MXPA01002856A - Recombinant celo virus and celo virus dna - Google Patents

Abstract

Recombinant CELO virus or CELO virus DNA with a deletion at the right end of the viral genome that allows insertion of large pieces of foreign DNA. The virus is useful as a vaccine for animals, in particular birds, and for gene therapy and vaccine applications in humans. The virus can also be used for recombinant protein production.

Description

RECOMBINANT CELO VIRUS AND CELO VIRUS DNA DESCRIPTION OF THE INVENTION The present invention relates to viral vectors and viral DNA. Adenovirus has been studied for its role in human diseases (25), as a model for many important discoveries in molecular biology, including mRNA splicing, DNA replication, transcription and cell transformation (reviewed in 44) and, more recently , as a powerful reagent for the transient expression of genes (12, 46). A detailed understanding of the life cycle of the adenovirus is well established (reviewed in 50). From the initial efforts to use adenovirus as a gene transfer vector (18, 52, 28) the virus has gained popularity as a vector and a number of methods have been developed to generate alterations in the viral genome to carry new genes (2, 5, 11, 15, 21, 23, 26 , 32, 38, 41, 43, 48 reviewed in 31, 49). Due to the ease of construction and purification of the vector, and because these vectors have a powerful ability to transiently transduce new genetic material in a variety of types of ReE: 127354 mammalian cells in vi, adenovirus vectors were widely used in initial efforts in clinical gene therapy. Unfortunately, several traits of the vectors based on the type 5 adenovirus (Ad5) have limited success in initial applications. These included both the host immune response to adenovirus (reviewed in reference 55), as well as the inability of the virus to efficiently penetrate certain target cell types (20, 58, 59). Thus, there is now an interest in types of adenoviruses that can elicit less aggressive host immune responses and that can penetrate more efficiently into target cells. A large number of alternative adenovirus serotypes are known that may provide advantages in some applications against vectors based on Ad5. Additional adenoviruses that have recently been modified as vectors include sheep adenovirus 287 (29, 53, 56), bovine adenovirus type 3 (40, 60) and canine adenovirus (30). It is considered that these alternative serotypes would both provide a new skeleton of the vector to which there is no pre-existing immune response in the target host. In addition, because the adenoviruses are extremely species-specific in their replication capacity (50), a degree of safety against inadequate replication of the vector is gained by using a vector derived from a distant adenovirus species. There are several justifications for the search of these alternative viral subtypes. For applications in vaccines in their non-human hosts, these viruses, if appropriately modified, can elicit more effective immune responses than a vector based on human adenoviruses. In addition, more robust immune responses from a virus competent for replication could be expected; thus, a vector is most useful in a host in which replication is partially or fully tolerated. This is not the case with vectors based on human adenoviruses in almost all non-human hosts. It has been an object of the invention to provide an alternative adenovirus vector for use as a gene delivery vector and for use as a vaccine. To solve the problem on which the present invention is based, the adenovirus CELO of the birds has been chosen to be modified. ZEAL (lethal orphan chicken embryo or adenovirus type 1 poultry, reviewed in 39) was characterized as an infectious agent in 1957 (57). There are few serious health or economic consequences due to infection with CELO virus. CELO can be isolated from healthy chickens and, in general, does not cause any disease when it is reintroduced into chickens (10). The CELO virus is structurally similar to mammalian adenoviruses (mastadenovirus) with a 70-80 nm icosahedral capsule consisting of hexon and penton structures (33); the CELO virus genome is a linear, double-helical DNA molecule, with the DNA condensed within the virion by core proteins encoded by the virus (33, 36). The CELO virus has a genome greater than Ad5 (44 kb versus about 36 kb, reference 6, WO 97/40180). The CELO virion has two different lengths at each vertex (24, 33, 35) more than the single fiber of most other serotypes (reviewed in 50). The CELO virus is not able to complement the E1A functions of Ad5, and the replication of the CELO virus is not facilitated by the El activity of Ad5 (37). The complete sequence of CELO DNA (6, WO 97/40180) revealed additional differences between the CELO virus and the mastadenovirus, including the absence of sequences corresponding to the early E1A, E1B, E3 and E4 regions of Ad5. The CELO genome contains approximately 5 kb of sequence at the extreme left and 12 kb at the extreme right, rich in open reading frames, which have no sequence homology with Ad5 but which probably encode the functions of the virus. When CELO develops into a gene delivery vector, it has been considered that the virus is defective, in nature, in mammalian cells, and this property should limit the possibility of complementing by wild-type mammalian adenovirus. The CELO virion has an increased ability to pack DNA and physical stability much greater than the Ad5 virion. A practical feature of CELO is the ability to grow the virus in chicken embryos, a low cost and very convenient system (9, 33). In the experiments of the present invention, the borderline sequences of CELO, that is, the furthest left of 5 kb and the furthest of 13 kb of the CELO genome, are widely unexplored and are not common to other adenoviruses. Viral genetics have been used to characterize the requirements of these sequences from the left and right ends of CELO in the replication of the virus. Viral sequences have been deleted in discrete stages in order to identify regions essential or non-essential for replication. To facilitate the monitoring of the replication of the mutants, a luciferase expression cassette was inserted in place of the deleted sequences. The modified CELO genomes were engineered as bacterial plasmids using homologous recombination in E. col i (5). Subsequently, after their release from the plasmid backbone by enzymatic digestion, the viral genomes were transfected into a chicken cell line that supports the replication of wild-type CELO. Transfection of the large viral DNA molecules (approximately 50 kb) was facilitated by optimization of the polyethylenimine mediated transfection method (PEI) (1, 3). In addition, with all mutations, a second transfection was performed with a plasmid carrying the CELO sequences that were deleted from the mutant, to determine if the mutation could be complemented. Surveillance of luciferase production in cells treated with lysates of the initial transfectants allowed the inventors to determine whether the replication of the virus and the production of transducing viral particles had occurred. These strategies were used to determine the essential portions of both the left and the right border sequences. As anticipated, some of the sequences were required in cis and, presumably, these contained packaging signals, transcriptional promoters or other transcription signals. The present invention relates to recombinant CELO virus and CELO virus DNA having the region encompassing nucleotides 41731-43684 of the genome of wild type CELO virus completely or partially deleted and / or contain an insertion in this region. This CELO virus (DNA) and its derivatives have been designated CELO AIM46 or CELO AIM46 derivatives, respectively. In one embodiment, the invention is directed to a CELO AIM46 derivative with a deletion and / or insertion, complete or partial, within the region of nt 41523-43684. In a further embodiment, the invention is directed to a CELO AIM46 derivative with a deletion and / or insertion, complete or partial, within the region of nt 41002-43684.

In a further embodiment, the invention is directed to a CELO AIM46 derivative with a deletion and / or insertion, complete or partial, within the region of nt 40065-43684. Preferably, the regions defined above are completely deleted to provide more space for inserting the foreign DNA at the deletion site. The modified viruses of the invention, which are derived from CELO viruses, contain deletions and / or insertions at the extreme right of the genome, are replication competent and can carry at least 3.2 kb more DNA than the wild type genome. . More specifically, the CELO virus and the CELO virus DNA of the invention carry a deletion of wild-type CELO sequences for the insertion of an expression cassette for foreign genes in the CELO virus genome, the deletion encompassing approximately the region from the nt 40,000 to approximately 200 bp from the extreme right of the virus genome. The region, which may be completely or partially deleted or interrupted, is thus defined by the last three directly open reading frames that encode peptides of more than 99 amino acid residues, the terminal repetitive function of the virus normally residing within the last 100-200 bp of the genome of the virus that remains uninterrupted. Optionally, the CELO virus and the CELO virus DNA of the invention may additionally have a deletion in the region defined by the open framework for the CELO dUTPase (794-1330). The numeration of the nucleotide sequence of CELO used in the present invention is derived from reference 6, WO 97/40180 and GenBank U46933, which describe the genome sequence of the wild-type CELO virus. Since CELO AIM46 and its previously defined derivatives allow the insertion of large pieces of foreign DNA, they are useful as a starting material for producing CELO virus vectors. Surprisingly, it has been found that a 3.3 kb insert is tolerated by CELO AIM46 without harming the growth of the virus, so it can be expected that larger DNA insertions of up to about 10 kb may be acceptable for the virus. The maximum size limit can easily be tested by the artisan in routine experiments by gradually increasing the size of the insertion and determining the growth parameters of the virus, such as in the experiments of the present invention. Apart from allowing the insertion of an expression cassette for genes, the recombinant CELO virus of the invention has been shown to be able to replicate without complementation, both in HML cells and in chicken embryos. An additional advantage of the recombinant CELO virus of the invention is that it provides 'amounts of virus that are comparable to wild-type CELO. In addition, it was found that vectors of AIM46 transduces mammalian cells comparable to Ad5 vectors, demonstrating effective mammalian cell receptor binding and / or penetration activity by CELO vectors. Since the deletion of 41731-43684 of CELO AIM46 separates only part of the open reading frame (MLA) starting at nt 41002, the complete MLA should be dispensable and can, therefore, be suppressed. Thus, the deletion can encompass the sequence from nts 41002-43684. In one embodiment of the invention, the gene of interest is inserted into other genomic sites than those in the suppressed region from nt 41731-43684, 41553-43684, 41002-43684 or 40065-43684, respectively; in this case, the vector provides additional space for the insertion of additional foreign genetic material. Any region can be chosen that proves to be dispensable, a preferred region for inserting foreign DNA is the open reading frame of dUTPase (nt 794-1330). The virus of the invention grows to wild-type levels and forms the basis of a vaccine strain competent for replication. CELO AIM46 was also used to start the cellular tropism analysis of CELO both in relation to species and cell types, generating information that is important to develop applications of this vector. CELO AIM46 and its derivatives comprising additional modifications can be used to deliver genes to poultry cells with efficiencies 10-100 times better than an Ad5 vector carrying the same marker gene. Surprisingly, in a variety of mammalian cell types, eg human, bovine, equine, monkey, murine, canine, CELO AIM46 operates with efficiencies that are comparable to an Ad5 vector, demonstrating the utility of CELO vectors for applications of gene transfers of mammals.

