MXPA01001788A - Improved expression of cry3b insecticidal protein in plants - Google Patents

Abstract

The present invention discloses methods and compositions comprising a group of novel expression cassettes which provide significantly improved levels of accumulation of Coleopteran inhibitory Cry3B and Cry3B variant amino acid sequences when these are expressed in plants. The preferred embodiments of the invention provide at least up to ten fold higher levels of insect controlling protein relative to the highest levels obtained using prior compositions. In particular, transgenic maize expressing higher levels of a protein designed to exhibit increased toxicity toward Coleopteran pests deliver superior levels of insect protection and are less likely to sponsor development of populations of target insects that are resistant to the insecticidally active protein.

Description

IMPROVED EXPRESSION OF CRY3B INSECTICIDE PROTEIN IN PLANTS BACKGROUND OF THE INVENTION FIELD OF THE INVENTION The present invention describes transgenic plants that express substantially higher levels of Bacillus thuringiensis d-endotoxin to control insects. Methods for obtaining said plants and compositions, and methods for using said plants and compositions are described. Also described are improved polynucleotide cassettes containing coding sequences for preferred proteins that impart substantially higher levels of d-endotoxins for insect control. The preferred embodiments of the invention surprisingly provide up to ten times higher levels of protein to control insects relative to the higher levels obtained using previous compositions. In particular, transgenic corn that expresses higher levels of a protein designed to exhibit increased toxicity against coleopteran pests provides higher levels of insect protection and is less likely to promote the development of target insect populations that are resistant to the insecticidally active protein. .

DESCRIPTION OF THE RELATED TECHNIQUE Most crops, plants and commercial agricultural areas are susceptible to attack by one or more insect pests. Particularly problematic are the pests of Coleoptera and Lepidoptera. Because crops of commercial interest are often the target of insect attacks, in many cases environmentally sensitive methods to control and eradicate insect infestation are convenient. This is particularly true for farmers, nursery owners, farmers, and commercial and residential areas who seek to control insect populations using non-aggressive compositions for the environment. The environmentally-sensitive insecticide formulations most used and developed in recent years have been composed of microbial pesticides derived from the bacterium Bacillus thuringiensis, a Gram-positive bacterium that produces crystal proteins or inclusion bodies that are specifically toxic to certain families or species of insects. . Many different strains of B. thuringiensis have been identified that produce one or more insecticidal crystal proteins, as well as other insecticidal proteins that do not form crystal. Compositions that include strains of B. thuringiensis that produce insecticidal proteins are commercially available and are used as environmentally acceptable insecticides because they are toxic to specific target insect pests, but are not harmful to vertebrate and invertebrate plants and animals. jnfc. * s £ * w Fundamentally, because these insect control proteins must be ingested by susceptible target insect pests in order to exert their insecticidal or toxic effects, the judicious application of such protein compositions limits or prevents members of non-target insects 5 of the susceptible order that may also be susceptible to the composition of significant exposure to proteins (for example, lepidopteran species in which lepidopteran-specific B. thuringiensis crystal protein is used as an insecticidal formulation). Additionally, insects of various orders have shown that they are totally 0 or not susceptible to specifically targeted insecticidal proteins even when ingested in large quantities. d-Endotoxins The d-endotoxins are used to control a large variety of 5 caterpillars that eat plants and beetles, as well as mosquitoes. These proteins, also known as insecticidal crystal proteins, crystal proteins, and Bt toxins, represent a large collection of insecticidal proteins produced by B. thuringiensis that are toxic when ingested by a susceptible host insect. During the past decade, research on the structure and function of B. thuringiensis toxins has covered all major categories of toxins, and although these toxins differ in structure and specific functions, general similarities in structure and function are taken for granted. . A recent report describes genetics, biochemistry and molecular biology of Bt toxins (Schnepf et al., Bacillus thuringiensis and its Pesticidal Crystal Proteins, Microbiol., Mol. Biol. Rev. 62: 775-806, 1998). Based on the knowledge acquired about B. thuringiensis toxins, a generalized mode of action has been created for B. thuringiensis toxins and includes: ingestion by the insect, solubilization in the entrails of the insect (a combination of the stomach and small intestine), resistance to digestion enzymes sometimes with partial digestion by entrain-specific proteases that specifically catalyze a cut at a peptide site within a protoxin structure that "activates" the toxin, binding the toxin to the brush-shaped border of the cells of the entrails, formation of a pore in the cells of the entrails of the insect, and the interruption of cellular homeostasis (English and Slatin, 1992).

Genes that encode crystal proteins Many of the d-endotoxins are related to varying degrees by similarities in their amino acid sequences. Historically, the proteins and genes that encode them were broadly classified based on their spectrum of insecticidal activity. The analysis conducted by Hófte and Whiteley (1989) deals with the genes and proteins that were identified in B. thuringiensis before 1990, and exposes the nomenclature and classification scheme that had traditionally been applied to genes and proteins of B. thuringiensis. The original nomenclature took advantage of the discovery that the few Bt Cry proteins known at that time, generally fell aaa- > ? w. . in a limited number of classes, where each class represented proteins that had specificity for specific orders of insects. For example, the cryl genes encoded Cry1 proteins toxic to Lepidoptera. The C y2 genes encoded Cry2 proteins which are toxic 5 generally for both lepidoptera and dipterans. The cry3 genes encoded Cry3 proteins toxic to coleopters, while the cry4 genes encoded for Cry4 proteins toxic to dipterans. Over the past decade or more, the nomenclature has become more confused with the discovery of more remotely related classes of Bt proteins. insecticides. Recently, a simplified homogenous nomenclature and bases for Bt protein classifications have been adopted, which have been reviewed by Schnepf et al. (1998). Schnepf et al. (1998) also provide a structural solution for a Cry1 crystal. This simplified nomenclature will be adopted in the present invention. The convention to identify Bt genes with lowercase letters, italics (for example, crylAbl) and identify Bt proteins with the first letter in uppercase (for example, Cry1Ab1) will also be observed in the present. Based on the degree of sequence similarity, the proteins were further classified into subfamilies. The proteins that seemed most related within each family were assigned with divisional letters such as CrylA, Cryl B, CrylC, etc. Even more closely related proteins within each division received names such as CrylCa, A »^ * i CrylCb, etc., and still more closely related proteins within each division were designated with names such as Cry1 Bb1, Cry1 Bb2, etc. Modern nomenclature systematically classifies Cry proteins based on amino acid sequence homology and not on target insect specificity. The classification scheme for many known toxins, not including allelic variations in individual proteins, is summarized in regularly updated tables that can be obtained from Dr. Neil Crickmore at: http://epunix.biols.susx.ac.uk/Home/ Neil_Crickmore / Bt / index.html.

Compositions of bioinsecticide polypeptides The utility of bacterial crystal proteins as insecticides extended beyond larvae of lepidoptera and diptera when the first isolation of a strain of B. thuringiensis toxic to coleoptera was reported (Kreig et al., 1983; ). It has been reported that this strain (described in U.S. Patent No. 4,766,203, specifically incorporated herein by reference), designated as B. thuringiensis var. tenebrionis, is toxic to larvae of Coleoptera insects Agelastica alni (blue alder leaf beetle) and Leptinotarsa decemlineata (Colorado potato beetle). The patent of E.U.A. No. 5,024,837 also describes hybrid strains of β. thuringiensis var kurstaki that showed activity against lepidopteran insects. The patent of E.U.A. No. 4,797,279 (corresponding to EP 0221024) describes a hybrid of B. thuringiensis containing a β plasmid. thuringiensis var kurstaki that codes for a gene that codes for lepidopteran toxic crystal protein, and a β plasmid. thuringiensis tenebrionis that codes for a gene that codes for a gene that codes for toxic glass protein for coleoptera. The hybrid strain of ß. thuringiensis produces crystal proteins characteristic of those produced by B. thuringiensis kurstaki and B. thuringiensis tenebrionis. The patent of E.U.A. No. 4,910,016 (corresponding to EP 0303379) describes an isolate of B. thuringiensis identified as MT 104 of β. thuringiensis which has insecticidal activity against Coleoptera and Lepidoptera. Recently, Osman et al. described a natural Bacillus thuringiensis isolate exhibiting activity against at least two orders of insects and against nematodes (WO 98/30700). For more than two decades it has been known that compositions comprising Bt insecticidal proteins are effective in providing protection from insect infestation in plants treated with said compositions. Recently, molecular genetic techniques have allowed the expression of Bt insecticidal proteins from nucleotide sequences stably inserted into plant genomes (Perlak et al., Brown &Santino, etc.). However, the expression of transgenes in plants has provided a pathway for increased insect resistance to Bts produced in plants because the plants have not been shown to produce high levels of insecticidal proteins. Initially it was believed that the differences morphological or major topological in the structure and gene architecture between plant and bacterial systems was the limitation that prevented the over-expression of Bt transgenes in plants. These differences were apparently counteracted as described by Perlak et al. (U.S. Patent No. 5,500,365) and by Brown et al. (U.S. Patent Nos. 5,424,412 and 5,689,052) wherein transgenes encoding Bt insecticidal protein containing preferred codons of plants improved expression levels. Alternatively, truncation of the protoxin coding domain to the shorter peptide coding domain that still encoded an insecticidal protein was also sufficient to counteract the limitation of dissimilarly low expression levels of the Bt coding transgene in the plant. The levels of expression of Bt proteins in plant from transgenes have varied widely regardless of the media used for expression, and accumulated protein levels have varied from virtually undetectable to 2 parts per million to about 20 to 30 parts per million. However, although these approaches provided improved levels of Bt protein accumulation in plants, none provided expression levels that could ensure that insect resistance would not become a problem without the need for coordinated expression of one or more additional insecticidal toxins by the transgenic plant, or alternatively without the coordinated topical application of additional insecticidal or complementary chemical compositions of Bt. The importance of accumulation of higher levels of Bt toxin to avoid insect resistance to individual Bt toxins has been understood for some time. Several laboratory studies in which selection against Bt was applied over several generations of insects have confirmed that resistance against Bt insecticidal proteins is rarely obtained. It should be noted that laboratory conditions represent rather low but constant selection pressure conditions, allowing the survival of a subpopulation of insects that has been subjected to insecticidal pressure and that produces subsequent generations of insects. Subsequent generations are also maintained in media containing low but constant concentrations of insecticidal protein. Generally, the concentrations used for selection pressures are in the range of LC40 to approximately LC60, however, LC95 concentrations have also been evaluated for the development of resistance. In most cases, resistance is acquired slowly, generally developing within reasonably few generations, for example 10-50 generations. However, such resistance is not observed when substantially higher levels of toxin are used, or in situations where multiple toxins are provided. Currently, recombinant plants expressing commercially useful levels of Bt insecticidal protein generally contain only one gene encoding a single Bt class. It is anticipated that these plants have a very limited duration of use for two reasons. First, these plants are expressing insufficient levels of the insecticidal protein for ensure that all target insects exposed to and fed from the tissues of the plant will perish due to the dose of toxin ingested. Second, due to insufficient insecticidal protein levels, the potential for the development of resistance is unreasonably increased. This does not mean that the level of toxin produced by said transgenic plants is insufficient to be effective. This simply represents the limitations of expression of in plant d-endotoxins even when sequences encoding Bt d-endotoxin are used that have been modified to adapt to preferred plant sequences. A limitation that has been observed for many sequences encoding Bt d-endotoxin modified for plant expression is that it has been impossible to predict which Bt d-endotoxin would be effective for expression in plants. For example, the expression of Cry2Aa in cotton plants results in phytotoxicity when directed to the chloroplast, however the expression of a sequence of closely related cry2Ab is not phytotoxic when directed to the chloroplast. (Corbin et al., US patent application, serial No. 09 / 186,002). Even so, the levels of d-endotoxin protein produced in plants are not sufficient to be effective against all desired target insect species that are known to be susceptible to one type and class. determined of d-endotoxin. As indicated above, alternative approaches to the development of resistance to insecticidal proteins have included ineffective attempts to increase the levels of transgene expression in plants. 1 Alternatively, additional insecticidal genes can be designed in plants so that multiple toxins are expressed in coordination. This would provide a more effective means of delaying the onset of resistance to any combination of Bts, however, this still does not counteract the limitation of insufficient levels of insecticidal protein that accumulate in the recombinant plant (s). A further alternative to insufficient levels of expression has been to design Bt insecticidal crystal proteins that code for genes that demonstrate improved insecticidal properties, having either a broader host scale or increased biological activity, which would result in an imaginable way to require less of the recombinant protein to control a target insect species than what was required of the native form of the protein. The combination of structural analyzes of B. thuringiensis toxins followed by an investigation of the function of said structures, motifs and the like, has taught that specific regions of crystal protein endotoxins are, in general, responsible for particular functions. For example, it has been found that domain 1 of Cry3Bb and CrylAc is responsible for the activity of ion channels, the initial step in the formation of a pore (Walters et al., 1993; Von Tersch et al., 1994). ). Domains 2 and 3 have been found to be responsible for receptor binding and insecticidal specificity (Aronson et al., 1995, Caramori et al., 1991, Chen et al., 1993, de Maagd et al., 1996;; Ge et al., 1991; Lee et al., 1992; Lee .Ut ^ jt ^^^ &Aa ^ Us'SM ^ irui? Ii ^^ et al., 1995; Lu et al., 1994; Smedley and Ellar, 1996; Smith and Ellar, 1994; Rajamohan et al., 1995; Rajamohan et al., 1996; Wu and Dean, 1996). The regions in domains 2 and 3 can also have an impact on the activity of the ion channels of some toxins (Chen et al., 1993, Wolfersberger et al., 1996, Von Tersch et al., 1994). Unfortunately, although many researchers have attempted to obtain mutated crystal proteins, few have succeeded in obtaining mutated crystal proteins with improved insecticidal toxicity. In almost all examples of genetically manipulated B. thuringiensis toxins cited in the literature, the biological activity of the mutated crystal protein is no better than that of the wild type protein, and in many cases, the activity is diminished or has been suppressed (Almond and Dean, 1993; Aronson et al., 1995; Chen et al., 1993, Chen et al., 1995; Ge et al., 1991; Kwak et al., 1995; Lu et al., 1994; Rajamohan et al., 1995; Rajamohan et al., 1996; Smedley and Ellar, 1996; Smith and Ellar, 1994; Wolfersberger et al., 1996; Wu and Aronson, 1992). However, Van Rie et al. have recently achieved the improvement of a Cry3A d-endotoxin that has increased insecticidal activity for Coleoptera by identifying a single mutant that has increased insecticidal activity. Van Rie et al. proposed a method for identifying mutants that have increased insecticidal activity, wherein the method consists of identifying amino acid mutations that reduce insecticidal activity, and selectively altering those residues by site-directed mutagenesis to incorporate l £ 3Íktágidk ^^^^^^^ one or more of the 20 amino acids that occur naturally in those positions, and feed the various forms of the resulting altered protein to rootworms of the western or northern corn to identify those that they have improved activity (U.S. Patent 5,659,123). Although sequences were not enabled using this method, as mentioned previously, Van Rie et al. they succeeded in identifying only one sequence that had increased activity and did not demonstrate an increase in the expression of the mutant form compared to the native sequence. For a crystal protein that has approximately 650 amino acids in the sequence of its active toxin, and the possibility of 20 different amino acids in each position in this sequence, the probability of arbitrarily creating a successful new structure is remote, even if one could assign a general function to a stretch of 250 to 300 amino acids. Furthermore, the prior art with respect to mutagenesis of genes for crystal protein has been mainly focused on studying the structure and function of crystal proteins, using mutagenesis to disrupt some step in the mode of action, rather than manipulating improved toxins. Taken together, the limited success in the art for developing synthetic toxins with improved insecticidal activity has suppressed progress in this area and confused the search for improved endotoxins or crystal proteins. Rather than follow simple and predictable rules, the successful design of an improved crystal protein can involve different strategies, depending on the crystal protein being improved and the insect pests to which they are being targeted. In this way, the procedure is highly empirical. Accordingly, the traditional recombinant DNA technology is clearly not a routine experimentation to provide improved insecticidal crystal proteins. What is lacking in the prior art are rational methods for producing genetically engineered B. thuringiensis crystal proteins having improved insecticidal activity and, in particular, improved toxicity to a wide range of insect pests such as lepidoptera, coleoptera or diptera. The methods and compositions that set forth these interests are described in the patent application of E.U.A. No. 08 / 993,170 (December 18, 1997; English et al.) And other applications of E.U.A. related (08 / 993,722, December 18, 1997, English et al., 08 / 993,755, December 18, 1997, English et al., and 08 / 996,441, December 18, 1997, English et al.) and in Van Rie et al. (U.S. Patent 5,659,123, June 1, 1999). In addition, recombinantly enhanced d-endotoxins have continued to be poorly expressed and / or cause non-toxic effects when expressed in plants, thus leading to the recovery of fewer commercially useful transgenic events.

BRIEF DESCRIPTION OF THE INVENTION In the present invention, novel compositions and methods for expressing β-endotoxin transformed plants are described. f * tt *? $ £ thuringiensis variant Cry3 that have important inhibitory activity for Coleoptera. These compositions and methods advantageously result in plants expressing Cry3 d-endotoxins from B. thuringiensis at Increased levels not previously observed for Cry3 d-endotoxins. Increased levels of Cry3 d-endotoxin expression are reflected in obtaining higher maximum expression levels in individual transgenic insertion events. Unexpectedly, the particular compositions described herein result in the recovery of an increased percentage of transgenic events that manifest levels of expression that far exceed the threshold levels of expression necessary for control of coleopteran insects and that provide sufficient levels of toxin capable of to support a resistance management strategy. Because Cry3 d-endotoxins are typically less potent than other d-endotoxins commonly used to control target pests of Coleoptera and Lepidoptera when they are expressed in transgenic plants, the obtaining of higher maximum levels of Cry3 d-endotoxin expression and the recovery of more transgenic events with effective expression levels are both critical in the isolation of transgenic events expressing Cry3 d-endotoxin that presents commercially useful levels of Cry3 control. target insects. Another limitation of the prior art set forth by the present invention is the development of insect resistance to d-endotoxins provided by plant expression. Specifically, the present invention provides a • taa ij. .- ^ i ». superior strategy for delaying or eliminating the development of resistance to Cry3 d-endotoxins through increased accumulation of d-endotoxin within plant cells so that the levels of the d-endotoxin are maintained in plant above a protein threshold level, typically measured in parts per million (ppm). The improved expression of d-endotoxins, which should also be taken for increased mean expression in view of what has previously been observed in the art, is believed to result in delayed onset of insect resistance, and therefore extends the utility of d-endotoxins expressed in plants as insect control agents. In preferred embodiments, the present invention provides novel isolated and purified Cry3B d-endotoxin proteins that exhibit particularly effective insecticidal activity directed at controlling insect species of coleopteran pests. Said d-endotoxin proteins of the present invention are provided by expression of isolated, purified and improved or increased DNA sequences or polynucleotide sequences each comprising a Cry3 d-endotoxin coding sequence placed under the control of gene expression elements functional in preferred plants such as a promoter, a leader untranslated, an intron and a transcription termination and polyadenylation sequence. Some preferred DNA or polynucleotide sequences may also provide protein sequences directed to plastids or chloroplasts. Preferred DNA constructs of the present invention include those constructs that encode Cry3 d-endotoxins • ^ Stt * showing coleopterous inhibitory activity or coleopterous controlling activity. In an illustrative embodiment, the polynucleotide sequences are assembled into an expression cassette for introduction into plant genomic DNA, wherein the expression cassette comprises a Cry3Bb variant d-endotoxin coding sequence operably linked to a sequence comprising a promoter. , a leader untranslated sequence, an intron and a transcription termination and polyadenylation sequence. In particular, a transgene located within a polynucleotide expression cassette operable in a plant or polynucleotide sequence comprising an expression cassette that is contained in genetic elements that function in plant cells to express a desired protein from a coding sequence. of nucleic acid (the transgene) that is operatively located within said expression cassette. The coding sequence is linked to the 5 'end to at least one promoter sequence, a leader untranslated sequence (UTL), an intron sequence and in certain embodiments indicated to a sequence encoding a peptide targeting plastid or chloroplast . The coding sequence is also linked to the 3 'end to at least one functional transcription terminus in the plant and polyadenylation sequence. The polynucleotide sequences comprising said expression cassette are shown herein to improve the expression of the desired protein encoded from within the cassette, increase the number of events obtained from the use of the polynucleotide sequence in the transformation of plants, wherein said increased number of events contains the desired transgene located within the expression cassette and has improved levels of expression of one or more desired proteins. The increased number of events is also surprisingly observed to express the desired protein at levels of more than 2 to 5 parts per million, but in general less than 200 to 500 parts per million of total cell protein. Even more surprising were some events in particular that expressed the desired protein at levels of more than 500 ppm. The indicated embodiments describe a sequence encoding a Cry3Bb variant d-endotoxin comprising SEQ ID NO: 9 isolated and purified, from Nco \ to EcoRI as set forth in Figure 1 illustrating the plasmid pMON25096. Other embodiments describe a sequence encoding a variant Cry3Bb d-endotoxin comprising an isolated and purified SEQ ID NO: 11, from Ncol to EcoRI as set forth in Figure 2 illustrating the plasmid pMON33741. However, it is contemplated that any Cry3 d-endotoxin exhibiting substantial coleopterous inhibitory or coleopterous controlling activity greater than or equal to that described in the present invention may be used in accordance with the embodiments of the present invention, with particular preference being given to Cry3 proteins that have substantial homologies to Cry3Bb. In a preferred embodiment, the invention provides transgenic plants that have been transformed with an expression DNA or cassette construct of the present invention that is expressed and translated to unexpectedly high levels by the plant resulting in surprisingly high levels of d-accumulation. endotoxin The monocotyledonous plants can be transformed according to the methods and DNA constructions described herein. However, it is also anticipated that dicotyledonous plants may also be transformed with DNA sequences described herein by one skilled in the art, in order to obtain transgenic plants that provide unexpectedly useful levels of insect resistance without the risk of developing resistance to insects to d-endotoxin. The plant transformed by the present invention can be prepared, in a further preferred embodiment, by a method that includes obtaining the isolated and purified DNA construct contained within the expression cassette, and then transforming the plant with the construction so that the plant expresses the protein for which it codes the construction. Alternatively, the plant transformed by the present invention can be prepared, in a further preferred embodiment, by a method that includes introducing the isolated and purified DNA construct into a competent transformation Agrobacterium strain, and then transforming the plant with the Agrobacterium strain. which contains the construction for the plant to express the proteins for which it codes the construction. It has been observed in the present that the transformation of plants by the compositions and methods described surprisingly results in increased frequencies of transformants exhibiting transgene expression as well as recovery from -5-8-Kt "J * i: • individual transgenic events that exhibit unexpectedly higher absolute levels of transgene expression It is appreciated that the increased levels of expression observed in the disclosed invention will allow a reduced development of insect resistance. Bt d-endotoxins presented to target insect pests The above can be achieved by transforming a plant with the preferred DNA construct to achieve high Cry3 expression regimes alone, or by simultaneously exposing target insects to the Cry3 d-endotoxins described together with other compositions effective for control Coleoptera species such as the Cry3B variants (English et al., WO 99/31248), variant Cry3A or variant Cry3D (US patent 5,659,123), CryET33 and CryET34 (Donovan et al., WO 97/17600), CryET70 (US application Serial No. 09 / 184,748; Mettus et al., November 2, 1998), Cry6A, Cry6B, Cry8B (US Patent No. 5,277,905), CryET29 (Rupar et al., WO 97/21587), acyl-lipid insecticidal hydrolases, combinations of amino acid oxidases and tedanalactam synthases (Romano et al., US application Serial No. 09 / 063,733, filed April 21, 1998), or insecticidal proteins such as VIP1 (Gay, WO 97/26339, Gourlet et al., WO 98/02453) and VIP3 (Estruch et al., U.S. Pat. 5,877,012; 1999) among others. Target susceptible insects include Diabroticus spp. centipedes in Zea mays and Leptinotarsa decemlineata (Say) in Solanum tuberosum, and cotton weevil in Gossypium species (cotton).

Therefore, it is contemplated that the compositions and methods described by the present invention will provide many advantages over the prior art including those specifically outlined above. Other advantages include improved control of susceptible target insect pests and achieve protection throughout the season of insect pathogens. A further advantage of the present invention relates to the reduction of the number of transgenic events that must be selected in order to identify one that contains beneficial levels of one or more compositions for insect control. The present invention also comprises cells transformed with the DNA constructs described herein. In addition, transformation vectors such as plasmids, bacmids, artificial chromosomes, viral vectors and the like are contemplated as elements for use in the delivery of nucleotide compositions of the present invention in contemplated cells in order to obtain transformed, both prokaryotic and host cells. as eukaryotic, which express the d-endotoxin proteins encoded by the novel DNA construct described herein. It is also contemplated that in some cases the genome of a transgenic plant of the present invention will have been enhanced through the stable integration of an expression cassette encoding a B. thuringiensis d-endotoxin controlling or inhibiting coleoptera or variants of the same as described herein. In addition, more than one transgene coding for an insecticidal composition will be incorporated into the nuclear genome, or alternatively, into the chloroplast or plastid genome of the transformed host plant cell. It is believed that more than one polynucleotide encoding an insecticidal crystal protein will be incorporated into the genome of a plant cell and it would be convenient to have two or even more sequences encoding insecticidal proteins or other beneficial plant proteins within the nucleotide sequences. contained in the cell. Such recombinantly derived proteins may exist as precursors, pro-toxins, or as fusions of beneficial proteins linked by flexible amino acid linker sequences or by specific protease cleavage sequences well known in the art. Chimeras comprising fusions of insecticidal proteins are also contemplated. The offspring of host cells of transgenic plants can be artificially manipulated to produce complete recombinant plants which have improved insecticidal properties, and in the present it is shown that the recombinant nucleotide sequences can be heritable. The ability to inherit from the elements is a preferred aspect of the invention, so that the expression elements can be delivered to linear descendants of the original transformed host plant cell, leading first to a stably transformed plant whose constituent cells express the desired transgene, although the tissue-specific expression can be selectively manipulated in a general manner through the selection of operable promoter in plant selected for use in a given expression cassette, as k described earlier. Transformed plants produce the seeds that contain the heritable expression cassette, and therefore the seeds produce plants in a linear fashion that contain the expression cassette, generally in Mendelian mode, particularly when they are self-fertilized according to methods well known in the art. .

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates the plasmid pMON25096. Figure 2 illustrates the plasmid pMON33741. Figure 3 illustrates the plasmid pMON25097. Figure 4 illustrates the plasmid pMON33748. Figure 5 illustrates the translation of nucleotide and amino acid sequence of a variant insecticidal protein Cry3Bb.11098 as shown in SEQ ID NO: 9. Figure 6 illustrates the translation of nucleotide and amino acid sequence of a Cry3Bb.11231 variant insecticidal protein as shown in SEQ ID NO: 11.

DETAILED DESCRIPTION OF THE INVENTION The following detailed description of the invention is provided to assist those skilled in the art in the practice of the present invention. Do not However, the following detailed description should not be constructed to unduly limit the present invention since those skilled in the art can make modifications and variations in the embodiments presented herein without departing from the spirit and scope of the present invention.

Definitions The following words and phrases have the meanings set out below. Functional biological equivalents. As used herein, said equivalents with respect to the insecticidal proteins of the present invention are peptides, polypeptides and proteins that contain a sequence or portion that exhibits sequence similarity to the novel peptides of the present invention, such as Cry3Bb.11231, and having the same or similar functional properties as those of the polypeptides described herein, including insecticidal activity. Biological equivalents also include peptides, polypeptides and proteins that react with, ie bind specifically to antibodies raised against Cry3Bb and which exhibit the same or similar insecticidal activity, including both monoclonal and polyclonal antibodies. Combating or controlling insect damage in an agricultural context refers to the reduction of damage in units relative to a crop or part of a plant caused by infestation of an insect pest. Generally, this phrase refers to the reduction of adverse effects caused by the presence of an unwanted insect in a particular location. Event refers to a transgenic plant derived from one of the following: 5 1. the insertion of foreign DNA in one or more unique sites in the Nuclear genomic DNA; 2. the insertion of foreign DNA in one or more unique sites in the plastid, chloroplast or mitochondrial genome; 3. the introduction of a stable, heritable, epigenetic vector into the cytoplasm of a plastid, chloroplast or mitochondrion; or 4. a combination of any of the above procedures. The events that are derived from these procedures contain an expression cassette that expresses a desired coding sequence as described herein. The events are also known as ITEs (independent transformation events). Expression. The combination of intracellular procedures, including transcription, translation and other functions of stabilization and processing of intracellular protein and RNA, experienced by a A nucleic acid coding sequence controlled by genetic sequences that function in plant cells to achieve the production of a desired product, such as a structural gene encoding an RNA molecule, or an RNA molecule that is used as a substrate for a ^^^ ,, ^ - ^^ rS¡ ^ & r ^ ^^ ^, ^: * at¿ - - enzyme reverse transcriptase or enzyme complex. Improved or increased expression cassette refers to the specific combination and order of genetic elements associated with the insecticidal protein coding sequence that, when expressed within a plant cell: causes the surprising average level of said protein expressed in plants, tissue of plant, or plant cells; it motivates the unexpected number of transformation events that express a surprisingly higher average level of insecticidal protein; gives rise to individual plants, plant tissue or plant cells that express an unexpectedly high level of the insecticidal protein; It originates plants that express unexpected levels of effective insecticidal protein to control or combat coleopteran pests and prevent the development of resistance by the coleopteran pest to the particular insecticidal protein. "Insecticidal polypeptide" refers to a polypeptide having insecticidal properties, for example, a polypeptide having the properties of inhibiting the growth, development, viability or fecundity of target insect pests. Operationally linked. Sequences of nucleic acid or polynucleotides connected sequentially in linear form, so that tretuje *.! * ^ * properties of one influencien the characteristics of expression of the other. A promoter, for example, operably linked to other polynucleotide sequences (which may consist of operator or enhancer sequences, translated or untranslated leader sequences, intron sequences, structural gene coding sequences, non-structural genes, transcription and translation, and polyadenylation sequences) influences the expression of a coding and non-coding sequence, regardless of whether the product is RNA, protein, or another product. Similarly, an intron sequence or a leader sequence not translated can influence the expression and stability of sequences operably linked to them, and the sequences of structural or non-structural genes can be influenced by elements operably linked to the 5 'end, in the middle, or to the 3' end. Coding regions that can be expressed in plants. The amino acid coding regions or open reading frames (ORF) that can be expressed in plant because they contain regulatory elements of typical plants facilitating their expression, and often include changes in the coding sequence so that codons preferred in plants are used instead of non-preferred codons in where heterologous coding regions are observed. Peptide of transit to plastid. Any amino acid sequence useful for directing a linked amino acid, such as a protein fusion, to a subcellular or organelle compartment such as a plastid or S ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ Polynucleotide sequence. Any DNA or RNA sequence of four or more consecutive nucleotides or ribonucleotides. Generally the polynucleotide sequences as described herein comprise at least 50 or more nucleotides or ribonucleotides. Progeny. "Progeny" includes any fruit or descendant of the transgenic plant, or any subsequent plant that contains the transgene (s) in an operable form. The progeny are not limited to one generation, but include the descendants of the transformant with the condition that they contain or express the transgene (s). Seeds containing transgenic embryos as well as the seeds of the transgenic plants and their offspring which, after Mendelian segregation continue to comprise the transgene (s), are also important parts of the invention. Promoter. A recognition site in a DNA sequence or group of DNA sequences that provides an expression control element for a preferred polynucleotide sequence to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that preferred sequence . Ro is the primary regenerative plant derived from the transformation of tissue or plant cells in culture. The progeny or subsequent generations derived from Ro are called Ri (first generation), R2 (second generation), and so on. g_ ^ j U & • r4, - * i ^ - k & ^^ e ^ íS?. ,, Regeneration. The process of growing a plant from a plant cell or group of plant cells (e.g., protoplast, embryo, callus or plant explant). Structural coding sequence refers to a A DNA sequence encoding a peptide, polypeptide, or protein that is made by a cell following the transcription of the structural coding sequence to messenger RNA (mRNA), followed by translation of the mRNA to the peptide, polypeptide or protein product wanted. Structural gene. A gene or polynucleotide sequence that contains the coding sequence of a desired polypeptide that is expressed by transcription and translation to produce the desired polypeptide. Synthetic gene The synthetic genes encoding the B. thuringiensis d-endotoxins of the present invention are those that are prepared in a manner that involves any type of isolation or genetic manipulation that alters the naturally occurring coding sequence of the d-endotoxin gene. This includes isolation of the gene from its natural state, manipulation of the gene as by codon modification (as described herein), or site-specific mutagenesis (as described herein), truncation of the gene or any other method of manipulation. or isolation. A synthetic gene can also be a polynucleotide sequence that is not known to occur naturally but that encodes a useful polypeptide or other product such as a tRNA or an antisense polynucleotide. A polynucleotide sequence that does not occur in a manner natural. Substantial homology. As this term is used herein, it refers to nucleic acid sequences or polypeptides that are approximately 86% homologous, to about 90% homologous, to about 95% homologous, to about 99% homologous. Specifically, the inventors consider the substantial homologs to be approximately 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99 percent homologous to the polypeptide reference nucleic acid sequence. . Terminator Referring to eukaryotic nuclear gene expression procedures, the operable 3 'end transcription termination sequence and polyadenylation sequence. With reference to prokaryotic gene expression, and including gene expression in plastids and chloroplasts, the DNA sequence operable at the 3 'end of an open reading frame that, for ORFs expressing the protein product, at least one termination codon in frame with the coding sequence of the ORF, which may also be followed by a DNA sequence encoding a transcription termination signal that can cause the translated RNA or mRNA product to form a hairpin or other three-dimensional structure which may or may not act together with one or more soluble structural proteins to cause the transcription to be interrupted. Transformation. A method for introducing a sequence of exogenous polynucleotides (e.g., a vector, a molecule fe ^ c of recombinant or non-recombinant DNA or RNA) in a cell or protoplast wherein that exogenous polynucleotide is incorporated into an inheritable genetic element or is capable of autonomous replication and therefore remains stably within that cell or protoplast as well as in the progeny of that cell or protoplast.

