activity of hexokinase in vi tro and the enzyme TPS therefore it is thought that it also exerts control in vivo by restricting the activity of hexokinase. Glucose-induced signaling, and also signaling directly or indirectly induced by related sugars, such as sucrose, plays an important role in many organisms for the proper reaction to the availability of external sugar, such as in yeast, or to internal production of sugar, such as in photosynthetic plants or in the digestive system of animals. In yeast, the presence of external glucose, or related sugars, triggers several signaling pathways that cause rapid adaptation of the metabolism to maximum ethanol production and rapid growth. In photosynthetic plants, sugar-induced signaling controls the photosynthetic activity and the division of sugar between the source (photosynthetic parts) and hidden organs (non-photosynthetic parts, in particular roots, seeds and fruits). In animals, sugar-induced signaling controls the rate of absorption of sugar from the blood by the storage organs, for example in mammals it controls the rate of absorption of blood glucose by the liver. Yeast TPS mutants are deficient in glucose-induced signaling, a deficiency that is thought to be due to the absence of trehalose-6-phosphate inhibition of hexokinase activity. In higher plants, where trehalose does not accumulate in appreciable amounts, the function of the trehalose metabolism genes is not well understood. The plants in which the heterologous TPS or TPP genes have been expressed, show altered photosynthetic activity and sinking division of the sugar source, which indicates the possible effects on the signaling pathways induced by sugar. It is thought that this is due to changes in the level of trehalose-6-phosphate caused by the expression of the TPS or TPP genes (Patent application Zeneca-Mogen 6047 PCT).

In the present invention, the unexpected situation is demonstrated in which the truncation of the N-terminal part of the TPS genes of plants increases their catalytic activity and therefore probably their regulatory capacity. Therefore, the present invention allows the alteration of sugar-induced signaling in a more efficient manner in higher plants and possibly in animals. In addition, this allows to achieve this by homologous genetic modification in principle in any plant and animal species, for example by the expression of a truncated form of the homologous TPS enzyme. In the present invention, this alteration in signaling induced by sugar is achieved by the same steps as described hereinabove for the improvement of stress resistance. The functionality of the modified genes for the restoration of glucose influx control to glycolysis and the restoration of glucose-induced signaling can be verified in the following test system. The yeast TPS mutants are not able to develop on glucose because they are defective in the control of glucose influx towards glycolysis and glucose-induced signaling. According to the invention, it is shown that the expression of the modified TPS genes in the yeast strain tpsl? restores growth or development on glucose, indicating the restoration of the appropriate glucose signaling controls required for growth. The present invention according to a further aspect thereof provides a novel method for the measurement of trehalose-6-phosphate and trehalose-6-phosphate synthase. This method is a highly reliable method for the quantitative determination of trehalose-6-phosphate. The level of trehalose-6-phosphate in all organisms where it has been measured, until now is very low, in the range of 100 to 200 μM. This low concentration makes accurate quantification difficult and not very reliable by classical methods, for example by high-performance liquid chromatography (HPLC). Chromatographic methods are also tedious because the samples can only be measured one at a time. Other research groups have used the inhibition of yeast hexokinase by trehalose-6-phosphate as an indirect way to estimate the concentration of trehalose-6-phosphate present in cell extracts (Blazquez ma, Lagunas R., Gancedo C and Gancedo JM, 1993, FEBS Lett 329, 51-54). However, in general such assays are easily prone to interference with other compounds present in the cell extract, especially when they are derived from organisms such as plants and animals that contain many compounds not present in yeast. In the present invention, the quantitative and precise measurement of the level of trehalose-6-phosphate is achieved by means of a novel enzymatic assay which makes use of the purified phosphothrephase enzyme, preferably of Bacillus subtilis. The method comprises the following steps: a) extraction of the cells to be analyzed, with an extraction medium, preferably a strong acid, which destroys all the enzymatic activity but does not degrade the trehalose-6-phosphate; b) neutralization of the extract; c) centrifugation of the extract; d) separation of the acidic compounds, including trehalose-6-phosphate, present in the supernatant from alkaline and neutral compounds, preferably by means of an anion exchange column; e) treatment of the fraction containing the acidic compounds with purified phosphothrelease of Bacillus subtilis, to degrade trehalose-6-phosphate quantitatively to glucose-6-phosphate and glucose; f) separation of the glucose produced in step (e) of the produced glucose-6-phosphate and of the remaining sugar phosphates present, preferably by means of a second anion exchange column; g) determination of the glucose present, preferably by means of a glucose oxidase and peroxidase assay. The glucose level measured is identical to the level of trehalose-6-phosphate originally present in the cell extract. The established method for the measurement of trehalose-6-phosphate can be extended to the measurement of the activity of trehalose-β-phosphate synthase. Until now there is no available method that allows the measurement of the activity of trehalose-6-phosphate synthase directly based on the rate of formation of trehalose-β-phosphate. Trehalose-6-phosphate synthase catalyzes the synthesis of trehalose-6-phosphate and UDP from the substrates glucose-6-phosphate and UDP-glucose. The classical method for determining the activity of trehalose-6-phosphate synthase that is universally used, measures the formation of the second product of the enzyme, UDP (Hottiger, T., Schmutz, P., and iem, A. , 1987, J. Bacteriol., 169: 5518-5522). However, in cell extracts other enzymes, for example glycogen synthase, are present, which are capable of producing UDP. Therefore, this method is prone to interference from other enzymatic reactions. A method that directly measures the formation of trehalose-6-phosphate is much more preferable. Furthermore, said method does not allow the continuous measurement of the enzymatic activity as a function of time, since the termination of the reaction is necessary before UDP can be measured. It is now shown according to the invention, that the use of the purified phosphothrelase enzyme makes it possible to achieve both goals at the same time. For this purpose a coupled assay has been developed in which trehalose-6-phosphate is directly and completely converted to glucose by means of purified phosphothrelease and glucose produced continuously measured using the glucose oxidase / peroxidase method. In this assay, phosphotrehalase, glucose oxidase and peroxidase are present in excess, while trehalose-6-phosphate synthase in the cell extract is the limiting factor in the formation of the colored product. The present invention further relates to plants and other eukaryotic organisms that exhibit constitutive, inducible and / or organ-specific expression of a specifically modified TPS gene, whose plants or other eukaryotic organisms are obtainable by the method of the invention. The invention further relates to the seeds of those plants or vegetatively reproducible structures of those plants, such as cuttings, somatic embryos, protoplasts, as well as the additional generations of progeny derived from those seeds and structures. The invention also relates to the additional progeny of the other eukaryotic organisms. The TPS gene can be derived from various sources, such as plants, in particular Selaginella lepidophylla, Arabidopsis thaliana, rice, apple, sugar beet, sunflower (Helianthus annuus), tobacco (Nicotiana tabacum), soybean (Glycine max). The various genes can be expressed in homologous and heterologous environments. The eukaryotic organism to be transformed can thus be a plant, either the plant from which the gene is derived and now modified such that a modification in TPS activity is obtained, or a heterologous plant. Especially preferred hosts or hosts for the modified gene are harvest plants, in particular plants that are not inherently resistant to stress, but can be made resistant to stress by the method of the invention. As an alternative, the goal of the modification may be increased photosynthetic productivity and / or improved carbon division in the entire plant and in the specific parts of the plant. Other eukaryotic organisms that are going to be transformed are fungi and animals or animal cells. Examples of fungi for which an increase in TPS activity may be beneficial are Aspergill us niger, Agaricus bisporus, Pichia pastoris, Kluyveromyces lactis and methylotrophic yeasts. An example of a yeast is Saccharomyces cerevisiae. Animal cells are for example cultures of mammalian and invertebrate cells used for the production of proteins and small molecules, invertebrate cells used for the expression of baculoviruses. The present invention will be further illustrated in the following examples, which are intended not to be limiting.

EXAMPLES MATERIALS AND GENERAL METHODS Reagents Analytical grade Baker or Sigma reagents were used. The restriction and modification enzymes were from Boehringer-Mannheim. The ZAP cDNA synthesis kit, the Uni-ZAP XR vector and the Gigapack II Gold packaging extracts were obtained from Stratagene Cloning Systems (USA). The Sequenase Version 2.0 equipment for the determination of the nucleotide sequence was purchased from the United States Biochemical Corporation (USA). The resurrection plant Selaginella lepidophylla (Hook. &Grev. Spring.) Was collected in a dehydrated form of rocky soil from the arid zones of the states of Morelos and Oaxaca in Mexico. This was subsequently cultivated in controlled conditions (24 ° C and 16 hours of light with an average of 50% humidity) in Conviron development chambers or in a greenhouse. The plants were watered every third day with 20 ml of water for 2 liter pots. In order to treat S. lepidophylla up to stress or stress due to dehydration, the whole plant or the microfilar fronds were air-dried by placing them on a Whatman 3MM filter paper. From that moment the dehydration time was determined.

Strains The cDNA library was plated in E. coli strain XLl-Blue MRF 'and the SOLR strain was used to remove the pBluescript fragment from lambda phage, following the instructions given in the "ZAP cDNA Synthesis Kit" (Stratagene Cloning Systems, USA, Catalog # 200400, 200401 and 2004029). The DH5 alpha strain of E. coli was used to subclone and elaborate the constructions. Strain LBA4404 from A. tumefaciencs was used to transform tobacco and strain E. coli HB101, which has the plasmid pRK2013 (Bevan, M. (1984) Nucí.Aids Res. 22 ^: 8711-8721) was used to transfer plasmid pIBT36 from E. coli to A. tumefasciens by means of the conjugation of three progenitors as previously described (Bevan, M. (1984), supra).

DNA manipulation Recombinant DNA techniques such as bacterial transformation, isolation of DNA from the plasmid and bacteriophage lambda were carried out according to standard procedures (Sambrook, J., Fritsch, EF &Maniatis, T (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, New York). The labeling of the radioactive fragments was carried out by the technique of "random printing" with the oligonucleotides (Feinberg, A.P. &Vogelstein, B. (1983) Anal. Biochem. 132: 6.130.