In a further embodiment, the invention relates to the production of recombinant CELO AIM46 virus and its derivatives. For the production of recombinant CELO virus, the DNA of the CELO virus is introduced into cells that support the replication of the CELO virus. Any standard method for gene transfer can be used to enter the DNA, for example transfection, microinjection, etc. Preferably, the viral DNA is introduced into the cells by polyethylenimine mediated transfection, as described in (3). Cells that support the replication of the CELO virus and, thus, are useful for the production of CELO viruses, can be selected from immortalized cells such as HML (27) or from primary embryonic cells of poultry, in particular useful kidney or kidney cells. liver. To identify useful cell lines, the cells are tested for infectivity and the ability to amplify a virus inoculum. Alternatively, the recombinant CELO virus can be produced by introducing CELO viruses into chicken embryos, preferably by first transfecting the cells described above with CELO virus DNA and keeping the cells in culture for a period of time, to produce a sufficient amount of virus. for the injection in and the amplification of the virus in chicken embryos. In order to produce recombinant CELO virus, regions that are dispensable for viral replication are first identified. For this purpose, subfragments of the CELO genome are cloned into a plasmid, which are sufficiently large (for example 1,000 - 15,000 bp) to facilitate reconstruction in the CELO genome and small enough to possess at least one, preferably 5 - 10 unique restriction sites. The plasmid is manipulated with standard digestion with restriction enzymes to suppress various fragments of the CELO genome and to insert a reporter gene construct in its place. This manipulated fragment is then inserted into the complete CELO genome, for example in a bacterial plasmid, replacing the corresponding wild-type fragment using ligation or standard recombination methods. The modified CELO genome is then released from the plasmid backbone by restriction digestion and introduced into cells that support the replication of the CELO virus, as exemplified in Figure 1.

In the case of 'CELO AIM46, the subfragment contains sequences of CELO from nts 1-5503 and 30502-30644 and 40064-43804. An EcoRV fragment is deleted from 41731-43684 and replaced by an expression cassette, eg, a luciferase expression cassette, to generate pAIM44. This is linearized with Hpal, recombined with wild-type CELO DNA to generate pAIM46. The CELO sequences are excised from the plasmid by digestion with Spel and introduced into HML cells to initiate virus replication. Alternatively, recombination can be carried out in avian cells that support viral replication, for example HML cells, by introducing a modified subfragment of CELO containing a deletion / insertion with a second fragment of CELO, so that the homology of overlap between the two fragments allow recombination to give a full-length CELO genome carrying the desired deletion / insertion. In the experiments of the present invention, the regions of the CELO genome that are essential for the replication of the virus were identified. Most importantly, a region has been identified at the extreme left of the genome of the virus that can be suppressed and delivered in trans. Therefore, this region can be useful for establishing a complementary cell line. In addition, a region has been identified at the far right of the genome that can be deleted without detectable effects on virus replication in cell culture or embryos. It has been shown that in this region an expression cassette for foreign genes can be inserted. It has been shown that CELO vectors can package an additional DNA sequence of 3.2 kb over the size of the wild-type genome, which is already 8 kb larger than the Ad5 vectors. Replication-competent CELO vectors carrying a luciferase expression unit or an EGFP expression unit were developed. These vectors were monitored for their ability to transduce a variety of cell types of birds and mammals. As expected, the CELO vectors work much better than an Ad5 vector in bird cells. However, in all types of mammalian cells tested, the CELO vectors worked, surprisingly, with transduction efficiencies comparable to the Ad5 vectors. The vectors of the invention have applications in vaccines in bird species in which the replication of the virus can promote immune responses. The ability to spread the virus in economical chicken embryos facilitates the production of large quantities of the vector for any of these applications. For applications in vaccines, the foreign DNA encodes one or more antigens that attract an immune response in the individual. The antigen can be the natural protein derived from the pathogen, or an immunogenic fragment thereof, for example an immunogenic peptide. To boost expression of the foreign DNA an expression cassette can be used, which typically includes an active promoter in the target cells, the cDNA of interest, a polyadenylation signal and, optionally, an intron. Alternatively, the DNA inserted into the modified CELO genome can include endogenous CELO promoters, introns and polyadenylation signals to drive expression of the cDNA of interest. An example of a useful expression cassette, which can be prepared by conventional methods, is the construction described in Example 12 of the present invention, which is derived from a plasmid designated pPM7. This contains the cytomegalovirus immediate early enhancer / promoter (CMV), followed by a short polylinker with Pací, Hpal and Kpnl sites, followed by a rabbit ß-globin intron / polyadenylation signal. The CMV / β-globin material can be derived from plasmids available in the art (for example from plasmid pLuc (74), which carries the luciferase gene), modified by PCR (polymerase chain reaction) to add flanking restriction sites , for example BamHI and, subsequently, modified by homologous recombination to replace the luciferase cDNA with a Pacl / Hpal / Hpnl polylinker. The final cassette of BamHI can be cloned into pSP65 to generate pPM7. The cDNAs to be cloned in CELO AIM46 derivatives are first cloned into pPM7 using the unique restriction sites (Pacl / Hpal / Kpnl). Subsequently, the restriction or PCR fragment is prepared, for example a BamHI fragment, containing the CMV / cDNA / β-globin promoter unit that is introduced into pAIM46 linearized with Paci by homologous recombination. The CMV and ß-globin sequences provide a homology for recombination and, thus, the luciferase cDNA is replaced by the new cDNA of interest. The expression cassettes described above can be modified, for example, by using, in place of the CMV enhancer / promoter, a variety of other viral or cellular promoters including, but not limited to, the SV40 enhancer-promoter, the long terminal repeat of the virus. Rous sarcoma (RTL VSR), the human β-actin promoter, the late major promoter of the CELO virus, the adenovirus major late promoter, the rat insulin promoter. Alternatives to the ß-rabbit globins intron / polyadenylation signal include, but are limited to the intron / SV40 polyadenylation signals, introns and polyadenylation signals from other viruses and cellular genes could also be used. Alternatively to using an expression cassette, the foreign cDNA may be a simple insertion within a region that defines CELO AIM46 or deoxyUTPase, thus using endogenous regulatory sequences of CELO, for example promoter, intron, polyadenylation signal. In the case that two different foreign cDNAs have to be expressed from the CELO virus, for example cDNAs encoding two different antigens from a pathogen, the following strategies can be used: in a first embodiment, they can be inserted into the CELO genome two gene expression cassettes (carrying different cDNAs and different regulatory sequences). Alternatively, an internal ribosome entry site (SERI) can be used to provide an expression from two cDNAs using a single promoter, as described, for example, by:; 67; 71; 72. Thus, a typical expression cassette for AIM46 cela carrying two cDNAs to be expressed includes a promoter, the first cDNA, a SERI, and the second cDNA followed by an optional intron and a polyadenylation signal. The foreign cDNA, for example antigen cDNA, can be isolated from the genomes of the pathogens by standard methods, for example PCR or by restriction digestion, which optionally includes reverse transcription to convert RNA into DNA, and is introduced in a transfer vector that carries regulatory sequences and unique restriction sites, for example pPM7. Subsequently, this unit of expression of the antigen is recombined in a linearized plasmid carrying the CELO genome and having the same regulatory sequences and the corresponding restriction sites, for example the plasmid pAIM46. The resulting CELO-AIM46 vector, which carries the antigen cDNA, can be grown and purified from chicken embryos.

Examples of useful antigens for vaccine applications are given in WO 97/40180, which is hereby incorporated in its entirety by reference. Other examples of antigens that can be carried by the virus for vaccine applications are antigens of the infectious bursal disease virus (VEBI; 64) and chicken coccidia antigens, for example Eimeria a cervulina, Eimeria brunet ti, Eimeria maximus, Eimeria my tis, Eimeria neca trix, Eimeria pra ecox and Eimeria tenella (61, 62, 63), examples of antigens they are a transhidrogenase of the shrinking body of parasites, lactate dehydrogenase, EalA and EaSC2 (reviewed in 77). Other examples of antigens are glycoprotein C (gC, glycoprotein gilí) of porcine pseudorabies virus (the causative agent of Aujeszky's disease (75; 76; 69).) A CELO vector AIM46 carrying gC can be used for attracting an anti-pseudorabies response in pigs As mentioned above, a robust immune response from a virus competent for replication is expected, therefore, a vector is most useful in a host in which replication is partial or fully permissive In this regard, the CELO vectors of the present invention, CELO AIM46 and its derivatives, are ideally suited for applications in vaccines for ves The vectors of the recombinant CELO virus of the invention are also useful in applications in vaccines. for human beings, in this case the foreign DNA encodes an antigen derived from a human pathogen CELO vectors based on the CELO genome, modified according to the pre This invention is also useful for gene transfer applications in mammalian systems; an additional argument for following a non-human adenovirus derived from the experience with human adenoviruses in human gene therapy applications. Pre-existing immune responses to human adenoviruses may impair initial transduction by vectors based on human adenoviruses or may exacerbate the cellular immune response to transduced cells. A patient may have no immune experience with an adenovirus of a distant species (although 2 to 7 patients had neutralizing antibodies against the canine adenovirus vector; 30) and the initial transductions will not be compromised by the host response to viral antigens. Except for certain agricultural workers, a previous immune exposure to CELO antigens would not be expected in the majority of the human population. Therefore, the CELO vectors may have an advantage over vectors based on the most common human adenovirus serotypes. An additional conceptual advantage of CELO-based vectors of the invention is that CELO, like bovine, ovine and canine adenoviruses, is naturally replication defective in human cells. Thus, replication of these vectors will not occur in human patients, even in the presence of an infection by wild-type human adenovirus. In addition, the ability to generate a defective CELO vector for replication will be facilitated by the deletion analysis performed in the present invention. The findings of the present invention provide the basis for constructing cell lines that express complementary functions of CELO. For applications in gene therapy, the foreign DNA may comprise any one or more DNA molecules that encode a therapeutically active protein. Examples are immunomodulatory proteins such as cytokines; receptors, enzymes, proteins that effect apoptosis, proteins that modulate angiogenesis, for example sFLT, FGF receptors, etc. For applications in tumor vaccines, the foreign DNA encodes one or more tumor antigens or fragments thereof, preferably in combination with a cytokine. Examples of applications for human vaccines are given in WO 97/40180, gene therapy and applications in vaccines against tumors, a document that is incorporated in its entirety with it as a reference. For applications in vaccines, the vector of the invention can be packaged as an enteric coated dosage unit, or in an injectable form for intramuscular, intraperitoneal or subcutaneous injection. Alternatively, the vector can be administered as a paste or a fluid intranasally or intratracheally, as an aerosol or as intraocular drops. The vector can also be supplied incorporated in feed pellets or in drinking water. The amount of virus introduced per patient, animal or egg can range between 1 and 1012 particles. The virus preparation can include physiological buffered saline or HEPES buffered saline and can be mixed, optionally, with adjuvants such as vitamin E acetate, oil / water emulsion, hydroxide, phosphate or aluminum oxide, mineral oil emulsions such such as Bayol® or Marcol 52® and saponins. It may be useful to use a lyophilized form of the virus as a vaccine (78). The inclusion of a stabilizer such as 10% sucrose can be used with a controlled two stage drying process (78). Alternative stabilizers include carbohydrates such as sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose, proteins such as albumin or casein, or their degradation products. In applications for vaccines, in order to enhance the host immune response, the immune response attracted by the application of the vector of the CELO vaccine carrying a specific antigen, can be raised by additionally administering the same antigen or an immunogenic fragment thereof. Preferably, the additionally administered antigen is recombinant; it can be obtained by standard methods or by the method described below that uses CELO vectors to obtain the recombinant proteins from eggs. The combined application of the vector and the antigen can be carried out as described by (65, 73).