Cell transformed. A cell that contains an inheritable genetic element altered by the introduction of one or more exogenous DNA molecules. A transgenic cell. Exemplary transformed or transgenic cells include plant corns derived from a transformed plant cell and particular cells such as leaf, root, stem, for example somatic cells, or reproductive cells (germinal) obtained from a transgenic plant. Transgender A gene construct, expression cassette, or segment or DNA sequence comprising an ORF that is convenient to be expressed in the cell, tissue or recipient organism. This may include a complete plasmid, or other vector, or may simply include the functional coding sequence, region, domain, or segment of the transferred DNA sequence. Transgenic event. A plant or progeny thereof derived from a plant cell or protoplast manufactured or constructed to contain one or more molecules of exogenous DNA inserted into the nuclear genome or other genome of the plant cell, or introduced and stably maintained within the cytoplasm of a plastid , chloroplast or mltocondria, which confers a certain phenotype that can be detected physically in the plant or progeny of it. Transgenic plant. A plant or progeny thereof that has been genetically modified to understand and express heterologous DNA sequences either as proteins or as nucleic acids. As specifically exemplified in this, a transgenic maize plant is genetically modified to comprise and express at least one heterologous DNA sequence operably linked to and under the regulatory control of transcription control sequences that function together in cells or plant tissue in whole plants to achieve expression of a nucleic acid sequence encoding an insecticidal d-endotoxin protein or an amino acid sequence variant thereof. A transgenic plant can also be called a transformed plant. A transgenic plant also refers to the progeny of the initial transgenic plant in which said progeny contains and expresses the heterologous coding sequence under the regulatory control of the transcription control sequences that can be expressed in plants described herein. Vector. A polynucleotide capable of replicating in a host cell and / or to which another polynucleotide sequence can be operably linked to cause replication of the linked sequence. A plasmid is an exemplary vector. The present invention describes novel DNA constructs comprising polynucleotide sequences encoding β-d-endotoxins. thuringiensis. Methods for the construction and expression of synthetic B. thuringiensis genes in plants are well known to those skilled in the art and are described in detail in the US patent. 5,500,365. The present invention contemplates the use of Cry3B genes of β. thuringiensis in the transformation of both monocotyledonous and dicotyledonous plants. To enhance the expression of these genes, the present invention provides DNA constructs comprising polynucleotide segments encoding plastid targeting peptides positioned towards the 5 'end of and in frame with the polynucleotide sequences encoding the d-endotoxins of B. thuringiensis desired, together with various combinations of untranslated leader sequences, functional intron sequences in plants, and transcription termination and polyadenylation sequences. In one aspect, the nucleotide sequence information provided by the present invention allows the preparation of relatively short DNA sequences that have the ability to specifically hybridize to gene sequences of the selected polynucleotides described herein. In these aspects, nucleic acid probes of a suitable length are prepared based on a consideration of selected polypeptide sequences encoding Cry3B d-endotoxin inhibitors for Coleoptera, for example, a sequence such as that shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12. These nucleic acid probes also * g $ & ^ X & can be prepared based on a consideration of selected polynucleotide sequences encoding a plastid targeting peptide, such as those shown in SEQ ID NO: 26. The ability of such nucleic acid probes to specifically hybridize to a gene sequence encoding a d-endotoxin polypeptide or a plastid targeting peptide sequence confers particular utility in a variety of modalities. Most importantly, the probes can be used in a variety of tests to detect the presence of complementary sequences in a given example. In certain embodiments, it is advantageous to use oligonucleotide primers. The sequence of said primers is designed using a polynucleotide of the present invention to be used in the detection, amplification or mutation of a defined segment of a crystal protein gene of β. thuringiensis using thermal amplification technology. The method can also be used to detect, amplify or mutate a defined segment of the polynucleotide encoding a plastid targeting peptide. The gene segments related to the polynucleotides encoding the d-endotoxin polypeptides and plastid targeting peptides of the present invention can also be amplified using said primers and thermal amplification methods. To provide some of the advantages according to the present invention, a preferred nucleic acid sequence employed for hybridization assays or assays includes a polynucleotide sequence of at least about 14 to 30 nucleotides in length complementary to a nucleotide sequence encoding for a crystal protein, or polynucleotide sequences of at least about 14 to 30 nucleotides in length complementary to a nucleotide sequence encoding a plastid targeting peptide. A size of at least 14 nucleotides in length helps to ensure that the fragment will be of sufficient length to form a double molecule that is both stable and selective. Generally, molecules that have complementary sequences over segments of more than 14 bases in length are preferred. In order to increase the stability and selectivity of the hybrid, and therefore improve the quality and degree of specific hybrid molecules obtained, it will generally be preferred to design nucleic acid molecules having complementary sequences of genes of 14 to 20 nucleotides, or even longer when is desired Such fragments can be easily prepared by, for example, directly synthesizing the fragment by chemical means, by application of nucleic acid reproduction technology, such as PCR ™ technology of US patents 4,683,195 and 4,683,202, or by removing fragments of DNA selected from of recombinant plasmids containing appropriate inserts and suitable restriction sites. The present invention also contemplates an expression vector comprising a polynucleotide of the present invention. Therefore, in one embodiment an expression vector is an isolated and purified DNA molecule comprising a promoter operably linked to a coding region encoding a polypeptide of the present invention, wherein the coding region is operably linked to a transcription termination region, whereby the promoter drives the transcription of the coding region. The coding region may include a segment encoding a B. thuringiensis d-endotoxin and a segment encoding a target peptide for plastid. The DNA molecule comprising the expression vector may also contain a functional intron. As used herein, the terms "operationally Linked "operably linked" or "means" that a promoter is connected to a coding region such that the transcription of said coding region is controlled and regulated by said promoter The means for operatively linking a promoter to a coding region to regulate both the 3 'end and the 5' end are well known in the technique. Preferred plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those described, for example, by Herrera-Estrella (1983), Bevan (1983), Klee (1985) and application European patent number EP 0120516. Promoters that function in bacteria are well known in the art. Exemplary and preferred promoters for the crystal proteins of β. thuringiensis include the gene promoters sigA, sigE and sigK. Alternatively, recombinant, native promoters can be used, mutagenized, heterologous derivatives of d-endotoxin protein coding sequences of Bacillus thuringiensis. When an expression vector of the present invention is used to transform a plant, a promoter is selected because it has the ability to drive expression in that particular plant species. Promoters that function in different plant species are also well known in the art. Promoters useful in the expression of polypeptide coding sequences in plants are those that are inducible, viral, synthetic or constitutive as described (Poszkowski et al., 1989; Odell et al., 1985), and / or temporarily regulated, spatially regulated and space-temporarily regulated (Chau et al., 1989). Preferred promoters include the improved CaMV35S promoters, and the FMV35S promoter. Other promoters include the POX promoter, the early promoter of ScbDNA virus and the yellow spot virus promoter. In accordance with the present invention, expression vectors designed to specifically enhance expression of the polypeptide in the transformed plant may include certain regions encoding plastid targeting peptides (PTP). These regions allow cellular procedures involved in the transcription, translation and expression of the encoded protein to be fully exploited when associated with certain d-endotoxins of B. thuringiensis. Such plastid targeting peptides function in a variety of ways, such as, for example, transferring the expressed protein to the cellular structure in which it operates most effectively, or transferring the expressed protein to areas of the cell where the cellular procedures necessary for expression are concentrated. In the case of Cry3B, elevated expression is critical for obtaining transgenic maize with CRW control because LC50 of Cry3B against CRW is significantly greater than LC50 of the B. thuringiensis toxins commonly used to control pests such as potato beetle. Colorado in potato (Cry3A) or European corn borer in corn (CrylAb). Increased expression is also especially valuable as it provides additional protection against the development of resistance through a high-dose strategy (McGaughey and Whalon, 1993; Roush, 1994). The expression of high level is even more convenient since it provides sustained insect protection in cases where the insecticidal gene expression decreases due to environmental conditions. Additionally and unexpectedly, maize plants transformed with vectors expressing Cry3B proteins or Coleoptera inhibitory variants showed normal growth and development. An example of a plastid or chloroplast targeting peptide (CTP) is a chloroplast targeting peptide. It has been found that chloroplast targeting peptides are particularly useful in the glyphosate resistant marker system. In that system, plants transformed to express a protein that confers resistance to glyphosate are transformed with a PTP that directs the peptide towards the chloroplasts of the cell. Glyphosate inhibits the path of shikimic acid that leads to the biosynthesis of aromatic compounds including amino acids and vitamins. Specifically, glyphosate inhibits the conversion of phosphoenolpyruvic acid and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpyruvyl-3-phosphoshikimic synthase (EPSP synthase or EPSPS). EPSPS complement, conferred through the insertion of a transgene that encodes this enzyme, allow the cell to resist the effects of glyphosate. Therefore, as the glyphosate herbicide functions to eliminate the cell by interrupting the biosynthesis of aromatic amino acids, particularly in the chloroplast of the cell, the CTP allows increased resistance to the herbicide by concentrating the glyphosate resistance enzyme that the cell expresses in the chloroplast, that is, in the objective organelle of the cell. Exemplary herbicide resistance enzymes include EPSPS as mentioned above, glyphosate oxide reductase (GOX) and the aro-A gene (US Patent Number 4,535,060). CTPs can direct proteins to chloroplasts and other plastids. For example, the target organelle may be the amloplast. Preferred CTPs of the present invention include those that target both chloroplasts and other plastids. Specific examples of preferred CTPs include corn RUBISCO SSU CTP protein, and functionally related peptides. An exemplary CTP polypeptide is shown in SEQ ID NO: 26. A sequence of polynucleotides that codes for this CTP polypeptide is shown in SEQ ID NO: 25. The expression of a gene that exists in the form of double-stranded DNA involves the transcription of messenger RNA (mRNA) from the coding strand of the DNA by pollmerasa RNA enzyme, 5 and subsequent processing of the mRNA primary transcript inside the nucleus. The transcription of DNA into mRNA is regulated by a region of DNA normally referred to as the "promoter". The promoter region contains a sequence of bases that label RNA polymerase to associate with DNA and to initiate transcription of mRNA using one of the 0 DNA strands as a template to make a corresponding strand of RNA. The particular promoter selected should be capable of eliciting sufficient expression of the enzyme coding sequence to result in the production of an effective insecticidal amount of the β protein. thuringiensis. The 3 'untranslated region of the chimeric plant genes of the present invention also contains a polyadenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA. Examples of 3 'regions preferred are (1) untranslated regions, transcribed 3' containing the polyadenylation signal of 0 genes (Ti) plasmid tumor-inducing Agrobacterium, such as the nopaline synthase gene (NOS) and ( 2) the 3 'ends of plant genes such as ssRUBISCO E9 pea gene (Fischhoff et al., 1987). A promoter is selected for his ability to direct the - JÉJa &Sb transcription activity of the transgenic plant or of the plant cell transformed to the coding region, to ensure sufficient expression of the enzyme coding sequence that results in the production of insecticidal amounts of the β-protein . thuringiensis. Structural genes can be driven by a variety of promoters in plant tissues. Promoters can be near-constitutive (ie, driving transcription of the transgene in all tissue), such as the CaMV35S promoter, or tissue specific promoters or specific development affecting dicots or monocots. When the promoter is an almost constitutive promoter such as CaMV35S or FMV35S, increases in the expression of polypeptides are found in a variety of tissues of transformed plants and most plant organs (eg, callus, leaf, seed and root). Improved or duplicate versions of the CaMV35S and FMV35S promoters are particularly useful in the practice of the invention (Kay et al., 1987; Rogers, U.S. Patent 5,378,619). The duplicating enhancer sequences one after another demonstrate that they are of particular importance, for example, as described in Neuhaus et al. (Tissue-specific expression from promoter AS-1 in transgenic tobaceous, Plant Cell 6: 827-834, 1994). Those skilled in the art will recognize that there are a number of promoters that are active in plant cells, and have been described in the literature. Such promoters may be obtained from plants or plant viruses and include, but are not limited to, nopaline slntase (NOS) promoters and ^ jÉtát ^ Kt? &? ^ Us tt A A ^ ^ octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of A. tumefaciens), the 19S and 35S virus cauliflower mosaic (CaMV) promoter, the promoter nducible by light from the small subunit of ribulose 1, 5-bisphosphate carboxylase (ssRUBISCO, a polypeptide very abundant plant), the Actl promoter from rice, the POX promoter, virus yellow spots, the early promoter of virus ScBV, the 35S promoter of escrofularia mosaic virus (FMV), and the 35S AS4 promoter (improved root expression from the 35S promoter linked to multiple as-1 sequences one after the other as in Neuhaus et al.). All of these promoters have been used to create various types of DNA constructs that have been expressed in plants (see for example, McEIroy et. al., 1990, patent of E.U.A. 5,463,175). In addition, it is also preferable to produce the expression of β-d-endotoxin. thuringiensis in specific tissues of the plant using vector plant integrators that contain a tissue-specific promoter. Specific target tissues may include the leaf, stem, root, tuber, seed, fruit, etc., and the selected promoter must have the desired tissue and developmental specificity. Therefore, the function of the promoter should be optimized by selecting a promoter with the desired tissue expression capabilities and resistance to the proximal promoter and selecting a transformant that produces the desired insecticidal activity in the target tissues. This selection approach of the group of transformants is routinely employed in the expression of heterologous structural genes in plants because there is variation between transformants containing the same heterologous gene due to the site of gene insertion within the plant genome (commonly referred to as as "position effect"). In addition to promoters known to cause transcription (constitutive or tissue-specific) of DNA in plant cells, other promoters can be identified for use in the present invention by selecting a plant cDNA library for genes that are selectively or preferably expressed in tissues. objective and then determine the promoter regions. An exemplary tissue-specific promoter is the lectin promoter, which is specific for seed tissue. The lectin protein in soybean seeds is encoded by a single gene (Lei) that is only expressed during seed maturation and is on the scale of 2 to about 5% of the total seed mRNA. The lectin gene and the seed-specific promoter have been fully characterized and used to direct seed-specific expression in transgenic tobacco plants (Vodkin et al., 1983; Lindstrom et al., 1990). An expression vector containing a coding region encoding a polypeptide of interest can be manipulated to be under the control of the lectin promoter and that vector can be introduced into plants using, for example, a protoplast transformation method (Dhir et al. , 1991). The expression of the polypeptide will then specifically target the seeds of the transgenic plant. A transgenic plant of the present invention produced from a plant cell transformed by a tissue-specific promoter can be crossed with a second transgenic plant developed from a plant cell transformed with a different tissue-specific promoter to produce a hybrid transgenic plant that shows the effects of transformation on more than one specific tissue. Other exemplary tissue-specific promoters are corn sucrose synthetase 1 (Yang et al., 1990), corn alcohol dehydrogenase 1 (Vogel et al., 1989), light corn harvest complex (Simpson, 1986), shock protein. by corn heat (Odell et al., 1985), small subunit of RuBP carboxylase of pea (Poulsen et al., 1986; Cashmore et al., 1983), mannoplast synthase of Ti plasmid (McBride and Summerfelt, 1989), nopalina plasmid synthase Ti (Langridge et al., 1989), chalcone isomerase of petunia (Van Tunen et al., 1988), protein 1 rich in bean glycine (Kelle et al., 1989), transcribed CaMV 35s (Odell et al. ., 1985) and potato patatin (Wenzier et al., 1989). The preferred promoters are the cauliflower mosaic virus (CaMV 35S) promoters and the small S-E9 subunit of RuBP carboxylase promoter. The promoters used in the DNA constructs of the present invention can be modified, if desired, to affect their control characteristics. For example, the CaMV35S promoter can be ligated to the portion of the ssRUBISCO gene that represses the expression of ssRUBISCO in the absence of light, to create a promoter that is active in leaves but not in roots. The resulting chimeric promoter can be used as described in i £ L & the present. For purposes of this description, the phrase "CaMV35S" promoter therefore includes variations of CaMV35S promoter, for example, promoters derived by ligation with operator regions, random or controlled mutagenesis, etc. In addition, promoters can be altered to contain multiple "enhancer sequences" to help elevate gene expression. Examples of such enhancer sequences have been reported by Kay et al., (1987) and Neuhaus et al., (1994). The RNA produced by a DNA construct of the present invention also contains a 5 'untranslated leader sequence. This sequence can be derived from the promoter selected to express the gene, and can be specifically modified to increase translation of the mRNA. The 5 'untranslated regions can also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence. The present invention is not limited to constructs wherein the untranslated region is derived from the 5 'untranslated sequence that accompanies the promoter sequence. As shown below, a plant gene leader sequence that is useful in the present invention is the leader of the heat shock protein of petunia 70 (hsp70) (Winter ef al., 1988), the CAB leader of wheat, or the leader PER of wheat. An exemplary embodiment of the invention involves the plastid direction of the B. thuringiensis sequence. Such plastid targeting sequences have been isolated from numerous genes of nuclear-coded plants and have been shown to direct the importation of cytoplasmically synthesized proteins into plastids (described in Keegstra and Olsen 1989). A variety of plastid targeting sequences, well known in the art, including but not limited to ADPGPP, EPSP synthase, or ssRUBISCO, can be used in the practice of the invention. In preferred alternative embodiments, the plastid targeting sequences (peptide and nucleic acid) for monocotyledonous cultures may consist of a genomic fragment containing an intronic sequence as well as a duplicated proteolytic cleavage site in the encoded plastid targeting sequences. The most preferred coding nucleic acid sequence for CTP, herein referred to as zmSSU CTP (SEQ ID NO: 25), consists of a genomic fragment containing an intronic sequence as well as a duplicated proteolytic cleavage site in the leader sequences Coded plastids were derived from the zmS1 plastid targeting sequence (Russell et al., 1993). Direct translation fusions of the zmSSU CTP peptide sequence (SEQ ID NO: 26) to the amino terminus of the sequence have been shown to be useful for obtaining high levels of the polypeptide in transgenic corn. Frame fusions of the zmSSU CTP nucleic acid sequence (SEQ ID NO: 25) for a cry3b gene (SEQ ID NO: 1) or gene variant can be effected by ligation of an Nco site designed at the 3 'end ( C-terminal coding) of the zmSSU CTP sequence to a 5 'Ncol site designed at the N-terminal coding end of the cry3B coding sequence or variant.

A & amp; .aa, The preferred TCC sequence for dicotyledonous cultures consists of a genomic coding fragment containing the chloroplast targeting peptide sequence from the EPSP slntase gene of Arabidopsis thaliana wherein the cut-off site of the transit peptide of the CTP ssRUBISCO of pea replaces the cutting site of CTP EPSP slntasa (Klee ef a /., 1987). As stated above, the 3 'untranslated region of the chimeric plant genes of the present invention contains a polladenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA. Examples of preferred 3 'regions are (1) untranslated, 3' transcribed regions containing the polyadenylate signal of plasmid (Ti) gene inducers of Agrobacterium, such as the nopaline synthase gene (NOS) and (2) plant genes such as the ssRUBISCO E9 gene from pea (Fischhoff et al., 1987). For optimized expression in monocotyledonous plants, an intron can also be included in the construction of DNA expression. Said intron is typically placed near the 5 'end of the mRNA in a non-translated sequence. This intron can be obtained from, but not limited to, a group of introns consisting of maize heat shock protein (HSP) intron 70 (U.S. Patent No. 5,424,412; 1995), the rice Act I intron (McEIroy et al., 1990), the 1-Adhtrontron (Callls et al., 19887), or the sucrose synthase intron (Vasil et al., 1989). As shown here, the corn HSP70 intron (SEQ ID NO: 33) and the rice actin intron; (SEQ ID NO: 32) are particularly useful in the present invention. RNA polymerase is transcribed through a coding DNA sequence to a site where polyadenylation occurs. Typically, DNA sequences located a few hundred base pairs toward the 3 'end of the polyadenylation site serve to terminate transcription. Those DNA sequences are referred to herein as transcription termination regions. Those regions are required for the efficient polyadenylation of transcribed messenger RNA (mRNA). The constructs will typically include the gene of interest together with a 3 'end DNA sequence that acts as a signal to terminate transcription and allow polyadenylation of the resulting mRNA. It is contemplated that the most preferred 3 'elements are those from the nopaline synthase gene of A. tumefaciens (nos 3') (Bevan et al., 1983), the terminator for the T7 transcript of the octopine synthase gene from A. tumefaciens , and the 3 'end of genes I or ii of potato or tomato protease inhibitor. Regulatory elements such as TMV O element (Gallie, et al., 1989) may additionally be included as desired. Another type of element that can regulate gene expression is the DNA sequence between the transcription initiation site and the start of the coding sequence, called the leader untranslated sequence. The leader sequence can influence gene expression. The compilations of leader sequences have been made to predict optimum or suboptimal sequences and generate "consensus" and preferred leader sequences (Joshi, 1987). It is contemplated that preferred leader sequences include those that comprise predicted sequences for directing optimal expression of the linked structural gene, i.e., including a preferred consensus leader sequence that can increase or maintain mRNA stability and prevent inappropriated translation initiation. . The choice of such sequences will be known to those skilled in the art in the light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants, and in corn in particular, will be most preferred. A particularly preferred leader 0 may be the wheat CAB leader (SEQ ID NO: 31). The transcription enhancers or duplications of enhancers can be used to increase expression. These enhancers are often located 5 'at the start of transcription in a promoter that functions in eukaryotic cells, but are often inserted in forward or backward 5' or 3 'orientation to the coding sequence. Examples of enhancers include elements of the CaMV promoter 35S, octopine synthase genes (Ellis et al., 1987), the rice actin gene, and the non-plant eukaryotic promoter (eg, yeast; Ma et al., 1988). The choice of which expression vector and finally to which promoter is operably linked a polypeptide coding region directly depends on the desired functional properties, for example, the location and time of protein expression, and the host cell that will be transformed. These are well-known limitations inherent in the ^ .M & aaahA »- technique for building recombinant DNA molecules. However, a vector useful in the practice of the present invention is capable of directing the expression of the polypeptide coding region to which it is operably linked. Typical vectors useful for gene expression in higher plants are well known in the art and include vectors derived from the tumor-inducing plasmid (Ti) of A. tumefaciens described in (Rogers et al., 1987). However, it is known that various other plant integration vector systems function in plants including the described pCaMVCN transfer control vector (Fromm et al., 1985). pCaMVCN (available from Pharmacia, Piscataway, NJ) includes the CaMV35S promoter. In preferred embodiments, the vector used to express the polypeptide includes a selection marker that is effective in a plant cell, preferably a drug resistance selection marker. A preferred drug resistance marker is the gene whose expression results in resistance to kanamycin; that is, the chimeric gene containing the nopaline synthase promoter, Tn5 neomycin phosphotransferase II (nptll) and the 3 'untranslated region of nopalline synthase described (Rogers et al., 1988). Means for preparing expression vectors are well known in the art. The expression (transformation) vectors used to transform plants and methods for making such vectors are described in the U.S. Patents. Nos. 4,971, 908, 4,940,835, 4,769,061 and 4,757,011. These vectors can be modified to include a sequence of & amp; ^ ££ feSM coding in accordance with the present invention. A coding region that encodes a polypeptide that has the ability to confer insecticidal activity to a cell is preferably a polynucleotide that encodes a B. thuringiensis d-endotoxin or a functional equivalent of such a polynucleotide. According to such embodiments, a coding region comprising the DNA sequences of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11, they are also preferred. B. thuringiensis d-endotoxin polypeptides that encode for ORFs contained in expression cassettes have been shown to express the d-endotoxins of B. thuringiensis at high levels in transformed plants. Preferred cassettes include those contained in the plasmids pMON33709, pMON33710, pMON33722, pMON33723, pMON25096, pMON25097, pMON33741, and pMON33748. The cassettes of The expression in these plasmids are respectively encoded by the sequences shown in: SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 17, SEQ ID NO: 19 , SEQ ID NO: 21 and SEQ ID NO: 23. Most preferably, plants can be successfully transformed with any expression cassette comprising the sequences of nucleotide nucleotides 14 to 3431 of SEQ ID NO: 36, 14 to 3025 of SEQ ID NO: 38, 14 to 3431 of SEQ ID NO: 17, 14 to 3020 of SEQ ID NO: 19, 14 to 3020 of SEQ ID NO: 21, or 25 to 3450 of SEQ ID NO: 23 (pMON33722, pMON33723, pMON25096, pMON25097, pMON33741 and pMON33748). Still very I ^^^^ g ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ preferably, plants may be successfully transformed with any cassette of expression comprising the nucleotide sequences of nucleotides 14 to 3431 of SEQ ID NO: 17, 14 to 3020 of SEQ ID NO: 19, 14 to 3020 of SEQ ID NO: 21, or 25 to 3450 of SEQ ID NO: 23 (pMON25096, pMON25097, pMON33741 and pMON33748). The work described here has identified methods to enhance the in plant expression of β-endotoxins. thuringiensis, which confer resistance to insect pathogens when incorporated into the genome of susceptible plants. The patent of E.U.A. 5,500,365 describes a method for synthesizing plant genes in order to optimize the level of expression of the protein for which it encodes the gene synthesized. This method refers to the modification of the structural gene sequences of the exogenous transgene, to make them more "plant-like" and therefore more easily translated and expressed by the plant. A similar method for increased expression of transgenes in monocotyledonous plants is described in U.S. Pat. 5,689,052. Agronomic, horticultural, ornamental and other economically and commercially useful plants can be produced according to the methods described herein, to express β-endotoxins. thuringiensis at levels high enough to confer resistance to insect pathogens. Such plants can co-express the β-endotoxin polypeptide. thuringiensis together with other peptides, polypeptides or antifungal, antibacterial or antiviral proteins related to the pathogenesis; i, "proteins that confer resistance to herbicides and proteins involved in improving the quality of plant products or the agronomic performance of plants. The simultaneous co-expression of several proteins in plants is advantageous since it exploits more than one mode of action to control the pathogenic damage in plants. This can minimize the possibility of developing resistant pathogenic strains, broaden the spectrum of resistance and potentially cause a synergistic insecticidal effect, thereby improving the ability of plants to resist insect infestation (WO 92/17591). Finally, the most desirable DNA segments for introduction into a monocot genome can be homologous genes or gene families that code for a desired trait (eg, increased yield), and which are introduced under the control of promoters or novel incrementers, etc., or maybe even promoters or homologous or specific control elements in tissue (for example, specific in root-neck / sheath, whorl, bark, spike, seed or leaf). In fact, it is envisioned that a particular use of the present invention could be the production of transformants comprising a transgene that was targeted in a tissue-specific manner. For example, genes resistant to insects could be expressed specifically in the tissues of the whorl and neck / sheath which are targets for the first and second progenies, respectively, of ECB. Likewise, it is desirable that genes that code for proteins with particular activity against rootworm be expressed preferentially in root tissues. Vectors for use in the tissue-specific direction of gene expression in transgenic plants will typically include tissue-specific promoters and may also include other specific control elements in tissues such as enhancer sequences. Promoters that direct specific or increased expression in certain plant tissues will be known to those skilled in the art in the light of the present disclosure. It is also contemplated that tissue-specific expression could be achieved functionally by introducing a constitutively expressed gene (all tissues) in combination with an antisense gene that is expressed only in those tissues in which the gene product is not desired. For example, a gene encoding the B. thuringiensis crystal toxin protein can be introduced to be expressed in all tissues using the 35S promoter of the Cauliflower Mosaic Virus. Alternatively, a rice actin promoter or a histone promoter of a dicotyledonous or monocotyledonous species could be used for the constitutive expression of a gene. In addition, it is contemplated that promoters combining elements from more than one promoter could be useful. For example, the patent of E.U.A. No. 5,491, 288 describes the combination of the Cauliflower Mosaic Virus promoter with a histone promoter. Therefore, the expression of an antisense transcript of a Bt d-endotoxin gene in a maize seed, using for example a promoter of -s * Jk.t Ai > . ~ - -afe zeína, could prevent the accumulation of d-endotoxin in the seed. Accordingly, the protein encoded by the introduced gene would be present in all tissues except that of the seed. It is specifically contemplated by the inventors that a similar strategy with the present invention could be used to direct the expression of an analysable or eligible marker in seed tissue. Alternatively, one might wish to obtain novel tissue-specific promoter sequences for use in accordance with the present invention. To achieve this, we could first isolate cDNA clones of the involved tissue and identify the clones that are specifically expressed in that tissue, for example, using Northern blotting. Ideally, one might wish to identify a gene that was not present in a high number of copies, but a gene product that was relatively abundant in specific tissues. The promoter and control elements of corresponding genomic clones could be located in this manner using molecular biology techniques known to those skilled in the art. It is contemplated that the expression of some genes in transgenic plants would be desired only under specified conditions. By For example, it is proposed that the expression of certain genes that confer resistance to environmental stress factors such as drought would be desired only under real stress conditions. It is further contemplated that the expression of such genes through a plant development could have harmful effects.