Constructs The expression vector pBN35 is a derivative of pBinl9 (Bevan, M. (1984), supra) which was constructed by subcloning the 850 base pairs of the 35S promoter of CaMV cauliflower virus (Guilley, H., Dudley, K. , Jonard, G., Richards, K., &Hirth, L. (1982) Cell 21: 285-294) between the HindIII and SalI sites of pBinl9 and the 260 base pair fragment that constitutes the polyadenylation signal of the T-DNA nopalin-synthase gene (Bevan, M., Barnes, W. &Chilton, MD (1983) Nucí.Aids Res. 171: 369-385) at the Sacl and EcoRI sites of the same vector (Fig. 4) . Plasmid pIBT36 (Figure 5) was constructed by subcloning the sl-tps / p cDNA into the BamHl and Kpnl sites of the pBN35 expression vector.

Construction of the S cDNA bank. lepidophylla In order to isolate the cDNA clones an expression bank was prepared with the mRNA isolated from dehydrated S. lepidophylla micropiles for 2.5 hours, using the ZAP cDNA synthesis kit, the Uni-ZAP XR vector and the extracts of Gigapack II gold packaging. The laboratory manual of the "ZAP cDNA Synthesis Equipment" provided by the manufacturer (Stratagene Cloning Systems, Calif., USA, Catalog # 200400, 200401 and 2004029) was followed step by step. The polyA + RNA was extracted from S. lepidophylla microphylls, dehydrated for 2.5 hours, according to a known method (Chomczyniski, P. &Sacchi, N. (1987) Anal. Biochem. 162: 156-159). The initial titre of the bank was 2xl06 bacteriophage plaques / ml and after amplification of 1.5x1o11 bacteriophage plaques / ml. The pBluescript SK (-) plasmid was excised from the bacteriophage by means of the "zapping" technique according to the laboratory manual of the ZAP cDNA synthesis "(Stratagene Cloning Systems, Calif., USA; Catalog # 200400, 200401 and 2004029).

DNA sequencing Nested deletions of the insert were created with the ExoII and Nuclease Sl enzymes from the selected clone (Henikoff, S. (1984) Gene 28: 351-359), in order to subsequently determine their nucleotide sequence using the termination method of chain with the dideoxynucleotides (Sanger, F., Nicklen, S. &Coulson, AR (1977) Proc. Nati, Acad. Sci. USA 74: 5463-5467). The DNA sequence was analyzed using the computer software package of the Genetics Computation Group of the University of Wisconsin (UWGCG) (Devereux, J. Haeberli, P. &Smithies, O. (1984) Nucí, Acis Res. 12: 387-395). Hydrophobicity plots were obtained using a known program (Kyte, J. &Doolittle, R. (1982) J. Mol. Biol. 157: 105-132) and the alignment of the protein sequence with the BESTFIT program included in the UWGCG package.

Hybridization of nucleic acids In order to select the bank, bacteriophage plaques were transferred to a nylon Hybond N + membrane (Amersham Life Sciences) that was treated according to the conventional method for DNA denaturation (Sambrook, J. Et al., Supra). Second edition. Cold Spring Harbor Laboratory Press, New York). The filter was hybridized with oligonucleotides, labeled with the 32P isotope by means of the polynucleotide kinase, using 6xSSC (lxSSC = 0.15 M sodium chloride and 0.015 M sodium citrate) at 37 ° C. The filter was washed three times, 10 minutes each time at the same temperature and under the following conditions: 6xSSC; 4xSSC; and 2xSSC. Southern and Northern blotting or gel blotting techniques were performed according to standard protocols (Sambrook, J. et al., Supra) with the following modifications. For the genomic Southern, the DNA was fractionated on a 0.8% agarose gel in the TBE buffer and transferred to a Hybond N + nylon membrane. { Amersham Life Sciences). The filter was hybridized using the sl-tps / p cDNA labeled with the 32P isotope as a probe, using 2xSSC (lxSSC = 0.15 M sodium chloride and 0.015 M sodium citrate) at 65 ° C. The filter was washed three times, twenty minutes each time at the same temperature, and under the following conditions: 2xSSC; lxSSC; and 0.5xSSC. For Northern analysis, a 1.2% agarose gel was used in a MOPS-formaldehyde buffer and a Hybond N + nylon membrane was also used for transfer. Hybridization conditions were in 50% formamide and 2xSSC at 42 ° C. The three successive washes of the filter were performed with 2xSSC, 2xSSc and lxSSC, respectively at 55 ° C.

Tobacco transformation The transformation of tobacco (Nicotiana tabacum variety SRl) was carried out by means of the leaf disk method (Horsch, RB, Fry, JE, Hoffmann, NL, Eichholtz, D., Rogers, SG, Fraley, RT (1985) Science 227: 1229-1231), using Agrobacterium tumefasciens LBA4404 containing the plasmid pIBT36. Leaf discs were grown in Petri dishes containing the MS medium with vitamins (Murashige, T. &Skoog, F. (1962) Physiol. Plant 15: 473-497), hormones (0.1 ppm NAA and 1 ppm of BAP) and antibiotics (100 μg / ml kanamycin and 200 μg / ml carbenicillin) to regenerate the outbreaks in 4 to 6 weeks. The shoots were transferred to Magenta pots containing the Ms medium with antibiotics (100 μg / ml kanamycin and 200 μg / ml carbenicillin) and without hormones or vitamins, in order to regenerate the roots in 2 to 3 weeks later. The regenerated plants were transferred to pots with soil and grown in growth chambers (at 24 ° C with 16 hours of light) in order to obtain fertile plants within 4 to 6 weeks.

Determination of trehalose Trehalose was determined by the degradative method with trehalase (Araujo, P.S., Panek, A.C., Ferreira, R. & amp;; Panek, A.D. (1989) Anal. Biochem. 176: 432-436). In order to obtain soluble sugars, 500 mg of the fresh tissue or 50 mg of the dehydrated tissue (frozen in liquid nitrogen) were crushed in 0.5 ml of 100 mM PBS buffer, pH 7.0, in a homogenizer for microcentrifuge tubes. Four volumes of absolute ethanol were added and the samples boiled for 10 minutes in tubes with screw caps in order to avoid evaporation. Subsequently, these were centrifuged in microcentrifuge tubes for 2 minutes at 13,000 rpm and the supernatant was recovered. The samples were reextracted again with the same volume of 80% ethanol and the button or concentrate was dried in vacuo. The samples were resuspended in 0.250 ml of 50 mM PBS, pH 6.5. For the determination of trehalose, 4 μl (approximately 15 mU) of trehalase (Sigma Catalog No. T-8778) was added to 10-30 μl of the extract, and incubated for 2 hours at 30 ° C. As a negative control, we used a tube with an extract but without trehalase and as a positive control a tube with pure trehalose (Sigma Catalog No. T-3663). The volume was brought to 0.5 ml with 50 mM PBS, pH 7.0 and 0.5 μl of glucose oxidase and peroxidase were added from the Sigma team, Catalog No. 510-A, in order to determine the glucose. The incubation was for 40 minutes at 37 ° C and the optical density at 425 nm was immediately determined. In order to calculate the glucose concentration, a standard glucose curve with values between 0 and 75 mM was used. The values of the tubes without trehalase were subtracted from those treated with this enzyme, in order to calculate the amount of trehalose, taking into account that one mole of glucose is 1/2 mole of trehalose.

Determination of enzyme activity To determine the activity of trehalose-6-phosphate synthase, a reported method was followed (Londesborough, J. &Vuorio, O (1991) J. Gen. Microbiol. 137: 323-330) which consists essentially of a coupled assay that measures the molar extinction of NADH at 340 nm. The reaction was carried out in a volume of 100 μl containing 40 mM HEPES / KOH, as a buffer, pH 6.8, 10 mM glucose-6-phosphate, 5 mM UDP-glucose, 10 mM magnesium chloride and 1 mg / ml of bovine serum albumin. The reaction was incubated for 10 minutes at 30 ° C and stopped by boiling for 2 minutes. After cooling the tube, 900 μl containing 40 mM HEPES / KOH buffer, pH 6.8, 10 mM magnesium chloride, 2.5 μg / ml phosphoenolpyruvate, 0.24 mM NADH, 3.5 units of pyruvate kinase and 5 lactate units were added. -dehydrogenase (Sigma Catalog No. P-0294). The disappearance of NADH at 340 nm, incubating under the same conditions as those mentioned above, was measured spectrophotometrically. In order to determine the specific activity of trehalose-6-phosphate synthase, the protein concentration was measured by the Bradford method (Bradford, m.m. (1976) Anal. Biochem. 72: 248- EXAMPLE 1 Selection of TPS genes A TPS gene can be selected in various ways. There are two main possibilities for isolating TPS genes from plants. First of all, the functional complementation of Saccharomyces cerevisiae cells that are suppressed for the TPS1 gene is a direct procedure. The suppression of this gene causes a pleiotropic phenotype in yeast (Van Aelst et al., 1993, Mol.Microbiol.8, 927-943). One of the phenotypes is that such cells can not develop on glucose. The construction of the cDNA libraries from the plants of interest in the yeast expression plasmids can be used to transform a yeast strain that is deleted for TPS1. Transformants can then be verified for the restoration of growth or development on glucose. On the other hand, the synthesis of trehalose in the transformants can also be measured. If it is found that the transformants that restore growth on the glucose medium or that produce trehalose again, the plasmid DNA can be isolated and the inserts sequenced. Based on the sequence, it can then be concluded whether a real TPS counterpart or a suppressor has been isolated or not.