Preferably, the recombinant antigen is administered, optionally together with an immunostimulatory adjuvant, subsequent to the CELO vector. In a further aspect of the invention, the CELO virus is used to produce any protein of interest. In this embodiment of the invention, the CELO virus, for example CELO AIM46 or its derivatives, is engineered, as described above, by introducing the cDNA or, preferably, an expression cassette, which encodes the protein of interest in one of the insertion sites of the recombinant CELO DNA of the invention. The virus can be obtained by replication in suitable cells, as described above, and the recombinant virus is preferably introduced by injection into the allantoic cavity of a bird embryo. Preferably, in the allantoic cavity of chicken embryos from 7 to 9 days old, approximately 4 x 107 particles are introduced, embryos which are subsequently incubated for three to four days at 37 ° C. The recombinant material is recovered after the allantoic fluid, serum, yolk, amniotic fluid or from the embryo itself.

The protein of interest may be an intracellular protein or a secreted protein. In the case of an intracellular protein, which is exemplified by the eGFP reporter protein in the experiments of the present invention (Example 11), the protein can be recovered by lysing infested cells that accumulate in the allantoic fluid. In the case of a secreted protein, the material can be recovered from various extracellular fluids of the embryo (allantoic fluid, amniotic fluid, serum, yolk) or, in analogy to the recovery of intracellular proteins, by lysing infested cells. In a preferred embodiment, the protein of interest is expressed as a fusion protein comprising the protein and, as the stabilizing sequence, an immunoglobulin Fc domain. The secretion of the recombinant protein can be directed by the natural signal sequence from the protein which can, in addition to the signaling function, have a stabilizing function. The Fc domain confers stability to the protein in the extracellular space and provides a protein sequence that can be used for affinity purification of the recombinant protein using, for example, protein A or protein A / G chromatography resins.

Constructs that include an Fc domain for stabilization and, thus, are useful to be expressed from CELO, have been employed to make soluble forms of FGF receptor 2 (sFGFr; 66) and VEGF receptor 1 (sFLT; ). As alternatives to the FLT and FGF receptor signal sequences, signal sequences of, or fusions with, the ovalbumin, conalbumin, avidin and lysozyme proteins can be used. These are proteins that are synthesized in the liver and / or oviduct of chickens and accumulate inside the egg. Thus, using part or all of the coding sequence of these proteins fused to a protein of interest is expected to provide secreted recombinant proteins that are stable within the developing embryo; In addition, when using sequences of this type, for example avidin, a label facilitating the chromatographic purification is provided.

Brief description of the Figures: Figure 1. Construction of plasmids carrying wild type and mutant CELO genomes Figure IA. Construction of a plasmid that carries the ends of the CELO genome Figure IB. Cloning of the full-length CELO genome as a bacterial plasmid Figure 1C. Cloning of modified versions of the CELO genome Figure 2. Analysis of the mutations of the left end of CELO Figure 2, upper panel: open reading frames Figure 2, lower panel: analysis of replication Figure 3. Analysis of the mutations of the right end of CELO Figure 3, upper panel: open reading frames Figure 3, lower panel: analysis of replication Figure 4. PCR analysis of CELO ts (wild type) versus CELO AIM46 Figure 5. Immunofluorescence, monitoring the replication of wild type CELO versus CELO AIM46 Figure 6. Thermal stability of AIM46 versus AdLuc Figure 7. Tropism of CELO versus Ad5 Figure 8. Transduction of EGFP using recombinant Ad5 or CELO vectors Figure 9. Analysis of the mutations of the right end of CELO Figure 9, upper panel: open reading frames Figure 9, lower panel: analysis of replication Figures 10a-1C. Tropics of CELO AIM46 for different animal species Figure 11. Production of recombinant GFP using a CELO derivative AIM46 Figure 12. Production of recombinant protein stabilized in Fc and soluble by a derivative of CELO AIM46 Unless otherwise stated, in the Examples the following materials and methods were used: a) Cloning of the terminal fragments of the CELO genome The two terminal HindIII fragments of CELO were cloned. The CELO genomic DNA (purified with CsCl) was digested with HindIII and the left-most fragment of 1601 bp and the right-hand fragment of 959 bp were purified from a low-melting agarose gel. . The 5 'ends of adenovirus genomes are linked by a phosphodiester linkage to a serine residue in the viral terminal protein (22, 47). The peptide that remains after digestion with proteinase must be separated to allow ligation and cloning. Accordingly, the terminal peptides were separated from the DNA fragments by adding NaOH at 0.3 N and heating at 37 ° C for 90 minutes (22). The solutions were then cooled to room temperature. Tris pH 7.4 at 0.1 M was added and 0.3 M HCl was added to neutralize the NaOH. The fragments were heated to 56 ° C for 20 minutes and cooled slowly to room temperature (1 hour) to facilitate coiling. The DNA was then purified (Qiaquick column, Qiagen), Spel linkers were added (New England Biolabs, cat # 1085) and each fragment was cloned through the Spel and HindIII sites into a derivative of pBR327 (GenBank L08856, ref 52) that contained a Spel site in a distributed EcoRI site (see Figure Ia). Both the HindIII fragment from the left end and the right end were cloned in this way and the DNA sequence analysis was performed to verify the two 300 pb terminals of the two fragments.

Subsequently, the two extreme fragments of CELO were cloned into a derivative of pBR327 containing a Spel site, a destroyed EcoRI site and a Clal / BamHI cleavage to separate the second HindIII site, creating the plasmid pWü-H35 (see Figure 1A) . b) Cloning of the complete CELO genome The vector pWü "-H35 linearized with HindIII and treated with alkaline phosphatase was mixed with purified CELO virus DNA and introduced by electroporation into electroconductive E. coli JC8679 (17, 42). Recombination between the terminal CELO sequences in pWü-H35 and the ends of the CELO genomic DNA generated a plasmid containing a full-length CELO genome (pCEL) flanked by the Spel sites (Figure IB). c) Modifications at the left end of the CELO genome The luciferase cassette containing the immediate cytomegalovirus enhancer / promoter early, the luciferase cDNA (14) followed by a rabbit ß-globin intron / polyadenylation signal was derived from pCLuc (45), modified by PCR to add flanking BamHI sites and cloned into pBlueScript II (SK) to generate pBlueLuc. For most insertions in CELO, the luciferase cassette was isolated from pBlueLuc by digestion with BamHI and the ends blunted by treatment with Klenow enzyme. The modification of the region of the left end of CELO was made using pAIM3 containing, on a skeleton of pBR327, the left end of CELO (nts 1 to 5501) and a portion of the extreme right (nts 30500 a 30639 and nts 40065 to 43804, derived by separating an Asp718 fragment from pWüHpa). Deletions in the CELO genome involved the digestion of pAIM3 at two enzyme sites in the left-most sequence of CELO, the excision of the sub-region followed by the insertion of a luciferase cassette. All manipulations were confirmed by restriction analysis and sequence analysis. This strategy was used to generate the transfer plasmids pAIM7, 16, 22, 23 and 24 (see Table 1). The numbering of the nucleotide sequence of CELO is derived from reference 6 and GenBank U46933. d) Generation of recombinant CELO genomes The plasmids pAIM7, 16, 22, 23 and 24 were linearized by double digestion using Asp718 and Hpal, and recombined with purified CELO DNA using a homologous recombination in E. coli BJ5183 (5, 13) to generate plasmids pAIMll, 21, 25, 26 and 27 of the CELO genome. Figure 1C and Table 1 illustrate the technique employed: Figure 1C shows the cloning of modified versions of the CELO genome. Stage 1: Transfer vectors were produced by manipulating subfragments of the CELO genome, either as pWü-H35 (with the terminal HindIII fragments of CELO) or as pWüHpa (with the terminal Hpal fragments of CELO), using standard methods of linkage- cloning in order to delete portions of the CELO genome and insert a luciferase cassette. Step 2: the linearized transfer vector was recombined with wild-type CELO genomic DNA. Recombination occurs in two ways, either to include the deletion / luciferase cassette or to exclude the deletion / luciferase cassette to generate a wild-type CELO plasmid. Plasmids carrying the desired mutation were identified by restriction enzyme digests and sequencing and used to initiate virus infection (all constructs were sequenced through the suppressed regions to verify construction, see Table 1). e) Modifications at the far right of the CELO genome Using methods similar to those described above, plasmids containing the Hpal fragments of CELO, both left and right, were generated and manipulated to insert the luciferase cassette. and to separate an EcoRV fragment from 33358-43684 (pAIM43) or 41731-43684 (pAIM44). These plasmids were linearized in the unique Hpal site and recombined in BJ5183 cells with wild-type CELO DNA to generate pAIM45 or pAIM46. f) Evaluation of the recombinant CELO genomes in HML cells and preparation of viral materials The recombinant CELO plasmids were digested with Spel to release the viral genome from the plasmid, extracted with phenol, with chloroform and then purified by filtration in gel (Pharmacia Nick column) balanced with TE.