It is known that there is a large number of genes that respond to the environment. For example, the expression of some genes such as rbcS, which codes for the small subunit of ribulose bisphosphate carboxylase, is regulated by light mediated through the phytochrome. Other genes are induced by secondary stimuli. For example, the synthesis of abscisic acid (ABA) is induced by certain environmental factors, including but not limited to water stress. A number of genes have been shown to be induced by ABA (Skriver and Mundy, 1990). It is also expected that the expression of genes that confer resistance to insect predation would be desired only under conditions of actual insect infestation. Therefore, for some desired traits, expression of transducible genes in transgenic plants would be desired. It is proposed that, in some embodiments of the present invention, the expression of a gene in a transgenic plant would be desired only in a certain period of time during the development of the plant. The regulation of development time is frequently related to the expression of specific genes in tissues. For example, the expression of zein storage proteins is initiated in the endosperm approximately 15 days after pollination. It is contemplated that the method described in this invention could be used to obtain substantially improved expression of a number of novel B. thuringiensis endotoxins isolated as described below, the identification of new strains of Bacillus thuringiensis which encode Crystalline endotoxins with insecticidal activity have been described previously (Donovan et al., 1992). The isolation of the endotoxin from B. thuringiensis, followed by the amino acid sequence determination of the amino terminal, the retro-translation of the amino acid sequence to design an ollgonucleotide probe or the use of a B. thuringiensis gene as a probe, followed by cloning of the gene encoding endotoxin by hybridization are familiar to those skilled in the art and have been described (see for example, Donovan et al., 1992, U.S. Patent No. 5,264,364). Bacillus thuringiensis Cry3Bb d-endotoxins with improved coleopterous inhibitory activity can be achieved using the methods described in English et al., (W099 / 31248). Also contemplated is a plant transformed with an expression vector of the present invention. A transgenic plant derived from said transformed or transgenic cells is also contemplated. Those skilled in the art will recognize that a chimeric plant gene that contains a structural coding sequence of the present invention can be inserted into the genome of a plant by methods well known in the art. Such methods for the transformation of plant cell DNA include Agrobacterium-mediated plant transformation, the use of liposomes, transformation using virus or pollen, electroporation, protoplast transformation, gene transfer in pollen, injection or vacuum infiltration ( Bechtold et al., Meth. Mo. Biol., 82: 259-266; 1998) in reproductive organs, injection in immature embryos and bombardment with particles. Each of these methods has different advantages and disadvantages. Thus, a particular method for introducing genes into a particular plant strain may not necessarily be the most effective for another plant strain, but it is well known which methods are useful for a particular plant strain. The technology for the introduction of DNA into cells is well known to those skilled in the art. Four general methods for delivering a gene to cells have been described: 1) chemical methods (Graham and van der Eb, 1973); 2) physical methods such as microinjection (Capecchi, 1980), electroporation (Wong and Neumann, 1982; Fromm et al., 1985) and the gene gun (Johnston and Tang, 1994; Fynan et al., 1993); 3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis and Anderson, 1988a; 1988b) and 4) mechanisms mediated by receptors (Curiel et al., 1991; 1992; Wagner et al., 1992). A suitable method for supplying segments of transformation DNA to plant cells is the bombardment with microprojectiles. In this method, the particles can be coated with nucleic acids and delivered to the cells by means of a propulsive force. Exemplary particles include those comprised of tungsten, gold, platinum and the like. Using these particles, the DNA is carried through the cell wall and into the cytoplasm on the surface of small metal particles as described (Klein et al., 1987, Klein et al., 1988 and Kawata et al., 1988). ). The metal particles penetrate through several layers of cells and thus allow the transformation of the cells into tissue explants. One advantage of microprojectile bombardment, besides being an effective means of transforming plant cells in a stable and reproducible manner, is that neither protoplast isolation (Crlstou et al., 1988) nor susceptibility to infection by Agrobacterium is required. An illustrative embodiment of a method for delivering DNA to plant cells by acceleration is a Biolistic Particle Delivery System, which can be used to propel particles coated with DNA or cells through a sieve, such as a stainless steel screen or Nytex, on a filter surface covered with plant cells grown in suspension. The sieve disperses the particles so that they are not supplied to the recipient cells in large aggregates. It is believed that a sieve intervening between the projectile apparatus and the cells to be bombarded reduces the size of the projectile aggregate and could contribute to a higher frequency of transformation by reducing the damage inflicted on the recipient cells by projectiles that are too large. For the bombing, cells in suspension are preferably concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be placed on solid culture medium. The cells that will be bombarded are placed at a suitable distance below the macroprojectile stop plate. If desired, one or more sieves are also placed between the acceleration device and the cells to be bombarded. Through the use of techniques described herein, up to 1000 or more foci of cells could be obtained that transiently express a marker gene. The number of cells in a focus that express the exogenous gene product 48 hours after the bombardment commonly varies from 1 to 10 and on average 1 to 3. In the bombardment transformation, pre-bomb culture conditions and parameters can be optimized of bombardment to produce the maximum numbers of stable transformants. Both the physical and biological parameters for bombing are important in this technology. Physical factors are those that involve manipulation of the DNA / microprojectile precipitate or those that affect the flight and velocity of macro or microprojectiles. Biological factors include all steps involved in the manipulation of cells before and immediately after bombardment, the osmotic adjustment of the target cells to help alleviate the trauma associated with the bombardment, and also the nature of the transforming DNA, such as DNA llnealized or intact supercoiled plasmids. It is believed that pre-bomb manipulations are especially important for the successful transformation of immature plant embryos. Accordingly, it is contemplated that one might wish to adjust several of the bombardment parameters in small-scale studies to fully optimize the conditions. One could particularly desire to adjust physical parameters such as distance between spaces, flight distance, tissue distance and helium pressure. Trauma reduction factors (TRFs) could also be reduced to a minimum by modifying the conditions that influence the physiological state of the recipient cells and that therefore influence the efficiencies of transformation and integration. For example, the osmotic state, tissue hydration and the subculture or cell cycle stage of the recipient cells could be adjusted for optimal transformation. The execution of other routine adjustments will be known to those skilled in the art in light of the present disclosure. The methods of particle-mediated transformation are are well known to those skilled in the art. The patent of E.U.A. No. 5,015,580 describes the transformation of soybeans using said technique. Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into tissues of whole plants, avoiding this forms the need for the regeneration of an intact plant from a protoplast. The use of plant integration vectors mediated by Agrobacterium to introduce DNA into plant cells is well known in the art. See, for example, the described methods (Fraley et al., 1985, Rogers et al., 1987). Genetic manipulation of cotton plants using transfer mediated by Agrobacterium is described in the patent of E.U.A. No. 5,004,863; the similar transformation of lettuce plants is described in the U.S. patent. No. 5,349,124 and the Agrobacterium-mediated transformation of soybeans are described in the U.S. patent. No. 5,416,011. ^^ fe ^ feM ^ -fefe «g,« gaaas ^: »^ fe ^ ^ -í S xÉiiik m In addition, the integration of the Ti DNA is a relatively precise process that results in few rearrangements. The region of DNA that will be transferred is defined by the boundary sequences, and the Interventor DNA is normally inserted into the genome of the plant as described (Spielmann et al., 1986, Jorgensen et al., 1987). Modern vectors of transformation by Agrobacterium are capable of replication in E. coli as well as in Agrobacterium, allowing convenient manipulations such as those described (Klee et al., 1985). Moreover, recent technological advances in vectors for Agrobacterium-mediated transfer have improved the arrangement of genes and restriction sites in vectors to facilitate the construction of vectors capable of expressing several polypeptide coding genes. The vectors described (Rogers et al., 1987) have convenient multiple linker regions flanked by a promoter and a polyadenylation site for the direct expression of inserted polypeptide coding genes and are suitable for the present purposes. In addition, both armed and unarmed Ti genes containing Agrobacterium can be used for transformations. In those plant varieties in which Agrobacterium-mediated transformation is efficient, it is the method of choice thanks to the easy and defined nature of gene transfer. The Agrobacterium-mediated transformation of foliar discs and other tissues such as cotyledons and hypocotyls seems to be limited to plants that Agrobacterium naturally infects. The transformation mediated by Agrobacterium is more efficient in dicotyledonous plants. Few monocots appear to be natural hosts for Agrobacterium, although transgenic plants have been produced in asparagus using Agrobacterium vectors as described (Bytebier et al., 1987). Other monocots have also recently been transformed with Agrobacterium. Corn (Ishida et al.) And rice (Cheng et al.) Are included in this group. A transgenic plant formed using transformation methods with Agrobacterium typically contains a single gene on a chromosome. Such transgenic plants can be referred to as being heterozygous for the added gene. However, since the use of the word "heterozygous" usually implies the presence of a complementary gene in the same place of the second chromosome of a pair of chromosomes, and since there is no such gene in a plant that contains an added gene as in this case, it is believed that a more precise name for said plant is an independent segregant, since the exogenous added gene segregates independently during mitosis and meiosls. An independent segregant may be preferred when the plant is marketed as a hybrid, such as corn. In this case, an independent segregating gene that contains the gene is crossed with other plants, to form a hybrid plant that is heterozygous for the gene of interest. An alternative preference is for a transgenic gene that is homozygous for the added structural gene; that is, a transgenic plant that contains two genes added, a gene in the same place in each chromosome or pair of chromosomes. A homozygous transgenic plant can be obtained by sexually crossing (mating) an independent segregating transgenic plant containing a single added gene, germinating a part of the produced seed and analyzing the resulting plants produced to verify the Mendelian activity and inheritance of the gene of interest indicating the homozygosity in relation to a control (native and non-transgenic) or an independent segregating transgenic plant. Two different transgenic plants can be crossed to produce progeny containing two exogenous genes added and independently segregating. The pairing of the appropriate progeny can produce plants that are homozygous for both exogenous added genes that code for a polypeptide of interest. Retro-crossing to a progenitor plant and exo-crossing with a non-transgenic plant is also contemplated. The transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation and combinations of these treatments (see, for example, Potrykus ef al., 1985, Lorz et al., 1985; ef al., 1985; Uchimiya et al., 1986; Callis et al., 1987; Marcotte et al., 1988). The application of these systems to different plant germplasms depends on the ability to regenerate that particular plant variety from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (see, for example, Fujimura et al., 1985, Toriyama et al., 1986, Yamada et al., 1986, Abdullah et al., 1986). To transform plant germplasm that can not be successfully regenerated from protoplasts, other forms can be used to introduce DNA into intact cells or tissues. For example, the regeneration of cereals from immature embryos or explants can be carried out as described (Vasil, 1988). DNA can also be introduced into plants by direct DNA transfer into pollen as described (Zhou et al., 1983, Hess, 1987). The expression of polypeptide coding genes can be obtained by injecting the DNA into reproductive organs of a plant as described (Pena et al., 1987). DNA can also be injected directly into the cells of immature embryos and the rehydration of dissected embryos as described (Neuhaus et al., 1987, Benbrook et al., 1986). Unmodified bacterial genes are commonly expressed in deficient form in cells of transgenic plants. Several reports have described methods to improve the expression of recombinant genes in plants (Murray et al., 1989, Diehn et al., 1996, Lannacone et al., 1997, Rouwendal et al., 1997, Futterer et al., 1997 and Futterer and Hohn, 1996). These reports describe several methods for designing coding sequences to represent sequences that are translated more efficiently based on codon frequency tables, improvements in the polarization of the third base position of the codons, using recombinant sequences that avoid suspicion polyadenylation or A / T rich domains or consensus sequences of introns cutting. Although these methods for the synthetic construction of genes are remarkable, the synthetic genes of the present invention were prepared according to the method of Brown et al., (U.S. Patent No. 5,689,052; 1997). In this manner, the present invention provides a method for preparing synthetic plant genes that express in-plant a desired protein product at significantly higher levels than wild-type genes. Briefly, of According to Brown et al., The frequency of codons of rare and semi-rare monocots in a polynucleotide sequence encoding a desired protein are reduced and replaced with codons of monocotyledons that are most preferred. The improved accumulation of a desired polypeptide encoded by a polynucleotide sequence modified in a monocotyledonous plant is the result of increasing the frequency of preferred codons by analyzing the coding sequence in six successive nucleotide fragments and altering the sequence based on the frequency of occurrence of the six fragments in terms of frequency of occurrence of the rarest fragments 284, 484 and 664 in plants monocots. In addition, Brown et al., Describe the improved expression of a recombinant gene by applying the method to reduce the frequency of rare codons with methods to reduce the occurrence of polyadenylation signals and introns cutting sites in the nucleotide sequence, removing self-complementary sequences in the nucleotide sequence and replacing said sequences with non-self-complementary nucleotides while maintaining a structural gene coding for the polypeptide, and reducing the frequency of the occurrence of 5'-CG-3 'dinucleotide pairs in the sequence of nucleotides. These steps are carried out sequentially and have a cumulative effect resulting in a nucleotide sequence containing a preferential use of the monocot coding codons most preferred for monocotyledonous plants for a majority of the amino acids present in the desired polypeptide. In this manner, the amount of a gene encoding a polypeptide of interest (ie, a bacterial crystal protein or d-endotoxin polypeptide or such d-endotoxin linked to a plastid targeting peptide) can be increased in plants transforming those plants using transformation methods such as those described herein. After carrying out the delivery of exogenous DNA to recipient cells, the next step to obtain a transgenic plant generally refers to identifying the transformed cells for additional plant culture and regeneration. As mentioned herein, to improve the ability to identify transformants, it is preferable to employ an eligible or analysable marker gene such as, or in addition to, the expressible gene of interest. In this case, the population of potentially transformed cells could then be tested generally by exposing the cells to a selective agent or agents, or the cells could be analyzed to verify the trait of the marker gene that is desired. An exemplary embodiment of methods for identifying transformed cells includes exposing the transformed cultures to a selective agent, such as a metabolic inhibitor, an antibiotic, a herbicide or the like. Cells that have been transformed and have stably integrated a marker gene that confers resistance to the selective agent used will grow and divide in the culture. Sensitive cells will not be available for additional culture. An example of a preferred marker gene encoding an EPSPS synthase that is resistant to inhibition with glyphosate. When this gene is used as an eligible marker, the putatively transformed cell culture is treated with glyphosate. After treatment, transgenic cells will be available for further culture, whereas sensitive or non-transformed cells will not be available. This method is described in detail in the patent of E.U.A. No. 5,569,834. Another example of a preferred marker system that is preferred is the nptll system by which resistance to the antibiotics kanamycin, neomycin, and paromomycin or related antibiotics is conferred, as described in the U.S. patent. No. 5,569,834. Again, after the transformation with this system, transformed cells containing a nptll gene expressible in plants will be available for further culture after treatment with kanamycin or related antibiotics, while untransformed cells will not be. The use of this type of eligible marker system is described in Brown et al., (U.S. Patent No. 5,424,412). Another eligible marker that can be used is the gene that codes for the green fluorescent protein. All the assays contemplated are non-destructive and the transformed cells can be further cultured after identification. It is further contemplated that combinations of analysable and eligible markers for the identification of transformed cells will be useful. In some types of cells or tissues a selection agent, such as glyphosate or kanamycin, may or may not provide sufficient activity of Such elimination as to clearly recognize the transformed cells or may cause substantial non-selective inhibition of the transformants and non-transformants alike, thus causing the selection technique to be ineffective. It is proposed that the selection with a growth inhibiting compound, such as glyphosate at concentrations below Those that cause 100% inhibition followed by analysis of the growing tissue to verify the expression of an analysable marker gene such as kanamycin would allow to recover transformants of cell or tissue types that were not available for selection on their own. It is proposed that selection and analysis combinations would make it possible to identify transformants in a wider variety of cell and tissue types. It is well known in the art to develop or regenerate plants from individual plant protoplasts or several explants (Weissbach and Welssbach, 1988). This process of regeneration and growth JEJ ^ aMfeg. ^ Fa'- ^ S'ii »1 typically includes the steps of selecting transformed cells, culturing those individualized cells through normal stages of embryonic development by means of the rooted seedling stage. Embryos and transgenic seeds regenerate similarly. The resulting transgenic rooted shoots are then planted in a suitable plant growth medium such as soil. The development or regeneration of plants containing the foreign and exogenous gene coding for a polypeptide of interest introduced by Agrobacterium from leaf expanders can be achieved by methods well known in the art, such as those described (Horsch et al., 1985). ). In this procedure, the transformants are cultured in the presence of a selection agent and in a medium that induces regeneration of shoots in the plant strain that is being transformed as described (Fraley et al., 1983). In particular, the patent of E.U.A. No. 5,349,124 details the creation of genetically transformed lettuce cells and plants resulting therefrom that express hybrid crystal proteins that confer insecticidal activity against lepidopteran larvae to said plants. This procedure typically produces shoots at two or four months and those shoots are then transferred to an appropriate root induction medium containing the selective agent and an antibiotic to prevent the growth of bacteria. The shoots that took root in the presence of the selective agent to form seedlings are then transplanted to land or other means to allow the production of roots. These methods vary depending on the partylcerecipitated plant strain, such variations being well known in the art. A transgenic plant of this invention then has an increased amount of a coding region encoding a B. thuringiensis d-endotoxin polypeptide or variant thereof, or it can code for such a d-endotoxin linked to a peptide of address to plastido. A transgenic plant that is preferred is an independent segregant and can transmit that gene and its activity to its progeny. A transgenic plant that is most preferred is homozygous for that gene, and transmits that gene to all its progeny after sexual mating. The seed of a transgenic plant can be grown in the field or greenhouse, and the resulting sexually mature transgenic plants are self-pollinated to generate true breeding plants. The progeny of these plants become true breeding lines that are evaluated for verify the increased expression of the transgene encoding the d-endotoxin. To identify a transgenic plant that expresses high levels of the d-endotoxin of interest, it is necessary to analyze the regenerated transgenic plants resistant to herbicides and antibiotics (generation of Ro) for verify the insecticidal activity and / or expression of the gene of interest. This can be achieved by several methods well known to those skilled in the art, including but not limited to: 1) obtaining small tissue samples from the transgenic Ro plant and directly testing the tissue for A¡ ^ & m¡ia3, ^ & £ > Í ?? ^ í > J verify the activity against susceptible insects in parallel with tissue derived from a negative control plant of non-expression. For example, transgenic Ro corn plants expressing B. thuringiensis endotoxins such as Cry3B can be identified by assaying leaf tissue or root tissue derived from such plants to verify activity against CRW; 2) analysis of protein extracts by enzyme-linked immunoassays (ELISAs) specific for the gene of interest (Cry3B) or 3) thermal amplification with reverse transcriptase to identify events that express the gene of interest. The genes and d-endotoxins according to the present invention include not only the full length sequences described herein but also fragments of these sequences, or fusion proteins, which retain the insecticidal activity characteristic of the sequences specifically exemplified herein. It should be apparent to a person skilled in the art that insecticide d-endotoxins can be identified and obtained by various means. The specific genes, or portions thereof, may be obtained from a culture repository, or constructed synthetically, for example, by the use of a gene machine. Variations of these genes can be easily constructed using standard techniques to make mutations by points. Likewise, fragments of these genes can be made using commercially available exonucleases or endonucleases according to standard procedures. For example, enzymes such as ßa / 31 or site-directed mutagenesis can be used for systematically cut nucleotides from the ends of these genes. Likewise, genes that code for active fragments can be obtained using a variety of other restriction enzymes. Proteases can be used to directly obtain active fragments of these d-endotoxins. Equivalent d-Endotoxins and / or genes encoding these d-endotoxins can also be isolated from Bacillus strains and / or DNA libraries using the teachings provided herein. For example, antibodies to the d-endotoxins described and claimed herein can be used to identify and isolate other d-endotoxins from a mixture of proteins. Specifically, antibodies can be developed for the portions of the d-endotoxins that are the most constant and most distinct from other β-endotoxins. thuringiensis. These antibodies can then be used to specifically identify equivalent d-endotoxins with the characteristic insecticidal activity by immunoprecipitation, enzyme-linked immunoassay (ELISA) or Western blotting. A further method to identify the d-endotoxins and genes of the present invention is by the use of oligonucleotide probes. These probes are nucleotide sequences that have a detectable label. As is well known in the art, if the probe molecule and nucleic acid sample hybridize when together in a mixture forming hydrogen bonds between the two molecules, it can reasonably be assumed that the probe and sample are essentially identical or substantially similar or homologous. at least along the length of the probe. The detectable label of the probe provides a means to determine in a known manner whether or not hybridization has occurred. Said probe analysis provides a rapid method for identifying insecticidal d-endotoxin genes of the present invention. The formation of duplex and stability depend on substantial complementarity between the two chains of a hybrid, and, as mentioned above, a certain degree of non-pairing can be tolerated. Therefore, the probes of the present invention include mutations (both single and multiple), deletions, insertions of the described sequences and combinations thereof, wherein said mutations, insertions and deletions allow the formation of stable hybrids with the target polynucleotide. of interest. Mutations, insertions and deletions may occur in a certain sequence of polynucleotides in many ways, by methods currently known to an ordinary skill expert, and perhaps by other methods that may become known in the future. The potential variations in the probes listed are due, in part, to the redundancy of the genetic code. Due to the redundancy of the genetic code, more than one triplet (codon) of coding nucleotides can be used for most of the amino acids used to make proteins. Therefore, different nucleotide sequences can code for a particular amino acid. In this manner, the amino acid sequences of the d-endotoxins and peptides of B. thuringiensis, and the plastid targeting peptides and the polynucleotides encoding them, can be prepared by equivalent nucleotide sequences encoding the same amino acid sequence of the protein or peptide. Site-specific mutagenesis is a useful technique in the preparation of individual peptides, or equivalent biologically functional proteins or peptides, through specific mutagenesis of the underlying DNA. The technique also provides an easy ability to prepare and test sequence variants, for example, incorporating one or more of the foregoing considerations, introducing one or more changes of the nucleotide sequence in the DNA. In general, the site-specific mutagenesis technique is well known in the art, as exemplified by several publications. As will be appreciated, the technique typically employs a phage vector that exists in both single chain and double chain form. Typical vectors useful in site-directed mutagenesis include vectors such as phage or M13 plasmids that contain an M13 repliccation origin. These phages are commercially available in an easy way and their use is generally well known to those skilled in the art. Modifications and changes in the structure of the peptides of the present invention and in the DNA segments encoding them can be made and still obtain a functional molecule that codes for a protein or peptide with desirable characteristics. The peptides, polypeptides and jj biologically functional equivalent proteins contemplated herein must possess about 80% or more of sequence similarity, preferably about 85% or more of sequence similarity and more preferably about 90% or more of sequence similarity, with the sequence of, or corresponding portion in, the fundamental amino acid sequence of Cry3B. The following is a discussion that is based on changing the amino acids of a protein to create an equivalent, or even an improved second-generation molecule. In particular embodiments of the invention, mutated crystal proteins are contemplated as being useful for increasing the insecticidal activity of the protein, and consequently increasing the insecticidal activity and / or expression of the recombinant transgene in a plant cell. Changes in amino acids can be achieved by changing the codons of the DNA sequence, according to codons 5 given in tables of readily available amino acid codons. For example, certain amino acids can substitute other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive ability and nature of a protein that defines the biological functional activity of that protein, certain substitutions can be made in the amino acid sequence in a protein sequence, and, of course, its underlying DNA coding sequence, Y iütS, ~ .¿- ^ t S- * '- «& **» «-». £ -y, to »-AA .A» ..- «. t- nevertheless obtain a protein with similar properties. It is then contemplated by the inventors that various changes can be made in the peptide sequences of the described compositions, or corresponding DNA sequences coding for said peptides without appreciable loss of their usefulness or biological activity. To make such changes, the hydropathic index of amino acids can be considered. The importance of the hydropathic amino acid index to confer interactive biological function in a protein is generally understood in the art (Kyte and Doolittle, 1982, incorporated herein by reference). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resulting protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens and the like. . It is known in the art that certain amino acids can be substituted by other amino acids having a similar hydropathic index or score, and still result in a protein with similar biological activity, that is, still obtain a functionally equivalent biological protein. It is also understood in the art that substitution of similar amino acids can be done effectively based on the hydrophilicity. The patent of E.U.A. No. 4,554,101 notes that the largest local average hydrophilicity of a protein, governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the ^ A **. «Sa? S?.« Gsfe. *. < «-, -« protein faith. It is understood that an amino acid can be substituted by another having a similar hydrophilicity value and still obtain a biologically equivalent one and in particular, an immunologically equivalent protein. As described above, the amino acid substitutions are therefore generally based on the relative similarity of the amino acid side chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size and the like. Exemplary substitutions that take into account several of the above characteristics are well known to those skilled in the art and include: argillin and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. The polynucleotides that code for d-endotoxins derived from β. thuringiensis are known to those skilled in the art, as being poorly expressed when incorporated into the nuclear DNA of transgenic plants (reviewed by Diehn et al., 1996). Preferably, a nucleotide sequence coding for the d-endotoxin of interest is designed essentially as described in the US patent. No. 5,500,365 and 5,689,052. Examples of nucleotide sequences useful for expression include but are not limited to ac / y3B (SEQ ID NO: 5), cry3Bb1 (SEQ ID NO: 1), CAy3β2 (SEQ ID NO: 3), v11231 (SEQ ID NO: 7) , 11231mv1 (SEQ ID NO: 9) and 11231mv2 (SEQ ID NO: 11). Peptides, polypeptides and proteins that are biologically and functionally equivalent to Cry3B include amino acid sequences that contain conservative amino acid changes in the fundamental sequence ¿»® * ^ ¿- shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12 (Cry3Bb1, CrySBJj," v11231, 11231mv1, 11231mv2 , Cry3Bb.11231 or Cry3Bb.11098, etc.) In such amino acid sequences, one or more amino acids in the fundamental sequence is (are) substituted with another amino acid (s), the charge and polarity of which is similar to that of the native amino acid, that is, a conservative amino acid substitution, resulting in an inactive charge Substitutes for an amino acid in the fundamental polypeptide sequence can be selected from other members of the class to which the naturally occurring amino acid belongs. The amino acids can be divided into the following four groups: (1) acidic amino acids, (2) basic amino acids, (3) neutral polar amino acids and (4) neutral non-polar amino acids Representative amino acids in these various groups include, but are not limited to: (1) amino acids (charged nega acids) such as aspartic acid and glutamic acid; (2) basic (positively charged) amino acids such as arginine, histidine and lysine; (3) neutral polar amino acids such as glycine, serine, threonine, cysteine, cystine, tyrosine, asparagine and glutamine; (4) neutral non-polar (hydrophobic) amino acids such as alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Conservative amino acid changes in the sequence of fundamental polypeptides can be made by substituting an amino acid in one of these groups with another amino acid in the same group. The biologically functional equivalents of Cry3B may have 10 or fewer conservative amino acid changes, most preferably seven or fewer conservative amino acid changes and more preferably five or fewer conservative amino acid changes. The coding nucleotide sequence (gene, plasmid DNA, cDNA, non-naturally occurring or synthetic DNA) will thus have corresponding base substitutions, allowing it to code for biologically functional equivalent forms of Cry3B. The present invention provides methods and compositions for expressing β-endotoxins. Cry3B thuringiensis coleopterous inhibitors or variants of amino acid sequences thereof at unexpectedly high levels in transgenic plants. The described methods and compositions can take advantage of any of the DNA constructs described, as well as any of the transformation vectors described herein. The contemplated methods and compositions make it possible for the Cry3Bb d-endotoxins or amino acid sequence variants thereof to be expressed in plants without adversely affecting the recovery of the agronomic qualities of the transgenic plants. The inventions described herein also make it possible to express Cry3B d-endotoxins and variants at levels up to 500 times higher than those achieved by previous methods and compositions. The methods described herein then make it possible to express Cry3B or variants to be used as an alternative or complement for plants that express other Cry proteins such as a variant of ** é £ si *. JA. * ^ '- ^^ Cry3B, a Cry3A or Cry3D or variant, CryET33 and CryET34 or variants thereof, a CryET70 or variant, a CryET29 or variant, a CrydA or CrydB or variant, a CrydB or variant, acyl hldrolases lipid insecticides, combinations of amino acid oxidases and tedanalactam synthases and other 5 insecticidal proteins such as VIP1 and VIP3 and various isolated combinations of Heterorhabdus, Photorhabdus and Xenorhabdus species for both control and resistance management of key insect pests, including Ostrina sp., Diatraea sp., Diabrotica sp., Helicoverpa sp., Spodoptera sp. in Zea mays; Heliothis virescens, Helicoverpa sp., Pectinophora sp. in Gossypium hirsutum and Anticarsia sp., Pseudoplusia sp., Epinotia sp. in Glycine max. It is also contemplated that the described methods can be used to dramatically increase the expression of β-d-endotoxins. thuringiensis including and related to Cry3, thereby increasing its effectiveness against target pests and decreasing the possibility of evolved resistance to these proteins. In one embodiment of the present invention, a Cry3 d-endotoxin is expressed. The target pests of this protein and its common hosts are shown below in table 1. -j TABLE 1 Target pests affected by CryB3 d-endotoxin active (inhibitory) in coleoptera and plant hosts common to these pests Antibodies were required for comparative studies of the expression of several Cry3 coding sequences, whereby polyclonal serum was generated as follows. Cry3 Bt crystals were collected from a sporulated fermentation of recombinant strain 11037 of Bacillus thuringiensis expressing native Cry3B. The crystals were solubilized in 100 mM of sodium carbonate pH buffer, pH 10.5, to give a concentration of 2.7 mg of protein per mL measured by a colorimetric bicinchoninic acid assay (Smith et al., 1985). A sample was diluted to a concentration of 0.4 mg / mL and mixed with an equal volume of Freund's complete adjuvant. An inoculum of 1 milliliter of this mixture was used & < ^ ^ ^ J ^ ^ ^ J $ u¿ &&^^^ *% ^ ^ 3? ", For the first intradermal injection in a rabbit. He took a first bleeding two weeks later. Subsequent injections of Cry3Bb protein designed to boost the immune concentration were prepared by mixing equal volumes of 0.2 mg / mL protein with equal volumes of Freund's complete adjuvant. One milliliter injections were administered at four week intervals, and additional bleeds were obtained every two weeks. Immune serum suitable for analytical purposes was prepared from rabbit # 783 after precipitation on an affinity chromatography CL-4B Protein A Sepharose according to the manufacturer's instructions (Sigma Chemical Co., St. Louis, Missouri) and concentrated to 1 milligram of IgG protein per milliliter and stored in the dark at 4 ° C. A sample of this antiserum was conjugated to alkaline phosphatase enzyme for subsequent use in quantitative ELISA assays. Leaf and root samples were taken from plants expressing proteins 11231, 11084, 11098 and 11247 of variant Cry3Bb. Extracts of plant samples were prepared as follows. Plant tissue, root or leaf parts, were harvested and weighed on a gram scale. Leaf tissue was mixed with 20 parts of TBA pH regulator, weight to volume. The root tissue was mixed with 10 parts of pH regulator TBA, weight by volume. Tissues were chopped in an emulsion using a Wheaton ™ upper head chopper and stored on ice at -20 ° C. 250 microliters of rabbit anti-Cry3Bb antiserum diluted 1: 1000 in carbonate coating buffer, pH 9.6, were distributed on each well of a 96-well microtiter plate and incubated overnight at 4 ° C. The plate was then washed with PBST (3 x 5 minutes). Tissue extract samples were loaded in duplicate at 20 microliters per well and at varying dilutions to obtain a value on an established standard curve using variant 11231 of Cry3Bb. The plates were incubated overnight at 4 ° C, then washed with PBST three times, five minutes each time. Fifty microllters of the rabbit anti-Cry3B alkaline phosphatase conjugated polyclonal antibody were loaded into each well, followed by the addition of 180 μL of PBST containing 1% PVP-40 (Sigma). After overnight incubation, the plates were washed with PBST (3 X 5 minutes) and developed with alkaline phosphatase color developing solution consisting of 20 mg of para-nitrophenyl phosphate in 25 mL of diethanolamine, pH 9.8 , 200 μL / well). The plates were read at? 405 after 15-20 minutes, using a quadratic curve fitted to a standard protein curve where the optical density of the highest parameter was approximately 1.00.

EXAMPLES The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those skilled in the art that the techniques described in the following examples represent techniques discovered by the inventor to function well in the practice of the invention. * -. oA ~ & rt w »afHJIt? ll4. gSS »- a ¿¿?? -. invention, and in this way preferred modes can be constituted for its practice. However, those skilled in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments described and still obtain a similar or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1 Isolation, characterization and identification of proteins and Cry 3. genes and construction of amino acid sequence variants thereof Means to identify and characterize coleopteran toxic gene products are well documented in the art, and methods for isolating, characterizing and identifying the genes encoding such gene products are also well known in the art. In addition, the means for producing amino acid sequence variants of said d-endotoxin proteins toxic to coleoptera are also well known. In particular, Van Rie et al. (U.S. Patent No. 5,659,123; 1997) identifies Cry3A and D toxins that exhibit coleopterous inhibitory properties, and also described a method for identifying mutants that can be constructed and that may have reduced insecticidal activity with reference to the wild-type protein. Van Rie et al. describe how those particular mutants can be manipulated further to identify toxins of variant amino acid sequence that exhibit increased insecticidal activity with «. - * - o- * &"* 3 * £ s &" reference to the wild-type protein English et al. (WO 99/31248) describe other methods and compositions, in particular for Cry3B, which make possible identification of Cry3B coding genes and gene products, and methods that can be used to construct and identify amino acid sequence variants that exhibit improved insecticidal activity with reference to that of wild-type Cry3B protein. the present were derived from those described in English et al., and the proteins produced from these coding sequences represent in particular the variants 11231 or 11098 as described herein.

EXAMPLE 2 Construction of expression vectors of monocotyledonous plants for Cry3Bb variants Gene Design of Cry3Bb Variant for Plant Expression For the efficient expression of Cry3Bb variants in transgenic plants, the gene coding for the variants must have a suitable sequence composition (Diehn et al., 1996). An example of such a sequence is shown for gene v11231 (SEQ ID NO: 7) which codes for variant 11231 of the Cry3Bb protein (SEQ ID NO: 8) which exhibits activity in Diabroticus. This gene was derived by mutagenesis (Kunkel, 1985) of a synthetic gene Cry3Bb (SEQ ID NO: 5) that codes for a protein & mja®bgS6t ^ t essentially homologous to the protein encoded by the native Cry3Bb gene (Gen Bank Accession number m89794; SEQ ID NO: 1). The following oligonucleotides were used in the mutagenesis of the original Cry3Bb synthetic gene (SEQ ID NO: 5) to create the gene v11231 (SEQ ID NO: 7). 5 Oligo # 1: TAGGCCTCCATCCATGGCAAACCCTAACAATC (SEQ ID NO: 40) Oligo # 2: TCCCATCTTCCTACTTACGACCCTGCAGAAATACGGTCCAAC (SEQ ID NO: 41) 0 Oligo # 3: GACCTCACCTACCAAACATTCGATCTTG (SEQ ID NO: 42) Oligo # 4: CGAGTTCTACCGTAGGCAGCTCAAG (SEQ ID NO: 43) Construction of the cry3Bb monocotyledonous plant expression vector To place the v11231 gene of the Cry3Bb variant in a vector suitable for expression in monocotyledonous plants (i.e., under the control of the 35S promoter of the Cauliflower Mosaic Virus and 0-linker). hsp70 intron followed by a polyadenylation site of nopaline synthase as in Brown and Santino, U.S. Patent No. 5,424,412; 1995), vector pMON18469 was digested with Ncol and EcoRI. The largest vector band of approximately 4.6 kb was isolated after the electrophoresis of the digestion products through an agarose gel, purified and ligated with T4 DNA ligases to the approximately 2 kb Ncol-EcoRI fragment containing the gene v11231 (SEQ ID NO: 7). The ligation mixture was transformed into a useful laboratory strain of E. coli, and colonies resistant to carbenicillin were recovered. Plasmid DNA was recovered by minipreparation DNA procedures from subsequent nocturnal cultures of selected carbenicillin-resistant colonies in broth containing antibodies. This DNA was subjected to restriction endonuclease analysis with enzymes such as Ncol and EcoRI, Notl and PstI to identify clones containing the coding sequence of v11231 fused to the hsp70tron under the control of the improved CaMV35S promoter. The clones identified as such were designated pMON33708. To place the v11231 gene in a vector suitable for the recovery of stably transformed and insect resistant plants, the 3.75 kb Notl restriction fragment of pMON33708 containing the lysine oxidase coding sequence fused to the hsp70trontron under promoter control Improved CaMV35S was isolated and purified after extraction of an agarose gel. This fragment was ligated with pMON30460 treated with Notl and calf intestine alkaline phosphatase. pMON30460 contains the coding sequence of neomycin phosphotransferase under the control of the CaMV35S promoter. Kanamycin-resistant colonies were obtained by transforming this ligation mixture into E. coli and the colonies containing the appropriate band were identified by • f- ^ S ^ ^ ¿- digestion with restriction endonuclease and designated pMON33710. Restriction enzymes such as Notl, EcoRV, Hindlll, Ncol, EcoRI and BglII were used to identify the appropriate clones containing the NotI fragment of PMON33708 at the NotI site of pMON30460 (ie, pMON33710), in the orientation such that both genes they are in tandem (ie, the 3 'end of the expression cassette of v11231 is attached to the 5' end of the nptll expression cassette). Expression of the v11231 protein by pMON33710 in corn protoplasts was confirmed by electroporation of covalently closed circular plasmid DNA from pMON33710 into protoplasts, followed by protein blot and ELISA analysis. This vector can be introduced into the genomic DNA of corn embryos by bombarding with particle gun, followed by selection for paronomycin to obtain maize plants expressing the v11231 gene essentially as described in Brown and Santino, U.S. Pat. No. 5,424,412. In this example, the vector was introduced by cobombardy with a plasmid that confers hygromycin resistance on immature embryo scutes (IES) of corn, followed by hygromycin selection, and regeneration. Transgenic corn lines expressing the v11231 protein were identified by ELISA analysis determining both the presence and amount of protein v11231 present in each extract sample. The plants were planted and left to form seed. Progeny seeds were cured and planted to produce seedling maize plants that were subsequently tested for protection against feeding by & &8 & * áBP * »8 ** ^ * Diabrotica.

Yield of variant 11231 of Cry3Bb in plant Transformed maize plants expressing protein 11231 of variant Cry3Bb were exposed to larvae of the western rootworm of corn (WCR) in a test on seedlings and a test in 25.4 cm pots. The transformed genotype was A634, where the progeny of the RO x A634 cross were evaluated. Observations included the effect on larval development (weight), evaluation of root damage (RDR) and protein expression. The transformation vector containing the gene of variant Cry3Bb was pMON33710. The treatments included Positive and negative sopoblations for each event and a proof of A634. The test in seedlings consisted of the following steps: i) individual seeds were placed in 28.34 g cups containing soil for sowing in pots; ii) in the gleaning, each seedling was infested with 4 neonatal larvae; and iii) after the infestation, the seedlings were incubated for 7 days at 25 ° C, 50% relative humidity and photoperiod of 14 hours of light: 10 hours of darkness. Adequate moisture was added to the soil for sowing in pots during the incubation period to maintain the vigor of the seedlings. The test in 25.4 cm pots consisted of the following steps: i) individual seeds were placed in 25.4 cm pots containing soil for sowing in pots; ii) 14 days after planting, each pot was infested with 800 eggs that had been previously incubated, so hatching occurred 5 to 7 days after the infestation; and iii) after the infestation, the plants were incubated for 4 weeks under the same environmental conditions as the test in seedlings. The pots were irrigated daily throughout its surface. For the test in seedlings, the plants of day 7 were evaluated for root damage (table 1), and the surviving larvae were weighed. Also on this occasion, the concentrations of the Cry3Bb protein in the roots were determined by ELISA test.

TABLE 1 Root damage determination scale for seedling testing RDR 0 = no feeding was observed; 1 = very light feeding; 2 = light feeding; 3 = moderate feeding; 4 = strong feeding; 5 = very strong feeding. The results of the test on seedlings are shown in the table 2. Plants that expressed Cry3Bb protein were completely protected by WCR feeding, where the surviving larvae within this treatment had not grown. The average weights of the larvae varied from 2. 03-2.73 mg for non-expression treatments, where the average weight of the surviving larvae was 0.11 mg in the treatment of cry3Bb expression. The root damage scales were 3.86 and 0.33 for the isopopulations of no expression and expression, respectively. Survival of larvae was on the scale of 75-85% for the negative and inspection treatments, where only 25% of the larvae survived in the treatment with Cry3Bb. ^ * j »3 ^ * aMg TABLE 2 Effect of Cry3Bb expression plants on WCR larvae in a seedling test Root Larva Plants% Average + SD Event Treatment N (ppm) RDR + SD N Surv Weight (mg) 16 Negative 7 0.0 3.86 ± 0.65 21 75 2.7311.67 16 Positive 3 29.01 0.33 ± 0.45 3 25 0.11 ± 0.07 A634 Inspection 4 0.0 13 81 2.03 ± 0.83 For the 10-inch container test, the height of the plant was recorded after 4 weeks post-infestation and a scale of root damage was given (lowa scale 1-6; Hills and Peters, 1971; a method to evaluate treatments with insecticide after planting for the control of worm larvae of the western root, Journal of Economic Entomology 64: 764-765). The results of the 10-inch canister test are shown in Table 3. The plants expressing Cry3Bb protein had significantly lower feeding damage and were higher than non-expressing plants. Event 16, the highest of the two expression events provided almost complete control. Negative treatments had very high root damage scales indicating very high insect pressure. The average positive root damage scales were 3.4 and 2.2 for event 6 and 16, respectively. The average RDR for the negative treatment was 5.0 and 5.6. ? m? ^ m? ^^ k ^^ ¡^? 3asYes.