Secondly, a comparison of the amino acid sequences of trehalose-6-phosphate synthase can be made, deduced from the reported nucleotide sequences. The sequences used come from E. coli, EC-otsA [Kaasen, I., McDougall, J., Strom, A.R. (1994) Gene 145: 9-15]; Schizosaccharomyces pombe, SP-TPS1 [Blazquez, M.A., Stucka, R., Feldman, H & Gancedo, C. (1994) J. Bacteriol. 176: 3895-3902)]; Aspergill us niger, AN-TPS1 [Wolschek, M.F. & Kubicek, C.P. (1994) NCBI: Seq. ID 551471; unpublished]; Saccharomyces cerevisiae, SC-TPS1 [McDougall, J., Kaasen, Y. & Strom, A.R. (1993) FEMS Microbiol. Let. 107: 25-30]; Kluyveromyces lactis, KL-GGSl [Luyten, K., from Koning W., Tesseur, Y., Ruiz, M.C., Ramos, J., Cobbaert, P., Thevelein, J.M. Hohmann, S. (1993) Eur. J. Biochem. 217: 701-713]. As an example for the isolation of a plant homolog, the isolation of the Sl-TPS cDNA will be described here. Dehydrated resurrection plants, Selaginella lepidophylla, were collected from the rocky soil in arid zones of the States of Morelos and Oaxaca in Mexico. These were subsequently cultivated in 2-liter flower pots at 24 ° C with 16 hours of light and 50% relative humidity in Conviron development chambers. The plants were watered every third day with 20 ml of water. In order to isolate the cDNA clones, an expression library was prepared using 5 μg of the mRNA isolated from 50 g of S. lepidophylla microphyls dehydrated for 2.5 hours. After the cDNA synthesis, this was cloned using 1 μg of the Uni-ZAP XR vector. The bacteriophages were packaged in vi tro and were subsequently selected with a mixture of degenerate oligonucleotides coding for the consensus regions in the trehalose-6-phosphate synthase of the reported E. coli and yeast sequences. One of the isolated clones corresponds to a cDNA (sl-tps) with a complete coding region (Seq ID No. 1). The analysis of the deduced amino acid sequence resulted in 53% identity for trehalose-6-phosphate synthase and 29% for trehalose-6-phosphate phosphatase, compared to the reported sequences of trehalose-6-phosphate -syntase of bacteria and various yeasts. The homology of the protein encoded by sl-tps, called SL-TPS, to trehalose-6-phosphate synthase, maps the N-terminal region of the former, and the homology of SL-TPS to trehalose-6. -phosphate-phosphatase can be found throughout the entire sequence.

The isolation procedure as described for S. lepidophylla can be used for any other plant, preferably monocotyledonous and dicotyledonous. This method is of general application because the oligos degerados that were used to fish Selaginella TPS were tested successfully in Arabidopsis thaliana. Using a PCR reaction, a fragment of the TPS gene of A. thaliana could be isolated. Based on this fragment the TPS gene of complete A. thaliana was isolated (SEQ ID NO .: 2).

EXAMPLE 2 Preparation of constructions 1. Construction of yeast expression vectors containing plant TPS genes A 3.1 kb fragment containing the full-length S1TPS1 gene was obtained after amplification by PCR (94 ° C, 3 minutes, 1 cycle, 94 ° C, 1 minute, 50 ° C, 1 minute, 72 ° C, 2 minutes, 40 cycles, 72 ° C, 10 minutes, 1 cycle) using high-fidelity Expand DNA polymerase (Boehringer). As oligonucleotides, SLTPS-S1 (5 '-CATGCCATGGCTATGCCTCAGCCTTACC-3' were used, the bold letters indicate the start codon and the Ncol site is underlined) and the universal primers (5'-GTAAACGACGGCCAGT-3 ') were used with S1 cDNA -TPS1 cloned in pBluescript SK as a template. The CPR fragment was digested with Ncol and Kpnl and cloned into pSAL4. The tpsl mutant strains? and tpsl? tps2? of yeast were transformed and selected on SDGal plates (-ura). The complementation was evaluated in SDGlc (mean minimum -ura plus CuS04 100 μM). For the construction of the N-terminal deletion, the following oligonucleotides were used: oligo 5 'SLTPS-100 5'-CATGCCATGGGTCGAGGCCAGCGGTTGC-3', the bold letters indicate the start codon and the Ncol site is underlined. The oligo 3 'universal 5' -GTAAACGACGGCCAGT-3 '. A 2.8 kb fragment was obtained after amplification by PCR (94 ° C, 3 minutes, 1 cycle, 94 ° C, 1 minute, 50 ° C, 1 minute, 72 ° C, 2 minutes, 40 cycles, 72 ° C, 10 minutes, 1 cycle) using the high-fidelity Expand DNA-polymerase (Boehringer) with the SLTPS-100 and universal oligos, and the S1-TPS1 cDNA cloned in pBluescript SK as template. The PCR fragment was digested with Ncol and Kpnl and cloned into pSAL4. The mutant strains of yeast tpsl? and tpsl? tps2? they were transformed and selected in SDGal (-ura). The complementation was evaluated in SDGlc (mean minimum -ura plus CuS04 100 μM).

For the construction of expression vectors in yeast containing the TPS gene of A. thaliana, RT-PCR was used. The total RNA (5 μg) extracted from Arabidopsis thaliana cv. Columbia developed for 2 weeks in liquid MS medium containing 100 mM sodium chloride, was reverse transcribed using Superscript II (GIBCO) using an oligo dT primer (25 mer). A PCR reaction was performed (94 ° C, 3 minutes, 1 cycle, 94 ° C, 1 minute, 50 ° C, 1 minute, 72 ° C, 2 minutes, 40 cycles, 72 ° C, 10 minutes, 1 cycle ) using high-fidelity Expand DNA polymerase (Boehringer) to amplify AtTPSl using Ath / TPS-5 'oligos (5'-CATGCCATGGCTATGCCTGGAAATAAGTACAACTGC-3', the bold letters indicate the start codon, the underscore is the Ncol site) and Ath / TPS-3 '(5'- ATAGTTTTGCGGCCGCTTAAGGTGAGGAAGTGGTGTCAG-3'; the bold letters indicate the termination codon, the underlined part indicates the Notl site). A fragment of 2.8 kb was obtained corresponding to the expected size, digested with Ncol and Notl, and cloned into pSAL6. The mutant strains of yeast tpsl? and tpsl? tps2? they were transformed. The transformants were developed in SDGal (minimal mean -his). The complementation was evaluated in SDGlc (minimum mean -his plus CuS04 100 μM).

For the construction of the N-terminal deletion the following oligonucleotides were used: oligo Ath / TPS-? N5 '5'-CATGCCATGGCTTATAATAGGCAACGACTACTTGTAGTG-3', the bold letters indicate the start codon and the underlined part indicates the Ncol site. oligo Ath / TPS-3 '5'-ATAGTTTTGCGGCCGCTTAAGGTGAGGAAGTGGTGTCAG-3'; the bold letters indicate the termination codon and the underlined part indicates the Notl site. The total RNA (5 μg) extracted from Arabidopsis thaliana cv. Columbia developed for 2 weeks in liquid MS medium containing 100 mM sodium chloride, was reverse transcribed using SuperScript II (GIBCO) and an oligo dT primer (25 mer). A PCR reaction was performed (94 ° C, 3 minutes, 1 cycle, 9 ° C, 1 minute, 50 ° C, 1 minute, 72 ° C, 2 minutes, 40 cycles, 72 ° C, 10 minutes, 1 cycle ) using the high-fidelity Expand DNA polymerase (Boehringer) to amplify AtTPSl using Ath / TPS-? N5 'and Ath / TPS-3' oligos. A fragment of 2.6 kb corresponding to the expected size was obtained, digested with Ncol and Notl, and cloned into pSAL6. The mutant strains of yeast tpsl? and tpsl? tps2? they were transformed. The transformants were developed in SDGal (minimal mean -his).

The complementation was evaluated in SDGlu (mean minimum -his). 2. Construction of plant expression vectors containing the TPS genes of plants To clone the expression vectors in plants, the plant trehalose-6-phosphate synthase genes were first tested in a tpsl yeast mutant? and subsequently subcloned into the appropriate plant transformation vectors. The AtTPSl coding regions of 2.9 kb and? NAtTPSl of 2.6 kb were isolated after the digestion of plasmids pSAL6:: AtTPSl and pSAL6::? NAtTPSl with the enzymes Ncol and Kpnl. This last cycle is downstream (3 ') from the Notl site in pSAL6. The coding regions S1TPS1 of 3.1 kb and? NS1TPS1 of 2.8 kb were isolated after digestion of the plasmids pSAL4.SlTPSl and pSAL4. dNSITPSI with the enzymes Ncol and Kpnl, too. All DNA fragments were ligated to a 57 base pair fragment containing the 5 'guide of AtTPSl, the Xbal and Ncol sites. This fragment was obtained after annealing of oligonucleotides NA4 (5 '-CTAGAGCGGCCGCCAGTGTGAGTAATT-TAGTTTTGGTTCGTTTTGGTGTGAGCGTC-3') and NA5 (5'-CATGGACGCTCACACCAAAACAGAACCAAAACTAAATTATCACACTGGCGGCCGCT-3 '). Each cassette of the ligated, guiding coding region was further ligated to the pBN35 expression vector digested with XbaI and KpnI (Figure 1) leading to the pIBTIOl plasmids containing AtTPSl (Figure 2), pIBT102 containing ΔNATTPSl (Figure 3) , pIBTl03 containing S1TPS1 (Figure 4) and pIBT104 containing? NSITPSI (Figure 5). The vector pBN35 allows the expression of any gene under the control of the 35S promoter of cauliflower virus (CaMV) 35S (Guilley, H., et al., Cell 21: 285-294 (1982)) which is a strong promoter and constitutive. These plasmids were used to obtain transgenic plants, transformed by means of the Agrobacterium system, which when regenerated were able to produce trehalose. These constructions can be expressed in any plant that can be transformed using the Agrobacterium system or by any other method known in the state of the art. The expression vector pBN35 is a derivative of pBinl9 (Bevan, M., Nucí, Acid Res. 22: 8711-8721 (1984)) which was constructed by subcloning 850 base pairs of the 35S promoter of cauliflower virus CaMV (Guilley, H. Et al., Supra) between the HindIII and SalI sites of pBinl9 and the 260 base pair fragment that constitutes the polyadenylation signal of the T-DNA nopalin-synthase gene (Bevan, M. Et. al., Nucí.

Res. 11: 369-385 (1983)) at the SacI and EcoRI sites of the same vector (Figure 1). 3. Construction of the alleles Sl TPS1, At TPS1,? N Sl TPS1 and? N At TPS1 marked with HA In order to determine if the difference in activity between the TPS1 genes of plants, full-length and N-terminally deleted alleles is caused by the fact that the former are not able to form a correct TPS complex when expressed in yeast cells, marked versions of these genes were elaborated. The scheme as shown in Figure 9 was used to make these constructions. Figure 10 shows the resulting plasmids. The plasmid containing the TPS genes of plants is digested with the two unique restriction sites, one cutting just after the gene (Rl) and the second cutting near the 3 'end of the gene (R2). The fragment that is removed by the combined use of RI and R2 is replaced with a fragment obtained by PCR which is also digested with RI and R2. Site R2 is located within the PCR product while site Rl is part of the reverse primer (rev.). The constitution of the reverse primer is as follows: 5 'Rl-DETENTION-marker HA-Codons for the 6 amino acids of the relevant gene - 3' Table 1 shows the primers that have been used: The primers can be used for full-length genes as well as for the alleles? N.