Transfection complexes were prepared using a modification of the PEI technique (1, 3). The DNA was condensed with PEI in two stages as follows: PEÍ PM 2000 (2.5 μl of 10 mM PEI in 125 μl of HBS (150 mM NaCl, 20 mM HEPES, pH 7.4)) was added dropwise to 3 μg of DNA diluted in 125 μl of HBS. The sample was incubated at room temperature for 20 minutes. Subsequently, PEI PM 25000 (3.5 μl PEI 10 mM in 125 μl HBS) was added dropwise to the sample and the complex was incubated at room temperature for an additional 20 minutes. Cells from hepato to male from Leghorn (HML) (27) were plated the day before transfection in 24-well plates at a rate of 7 x 10 4 cells / well (24-well plate). For transfection, the cell culture medium was replaced with 400 μl of DMEM supplemented with 10 μg / ml polymyxin B (without serum). The transfection complex (90 μl per well) was added to the cells for 4 hours at 37 ° C, after which the medium was replaced with freshly supplied serum-containing medium. The efficiency of the transfection was monitored by measuring luciferase activity in cell lysates at 24 hours after transfection.

To test the virus amplification, lysates cleared from transfected or transduced cells were prepared as follows. More supernatant cells were harvested, collected by centrifugation and the pellets of the cells were resuspended in 2 ml of treated supernatant. The material was frozen and thawed 3 times, treated with ultrasound in a bath ultrasound device to release viral particles, cell waste was separated by centrifugation and the cleaned lysate was used for further amplification in fresh cultures. of HML cells. The purification of CELO by means of a CsCl gradient was carried out as previously described (9). The virus was quantified based on the protein content, the conversion factor being 1 mg / ml of protein equal to 3.4 x 1012 virus particles / ml (34). g) Construction of an AIM46 CELO derivative expressing EGFP (CELO AIM 53) The luciferase cDNA in pAIM46 was replaced by an EGFP cDNA to generate pAIM53. The replacement was obtained by homologous recombination in E. col i between pAIM46 linearized in the unique PacI site in the luciferase cDNA, and pAIM52, a transfer plasmid carrying an EGFP cDNA under the control of the same CMV promoter and β-globin intron and polyadenylation signal as those used in the luciferase cassette of pAIM46, thus providing homologies for recombination. h) Construction of pPM7 The transfer plasmid pPM7 contains the immediate enhancer / promoter of cytomegalovirus, followed by a short polylinker with PacI, Hpal and Kpnl sites, followed by a rabbit ß-globin intron / polyadenylation signal. It was obtained as follows: the CMV / β-globin material was derived from pCLuc (74), modified by PCR to add flanking BamHI, and modified by homologous recombination to replace the luciferase cDNA by a Pacl / Hpal / Kpnl polylinker. The final cassette of Ba HI was cloned into pSP65 to generate pPM7. j) Generation of recombinant adenovirus type 5 AdLuc: the luciferase cassette was cloned into pDElaplB through the flanking BamHI sites (2), to produce pDElsplBluc, with the luciferase cDNA in the same orientation as the El transcript. The recombinant virus was generated using recombination after cotransfecting pDElsplBluc with pJM17 (2) in 293 cells (19). 10 days after transfection, cell lysates used to infest fresh 293 monolayers were prepared and the virus amplified from a single halo. The virus material used here was prepared from material that was subsequently passed through 2 additional rounds of halo purification, amplified, purified by a band pattern in CsCl and quantified by the protein content (1). mg / ml protein = 3.4 x 10a2 virus particles / ml; ref.34). AdGFP: A fragment containing the CMV promoter, the EGFP coding region and SV40 poly A sequences was excised from pEGFP-Cl (Clontech) using Asel / Mlul. The hanging ends were filled in by Klenow and cloned into the EcoRV site of pDElsplB (2) with the EGFP cassette in the same orientation as the El transcript. The recombinant virus was generated as described above, using recombination with pJM17 in 293 cells. k) Analysis of the thermal stability of CELO viruses AIM46 and AdLuc were diluted to a concentration of 4 x 109 particles / 100 μl in HBS (the final concentration of glycerol was 2.4% (vol / vol)) and exposed for 30 minutes to temperatures that oscillated between 48 and 68 ° C. Subsequently, aliquots of the virus were tested for the ability to transduce luciferase activity into A549 or CEF38 cells. 1) Immunofluorescence HML cells were spread on plates in gelatin-coated glass slides (Labtek, Nunc) at a rate of 10 5 cells / chamber and infested the next day with CELO AIM46 or wild type CELO virus at a rate of 500 viral particles / cell in DMEM medium containing 2% FCS. At the indicated times after the infestation, the cells were fixed in methanol cold-acetone (1: 1) at room temperature and the CELO proteins were visualized by immunofluorescence as follows: the non-specific binding sites were blocked using PBS + BSA at room temperature. 1% at room temperature for 1 h. The polyclonal anti-CELO antibody was diluted in the ratio 1: 1000 in PBS + 1% BSA and incubated for 1 h. After three 5 minute washes in PBS at room temperature, a goat anti-rabbit detection antibody (Boehringer Mannheim) coupled to FITC (1: 400 dilution) in PBS + 1% BSA was added. The plate holders were washed again, DAPI was included in the last wash for visualization of the cores and the plate holders were mounted in MOWIOL for examination by fluorescence microscopy. m) Generation of polyclonal anti-CELO virion serum. 100 μg of CELO virions purified by CaCl and thermally inactivated (70 ° C, 60 minutes) in Freund's complete adjuvant were injected into rabbits, enhanced at 2, 4 and 5 weeks. with 100 μg of CELO in incomplete Freund's adjuvant and the serum was subsequently collected. Western analysis showed that the pooled sera, used here, reacted specifically with all the major proteins of the CELO capsid, but not with the cell lysates of non-infested birds. n) Additional reagents wild type CELO (FAV-1, Phelps) (Type 1 bird adenoviruses, lethal chicken embryo orphan, CELO American Type Culture Collection: ATCC Vr-432; strain: Phelps; (57)) was purified from infested chicken embryos as previously described (9). The HML cell line (27) was obtained from ATCC no. CRL-2117, the A549 cell line was also obtained from ATCC no. CCL-185, and normal human dermal fibroblasts were obtained from Clonetics and used between steps 5 and 15. The chicken fibroblast cell line designated CEF38 was established from fibroblasts according to known methods; allows the entry of the CELO virus, but does not support the replication of CELO. All four cell types were cultured in DMEM / 10% FCS. Cell line 293 (19) was obtained from ATCC (# CRL-1573) and cultured in MEMalfa with 10% newborn calf serum. The MA-104 cell line (Macaca mulatta (monkey, Rhesus, kidney, embryo, epithelial) was obtained from ATCC (No. CRL-2378) The ED-2 cell line (equine, fibroblast of the dermis) was obtained from ATCC (No. CCL-57) The following lines were obtained from BFAfV, Rimes (Zellbank for Zellinien in der Veterinarmedizin, BFA and Viruskrankheiten der Tiere, 17498 Insel Rimes): SPEV (swine, kidney, embryo, "versified" catalog No. 8); FLU-R (porcine, lung, fetal, catalog number 113); WSH-R (boar, skin, fetal, catalog No. 388); KN-R1 (bovine, kidney, fetal, catalog No. 028); KMU-R (bovine, muscle, embryo, catalog No. 098); KLU-R1 (bovine, lung, embryo, catalog No. 091).

EXAMPLE 1 Construction of a plasmid couplet from the CELO genome initially, the terminal HindIII fragments were purified from viral DNA of CELO, treated with base to separate the terminal peptides, linkers encoding Spel restriction sites were added and both The terminal fragments were cloned in the correct orientation in a low copy number plasmid (Figure IA shows the construction of a plasmid that carries the ends of the CELO genome.) CELO genomic DNA was digested with HindIII, the two terminal fragments they were isolated, treated to separate the terminal peptides and cloned as Spel fragments, HindIII after the addition of Spel linkers, generating the plasmid pWü-H35). This plasmid encoding the two ends of the virus (pWü-H35) was linearized with the unique HindIII site and CELO genomic DNA was recombined to generate a full-length CELO genome flanked by the Spel sites in a bacterial plasmid (see FIG. IB, which shows the cloning of the full-length CELO genome as a bacterial plasmid, pWü-H35 was linearized with HindIII and recombined with CELO genomic DNA to generate the full-length plasmid clones of the CELO genome. were flanked by Spel sites to allow cleavage of the viral genome from the bacterial plasmid.No Spel sites exist within the CELO genome). Several independent clones were obtained from the viral genome, and the correct structure was verified by restriction analysis and by virus production after transfection.

Example 2 a) Analysis of unique sequences required for virus replication A screening method was developed to determine the requirement of the CELO sequences for virus replication. Deletions were first introduced into copies of the bacterial plasmid of the viral genome using homologous recombination in bacteria. In all cases, the deleted viral sequences were replaced by a luciferase cassette to allow for the monitoring of both the initial transfection efficiency in cells supporting the replication of the wild type virus and the potential for replication and transduction in the mutant virus in subsequent steps. As will be demonstrated below, the CELO genome allows for the insertion of at least 1.7 kb of sequence beyond the size of the wild-type genome, thus the concern that the introduction of the luciferase cassette itself could impair replication was not consummated. The viral mutant genomes were excised from the plasmid and transfected into HML cells, either alone, to determine whether the deletion deleted essential DNA sequences, or with a plasmid carrying the region of the deletion-encompassing CELO genome, to determine if it could produce a complementation of the deletion. Five days after the transfection, the cells were used, a portion of the lysate was assayed for luciferase activity to monitor the efficiency of the transfection, and a second portion was used to infest a recently added cell monolayer. HML After another 5 day period, the cells were monitored for a cytopathic effect, the lysates were prepared and tested for luciferase and a portion was used again to infest fresh HML cells. b) Analysis of the left end of CELO Using the strategy described in a), the left-most CELO sequences unique in terms of the replication function were analyzed. Figure 2A shows the map of open left reading frames of 99 amino acids and larger: open reading frames greater than 99 amino acid residues on the left, approximately 5000 nt of the CELO genome, are indicated in black (transcription to the right) or gray (transcription to the left). Open reading frames encoding a deoxyUTAPase (dUTPase) and a protein with homologies with the parvovirus REP (REP) are indicated. An open reading frame that encodes a functional dUTPase is found at position 784 (54). An open reading frame beginning at position 1991 encodes a protein with significant homology to the parvovirus REP gene. Five additional open reading frames are also indicated.