TABLE 3 Effect of Cry3Bb expressed in corn to control feeding of WCR larvae in a 10-inch container test Root Plant Event Treatment N (ppm) RDR ± SD Height (cm) 6 Negative 7 0.0 5.0 + 1.41 49.7 ± 18.72 6 Positive 5 7.0 3.4 ± 1.14 73.9 ± 8.67 16 Negative 5 0.0 5.6 ± 0.89 61.2 ± 7.75 16 Positive 5 55.0 2.2 ± 0.84 83.8 ± 27.15 In summary, maize plants expressing Cry3Bb protein have an important biological effect on the development of WCR larvae as observed in the seedling test. When challenged with very high infestation levels, plants expressing the Cry3Bb protein were protected from WCR larval feeding damage as illustrated in the 10-inch canister test.

EXAMPLE 3 Increased expression of a Cry3Bb protein in transgenic corn The expression of a Cry3Bb protein in transformed corn plants was compared with standard or preferred Cry3Bb expression vectors. Plants transformed with the improved vectors consistently demonstrated significantly higher levels of Cry3Bb when compared to plants transformed with the Cry3Bb vectors . ' &3UÉs # Z¡ ~ J ?? ß¡í. ? .- *. standards A standard Cry3Bb plant expression vector pMON33710 contains an expression cassette composed of an improved CaMV35S promoter sequence (P-CaMV.35S, SEQ ID NO: 29), an Hsp70 introns sequence of Zea mays (l-Zm.Hsp70 , SEQ ID NO: 33), a non-naturally occurring sequence encoding the v11231 protein of the Cry3Bb variant (Bt.cry3Bb.v11231, SEQ ID NO: 7) and nopaline synthase translation and polyadenylation sequence ( T-AGRtu.nos, SEQ ID NO: 34). Another standard Cry3Bb plant expression vector pMON33709 contains an expression cassette composed of a sequence improved CaMV35S promoter (P-CaMV.35S, SEQ ID NO: 29), a Hsp70 introns sequence of Zea mays (l-Zm.Hsp70, SEQ ID NO: 33), a CTP coding sequence of Zea mays (TS-Zm.rbc1, SEQ ID NO: 25), a sequence that occurs not naturally encoding the v11231 protein of the Cry3Bb variant (Bt.cry3Bb.v11231, SEQ ID NO: 7) and a Nopaline synthase translation and polyadenylation sequence (T-AGRtu.nos, SEQ ID NO: 34). The plant expression vector pMON25097 is improved as compared to pMON33710 as judged by the expression levels of Cry3Bb in plant, and contains an expression cassette comprising a promoter sequence of CaMV35S AS4 that occurs not Naturally (P-CaMV.AS4, SEQ ID NO: 30), a leaderless untranslated sequence of chlorophyll wheat A / B binding protein (L-Ta.hcb1, SEQ ID NO: 31), an introns sequence of rice actin (l-Os.Act1, SEQ ID NO: 32) and a sequence that occurs not naturally coding for the 11231mv1 protein (11098) variant Cry3Bb (Bt.cry3Bb.11231mv1, SEQ ID NO: 9) linked to a translation termination and polladenylation sequence of heat shock Hsp17 of wheat (T-Ta.Hsp17, SEQ ID NO: 35) . Another vector that is preferred is pMON25096, which contains an expression cassette (SEQ ID NO: 17) comprising a promoter sequence of CaMV35S AS4 occurring non-naturally (P-CaMV.AS4, SEQ ID NO: 30), a leader untranslated sequence of chlorophyll wheat A / B binding protein (L-Ta.hcb1, SEQ ID NO: 31), a sequence of rice actin introns (l-Os.Act1, SEQ ID NO: 32), a coding sequence for CTP of Zea mays (TS-Zm.rbd, SEQ ID NO: 25) and a sequence that occurs not naturally encoding the C31B1 variant protein 11231mv1 (Bt.cry3Bb.11231 mv1, SEQ ID NO: 9) linked to a translation termination and polyadenylation sequence of Hsp17 heat shock from wheat (T-Ta.Hsp17, SEQ ID NO: 35). All vectors contain an identical cassette attached to the Cry3Bb expression cassette that confers resistance to paromomycin to transformed plant tissue. This resistance cassette consists of an improved CaMV35S promoter sequence, and a neomycin phosphotransferase coding sequence linked to a nopaline synthase translation and polyadenylation sequence. Table 4 presents a summary of the standard and improved vectors. The transgenic corn plants resistant to paromycin were derived essentially as described in the patent of E.U.A. No. 5,424,412 (1995). gj? tt't ^ '% ^^^ C TABLE 4 Summary of plant expression vectors Corn leaf protoplasts were electroporated with standard vectors (pMON33709 or pMON33710) or improved vectors (pMON33722, pMON33723, pMON25097, pMON33741) as described (Sheen, Plant Cell 2: 1027-1038, 1990) and transient protein expression. Cry3Bb variant was compared using ELISA and Western Blot analysis methods. The ELISA used an IgG capture antibody purified by rabbit anti-Cry3B chromatography against Cry3B 11231, a sample of that antibody conjugated to alkaline phosphatase as the secondary detection antibody, and a purified native protein Cry3Bb as a parameter. Comparison of the ratio of Cry3Bb with levels of expression of neomycin phosphotransferase (Npt II) by ELISA indicated that approximately two-fold increases in the normalized expression levels of protein 11231 of variant Cry3Bb were obtained with improved vectors pMON33723 and pMON33722 in relation to the standard vectors pMON33710 and pMON33709, respectively (Expt.1, table 5). The differences in Cry3Bb expression are attributed directly to the improved expression cassette in the improved vectors rather than to the differences in protoplast electroporation efficiency since the expression of the Cry3Bb protein is normalized to Npt II produced by the linked ppfll gene identical present in all vectors. The improved vectors that are most preferred such as pMON25096, pMON25097 and pMON33741 expressed about 10-fold higher normalized levels of Cry3Bb and variant Cry3Bb protein than preferred improved vectors such as pMON33722 or pMON33723 (Table 5, Expt.2, 3). Finally, the equally preferred vectors pMON33741 and pMON25097 produced almost equivalent normalized Cry3Bb expression (Table 5, expt 4).

TABLE 5 Expression of Cry3Bb and transient Cry3Bb variant in corn leaf protoplasts (normalized to Nptll expression) Since the improved expression cassette in pMON2597 codes for the variant 11231mv1 (11098) of Cry3Bb, and that the standard cassette in pMON33710 codes for variant v11231 of Cry3Bb that are different by a single amino acid, the intrinsic immunoreactivity of the two proteins in ELISA test. Subsequent ELISA experiments with variant proteins v11231 and 11231 mv1 (11098) of Cry3Bb produced in and purified from B. thuringiensis indicate that the two proteins have similar immunoreactivity levels. Accordingly, the observed increase in the 11231mv1 (11098) protein levels of Cry3Bb produced from the expression cassette in pMON25097 is due to increased expression levels rather than a difference in immunoreactivity. Protein transfer analysis confirms that the increased level of cross-reactivity material produced in corn protoplasts from the improved Cry3Bb expression cassette in pMON25097 was due to the increased accumulation of a protein of approximately 60,000 Mr immunoreactive with Cry3B antiserum which also co-migrated with the 11231 variant protein of Cry3Bb produced in a recombinant cry-B. thuringiensis strain of pEG7174. Equally preferred and improved Cry3Bb variant protein expression cassettes in pMON33741 and pMON33748 encoding Cry3Bb.11231 also exhibit increased expression levels of Cry3Bb relative to the expression observed from the standard cassette in pMON33710. These results confirm that differences in expression are due to the improved compositions described herein, rather than differences in the intrinsic immunoreactivity of the different variants. Root tissue from transgenic plants in the Ro stage obtained independently after transformation with improved vectors (pMON33723, 25097) or with a standard vector (pMON33710) was subjected to quantitative analysis of Cry3Bb protein levels by means of a quantitative ELISA test . Comparison of the expression levels of Cry3Bb or Cry3Bb protein variant in maize plants transformed with improved vectors and standards show that the expression of the Cry3Bb11231 variant does not exceed 50 ppm in the standard pMON33710 transgenics, whereas the expression of Cry3Bb.11098 (11231mv1) in the improved pMON25097 transgenics is frequently higher than 50ppm (Table 6). Protein transfer analysis confirms that the Increased level of cross-reactivity material produced by pMON25097 (enhanced) was due to the increased accumulation of a protein of approximately Mr 60,000 that migrates with standard Cry3Bb of β. thuringiensis. Other improved Cry3Bb protein variant expression cassettes found in pMON33741 and 33748 also consistently produce select independently transformed events (ITE's) with Cry3Bb protein variant levels greater than 100 PPM, while 0 standard vectors have never originated ITE's with more than 50 PPM of Cry3Bb protein variant (table 7). High level expression is evident in the corn genotypes of both H99 and A634, indicating that the compositions described herein have wide utility for many varieties of commercially grown corn. Said lines of select high-expression Cry3 protein variants obtained with the vectors described herein are expected to be especially suitable for conferring high levels of insect damage protection and for reducing the incidence of insect resistance to proteins. Cry3 insecticides.

«Fc -ag 4.: TABLE 6 Comparison of Cry3Bb expression in transformed Rp corn with improved Cry3Bb protein variant expression cassettes Expression level of Cr 3Bb ppm TABLE 7 Expression of Cry3Bb in Rrj maize transformed with improved Cry3Bb protein variant expression cassettes Progeny derived from corn plants transformed into both standard cassettes (pMON33709 and pMON33710) and preferred »I > i < u ^ '(pMON25096, 25097, 33722, 33723, 33726, 33741 and 33748) expressing 10 ppm or more of the Cry3Bb protein were further tested for resistance to maize root worm (CRW) feeding resistance in bioassays based on greenhouse or growth chamber as previously described (English et al., WO 99/31248). Transgenic corn plants resistant to corn rootworm were obtained from essentially all the preferred vectors (Table 8). For example, the improved pMON25096 vector was used to generate 89 independently transformed events (ITE's), 14 independent pMON25096 Fi line offspring that express 10 ppm or more of Cry3Bb, and seven Fi line offs that display significant levels of resistance to CRW. (an RDR that averages> 3.5 on a graduation scale of 0-6). In contrast, we did not obtain a single event with a RDR average < 3.5 out of 12 of the progeny lines Fi of the standard pMON33710 cassette that expresses 10 PPM or more of the Cry3Bb protein variant. The failure to obtain lines resistant to CRW with any of the standard vectors (pMON33709 or pMON33710) was not due to insufficient numbers of ITE's since more than 300 ITE's of each of these two vectors were generated and analyzed for progeny F-? resistant to CRW. Much fewer ITE's were generated with preferred vectors such as pMON33722, pMON33723 and pMON25096, but all eventually gave rise to lines of Fi progeny Fi resistant to CRW.

TABLE 8 In the examples provided herein, experimental evidence is shown that substantially equivalent compositions based on the improvements described herein produce equivalent improvements in performance relative to the standards previously described. More specifically, it is demonstrated that the improved compositions coding for both the Cry3Bb.11098 and Cry3Bb.11231 variants produce both improved performance in equivalent form, relative to the standard compositions previously described coding for Cry3Bb.11231. It is then concluded that the use of other variants of Cry3Bb with specific biological activities that are greater than or equal to Cry3Bb.11098 or Cry3Bb.11231 is contemplated by and within the scope of this invention. For example, the improved vector compositions encoding Cry3Bb variants include 11231, 11084, 11098, 11247 and others as described in English et al., Applications of E.U.A. Nos. 08 / 993,170, 08 / 993,722, 08 / 993,755 and 08 / 996,441, all filed on December 18, 1997, can be derived from pMON25095 using standard mutagenesis procedures in a manner essentially equivalent to the construction of pMON33740.

EXAMPLE 4 Preferred expression cassettes confer resistance to damage by CRW in field tests Corn plants genetically modified to express variants of Cry3Bb protein derived from the preferred vectors pMON33722, pMON33723, pMON25096 and pMON25097 were evaluated in the field to verify control of corn rootworm, Diabrotica vergifera vergifera, LeConte (WCR). None of the corn plants transformed with the standard vectors were advanced to tests in field since none showed adequate control of corn rootworm in greenhouse tests (example 3, table 8). Efficacy tests were carried out at a Monsanto research farm in Jerseyville, Illinois and at the Northern Grain Insects Research Laboratory research station., USDA ARS in Brookings, South Dakota. These tests are used to evaluate the performance of the preferred cassettes in the field under strong insect pressure and to compare their performance with currently commercially available insecticides. 17 independent transformation events (ITE) were selected for field evaluation based on greenhouse yield. The amount of seeds available for field evaluation varied for each ITE. Of these 17 events, only seven were planted at the Brooklings research station. The field design for the Brooklings location was a randomized complete block (RCB) with 2 replications where each plot was a single row containing a maximum of 30 plants. All 17 ITE's were planted at the Jerseyville location, where the design was an RCB with a maximum of four replications, plots of one row each, where the number of replications depended on the available seeds of each ITE. Because of this, the number of replications in Jerseyville varied from two to four. Additional treatments included an untreated control (non-transgenic corn) and commercial insecticides, including Counter®, Lorsban® and Forcé®. The insecticide treatments were only done at the Jerseyville location. The insecticides were applied as a 20 cm band on the plantation using the recommended amounts. The planting dates were May 28 and June 3 for Jerseyville and Brooklings, respectively. The study was carried out as follows: plots with CRW eggs were infested in the plantation with 1, 600 eggs per row foot, approximately 800 eggs per plant. In the plant growth stage V1-V2, the plants were analyzed to verify the presence of Cry3Bb protein variant expression using an ELISA. The negative plants for the gene were extracted from the plot. At the end of the larval feeding stage of CRW, when maximum damage could have occurred, all remaining plants in each plot were evaluated to verify root feeding injury using a root damage score scale (RDR). 1 - 6 described by Hills and Peters (1971). The RDR scale is as follows: Root damage score: 1. There are no visible scars 2. Visible feeding scars, but no roots were pruned less than 4 cm from the stem 3. One or more nodal roots were pruned at 4 cm of the stem, but less than one knot was removed from the roots 4. A knot came out of the pruned roots 5. Two knots came out of the pruned roots 6. Three or more knots came out of the pruned roots on July 25 and August 3 the field tests were evaluated in Jerseyville and Brooklings, respectively. The average RDRs for all the treatments are illustrated in Table 9. Of the 17 ITE's evaluated, 16 ITE's controlled the feeding by CRW, <; 3.0 RDR. Two of the three chemical parameters had an RDR of less than 3.0. Forcé® had a root damage score of 3.2. except for one ITE, WCR20, all treatments were significantly better than controls (p <.01) but were not significantly different from each other. Figure one illustrates the difference in larval feeding damage between a transgenic plant resistant to CRW and an untreated control. Even though the ITE's were not significantly different from the chemical parameters with respect to the root damage score, the amount of feed injury observed in roots of the insecticide treatments was higher than in the roots that express the gene property of Monsanto. The lack of difference between the root damage graduation is an artifact of the root graduation scale, where this scale is married to the "pruned" roots. Hills and Peters describe a pruned root as less than 4 cm in length due to the feeding of CRW. Therefore, the root masses without a "pruned" root but with visible feeding scars are given a score of 2. The roots outside the protection zone of the insecticide treatments had much more scars from feeding and in In most cases the tips of the roots were destroyed compared to the ITE's. Unlike insecticide treatments, transgenic plants express the CRW-resistant gene along the entire root mass. However, because the control mechanism of the transgenic plant is mediated orally, a minimum amount of feeding is required to control any additional injury by the CRW larvae. This minimum feed requirement resulted in an RDR of 2. In summary, corn plants expressing Cry3Bb protein variants were completely protected against feeding by CRW larvae. This level of protection eliminates the need for an insecticide treatment. Insecticides, including organophosphates, crbamates and pyrethroids, are incorporated into the soil on more than 16 million acres of corn annually to control CRW. The CRW resistance technology has the potential to significantly reduce the current level of exposure of these insecticides to the environment. The benefits of switching from soil insecticides to a transgenic approach are impressive and include a reduction in potential human health and safety risks, reduced direct impacts on non-target organisms, reduced surface contamination and onshore water supplies, diminished problems for the disposal of insecticide containers and general compatibility with other agricultural and pest management programs.

TABLE 9 Means of damage by root feeding of corn rootworm (RDR) for corn-independent transformation events containing Monsanto-owned CRW-resistant gene EXAMPLE 5 Transformation of tobacco chloroplast with a c 3B gene Recombinant plants can be produced in which only mitochondria or chloroplast DNA has been altered to incorporate the molecules mentioned in this application. Promoters that function in chloroplasts have been known in the art (Hanley-Bowden et al., Trends in Biochemical Sciences 12: 67-70, 1987). The methods and compositions for obtaining cells containing chloroplasts in which DNA has been inserted Heterologous have been described, for example, by Daniell et al., (U.S. Patent No. 5,693,507; 1997) and Maliga et al., (U.S. Patent No. 5,451, 513, 1995). A vector can be constructed that contains an expression cassette from which a Cry3B protein can be produced. A cassette could contain a chloroplast-operable promoter sequence that drives the expression of a cry3B crystal protein gene, constructed in almost the same manner as the other polynucleotides of the present, using thermal amplification, restriction endonuclease digestion and ligation methodologies, etc. A chloroplast-expressible gene could provide a promoter and a 5 'untranslated region of a heterologous gene or chloroplast gene such as psoA, which would provide the transcription and translation of a DNA sequence that would code for a Cry3B protein in the chloroplast; a DNA sequence encoding Cry3B protein and a transcription or translation termination region such as a 3 'inverted repeat region of a ,, 4, "^" chloroplast gene that could stabilize an expressed cry3B mRNA. Expression from the interior of the chloroplast would improve the accumulation of the cry3B gene product. A host cell containing chloroplasts or plastids can be transformed with the expression cassette and then the resulting cell containing the transformed chloroplasts can be cultured to express the Cry3B protein. A cassette may also include an antibiotic, herbicide tolerance or other eligible marker gene in addition to the c / y3B gene. The expression cassette can be flanked by DNA sequences obtained from a chloroplast DNA, which could facilitate the stable integration of the expression cassette into the chloroplast genome, particularly by homologous recombination. Alternatively, the expression cassette may not integrate, but by including an origin of replication obtained from a chloroplast DNA, it would be capable of providing replication of the heterologous c / y3B gene in the chloroplast. The plants can be generated from cells containing transformed chloroplasts and can then be grown to produce seeds, from which additional plants can be generated. These transformation methods are better than the transformation of the nuclear genome, particularly when chloroplast transformation is carried out by integration into the chloroplast genome, because the chloroplast genes are generally inherited matemally. This provides environmentally safer transgenic plants, virtually eliminating the possibility of escapes into the environment. In addition, chloroplasts can be transformed several times to produce functional chloroplast genomes expressing several desired recombinant proteins, while nuclear genomic transformation has been shown to be quite limited when several genes are desired. Segregative events using the chloroplast or plastid transformation are thus avoided. Unlike expression of the nuclear genome, expression in chloroplasts or plastids can be initiated from only one promoter and continue through a polycistronic region to produce several peptides from a single mRNA. The expression cassette would be produced in much the same way that other vectors of plant transformation are constructed. DNA sequences operable in plant chloroplast can be inserted into a bacterial plasmid and linked to DNA sequences expressing desired gene products, such as Cry3B proteins, for the Cry3B protein to be produced in the chloroplast, obviating the need for nuclear gene regulation, end blocking, cutting or polyadenylation of nuclear regulated genes, or chloroplast or plastid targeting sequences. An expression cassette comprising a c / 3B gene, whether constructed synthetically or a native gene derived directly from a B. thuringiensis genome or an episomal element from B. thuringiensis, would be inserted into a restriction site in a vector constructed for the purpose of transformation of the chloroplast or plastid. The cassette would be flanked towards the 5 'end by a chloroplast or plastid functional promoter and towards the 3' end by a functional transcription and transcription termination sequence in chloroplast or plastid. The resulting cassette would be incorporated into the chloroplast or plastid genome using well known homologous recombination methods. Alternatively, the transformation of the chloroplast or plastid could be obtained using an autonomously replicating plasmid or another vector capable of propagation within the chloroplast or plastid. One means to effect this method would be to utilize a portion of the chloroplast or plastid genome necessary for the initiation of the repolcation of the chloroplast or plastid as a means to maintain the plasmid or vector in the transformed chloroplast or plastid. A sequence that makes possible the stable replication of an epigenetic element of chloroplast or plastid could easily be identified from the random cloning of a chloroplast or plastid genome in a standard bacterial vector that also contains a chloroplast or plastid-eligible marker gene, followed by the transformation of chloroplasts or plastids and the selection of transformed cells in a suitable selection medium. The introduction of an expression cassette as described herein into an epigenetic element replicable in chloroplast or plastid would thus provide an effective means to localize a d-endotoxin of B. thuringiensis Cry3B to the chloroplast or plastid.

EXAMPLE 6 Direction of Cry3Bb or Cry3Bb protein variant to plastids Improved expression by directing recombinant insecticidal protein to the chloroplast could result in tissues that are exposed to light and which will accumulate mature chloroplasts as a result. Improving expression in leaf tissue to inhibit foliar feeding pests susceptible to the insecticidal protein would be advantageous. To test this, two plasmids, pMON33709 and pMON33710, were constructed, which were isogenic with respect to all elements except for a plastid or chloroplast targeting sequence bound in frame to the improved Cry3Bb insecticide variant in pMON33709. Ro corn plants were recovered and were shown to contain and express the transgene by ELISA. Six lines pMON33709 and sixteen lines pMON33710 that expressed the transgene both in the root and in the leaves were recovered. Leaf and root tissue was recovered and analyzed to verify the presence and amount of Cry3Bb variant protein, measured in parts per million. The results are shown in table 10.

TABLE 10 Comparison of the expression in leaf vs non-directed and plastid-directed root of variant v1 231 of Cry3Bb in corn transformation events R0 »^ KS * j > * ~~? - ".

All but one line pMON33709 (Ro53643) produced between 3 to 15 times more insecticidal protein in the leaves than in the root tissue. The line that produced less in the leaves also produced less than 1 ppm in the root, while the other lines produced up to almost 100 ppm in the leaves. The amount of Cry3Bb variant protein expressed was even more variable in the non-directed lines derived from transformation events of pMON33710 that were determined to express the recombinant protein in both leaf and root tissues. Although most of these lines produced more protein in leaves than in roots, some also produced more in roots, but the difference between the amount produced in the roots in those improved root exprestors was less substantial than in the only event directed to pMON33709 . Similarly, the scale of expression levels was less pronounced in non-directed events with one exception.

Surprisingly, one line (Ro53904) produced substantially more protein in the leaves than observed in any other line, directed or non-directed. It would be expected that this line would be a candidate for a commercial line aimed at protecting against coleopteran pests that feed on leaf tissues. Conversely, lines such as Ro53923 would be expected to be optimal candidates for the protection of maize plants against root-feeding pests such as corn rootworms. The data indicate in summary that the direction of the Ct3B protein from Bt to the plastid or chloroplast improves the accumulation of the protein in leaf tissue, but not in root tissue, and improves the general expression of the protein in leaves of plants transformed with such constructions compared to the expression levels observed in root tissues in those same plants. In view of the foregoing, it will be noted that the various advantages of the invention are achieved and that other suitable results are obtained. Since several changes can be made to the above methods and compositions without departing from the scope of the invention, it is intended that all of the material contained in the above description and shown in the accompanying drawings be construed as illustrative and not in a limiting sense. In addition, all references mentioned in this application are incorporated herein by reference in their entirety.