Table 1 In Table 2, the different vectors and restriction enzymes that were used are indicated.

Table 2 EXAMPLE 3 Functional complementation of yeast tps mutants with plant TPS genes, modified 1. Complementation of the growth defect of tpsl? and tpsl? tps2? The tpsl strains? and tpsl? tps2? were transformed with the expression vectors in yeast containing either the TPS genes of S. lepidophylla or of A. thaliana of full length or suppressed at the end?. As controls, wild-type strains, tpsl? or tpsl? tps2? were transformed with an empty plasmid, or with a plasmid containing the TPS1 gene of yeast. The transformants were tested for growth on media containing glucose and fructose. Figures 6A and 6B show the growth on the medium containing glucose and fructose, of the Wild type and tpsl? transformed with a yeast expression vector containing a complete or truncated S. lepidophylla TPS gene. The bands are as follows: 1. Wild type, 2. tpsl ?, 3. tpsl? +? NTPS1 YES, 4. tpsl? + TPS1 YES, 5. tpsl? + TPS1 Se, 6. tpsl? tps2 ?, 7. tpsl? tps2? +? NTPS1 YES, 8. tpsl? tps2? + TPS1 YES, 9. tpsl? tps2? + TPS1 Se, 10. tpsl? tps2? + TPS2 Se. The full-length clone can only complement the tpsl strain? tps2 ?. This can not complement the growth defect of a tpsl strain? about glucose or fructose. However, if the N-terminal part is deleted, the gene of S. lepidophylla expressed from the Cu-inducible promoter can complement the growth defect in a tpsl ?. This clearly illustrates the beneficial effect of the N-terminal deletion. If the plant gene is expressed under the control of a strong promoter, can the full-length clone also complement the tpsl strain? for growth on glucose or fructose (not shown). 2. Restoration of trehalose levels in tpsl strains? Trehalose was measured in yeast cells using the method of Neves et al. (Microbiol Biotechnol 10: 17-19 (1994)). In this method, trehalose is degraded by trehalase and the glucose that is formed is measured by the glucose oxidase / peroxidase method. In summary, cells were collected on a filter, with pores of 0.22 or 0.45 μm, on a vacuum flask and washed with water. The cells were harvested, the weight was determined and these were frozen in liquid nitrogen. For extraction of trehalose, sodium carbonate (0.25 M) was added to the cells (1 ml per 50 mg of cells) and these were boiled for 20 minutes. After centrifugation, 10 μl of the supernatant was used to measure the content of trehalose. Each sample was then neutralized by the addition of 5 μl of a 1 M acetic acid solution. To each sample were added 5 μl of TI buffer (300 mM sodium acetate + 30 mM calcium chloride, pH 5.5) and 20 μl of Trehalase solution (isolated from the fungus Humicola grísea). The samples were incubated at 40 ° C for 45 minutes. In this step, trehalose is cleaved to glucose. In parallel to the samples, trehalose standards and control samples were also measured. After this incubation, the tubes were centrifuged briefly and 30 μl of the supernatant was used for the determination of glucose. To each sample, 1 ml of glucose oxidase / peroxidase solution containing o-dianisidine (0.1 mg / ml) was added and the mixture was incubated for 1 hour at 30 ° C. The reaction was stopped by the addition of 56% (v / v) sulfuric acid. For each sample the extinction was measured at 546 nm. Trehalose levels were measured in strains of S. cerevisiae tpsl? transformed - with the plasmids containing the genes S1TPS1,? NS1TPS1, AtTPSl or? NAtTPSl under the control of a Cu-inducible promoter. Table 3 shows the results of three independent experiments. The abbreviation 1? does tpsl mean? Table 3 l? + pSAU galactose 3.2 0.05 glucose NG NG fructose NG NG l? + pSAL4 :: SlTPSl galactose 2.1 0.01 glucose NG NG fructose NG NG l? + pSAL4 ::? NSlTPSl galactose 43.5 0.41 glucose 49.2 0.65 fructose 89.2 0.43 l? + PSAL6 :: AtTPSl galactose 1.6 0 glucose NT NT fructose NT NT l? + pSAL ::? NAtTPSl galactose 36.5 0.1 glucose 41.4 0.12 fructose 59 0.07 l? + pSAL4 :: ScTPSl galactose 43.4 1.25 glucose 37.1 1.01 fructose 54.4 1.53 l? + pSAL4 ::? CSlTPSl galactose 0 0 glucose NG NG fructose NG NG 1? + pSAL4 ::? N? C Sl TPS galactose 8.2 0.08 glucose 48.2 NT fructose NT NT The results in this table confirm the results shown in Figure 6. The full-length clones can not complement the growth defect of a tpsl strain? on medium containing glucose or fructose. Also on galactose these full-length clones are not capable of producing trehalose in tpsl ?. However, if the N-terminal part of either S lepidophylla or the TPS gene of A. thaliana is suppressed and the tpsl? are transformed with the plasmids that contain these genes, these strains are able to develop on glucose or fructose and these strains also produce high levels of trehalose. ("-" means that the measurement could not be performed because the cells are unable to develop under this condition; "ND" means not detectable). 3. The suppression of the N-terminus is necessary to obtain the TPS activity of an in vi tro assay.

The activity of trehalose-6-phosphate synthase was measured by a coupled enzymatic assay as described by Hottiger et al. (J. Bacteriol., 169: 5518-552 (1987)). The crude extracts were desalted on a Sephadex G-25 column with a bed volume of 2 ml, pre-equilibrated with 50 mM Tricine buffer, pH 7.0. The assay mixture contained 50 mM Tricine / KCl (pH 7.0), 12.5 mM magnesium chloride, 5 mM UDP-glucose, 10 mM glucose-6-phosphate, enzyme sample and water in a total volume of 240 μl. In controls, glucose-6-phosphate was omitted and replaced with water. The assay mixtures were incubated at 30 ° C for 30 minutes. The reaction was stopped by boiling for 5 minutes. After cooling, the test mixtures were centrifuged at 13000 rpm for 10 minutes. The UDP formed in the supernatant was measured enzymatically. The test mixture contained 66 mM Tricine / KCl (pH 7.6), 1.86 M phosphoenolpyruvate, 0.3 mM NADH, 5 μ of lactic dehydrogenase, and 60 μl of sample in a total volume of 990 μl. The reaction was initiated by the addition of 10 μl of pyruvate kinase, and incubated at 37 ° C for 30 minutes. The decrease in absorbance at 340 nm was recorded and used to calculate the enzymatic activity. enzymatic activity (μkat / gprot.) = ? OD3 0 x 240 μl x 1012 60μl x 6. 22 x 106 x 30 min x 60 sec / min x 30 μl x mg / ml protein lkat = 6xl07 units. The results of measurements of TPS activity are shown in Table 3. These indicate that only TPS genes deleted at the N-terminus, and not full-length clones, result in the high activity of trehalose-6-phosphate synthase when expressed in yeast. After the construction of alleles labeled with HA, these alleles were introduced into the tpsl strains? and tpsl? tps2 ?. The following strains were obtained: PVD164: a leu2-3 / 112 ura3-l trpl-1 his3-ll / 15 ade2-l canl- 100 GAL SUC2 + tpsl? :: TRPl + pSAL4 / Sl TPS1 HAtag (UR &3) PVD165: a leu2-3 / 112 ura3-l trpl-1 his3-ll / 15 ade2-l canl- 100 GAL SUC2 + tpsl? :: TRPl + pSAL4 /? N Sl TPS1 HAtag (UR .. 3) PVD179: a leu2-3 / 112 ura3-l trpl-1 his3-ll / 15 ade2-l canl- 100 GAL SUC2 + tpsl? :: TRPl Tps2? :: LEU2 + pSAL4 / Sl TPS1 HAtag (URA3) PVD181: a leu2-3 / 112 ura3-l trpl-1 his3-ll / 15 ade2-l canl- 100 GAL SUC2 + tpsl? :: TRPl Tps2? :: LEU2 + pSAL4 /? N Sl TPS1 HAtag (URA3) The presence of HA-tag (HA marker) did not interfere with the function of plant genes. The expression from the CUP1 promoter (pSal vectors) of the full length plant alleles did not restore the growth defect on glucose of a tpsl ?. Expression of the N-terminally deleted alleles restored the growth on glucose as observed for alleles not labeled with HA. The expression of Sl TPS1 genes labeled with HA N-terminally deleted and full length was tested in the tpsl strain? and in the tpsl strain? tps2 ?. Strains PVD164 (tpsl? + Sl TPS1-HA), PVD165 (tpsl? +? N Sl TPS1 HA), PVD179 (tpsl? Tps2? + Sl TPS1-HA) and PVD181 (tpsl? Tps2? +? N Sl TPS1-HA) have been developed up to the stationary phase in SDgal-URA (+ CuS04). The cells were washed in extraction buffer (for 1 liter: 10.7 g of Na2HP04 * 2H20, 5.5 g of NaH2P04 * H20, 0.75 g of KCl, 246 mg of MgSO4 »7H20, 1 mM PMSF, pH 7.0) and resuspended in 500 μl of extraction buffer. The extracts were made by vortexing twice for 1 minute in the presence of glass spheres. The extracts were clarified by centrifugation for 20 minutes. 10 μg of the extracts were run on a 7.5% PAGE gel. After staining or transfer, the nitrocellulose membranes were incubated for 1 hour in TBST containing 2% BSA (5xTBS: 6 g of Tris + 45 g of NaCl, pH 7.4; TBST = 1 x TBS + 0.05% Tween 20). The filters were then incubated for 1 hour with anti-HA antibodies (clone 3F10 of the anti-HA high affinity rat monoclonal antibody, Boehringer Mannheim) diluted 1: 1000 in TBST containing 2% BSA. The filters were then washed 3 times for 5 minutes in TBS and subsequently incubated for 45 minutes with the secondary antibody (Sigma A-6066, anti-rat) diluted 1: 20000 in TBST containing 2% BSA. The filters were then washed 3x5 minutes in TBST. After this, the filters were washed for 5 minutes in TBS. The alkaline phosphatase developing mixture (10 ml of 100 mM tris, pH 9.5, 50 mM MgCl2, 100 mM NaCl, 37.5 μl of X-phosphate and 50 μl of nitroblue tetrazolium (NBT)) was added to the filters and when the bands became visible, the reaction was stopped by the addition of water. The results are presented in Figure 11. The calculated molecular weight of the full-length SlTpsl protein (without the HA marker) is 109353 while the? N SlTpsl protein has a molecular weight of 99453. In order to find out if the difference in the capacity of complementation between the full-length TPS1 gene and the N-terminally deleted TPS1 gene is caused or not by the fact that the full-length protein can not perform a correct TPS complex, the FPLC analysis was performed. yeast extracts prepared from the tpsl strains? transformed with either Sl TPS1 full-length or the gene? N Sl TPS1. The extracts were separated on a gel filtration column (Superdex 200 HR 10/30) and the 750 μl fractions were collected as described by Bell et al., (J. Biol. Chem., 373, 33311-33319, 1998). The first fraction containing the proteins is fraction 10. Based on the characteristics of the column and based on the calibration experiments, the proteins in fraction 10-14 correspond to very large protein complexes in the range of 800,000 to 400,000 Daltons Figure 11 gives the result of Western blot using anti-HA antibodies. Here only fractions 10 through 15 are shown. Free TPS1 protein is present in fractions 25-27 (not shown). Very important is the fact that the full-length alleles and the? N Sl TPS1 are able to form complexes with the other subunits of the complex TPS This may indicate that the N-terminal region itself can exert an inhibitory function directly on the rest of the plant Tpsl protein. The fact that full-length TPS1 alleles do not result in any synthesis of trehalose in higher plants, can be caused by the inhibitory effect of the N-terminus. The construction of transgenic plants with these N-terminally suppressed constructs can result in plants with higher levels of trehalose and better resistance to stress.