Figure 2 shows the analysis of replication. The numbers of nucleotide deletions introduced into the CELO genome are listed in the upper panel of Figure 2 and in Table 2. The modified CELO genomes were linearized with Spel to release the genome from the bacterial plasmid and transfected into HML cells, either alone or in the presence of a plasmid (pB5.5) that carries wild-type CELO sequences from 1-5501 ("more extreme from the left"). At 5 days after transfection, the cells were harvested, used by freeze / thaw and sonication, and the lysates were applied to a fresh HML culture. This amplification was repeated twice and equal aliquots from the third step of the virus were tested for their ability to transduce luciferase activity in HML cells. The average of three transductions is indicated with the standard deviations. Mutant genomes were constructed that first separated the entire region (pAIMII) or deleted simple or small groups of open reading frames (pAIM21, 25, 26, 27). When introduced by transfection into HML cells, pAIMll, which has a deletion that separates the entire region, was positive for luciferase in the first lysate, but unable to transfer the expression of the luciferase gene in subsequent step attempts, either in the absence or in the presence of a complementary fragment of the extreme left. A more discrete mutant (pAIM21) breaks only three of the unknown MLAs, but leaves the dUTPase and MLAs similar to REP intact. However, similarly to pAIMII, the genome of pAIM21 was also to transfer expression of the luciferase gene in subsequent passage attempts, either in the absence or in the presence of a complementary fragment of the left end (Figure 2B). Thus, both mutations alter the sequences that must be present in cis for the replication of the virus. PAIM27 suppresses only REP, while pAIM25 and 26 suppress dUTPase, REP and an unknown open reading frame. All of these three genomes produced luciferase activity in the first lysate. The subsequent passage of the material revealed that CELO AIM25, 26 and 27 were not able to replicate in the absence of complementation. However, unlike pAIMII and 21, a luciferase activity likely to pass was observed if the initial transfection contained the complementary left end plasmid (Figure 2B). These three complemented viruses (CELO AIM25 + 26+ and 27+) were amplified for an additional 6 steps in HML cells, surprisingly with only modest decreases in their ability to transduce luciferase activity (results not shown). The PCR and Southern analysis revealed a substantial contribution of CELO, apparently wild-type, in the material from step 3, demonstrating that a recombination had occurred which reintroduced the suppressed sequences into the original mutants. A) Yes, an apparently wild-type CELO was produced and provided complementation functions for mutant CELO carrying luciferase. In short, a region (between 2981 and 4334) that is essential in cis for the replication of the virus was identified from the sequences at the extreme left. A second region (between nts 938 and 2900) was identified that is essential for the replication of the virus, but could be provided in trans. Formally, it is possible that a series of recombination events generated a viral genome that contained both the originally deleted sequence and the luciferase cassette, but the simplest explanation for this model is that there was a simple recombination between pB5.5 and the genome. of mutant CELO to generate a wild type CELO genome that, in subsequent steps, provided a complementation activity for a small number of the mutant viruses (positive luciferase) in the mixture. Some of these viral genomes contain pure inserts of frequent sequence to wild-type size, with the highest being a 1616 bp deletion combined with a 3.3 kb luciferase cassette insert. Thus, CELO, which in the form of wild type is already 8 kb greater than Ad5, can pack at least 1700 additional bp of sequence.

Example 3 A portion of the right end of CELO is dispensable A similar mutational strategy was used for an initial analysis of the right-hand end sequences of CELO. The genome plasmid pAIM45 contains a large deletion from 33358-43684, deleting 10 MLAs of 99 amino acids or more, including the previously characterized GAM1 gene (Figure 3, ref 7). Plasmid pAIM46 contains a more discrete deletion from 41731-43684 and breaks two MLAs (Figure 3 shows the mutation analysis of the rightmost end of CELO). The analysis was carried out as outlined in Example 3, Figure 2B, except that plasmid pB13.3 complementary to the right end was used instead of pB5.5 (tracks marked "plus end of the right). mutant genomes included a luciferase cassette in place of the deleted sequences, pAIM45 and pAIM46 were transfected into HML cells alone or with a plasmid carrying the wild-type CELO sequences of the right (pB13.3). Luciferase was obtained in lysates from the transfected cells, demonstrating successful transfection (results not shown) .The subsequent passage of the material onto fresh HML cells revealed that pAIM45, with the deletion of the far right end, was not capable of generate infectious CELO particles, neither in the absence nor in the presence of the intact right end sequences (Figure 3). Not surprisingly, this extensive deletion separated sequences that were essential and, most likely, some of these are required in cis, as evidenced by the absence of complementation by the wild-type right-wing sequences. In contrast, it was found that the genome of pAIM46 generates infectious viruses and is susceptible to passing both in the presence and absence of the complementary genome fragment (Figure 3). The two broken open reading frames in pAIM46 are, thus, dispensable for the growth of CELO in cell culture, as well as for growth in chicken embryos (cf.

Example 5). To verify the structure of pAIM46 and the genome carried by CELO AIM46, a PCR analysis was performed to demonstrate that the deletion / insertion constructed in the plasmid was maintained in the genome of the amplified CELO AIM46 virus. The primers used for the CPR are the following: OAIM24: (CCGAGAATCCACCAATCGTA) is an oligo sense that hybrid on the right end of CELO (in the nt 41699). OAIM25: (CAGCGTGTCGCTATACGCAA) is an antisense oligo that hybridizes at the far right end of CELO (at nt 43752). OAIM26: (GCGATGACGAAATTCTTAGC) is an oligo sense that hybridizes in the luciferase expression cassette. CPR with OAIM24 and 25 should give a 2053 bp product with a wild-type CELO template and a 3422 bp product with the AIM46 template. CPR with OAIM24 and 26 should yield a 958 bp product with an AIM46 mold and no product with the wild type CELO template. The result of the PCR analysis of CELO ts versus CELO AIM46 is shown in Figure 4: Tracks marked with M: marker DNA, (lambda DNA cut with EcoRI / HindI II); lanes 2 to 6: primers OAIM24 + OAIM26 were used with, lane 2: irrelevant target DNA; Lane 3: DNA of CELO ts; lane 4: DNA of plasmid pAIM46; lanes 5 and 6: DNA isolated from CELO AIM46; lanes 7 to 11: the primers OAIM24 and OAIM26 were used with, lane 7: irrelevant DNA; Lane 8: DNA of CELO ts; lane 9: DNA of plasmid pAIM46; lanes 10 and 11: DNA isolated from the DNA of CELO AIM46. DNA sizes (in base pairs) are indicated for some of the marker molecules (left side) and for the expected PCR products (right sides). As shown in Figure 4, both the plasmid pAIM46 and the DNA isolated from the CELO AIM46 virus provided the expected PCR products. Primers encompassing the deletion / insertion site generate the predicted PCR product of 3422 bp with target DNA from pAIM46 (Figure 4, lane 4) and with DNA derived from two preparations of CELO AIM46 (Figure 4, lanes 5 and 6), while PCR with wild type CELO DNA produces the predicted DNA molecule of 2039 bp (Figure 4, lane 3 ). In addition, primers that recognize the luciferase insert provide the predicted product of 958 bp from DNA derived from pAIM46 or from two CELO isolated materials AIM46 (Figure 4, lanes 9-11), but not from DNA derived from Wild type CELO (Figure 4, track 8).

EXAMPLE 4 Immunofluorescence Analysis of CELO Replication AIM46 vs. Wild-type CELO Luciferase data demonstrated that CELO AIM46 can replicate in HML cells in the absence of complementation. To more directly analyze the replication of CELO AIM46 compared to wild-type CELO, both types of virus were used to infest HML cells, and the progression of the virus infestation was monitored by immunofluorescence microscopy using a polyclonal antiserum directed against the proteins of the capsid of CELO. Figure 5 shows immunofluorescence, monitoring the replication of wild type CELO against CELO AIM46. The HML cultures were infested at 500 particles per cell with CELO AIM46 (top row) or wild type CELO (bottom row). The cell samples were fixed at the indicated times after infection and the production of CELO virions proteins was monitored by immunofluorescence using an antiserum against the CELO virion. For both wild type CELO and CELO AIM46, replication is detected first 10 hours after the infestation and the signal increases over the next 30 hours until the cytopathic effect results in a cell separation and a decay in the fluorescence signal. Thus, in a cell culture infestation, CELO AIM46 seems to replicate with kinetics that are similar to those of wild-type CELO.

Example 5 Growth of CELO AIM46 in chicken embryos In the initial phases of this work, HML cells were used for the propagation of CELO AIM46 in cell cultures. Because the nature of the transformation event that established this cell line is unclear, it is still possible for HML cells to provide some helper functions for CELO AIM46 that wild-type cells of chicken embryos might lack. This experiment should also determine if CELO AIM46 was capable of growing in chicken embryos for practical considerations: the low cost and ease of embryo manipulation would facilitate the production of these viruses. Equal amounts of wild type CELO or CELO AIM46 were injected into the allantoic cavity of 9-day-old chicken embryos. After incubation at 37 ° C for 4 days, the allantoic fluid was collected and the virus was purified by band pattern in density gradients with CsCl. The yields of purified wild-type CELO ranged between 0.149 and 0.9 mg per egg (mean: 0.427 mg / egg), while yields of CELO AIM46 were from 0.119 to 0.828 mg per egg (mean: 0.301 mg / egg, Table 3). The modifications introduced in CELO AIM46 seem to effect the growth of AIM46 in chicken embryos to only a modest degree.