LIST OF SEQUENCES < 110 > Romano, Charles P. < 120 > Increased expression of Cry3Bb in corn < 130 > 38-21 (15304) Increased expression of Cry3Bb in corn < 140 > unknown 10 < 141 > 1999-08-18 < 150 60 / 097,150 < 151 > 1998-08-19 < 160 > 43 < 170 > Patentln Ver. 2.0 < 210 > 1 20 < 211 > 1959 < 212 > DNA < 213 > Bacillus thuringiensis & em? & eaBiii? ** ^ ¡^^? faith * < 220 > < 221 > CDS < 222 > (1) .. (1956) < 220 > < 223 > Description of Artificial Sequence: naturally occurring nucleotide sequence that codes for an amino acid sequence Cry3Bb1 Are you, J & amp; amp; amp; amp? Amp? & ih \ < 400 > 1 atg aat cea aac aat cga agt gaa cat gat acg ata aag gtt here cct 48 Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr lie Lys Val Thr Pro 1 May 10 15 aac agt gaa ttg caa act aac cat aat caa tat cct tta gct gac aat 96 Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn 20 25 30 cea aat tea here cta gaa gata tta aat tat aaa gaa ttt tta aga atg 144 Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40 45 act gaa gac agt tet acg gaa gtg cta gac aac aaa gat gta tet here Glu Asp Thr 192 Thr Ser Ser Glu Asp Asn Ser Val Leu Thr Val Asp Lys gtt gca ggg gga att ac gtt gta ggg cag tet att tta gta gtt ggt 240 Ala Val Gly Thr Gly He Ser Val Val Gly Gln I Leu Gly Val Val 65 70 75 80 GGA GTT cea TTT GCT GGG GCA etc Act tea ttt tat caá tea ttt ctt 288 Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Be Phe Leu 85 90 95 10 aac act ata fc99 ca a9t 9at 9ct 9ac cca t99 aa99ct: t at99c 336 Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met Wing 100 105 110 ca gtt gaa gta ctg ata gat aag aaa ata gag gag tat gct aaa agt 384 Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys Ser 115 120 125 aaa gct ctt gca gag tta cag ggt ctt caa aat aat ttc gaa gat tat 432 Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr 130 135 140 gtt aat gcg tta aat tec tgg aag aaa cct tta agt ttg cga agt 480 val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser 145 150 155 160 aaa aga age caga gat cga ata agg gaa ctt ttt tet caa gca gaa agt 528 Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Ala Glu Ser 165 170 175 cat ttt cgt aat tec atg ccg tea ttt gca gtt tec aaa ttc gaa gtg 576 His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu Val 180 185 190 ctg ttt cta cca here tat gca ca gct gca aat here cat tta ttg cta 624 Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu Leu 195 200 205 20 tta aaa 9at 9ct caa 9tfc ttfc 99a 9aa 9aa 99 993 tat tet tea gaa 672 Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu 210 215 220 ~ "- J r .. '' $ e & ¿& * le ^ u £ ~ gat GTT GCT gaa ttt tat cat aga caá TTA aaa ctt here caá caá tac 720 Asp Val Ala Glu Phe Tyr His Arg Gln Leu Lys? Leu Thr Gln Gln Tyr 225 230 235 240 act gac cat tgt gtt aat tgg tat aat gtt gga tta aat ggt tta aga 768 Thr Asp Hxs Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245 250 255 ggt tea act tat gat gca tgg gtc aaa ttt aac cgt ttt cgc aga gaa 816 Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg Glu 260 265 270 atg act tta act gta tta gat cta att gta ctt ttc cca ttt tat gat 864 Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp 275 280 285 att cgg tta tac tea aaa ggg gtt aaa here gaa cta here aga gac att 912 He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He 290 295 300 ttt acg gat cca att ttt tea ctt aat act ctt cag gag tat gga cca 960 Phe Thr Asp Pro He Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro 305 310 315 320 act ttt ttg agt ata gaa aac tet att cga aaa cct cat tta ttt gat 1008 Thr Phe L eu Ser I Glu Asn Ser've Arg Lys Pro His Leu Phe Asp 325 330 335 tat tta cag ggg att gaa ttt cat ACG CGT ctt caá cct GGT tac ttt 1056 Tyr Leu Gln Gly I Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Phe 340 345 350 ggg aaa gat tet ttc aat tat tgg tet ggt aat tat gta gaa act aga 1104 Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355 360 365 cct agt ata gga tet agt aag here att act tec cca ttt tat gga gat 1152 Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp 370 375 380 aaa tet act gaa cct gta caa aag cta age ttt gat gga caa aaa gtt 1200 Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val 385 390 395 400 tat cga act ata gct aat here gac gta gcg gct tgg ccg aat ggt aag 1248 Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys 405 410 415 gta tat tta ggt gtt acg aaa gtt gat ttt agt ca ta tat gat gat ca 1296 Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln 420 425 430 aaa aat gaa act agat here ca tat tat aa aat aat a ggc 1344 Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly 435 440 445 cat gta agt gca cag gat tet att gac cata tta ccg cca gaa here 1392 His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr Thr 450 455 460 gat gaa cca ctt gaa aaa gca tat agt cat cag ctt aat tac gcg gaa 1440 Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala Glu 465 470 475 480 tgt ttc tta atg cag gac cgt cgt gga here att cca ttt ttt act tgg 1488 Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp 485 490 495 here cat aga agt gta gac ttt ttt aat here att gat gct gaa aag att 1536 Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys He 500 505 510 act ca ctt cca gta gtg aaa gca tat gcc ttg tet tea ggt gct tec 1584 Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing Ser 515 520 525 att att gaa ggt cca gga ttc here gga gga aat tta cta ttc cta aaa 1632 He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530 535 540 gaa tet agt aat tea att gct aaa ttt aaa gtt here tta aat tea gca 1680 Glu Being Ser Asn Being He Wing Lys Phe Lys Val Thr Leu Asn Being Wing 545 550 555 560 gcc ttg tta caga cga tat cgt gta aga ata cgc tat gct tet acc act 1728 Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr Thr 565 570 575 aac tta c9a ctt ttt 9t9 c at tca aac at 9at ttt ctt gtc ate 1776 Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val He 580 585 590 tac att aat aaa act atg aat a gat gatta tta here tat caa here 1824 Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln Thr 595 600 605 ttt gat etc gca act act aat tet aat atg ggg ttc tcg ggt gat aag 1872 Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp Lys 610 615 620 aat gaa ctt ata ata gga gca gaa tet ttc gtt tet aat gaa aaa ate 1920 Asn Glu Leu He He Gly Ala Glu Ser Phe Val Ser Asn Glu Lys He 625 630 635 640 tat ata gat aag ata gaa ttt ate cca gta caa ttg taa 1959 Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 2 < 211 > 652 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 2 Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr Pro i 5 10 15 Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn 20 25 30 Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40 45 Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp 50 55 60 Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val Val 65 70 75 80 Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu 85 90 95 Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met Wing 100 105 110 Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys Ser 115 120 125 Lys Wing Leu Wing Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr 130 135 140 Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser 145 150 155 160 Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu Ser 165 170 175 His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu Val 180 185 190 Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu Leu 195 200 205 L eu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu 210 215 220 Asp Val Ala Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr 225 230 235 240 Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245 250 255 Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg Glu 260 265 270 Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp 275 280 285 He Arg Leu Tyr Be Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He 290 295 300 Phe Thr Asp Pro He Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro 305 310 315 320 Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe Asp 325 330 335 Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Phe 340 345 350 Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355 360 365 Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp 370 375 380 Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val 385 390 395 400 Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys 405 410 415 Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln _ 420 425 430 Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly 435 440 445 His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr Thr 450 455 460 Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Ala Glu 465 470 475 480 Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp 485 490 495 0 Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys He 500 505 510 Thr Gln Leu Pro Val Val Lys Wing Tyr Ala Leu Ser Ser Gly Wing Ser 515 520 525 He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530 535 540 Glu Be Ser Asn Be He Wing Lys Phe Lys Val Thr Leu Asn Ser Wing 545 550 555 560 Wing Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Wing Ser Thr Thr 565 570 575 5 Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val He 580 585 590 Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln Thr 595 600 605 Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Lys 610 615 620 Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys He 625 630 635 640 0 tr Ile AsP LYS Ile G ^ u phe He Pro Val Gln Leu 645 65 0 «Ja &sjüi,» »5¡Kfe» afl? Fc8 & iBi. 'suJ. - - - *. . .w »< 210 > 3 < 211 > 1959 < 212 > DNA < 213 > Bacillus thuringiensis < 220 > < 221 > CDS < 222 > (1) .. (1956) < 223 > naturally occurring nucleic acid sequence encoding an amino acid sequence Cry3Bb2 < 400 > 3 atg aat cca aac aat cga agt gaa cat gat acg ata aag gtt here cct 48 Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr Pro 1 5 10 15 aac agt gaa ttg cca act aac cat aat caa tat cct tta gct gac aat 96 Asn Ser Glu Leu Pro Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn 20 25 30 cca aat tcg here cta gaa gata tta aat tat aaa gaa ttt tta aga atg 144 Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40 45 act gaa gac agt tet acg gaa gtg cta gac aac tet here gta aaa gat 192 Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr val Lys Asp 50 55 60 gca gtt ggg here gga att tet gtt gta ggg cag att tta ggt gtt gta 240 Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val Val 65 70 75 80 gga gtt cca ttt gct ggg gca etc act tea ttt tat caa tea ttt ctt 288 Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu 85 90 95 gac act ata tgg cca agt gat gct gac cca tgg aag gct ttt atg gca 336 Asp Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met Wing 100 105 110 caa gtt gaa gta ctg ata gat aag aaa ata gag gag tat gct aaa agt 384 Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys Ser 115 120 125 aaa gct ctt gca gag tta cag ggt ctt caa aat aat ttc gaa gat tat 432 Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr 130 135 140 gtt aat gcg tta aat tec tgg aag aaa cct tta agt ttg cga agt 480 Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser 145 15 0 155 160 aaa aga age caa gat cga ata agg gaa ctt ttt tet caa gca gaa agt 528 Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Ala Glu Ser 165 170 175 cat ttt cgt aat tec atg ccg tea ttt gca gtt tec aaa ttc gaa gtg 576 His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu Val 180 185 190 -r ^^ m UJJIA. ctg ttt cta cca here tat gca caa gct gca aat here cat tta ttg cta 624 Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu Leu 195 200 205 tta aaa gat gct caa gtt ttt gga gaa gag tgg gga tat tet tea gaa 672 Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu 210 215 220 gat gtt gct gaa ttt tat cat aga caa tta aaa ctt acta caa caa tac 720 Asp Val Ala Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr 225 230 235 240 act gac cat tgt gtc aat tgg tat aat gtt gga tta aat ggt tta aga 768 Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245 250 255 ggt tea act tat gat gca tgg gtc aaa ttt aac cgt ttt cgc aga gaa 816 Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg Glu 260 265 270 atg act tta act gta tta gat cta att gta ctt ttc cca ttt tat gat 864 Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp 275 280 285 gtt cgg tta tac tea aaa ggt gtt aaa here gaa cta here aga gac att 912 10 Val Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He 290 295 300 ttt acg gat cca att ttt tea etc aat act ctt cag gag tat gga cca 960 Phe Thr Asp Pro He Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro 305 310 315 320 act ttt ttg agt ata gaa aac tet att cga aaa cct cat tta ttt gat 1008 Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe Asp 325 330 335 tat tta cag ggt att gaa ttt cat acg cgt ctt caa cct ggt tac tet 1056 Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Ser 340 345 350 ggg aaa gat tet ttc aat tat tgg tet ggt aat tat gta gaa act aga 1104 Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355 360 365 cct agt ata gga tet agt aag here act tec cca ttt tat gga gat 1152 Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp 370 375 380 aaa tet act gaa cct gta caa aag tta age ttt gat gga caa aaa gtt 1200 Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val 385 390 395 400 tat cga act ata gct aat here gac gta gcg gct tgg ccg aat ggc aag 1248 Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys 405 410 415 ata tat ttt ggt gtt acg aaa gtt gat ttt agt caa tat gat gat caa 1296 He Tyr Phe Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln 420 425 430 ~ t £ susSaU & VHS * ?? *, «Li« »- and» .a »¿8»% a > # ~. «. aaa aat gaa act agt here caa tat gat tea aaa aga aac aat ggc 1344 Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly 435 440 445 cat gta ggt gca cag gat tet att gac caa tta cca cca gaa here 1392 His Val Gly Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr Thr 450 455 460 gat gaa cca ctt gaa aaa gca tat agt cat cag ctt aat tac gcg gaa 1440 Asp Glu Pro Leu Glu Lys Wing Tyr Ser H s Gln Leu Asn Tyr Ala Glu 465 470 475 480 tgt ttc tta atg cag gac cgt cgt gga here att cca ttt ttt act tgg 1488 Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp 485 490 495 here cat aga agt gta gac ttt ttt aat here att gat gct gaa aag att 1536 Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Ala Glu Lys He 500 505 510 act caa ctt cca gta gtg aaa gca tat gcc ttg tet tea ggt gct tec 1584 Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing Ser 515 520 525"| 0 at att gaa ggt cca gga ttc ac gga aat tta cta tta cta aaa 1632 He He Glu Gly Pro Gly Phe Thr Gl and Gly Asn Leu Leu Phe Leu Lys 530 535 540 gaa tet agt aat tea att gct aaa ttt aaa gtt ac tta aat tea gca 1680 Glu Ser Ser Asn Ser Wing Lys Phe Lys Val Thr Leu Asn Ser Wing 545 550 555 560 gcc ttg tta caa cga tat cgt gta aga ata cgc tat gct tet acc act 1728 Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr Thr 565 570 575 aac tta cga ctt ttt gtg caa aat tea aac aat gat ttt att gtc ate 1776 Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe He Val 15 580 585 590 tac att aat aaa act atg aat gat gattata here tat here 1824 Tyr He Asn Lys Thr Met Asn He Asp Asp Asp Leu Thr Tyr Gln Thr 595 600 605 ttt gat etc gca act act aat tet aat atg ggg ttc tcg ggt gat acg 1872 Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Thr 610 615 620 aat gaa ctt ata ata gga gca gaa tet ttc gtt tet aat gaa aaa ate 1920 Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys He 625 630 635 640 20 tat ata gat aag ata gaa ttt ate cca gta caa ttg taa 1959 Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 4 < 211 > 652 < 212 > PRT < 213 > Bacillus thuringiensis < 400 > 4 Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr Pro 1 5 10 15 Asn Ser Glu Leu Pro Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn 20 25 30 Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40 45 Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp 50 55 60 Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val Val 65 70 75 80 Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu 85 90 95 Asp Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met Wing 100 105 110 Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys Ser 115 120 125 10 Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr 130 135 140 Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser 145 150 155 160 Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu Ser 165 170 175 His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu Val 180 185 190 Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu Leu 195 200 205 Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu 210 215 220 Asp Val Wing Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr 225 230 235 240 Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245 250 255 Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg Glu 260 265 270 20 Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp 275 280 285 Val Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He 290 295 300 Phe Thr Asp Pro He Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro 305 310 315 320 - ^ te ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe Asp 325 330 335 Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Ser 340 345 350 Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355 360 365 Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp 370 375 380 Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val 385 390 395 400 Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys 405 410 415 He Tyr Phe Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln 420 425 430 Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly 435 440 445 His Va G1y Ala Gln ASP Ser Ile ASP Gln Leu pro Pr ° Glu thr thr 450 455 460 Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing Glu 465 470 475 480 Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp 485 490 495 Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Ala Glu Lys He 500 505 510 Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala Ser 515 520 525 He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530 535 540 Glu Ser Ser Asn Ser He Wing Lys Phe Lys Val Thr Leu Asn Ser Wing 545 550 555 560 Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr Thr 565 570 575 Asn Leu Arg Leu Phe Val Gln Asn As Asn Asn Asp Phe He Val He 580 585 590 tyr I ^ e Asn LYS thr Met Asn Ile ASP ASP ASP Leu thr tyr Gln thr 595 600 605 Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Thr 610 615 620 Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys He 625 630 635 640 Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 5 < 211 > 1962 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of Artificial Sequence: nucleotide sequence that does not occur naturally or synthetically encoding an amino acid sequence of Cry3Bb < 220 > < 221 > CDS < 222 > (1) .. (1956) < 400 > 5 atg aac cct aac aat cgt tec gaa falls gac acc ate aag gtt act cca 48 Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr Pro 1 5 October 15 aac tet gag ttg caa act aat falls aac cag tac cca ttg gct gac aat 96 Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn 20 25 30 cct aac agt act ctt gag gaa ctt aac tac aag gag ttt etc cgg atg 144 Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40 45 acc gaa gat age tec act gag gtt etc gat aac tet here gtg aag gac 192 Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp 50 55 60 gct gtt gga act ggc att age gtt gtg gga cag att ctt gga gtg gtt 240 Ala Val Gly Thr Gly He Ser Val Val Gly Gln I Leu Gly Val Val 65 70 75 80 GGT GTT cca ttc GCT GGA GCT ttg acc age ttc tac cag tec ttt etc 288 Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Be Phe Leu 85 90 95 aac acc ate tgg cct tea gat gct gat ccc tgg aag gct ttc atg gcc 336 Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met Wing 100 105 110 caa gtg gaa gtc ttg ate gat aag aag ate gaa gag tat gcc aag tet 384 Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys Ser 115 120 125 aaa gcc ttg gct gag ttg caa ggt ttg cag aac aac ttc gag gat tac 432 Lys Ala Leu Ala Glu Leu Gln G1 and Leu Gln Asn Asn phe G or ASP tyr 130 135 140 gtc aac gca etc aac age tgg aag aaa act ccc ttg agt etc agg tet 480 Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser 145 150 155 160 aag cgt tec cag gac cgt att cgt gaa ctt ttc age caa gcc gaa tec 528 Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Ala Glu Ser 165 170 175 faith "ttc aga RI- ^ falls tec aac atg cct ttt gcc gtt age ttc gag gtg aag tet 576 His Phe Arg Asn Ser Met Phe Ser Pro Ala Val Phe Ser Lys Val Glu 180 185 190 ttc ttg cca etc tac gca caa gct here gcc aac act cat etc ttg ctt 624 Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu Leu 195 200 205 etc aaa gac gct cag gtg ttt ggt gag gag tgg ggt tac tec agt gaa 672 Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Glu 210 215 220 gat gtt gcc gag ttc tac cat agg cag etc aag ttg act caa cag tac 720 Asp Val Wing Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr 225 230 235 240 here gac falls tgc gtc aac tgg tac aac gtt ggg etc aat ggt ctt aga 768 Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245 250 255 gga tet acc tac gac gca tgg gtg aag ttc aac agg ttt cgt aga gag 816 Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg Glu 260 265 270 atg acc ttg act gtg etc gat ctt ate gtt etc ttt cca tcc tac gac 864 Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp 275 280 285 att cgt ctt tac tec aaa ggc gtt aag here gag ctg acc aga gac ate 912 He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He 290 295 300 ttc acc gat ccc ate ttc tea ctt aac acc ctg cag gaa tac ggt cca 960 Phe Thr Asp Pro He Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro 305 310 315 320 act ttt etc tec att gag aac age ate agg aag cct drops etc tcc gac 1008 Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe Asp 325 330 335 tat ctg caa ggc att gag ttt falls acc agg ttg caa cct ggt tac ttc 1056 Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Phe 340 345 350 ggt aag gat tec ttc aac tac tgg age gga aac tac gtt gaa acc aga 1104 Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355 360 365 cea tec ate gga tet age aag acc ate act tet cca ttc tac ggt gac 1152 Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp 370 375 380 aag age act gag cca gtg cag aag ttg age ttc gat ggg cag aag gtg 1200 Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val 385 390 395 400 tat aga acc ate gcc aat acc gat gtt gct gct tgg cct aat ggc aag 1248 Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys 405 410 415 gtc tac ctt gga gtt act aaa gtg gac ttc tec caa tac gac gat cag 1296 Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln 420 425 430 aaag aac gag here tet act a ct aac ag ag aac ag g aac g gc 1344 Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly 435 440 445 cat gtt tec gca caa gac tec att gac caa ctt cca cca gact acc act 1392 His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr Thr 450 455 460 gat gaa cca ttg gag aag gct tac agt falls caa ctt aac tac gcc gaa 1440 Asp Glu Pro Leu Glu Lys Ala Tyr Ser H s Gln Leu Asn Tyr Ala Glu 465 470 475 480 tgc ttt etc atg caa gac agg cgt ggc acc att ccg ttc ttt here tgg 1488 Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp 485 490 495 act falls agg tet gtc gac ttc ttt aac act ate gac gct gag aag att 1536 Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Ala Glu Lys He 500 505 510 acc ata ctt ccc gtg gtc aag gct tat gcc ttg tec age gga tec 1584 Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala Ser 515 520 525 ate att gaa ggt cca ggc ttc acc ggt ggc aac ttg etc ttc ctt aag 1632 He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530 535 540 gag tec age aac tec ate gcc aag ttc aaa gtg here ctt aac tea gca 1680 Glu Ser S er Asn Ser He Wing Lys Phe Lys Val Thr Leu Asn Ser Wing 545 550 555 560 gcc ttg etc caa cgt tac agg gtt cgt ate aga tac gca age act acc 1728 Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr Thr 565 570 575 aat ctt cgc etc ttt gtc cag aac age aac aat gat ttc ctt gtc ate 1776 Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val He 580 585 590 tac ate aac aag aac aac aaa gac gat gac etc acc tac aac here 1824 Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Asn Thr 595 600 605 ttc gat ctt gcc act acc aat agt aac atga gga ttc tet ggt gac aag 1872 Phe Asp Leu Wing Thr Thr Asn Being As Met Met Gly Phe Being Gly Asp Lys 610 615 620 aac gag ctg ate ata ggt gct gag age ttt gtc tet aat gag aag att 1920 Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys He 625 630 635 640 tac ata gac aag ate gag ttc att cca gtt caa etc taatag 1962 Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 <; 210 > 6 < 211 > 652 < 212 > PRT < 213 > Artificial Sequence < 400 > 6 Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr Pro 1 5 10 15 Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn 20 25 30 Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40 45 Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp 50 55 60 Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val Val 65 70 75 80 Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu 85 90 95 Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met Wing 100 105 110 Gln val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Wing Lys Ser 115 120 125 Lys Ala Leu Wing Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr 130 135 140 Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser 145 150 155 160 Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu Ser 165 170 175 His Phe Arg Asn Ser Met Pro Be Phe Wing Val Ser Lys Phe Glu Val 180 185 190 Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu Leu 195 200 205 Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu 210 215 220 Asp Val Wing Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr 225 230 235 240 Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245 250 255 Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg Glu 260 265 270 Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp 275 280 285 He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He 290 295 300 Phe Thr Asp Pro He Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro 305 310 315 320 Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe Asp 325 330 335 Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Phe 340 345 350 Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355 360 365 Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp 370 375 380 Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val 385 390 395 400 Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys 405 410 415 Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln 420 425 430 Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly 435 440 445 His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr Thr 450 455 460 Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing Glu 465 470 475 480 Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp 485 490 495 Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys He 500 505 510 15 Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing Ser 515 520 525 He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530 535 540 Glu Being Ser Asn Being He Wing Lys Phe Lys Val Thr Leu Asn Being Wing 545 550 555 560 Wing Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr Thr 565 570 575 Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val He 580 585 590 Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Asn Thr 595 600 605 Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Lys 610 615 620 Asn Glu Leu He He Gly Wing Glu Be Phe Val Ser Asn Glu Lys He 625 630 635 640 Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 7 < 211 > 1989 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: nucleotide sequence that does not occur naturally that codes for a variant amino acid sequence Cry3Bb vll231 < 220 > < 221 > CDS < 222 > (3) .. (1961) < 223 > Coding sequence for amino acid sequence Cry3Bb variant vll231 < 400 > 7 ce atg gca aac cct aac aat c gt tec gaa cae gac acc ate aag gtt 47 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val 1 5 10 15 act cca aac tet gag ttg caa act aat falls aac cca tc tc gct 95 Thr Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Ala 20 25 30 gac aat cct aac agt act ctt gag gaa ctt aac tac aag gag ttt etc 143 Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu 35 40 45 cgg atg acc gaa gat age tec act gag gtt etc gat aac tet here gtg 191 Arg Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val 50 55 60 aag gac gct gtt gga act ggc att age gtt gtg gga cag att ctt gga 239 Lys Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly 65 70 75 gtg gtt gtt ctc gt ct gct ggt gct gt ttg acc age ttc tac cag tec 287 Val Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser 80 85 90 95 ttt etc aac acc ate tgg cct tea gat gct gat ccc tgg aag gct ttc 335 Phe Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe 100 105 110 atg gcc caa gtg gaa gtc ttg ate gat aag aag ate gaa gag tat gcc 383 Met Ala Gln Val Glu Val Leu He Asp Lys He Glu Glu Tyr Ala 115 120 125 aag tet aaa gcc ttg gct gag ttg caa ggt ttg cag aac aac ttc gag 431 Lys Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu 130 135 140 gat tac gtc aac gca etc aac age tgg aag aaa act ccc ttg agt etc 479 Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu 145 150 155 agg tet aag cgt tec cag gac cgt att cgt gaa ctt ttc age caa gcc 527 Arg Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing 160 165 170 175 gaa tec falls ttc aga aac tec atg cct age ttt gcc gtt tet aag ttc 575 Glu Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe 180 185 190 gag gtg etc ttc ttg cca here tac gca caa gct gcc aac act cat etc 623 Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Wing Asn Thr His Leu 195 200 205 ttg ctt etc aaa gac gct cag gtg ttt ggt gag gag tgg ggt tac tec 671 Leu Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser 210 215 220 agt gaa gat gtt gee gag ttc tac cgt agg cag etc aag ttg act caa 719 Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln 225 230 235 cag tac here gac falls tgc gtc aac tgg tac aac gtt ggg etc aat ggt 767 Gln Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly 240 245 250 255 ctt aga gga tet acc tac gac gg tgg gtg aag ttc aac agg ttt cgt 815 Leu Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg 260 265 270 aga gag atg acc ttg act gtg etc gat ct t ate gtt etc ttt cca ttc 863 Arg Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe 275 280 285 tac gac att cgt ctt tac tec aaa ggc gtt aag here gag ctg acc aga 911 Tyr Asp He Arg Leu Tyr Be Lys Gly Val Lys Thr Glu Leu Thr Arg 290 295 300 gac ate ttc acc gat ct t ct tc cta cct acg acc ctg cag aaa tac 959? Sp He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr 305 310 315 ggt cca act ttt etc tec att gag aac age ate agg aag cct falls etc 1007 Gly Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu 320 325 330 335 ttc gac tat ctg caa ggc att gag ttt falls ace agg ttg caa cct ggt 1055 Phe Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly 340 345 350 tac ttc ggt aag gat tec ttc aac tac tgg age gga aac tac gtt gaa 1103 Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu 355 360 365 acc aga cca tec ate gga tet age aag acc ate act tet cca ttc tac 1151 Thr Arg Pro Be He Gly Be Ser Lys Thr He Thr Ser Pro Phe Tyr 370 375 380 ggt gac aag age act gag cca gtg cag aag ttg age ttc gat ggg cag 1199 Gly Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln 385 390 395 aag gtg tat aga acc ate gcc aat acc gtt gct gct tgg cct aat 1247 Lys Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn 400 405 410 415 ggc aag gtc tac ctt gga gtt act aaa gtg gac ttc tec caa tac gac 1295 Gly Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp 420 425 430 gat cag aag aac gag here tet act a ct ac ag ag aac ag ag aac 1343 Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn 435 440 445 aat ggc cat gtt tec gca caa gac tec att gac caa ctt cca cca gaa 1391 Asn Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu 450 455 460 acc act gat gaa cca ttg gag aag gct tac agt falls caa ctt aac tac 1439 Thr Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr 465 470 475 gcc gaa tgc ttt etc atg caa gac agg cgt g gc acc att ccg ttc ttt 1487 Wing Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe 480 485 490 495 aca. tgg act falls agg tet gtc gac ttc ttt aac act ate gac gct gag 1535 Thr Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Ala Glu 500 505 510 aag att ac caa ctt ccc gtg gtc aag gct tat gcc ttg tec age gga 1583 Lys He Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly 515 520 525 gct tec ate att gaa ggt cca ggc ttc acc ggt ggc aac ttg etc ttc 1631 Wing Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe 530 535 540 ctt aag gag tec age aac tec ate gcc aag ttc aaa gtg here ctt aac 1679 Leu Lys Glu Ser Ser Asn Ser He Ala Lys Phe Lys Val Thr Leu Asn 545 550 555 tea gca gcc ttg etc caa cgt tac agg gtt cgt ate aga tac gca age 1727 Be Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser 560 565 570 575 act acc aat ctt cgc etc ttt gtc cag aac age aac aat gat ttc ctt 1775 Thr Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu 580 585 590 gtc ate tac ate aac aag aa g aac aaaaa gao gat gac etc acc acc 1823 Val He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr 595 600 605 caa ac ttc gat ctt gcc act acc aat agat aat gga ttc tet ggt 1871 Gln Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly 610 615 620 gac aag aac gag ctg ate ata ggt gct gag age ttt gtc tet aat gag 1919 Asp Lys Asn Glu Leu He He Gly Ala Glu Ser Phe Val Ser Asn Glu 625 630 635 and-. ^, ^ A ^ ^ fciw & ^ * - A ^^^^^ t ^ B ^ * 8A ^ 4SgA ,, At. -If »*, Aaag att tac ata gac aag ate gag ttc att cca gt caa etc 1961 Lys He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 640 645 650 taatagatec cccgggctgc aggaattc 1989 < 210 > 8 < 211 > 653 < 212 > PRT < 213 > Artificial Sequence < 400 > 8 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 10 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Wing Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 15 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 20 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Wing Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 & itó ^ -; : .v-, i ': _- ^ -'. ^ Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 10? Sp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 15 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Ala Leu Ser Ser Gly Ala 515 520 525 20 Ser Ile Ile Glu G1y Pr ° G1y phe thr Qiy G1y Asn Leu Leu phe Leu 530 535 540 Lys Glu Ser Ser Asn Ser He Ala Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr 565 570 575 u * tSe * £ *? r? a £. 5, FAITH &BE? AISSE? ¡& jürfOM-SajCtuj- * - ~ x? r * ¿yes¿Stti e *.

Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 9 < 211 > 1984 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: nucleotide sequence that does not occur in a natural way that codes for a sequence of amino acids Cry3Bb variant 11231mvl < 220 > < 221 > CDS < 222 > (3) .. (1961) < 223 > sequence coding for an amino acid sequence of Cry3Bb variant 11231mvl < 400 > 9 C ATAC GCC aac ccc aac aat cgc tec gag cae gac acg ate aag gtc 47 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val 1 5 10 15 acc ccc aac tec gag etc cag acc aac falls aac c a gc cc gc gcc 95 Thr Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing 20 25 30 gac aac ccc aac tec acc ctg gaa gag ctg aac tac aag gag ttc ctg 143 Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu 35 40 45 cgc atg acc gag gac tec tec acg gag gtc ctg gac aac tec acc gtc 191 Arg Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val 50 55 60 aag gac gcc gtc ggg acc ggc ate tec gtc gtt ggg cag ate ctg ggc 239 Lys Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly 65 70 75 gtc gtt ggc gtc ccc ttc gca ggt gct etc acc tectc tac cag tec 287 Val Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser 80 85 90 95 ttc ctg aac acc ate tgg ccc tec gac gcc gac ccc tgg aag gcc ttc 335 Phe Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe 100 105 110 atg gcc caa gtc gaa gtc ctg ate gac aag aag ate gag gag tac gcc 383 Met Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala 115 120 125 aag tec aag gcc ctg gcc gag ctg caa ggc ctg caa aac aac ttc gag 431 Lys Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu 130 135 140 gac tac gtc aac gcg ctg aac tec tgg aag aag acg cct ctg tec ctg 479 Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu 145 150 155 cgc tec aag cgc tec cag ggc cgc ate cgc gag ctg ttc tec cag gcc 527 Arg Ser Lys Arg Ser Gln Gly Arg He Arg Glu Leu Phe Ser Gln Wing 160 165 170 175 gag tec falls ttc cgc aac tec atg ccg tec ttc gcc gtc tec aag ttc 575 Glu Ser His phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe 180 185 190 gag gtc ctg ttc ctg ccc gcc cctc acc gcc acc gcc acac acc falls 623 Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu 195 200 205 ctg ttg ctg aag gac gcc cag gtc ttc ggc gag gaa tgg ggc tac tec 671 Leu Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser 210 215 220 tcg gac gac gcc gcc gac tcc tac ccc cgc cag ctc aag ctg accc 719 Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln 225 230. 235 cag tac acc gac falls tgc gtc aac tgg tac aac gtc ggc ctg aac ggc 767 Gln Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly 240 245 250 255 ctg agg ggc tec acc tac gac gca tgg gtc aag ttc aac cgc ttc cgc 815 Leu Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg 260 265 270 agg gag atg acc ctg acc gtc ctg gac ctg ate gtc ctg ttc ccc ttc 863 Arg Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe 275 280 285 tac gac ate cgc ctg tac tec aag ggc gtc aag acc gag ctg acc cgc 911 Tyr Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg 290 295 300 gac ate tcc acc gac ccc tc ctc tc ctg etc. acg etc cag aag tac 959 Asp He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr 305 310 315 ggt ccc acc ttc ctg tec ate gag aac tec cgc aag ccc falls ctg 1007 Gly Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu 320 325 330 335 ttc gac tac etc cag ggc ate gag ttc falls acg cgc ctg agg cca ggc 1055 Phe Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly 340 345 350 tac tgc aag gac tec ttc aac tac tg tec ggc aac tac gtc gag 1103 Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu 355 360 365 acc agg ccc tec ate ggc tec tcg aag acg ate ac t ect tctc tac 1151 Thr Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr 370 375 380 ggc gac aag tec acc gag ccc gtc cag aag ctg tec ttc gac ggc cag 1199 Gly Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln 385 390 395 aag gtc tac cgc acc ate gcc aac acc gac gtc gcg gct tgg ccg aac 1247 Lys Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn 400 405 410 415 ggc aag gtc tac ctg ggc gtc acg aag gtc gac ttc tec cag tac gat 1295 Gly Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp 420 425 430 gac cag aag aat gaa acc tec acc acc gac tec aag cgc aac 1343 Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn 435 440 445 aat ggc falls gtc tec gcc cag gac tec ate gac cag ctg ccg cct gag 1391 Asn Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu 450 455 460 ac act gac gag ccc ctg gag aag gcc tac tec falls cag ctg aac tac 1439 Thr Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr 465 470 475 gcg gag tgc ttc ctg atg caa gac cgc agg ggc acc ate ccc ttc ttc 1487 Wing Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe 480 485 490 495 acc tgg acc falls cgc tec gtc gac ttc ttc aac acc ate gac gcc gag 1535 Thr Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Ala Glu 500 505 510 aag ate acc gtg ctg ccc gtg gtc aag gcc tac gcc ctg tec tcg ggt 1583 Lys He Thr Gln Leu Pro Val Val Lys Wing Tyr Ala Leu Ser Ser Gly 515 520 525 gcc tec ate att gag ggt cca ggc ttc acc ggt ggc aac ctg ctg ttc 1631 Wing Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe 530 535 540 ctg aag gag tec tcg aac tec ate gcc aag ttc aag gtc ac ct g aac 1679 Leu Lys Glu Ser Ser Asn Ser He Wing Lys Phe Lys Val Thr Leu Asn 545 550 555 tec gct gcc ttg ctg caa cgc tac cgc gtc cgc ate cgc tac gcc tec 1727 Be Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser 560 565 570 575 acc acg aac ctg cgc ctg ttc gtc cag aac tec aac aat gac ttc ctg 1775 Thr Thr A sn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu 580 585 590 gtc ate tac ate aac aag aac aac agac gac gat gac ctg acc tc 1823 Val He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr 595 600 605 cag acc ttc gac etc gcc ac ac aac tec aac ggc ttc tcg ggc 1871 Gln Thr Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly 610 615 620 gac aag aat gaa ctg ate att ggt gct gag tec ttc gtc tec aat gaa 1919 Asp Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu 625 630 635 aag ate tac ate gac aag ate gag ttc ate cc cc gc gcc 1961 Lys He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 640 645 650 tgataggaac tctgattgaa ttc 1984 < 210 > 10 < 211 > 653 < 212 > PRT < 213 > Sequence Art: Lficial < 400 > 10 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Wing Gln Val Glu val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Gly Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 ts * tigi? : * - Mki * i ..- Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Ala 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Ala Leu Be Ser Gly Ala 515 520 525 Be He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Ser Ser Asn Be He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Wing Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 11 < 211 > 1984 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: nucleotide sequence that does not occur naturally that encodes an amino acid sequence of Cry3Bb variant 11231mv2 < 220 > < 221 > CDS < 222 > (3) .. (1961) < 223 > sequence encoding an amino acid sequence of Cry3Bb variant 11231mv2 < 400 > 11 ce atg gcc aac ccc aac c gc tec gag gac g aac g a g g tc 47 Met Ala Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val 1 5 10 15 acc ccc aac tec gag etc cag acc aac aac cag tac ccg ctg gcc 95 Thr Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing 20 25 30 gac aac ccc aac tec ctg aac tc aac gac c tg aac gac ttc ctg 143 Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu 35 40 45 cgc atg acc gag gac tec tec acg gag gtc ctg gac aac tec acc gtc 191 Arg Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val 50 55 60 aag gac gcc gtc ggg acc ggc ate tec gtc gtt ggg cag ate ctg ggc 239 Lys Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly 65 70 75 gtc gtt ggc gtc ccc ttc gca ggt gct etc acc tectc tac cag tec 287 Val Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser 80 85 90 95 ttc ctg aac acc ate tgg ccc tec gac gcc gac ccc tgg aag gcc ttc 335 Phe Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe 100 105 110 atg gcc caa gtc gaa gtc ctg ate gac aag aag ate gag gag tac gcc 383 Met Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala 115 120 125 aag tec aag gcc ctg gcc gag ctg caa ggc ctg caa aac aac ttc gag 431 Lys Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu 130 135 140 ga.c tac gtc aac gcg ctg aac tcg aaag a g c a c t c t c t c tc c tc 473 Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu 145 150 155 cgc tec aag cgc tec cag gac cgc ate cgc gag ctg ttc tec cag gcc 527 Arg Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing 160 165 170 175 gag tec falls ttc cgc aac tec atg ccg tec ttc gcc gtc tec aag ttc 575 Glu Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe 180 185 190 gag gtc ctg ttc ctg ccc acc tac gcc cag gct gcc aac crash etc 623 Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu 195 200 205 ctg ttg ctg aag gac gcc gtc gtc ggc gag gaa tgg ggc tac tec 671 Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser 210 215 220 tcg gag gac gtc gcc gag ttc tac cgt cgc cag ctg aag ctg acc caa 719 Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln 225 230 235 cag tac acc gac falls tgc gtc aac tgg tac aac gtc ggc ctg aac ggc 767 Gln Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly 240 245 250 255 ctg agg ggc tec acc tac gac gca tgg gtc aag ttc aac cgc ttc cgc 815 Leu Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg 260 265 270 agg gag atg acc ctg acc gtc ctg gac ctg ate gtc ctg ttc ccc ttc 863 Arg Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe 275 280 285 j ^ ^ ^! ^ - '«^ > x ££ ^^ & ^ * &. * '* & & & >c-a-ccc cgc ctc tac tec aag ggc gtc aag acc gag ctg acc cgc 911 Tyr Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg 290 295 300 gac ate ttc acg gac ccc ate ttc ctg etc acg acc etc cag aag tac 959 Asp He Phe Thr Asp Pro He Phe Leu Leu Thr Leu Gln Lys Tyr 305 310 315 ggt ccc acc ttc ctg tec ate gag aac tec ate cgc aag ccc falls ctg 1007 Gly Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu 320 325 330 335 ttc gac tac etc cag ggc ate gag ttc falls acg cgc ctg agg cca ggc 1055 Phe Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly 340 345 350 tac tcc ggc aag gac tec ttc aac tac tgg tec ggc aac tac gtc gag 1103 Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu 355 360 365 acc agg ccc tec ate ggc tec tcg aag acg ate acc tec cct ttc tac 1151 Thr Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr 370 375 380 99c 9 c a9 ec acc gag ccc gtc cag aag ctg tec ttc gac ggc cag 1199 Gly Asp Lys Ser Thr Glu Pro Val Gln L ys Leu Ser Phe Asp Gly Gln 385 390 395 aag gtc tac cgc acc ate gcc aac ac gac gc gcg gct tgg ccg aac 1247 Lys Val Tyr Arg Thr He Wing Asn Thr Asp val Wing Wing Trp Pro Asn 400 405 410 415 ggc aag gtc tac ctg ggc gtc acg aag gtc gac ttc tec cag tac gat 1295 Gly Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp 420 425 430 gac cag aag aat gaa acc tec acc acc gac tec aag cgc aac 1343 Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn 435 440 445 aat ggc falls gtc tec gcc cag gac tec ate gac cag ctg ccg cct gag 1391 Asn Gly His Val Ser Ala Gln Asp Ser He Asp Gln Leu Pro Pro Glu 450 455 460 acc act gac gag ccc ctg gag aag gcc tac tec cag ctg aac tac 1439 Thr Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr 465 470 475 gcg gag tgc ttc ctg atg caa gac cgc agg ggc acc ate ccc ttc ttc 1487 Wing Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe 480 485 490 495 acc tgg acc falls cgc tec gtc gac ttc ttc aac acc ate gac gcc gag 1535 Thr Trp Thr Hi s Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu 500 505 510 aag ate ctg cct gcc gtc aag gcc tac gcc ctg tec tcg ggt 1583 Lys He Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly 515 520 525 gcc tec ate att gag ggt cca ggc ttc acc ggt ggc aac ctg ctg ttc 1631 Wing Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe 530 535 540 ctg aag gag tec tcg aac tec ate gcc aag ttc aag gtc acc ctg aac 1679 Leu Lys Glu Ser Ser Asn Ser He Ala Lys Phe Lys Val Thr Leu Asn 545 550 555 tec gct gcc ttg ctg caa cgc tac cgc gtc cgc ate cgc tac gcc tce 1727 Be Wing Wing Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Wing Ser 560 565 570 575 acc acg aac ctg cgc ctg ttc gtc cag aac tec aac gac ttc ctg 1775 Thr Thr Asn Leu Arg Leu Phe Val Gln Asn Being As Asn Asp Phe Leu 580 585 590 gtc ate tac ate aac aag aac aac agac a gac gat gac ctc acc t 1823 Val He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr 595 600 605 cag acc ttc gac etc gcc ac ac aac tec aac ggc tcc tcg ggc 1871 Gln Thr Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly 610 615 620 9ac aag aat gaa ctg ate att ggt gct gag tec ttc gtc tec aat gaa 1919 Asp Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu 625 630 635 aag ate tac ate gac aag ate gag ttc ate cc cc gc gcc 1961 Lys He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 640 645 650 tgataggaac tctgattgaa ttc 1984 < 210 > 12 < 211 > 653 < 212 > PRT < 213 > Artificial Sequence < 400 > 12 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Ala Gln Val Glu Val Leu He Asp Lys He Glu Glu Tyr Ala Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 < 31u Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Ar9 Pr ° Ser Ile Gly Ser Ser Ly Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Ser Ser Asn Be He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Ala Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 13 < 211 > 4149 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: expression cassette < 220 > < 221 > promoter < 222 > (25) .. (640) < 223 > P-CaMV.35S _A < 220 > < 221 > intron < 222 > (669) .. (1472) < 223 > I-Zm.Hsp70 < 220 > < 221 > transit peptide < 222 > (1489) .. (1635) < 223 > terminal amino TS-Zm.rbcS < 220 > < 221 > intron < 222 > (1636) .. (1798) < 223 > I-Zm.rbcS < 220 > < 221 > transit peptide < 222 > (1799) .. (1885) < 223 > carboxy termion TS-Zm.rbcS < 220 > < 221 > CDS < 222 > (1885) .. (3843) < 223 > Cry3Bbl variant V11231 10 < 220 > < 221 > termir < 222 > (3871) .. (4127) < 223 > T-AGRtu.nos 3 'polyadenylation and transcription termion sequence < 400 > 13 gcggccgcgt taacaagctt ctgcaggtcc gatgtgagac ttttcaacaa agggtaatat 60 ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg aagatagtgg 120 aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc atcgttgaag 180 atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa 240 aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatggt ccgatgtgag 300 acttttcaac aaagggtaat atccggaaac ctcctcggat tccattgccc agctatctgt 360 cactttattg tgaagatagt gaaaaggaag gtggctccta caaatgccat cattgcgata 420 aaggaaaggc catcgttgaa gatgcctctg cegacagtgg tcccaaagat ggacccccac 480 ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt 540 gatgtgatat ctccactgac gtaagggatg acgcacaatc ccactatcct tcgcaagacc 600 cttcctctat ataaggaagt teattteatt tggagaggac acgctgacaa gctgactcta 660 geagatetac cgtcttcggt acgcgctcac tccgccctct gcctttgtta ctgccacgtt 720 tctctgaatg ctctcttgtg tggtgattgc tgagagtggt ttagctggat ctagaattac 780 actctgaaat cgtgttctgc ctgtgctgat tacttgccgt cctttgtagc agcaaaatat 840 agggacatgg tagtacgaaa cgaagataga acctacacag caatacgaga aatgtgtaat 900 gcggtattta ttggtgctta tttaagcaca tgttggtgtt atagggcact tggattcaga 960 agtttgctgt taatttaggc acaggcttca tactacatgg tagggattca gtcaatagta 1020 tattataggc gatactataa taatttgttc gtctgcagag cttattattt gccaaaatta 1080 gatattecta ttetgttttt gtttgtgtgc tgttaaattg ttaacgcctg aaggaataaa 1140 5 tataaatgac gaaattttga tgtttatctc tgctccttta ttgtgaccat aagtcaagat 1200 cagatgeact tgttttaaat attgttgtct gaagaaataa gtactgacag tattttgatg 1260 cttgatctgc ttgtttgttg taacaaaatt taaaaataaa gagtttcctt tttgttgctc 1320 tccttacctc ctgatggtat etagtateta ccaactgaca etatattget tetetttaca 1380 tacgtatctt gctcgatgcc ttctccctag tgttgaccag tgttactcac atagtctttg 1440 ctcatttcat tgtaatgcag ataccaageg geetetagag gatcageatg gcgcccaccg 1500 10 tgatgatggc ctcgtcggcc accgccgtcg ctccgttcct ggggctcaag tccaccgcca 1560 gcctccccgt cgcccgccgc tcctccagaa gcctcggcaa cgtcagcaac ggcggaag ga 1620 tccggtgcat gcaggtaaca aatgcatcct agctagtagt tctttgcatt gcagcagctg 1680 gttagtaata cagetagega ggaagggaac tgatgatcca tgcatggact gatgtgtgtt 1740 tcccatccca gcccatccca tttcccaaae gaaccgaaaa caccgtacta cgtgeaggtg 1800 tggccctacg gcaacaagaa gttcgagacg ctgtcgtacc tgccgccgct gtcgaccggc 1860 gggcgcatcc gctgcatgca GGCC atg gca aac cct aac aat cgt tec gaa 1911 Met Ala Asn Pro Asn Asn Arg Ser Glu 15 1 5 falls gac acc ate aag gtt act cca aac tet gag ttg caa act aat falls 1959 His Asp Thr He Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn His 10 15 20 25 aac cag tac cca ttg gct gac aat cct aac agt act ctt gag gaa ctt 2007 Asn Gln Tyr Pro Leu Wing Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu 30 35 40 aac taag aag gag ttt etc cgg atg acc gaa gat age tec act gag gtt 2055 Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr Glu Val 45 50 55 20 etc gat aac tet here gtg aag gac gct gtt gga act ggc att age gtt 2103 Leu Asp Asn Ser Thr Val Lys Asp Ala Val Gly Thr Gly He Ser Val 60 65 70 gtg gga cag att ctt gga gtg gtt ggt gtt cca ttc gct gga gct ttg 2151 Val Gly Gln He Leu Gly Val Val Gly Val Pro Phe Ala Gly Ala Leu 75 80 85 acc age ttc tac cag tec ttt etc aac acc ate tgg cct tea gat gct 2199 Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr He Trp Pro Ser Asp Ala 90 95 100 105 gat ccc tgg aag gct ttc atg gcc caa gtg gaa gtc ttg ate gat aag 2247 Asp Pro Trp Lys Wing Phe Met Wing Gln Val Glu Val Leu He Asp Lys 110 115 120 aag ate gaa tat gcc aag tet aaa gcc ttg gct gag ttg caa ggt 2295 Lys He Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala Glu Leu Gln Gly 125 130 135 ttg cag aac aac ttc gag gat tac gtc aac gca etc aac age tgg aag 2343 Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys 140 145 150 aaa act ccc ttg agt etc agg tet aag cgt tec cag gac cgt att cgt 2391 Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln Asp Arg He Arg 155 160 165 gaa ctt ttc age caa gcc gaa tec falls ttc aga aac tec atg cct age 2439 Glu Leu Phe Ser Gln Wing Glu Ser His Phe Arg Asn Ser Met Pro Ser 170 175 180 185 ttt gcc gtt tet aag ttc gag gtg etc ttc ttg cca tac tac gca caa 2487 Phe Wing Val Ser Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Wing Gln 190 195 200 gct gcc aac act cat etc ttg ctt etc aaa gac gct cag gtg ttt ggt 2535 Wing Wing Asn Thr His Leu Leu Leu Leu Lys A sp Ala Gln Val Phe Gly 205 210 215 gag gag tgg ggt tac tec agt gaa gat gtt gcc gag ttc tac cgt agg 2583 Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg 220 225 230 cag etc aag ttg act caa cag tac here gac falls tgc gtc aac tgg tac 2631 Gln Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys Val Asn Trp Tyr 235 240 245 aac gtt ggg etc aat ggt ctt aga gga tet acc tac gac gca tgg gtg 2679 Asn Val Gly Leu Asn Gly Leu Arg Gly Be Thr Tyr Asp Wing Trp Val 250 255 260 265 aag ttc aac agg ttt cgt aga gag atg acc ttg act gtg etc gat ctt 2727 Lys Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp Leu 270 275 280 ate gtt etc ttt cca ttc tac gac att cgt ctt tac tec aaa ggc gtt 2775 He val Leu Phe Pro Phe Tyr Asp He Arg Leu Tyr Ser Lys Gly Val 285 290 295 aag here gag ctg acc aga gac ate ttc acc gat ccc ate tc cta ctt 2823 Lys Thr Glu Leu Thr Arg Asp He Phe Thr Asp Pro He Phe Leu Leu 300 305 310 acg acc ctg cag aaa tac ggt cca act ttt etc tec att gag aac age 2871 Thr Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser He Glu Asn Ser 315 320 325 ate agg aag cct falls etc ttc gac tat ctg caa ggc att gag ttt falls 2919 He Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly He Glu Phe His 330 335 340 345 acc agg ttg caa cct ggt tac ttc ggt aag gat tec ttc aac tac tgg 2967 Thr Arg Leu Gln Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp 350 355 360 age gga aac tac gtt gaa acc aga cca tec ate gga tet age aag acc 3015 Ser Gly Asn Tyr Val Glu Thr Arg Pro Ser He Gly Ser Ser Lys Thr 365 370 375 ate act tet cca ttc tac ggt gac aag age act gag cca gtg cag aag 3063 He Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln Lys 380 385 390 ttg age ttc gat ggg cag aag gtg tat aga acc ate gcc aat acc gat 3111 Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr He Wing Asn Thr Asp 395 400 405 gtt gca gct tgg cct aat ggc aag gtc tac ctt gga gtt ac t aaa gtg 3159 Val Wing Wing Trp Pro Asn Gly Lys Val Tyr Leu Gly Val Thr Lys Val 410 415 420 425 gac ttc tec caa tac gac gat cag aag aac gag ac t t t act act 3207 Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Thr Gln Thr 430 435 440 tac gat agt aag ag g aac g gc cat gtt tec gca caa gac tec att 3255 Tyr Asp Ser Lys Arg Asn Asn Gly His Val Ser Wing Gln Asp Ser He 445 450 455 gac caa ctt cca cct gaa acc gat gaa cca ttg gag aag gct tac 3303 Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Wing Tyr 460 465 470 agt falls caa ctt aac tac gcc gaa tgc ttt etc atg caa gac agg cgt 3351 Ser His Gln Leu Asn Tyr Wing Glu Cys Phe Leu Met Gln Asp Arg Arg 475 480 485 ggc acc att ccg ttc ttt here tgg act falls agg tet gtc gac ttc ttt 3399 Gly Thr He Pro Phe Phe Thr Trp Thr His Arg Ser Val Asp Phe Phe 490 495 500 505 aac act ate gac gct gag aag att action ctt ccc ctc gtg gtc aag gct 3447 Asn Thr He Asp Wing Glu Lys He Thr Gln Leu Pro Val Val Lys Wing 510 515 520 tat gcc ttg tec age gga gct t ec ate att gaa ggt cca ggc ttc acc 3495 Tyr Ala Leu Ser Ser Gly Wing Be He He Glu Gly Pro Gly Phe Thr 525 530 535 ggt ggc aac ttg etc ttc ctt aag gag tec age aac tec ate gcc aag 3543 Gly Gly Asn Leu Leu Phe Leu Lys Glu Be Ser Asn Be He Wing Lys 540 545 550 ttc aaa gtg here ctt aac tea gca gcc ttg etc caa cgt tac agg gtt 3591 Phe Lys Val Thr Leu Asn Ser Ala Ala Leu Leu Gln Arg Tyr Arg Val 555 560 565 cgt ate aga tac gca age act acc aat ctt cgc etc ttt gtc cag aac 3639 Arg He Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln Asn 570 575 580 585 age aac aat gat ttc ctt gtc ate tac ate aac aag act at aac aaa 3687 Ser Asn Asn Asp Phe Leu Val He Tyr He Asn Lys Thr Met Asn Lys 590 595 600 gac gat gac etc acc tac caa here tcc gat ctt gcc act accat agat 3735 Asp Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Wing Thr Thr Asn Ser 605 610 615 aac atg gga ttc tet ggt gac aag aac gag ctg ate ata ggt gct gag 3783 Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Leu He He Gly Ala Glu 620 625 630 age ttt gtc tet aat gag aag att tac ata gac aag ate gag ttc att 3831 Ser Phe Val Ser Asn Glu Lys He Tyr He Asp Lys He Glu Phe He 635 640 645 cca gtt caa etc taatagatec cccgggctgc aggaattccc gatcg ttcaa 3883 Pro Val Leu Gln 650 acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca 3943 tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat 4003 ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac gegatagaaa 4063 acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag 4123 atcggggata tccccggggc ggccgc 4149 < 210 > 14 < 211 > 653 < 212 > PRT < 213 > Artificial Sequence < 400 > 14 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 5 ° 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 .A.-v • vt ^^^. ^. J Ala Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Wing Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu T hr Thr Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 AsP Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Ala 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Ser Ser Asn Ser He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560? L? L Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 15 < 211 > 3754 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: expression cassette < 220 > < 221 > promoter < 222 > (25) .. (640) < 223 > P-CaMV.35S < 220 > < 221 > intron < 222 > (669) .. (1472) < 223 > I-Zm.Hsp70 < 220 > < 221 > CDS < 222 > (1490) .. (3448) < 223 > Cry3Bbl variant V11231 < 220 > < 221 > thermometer < 222 > (3475) .. (3730) < 223 > transcription termination sequence and 3 'polyadenylation of Agrobacterium tumefaciens < 400 > 15 gcggccgcgt taacaagctt ctgcaggtcc gatgtgagac ttttcaacaa agggtaatat 60 ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg aagatagtgg 120 aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc atcgttgaag 180 atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa 240 aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatggt ccgatgtgag 300 acttttcaac aaagggtaat atccggaaac ctcctcggat tccattgccc agctatctgt 360 cactttattg tgaagatagt ggaaaaggaa ggtggctcct acaaatgcca tcattgcgat 420 aaaggaaagg ccatcgttga agatgcctct gccgacagtg gtcccaaaga tggaccccca 480 cccacgagga gcatcgtgga gttccaacca aaaagaagac cgtcttcaaa gcaagtggat 540 tctccactga tgatgtgata cgtaagggat gacgcacaat cccactatcc ttcgcaagac 600 ccttcctcta tataaggaag ttcatttcat ttggagagga cacgctgaca agctgactct 660 agcagatcta ccgtcttcgg tacgcgctca ctccgccctc tgcctttgtt actgccacgt 720 ttctctgaat gctctcttgt gtggtgattg ctgagagtgg tttagctgga tctagaatta 780 cactctgaaa tcgtgttctg cctgtgctga ttacttgccg tcctttgtag cagcaaaata 840 tagggacatg gtagtacgaa acgaagatag aacctacaca gcaatacgag aaatgtgtaa 900 tttggtgctt agcggtattt atttaagcac atgttggtgt tatagggcac ttggattcag 960 aagtttgctg ttaatttagg cacaggcttc atactacatg ggtcaatagt atagggattc 1020 atattatagg cgatactata ataatttgtt cgtctgcaga gcttattatt tgccaaaatt 1080 agatattcct attctgtttt tgtttgtgtg ctgttaaatt gttaacgcct gaaggaataa 1140 atataaatga cgaaattttg atgtttatct ctgctccttt attgtgacca taagtcaaga 1200 tcagatgcac ttgttttaaa tattgttgtc tgaagaaata agtactgaca gtattttgat 1260 gcattgatct gcttgtttgt tgtaacaaaa tttaaaaata aagagtttcc tttttgttgc 1320 tctccttacc tcctgatggt atc tagtatc taccaactga cactatattg cttctcttta 1380 catacgtatc ttgctcgatg ccttctccct agtgtttacc agtgttaetc acatagtctt 1440 tgctcatttc attgtaatgc agataccaag cggcctctag aggatctcc atg gca aac 1498 Met Ala Asn 1 cct aac aat cgt tec gaa cae gac acc ate aag gtt act cca aac tet 1546 Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr Pro Asn Ser 5 10 15 gag ttg caa act aat falls aac cag tac cca ttg gct gac aat cct aac 1594 Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn Pro Asn 25 30 35 agt aet ctt gag gaa ctt aac tac aag gag ttt etc cgg atg acc gaa 1642 Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu 40 45 50 gat age tec act gag gtt etc gat aac tet here gtg aag gac gct gtt 1690 Asp Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp Wing Val 55 60 65 gga act ggc att age gtt gtg gga cag att ctt gga gtg gtt ggt gtt 1738 Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val Val Gly Val 70 75 80 cca ttc gct gga gct ttg acc age ttc tac cag tec ttt etc aac acc 1786 Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr 85 90 95 ate tgg cct tea gat gct gat ccc tgg aag gct ttc atg gcc caa gtg 1834 He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met Wing Gln Val 100 105 110 115 gaa gtc ttg ate gat aag aag ate gaa gag tat gcc aag tet aaa gcc 1882 Glu Val Leu He Asp Lys He Glu Glu Tyr Ala Lys Ser Lys Wing 120 125 130 ttg gct gag ttg caa ggt ttg cag aac aac ttc gag gat tac gtc aac 1930 Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr V al Asn 135 140 145 gca etc aac age tgg aag aaa act ccc ttg agt etc agg tet aag cgt 1978 Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg 150 155 160 tec cag gac cgt att cgt gaa ctt ttc age caa gcc gaa tec falls ttc 2026 Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu Ser His Phe 165 170 175 aga aac tec atg cct age ttt gcc gtt tet aag ttc gag gtg etc ttc 2074 Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu Val Leu Phe 180 185 190 195 ttg cca here tac gca caa gct gcc aac act cat etc ttg ctt etc aaa 2122 Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu Leu Leu Lys 200 205 210 gac gct cag gtg ttt ggt gag gag tgg ggt tac tech ag gaa gat gtt 2170 Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val 215 220 225 gcc gag ttc tac cgt agg cag etc aag ttg act caa cag tac here gac 2218 Wing Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln Tyr Thr Asp 230 235 240 falls tgc gtc aac tgg tac aac gtt ggg etc aat ggt ctt aga gga tet 2266 His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser 245 250 255 acc tac gac gca tgg gtg aag ttc aac agg ttt cgt aga gag atg acc 2314 Thr Tyr Asp Wing Trp val Lys Phe Asn Arg Phe Arg Arg Glu Met Thr 260 265 270 275 ttg act gtg etc gat ctt ate gtt etc ttt cca ttc tac gac att cgt 2362 Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp He Arg 280 285 290 ctt tac tec aaa ggc gtt aag here gag ctg acc aga gac ate ttc acc 2410 Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He Phe Thr 295 300 305 gat ccc ate ttc cta ctt acg acc ctg cag aaa tac ggt cca act ttt 2458 Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly Pro Thr Phe 310 315 320 etc tec att gag aac age ate agg aag cct drops etc ttc gac tat ctg 2506 Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe Asp Tyr Leu 325 330 335 caa ggc att gag ttt falls acc agg ttg caa cct ggt tac ttc ggt aag 2554 Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Phe Gly Lys 340 345 350 355 gat tec ttc aac tac tgg age gga aac tac gtt gaa ac aga cca tec 2602 Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg Pro Ser 360 365 370 ate gga tet age aag acc ate act tet cca ttc tac ggt gac aag age 2650 He Gly Be Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp Lys Ser 375 380 385 act gag cca gtg cag aag ttg age ttc gat ggg cag aag gtg tat aga 2698 Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg 390 395 400 acc ate gcc aat acc gt gct gct tgg cct aat ggc aag gtc tac 2746 Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys Val Tyr 405 410 415 ctt gga gtt act aaa gtg gac ttc tec caa tac gac gat cag aag aac 2794 Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn 420 425 430 435 gag here tet act ac cat ag ag aac ag g aac g gc cat gtt 2842 Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly His Val 440 445 450 tec gca caa gac tec att gac caa ctt cca cca gaa acc act gat gaa 2890 Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu 455 460 465 cea ttg gag aag gct tac agt falls caa ctt aac tac gcc gaa tgc ttt 2938 Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala Glu Cys Phe 470 475 480 etc atg caa gac agg cgt ggc acc att ccg ttc ttt here tgg act drops 2986 Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp Thr His 485 490 495 agg tet gtc gac ttc ttt aac act ate gac gct gag aag att acca 3034 Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys He Thr Gln 500 505 510 515 ctt ccc gtg gtc aag gct tat gcc ttg tec age gga gct tec ate att 3082 Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala Ser He He 520 525 530 gaa ggt cca ggc ttc acc ggt ggc aac ttg etc ttc ctt aag gag tec 3130 Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser 535 540 545 agc aac tec ate gcc aag ttc aaa gtg here ctt aac tea gca gcc ttg 3178 Ser Asn Be He Wing Lys Phe Lys Val Thr Leu Asn Ser Wing Wing Leu 550 555 560 etc caa cgt tac agg gtt cgt ate aga tac gca age act acc aat ctt 3226 Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr Th r Asn Leu 565 570 575 cgc etc ttt gtc cag aac age aac aat gat ttc ctt gtc ate tac ate 3274 Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val He Tyr He 580 585 590 595 aac aag act at aac aaa gac gat gac etc acc tac caa here ttc gat 3322 Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln Thr Phe Asp 600 605 610 ctt gcc act acc aat agt aac atga gga ttc tet ggt gac aag aac gag 3370 Leu Ala Thr Thr Asn As As Met Met Gly Phe Ser Gly Asp Lys Asn Glu 615 620 625 ctg ate ata ggt gct gag age ttt gtc tet aat gag aag att tac ata 3418 Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys He Tyr He 630 635 640 gac AAG ate gag ttc att cca GTT caa etc taatagatec cccgggctgc 3468 Asp Lys I Glu Phe I Pro Val Gln Leu 645 650 gategttcaa aggaattccc acatttggea ataaagtttc ttaagattga atcctgttgc 3528 atgattatca cggtcttgcg tataatttct gttgaattac gttaagcatg taataattaa 3588 catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata 3648 gegatagaaa catttaatac acaaaatata gcgcgcaaac taggataaat tatcgcgcgc 370 8 ggtgtcatct atgttactag atcggggata tccccggggc ggccgc 3754 < 210 > 16 < 211 > 653 < 212 > PRT < 213 > Artificial Sequence < 400 > 16 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 2 5 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 ^% ü¡ ^ Ég? i £ &&; ¿?? ^^ - ~? , s -, - Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Ala Leu Ser Ser Gly Wing 515 520 525 Ser He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 20 Lys Glu Ser Ser Asn Ser He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Wing Wing Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Wing Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Being Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 17 < 211 > 3450 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: expression cassette < 220 > < 221 > promoter < 222 > (14) .. (235) < 223 > P-CaMV.AS4 < 220 > < 221 > 5'UTR < 222 > (240) .. (304) < 223 > L-Ta.hcbl < 220 > < 221 > intron < 222 > (318) .. (805) < 223 > I-Os.Actl < 220 > < 221 > transit peptide < 222 > (825) .. (971) < 223 > terminal amino TS-Zm.rbcS < 220 > < 221 > intron < 222 > (972) .. (1134) < 223 > 1-Zm.rbcS < 220 > < 22l > transit peptide < 222 > (1135) .. (1221) <; 223 > carboxy termination TS-Zm.rbcS < 220 > < 221 > CDS < 222 > (1222) .. (3180) < 223 > Cry3Bbl variant 11231mvl < 220 > < 221 > terminator < 222 > (3198) .. (3431) < 223 > T-Ta.hspl7 < 400 > 17 gcggccgcgt taacaagctt ctgacgtaag ggatgaegca cctgacgtaa gggatgacgc 60 acctgacgta agggatgacg cacctgacgt aagggatgac gcactcgaga tccccatctc 120 cactgacgta agggatgacg cacaatccca ctatccttcg caagaccctt cctctatata 180 aggaagttca tttcatttgg agaggacacg ctgacaagct agcttggctg caggtagatc 240 ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg gacaacacac 300 cataagatcc aagggaggcc tccgccgccg ccggtaacca ccccgcccct ctcctctttc 360 tttctccgtt tttttttccg tctcggtctc gatctttggc cttggtagtt tgggtgggcg 420 agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct cgcggctggg 480 gctctcgccg gcgtggatcc ggcccggatc tcgcggggaa tggggctctc ggatgtagat 540 ctgcgatccg ccgttgttgg gggagatgat ggggggttta aaatttccgc cgtgctaaac 600 agaggggaaa aagatcagga agggcactat ggtttatatt tttatatatt tctgctgctt 660 cgtcaggctt agatgtgcta gatctttctt tcttcttttt gtgggtagaa tttgaatccc 720 tcagcattgt tcatcggtag tttttctttt catgatttgt gacaaatgca gcctcgtgcg 780 gagctttttt gtaggtagaa gtgatcaacc tctagaggat cagcatggcg cccaccgtga 840 tgatggcctc gtcggcc acc gccgtcgctc cgttcctggg gctcaagtcc accgccagcc 900 tccccgtcgc ccgccgctcc tccagaagcc tcggcaacgt cagcaacggc ggaaggatcc 960 ggtgcatgca ggtaacaaat gcatcctagc tagtagttct ttgcattgca gcagctgcag 1020 etagegagtt agtaatagga agggaactga tgatccatgc atggactgat gtgtgttgcc 1080 catcccatce catcccattt cccaaacgaa ccgaaaacac cgtactacgt geaggtgtgg 1140 ccctacggca acaagaagtt cgagacgctg tcgtacctgc cgccgctgtc gaccggcggg 1200 cgcatccgct gcatgcaggc c atg gcc aac ccc aac aat cgc tec gag drops 1251 Met Wing Asn Pro Asn Asn Arg Ser Glu His 1 5 10 gac acg ate aag gtc acc ccc aac tec gag etc cag acc aac falls aac 1299 Asp Thr He Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn His Asn 15 20 25 cag tac ccg ctg gcc gac aac ccc aac tec acc ctg gaa gag ctg aac 1347 Gln Tyr Pro Leu Wing Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn 30 35 40 tac aag gag ttc ctg cgc atg acc gag gac tec tec acg gag gtc ctg 1395 Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr Glu Val Leu 45 50 55 gac aac tec acc gtc aag gac gcc gtc ggg acc ggc ate tec gtc gtt 1443 Asp Asn Ser Thr Val Lys Asp Wing Val Gly Thr Gly He Ser Val Val 60 65 70 • ^ t = ^ ^ .- ^ ^^^^^^ ggg cag ate ctg ggc gtc gtt ggc gtc ccc ttc gca ggt gct etc acc 1491 Gly Gln He Leu Gly Val Val Gly Val Pro Phe Ala Gly Ala Leu Thr 75 80 85 90 tec ttc tac cag tec ttc ctg aac acc ate tgg ccc tec gac gcc gac 1539 Ser Phe Tyr Gln Ser Phe Leu Asn Thr He Trp Pro Ser Asp Ala Asp 95 100 105 ccc tgg aag gcc ttc atg gcc caa gtc gaa gtc ctg ate gac aag aag 1587 Pro Trp Lys Wing Phe Met Wing Gln Val Glu Val Leu He Asp Lys Lys 110 115 120 ate gag gag tac gcc aag tec aag gcc ctg gcc gag ctg caa ggc ctg 1635 He Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu 125 130 135 caa aac aac aac tte gag gac tac gc aac gcg ctg aac tec agg aag 1683 Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys 140 145 150 acg cct ctg tec ctc cgc tec aag cgc tec cag ggc cgc ate cgc gag 1731 Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln Gly Arg He Arg Glu 155 160 165 170 10 ctg ttc tec cag gcc gag tec drops ttc cgc aac tec atg ccg tec ttc 1779 Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn Ser Met Pro Ser Phe 175 180 185 gcc gtc tec aag ttc gag gtc ctg ttc ctg ccc acc tac gcc cag gct 1827 Wing Val Ser Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln Wing 190 195 200 gcc aac acc falls etc ctg ttg ctg aag gac gcc cag gtc ttc ggc gag 1875 wing Asn Thr His Leu Leu Leu Leu Lys Asp Wing Gln Val Phe Gly Glu 205 210 215 gaa tgg ggc tac tec tcg gag gac gtc gcc gag ttc tac cgt cgc cag 1923 Glu Trp Gly Tyr Ser Ser Glu Asp Val Wing Glu Phe Tyr Arg Arg Gln 15 220 225 230 ctg aag ctg acc ca g a cc ac cc gc cc tc gc tc aac tgg tac aac 1971 Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys Val Asn Trp Tyr Asn 235 240 245 250 gtc ggc ctg aac ggc ctg agg ggc tec acc tac gac gca tgg gtc aag 2019 Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys 255 260 265 ttc aac cgc- ttc cgc agg gag atg acc ctg acc gtc ctg gac ctg ate 2067 Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp Leu He 270 275 280 20 gtc ctg ttc ccc ttc tac gac ate cgc ctg tac tec aag ggc gtc aag 2115 Val Leu Phe Pro Phe Tyr Asp He Arg Leu Tyr Ser Lys Gly Val Lys 285 290 295 acc gag ctg acc cgc gac ate tcc acc gac ccc cc tc ctc etc acg 2163 Thr Glu Leu Thr Arg Asp He Phe Thr Asp Pro He Phe Leu Leu Thr 300 305 310 acc etc cag aag tac ggt ccc acc ttc ctg tec ate gag aac tec ate 2211 Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser He Glu Asn Ser He 315 320 325 330 cgc aag ccc falls ctg tcc gac tac etc cag ggc ate gag ttc falls acg 2259 Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly He Glu Phe His Thr 335 340 345 cgc ctg agg cca ggc tac tgc aag gac tec ttc aac tac tgg tec 2307 Arg Leu Arg Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser 350 355 360 ggc aac tac gtc gag acc agg ccc tec ate ggc tec tcg aag acg ate 2355 Gly Asn Tyr Val Glu Thr Arg Pro Ser He Gly Ser Ser Lys Thr He 365 370 375 acc tec cct ttc tac ggc gac aag tec acc gag ccc gtc cag aag ctg 2403 Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln Lys Leu 380 385 390 tec ttc gac ggc cag aag gtc tac cgc acc ate gcc aac acc gac gtc 2451 Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr He Wing Asn Thr Asp Val 395 400 405 410 10 C9 9ct tgg ccg aac ggc aag gtc tac ctg ggc gtc acg aag gtc gac 2499 Wing Wing Trp Pro Asn Gly Lys Val Tyr Le u Gly Val Thr Lys Val Asp 415 420 425 ttc tec cag tac gat gag cag aag aat gaa acc tec acc cag acc tac 2547 Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr 430 435 440 gac tec aag cgc aac aat ggc falls gtc tec gcc cag gac tec ate gac 2595 Asp Ser Lys Arg Asn Asn Gly His Val Ser Wing Gln Asp Ser He Asp 445 450 455 cag ctg ccg cct gag acc act gac gag ccc ctg gag aag gcc tac tec 2643 Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser 15 460 465 470 falls to the gcg gag tgc ttc ctg atg cag gac cgc agg ggc 2691 His Gln Leu Asn Tyr Ala Glu Cys Phe Leu Met Gln Asp Arg Arg Gly 475 480 485 490 acc ate ccc ttc ttc acc tgg acc fall cgc tec gtc gac ttc ttc aac 2739 Thr He Pro Phe Phe Thr Trp Thr His Arg Ser Val Asp Phe Phe Asn 495 500 505 acc ate gac gcc gag aag ate acc cag ctg ccc gtg gtc aag gcc tac 2787 Thr He Asp Wing Glu Lys He Thr Gln Leu Pro Val Val Lys Wing Tyr 510 515 520 20 gcc ctg tec tcg ggt gcc tec ate att gag ggt cca ggc ttc acc ggt 28 35 Ala Leu Ser Ser Gly Wing Be He Glu Gly Pro Gly Phe Thr Gly 525 530 535 ggc aac ctg ctg ctg ctg aag gag tec tcg aac tec ate gcc aag ttc 2883 Gly Asn Leu Leu Phe Leu Lys Glu Being Ser Asn Ser He Ala Lys Phe 540 545 550 aag gtc acc ctg aac tec gct gcc ttg ctg caa cgc tac cgc gtc cgc 2931 Lys Val Thr Leu Asn Ser Ala Ala Leu Leu Gln Arg Tyr Arg val Arg 555 560 565 570 ate cgc tac gcc tec ac ac aac ctg cgc ctg ttc gtc cag aac tec 2979 He Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln Asn Ser 575 580 585 aac aat gac ttc ctg gtc at ate aac aac aac aac aag a ga a g aac 3027 Asn Asn Asp Phe Leu Val He Tyr He Asn Lys Thr Met Asn Lys Asp 590 595 600 gat gac ctg acc tac cag acc ttc gac etc gcc ac ac aac tec aac 3075 Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Wing Thr Thr Asn Ser Asn 605 610 615 atg ggc ttc tcg ggc gac aag aat gaa ctg ate att ggt gct gag tec 3123 Met Gly Phe Ser Gly Asp Lys Asn Glu Leu He He Gly Wing Glu Ser 620 625 630 ttc gtc tec aat gaa aag ate tac ate gac aag ate gag ttc ate ccc 3171 Phe Val Ser Asn Glu Lys He Tyr He Asp Lys He Glu Phe He Pro 635 640 645 650 10 gtc cag ctg tgataggaac tctgattgaa ttctgcatgc gtttggacgt 3220 Val Gln Leu atgctcattc aggttggagc caatttggtt ga tgtgtgtg cgagttcttg cgagtctgat 3280 gagacatetc tgtattgtgt ttctttcccc agtgttttct gtacttgtgt aateggetaa 3340 tcgccaacag attcggcgat gaataaatga gaaataaatt gttctgattt tgagtgeaaa 3400 aaaaaaggaa ttagatctgt gtgtgttttt tggatccccg gggcggccgc 3450 < 210 > 18 < 211 > 653 15 < 212 > PRT < 213 > Artificial Sequence < 400 > 18 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 20 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 i ^ * ^ É £ ¿^ Ja Leu Asn Thr He Trp Pro Being Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Ala Gln Val Glu Val Leu He Asp Lys He Glu Glu Tyr Ala Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Gly Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Wing Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 &- - - «JÜ-gH1" '- "-fc, AÁ«? »- *, M.

Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Ser Ser Asn Be He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Ala Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 19 < 211 > 3039 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: expression cassette < 220 > < 221 > promoter < 222 > (14) . (235) < 223 > P - Ca V. AS4 < 220 > < 221 > 5'UTR < 222 > (240) .. (304) < 223 > L-Ta.hcbl < 220 > < 22l > mtrón < 222 > (318) .. (805) < 223 > I-Os.Actl < 220 > < 221 > CDS < 222 > (811) .. (2769) < 223 > Cry3Bbl variant 11231mvl < 220 > < 221 > thermometer < 222 > (2787) .. (3020) < 223 > T-Ta.hspl7 < 400 > 19 gcggccgcgt taacaagctt ctgacgtaag ggatgacgca cctgacgtaa gggatgacgc 60 acctgacgta agggatgacg cacctgacgt aagggatgac gcactcgaga tccccatctc 120 cactgacgta agggatgacg cacaatccca ctatccttcg eaagaccctt cctctatata 180 aggaagttca ttteatttgg agaggacacg ctgacaagct agcttggctg caggtagatc 240 ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg gacaacacac 300 cataagatec aagggaggcc tccgccgccg ccggtaacca ccccgcccct ctcctctttc 360 tttctccgtt tttttttccg tctcggtctc gatctttggc cttggtagtt tgggtgggcg 420 agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct cgcggctggg 480 gctctcgccg gcgtggatcc ggcccggatc tegeggggaa tggggctctc ggatgtagat 540 ctgcgatccg ccgttgttgg gggagatgat ggggggttta aaatttccgc cgtgctaaac 600 agaggggaaa aagatcagga agggcactat ggtttatatt tttatatatt tctgctgctt 660 cgtcaggctt agatgtgcta gatctttctt tcttcttttt gtgggtagaa tttgaatccc 720 tcagcattgt tcatcggtag tttttctttt catgatttgt gacaaatgea gcctcgtgcg 780 gagctttttt gtaggtagaa gtgatcaace atg gcc aac ccc aac aat cgc tec 834 Met Ala Asn Pro Asn Asn Arg Ser 1 5 20 ga9 cac a acag ate aac g ac cac aac tec gag etc cag acc aac 882 Glu H as As Thr He Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn 10 15 20 cac aac cag tac ccg ctg gcc gac aac ccc aac tec acc ctg gaa gag 930 His Asn Gln Tyr Pro Leu Wing Asp Asn Pro Asn Ser Thr Leu Glu Glu 25 30 35 40 ctg aac tac aag gag ttc ctg cgc atg acc gag gac tec tec acg gag 978 Leu Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr Glu 45 50 55 gtc ctg gac aac tec acc gtc aag gac gcc gtc ggg acc ggc ate tec 1026 Val Leu Asp Asn Ser Thr Val Lys Asp Wing Val Gly Thr Gly He Ser 60 65 70 gtc gtt ggg cag ate ctg ggc gtc gtt ggc gtc ccc ttc gca ggt gct 1074 Val Val Gly Gln He Leu Gly Val Val Gly Val Pro Phe Ala Gly Ala 75 80 85 etc acc tec ttc tac cag tec ttc ctg aac acc ate tgg ccc tec gac 1122 Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr He Trp Pro Ser Asp 90 95 100 gcc gac ccc tgg aag gcc ttc atg gcc caa gtc gaa gtc ctg ate gac 1170 Wing Asp Pro Trp Lys Wing Phe Met Wing Gln Val Glu Val Leu He Asp 105 110 115 120 aag aag ate gag gag tac gcc aag tec aag gcc ctg gcc gag ctg caa 1218 Lys Lys He Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala Glu Leu Gln 125 130 135 ggc ctg caa aac aac ttc gag gac tac gtc aac gcg ctg aac tec tgg 1266 Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp 140 145 150 aaag aag acct cct c tc c tc c gc a cc cc tc gc cc tc gc cc a tec 1314 Lys Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln Gly Arg He 155 160 165 cgc gag ctg ttc tec cag gcc gag tec cac tcc ccc aac tec atg ccg 1362 Arg Glu Leu Phe Ser Gln Wing Glu Ser His Phe Arg Asn Ser Met Pro 170 175 180 tec ttc gcc gtc tec aag ttc gag gtc ctg ttc ctg ccc acc tac gcc 1410 Ser Phe Ala Val Ser Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Wing 185 190 195 200 cag gct gcc aac acc acc etc ctg ttg ctg aag gac gee cag gtc ttc 1458 Gln Ala Ala Asn Thr His Leu Leu Leu Leu Lys Asp Wing Gln Val Phe 205 210 215 ggc gag gag tgg ggc tac tec tcg gag gac gtc gcc gag ttc tac cgt 1506 Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Wing Glu Phe Tyr Arg 220 225 230 cgc cag ctg aag ctg acc cag tac acc gac cac tgc gtc aac tgg 1554 Arg Gln Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys Val Asn Trp 235 240 245 tac aac gtc ggc ctg aac ggc ctg agg ggc tec accc tac gac gca tgg 1602 Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp Wing Trp 250 255 260 gtc aag ttc aac cgc ttc cgc agg gag atg acc ctg acc gtc ctg gac 1650 Val Lys Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp 265 270 275 280 ctg ate gtc ctg ttc ccc ttc tac gadget cgc ctg tac tec aag ggc 1698 Leu He Val Leu Phe Pro Phe Tyr Asp He Arg Leu Tyr Ser Lys Gly 285 290 295 gtc aag acc gag ctg acc cgc gac ate ttc acg gac ccc ate ttc ctg 1746 Val Lys Thr Glu Leu Thr Arg Asp He Phe Thr Asp Pro He Phe Leu 300 305 310 etc acg etc cag aag tac ggt ccc acc ttc ctg tec ate gag aac 1794 Leu Thr Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser He Glu Asn 315 320 325 tec ate cgc aag ccc cac ctg ttc gac tac etc cag ggc ate gag ttc 1842 Ser He Arg Lys Pro H s Leu Phe Asp Tyr Leu Gln Gly He Glu Phe 330 335 340 cac acg cgc ctg agg cca ggc tac tcc ggc aag gac tec ttc aac tac 1890 His Thr Arg Leu Arg Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr 345 350 355 360 tgg tec ggc aac tac gtc gag acc agg ccc tec ate ggc tec tcg aag 1938 Trp Ser Gly Asn Tyr Val Glu Thr Arg Pro Ser He Gly Ser Ser Lys 365 370 375 acg ate acc tec cct ttc tac ggc gac aag tec acc gag ccc gtc cag 1986 Thr He Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln 380 385 390 aag ctg tec ttc gac ggc cag aag gtc tac cgc acc ate gcc aac acc 2034 Lys Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr He Wing Asn Thr 395 400 405 gac gtc gcg gct tcg ccg aac ggc aag gtc tac ctg ggc gtc acg aag 2082 Asp Val Wing Wing Trp Pro Asn Gly Lys Val Tyr Leu Gly Val Thr Lys 410 415 420 gtc gac ttc tec cag tac gat gac cag aag aat gaa acc tec acc cag 2130 Val Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln 425 430 435 440 acc tac gac tec aag cgc aac aat ggc cac gtc tec gcc cag gac tec 2178 Thr Tyr Asp Ser Lys Arg Asn Asn Gly His Val Ser Wing Gln Asp Ser 445 450 455 ate gac cag ctg ccg cct gag acc act gac gag ccc ctg gag aag gcc 2226 He Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Wing 460 465 470 tac tec cac cag ctg aac tac gcg gag tgc ttc ctg atg caa gac cgc 2274 Tyr Ser His Gln Leu Asn Tyr Wing Glu Cys Phe Leu Met Gln Asp Arg 475 480 485 a g gc acc ate ccc ttc ttc acc tgg acc ccc gc gcc gac tcc 2322 Arg Gly Thr He Pro Phe Phe Thr Trp Thr His Arg Ser Val Asp Phe 490 495 500 ttc aac acc ate gac gcc gag aag ate acc cag ctg ccc gtg gtc aag 2370 Phe Asn Thr He Asp Wing Glu Lys He Thr Gln Leu Pro Val Val Lys 505 510 515 520 ogaaaa - ».?., -,, s * u ^ & - gcc tac gcc ctg tec tcg ggt gcc tec ate att gag ggt cca ggc ttc 2418 Ala Tyr Ala Leu Ser Ser Gly Ala Ser He He Glu Gly Pro Gly Phe 525 530 535 acc ggt ggc aac ctg ctg ttc ctg aag gag tec tcg aac tec ate gcc 2466 Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn Ser Wing 540 545 550 aag ttc aag gtc acc ctg aac tec gct gcc ttg ctg caa cgc tac cgc 2514 Lys Phe Lys Val Thr Leu Asn Ser Ala Ala Leu Leu Gln Arg Tyr Arg 555 560 565 gtc cgc ate cgc tac gcc tec acc acg aac ctg cgc ctg ttc gtc cag 2562 Val Arg He Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln 570 575 580 aac tec aac aat gac ttc ctg gtc ate tac ate aac aag ac aac aac aac 2610 Asn As Asn Asp Ashe Phe Leu Val He Tyr He Asn Lys Thr Met Asn 585 590 595 600 aag gac gat gac ctg acc tac cag acc ttc gac etc gcc ac ac aac 2658 Lys Asp Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Wing Thr Thr Asn 605 610 615 10 tec aac ggc ttc tcg ggc gac aag aat gaa ctg ate att ggt gct 2706 Ser Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Le u He He Gly Wing 620 625 630 gag tec ttc gtc tec aat gaa aag ate tac ate gac aag ate gag ttc 2754 Glu Ser Phe Val Ser Asn Glu Lys He Tyr He Asp Lys He Glu Phe 635 640 645 ate ccc gtc cag ctg tgataggaac tctgattgaa ttctgcatgc gtttggacgt 2809 He Pro Val Gln Leu 650 atgctcattc aggttggagc caatttggtt gatgtgtgtg cgagttcttg cgagtctgat 2869 gagacatetc tgtattgtgt ttctttcccc agtgttttct gtacttgtgt aateggetaa 2929 tcgccaacag attcggcgat gaataaatga gaaataaatt gttctgattt tgagtgeaaa 2989 aaaaaaggaa ttagatctgt gtgtgttttt tggatccccg gggcggccgc 3039 < 210 > 20 < 211 > 653 < 212 > PRT < 213 > Artificial Sequence < 400 > 20 20 Met the? Sn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 r < a = ¿> .

Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Wing Lys 115 120 125 Ser Lys Wing Leu Wing Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Gly Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Wing Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 • To faith. - < * & amp & i &&g 3K > sHk- -i feaSSÚ * - »> . .a¿8 »3 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Being Ser Asn Being He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Wing Wing Leu Leu Gln Arg Tyr Arg Wing Arg Arg Tyr Wing Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Ala Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 21 < 211 > 3039 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: expression cassette < 220 > < 221 > promoter < 222 > (14) .. (235) < 223 > P-CaMV.AS4 < 220 > < 221 > 5'UTR < 222 > (240) .. (304) < 223 > L-Ta.hcbl < 220 > < 221 > intron < 222 > (318) .. (805) < 223 > I-OS Actl < 220 > < 221 > CDS < 222 > (811) .. (2769) < 223 > Cry3Bbl variant 11231mv2 < 220 > < 221 > terminator < 222 > (2787) .. (3020) < 223 > T-Ta.hspl7 10 < 400 > 21 gcggccgcgt taacaagctt ctgacgtaag ggatgacgca cctgacgtaa gggatgacgc 60 acctgacgta agggatgacg cacctgacgt aagggatgac gcactcgaga tccccatctc 120 cactgacgta agggatgacg cacaatccca ctatccttcg caagaccctt cctctatata 180 aggaagttca ttteatttgg agaggacacg ctgacaagct agcttggctg caggtagatc 240 ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg gacaacacac 300 cataagatec aagggaggcc tccgccgccg ccggtaacca ccccgcccct ctcctctttc 360 tttctccgtt tttttttccg tctcggtctc gatctttggc cttggtagtt tgggtgggcg 420 agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct cgcggctggg 480 gctctcgccg gcgtggatcc ggcccggatc tegeggggaa tggggctctc ggatgtagat 540 ctgcgatccg ccgttgttgg gggagatgat ggggggttta aaatttccgc cgtgctaaae 600 agaggggaaa aagatcagga agggcactat ggtttatatt tttatatatt tctgctgctt 660 cgtcaggctt agatgtgcta gatctttctt tcttcttttt gtgggtagaa tttgaatccc 720 tcagcattgt tcatcggtag tttttctttt catgatttgt gacaaatgea gcctcgtgcg 780 gagctttttt gtaggtagaa gtgatcaacc atg gcc aac ccc aac aat cgc tec 834 Met Wing Asn Pro Asn Asn Arg Ser 1 5 gag cac gac acg ate aag gtc acc ccc aac tec gag etc cag acc aac 882 Glu His Asp Thr He Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn 10 15 20 falls to ccg ccg ccg gcc gac aac ccc aac tec acc ctg gaa gag 930 His Asn Gln Tyr Pro Leu Wing Asp Pro Asn Ser Thr Leu Glu Glu 25 30 35 40 ctg aac taag aag gag ttc ctg cgc atg acc gag gac tec tec acg gag 978 Leu Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr Glu 45 50 55 gtc ctg gac aac tec acc gtc aag gac gcc gggc ggc ate tec 1026 Val Leu Asp Asn Ser Thr Val Lys Asp Ala Val Gly Thr Gly He Ser _ 60 65 70 5 gtc gtt ggg cag ate ggc ggc gtt gtt ggc gtc ccc tcc gca ggt gct gct 1074 Val Val Gly Gln He Leu Gly Val Val Gly Val Pro Phe Ala Gly Ala 75 80 85 etc acc tec ttc tac cag tec ttc ctg aac acc ate tgg ccc tec gac 1122 Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr He Trp Pro Ser Asp 90 95 100 gcc gac ccc tgg aag gcc ttc atg gcc caa gtc gaa gtc ctg ate gac 1170 Wing Asp Pro Trp Lys Wing Phe Met Wing Gln Val Glu Val Leu He Asp 105 110 115 120 10 9 aag ate gag gag tac gcc aag tec aag gcc ctg gcc gag ctg caa 1218 Lys Lys He Glu Glu Tyr Ala Lys Ser Lys Ala Leu To the a Glu Leu Gln 125 130 135 ggc ctg caa aac aac ttc gag gac tac gtc aac gcg ctg aac tec tgg 1266 Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp 140 145 150 aag aag acg cct ctg tec ctg cgc tec aag cgc tec cag gac cgc ate 1314 Lys Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln Asp Arg He 155 160 165 cgc gag ctg ttc tec cag gcc gag tec cac ttc cgc aac tec atg ccg 1362 Arg Glu Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn Ser Met Pro 15 170 175 180 tec ttc gcc gtc tec aag ttc gag gtc ctg ttc ctg ccc acc tac gcc 1410 Ser Phe Ala Val Ser Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala 185 190 195 200 cag gct gcc aac acc cac etc ctg ttg ctg aag gac gcc cag gtc ttc 1458 Gln Ala Ala Asn Thr H s Leu Leu Leu Lys Asp Wing Gln Val Phe 205 210 215 ggc gag gag tgg ggc tac tec tcg gag gac gtc gcc gc gac tcc tac cgt 1506 Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg 220 225 230 20 cgc cag ctg aag ctg acc a g ca g a cc ac gc a cc gc tc gc aac tgg 1554 Arg G ln Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys Val Asn Trp 235 240 245 tac aac gtc ggc ctg aac ggc ctg agg ggc tec acc tac gac gca tgg 1602 Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp Ala Trp 250 255 260 gtc aag ttc aac cgc tcc cgc agg gag atg acc ctg acc gtc ctg gac 1650 Val Lys Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp 265 270 275 280 ctg ate gtc ctg ttc ccc ttc tac gac ate cgc ctg tac tec aag ggc 1698 Leu He Val Leu Phe Pro Phe Tyr Asp He Arg Leu Tyr Ser Lys Gly 285 290 295 gtc aag acc gag ctg acc cgc gac ate ttc acg gac ccc ate ttc ctg 1746 Val Lys Thr Glu Leu Thr Arg Asp He Phe Thr Asp Pro He Phe Leu 300 305 310 etc acg acc etc cag aag tac ggt ccc acc ttc ctg tec ate gag aac 1794 Leu Thr Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser He Glu Asn 315 320 325 tec ate cgc aag ccc cac ctg ttc gac tac etc cag ggc ate gag ttc 1842 Ser He Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly He Glu Phe 330 335 340 falls acg cgc ctg agg cca ggc tac tcc ggc aag gac tec ttc aac tac 1890 His Thr Arg Leu Arg Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr 345 350 355 360 fc99 ec ggc aac tac gtc gag acc agg ccc tec ate ggc tec tcg aag 1938 Trp Ser Gly Asn Tyr Val Glu Thr Arg Pro Ser He Gly Ser Se r Lys 365 370 375 acg ate acc tec cct ttc tac ggc gac aag tec acc gag ccc gtc cag 1986 Thr He Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln 380 385 390 aag ctg tec ttc gac ggc cag aag gtc tac cgc acc ate gcc aac acc 2034 Lys Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr He Wing Asn Thr 395 400 405 gac gtc gcg gct tgg ccg aac ggc aag gtc tac ctg ggc gtc acg aag 2082 Asp Val Ala Wing Trp Pro Asn Gly Lys Val Tyr Leu Gly Val Thr Lys 410 415 420 gtc gac ttc tec cag tac gat gac cag aag aat gaa acc tec acc cag 2130 Val Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln 425 430 435 440 acc tac gac tec aag gg aac g gc cac gtc tec gcc cag gac tec 2178 Thr Tyr Asp Ser Lys Arg Asn Asn Gly His Val Ser Ala Gln Asp Ser 445 450 455 ate gac cag ctg ccg cct gag acc act gac gag ccc ctg gag aag gcc 2226 He Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Wing 460 465 470 tac tec cac cag ctg aac tac gcg gag tgc ttc ctg atg caa gac cgc 2274 Tyr Ser His Gln Leu Asn Tyr Wing Glu Cys Phe Leu Met Gln Asp Arg 475 480 485 agg ggc ccc ttc ttc tie acc acc acc TGG CGC tec cac gtc gac ttc Arg Gly Thr 2322 Phe Phe Thr Pro He Trp Thr Arg Ser His Asp Phe Val 490 495 500 ttc gac aac acc gcc tie gag cag aag acc tie CTG GTG ccc gtc aag 2370 Phe Asn Thr He Asp Wing Glu Lys He Thr Gln Leu Pro Val Val Lys 505 510 515 520 gcc tac gcc ctg tec tcg ggt gcc te ate att gag ggt cca ggc ttc 2418 Wing Tyr Wing Leu Ser Ser Gly Wing He He Glu Gly Pro Gly Phe 525 530 535 acc ggt ggc aac ctg ctg ttc ctg aag gag tec tcg aac tec ate gcc 2466 Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn Ser He Ala _ 540 545 550 aag ttc aag gtc acc ctg aac tec gct gcc ttg ctg caa cgc tac cgc 2514 Lys Phe Lys Val Thr Leu Asn Ser Wing Wing Leu Leu Gln Arg Tyr Arg 555 560 565 gtc cgc ate cgc tac gcc tec acc acg aac ctg cgc ctg ttc gtc cag 2562 Val Arg He Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln 570 575 580 aac tec aac aat gac ttc ctg gtc ate tac ate aac aag acc atg aac 2610 Asn Ser Asn Asn Asp Phe Leu Val He Tyr He Asn Lys Thr Met Asn 585 590 595 600 0 ag gc gat gac ctg acc tac cag acc ttc gac etc gcc ac ac aac 2658 Lys Asp Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Wing Thr Thr Asn 605 610 615 tec aac atg ggc ttc tcg ggc gac aag aat ctg gaa ate ggt gct att 2706 Asn Ser Met Gly Asp Lys Phe Gly Asn Ser Leu Glu Gly Ala He He 620 625 630 gag gtc ttc tec tec aag gaa aat gac aag ate ate tac ttc ate gag 2754 G lu Ser Phe Val Ser Asn Glu Lys I Tyr He Asp Lys I Glu Phe 635,640,645 ate ccc gtc cag CTG tgataggaac tctgattgaa ttctgcatgc gtttggacgt 2809 I Pro Val Gln Leu 5650 atgctcattc aggttggagc caatttggtt gatgtgtgtg egagttettg cgagtctgat 2869 gagacatetc tgtattgtgt ttctttcccc agtgttttct gtacttgtgt aateggetaa 2929 tcgccaacag attcggcgat gaataaatga gaaataaatt gttctgattt tgagtgeaaa 2989 aaaaaaggaa ttagatctgt gtgtgttttt tggatccccg gggcggccgc 3039 < 210 > 22 < 211 > 653 0 < 212 > PRT < 213 > Artificial Sequence < 400 > 22 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 5 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Wing Lys 115 120 125 Ser Lys Wing Leu Wing Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Wing Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Wing Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 Ile phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340 345 350 ¡Ik $? * & amp;. - ^ wat. > .- »Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Be Ser Lys Thr Xle Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser H s Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Ser Ser Asn Ser He Ala Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 23 < 211 > 3469 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: expression cassette < 220 > < 221 > promoter < 222 > (25) .. (640) < 223 > P-CaMV.35S < 220 > < 221 > 5'UTR < 222 > (664) .. (734) < 223 > L-Ta.hcbl < 220 > < 221 > intron < 222 > (748) .. (1238) < 223 > I-Os.Actl < 220 > < 221 > CDS < 222 > (1241) .. (3199) < 223 > Cry3Bbl variant 11231mv2 < 220 > < 221 > terminator < 222 > (3217) .. (3450) < 223 > T-Ta.hspl7 < 400 > 23 gcggccgcgt taacaagctt ctgcaggtcc gatgtgagac ttttcaacaa agggtaatat 60 ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg aagatagtgg 120 aaaaggaagg tggctcctac aaatgecate attgcgataa aggaaaggcc atcgttgaag 180 atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa 240 aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatggt ccgatgtgag 300 acttttcaac aaagggtaat atccggaaac ctcctcggat tccattgccc agetatetgt 360 cactttattg tgaagatagt ggaaaaggaa ggtggctcct acaaatgeca tcattgcgat 420 aaaggaaagg ccatcgttga agatgectet gccgacagtg tggaccccca gtcccaaaga 480 cccacgagga gcatcgtgga aaaagaagac gttccaacca cgtcttcaaa gcaagtggat 540 tctccactga tgatgtgata cgtaagggat gacgcacaat cccactatcc ttcgcaagac 600 ccttcctcta tataaggaag ttcatttcat ttggagagga cacgctgaca agctgactct 660 ageagatect ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg 720 gacaacacac cataagatec aagggaggcc tccgccgccg ccggtaacca ccccgcccct 780 ctcctctttc tttctccgtt tttttttccg tctcggfcctc gatctttggc cttggtagtt 840 tgggtgggcg agag gcggct tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct 900 cgcggctggg gctctcgccg gcgtggatcc ggcccggatc tegeggggaa tggggctctc 960 ggatgtagat ctgcgatccg cegttgttgg gggagatgat ggggggttta aaatttccgc 1020 cgtgctaaac aagatcagga agaggggaaa agggcactat ggtttatatt tttatatatt 1080 _ Tctgctgctt cgtcaggett agatgtgeta gatctttctt tcttcttttt gtgggtagaa 1140 tttgaatccc tcagcattgt tcatcggtag tttttctttt catgatttgt gacaaatgea 1200 gcctcgtgcg gagctttttt gtaggtagaa gtgatcaacc atg gcc aac ccc aac 1255 Met Ala Asn Pro Asn 1 May aat cgc tec gag cac gac acg ate aag gtc acc ccc aac tec gag etc 1303 Asn Arg Ser Glu His Asp Thr He Lys Val Thr Pro Asn Ser Glu Leu 10 15 20 cag acc aac cac aac cag tac ccg ctg gcc gac aac ccc aac tec acc 1351 Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp Asn Pro Asn Ser Thr 0 25 30 35 ctg gaa gag ctg aac tac aag gag ttc ctg cgc atg acc gag gac tec 1399 Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser 40 45 50 tec acg gag gtc ctg gac aac tec acc gtc aag gac gcc gtc ggg acc 1447 Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp Ala Val Gly Thr 55 60 65 ggc ate tec gtc gtt ggg ggc cag ate gtc gtc gtt ggc gte ccc ttc 1495 Gly He Ser Val Val Gly Gln He Leu Gly Val Val Gly Val Pro Phe 70 75 80 85 '3 gca ggt gct etc acc tec ttc tac cag tec ttc ctg aac acc ate tgg 1543 Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr He Trp 90 95 100 ccc tec gac gcc gac ccc tgg aag gcc ttc atg gcc caa gtc gaa gtc 1591 Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met Ala Gln Val Glu Val 105 110 115 ctg ate gac aag aag ate gag gag tac gcc aag tec aag gcc ctg gcc 1639 Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala 120 125 130 gag ctg caa ggc ctg caa aac aac tcc gag gac tac gcc aac gcg ctg 1687 0 Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu 135 140 145 aac tec tg aag aag a cg cct cc g c tc cc c tec aag c gc tec cag 1735 Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln 150 155 160 165 gac cgc ate cgc gag ctg ttc tec cag gcc gag tec cac ttc cgc aac 1783 Asp Arg He Arg Glu Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn 170 175 180 tec atg ccg tec ttc gcc gtc tec aag ttc gag gtc ctg ttc ctg ccc 1831 Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu Val Leu Phe Leu Pro 185 190 195 acc tac gcc cag gct gcc aac acc cac etc ctg ttg ctg aag gac gcc 1879 Thr Tyr Wing Gln Wing Ala Asn Thr His Leu Leu Leu Leu Lys Asp Wing 200 205 210 cag gtc gtc tgc gag gag tgg ggc tac tec tcg gag gac gtc gcc gag 1927 Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Glu Asp Val Ala Glu 215 220 225 ttc tac cgt cgc cag ctg aag ctg c agac ca g a cc acca gcac tcc 1975 Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys 230 235 240 245 gtc aac tgg tac aac gtc ggc ctg aac ggc ctg agg ggc tec acc tac 2023 Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr 250 255 260 gac gca tgg gtc aag ttc aac cgc ttc cgc agg gag atg acc ctg acc 2071 Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr 265 270 275 10 9tc ct9 9ac ctg ate gtc ctg ttc ccc ttc tac gac ate cc cc tac tac 2119 Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr Asp He Arg Leu Tyr 280 285 290 tec aag ggc gtc aag acc gag ctg acc cgc gac ate tcc acg gac ccc 2167 Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp He Phe Thr Asp Pro 295 300 305 ate ttc ctg etc acg acc ect cag aag tac ggt ccc acc ttc ctg tec 2215 He Phe Leu Leu Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser 310 315 320 325 ate gag aac tec ate cgc aag ccc cac ctg tcc gac tac etc cag ggc 2263 He Glu Asn Ser He Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly 15 330 335 340 ate gag ttc cac acg cgc ctg agg cca ggc tac tcc ggc aag gac tec 2311 He Glu Phe His Thr Arg Leu Arg Pro Gly Tyr Phe Gly Lys Asp Ser 345 350 355 ttc aac tac tgg tec ggc aac tac gtc gag acc agg ccc tec gcc 2359 Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg Pro Ser He Gly 360 365 370 tec tcg aag acg ate ac tec cct ttc tac ggc gac aag tec gag 2407 Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu 375 380 385 20 ccc gtc cag aag ctg tec ttc gac ggc cag aag gtc tac cgc acc ate 2455 Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr He 390 395 400 405 gcc aac ac gac gtc gcg gct tgg ccg aac ggc aag gtc tac ctg ggc 2503 Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly Lys Val Tyr Leu Gly 410 415 420 gtc acg aag gtc gac ttc tec cag tac gat gac cag aag aat gaa acc 2551 Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr 425 430 435 tce acc acc gc tc gc aac a gc c gcc tec gcc 2599 Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly His Val Ser Wing 440 445 450 cag gac tec ate gac cag ctg ccg cct gag acc act gac gac ccc ctg 2647 Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu 455 460 465 gag aag gcc tac tec cac cag ctg aac tac gcg gag tgc ttc ctg atg 2695 Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala Glu Cys Phe Leu Met 470 475 480 485 caa gac cgc agg ggc acc ate ccc ttc ttc acc tgg ccc ac acc 2743 Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr Trp Thr His Arg Ser 490 495 500 gtc gac ttc tcc aac acc ate gac gcc gag aag ate accc cc cg ccc 2791 Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys He Thr Gln Leu Pro 505 510 515 9t9 gc aa.g gcc tac gcc ctg tec tcg ggt gcc tec ate att gag ggt 2839 Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala Ser He He Glu Gly 520 525 530 cca ggc ttc acc ggt ggc aac ctg ctg ttc ctg aag gag tec tcg aac 2887 Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn 535 540 545 tec ate gcc aag ttc aag gtc acc ctg aac tec gct gcc ttg ctg caa 2935 Ser He Wing Lys Phe Lys Val Thr Leu Asn Ser Ala Wing Leu Leu Gln 550 555 560 565 cgc tac cgc gtc cgc ate cgc tac gcc tec acc acg aac ctg cgc ctg 2983 Arg Tyr Arg Val Arg He Arg Tyr Wing Being Thr Thr Asn Leu Arg Leu 570 575 580 ttc gtc cag aac aat gac ttc ctg gtc ate ate aac aag aaag 3031 Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val He Tyr He Asn Lys 585 590 595 acc atg aac aac gac gat gac ctg acc tac cag acc ttc gac etc gcc 3079 Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Wing 600 605 610 acc acg aac tec aac ggc ttc tcg ggc gac aag aat gaa ctg ate 3127 Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Leu He 615 620 625 att ggt gct gag tec ttc gtc tec aat gaa aag ate tac ate gac aag 3175 He Gly Ala Glu Ser Phe Val Ser Asn Glu Lys He Tyr He Asp Lys 630 635 640 645 ate gag ttc ate ccc gtc cag ctg tgataggaac tetgattgaa ttctgcatgc 3229 He Glu Phe He Pro Val Gln Leu 650 -teSte the FFI l ^ to ^^ jai-iM-at = - ^ aé gtttggacgt atgctcattc aggttggagc caatttggtt gatgtgtgtg egagttettg 3289 cgagtctgat gagacatetc tgtattgtgt ttctttcccc agtgttttct gtacttgtgt 3349 aateggetaa tcgccaacag attcggcgat gaataaatga gaaataaatt gttctgattt 3409 aaaaaaggaa tgagtgeaaa ttagatctgt gtgtgttttt tggatccccg gggcggccgc 3469 < 210 > 24 j. < 211 > 653 5 < 212 > PRT < 213 > Artificial Sequence < 400 > 24 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 10 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Wing Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys 115 120 125 15 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 20 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 19 5 200 205 Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thr Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365? Rg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 Ile Tnr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Ser Ser Asn Be He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Wing Wing Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Wing Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn As Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 25 < 211 > 416 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: nucleotide sequence that does not occur naturally encoding for peptide targeting ribulphase of ribulose bis-phosphate carboxylase from .Zea mays < 220 > < 221 > CDS < 222 > (16) .. (162) < 220 > < 221 > CDS < 222 > (326) .. (415) <; 220 > < 221 > intron < 222 > (163) .. (325) < 223 > I-Zm.rbcS < 400 > 25 ttetagagga teage atg gcg ccc acc gtg atg atg gee tcg tcg gcc acc 51 Met Wing Pro Thr Val Met Met Wing Being Ser Wing Thr 1 5 10 gcc gtc gct ccg ttc ctg ggg etc aag tec acc gcc age etc ccc gtc 99 Wing Val Wing Pro Phe Leu Gly Leu Lys Be Thr Wing Ser Leu Pro Val 15 20 25 gcc cgc cgc tec tec aga age etc ggc aac gtc age aac ggc gga agg 147 Wing Arg Arg Ser Ser Arg Ser Leu Gly Asn Val Ser Asn Gly Gly Arg 30 35 40 ate cgg tgc atg cag gtaacaaatg catcctagct agtagttctt tgcattgcag 202 He Arg Cys Met Gln 45 cagctgcagc tagegagtta gtaataggaa gggaactgat gatccatgca tggactgatg 262 tgtgttgccc atcccatccc atcccatttc ccaaacgaac cgaaaacacc gtactacgtg 322 cag gtg tgg ccc tac ggc aac aag aag ttc gag acg ctg tcg tac ctg 370 Val Trp Pro Tyr Gly Asn Lys Lys Phe Glu Thr Leu Ser Tyr Leu 50 55 60 ccg ccg ctg tcg acc ggc ggg cgc ate cgc tgc atg cag gcc atg g 416 Pro Pro Leu Ser Thr Gly Gly Arg He Arg Cys Met Gln Ala Met 65 70 75 < 210 > 26 < 211 > 79 < 212 > PRT < 213 > Artificial Sequence < 400 > 26 Met Wing Pro Thr Val Met Met Wing Being Ser Wing Thr Wing Val Wing Pro 1 5 10 15 Phe Leu Gly Leu Lys Ser Thr Wing Being Leu Pro Val Wing Arg Arg Being 20 25 30 Being Arg Being Leu Gly Asn Val Being Asn Gly Gly Arg He Arg Cys Met 35 40 45 Gln Val Trp Pro Tyr Gly Asn Lys Lys Phe Glu Thr Leu Ser Tyr Leu 50 55 60 Pro Pro Leu Ser Thr Gly Gly Arg He Arg Cys Met Gln Ala Met 65 70 75 < 210 > 27 < 211 > 49 < 212 > PRT < 213 > Artificial Sequence < 400 > 27 Met Ala Pro Thr Val Met Met Ala Be Ser Ala Thr Ala Ala Ala Pro 1 5 10 15 Phe Leu Gly Leu Lys Ser Thr Ala Ser Leu Pro Val Ala Arg Arg Ser 20 25 30 Ser Arg Ser Leu Gly Asn Val Ser Asn Gly Gly Arg He Arg Cys Met 35 40 45 Gln < 210 > 28 < 211 > 30 < 212 > PRT < 213 > Artificial Sequence < 400 > 28 Val Trp Pro Tyr Gly Asn Lys Lys Phe Glu Thr Leu Ser Tyr Leu Pro 1 5 10 15 Pro Leu Ser Thr Gly Gly Arg He Arg Cys Met Gln Ala Met 20 25 30 < 210 > 29 < 211 > 202 _ < 212 > DNA ^ < 213 > Cauliflower mosaic virus < 400 > 29 gacgcacctg acgtaaggga tgacgcacct gaegtaaggg atgacgcacc tgacgtaagg 60 gatgacgcac tcgagatccc catctccact gaegtaaggg atgacgcaca atcccactat 120 ccttcgcaag acccttcctc tatataagga agttcatttc atttggagag gacacgctga 180 caagetaget tggctgcagg t 202 < 210 > 30 10 < 211 > 416 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: AS4 promoter of modified cauliflower mosaic virus < 400 > 30 ttetagagga tcagcatggc gcccaccgtg atgatggcct cgtcggccac cgccgtcgct 60 ccgttcctgg ggctcaagtc caccgccagc ctccccgtcg cccgccgctc ctccagaagc 120 ctcggcaacg tcagcaacgg cggaaggatc cggtgcatgc aggtaacaaa tgcatcctag 180 15 ctagtagttc tttgcattgc ageagetgea gctagcgagt tagtaatagg aagggaactg 240 atgatccatg catggactga tgtgtgttgc ccatcccatc ccatcccatt tcccaaacga 300 accgaaaaca ccgtactacg tgcaggtgtg gccctacggc aacaagaagt tegagaeget 360 gtcgtacctg ccgccgctgt cgaccggcgg gcgcatccgc tgcatgcagg ccatgg 416 < 210 > 31 < 211 > 75 < 212 > DNA 20 < 213 > Triticum aestivum < 400 > 31 ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg gacaacacac 60 cataagatec aaggg 75 fe ^^^^ fe ^ jt ^ fefe - ^^^ a ^ s ^ Bi ^ fc ^ »^». - * - '- &HMKttti -__ * - M ^.? iai ^^ < 210 > 32 < 211 > 804 < 212 > DNA < 213 > Oryza sp. < 400 > 32 accgtcttcg gtacgcgctc actccgccct ctgcctttgt tactgccacg tttctctgaa 60 tgctctcttg tgtggtgatt gctgagagtg gtttagctgg atctagaatt acactctgaa 120 atcgtgttct gcctgtgctg attacttgcc gtcctttgta gcagcaaaat atagggacat 180 aaegaagata ggtagtaega gaacctacac agcaatacga gaaatgtgta atttggtget 240 tageggtatt tatttaagea catgttggtg ttatagggea cttggattca gaagtttgct 300 gttaatttag gcacaggctt catactacat gggtcaatag tatagggatt catattatag 360 gegatactat aataatttgt tcgtctgcag agettattat ttgccaaaat tagatattec 420 tattctgttt ttgtttgtgt gctgttaaat tgttaacgcc tgaaggaata aatataaatg 480 acgaaatttt gatgtttatc tctgctcctt tattgtgacc ataagtcaag ateagatgea 540 cttgttttaa atattgttgt ctgaagaaat aagtactgac agtattttga tgcattgatc 600 tgcttgtttg ttgtaacaaa atttaaaaat aaagagtttc ctttttgttg ctctccttac 660 ctcctgatgg tatetagtat ctaccaactg acactatatt gcttctcttt acatacgtat 720 cttgctcgat gccttctccc tagtgttgac cagtgttact cacatagtct ttgctcattt cattgtaatg cagataccaa GCGG 780 804 < 210 > 33 < 211 > 804 < 212 > DNA < 213 > Zea mays < 400 > 33 accgtcttcg gtacgcgctc actccgccct ctgcctttgt tactgccacg tttctctgaa 60 tgctctcttg tgtggtgatt gctgagagtg gtttagctgg atctagaatt acactctgaa 120 atcgtgttct gcctgtgctg attacttgcc gtcctttgta gcagcaaaat atagggacat 180 aaegaagata ggtagtaega gaacctacac agcaatacga gaaatgtgta atttggtget 240 tageggtatt tatttaagea catgttggtg ttatagggea cttggattca gaagtttgct 300 gttaatttag gcacaggctt catactacat gggtcaatag tatagggatt catattatag 360 gegatactat aataatttgt tcgtctgcag agettattat ttgccaaaat tagatattec 420 tattctgttt ttgtttgtgt gctgttaaat tgttaacgcc tgaaggaata aatataaatg 480 acgaaatttt gatgtttatc tctgctcctt tattgtgacc ataagtcaag ateagatgea 540 cttgttttaa atattgttgt ctgaagaaat aagtactgac agtattttga tgcattgatc 600 tmli? ' i < aLaLa- »JaJSsftJ 'tgcttgtttg ttgtaacaaa atttaaaaat aaagagtttc etttttgttg ctctccttac 660 ctcctgatgg tatetagtat ctaccaactg acactatatt gcttctcttt acatacgtat 720 cttgctcgat gccttctccc tagtgttgac cagtgttact cacatagtct ttgctcattt 780 cattgtaatg cagataccaa gcgg 804 < 210 > 34 < 211 > 257 < 212 > DNA < 213 > Agrobacterium tumefaciens < 400 > 34 tcccgatcgt tcaaacattt ggcaataaag tttettaaga ttgaatcctg ttgccggtct 60 tgcgatgatt atcatataat ttctgttgaa ttacgttaag catgtaataa ttaacatgta 120 atgcatgacg ttatttatga gatgggtttt tatgattaga gtcccgcaat tatacattta 180 ataegegata gaaaacaaaa tatagcgcgc aaactaggat aaattatege gcgcggtgtc 240 257 atctatgtta ctagatc < 210 > 35 < 211 > 234 < 212 > DNA < 213 > Traticum aestivum < 400 > 35 aattctgcat gcgtttggac gtatgetcat tcaggttgga gccaatttgg ttgatgtgtg 60 tgcgagttct tgcgagtctg atgagacatc tctgtattgt gtttctttcc ccagtgtttt 120 ctgtacttgt gtaatcggct aatcgccaac agattcggcg atgaataaat gagaaataaa 180 ttgttctgat tttgagtgca aaaaaaaagg aattagatct gtgtgtgttt TTTG 234 < 210 > 36 < 211 > 3455 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence expression cassette < 220 > < 221 > promoter < 222 > (14) (235) < 223 > P CaMV AS4 < 220 > < 221 > 5'UTR < 222 > (240) (304) < 223 > L-Ta hcbl < 220 > < 221 > intron < 222 > (318) .. (805) < 223 > I-OS.ACtl < 220 > < 221 > transit peptide < 222 > (825) .. (971) < 223 > TS-Zm.rbcS amino terminal coding sequence towards the 5 'end of the rbcS intron of Zea mays < 220 > < 221 > intron < 222 > (972) .. (1134) < 223 > I-Zm.rbcS < 220 > < 221 > transit peptide < 222 > (1135) .. (1221) < 223 > TS-Zm.rbcS encoding sequence carboxy terminus towards the 3 'end of the rbcS intron of Zea mays < 220 > < 221 > CDS < 222 > (1222) .. (3180) < 223 > variant coding sequence Cry3BBl coding for V11231 < 220 > < 22l > terminator < 222 > (3198) .. (3431) < 223 > T-Ta.hspl7 < 400 > 36 gcggccgcgt taacaagctt ctgacgtaag ggatgacgca cctgacgtaa gggatgacgc 60 acctgacgta agggatgacg cacctgacgt aagggatgac gcactcgaga tccccatctc 120 cactgacgta agggatgacg cacaatccca ctatccttcg caagaccctt cctctatata 180 aggaagttca ttteatttgg agaggacacg ctgacaagct agcttggctg caggtagatc 240 ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg gacaacacac 300 cataagatec aagggaggcc tccgccgccg ccggtaacca ccccgcccct ctcctctttc 360 tttctccgtt tttttttccg tctcggtctc gatctttggc cttggtagtt tgggtgggcg 420 agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct cgcggctggg 480 gctctcgccg gcgtggatcc ggcccggatc tegeggggaa tggggctctc ggatgtagat 540 ctgcgatccg cegttgttgg gggagatgat ggggggttta aaatttccgc cgtgctaaac 600 agaggggaaa aagatcagga agggcactat ggtttatatt tttatatatt tctgctgctt 660 cgtcaggett agatgtgeta gatctttctt tcttcttttt gtgggtagaa tttgaatccc 720 tcagcattgt tcatcggtag tttttctttt catgatttgt gacaaatgea gcctcgtgcg 780 gagctttttt gtaggtagaa gtgatcaacc tctagaggat cagcatggcg cccaccgtga 840 tgatggcctc gtcggcc acc gccgtcgctc cgttcctggg gctcaagtcc accgccagcc 900 tccccgtcgc ccgccgctcc tccagaagcc tcggcaacgt cagcaacggc ggaaggatcc 960 ggtgcatgca ggtaacaaat gcatcctagc tagtagttct ttgcattgca gcagctgcag 1020 etagegagtt agtaatagga agggaactga tgatccatgc atggactgat gtgtgttgec 1080 catcccatcc catcccattt cccaaacgaa ccgaaaacac cgtactacgt geaggtgtgg 1140 ccctacggca acaagaagtt cgagacgctg tcgtacctgc cgccgctgtc gaccggcggg 1200 cgcatccgct gcatgcaggc c atg gca aac cct aac aat cgt tec gaa cac 1251 Met Wing Asn Pro Asn Asn Arg Ser Glu His 1 5 10 gac acc ate aag gtt act cca aac tet gag ttg caa act aat cac aac 1299 Asp Thr He Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn His Asn 15 20 25 cag tac cca ttg gct gac aat cct aac agt act ctt gag gaa ctt aac 1347 Gln Tyr Pro Leu Wing Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn 30 35 40 tac aag gag ttt etc cgg atg acc gaa gat age tec act gag gtt etc 1395 Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr Glu Val Leu 45 50 55 gat aac tet here gtg aag gac gct gtt gga act ggc att age gtt gtg 1443 Asp Asn Ser Thr Val Lys Asp Wing Val Gly Thr Gly He Ser Val Val 60 65 70 gga cag att ctt gga gtg gtt ggt gtt cca ttc gct gga gct ttg acc 1491 Gly Gln He Leu Gly Val Val Gly Val Pro Phe Ala Gly Ala Leu Thr 75 80 85 90 age ttc tac cag tec ttt etc aac acc ate tgg cct tea gat gct gat 1539 Ser Phe Tyr Gln Ser Phe Leu Asn Thr He Trp Pro Ser Asp Wing Asp 95 100 105 ccc tgg aag gct ttc atg gcc caa gtg gaa gtc ttg ate gat aag aag 1587 Pro Trp Lys Wing Phe Met Wing Gln Val Glu Val Leu He Asp Lys Lys 110 115 120 ate gaa gag tat gcc aag tet aaa gcc ttg gct gag ttg caa ggt ttg 1635 He Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu 125 130 135 cag aac aac ttc gag gat tac gac aac gca etc aac age tgg aag aaa 1683 Gln Asn? Sn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys 140 145 150 act ccc ttg agt etc agg tet aag cgt tec cag gac cgt att cgt gaa 1731 Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln Asp Arg He Arg Glu 155 160 165 170 ctt ttc age caa gcc gaa tec cac ttc aga aac tec atg cct age ttt 1779 Leu Phe Ser Gln Wing Glu Ser His Phe Arg Asn Ser Met Pro Ser Phe 175 180 185 gcc gtt tet aag ttc gag gtg etc ttc ttg cca here tac gca caa gct 1827 Wing Val Ser Lys Phe Glu Val Leu Phe Leu Pro T hr Tyr Ala Gln Wing 190 195 200 gcc aac act cat etc ttg ctt etc aaa gac gct cag gtg ttt ggt gag 1875 Wing Asn Thr His Leu Leu Leu Leu Lys Asp Wing Gln Val Phe Gly Glu 205 210 215 gaa tgg ggt tac tec agt gaa gat gtt gcc gag tcc tac cgt agg cag 1923 Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln 220 225 230 etc aag ttg act caa cac tac ac gac cac tcc aac tgg taac aac 1971 Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys Val Asn Trp Tyr Asn 235 240 245 250 gtt ggg etc aat ggt ctt aga gga tet acc tac gac gg tgg gtg aag 2019 Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys 255 260 265 ttc aac agg ttt cgt aga gag atg acc ttg act gtg etc gat ctt ate 2067 Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp Leu He 270 275 280 gtt etc ttt cca ttc tac gac att cgt ctt tac tec aaa ggc gtt aag 2115 Val Leu Phe Pro Phe Tyr Asp He Arg Leu Tyr Ser Lys Gly Val Lys 285 290 295 here gag ctg acc aga gac ate ttc acc gat ccc ate ttc cta ctt acg 2163 Thr Glu Leu Thr Arg A sp He Phe Thr Asp Pro He Phe Leu Leu Thr 300 305 310 acc ctg cag aaa tac ggt cca act ttt etc tec att gag aac age ate 2211 Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser He Glu Asn Ser He 315 320 325 330 agg aag cct cac etc ttc gac tat ctg caa ggc att gag ttt cac ace 2259 Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly He Glu Phe His Thr 335 340 345 agg ttg caa cct ggt tac ttc ggt aag gat tec ttc aac tac tgg age 2307 Arg Leu Gln Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser 350 355 360 gga aac tac gtt gaa acc aga cca tec ate gga tet age aag acc ate 2355 Gly Asn Tyr Val Glu Thr Arg Pro Ser He Gly Ser Ser Lys Thr He 365 370 375 act tet cca ttc tac ggt gac aag age act gag cca gtg cag aag ttg 2403 Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln Lys Leu 380 385 390 age ttc gat ggg cag aag gtg tat aga acc ate gcc aat acc gat gtt 2451 Be Phe Asp Gly Gln Lys Val Tyr Arg Thr He Wing Asn Thr Asp Val 395 400 405 410 gca gct tgg cct aat ggc aag gtc tac >c ctt gga gtt act aaa gtg gac 2499 Wing Wing Trp Pro Asn Gly Lys Val Tyr Leu Gly Val Thr Lys Val Asp 415 420 425 ttc tec caa tac gac gat cag aag aac gag here tet act a tta ac tac 2547 Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr 430 435 440 gat agt aag agg aac aat ggc cat gtt tec gca caa gac tec att gac 2595 Asp Ser Lys Arg Asn Asn Gly His Val Ser Ala Gln Asp Ser He Asp 445 450 455 caa ctt cca cct ect gaa acc act gat gaa cca ttg gag aag gct tac agt 2643 Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser 460 465 470 falls caa ctt aac tac gcc gaa tgc ttt etc atg caa gac agg cgt ggc 2691 His Gln Leu Asn Tyr Wing Glu Cys Phe Leu Met Gln Asp Arg Arg Gly 475 480 485 490 ace att ccg ttc ttt here tgg act cag agg tet gtc gac ttc ttt aac 2739 Thr He Pro Phe Phe Thr Trp Thr His Arg Ser Val Asp Phe Phe Asn 495 500 505 ct ate gac gct gag aag att ac cta ctt ccc gtg gtc aag gct tat 2787 Thr He Asp Ala Glu Lys He Thr Gln Leu Pro Val Val Lys Wing Tyr 510 515 520 gcc ttg tec age gga gct tec ate att gaa ggt cca ggc ttc acc ggt 2835 Wing Leu Ser Ser Gly Wing Be He He Glu Gly Pro Gly Phe Thr Gly 525 530 535 ggc aac ttg etc ttc ctt aag gag tec age aac tec ate gcc aag ttc 2883 Gly Asn Leu Leu Phe Leu Lys Glu Be Ser Asn Ser He Wing Lys Phe 540 545 550 aaa gtg here ctt aac tea gca gcc ttg etc caa cgt tac agg gtt cgt 2931 Lys Val Thr Leu Asn Be Ala Ala Leu Leu Gln Arg Tyr Arg val Arg 555 560 565 570 ate aga tac gca age act acc aat ctt cgc etc ttt gtc cag aac age 2979 He Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln Asn Ser 575 580 585 aac aat gat ttc ctt gtc at ate aac aac aac aag aac aaaa gac 3027 Asn Asn Asp Phe Leu Val He Tyr He Asn Lys Thr Met Asn Lys Asp 590 595 600 gat gac ect accc ation tc cc tc cc gcct acc aat agt aac 3075 Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Wing Thr Thr Asn Ser Asn 605 610 615 atg gga ttc tet ggt gac aag aac gag ctg ate ata ggt gct gag age 3123 Met Gly Phe Be Gly Asp Lys Asn Glu Leu He He Gly Wing Glu Be 620 625 630 ttt gtc tet aat gag aag att tac ata gac aag ate gag ttc att cca 3171 Phe Val Ser Asn Glu Lys He Tyr He Asp Lys He Glu Phe He Pro 635 640 645 650 caa gtt etc taatagatec cecgggctgc aggaattctg Val Gln Leu 3220 catgcgtttg gaegtatget catteaggtt ggagecaatt tggttgatgt gtgtgcgagt tcttgcgagt 3280 ctgatgagac atctctgtat tgtgtttctt tccccagtgt tttctgtact tgtgtaateg 3340 gctaatcgcc aacagattcg gcgatgaata aatgagaaat aaattgttet gattttgagt 3400 aggaattaga gcaaaaaaaa tctgtgtgtg ttttttggat ccccggggcg gcege 3455 < 210 > 37 < 211 > 653 < 212 > PRT < 213 > Artificial Sequence < 400 > 37 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30? Sn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Wing Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Ala Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140 Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu 195 200 205 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210 215 220 Glu Asp Val Wing Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr 340 345 350 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly His Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530"535 540 Lys Glu Ser Ser Asn Ser He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Wing Wing Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Wing Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Being Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 10 <210> 38 <211 > 3044 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Expression Cassette < 220 > < 221 > promoter < 222 > (14) . (235) 1 5 < 223 > P-CaMV. AS4 < 220 > < 221 > 5'UTR < 222 > (240) .. (304) < 223 > L-Ta.hcbl < 220 > < 221 > intron < 222 > (318) .. (805) < 223 > I-OS.ACtl < 220 > 20 < 221 > CDS < 222 > (811) .. (2769) < 223 > variant coding sequence Cry3Bbl that encodes vll231 < 2.20 > < 22l > terminator < 222 > (2792) .. (3025) < 223 > T-Ta.hspl7 gsfes | ^^ »a £ | gfc fag < 400 > 38 gcggccgcgt taacaagctt ctgacgtaag ggatgacgca cctgacgtaa gggatgacgc 60 acctgacgta agggatgacg cacctgacgt aagggatgac gcactcgaga tccccatctc 120 cactgacgta agggatgacg cacaatccca ctatccttcg caagaccctt cctctatata 180 aggaagttca ttteatttgg agaggacacg ctgacaagct agcttggctg caggtagatc 240 cttccacaca ctagaaccat ctcaagccae actattggag aacacacagg gacaacacac 300 cataagatec aagggaggcc tccgccgccg ccggtaacca ccccgcccct ctcctctttc 360 tttctccgtt tttttttccg tctcggtctc gatctttggc cttggtagtt tgggtgggcg 420 agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct cgcggctggg 480 gctctcgccg gcgtggatcc ggcccggatc tegeggggaa tggggctctc ggatgtagat 540 ctgcgatccg cegttgttgg gggagatgat ggggggttta aaatttccgc cgtgetaaac 600 agaggggaaa aagatcagga agggcactat ggtttatatt tttatatatt tctgctgctt 660 cgtcaggett agatgtgeta gatctttctt tcttcttttt gtgggtagaa tttgaatccc 720 tcagcattgt tcatcggtag tttttctttt catgatttgt gacaaatgea gcctcgtgcg 780 gagctttttt gtaggtagaa gtgatcaacc atg gca aac cct aac aat cgt tec 834 Met Ala Asn Pro As n Asn Arg Ser 1 5 gaa cac gac acc ate aag gtt act cca aac tet gag ttg caa act aat 882 Glu His Asp Thr He Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn 10 15 20 cac aac cag tac cca ttg gct gac aat cct aac agt act ctt gag gaa 930 His Asn Gln Tyr Pro Leu Wing Asp Pro Asn Ser Thr Leu Glu Glu 25 30 35 40 ctt aac tac aag gag ttt etc cgg atg acc gaa gat age tech act gag 978 Leu Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr Glu 45 50 55 gtt etc gat aac tet here gtg aag gac gct gtt gga act ggc att age 1026 Val Leu Asp Asn Ser Thr Val Lys Asp Wing Val Gly Thr Gly He Ser 60 65 70 gtt gtg gga cag att ctt gt gtg gtt gtc gtt cca tcc gct ggc gct 1074 Val Val Gly Gln He Leu Gly Val Val Gly Val Pro Phe Ala Gly Ala 75 80 85 ttg acc age ttc tac cag tec ttt etc aac acc ate tgg cct tea gat 1122 Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr He Trp Pro Ser Asp 90 95 100 gct gat ccc tgg aag gct ttc atg gcc caa gtg gaa gtc ttg ate gat 1170 Wing Asp Pro Trp Lys Wing Phe Met Wing Gln Val Glu Val Leu He Asp 105 110 115 120 aag aag ate gaa tat gcc aag tet aaa gcc ttg gct gag ttg caa 1218 Lys Lys He Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala Glu Leu Gln 125 130 135 ggt tgc tcg tcg tcg tcc tcc gc tc aac gcc aac age tcg 1266 Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Wing Leu Asn Ser Trp 140 145 150 aag aaa act ccc ttg agt etc agg tet aag cgt tec cag gac cgt att 1314 Lys Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln Asp Arg He 155 160 165 cgt gaa ctt ttc age caa gcc gaa tec cac ttc aga aac tec atg cct 1362 Arg Glu Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn Ser Met Pro 170 175 180 age ttt gcc gtt tet aag ttc gag gtg etc ttc ttg cca ac tac gca 1410 Ser Phe Ala Val Ser Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala 185 190 195 200 caa gct gcc aac act cat etc ttg ctt etc aaa gac gct cag gtg ttt 1458 Gln Ala Ala Asn Thr His Leu Leu Leu Leu Lys Asp Ala Gln Val Phe 205 210 215 10 ggt gag gag tgg ggt tac tec agt gaa gat gtt gcc gc gag tcc tac cgt 1506 Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Wing Glu Phe Tyr Arg 220 225 230 agg cag etc aag ttg act caa cag tac here gac cac tgc gtc aac tgg 1554 Arg Gln Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys Val Asn Trp 235 240 245 tac aac gtt ggg etc aat ggt ctt aga gga tet acc tac gac gca tgg 1602 Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp Ala Trp 250 255 260 15 gtg aag ttc aac agg ttt cgt aga gag atg acc ttg act gtg etc gat 1650 Val Lys Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp 265 270 275 280 ctt ate gtt etc ttt cca ttc tac gac att cgt ctt tac tec aaa ggc 1698 Leu He Val Leu Phe Pro Phe Tyr Asp He Arg Leu Tyr Ser Lys Gly 285 290 295 gtt aag here gag ctg acc aga gac ate ttc acc gat ccc ate ttc cta 1746 Val Lys Thr Glu Leu Thr Arg Asp He Phe Thr Asp Pro He Phe Leu 300 305 310 ctt acg acc ctg cag aaa tac ggt cca act ttt etc tec att gag aac 179420 Leu Thr Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser He Glu Asn 315 320 325 age ate agg aag cct cac etc ttc gac tat ctg caa ggc att gag ttt 1842 Ser He Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly He Glu Phe 330 335 340 falls acc agg ttg caa cct ggt tac ttc ggt aag gat tec ttc aac tac 1890 His Thr Arg Leu Gln Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr 345 350 355 360 tgg age gga aac tac gtt gaa acc aga cca tec ate gga tet age aag 1938 Trp Ser Gly Asn Tyr Val Glu Thr Arg Pro Ser He Gly Ser Ser Lys 365 370 375 acc ate act tet cca ttc tac ggt gac aag age act gag cca gtg cag 1986 Thr He Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln 380 385 390 aag ttg age ttc gat ggg cag aag gtg tat aga acc ate gcc aat acc 2034 Lys Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr He Wing Asn Thr 395 400 405 gat gtt gc gct tgg cct aat ggc aag gtc tac ctt gga gtt act aaa 2082 Asp Val Wing Wing Trp Pro Asn Gly Lys Val Tyr Leu Gly Val Thr Lys 410 415 420 gtg gac ttc tec caa tac gac gat cag aag aac gag here tet act a caa 2130 Val Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln 425 430 435 440 Acc Tac Gat Agt aag Agg aac ggc cat gtt tec gca caa gac tec 2178 Thr Tyr Asp Ser Lys Arg Asn Asn Gly His Val Ser Wing Gln Asp Ser 445 450 455 att gac caa ctt cca cct gaa acc act gat gaa cca ttg gag aag gct 2226 He Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Wing 460 465 470 tac agt cac caa ctt aac tac gcc gaa tgc ttt etc atg caa gac agg 2274 Tyr Ser His Gln Leu Asn Tyr Wing Glu Cys Phe Leu Met Gln Asp Arg 475 480 485 cgt ggc acc att ccg ttc ttt here tgg act cac agg tet gtc gac ttc 2322 Arg Gly Thr He Pro Phe Phe Thr Trp Thr His Arg Ser Val Asp Phe 490 495 500 ttt aac act ate gac gct gag aag att ac ct cct ccc gtg gtc aag 2370 Phe Asn Thr He Asp Ala Glu Lys He Thr Gln Leu Pro Val Val Lys 505 510 515 520 gct tat gcc ttg tec age gga gct tec att att gaa ggt cca ggc ttc 2418 Wing Tyr Wing Leu Ser Ser Gly Wing Being He He Glu Gly Pro Gly Phe 525 530 535 ggt ggc gc aac ttg etc ttc ctt aag gag tec age aac tec ate gcc 2466 Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Be Ser Asn Ser Wing 540 545 550 aag ttc aaa gtg here ctt aac tea gca gcc ttg etc caa cgt tac agg 2514 Lys Phe Lys Val Thr Leu Asn Be Ala Ala Leu Leu Gln Arg Tyr Arg 555 560 565 gtt cgt ate aga tac gca age act acc aat ctt cgc etc ttt gtc cag 2562 Val Arg He Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln 570 575 580 aac age aac aat gat ttc ctt gtc ate tac ate aac aag act at aaac 2610 Asn Asn Asn Asp Phe Leu Val He Tyr He Asn Lys Thr Met Asn 585 590 595 600 aaa gac gat gac etc acc tac caa here ttc gat ctt gcc act acc aat 2658 Lys Asp Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Wing Thr Thr Asn 605 610 615 agt aac atg gga ttc tet ggt gac aag aac gag ctg ate ata ggt gct 2706 Ser Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Leu He He Gly Wing 620 625 630 gag age ttt gtc tet aat gag aag att tac ata gac aag ate gag ttc 2754 Glu Ser Phe Val Ser Asn Glu Lys He Tyr He Asp Lys He Glu Phe 635 640 645 att cca gtt caa etc taatagatec cccgggctgc aggaattctg 2809 catgcgtttg Leu Gln I Pro val 650 gaegtatget catteaggtt ggagecaatt tggttgatgt gtgtgcgagt tcttgcgagt 2869 ctgatgagac atctctgtat tgtgtttctt tccccagtgt tttctgtact tgtgtaateg 2929 gctaatcgcc aacagattcg gcgatgaata aatgagaaat aaattgttet gattttgagt 2989 aggaattaga gcaaaaaaaa tctgtgtgtg ttttttggat ccccggggcg gcege 3044 < 210 > 39 < 211 > 653 < 212 > PRT < 213 > Artificial Sequence < 400 > 39 Met Wing Asn Pro Asn Asn Arg Ser Glu His Asp Thr He Lys Val Thr 1 5 10 15 Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Wing Asp 20 25 30 Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40 45 Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50 55 60 Asp Wing Val Gly Thr Gly He Ser Val Val Gly Gln He Leu Gly Val 65 70 75 80 Val Gly Val Pro Phe Ala Gly Wing Leu Thr Ser Phe Tyr Gln Ser Phe 85 90 95 Leu Asn Thr He Trp Pro Ser Asp Wing Asp Pro Trp Lys Wing Phe Met 100 105 110 20 Wing Gln Val Glu Val Leu He Asp Lys Lys He Glu Glu Tyr Wing Lys 115 120 125 Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135 140SLÍ &.LÍ -z. ~ Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg 145 150 155 160 Ser Lys Arg Ser Gln Asp Arg He Arg Glu Leu Phe Ser Gln Wing Glu 165 170 175 Ser His Phe Arg Asn Ser Met Pro Ser Phe Wing Val Ser Lys Phe Glu 180 185 190 Val Leu Phe Leu Pro Thr Tyr Wing Gln Wing Wing Asn Thr His Leu Leu c 195 200 205 Leu Leu Lys Asp Wing Gln Val Phe Gly Glu Glu Trp Gly Tyr Being Ser 210 215 220 Glu Asp Val Wing Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln 225 230 235 240 Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245 250 255 Arg Gly Ser Thr Tyr Asp Wing Trp Val Lys Phe Asn Arg Phe Arg Arg 260 265 270 10 Glu Met Thr Leu Thr Val Leu Asp Leu He Val Leu Phe Pro Phe Tyr 275 280 285 Asp He Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295 300 He Phe Thr Asp Pro He Phe Leu Leu Thr Thu Leu Gln Lys Tyr Gly 305 310 315 320 Pro Thr Phe Leu Ser He Glu Asn Ser He Arg Lys Pro His Leu Phe 325 330 335 Asp Tyr Leu Gln Gly He Glu Phe His Thr Arg Leu Gln Pro Gly Tyr 340 345 350 15 Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360 365 Arg Pro Ser He Gly Ser Ser Lys Thr He Thr Ser Pro Phe Tyr Gly 370 375 380 Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys 385 390 395 400 Val Tyr Arg Thr He Wing Asn Thr Asp Val Wing Wing Trp Pro Asn Gly 405 410 415 2 > Q Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425 430 Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435 440 445 Gly H s Val Ser Wing Gln Asp Ser He Asp Gln Leu Pro Pro Glu Thr 450 455 460 you jgSs i a £ * &** a. c * i * alSi & '~~~ * ^% & amp & * - ^. > . * * - -u * - ® &ki ^ Thr Asp Glu Pro Leu Glu Lys Wing Tyr Ser His Gln Leu Asn Tyr Wing 465 470 475 480 Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr He Pro Phe Phe Thr 485 490 495 Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr He Asp Wing Glu Lys 500 505 510 He Thr Gln Leu Pro Val Val Lys Wing Tyr Wing Leu Ser Ser Gly Wing _ 515 520 525 Ser He He Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530 535 540 Lys Glu Ser Ser Asn Ser He Wing Lys Phe Lys Val Thr Leu Asn Ser 545 550 555 560 Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg He Arg Tyr Ala Ser Thr 565 570 575 Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580 585 590 10 He Tyr He Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595 600 605 Thr Phe Asp Leu Wing Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp 610 615 620 Lys Asn Glu Leu He He Gly Wing Glu Ser Phe Val Ser Asn Glu Lys 625 630 635 640 He Tyr He Asp Lys He Glu Phe He Pro Val Gln Leu 645 650 < 210 > 40 15 < 211 > 32 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: synthetic oligonucleotide < 400 > 40 taggcctcca tccatggcaa accctaacaa te 32 < 210 > 41 < 211 > 20 20 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: synthetic oligonucleotide < 400 > 41 tcccatcttc etaettagea ccctgcagaa atacggtcca ac 42 < 210 > 42 < 211 > 28 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: synthetic oligonucleotide < 400 > 42 gacctcacct accaaacatt cgatcttg 28 < 210 > 43 < 211 > 25 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: synthetic oligonucleotide < 400 > 43 cgagttctac cgtaggcagc tcaag 25