EXAMPLE 4 Construction of transgenic Arabidopsis thaliana plants, which produce trehalose The transformation of Arabidopsis thaliana ecotype Columbia is carried out by means of the vacuum infiltration method (Bechtold, N. Et al., CR Acad. Sci. Paris 316: 1194-1199 (1993); Bent, A. et al. , Science 265: 1856-1860 (1994)), using the C58C1 strain of Agrobacterium tumefasciens harboring the auxiliary plasmid pMP90 and the appropriate plasmidic construct, and is mobilized from E. coli strain DH5 alpha by coupling three progenitors using E. coli strain HB101 harboring plasmid pRK2013 as an adjuvant. In summary, A. thaliana plants develop at 22-20C, under 16 hours of light, for 4 to 6 weeks, until inflorescences begin to appear. After emptying an Agrobacterium culture in a vacuum desiccator, the pots containing the Arabidopsis plants are placed upside down and infiltrated in a vacuum for 5 minutes. The plants are allowed to develop under the conditions described above. The seeds are harvested and selected in Petri dishes containing 4.4 g / liter of MS salts, 1% sucrose, 0.5 g / liter of MES buffer at pH 5.7 (KOH), 0.8% phytagar, and 30 mg / liter of Kanamycin to select the transformants. 500 mg / liter of carbenicillin are also added to stop bacterial growth. After 5 to 7 days the transformants are visible as green plants and are transferred to the same medium as described above but with 1.5 phytagar. After 6 to 10 days the plants with true leaves are transferred to the soil. The analysis of the transgenic plants is conducted to determine the integration of the gene in the genome of the plant and the number of copies of the gene by staining or Southern blotting and the transcription of the gene is carried out by Northern staining with standard techniques ( Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, New York (1989). An antibody against S1-TPS1 is used to confirm the correct translation of the transgene using Western blot (Towbin, H. et al., Proc. Nati, Acad. Sci. USA 76, 4350-4353 (1979)). The activity of trehalose-6-phosphate synthase (De Virgilio, C. et al., FEBS Lett 273: 107-110 (1990)) and the content of trehalose (Neves, MJ et al., World J. Microbiol Biotechnol 10: 17-19 (1994)) were measured by known methods. Table 4 shows phenotypes of transgenic Arabidopsis thaliana overexpressing the plant gene of trehalose-6-phosphate synthase.

TABLE 4. PHENOTYPES OF TRANSGENIC Arabidopsis thaliana WHICH EXPRESSLY EXPRESSES THE VEGETABLE GENES OF TREHALOSA-6-P-SYNTHASE TRANSGEN ROSETTE GROWTH INFLORESCENCES SILIQUA SEEDS (FLORENCE TIME) AtPSl Larger with leaves Retarded Larger Normal Normal greens and some purples (1-2 weeks)? NAtTPSl Smaller with Retarder Larger Few and Normal on tips of many purple leaves ( 2-3 weeks) purple inflorescence and smaller and sterile on inflorescence backgrounds SITPS1 Smaller with leaves Retarded Larger normal Normal greens and some purples (1-2 weeks)? NSITPS1 Smaller with many Retardants Larger Few and Normal on tips of purple leaves (2-3 weeks) purple inflorence and smaller and sterile on the inflorescence bottoms CONTROL Normal Normal Normal Normal Normal EXAMPLE 5 Mass Synthesis of Trehalose in Transgenic Plants of Potato, Sugar Beet and Sugar Cane Manipulation by genetic engineering has made it possible to express almost any gene in a heterologous organism. Transgenic plants can be used as bioreactors for the large-scale production of compounds of commercial interest, which are normally only obtained in limited quantities, such as biodegradable plastics, different carbohydrates, polypeptides for pharmaceutical use and enzymes for industrial use (Goddijn , OJM and Pen, J., Trends Biotech 13: 379-387 (1995)). Different methods for the transformation of higher plants have been reported, including crops of great economic importance (Walden, R. and Wengender, R., Trends Biotech, 13: 324-331 (1995)). Tobacco transformation (Horsch, RB et al., Science 227: 1229-1231 (1995)) and potato (Sheerman, S. and Bevan, MW, Plant Cell Rep. 7: 13-16 (1988)) are carried performed efficiently using the Agrobacterium tumefasciens system and said technique can be established in a laboratory by people who are experts in the state of the art. Constructs for the expression in plants of any plant gene of trehalose-6-phosphate synthase, preferably S1TPS1, devoid of its N-terminal region can be made in a vector derived from the Ti plasmid which lacks the tumorigenic T-DNA genes and which contains a selection marker for transformed plants which, for example, confers resistance to kanamycin (Bevan, M., 1984, Nucí Acids Res. 22: 8711-8721). In addition, an appropriate promoter must be chosen depending on the use that will be given to the transgenic plant. The polyadenylation signal from the nopalin-synthase gene in the T-DNA can be used (Bevan, M., Barnes, W. and Chilton, M.D., 1983, Nucí.Aids.Res. 11: 369-385). To overproduce trehalose for industrial use, plants such as potatoes, cane sugar or sugar beet can be used. For example, potatoes store large amounts of carbohydrate in the tuber. In terms of plant biomass, potatoes represent one of the most productive crops per unit area (Johnson, V.A. and Lay, C.L., 1974, Agrie Food Chem. 22: 558-566). There are strong tuber-specific promoters such as the promoter of class I of the patatin gene (Bevan, M. et al., Nucí Acids Res. 14: 4625-4638 (1986); Jefferson, R. et al., Plnat Mol, Biol. 14: 995-1006 (1990)) which could be used to produce large amounts of trehalose. The convenience of using potatoes, sugar beets or cane sugar as systems for overproducing trehalose is that these plants are human food and therefore the trehalose isolated from them could easily be accepted by consumers. Trehalose obtained by overexpression in plants could be used to preserve biomolecules for industrial use, such as restriction and modification enzymes (Colaco, C. et al., Bio / Technology 10: 1007-1111 (1992)), vaccines, or processed foods.

EXAMPLE 6 Transgenic cereal plants resistant to environmental stress Cereals are the staple food for global nutrition and these could be grown under conditions of unfavorable climates if they could produce trehalose in response to cold, heat, salinity or drought. In order to achieve this, it is required to express any plant gene of trehalose-6-phosphate synthase, preferably S1-TPS1, devoid of its N-terminal region under the control of promoters that are induced by any of these environmental factors. (Baker, SS et al., Plant Mol. Biol .. 24: 701-713 (1994); Takahashi, T. et al., Plant J. 2: 751-761 (1992); Yamaguchi-Shinozaki, K. and Shinozaki, K., Plant Cell 6: 251-254 (1994)). The synthesis of trehalose only under stress conditions could avoid the continuous production of trehalose (using a constitutive promoter) that deviates from the metabolism of carbohydrates and as a consequence could decrease the quality and productivity of the grains. There are reports on corn transformation (D'Halluin, K. et al., Plant Cell 4: 1495-1505 (1992)), barley (Wan, Y. and Lemaux, PP.G., Plant Physiol. 104: 37-48 (1994)), wheat (Vasil, V. Et al., Bio / Technology : 667-674 (1992)) and rice (Shimamoto, K. et al., Nature 338: 274-276 (1989)). This methodology can be implemented by a person familiar with the state of the art.

EXAMPLE 7 Fruits from transgenic plants with a longer shelf life Different types of fruit such as tomatoes, mangoes and bananas mature quickly and tend to rot before reaching consumers. The early harvest of fruits and their storage in refrigeration or in chambers with a controlled environment has traditionally been used to avoid this problem. However, these methods are expensive, especially if the fruits will be transported to distant places. In order to increase the shelf life of the tomato, a delay in maturation has been reported using transgenic plants that express in antisense the gene and the polygalacturonase that is involved in the ripening of the fruit. Despite this delay in maturation, there is still the problem that after a certain time this process is carried out without the product necessarily reaching the consumer in a good condition. As an alternative to this method, it is proposed to produce trehalose in transgenic tomato, mango and banana plants. For example, using a specific promoter of tomato fruit (Bird, CR et al., Plant Mol. Biol. 11: 651-662 (1988)), any plant gene of trehalose-6-phosphate synthase, preferably S1 -TPS1, devoid of its N-terminal region could be overexpressed so that trehalose accumulates specifically in that organ. The transformation and regeneration method for tomato plants (as described by McCormick, S. et al., Plant Cell Rep. 5: 81-84 (1986)) can be carried out by anyone who knows that state of The technique. The tomato and other types of fruit could be harvested mature and then subjected completely or in parts to desiccation and preserved for prolonged periods without the need for refrigeration. When rehydrated, the fruit could have the normal organoleptic properties that the consumer demands. In principle, the strategy described above can be implemented for other types of fruit with the condition that a regeneration and transformation system is available for the plant in question, and that there is an appropriate promoter specific to the fruit.