EXAMPLE 6 Physical stability of CELO AIM46 A distinguishing feature of the CELO virion is physical stability, which is most easily measured by the resistance of the virion at elevated temperatures. While the mastadenovirus such as Ad5 are inactivated by exposure to temperatures of 48 ° C and above (4, 8, 16), he initially noted that CELO was stable at 56 ° C (57), and subsequent materials have been reported. isolates of the virus with stability at higher temperatures, as well as other rigorous treatments (reviewed in 39). The molecular nature of the stability of CELO has not been determined. A major component of the stability of the Ad5 capsid, pIX, has not been identified in CELO. Perhaps, the hexon or other components of the capsid have altered sequences that allow for more stable protein / protein interactions. It is likely that this stability is important in nature for the survival of the CELO virus in the rigorous environment of the birds. In any case, it was of interest to determine if the recombinant vector of CELO retains the stability of the wild type CELO virion. A recombinant type 5 adenovirus, carrier of a luciferase expression unit (AdLuc) and CELO AIM45 were exposed to a thermal titration (30 minutes of exposure at defined temperatures of 42 to 680C). Subsequently, each sample was tested for its ability to transfer the luciferase activity to human A549 cells or bird CEF Figure 6 shows the immunofluorescence assays monitoring wild-type CELO replication against CELO AIM.46 HML cultures were infested at 500 particles per cell with CELO AIM46 (row superior) or wild type CELO (lower row) Cell samples were fixed at the indicated times after infestation and production of CELO virion proteins was monitored by immunofluorescence using an antiserum against the CELO virion. previously demonstrated for Ad5, the virus capsid and, thus, the transduction capacity of the virus is sensitive to heat (4, 8, 16). Ad5 concentration of human cells decays by a factor of more than 100 when exposed to 48 ° C for 30 minutes and inactivated at 52 ° C and higher temperatures (Figure 6). In strong contrast, the transduction capacity of CELO AIM46 is not affected by heating at 56 ° C, and the virus only begins to lose activity when exposed to 60 ° C for 30 minutes (Figure 6). It was found that transduction with wild type CELO exhibits a similar thermal stability, which indicates that the alterations introduced in CELO AIM46 do not significantly alter the stability of the virion.

Example 7 CELO can transduce a variety of cell types When considering future applications, it is of interest to determine the types of cells that can be transduced by a CELO-based vector. A panel of mammalian and chicken cell types, commonly used, was tested for transferability by CELO AIM46. For comparison, AdLuc derivative of Ad5 carrying the same luciferase expression cassette was used. The results for four of these cell types are presented in Figure 7, which shows the tropism of CELO versus Ad5. The indicated cell types were exposed to AdLuc or CELO AIM46 at a rate of 10000, 3000, 1000 or 300 particles per cell (see the methods section for the protocol for 24-well plates). At 24 hours after the infestation, the luciferase activity was determined. The values are the average of three transductions with the indicated standard deviations. Cells of poultry origin (for example the line of chicken fibroblasts CEF38) were transduced with an efficiency almost 100 times higher with the CELO vector than with the human AdLuc (Figure 7). Note that CEF38 cells do not support virus replication, so the difference between the Ad5 vector and the CELO vector can not be attributed to an amplification associated with the replication of the virus and must be due to primary transduction or effects of gene expression. In the types of human cells tested, CELO acted in a manner comparable to the Ad5 vector. These included the HepG2 hepatoma line, the A549 line of lung epithelial carcinoma and the fibroblast of the primary human dermis (Figure 7). Similar results were obtained with the HeLa line of human carcinoma, the murine myoblast C2C12 line and the canine epithelial MDCK line. In the conclusion, it was found that CELO AIM46 is capable of transducing cells of birds with an efficacy approximately 100 times greater than a vector of human Ad5. Surprisingly, CELO AIM46 also transduces mammalian cell types with efficiencies comparable to an Ad5-based vector.

Example 8 Expression of PFV from adenoviruses and CELO vectors Green fluorescent protein (PFV) has emerged as a useful marker for gene transfer studies. Accordingly, a CELO vector (CELO AIM53) expressing EGFP (Clontech) was prepared at the bottom of CELO AIM46. This vector was compared with an Ad5 vector carrying the same CMV / EGFP / β-globin expression unit. It was found that both vectors act to transfer a GFP gene to human A549 cells. The results are shown in Figure 8, which describes the transduction of EGFP using recombinant Ad5 or CELO vectors. The AdGFP adenovirus expressing EGFP and CELO AIM53 were used to infest human A549 cells over a range of virus / cell ratios (10 to 1000 particles per cell). At 24 hours after the infestation, the cells were fixed and the expression of PFV was monitored by immunofluorescence microscopy. Although immunofluorescence with PFV is not quantitative in this format, it seems that, similarly to the luciferase recombinants, there are no large differences in the transduction capacity between the CELO and AddEGFP viruses when transducing human A549 cells.

EXAMPLE 9 Additional deletions of the right end of CELO A mutational strategy similar to that of Example 3 was used to generate additional deletions in the sequences of the rightmost end of CELO.

The pAIM69 genome plasmid contains a deletion from 41523-43684, breaking the same two open reading frames as those affected in CELO AIM46. The pAIM70 genome plasmid contains a slightly larger deletion from 40065-43684 and breaks the same two MLAs as AIM46 and AIM69 plus an additional MLA. The analysis was carried out as outlined in Example 3, Figure 2B, except that plasmid pB13.3 complementary to the right end was used instead of pB5.5 (Figure 9, tracks marked "more extreme right"). The mutant genomes included a luciferase cassette in place of the deleted sequences. pAIM69 and pAIM70 were transfected into HML cells either alone or with a plasmid carrying the sequences of the right-hand end of wild-type CELO (pB13.3). Luciferase activity was obtained in lysates of the transfected cells, demonstrating successful transfection. The subsequent passage of the material onto fresh HML cells revealed that both AIM69 and AIM70 were capable of generating infectious particles of CELO in the absence of the intact sequences of the right end (Figure 9). As shown for CELO AIM46, the two open reading frames broken in pAIM69 are, thus, dispensable for the growth of CELO in cell culture. The additional open reading frame, broken in AIM70, is apparently also dispensable for growth in cell culture.

Example 10 Comparison of tropism of adenovirus 5 with CELO The following cell types of various animal species were infested in order to compare the tropism of Ad5 and CELO: MA-104 (Rhesus monkey); ED-2 (equine); SPEV (porcine), FLU-R (porcine), WSH-R (boar), KN-R1 (bovine), KMU-R (bovine); KLU-R1 (bovine). The cell types listed above were exposed to AdLuc or CELO AIM46 from 10,000, 3,000, 1,000, 300, 100, 30 or 10 particles per cell (see the section on methods for the protocol for 24-well plates). All cells were grown in Dulbecco's modified Eagle's medium plus 10% fetal calf serum (DMEM, 2 mM glutamine, 100 IU penicillin, 100 μg / ml streptomycin and 10% fetal calf serum (v / v), all sera were thermally inactivated at 56 ° C for 60 minutes). The cells were plated at a rate of 5 x 10 4 cells / well of 24-well plates, approximately 18 hours before transduction. For transduction, the medium was changed to DMEM containing 2% horse serum (500 μl per well) containing the indicated virus article number. After 4 hours at 37 ° C, the medium was changed to DMEM / 10% FCS. At 24 hours after the infestation, the luciferase activity was determined. The values given in Figures 10a-lOh are the average of three transductions with the indicated standard deviations. Virus growth, purification and quantification were performed as previously described (Example 7).

Example 11 Production of recombinant protein using a CELO derivative AIM46 Chicken embryos (9 days old) were infested with 4 x 107 particles of CELO AIM53, a derivative of CELO AIM46. After incubation for 4 days at 37 ° C, allantoic fluid (AF) was collected (approximately 12 ml of AF per embryo). Aliquots of FA were resolved by SDS-PAGE, transferred to nitrocellulose and eGFP was detected by immunostaining with an antibody recognizing eGFP (Clontech), followed by detection by ECL (Amersham) (Figure 11). Reference portions of purified eGFP were included. When comparing the performance of eGFP in the unfractionated FA with the reference, it can be calculated that 28 μl of FA contains approximately 1.25 μg of eGFP, thus 12 ml of FA would provide approximately 500 μg of eGFP. Similar amounts of eGFP were obtained from 5 separate infested embryos.

Example 12 The cDNAs encoding soluble receptor constructs stabilized in Fc from sFGFR2 (66) or sFLT (sFLT; 68) were cloned between the CMV promoter and the β-globin intron / polyadenylation sequence of the transfer plasmid pPM7. Subsequently, the CMV / sFGFr / β-globin promoter fragments or CMV / sFLT / β-globin promoter were introduced into pAIM46 linearized with Paci using homologous recombination to produce pCELOsFgFr or pCELOsFLT. The recombination replaced the luciferase cDNA of pAIM46 by the cDNAs of soluble receptors. pCELOsFGFr or pCELOsFLT were cut with Spel to release the viral genome and transfected into HML cells to initiate virus replication. After the amplification of the viruses and the purification of the viruses in CsCl gradients, aliquots of each virus (4 x 107 particles) were introduced into the allantoic cavity of 9-day-old chicken embryos. 4 days later, the allantoic fluid was collected (approximately 12 ml per egg). The soluble receptor content stabilized in Fc was determined by immunostaining, using an antibody specific for the Fc domain. Figure 12 shows the results of eggs infested with CELOsFLT. Ig track: 1 μg of murine Ig as a standard, track K: 35 μl of allantoic fluid from a non-infested egg; lanes 1-7: 35 μl of allantoic fluid from eggs infested with CELOsFLT; the mobilities of the immunoglobulin standard (Ig) and the sFLT molecule of approximately 120 kd (sFLT) are indicated. From the standard it can be calculated that each egg contains 300-500 μg of the soluble receptor.

Table 1 Plasmids used in the recombinant construction of CELO Op-bre of Sequences of the Sequences of the Comments plae gone end of the extreme of the left of CELO right of CELO pWü-H35 1-1601 42845-43804 HindIXX fragments of CELO terminals on the left and right cloned with flanking Spel linkers in pBR327 pB5. 5 1-5503 HEL fragment of terminal CELO on the left in pBluescript pB13 .3 30502-43804 Fragment Hpal of terminal CELO on the right in pBluescript p ü-Hpa 1-5503 30502-43804 Hilalic fragments of CELO terminals on the left and the right cloned with flanking Spel linkers in pER327 pAIM3 1-5503 30502-30643 Derivative pNüHpa 40064-43804 (separation of As 718 fragment) pAIM? 1-1069 30502-30643 Trans vector (luc *) 4339-5503 40064-43804 ference of the pWüHpa derivative for pAIMll PAIM16 1-2981 30502-30643 trans vector (luc) 4339-5503 40064-43804 ference of the pWüHpa derivative for pAIM21 pAIM22 1-2981 30502-30643 Trans vector (lc) 2303-5503 40064-43804 ference of the pWúHpa derivative for pAIM25 pAIM23 1-1069 30502-30643 Trans vector (luc) 2681-5503 40064-43804 ference of the pWüHpa derivative for pAIM26 pAIM24 1-1689 30502-30643 Trans (luc) 2903-5503 40064-43804 vector of the pWüHpa derivative for pAIM27 pAIM 3 1-5503 30502-30643 Transiluc vector) 40064-43804 ference of the pWüHpa derivative for pAIM45 pAIM44 1-5503 30502-30643 Trans (luc) 40064-43804 vector of the pWüHpa derivative for pAIM46 pAIM52 Trans vector (EGFP) for homologous recombination with pAIM44 luc * «luciferase Table 2 Plasmids containing variants of CELO Construction of the CELO Sequences Replication in the CELO celangenome suppressed the HHL End of the left of CELO pAIMll 1065-4334 Defective, no se (3269 bp) can complement AatlI + NcoI pAIM25 938-2300 Defective, it (1362 bp) can complement Eco47-3 PAIM26 1065-2681 Defective, se (1616 bp) can complement Aatll + Sphl pAIM27 1687-2900 Defective, se (1213 bp) can complement PmaCl pAIM21 2981-4334 Defective, no se (1353 bp) can complement Styl End of the right of CELO PAIM45 33358-43684 Defective, no se (10326 bp) can complement EcoRV pAIM46 41731-43684 Competent for PAIM53 (1953 bp) EcoRV replication pAIM69 41523-43684 Competent for (2161 bp) PvuII-EcoRV replication pAIM70 40065-43684 Competent for (3619) replication Asp718 + EcoRV Table 3 Yield of CELO virus from eggs1 Type of virus Prepara- Performance Number of Virus per Performance n "(mg egg virus virus (mg) medium per egg purified (mg > with CsCl) 1 CELO 1.80 2 0.90 0.427 wild type CELO 0.496 2 0.248 wild type CELO 0,345 2 0.173 wild type CELO 1,33 2 0,665 wild type CELO 5,96 40 0,149 wild type CELO AIM46 1,66 0,828 0,301 ZEAL AIM46 0,133 0,133 ZEAL AIM46 0,247 0,247 ZEAL AIM46 0,618 0,309 ZEAL A? M46 0,340 0- 170 CELO AIM46 0,237 0,119 Notes i) Wild type CELO or CELO AIM46 (8 xi? Particles in loo μl of HBS) were injected into the allantoic cavity of 9-day-old chicken embryos After 4 days of incubation at 37ßC, the allantoic fluid was collected and the virus was purified by band pattern in density gradients with CsCl as previously described (9) 2. The virus yield is expressed as purified virus protein. by Bradford's trial using album ina of bovine serum as a standard.

REFERENCES I. Baker, A., M. Saltik, H. Lehrmann, I. Killisch, v. Mautner, G. Lamm, G. Christofori, and M. Cotten. 1997. Gene Therapy 4: 773-782. 2. Bett A.J., W. Haddara, L. Preveo, F.L.Graham. 1994. Proc Nati Acad Sci USA 91: 8802-8806. 3. Boussif 0., F. Lezoualc'h, M.A. Zanta, M.D. Mergny, D Sherman, B. Deneneix, and J.-P.Behr. 1995. Proc Nati. Acad. Sci. U S A. 92: 7297-7301. 4. Caravokyri, C. and K.N. Leppard. 1995. J. Virol.69: 6627-6633. 5. Chartier C., E. Degryse, M. Gantzer, A. Dieterle, A. Paviriani, and M. Mehtali. 1996. J. Virol. 70: 4805-4810. 6. Chiocca, S., R. Kurzbauer, G. Shaffner, A. Baker, V. Mautner, and M. Cotten. 1996. J. Virol. 70: 2939-2949. 7. Chiocca, S., A. Baker, and M. Cotten. 1997. J. Virol. 71: 3168-3177 8. Colbi, W.W. and T.Shenk. 1981. J. Virol. 39: 977-980. 9. Cotten, M., E. Wagner, K.Zatloukal, and M.L.Birnstiel. 1993. J. Virol. 67: 3777-3785. 10. Cowen, B., B.W. Calnek, N.A. Menendez and R.F Ball. 1978. Avian Diseases 22: 459-470. II. Crouzet J., Naudin, C. Orsin, E. Vigne, L. Ferrero, A. Le Rouk, P. Benoit M. Latta, C, Torrent, D.

Branellec, P. Denefle, J.F. Mayauk, M. Perricaudet, and P. Yeh, 1997. Proc Nati Acad Sci USA 94: 1414-1419 DeGregori J., G. Leone, A. Myron, L. Jakoi, and J.R. Nevins 1997. Proc Nati Sci USA 94: 7245-7250 Degryse, E. 1996. Gene 170: 45-50. by Wet J.R., K.V. Wood, M. DeLuca, D.R. Helinski, and S. Subramani. 1987. Mol Cell Biol 7: 725-737.

Fisher K.J., H. Choi, J. Burda, S.J. Chen, and J.M. Wilson 1996. Virology 217: 11-22. Ghosh-Choudhury, G., Y. Haj-Ahmad, and F.L.

Graham.1987. EMBO J. 6: 1733-1739. Gillen, J.R., D.K.Willis, and A.J. Clark. 1974. in Mechanisms in Genetic Recombination (R.F. Greil, ed.) Plenum, New York, ppl23-135. Gluzman, Y., H. Reichl, and D. Solnick, 1982.

Helpr-free adenovirus type 5 vectors. P187-192. in Y. Gluzman (ed.) Eukaryotic Viral Vectors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Graham F.L., J. Smiley, W.C. Russell, and R.

Nairn 1977. J. Gen. Virol. 36: 59-74. Grubb B.R., R.J. Pickles, H. Ye, J.R. Yankaskas, R.N.Vick, J.F. Engelhardt, J.M. Wilson, L.G.

Johnson, and R.C. Nature 371: 802-806. 21. Hardy S., M. Kitamura, T. Harris-Stansil, Y. Dai, M.L. Phipps. 1997. J Virol 71: 1842-849. 22. Hay, R.T., N.D. Stow, and I.M. McDouglall. 1984. J. Mol. Biol. 175: 493-510. 23. He T.C., S. Zhou, L.T. da Costa, J. Yu, K.W. kinzler, and B.A. Vogelstein. 1998. Proc Nati Acad Sci USA 95: 2509-2514. 24. Hess, M., A. Cuzange, R.W.H Ruigrok, J. Chroboczek and B. Jacrot. 1995. J. Mol. Biol. 252: 379-385. 25. Horwitz, M.S. 1996. Adenoviruses. Pp2149-2171 in Fields Virology, Third Edition. Edited by B.N. Fields, D.M. Knipe, P.M. Howley et al., Lippincot t-Raven Publishers, Philadelphia. 26 Imler J.L., Chartier, A. Dieterle, D. Dreyer, M. Mehtali, and A. Pavirani. 1995. Gene Ther. 2: 263-268. 27. Kawaguchi T., K. Nomura, Y. Hirayama, T. Kitagawa 1987. Cancer Res. 47: 4460-4464. 28. Karlsson S., R.K. Humpries, Y. Gluzman, and A.W. Nienhus. 1985. Proc Nati Acad Sci USA 82: 158-162. 29. Khatri A., Z.Z. Xu, and G.W. Both. 1997. Virology 239: 226-237. 30. Klonjkowsky B., P. Gilardi-Hebenstreit, J. Hadchouel V. Randrianarison, S. Boutin, P. Yeh, M. Perricaudet, and E.J. Kremer 1997. Hum. Gene Ther. 8: 2103-2115.

Kovesdi I., D.E. Brough, J.T. Bruder, and T.J.

Wickham. 1997. Curr. Opin. Biotechnol. 8: 583-589.

Kumar-Singh R., and J.S. Chamberlain. 1996. Hum Mol Genet 5: 913-921. Laver, W.G., H.B. Younghusband and N.G. Wrigley. 1971. Virology 45: 598-614. Lemay P., M.L. Boudin, M. Milleville, and P.

Boulanger. 1980. Virology 101: 131-143. Li, P., A.J.D. Bellect and C.R. Parish. 1984a. J.

Gen. Virol. 65: 1803-1815. Li, P., A.J.D. Bellect and C.R. Parish. 1984b. J.

Virol. 52: 638-649. Li, P., A.J.D. Bellect and C.R. Parish. 1984c. J.

Virol. 65: 1817-1825. Lieber A., C.Y. He, I. Kirillova, and M.A. Kay. nineteen ninety six. J Virol 70: 8944-8960. McFerran, J.B. and B.M. Adair 1977. Avian Pathology 6: 189-217. Mittal S.K., L. Prevec, F.L. Graham, and L.A.

Babiuk. 1995 .. J. Gen. Virol. 76: 93-102. Miyake S., M. Makimura, Y. Kanegae, S. Harada, Y.

Sato, K. Takamori, C. Tokuda, and I. Saito. nineteen ninety six.

Proc Nati Acad Sci USA 93: 1320-1324. Oliner, J. D., K.W. Kinzler, and B. Vogelstein. 1993. Nucleic Acids Research 21: 5192-5197.

Parks R.J., L. Chen, M. Antón, U. Sankar, M.A. Rudnicki, F.L. Graham. 1996. Proc Nati Acad Sci USA 93: 13565-13570. Petersson, U. and R.J. Roberts. 1986. Adenovirus gene expression and replication: a historical review. in DNA Tumor Viruses: Control of Gene Expression and Replication pp 37-57. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Plank C, K. Zatloukal, M. Cotton, K. Mechtler, and E. Wagner. 1992. Bioconjugate Chemistry. 3: 533-539. Polyak K., Y. Xia, J.L. Zweier, K.W. Kinzler, and B. Vogelstein. 1997. Nature 389: 300-305. Robinson A.J., H. B. Younghusband, and A.J. Bellet.1973. Virology 56: 54-69. Shaack J., S. Langer, X. Guo. 1995. J Virol. 69: 3920-3923. Shenck, T. 1995. Group C adenovirus as vectors for gene therapy. pp 2111-2148 in Viral Vectors (eds.M.G. Kaplitt and A.D. Loewy) pp. 43-54. Academic Press, San Diego. Shenck, T. 1996. Adenoviridae: The viruses and their replication. in Fields Virology, Third Edition. Edited by B.N. Fields, D.M. Knipe P.M. Howley et al., Lippincott-Raven Publishers, Philidelphia. 51 Soberon X., L. Covarrubias, F. Bolívar. 1980. Gene 9: 287-305. 52. Van Doren K., D. Hanahan, and Y. Gluzman. 1984. J Virol. 50: 606-614. 53. Vraty S., E.S Macavoy, Z.Z. Xu, C. S ole, D.B.