EXAMPLE 8 Increase in the viability of the cells, organs or parts of the plant involved in sexual or asexual reproduction The production of pollen with prolonged viability could be of great help in the programs of cultivation of plants and in the preservation of germinal plasma. Similarly, the possibility of storage for prolonged periods and an increase in the viability of seeds, bulbs, tubers, cuttings for grafts, shoots and flowers will have a greater impact on the cultivation of plants and the conservation of germ plasm. The presence of trehalose in a tissue, organ or part of the transformed plant will make it possible to preserve said tissue, organ or part at room temperature in a dehydrated state for significantly longer periods than without trehalose. In order to achieve this goal, it is necessary to clone any plant gene of trehalose-6-phosphate synthase, preferably Sl-TPS1, devoid of its N-terminal region in a plant expression vector under a tissue-specific or tissue-specific promoter. organ and transform the plant in question with this construction by any of the methods reported, known by someone familiar with the state of the art. There are reports of pollen-specific promoters (Guerrero, FD et al., Mol.Gen. Genet, 224: 161-168 (1990), tuber-specific promoters (Bevan, M. et al., Nucí, Acis Res. 4625-4638 (1986); Jefferson, R., Plant Mol. Biol. 14: 995-1006 (1990)) and seed-specific promoters (Colot, V. et al., EMBO J. 7: 297-302 ( 1988)) that could be used to construct hybrid genes for the expression of trehalose in plants.

EXAMPLE 9 Test of different stress conditions The tolerance of transgenic plants against various stress conditions was tested in the following way. 1. FRIÓ Transgenic plants that overexpress S1-TPS1 under the control of the constitutive 35S promoter were analyzed by Southern blotting to verify the correct insertion of the transgene in the plant genome. The expression of the S1-TPS1 gene was corroborated by Northern blotting. The transgenics were verified for the accumulation of trehalose and not detected in the control plants, transformed only with the vector. T2 plants of Arabidopsis, transgenic (20 days old) were grown in pots containing soil / vermiculite, under 16 hours of light / 8 hours of darkness at 24 ° C in a growth chamber under well-wet conditions. The control and synthesis plants of trehalose were transferred to a growth chamber at 4 ° C for 10 days at constant light and returned to 24 ° C for 2 days. Other groups of plants were left at 24 ° C. Damage to cold treated plants was visually estimated (chlorosis, leaf decay and death) and by the measurement of photosynthesis photoinhibition (Murata, N. et al., Nature 356: 710-713 (1992)) using an IRGA device (infrared gas analyzer). Growth retardation in leaf size and plant height was also measured after comparison of cold treated versus untreated plants. 2. FREEZING Freezing tolerance was determined in the cold treated trehalose control and synthesis plants, obtained as previously described, by the electrolyte leak test. Frozen leaves were detached at various temperatures below zero and, after thawing, cellular damage due to membrane damage was estimated by measuring the leakage of ions from the tissues using a conductivity meter (Jaglo- Ottosen, KR et al., Science 280: 104-106 (1998). 3. HEAT Transgenic plants of generation T2 of Arabidopsis (of 20 days of age), control and synthesis of trehalose were developed in pots containing soil / vermiculite, under 16 hours of light / 8 hours of darkness at 24 ° C in a chamber of growth under well-wet conditions. The plants were pre-conditioned after incubation for two hours at 35 ° C and then subjected to 1 hour of heat at various temperatures in the range of 46 to 56 ° C for each independent treatment. The plants were returned at 24 ° C for 5 days. The damage was determined visually (chlorosis, leaf deterioration and death). Similar tests can be conducted using seedlings developed for 7 days at 24 ° C on moist filter paper inside Petri dishes (Lee, J.H. et al., Plant J. 8: 603-612 (1995)). 4. DESECTION Transgenic plants of the T2 generation of Arabidopsis (20 days old), control and that synthesize trehalose, were developed in pots containing soil / vermiculite, under 16 hours of light / 8 hours of darkness at 24 ° C in a chamber of growth under well-wet conditions. Tension to the drought was imposed by stopping the irrigation for several days until the leaves withered and then the plants were watered again. The controls were not recovered while the trehalose producing plants continued to develop normally. Also the detached leaves were air dried at 20% relative humidity. The fresh weight was measured in a period of 48 hours. The trehalose-producing plants lost less weight (Holmstrom, K.-0 et al., Nature 379: 683-684 (1996)).

. OSMOTIC TENSION Transgenic plants of the T2 generation of Arabidopsis (20 days old), control and that synthesize trehalose, were developed in pots containing soil / vermiculite, under 16 hours of light / 8 hours of darkness at 24 ° C in a growth chamber under well-wet conditions. Independent groups of plants were irrigated with various concentrations of NaCl (100-300 mM) or PEG (5 or 10%) for 1 to 3 weeks. The development of the plants was evaluated by measuring the percentage change in height and in fresh weight (Tarczynski, M.C. et al., Science 259: 508-510 (1993)). 6. STORAGE The plant TPS gene will be cloned under the control, for example, of the E8 promoter specific to tomato fruit, which is induced by ethylene and its maximum activity is reached in mature fruits (Lincoln, JE &Fischer, RL, Mol. Genet, 212: 71-75 (1988); Good, X. et al., Plant Mol. Biol. 26: 781-790 (1994); Tieman, D. et al., Plant Cell 4: 667-669 ( 1992)) in the pBIN19 vector containing a 3 'end NOSpA (Guilley, H., et al., Cell 21: 285-294 (1982)) and (Bevan, M. et al., Nucí Acids Res. : 369-385 (1983)). The vectors will be mobilized to Agrobacterium tumefaciens by coupling three progenitors. Tomato transformation will be performed by well-established protocols (Tieman, D. et al., Plant Cell 4: 667-669 (1992)). The analysis of gransgenic fruits will be carried out using different techniques. Determination of the S1-TPS1 cDNA in the genome of the plant by Genomic Southern gels. Determination of transcription of S1-TPS1 by Northern blotting and expression of S1-TPS1 proteins by Western blotting. The measurement of the enzymatic activity of S1-TPS1 and the content of trehalose will be carried out by standard techniques (De Virgilio, C. et al., FEBS Lett 273: 107-110 (1990) and (Neves, MJ. Et al. , World J. Microbiol, Biotechnol 10: 17-19 (1994).) Shelf life is analyzed in control tomatoes and trehalose producers considering several ripening parameters, such as: smoothing ratio, ethylene production and quality of the fruit (texture, color, sugar content, size) in periods of several weeks.

EXAMPLE 10 Trehalose-6-phosphate assay 1.1 Existing assays of trehalose-6-phosphate To study the importance of Tpsl and more specifically of its trehalose-6-phosphate product, it is essential to be able to measure the levels of Tre6P that are actually present in the cytosol. So far, three methods for determining Tre6P levels have been described. In a first method (Meleiro et al., 1993, Analytical Biochemistry 213, 171-2) Tre6P was extracted by a combination of extraction with TCA, followed by extractions with ether, precipitation with barium acetate and anion exchange chromatography. TredP was dephosphorylated by alkaline phosphatase, hydrolysed in two glucose molecules by trehalase and finally glucose was detected by the glucose-oxidase-peroxidase method. This method has been developed to evaluate a process for producing and purifying large amounts of Tre6P. Since the reported levels of Tre6P in yeast cells are lower than the levels For glucose, trehalose and Glu6P, this method could have a huge antecedent and a lack of sensitivity. A second method uses high pressure liquid chromatography (HPLC) to detect and quantify Tre6P (De Virgilio et al., 1993, Eur J. Biochem.212, 315-23). With this method it was possible to quantify high levels of TredP in tps2 mutants? after a heat shock (Reinders et al., 1997, Mol Microbiol 24, 687-95) and detect a transient increase in Tre6P levels after the addition of glucose to wild-type, derepressed yeast cells. Hohmann et al., 1996, Mol Microbiol 20, 981-91). This had a detection limit of about 200 μM of Tre6P. This is around resting levels that have been reported in cells in exponential growth and stationary phase (Blazquez et al., 1993, FEBS Lett 329, 51-4). The sensitivity of this method does not allow reliable quantification of the concentrations present in normal yeast strains or strains affected in the Tre6P synthesis. A third method is based on the observation that Tre6P inhibits the activity of the yeast hexokinase in vi tro (Blázquez et al., 1994, FEMS Microbiol Lett 121, 223-7). The level of this inhibition serves as a measure for the Tre6P content of the extracts. Activity j ^ iüH hexokinase is measured by the determination of the rate or rate of formation of one of its products, fructose-6-phosphate (Fru6P). The intracellular Tre6P in cells in stationary and exponential growth was estimated to be around 200 μM. The authors also observed that this inhibitory effect of Tre6P on the activity of hexokinase was suppressed by the presence of glucose. Since under certain conditions high concentrations of glucose and in general other compounds that interfere with the compounds may be present, this method is also not suitable. 1. 2 Principles of the new method The main objective of the method of the invention is to be more sensitive and more reliable than the existing methods. This is based on the enzyme phosphothrelease of Bacillus subtilis that is encoded by the treA gene. This enzyme is functionally related to the bacterial PTS system, and hydrolyses Tre6P in glucose and GludP (Helfert et al., 1995, Mol Microbiol 16, 111-120, Rimmele &Boos, 1994, J. Bacteriol., 176, 5654-64) . By measuring the glucose produced in this reaction, the initial amount of Tre6P can be calculated. GludP is not used for this purpose because this compound is frequently present in large quantities in yeast cells. It is difficult to separate it from TredP, while the glucose originally present in the extracts can be easily separated from the sugar phosphates by anion exchange chromatography (Figure 16). 1. 3 Purification of the enzyme phosphotrehalase from B. subtilis The enzyme phosphotrehalase has been purified and characterized by the group of M.K. Dahl (Gotsche &Dahl, 1995, J. Bacteriol 177, 2721-6; (Heelfert, et al., 1995, supra) This group provided the plasmid pSG2 with the treA gene constitutively expressed behind the strong degQ36 promoter of B. subtilis To obtain stable high expression, the gene was cloned into the vector pCYBl (New England Biolabs) behind the strong tac promoter inducible by IPTG.The treA gene was amplified by PCR with the primers CVV5 (TGGTGGAT'TA, ATATGAAAACAGAACAAACGCCATGGTGG) and CVV6 (TTAACAGCTCTTCC 'GCA, AACGATAAACAATGGACTCATATGGGCG), introducing respectively an Asel and a SapI restriction site at each end of the PCR product and cloned into the plasmid pCYBl and called pCVVl (Figure 7). And, indicate the site where the restriction enzyme.