Boyle, and G.W.Both. 1996b, Virology 220: 200-203. 54 Weiss R.S., S.S. Lee, B.V. Prasad, and R.T.

Javier. 1997. J. Vjrol. 71: 1857-1870. 55 Wilson C., and M.A. Kay. 1995. Nature Medicine. 1: 887-889. 56 Xu Z.Z., A. Hyatte, D.B. Boyle and G.W. Both. 1997. Virology 230: 62-71. 57 Yachts, V.J. and D.E. Fry. 1957. Am. J. Vet. Beef. 18: 657-660. 58 Zabner J., B.G. Zeiner, E. Friedman, and Welsh M.J. 1996. J. Virol. 70: 6994-7003. 59 Zabner J., P. Freimuth, A. Puga, A. Fabrega, and Welsh MJ. 1997. J. Clin. Invest. 100: 1144-1149. 60. Zheng B., S.K. Mittal, F.L. Graham, and L. Prevec. 1994. Virus Res 31: 163-186. 61 Lillehoj H. S., and Trout J.M., 1996, Clin.

Microbiol. Rev., Jul. 9 (3): 349-360. 62 Taylor M.A., and Catchpole J. 1994, Appl.

Parasitol, Jun. 35 (2): 73-86. 63 Shirley M.W., 1992, Br. Vet. J., Nov. 148 (6): 479-499.

Lasher H.N. and Davis V.S., 1997, Avian Dis., Jan. 41 (1): 11-19. . Buge S.L., Richardson E., Alipanah S., Markham P., Cheng S., Kalyan N., Miller C.J., Lubeck M., Udem S., Eldridge J., Robert-Guroff M., 1997, J Virol Nov; 71 (11): 8531-41. . Celli G., LaRochelle W.J., Mackem S., Sharp R., Merlino G., 1998, EMBO J. Mar 16: 17 (6): 1642-55. , De Quinto S.L., Martinez-Salas E., 1998, Gene Sep 14: 217 (1-2): 51-6. Gerber H.P., Hillan K.J., Ryan A.M., Kowalski J., Keller G.A., Rangell L., Wright B.D., Radtke F., Aguet M., Ferrara N., 1999, Development Mar; 126 (6) -.1149-59. Gerdts V., Jons A., Makoschey B., Visser N., Mettenleiter T.C., 1997, J Gen Virol Sep; 78 (Pt 9): 2139-46. Havenga M.J.E., Vogels R., Braakman E., Kroos N., Valerio D., Hagenbeek A., van Es H.H.G., 1998, Gene Nov 19; 222 (2): 319-27. Levenson V.V., Transue E.D., Roninson I.B., 1998, Hum Gene Ther May 20; 9 (8): 1233-6. Li X., Wang W., Lufkin T., 1997; Biotechniques Nov; 23 (5): 874-8, 880, 882. 73 Lubeck M.D., Natuk R., Myagkikh M., Kalyan N., Aldrich K., Sinangil F., Alipanah S., Murthy S.C., Chanda P.K., Nigida S.M. Jr. , Markham P.D., Zolla-Pazner S., Steimer K., Wade M., Reitz M.S. Jr., Arthur L.O., Mizutani S., Davis A., Hung P.P., Gallo R.C., Eichberg J., Robert-Guroff M., 1997, Nat Med Jun; 3 (6): 651-8. 74. Plank C, Zatloukal K., Cotton M., Mechtler K., and Wagner E., 1992, Bioconjugate Chemistry. 3: 533-539. 75 Robbins A.K., Watson R.J., Whealy M.E., Hays W.W., Enquist L.W., 1986, J Virol May; 58 (2): 339-47. 76 Schreurs C, Mettenleiter T.C., Zuckermann F., Sugg N., Ben-Porat T., 1988, J Virol Jul; 62 (7): 2251-7. 77. Vermeulen A.N., 1998, Int J Parasitol Jul; 28 (7): 1121-30. 78 Talsma H., et al., 1997, Int. J. of Pharmaceutics 157, 233-238.

LIST OF SEQUENCES GENERAL INFORMATION: (i) APPLICANT: (A) NAME: Boehringer Ingelheim International GmbH (B) STREET: Binger Strasse 173 (C) CITY: Ingelheim am Rhein (E) COUNTRY: Germany (F) POSTAL CODE (ZIP): 55216 ( G) TELEPHONE: 06132/772282 (H) TELEFAX: 06132/774377 (ii) TITLE OF THE INVENTION: Recombinant CELO virus and CELO virus DNA (iii) NUMBER OF SEQUENCES: 3 (iv) COMPUTER-FRIENDLY FORM: (A) TYPE OF MEDIA: Soft disk (B) COMPUTER: compatible with IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.30 (EPO) (2) INFORMATION FOR THE IDENT SEC NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: synthetic DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC DE IDENT NO: l: CCGAGAATCC ACCAATCGTA 20 (2) INFORMATION FOR THE SECTION OF IDENT NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: synthetic DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC DE IDENT NO: 2: CAGCGTGTCG CTATACGCAA 20 (2) INFORMATION FOR THE SECTION OF IDENT NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: synthetic DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC DE I DENT NO: 3: GCGAT GACGA AAT T CT TAGC 20 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (33)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. Recombinant CELO virus or CELO virus DNA, characterized in that the region encompassing nucleotides 41731-43684 of the wild type CELO virus genome is completely or partially deleted and / or contains a foreign DNA insert.

2. The recombinant CELO virus or CELO virus DNA according to claim 1, characterized in that the deletion covers the region nt 41523-43684.

3. The recombinant CELO virus or CELO virus DNA according to claim 1, characterized in that the deletion covers the nt region 41002-43684.

4. The recombinant CELO virus or virus DNA ZEAL according to claim 1, characterized in that the deletion covers the region nt 40065-43684.

5. The recombinant CELO virus or CELO virus DNA according to any of claims 1 to 4, characterized in that it contains, in addition to the deletions defined in claims 1 to 4, a complete or partial deletion or insertion of foreign DNA into the nt region 794-1330.

6. The recombinant CELO virus or CELO virus DNA according to any of claims 1 to 5, characterized in that it is contained in a plasmid that can be replicated in prokaryotic or eukaryotic cells.

7. The recombinant CELO virus or CELO virus DNA according to any of claims 1 to 6, characterized in that it contains a foreign DNA insertion in place of the deletions (s).

8. The recombinant CELO virus or CELO virus DNA according to claim 7, characterized in that it contains the foreign DNA insertion in place of or within a region defined in any of claims 1 to 4, and / or in place of the deletion defined in claim 5.

9. The recombinant CELO virus or CELO virus DNA according to claim 7 or 8, characterized in that the foreign DNA encodes an antigen derived from an animal pathogen.

10. The recombinant CELO virus or CELO virus DNA according to claim 9, characterized in that the pathogen is poultry.

11. The recombinant CELO virus or virus DNA ZEAL according to claim 7 or 8, characterized in that the foreign DNA encodes a human protein.

12 The recombinant CELO virus or CELO virus DNA according to claim 11, characterized in that the foreign DNA encodes a therapeutically active protein.

13. The recombinant CELO virus or CELO virus DNA according to claim 12, characterized in that the foreign DNA encodes a protein in a stimulator.

14. The recombinant CELO virus or CELO virus DNA according to claim 13, characterized in that the immunostimulatory protein is a cytokine.

15. The recombinant CELO virus or CELO virus DNA according to claim 11, characterized in that the foreign DNA encodes a tumor antigen or a fragment thereof.

16. The recombinant CELO virus or CELO virus DNA according to claim 12, characterized in that the foreign DNA encodes a protein that modulates angiogenesis.

17. The recombinant CELO virus or CELO virus DNA according to claim 11, characterized in that the foreign DNA encodes an antigen derived from human pathogen.

18. A method for producing the recombinant CELO virus according to any of claims 1 to 17, characterized in that the deletions and, optionally, insertions or insertions are carried out on DNA of the CELO virus carried by a plasmid, and because the DNA of the recombinant CELO virus is introduced into a host that supports the replication of the virus.

19. The method according to claim 18, characterized in that the host is a primary cell or a cell of an immortalized cell line.

20. The method according to claim 18, characterized in that the host is an avian embryo.

21. The method according to claim 19, characterized in that the cells defined in claim 19 are transfected with recombinant virus DNA CELO and kept in culture to produce a quantity of virus, and because the amount of virus is injected into and amplified in an embryo of birds.

22. The method according to claim 21, characterized in that the embryo is chicken.

23. A vaccine against an infectious disease of an animal, characterized in that it comprises the CELO virus according to claim 9.

24. A vaccine against an infectious disease of a bird, characterized in that it comprises the CELO virus according to claim 10.

25. A vaccine against an infectious disease of a human being, characterized in that it comprises the CELO virus according to claim 17.

26. A pharmaceutical composition, characterized in that it comprises a CELO virus according to claim 12.

27. The CELO virus according to any of claims 13, 14 or 15 for the manufacture of a tumor vaccine.

28. A method for producing a recombinant protein of interest, characterized in that the recombinant CELO virus according to claim 7, wherein the foreign DNA encodes the protein of interest, is introduced into avian embryos and the virus is allowed to amplify to produce the protein of interest, and the protein is recovered.

29. The method according to claim 28, characterized in that the DNA encoding the protein of interest is fused to a DNA molecule that encodes an immunoglobulin Fc domain.

30. The method in accordance with the claim 29, characterized in that the foreign DNA also comprises a signal sequence.

31. The method in accordance with the claim 30, characterized in that the protein of interest is a secreted protein and the signal sequence is its natural signal sequence.

32. The method according to claim 30, characterized in that the signal sequence is derived from a protein secreted naturally in eggs of chickens, the protein being different from the protein of interest.

33. The method according to claim 32, characterized in that the signal sequence is derived from ovalbumin, avidin, conalbumin or lysozyme. RECOMBINANT CELO VIRUS AND CELO VIRUS DNA SUMMARY OF THE INVENTION Recombinant CELO virus or CELO virus DNA with a deletion on the right end of the viral genome that allows the insertion of large pieces of foreign DNA. The virus is useful as a vaccine for animals, in particular birds, and for gene therapy and vaccine applications in humans. The virus can also be used for the production of recombinant proteins.