Comparison of the phosphothrelase activity of the transformed strains with the original pSG2 plasmid (EcVVl) or the new pCVVl (EcVV3) showed that the last strain contained 10 times more activity than the strain with the plasmid pSG2 (Figure 17). These EcVV3 cells were grown overnight in 4 ml of LB-ampicillin medium. The next day this culture was used to inoculate 100 ml of LB ampicillin and allowed to develop again for 3 hours, after which expression was induced with IPTG (0.5 mM) and the culture was incubated for another 3 hours at 37 ° C . The cells were centrifuged 10 minutes at 4000 rpm and resuspended in 30 ml of buffer A (25 mM Bis-Tris, pH 7, 10 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride). The cells were used by passing the resuspended cells twice through a French press. The crude extract was then rinsed by ultracentrifugation for 30 minutes at 35,000 rpm and the supernatant was passed through a 0.22 μm filter. Anion exchange chromatography was performed with a linear gradient from 100% buffer A to 50% buffer B (25 mM Bis-Tris pH 7, 10 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 1 M sodium chloride) in 20 column volumes on a MonoQ HR5 / 5 column. Fractions of 500 μl were collected. The hydrolysis activity of PNPG of each fraction was measured and the two fractions with the highest activity were combined and concentrated to 200 μl before the gel filtration with a Vivaspin column (Vivascience). For the gel filtration, an isocratic elution with 10% buffer B was used on a Superdex75 column. The two fractions of 500 μl with the highest activity were combined and again concentrated to 400 μl and stored in aliquots at -30 ° C. Both columns were run on an AKTA-FPLC system (Pharmacia). The purification performed in this manner gave a 4.5-fold increase in the specific activity with a recovery of 34%. The analysis of SDS-PAGE with Coomassie Blue staining showed already a band of very large overexpression protein of the expected size. No other bands were visible in the final purified fractions with 10 μg of protein per band. 1. 4 Sampling of the yeast culture Samples were taken by steeping 3 ml of a cell suspension in 10 ml of 60% methanol at -40 ° C. This immediately stops the cell metabolism and allows the determination of the intracellular metabolites as a function of time after an experimental manipulation, for example the addition of glucose to the derepressed cells (de Koning &van Dam, 1992, Anal Biochem 204, 118 -2. 3). 1. 5 Extraction of metabolites The extraction of metabolites from the frozen cells was carried out using the extraction with perchloric acid. 1. 6 The first anion exchange chromatography To separate the glucose and trehalose from the Tre6P present in the cell extracts, the weak anion exchanger NH2-SPE (International Sorbent Technology, United Kingdom) was selected. The columns were filled with 500 mg of resuspended sorbent in 3 ml of 100% methanol and rinsed with 3 ml of 100% methanol. A weak anion was bound to it by equilibrating the column with 0.5 M acetic acid and the excess acid in the column was rinsed with 2 3 ml portions of MilliQ water. The sample was applied and the bound sample was rinsed with 3 ml of 20% methanol to remove the specific binding. The anions were eluted with a 2.5 M ammonia solution pH 12.5. When 250 mg of sorbent per 100 mg of extracted cells were used, there was no risk of spinal overload. Salt did not interfere significantly with the determination of glucose. The eluted extracts were evaporated without loss of TredP. 1. 7 The reaction conditions of phosphotretalase Because the enzyme was unstable at the reported optimum pH of 4.5, a more physiological pH of 7 was chosen to perform the incubation. The incubation buffer was a 50 mM Bis-Tris buffer, pH 7. The incubation temperature was 37 ° C. 2000 U of phosphobrehalase was added and the samples were incubated at 37 ° C for 2 hours. One unit was the amount of enzyme that hydrolyzed 1 nmol of Tre6P per minute under the conditions mentioned. 1. 8 The second anion exchange chromatography To separate the glucose that was produced in the phosphothrelease reaction from the other anionic cell compounds, a second chromatography was performed J ^^ of anion exchange in the same way as the first. This time the side-to-side flow that does not bind to the column and that contains the glucose, was recovered and concentrated by vacuum drying. 1. 9 The glucose test The dried glucose samples were redissolved in 250 μl of 50 mM Bis-Tris buffer, pH 7. From each sample, the glucose concentration was determined in 200 μl of undiluted sample and in a 1/5 and 1/25 dilution. In a microtitre plate at a sample volume of 200 μl, 20 μl of a reaction mixture containing 15 glucose-oxidase units, 10 units of peroxidase and 100 μg of ortho-dianisidine was added. This plate was incubated at 37 ° C for 45 minutes and then the reactions were stopped by the addition of 45 μl of 56% sulfuric acid. The absorbance was measured at a wavelength of 530 nm. 1. 10 Recovery and reproducibility The recovery of the extraction procedure with perchloric acid is 57%. The trial recovery Tre6P complete is 25%. The detection limit of the method was 100 μM and the standard lines of TredP are linear in the physiologically relevant range (Figure 8-1 to 8-III). The TredP standards were performed by adding known amounts of TredP to the cells of the tpsl strain. that lacks the TredP synthase, before extraction with perchloric acid. The standard error on the slope and the ordered to the origin of 4 independent standard lines was respectively 2 and 9%. The concentrations of trehalose-6-phosphate were measured in yeast strains containing the TPS1 alleles plant, full length and N-terminally deleted. The strains were either developed to the exponential phase or to the stationary phase in minimal medium containing galactose or glucose. For this experiment, the background of tpsl? Tps2 was used? because the level of trehalose-6-P in the background of tpsl? It is too low to be measured. The strains that were used are: JT6308 1? 2? + pSAL4 PVD44 1? 2? + pSAL4 / Sc TPS1 JT6309 1? 2? + pSAL4 / Sl TPS1 PVD43 1? 2? + pSAL4? N Sl TPS1 PVD138 1? 2? + pSAL6 / At TPS1 JT20050 1? 2? + pSAL6 /? N At TPS1 PVD150 2? + pRS6 (empty plasmid with the HIS3 marker) "1?" does it mean "tpsl?", "2?" does it mean "tps2?" After collection of yeast cells, extractions were performed as described in Example and the concentrations of trehalose-6-P were measured. The results are shown in Figure 18. There are four times less trehalose-6-phosphate in the extracts prepared from the strains containing the plant TPS1 genes compared to the control strain overexpressing the TPS1 gene of yeast. This lower level of trehalose-6-phosphate may explain why there is still dysregulation of the glucose influx in glycolysis in this strain (Example 12). This dysregulation of glucose influx was similar for strains containing either full-length or N-terminally deleted plant TPS alleles and this is consistent with the results obtained here. There is no difference in trehalose-6-phosphate levels between the strains containing the full-length or N-terminally deleted alleles.

EXAMPLE 11 Chimeric mergers of the TPS and TPP domains To generate a more efficient enzymatic pathway involved in the biosynthesis of trehalose, a series of chimeric enzymatic fusions were created between the TPS and TPP domains from TPS1 and TPS2, either from A. thaliana or S. cerevisiae As shown in Figure 13, these four fusions consist of: a DNA fragment of 1337 base pairs of AtTPSl (? NAtTPSl) encoding a truncated N-terminal protein (lacking its first 100 amino acids) of 442 amino acids , obtained by pCR (94 ° C, 3 minutes, 1 cycle, 94 ° C, 1 minute, 52 ° C, 1 minute, 72 ° C, 1.5 minute, 40 cycles, 72 ° C, 10 minutes, 1 cycle) using High-fidelity Expand DNA-polymerase (Boehringer) with oligonucleotides (5'-CATG-CCATGGCTTAT-AATAGGCAACGAC-TACTTGTAGTG-3 ', the site Underlined Ncol and start codon in bold) and (5'-CGGGATCCAGCTGTCATGTTTAGGGC-TTGTCC-3 ', underlined BamHl site), fused to a 1138 base pair DNA fragment from AtTPPB encoding full-length protein of 374 amino acids obtained by PCR (94 ° C, 3 minutes, 1 cycle, 94 ° C, 1 minute, 52 ° C, 1 minute, 72 ° C, 1.5 minute, 40 cycles, 72 ° C, 10 minutes, 1 cycle ) using the high-fidelity Expand DNA-polymerase (Boehringer) with the oligonucleotides (5'CGGGATCCACTAACCAGAATGTCATCG-3 ', BamHl site underlined) and (5'GGGGTACCTCACCTCCCACTGCC-3 'underlined Kpnl site and the start codon in bold). A second fusion consists of? NAtTPSl fused to a DNA fragment of 1358 base pairs from ScTPS2 coding for the 397 amino acids from its C-terminus, obtained by PCR (94 ° C, 3 minutes, 1 cycle, 94 ° C, 1 minute, 50 ° C, 1 minute, 72 ° C, 1.5 minute, 40 cycles, 72 ° C, 10 minutes, 1 cycle) using the high-fidelity Expand DNA-polymerase (Boehringer) with the Oligonucleotides (5 '-CGGGATCCGCTAAA-ATTAACATGG-3 ', BamHl site underlined) and (5' CGGGGTACCATGG-TGGGTTGAGAC-3 ', underlined Kpnl site). A third construct led to a fusion between a 1531 bp DNA fragment from ScTPSl that encodes a 492-amino acid protein, obtained by PCR (94 ° C, 3 minutes, 1 cycle, 94 ° C, 1 minute , 52 ° C, 1 minute, 72 ° C, 1.5 minute, 40 cycles, 72 ° C, 10 minutes, 1 cycle) using the high-fidelity Expand DNA-polymerase (Boehringer) with the oligonucleotides (5 '-CCGCTCGAGGGTACTC-ACATACAGAC -3 ', the underlined Xhol site) and (5' -CGGGATCCGGTGGCA-GAGGAGCTTGTTGAGC-3 ', underlined BamHl site), and AtTTPB.

The last fusion was performed between the ScTPSl and ScTPS2 fragments obtained as described above. The PCR fragments were digested with the appropriate restriction enzymes (Figure 13) and subcloned into the pRS6 vector. The mutant strains tpsl ?, tps2? and tpsl? tps2? of yeast were transformed and selected in SDGal (-his). The complementation was evaluated in SDGlc (mean minimum -his) and the development at 38.3 ° C.

EXAMPLE 12 Expression in tpsl? Yeast strains of the N-terminally deleted TPS1 plant genes restores growth on glucose but does not suppress the hyperaccumulation of sugar phosphates The suppression of TPS1 in S. cerevisiae results in a pleiotropic phenotype (Van Aelst et al., Mol.Microbiol., 8, 927-943). One of the phenotypes is that such a strain can no longer develop on rapidly fermentable sugars. Why the tpsl strains? they can not develop on glucose yet it is not clear. Three different hypotheses have been proposed (Hohmann and ^, ---------- Thevelein, Trends in Biol. Sciences, 20, 3-10, 1995). When the tpsl strains? they are changed from a medium containing glycerol to a medium containing glucose, there is a rapid accumulation of sugar phosphates and a rapid drop in the concentration of ATP. Apparently, TPS1 has a role in controlling the influx of glucose into glycolysis. Because the transport and phosphorylation are together, all the sugar that reaches the cell is phosphorylated. The reduction of the activity of Hxk2 can suppress the growth defect phenotype of the tpsl? about glucose and fructose (Hohmann et al., Current genetics 23, 281-289, 1993). In vi tro studies have clearly indicated that the product of the Tpsl protein, trehalose-6-phosphate, inhibits the activity of Hxk2 and as such, could control the flow of glucose towards glycolysis. When the counterpart of TPS1 of S. lepidophylla was expressed in yeast, a clear difference in growth was observed on the medium containing glucose, between the full-length clone and the N-terminal deletion construct. The Tpsl strains? transformed with Sl TPS1 of full length under the control of the CUP1 promoter do not grow on glucose. The expression in a tpsl strain? of a construct where the first 300 base pairs encoding the first 100 amino acids of the Sl TPS1 protein are deleted, results in growth on glucose. Thus, apparently, the full-length clone can not solve the glucose influx problem, whereas N-terminal suppression is able to control the glucose influx. To test this, an experiment was carried out where the concentration of the first metabolites in glycolysis was measured. The following strains were used: PVD72 Tpsl? + pSAL4 PVD14 Tpsl? + pSAL4 / Sc TPS1 PVD73 Tpsl? + PSAL4 / S1 TPS1 PVD15 Tpsl? + pSAL4 /? N Sl TPS1 For the determination of glycolytic metabolites, cells were developed on SDglycerol medium until the exponential phase. The cells were harvested by centrifugation. The button or concentrate was washed once, resuspended and then incubated in YP medium at 30 ° C. Glucose was added to a final concentration of 100 mM and CuS0 was added to a final concentration of 100 μM. Before and after the addition of glucose, samples were taken at the indicated time intervals and quenched immediately in 60% methanol at -40 ° C. The determination of glycolytic metabolites was performed on these samples essentially as described by Koning and van Dam (Anal Biochem 204, 118-123, 1992). Using the total amount of the protein in the sample as determined according to Lowry et al. (J. Biol. Chem. 193, 265-275, 1951), and the assumption of a cytosolic yeast volume of 12 μl per mg of protein, the cytosolic concentrations in mM were calculated. Figure 14 shows the result of a representative experiment. The results clearly indicate that in this short period after the addition of glucose, there is no difference between the metabolite concentrations of the TPS1 gene of full-length S. lepidophylla and that deleted from the N-terminus. There is clear hyperaccumulation of sugar phosphates after the addition of glucose, which is similar to what can be observed for the tpsl strain ?. These results with the constructs with N-terminal deletion show that the accumulation of sugar phosphates is not related to the fact that the yeast cells may or may not develop on glucose. This means that the N-terminal part is important for the control of the glucose influx towards glycolysis. This also implies that a strain tpsl? which contains the genes? N SI or? N At TPS1 can be used as a tool to increase the total flow through glycolysis. This strain develops perfectly on glucose but there is still a hyperaccumulation of metabolites in the upper part of glycolysis. Overexpression of enzymes downstream in glycolysis results in a higher flow. Since the metabolite concentration was only measured in a short period of time after the addition of glucose, another experiment was performed where the concentration of the metabolite was measured during the exponential development and during the stationary phase. These results are shown in Figures 15A-15F. These data confirm the results obtained in the first experiment. Is there a hyperaccumulation of sugar phosphates in the tpsl strain? Transformed with the construction of suppression 'N-terminal. From Figures 14 and 15 it is clear that the difference between the tpsl? and the tpsl strain? which contains the expression plasmid? N Sl TPS1 is the level of ATP. While the level of ATP in the tpsl strain? falls to zero, this is not the case in the other strains. The level of ATP that is left is apparently sufficient to develop on glucose. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (29)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. A method for the preparation of a eukaryotic organism, for example selected from plants, animals and fungi, which exhibits constitutive, inducible, and / or organ-specific expression of a specifically modified trehalose-6- (TPS) phosphate synthase gene, characterized the method because it comprises the steps of: a) the provision of a TPS gene; b) designing an appropriate modification to the TPS gene by aligning the gene with the corresponding gene of the yeast, and establishing which part of the gene extends beyond the 5 'end of the yeast gene; c) the deletion or inactivation of a portion of the N-terminal region of the TPS gene that extends beyond the 5 'end of the yeast gene, preferably the entire extension part thereof, in order to achieve increased activity of trehalose-6-phosphate synthase; d) the cloning of the gene thus modified into an expression vector under the control of a constitutive, inducible and / or organ specific promoter; e) the transformation of a plant cell or plant tissue with the expression vector obtained in this way; f) the regeneration of a complete plant from the transformed plant cell or tissue.

2. The method according to claim 1, characterized in that the part of the N-terminal region of the TPS gene that extends beyond the 5 'end of the yeast gene is inactivated by mutagenesis.

3. The method according to claim 1 6 2, characterized in that the TPS gene is the gene from a plant.

4. The method according to claim 3, characterized in that the TPS gene is the gene from Selaginella lepidophylla.

5. The method according to claim 3, characterized in that the TPS gene is the gene from Arabidopsis thalliana.

6. The method according to claim 3, characterized in that the TPS gene is the gene from rice.

7. The method according to claim 3, characterized in that the TPS gene is the gene from apple.

8. The method according to claim 3, characterized in that the TPS gene is the gene from sugar beet.

9. The method according to claim 3, characterized in that the TPS gene is the gene from sunflower (Helianthus annuus).

10. The method according to claim 3, characterized in that the TPS gene is the gene from tobacco (Nicotiana tabacum).

11. The method according to claim 3, characterized in that the TPS gene is the gene from soybean (Glicine max).

12. The method according to claim 1 or 2, characterized in that the eukaryotic organism that is transformed is a plant. The method according to claim 12, characterized in that the plant is selected from Selaginella lepidophylla, Arabidopsis thaliana, rice, apple, sugar beet, sunflower (Helian thus annuus), tobacco (Nicotiana tabacum), soybean (Glycine max ).

14. The method according to claim 1 or 2, characterized in that the eukaryotic organism that is transformed is a fungus. 15. The method according to claim 14, characterized in that the fungus is selected from Aspergillus niger, Agaricus bisporus, Pictia pastoris, Kluyveromyces lactis and methylotrophic yeasts. 16. The method according to claim 1 or 2, characterized in that the eukaryotic organism that is transformed is an animal. 17. The method according to claim 16, characterized in that the animal is selected from mammalian and invertebrate cell cultures, used for the production of proteins and small molecules, invertebrate cells used for baculovirus expression. 18. The plants, characterized in that they have an increased tolerance to stress and / or increased photosynthetic productivity and / or improved carbon distribution in the whole plant or in specific parts of the plant and / or a morphological or developmental alteration and that they harbor in its genome a specifically modified TPS gene as defined in accordance with claim 1 or 2. • The plant according to claim 18, characterized in that it is obtainable by a method according to claims 1 to 13. 20. The seeds of a plant according to claims 18 and 19. 21. The plants, characterized in that they are obtained from the seeds according to claim 20. 22. The progeny, characterized in that it comes from the plants according to claims 18, 19 and 20. 23. The fungi, characterized in that they have a capacity of improved fermentation and which contain in their genome a specifically modified TPS gene as claimed in accordance with claim 1 or 2. 24. The fungi, characterized in that they have an improved fermentation capacity and that they harbor in their genome a TPS gene specifically modified as is claimed in accordance with claim 1 or 2. 25. A method for the determination of trehalose-6-phosphate, characterized in that e a phosphotretalyase b is used from a bacterium, such as the auxiliary enzyme.

26. The method according to claim 25, characterized in that the bacterium is Bacillus subtilis. 27. The method according to claim 25, characterized in that the bacteria is Escherichia coli 28. Chimeric DNA constructions between the TPS and TPP domains, characterized in that they are from TPS1 and TPS2, either from A. thaliana or from S. cerevisiae 29. The DNA chimeric constructions according to claim 28, characterized in that they are as shown in Figure

13. The present invention relates to a method for the preparation of a eukaryotic organism, for example selected from plants, animals and fungi, which exhibits constitutive, inducible and / or organ specific expression of a specifically modified TPS gene, comprising the steps of provide a TPS gene; designing a suitable modification of the TPS gene by aligning the gene with the corresponding gene of the yeast, and establishing which part of the gene extends beyond the 5 'end of the yeast gene; suppressing or inactivating a part of the N-terminal region of the TPS gene that extends beyond the 5 'end of the yeast gene, preferably the entire extension part thereof, in order to achieve an increased activity of trehalose-6 -phosphate synthase; cloning of the gene modified in this way within an expression vector, under the control of a constitutive, inducible and / or organ-specific promoter; the transformation of a plant cell or plant tissue with the expression vector obtained in this way; and the regeneration of a whole plant from the transformed plant cell or tissue.