Claims (43)

NOVELTY OF THE INVENTION CLAIMS

1. - A plant comprising a polynucleotide sequence containing an expression cassette having a linear arrangement of genetic sequences that function together in plant cells to obtain improved expression of at least one insecticidal portion of a protein or amino acid sequence variant of the same from a nucleic acid coding sequence in said plant cells, said protein or variant derived from a Cry3B d-endotoxin from Bacillus thuringiensis, said variant exhibits an insecticidal activity toxic to a coleopteran insect pest that is at least equivalent to said Cry3B, wherein said genetic sequences comprise a promoter operably linked in linear sequence to a leader, untranslated sequence, of ntron, said nucleic acid coding sequence, and a transcription termination sequence and polyadenylation sequence, and in where said expression cassette is selects from the group consisting of SEQ ID NO: 38, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23. 2. The plant according to claim 1, further characterized in that said endotoxin protein or variant amino acid sequence thereof is a Cry3Bb protein or variant thereof, said variant exhibits an insecticidal activity at least equivalent to said Cry3Bb.

i. ^? ,,,, < :: I ..; s? S ^ Müu.,

3. - The plant according to claim 2, further characterized in that said endotoxin protein or variant amino acid sequence thereof is a Cry3Bb2 protein or variant thereof, said variant exhibits an insecticidal activity at least equivalent to said Cry3Bb2.

4. The plant according to claim 1, further characterized in that said endotoxin protein or variant amino acid sequence thereof is a protein or variant thereof selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12, said variant exhibits an insecticidal activity at least equivalent to the protein as set forth in SEQ ID NO: 4.

5. The plant according to claim 1, further characterized in that said genetic sequence comprising a promoter is selected from the group consisting of CaMV-35S-AS4 promoter, CaMV-e35S promoter, CaMV-35S promoter, and POX promoter.

6. The plant according to claim 1, further characterized in that said genetic sequence comprising a promoter is selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO: 29.

7. The plant according to claim 1, further characterized in that said genetic sequence comprising an untranslated leader is the untranslated leader of the ab binding protein of wheat chlorophyll.

8. - The plant according to claim 1, further characterized in that said genetic sequence comprising a non-translated leader is SEQ ID NO: 31.

9. The plant according to claim 1, further characterized in that said genetic sequence comprising an intron is selected from the group consisting of rice actin intron and HSP70 intron.

10. The plant according to claim 1, further characterized in that said genetic sequence comprising an intron is selected from the group consisting of SEQ ID NO: 32 and SEQ ID NO: 33.

11. The plant according to claim 1, further characterized in that said genetic sequence comprising a transcription termination sequence and polyadenylation sequence is selected from the group consisting of transcription termination and polyadenylation sequence of Agrobacterium nopaline synthase. tumefaciens and the transcription termination element and wheat polyadenylation sequence hsp17.

12. The plant according to claim 1, further characterized in that said genetic sequence comprising a transcription termination sequence and polyadenylation sequence is selected from the group consisting of SEQ ID NO: 34 and SEQ ID NO: 35.

13. The plant according to claim 1,

Í & fisw »f» lAjiaS.

further characterized in that said genetic sequence comprising said nucleic acid coding sequence is selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11.

14. The plant according to claim 1, further characterized in that it is selected from the group consisting of a monocotyledonous plant and a dicotyledonous plant.

15. The plant according to claim 14, further characterized in that it is a monocotyledonous plant.

16. The plant according to claim 1 or a progeny of said plant, further characterized in that said plant or said progeny comprises said polynucleotide sequence.

17. A seed of said plant or progeny according to claim 16.

18. A plant germinated from the seed of compliance with claim 17.

19. The plant according to claim 1, further characterized because said genetic sequences comprise a promoter operably linked in linear sequence to a leader, untranslated, intron sequence, a nucleotide sequence encoding a plastid or chloroplast targeting peptide in frame and adjacent said nucleic acid coding sequence , and a transcription termination and polyadenylation sequence, and wherein said nucleotide sequence encoding a plastid or chloroplast targeting peptide is a

, 4" • --. j? t? jjfÍBW - < -! TBjKM5: - < afc ~ Jfe ^ «.-» * • **** 1, »« A. < j & amp; and chloroplast targeting sequence of small subunit of ribulose bisphosphate carboxylase synthase of Zea mays.

20. The plant according to claim 19, further characterized in that said genetic sequence comprising a nucleotide sequence coding for a plastid or chloroplast targeting peptide is SEQ ID NO: 25.

21. A plant comprising a polynucleotide sequence that contains an expression cassette that has a linear arrangement of genetic sequences that work together in cells

10 plants for obtaining expression of a nucleic acid sequence coding for a Cry3B d-endotoxin protein of Bacillus thuringiensis insecticide or variant amino acid sequence thereof toxic to a pest of coleopteran insects that feed on said plant, said variant exhibits a insecticidal activity at least equivalent to said

15 Cry3B, said genetic sequences comprise a promoter operably linked in linear sequence to a leader, untranslated, intron sequence, said nucleic acid coding sequence, and a transcription termination sequence and polyadenylation sequence, wherein said expression cassette is selected from the group consisting of SEQ ID NO: 38,

SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23, and wherein the expression of said protein or variant in plant cells of said plant is increased to sufficient protein or variant levels to protect said plant from infestation of coleopteran pests and sufficient

? ^ s? íSSi ^. ^^^? ^^ SßÉ ^ í ^^ ^ kí ^ -., ",., - > *. -« n ^ a * - **. * - .. ^ ¿ ii ^? Ui ^^ Ü ^ & ^ sü A ^^ i delay the initiation of insect resistance to said protein or variant 22.- The plant according to claim 21, further characterized in that said increased expression provides levels of protein or variant in plant cells from about 200 to about 500 parts per million of total plant protein 23. The plant according to claim 21, further characterized in that said increased expression provides protein or variant levels in plant cells of the plant. 24. The plant according to claim 21, further characterized in that said increased expression provides levels of protein or variant in plant cells of about 50 to about 100 parts. per million total plant protein 25.- The plant in accordance with claim 21, further characterized in that said increased expression provides levels of protein or variant in plant cells from about 10 to about 50 parts per million of total plant protein. 26. The plant according to claim 21, further characterized in that said increased expression provides levels of protein or variant in plant cells from about 5 to about 10 parts per million of total plant protein. 27. The plant according to claim 21, further characterized by the percentage obtained from plants that present

said levels of improved expression of protein or variant in said plant cells that are more than about 200 parts per million of total cell protein is from about 0.5 to about 5 percent of all plants obtained after transformation and 5 selecting events using said expression cassette to produce transgenic events. 28. The plant according to claim 21, further characterized in that the percentage obtained from plants having said levels of provision of improved expression of protein or variant in

Said plant cells which are more than about 100 parts per million total cell protein is from about 0.5 to about 6 percent of all plants obtained after the transformation and selection of events using said expression cassette to produce transgenic events. The plant according to claim 21, further characterized in that the percentage obtained from plants having said levels of provision of improved expression of protein or variant in said plant cells that are more than about 50 parts per million of Total cell protein is around 0.5 to about 8 per

20 percent of all the plants obtained after the transformation and selection of events using said expression cassette to produce transgenic events. 30. The plant according to claim 21,

further characterized in that the percentage obtained from plants exhibiting said levels of improved protein or variant expression provision in said plant cells that are more than about 10 parts per million total cell protein is from about 0.5 to about 18 per cell. hundred of all the plants obtained after the transformation and selection of events using said expression cassette to produce transgenic events. 31. A method for producing a transgenic plant comprising the steps of: a) introducing into the DNA of a plant cell or plant tissue a polynucleotide sequence comprising an expression cassette having a linear arrangement of genetic sequences that work together in plant cells to obtain expression of a nucleic acid sequence that encodes a Cry3B d-endotoxin protein of Bacillus thuringiensis insecticide or variant amino acid sequence thereof toxic to a pest of coleopteran insects that feed on said plant, said variant exhibits an insecticidal activity at least equivalent to said Cry3B, said genetic sequences comprise a promoter operably linked in linear sequence to a leader, untranslated sequence, intron, said nucleic acid coding sequence, and a transcription termination sequence and sequence of polyadenylation, wherein said former cassette pressure is selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23; b) cultivating said plant cell or plant tissue in

- Uí? Áá S £ & & k - selective means for obtaining a transgenic plant containing said polynucleotide sequence incorporated in a heritable manner in said DNA; and c) selecting a plant expressing said protein or variant; wherein said selected plant exhibits increased expression of said protein or variant in said transgenic plant, said improved expression is increased to levels of protein or variant sufficient to protect said plant from infestation of coleopteran pests and sufficient to retard the onset of resistance to insects to said protein or variant when they are produced in said transgenic plant. The method according to claim 31, further characterized in that said step of introducing said polynucleotide into the DNA of said plant cell or tissue is achieved by bombardment of ballistic particles coated with nucleic acid, electroporation, or competent transformation of Agrobacterium. tumefaclens transformed with

15 a plasmid containing said polynucleotide sequence. 33.- The method according to claim 32, further characterized in that said transgenic plant is a monocotyledonous or dicotyledonous plant. 34.- The method according to claim 33,

20 further characterized in that said transgenic plant is monocotyledonous. 35. The method according to claim 34, further characterized in that said monocotyledonous plant is selected from the group consisting of corn, wheat, barley, rice, oats, herbs and bananas.

a ?, J4a jfrtfa * - ..-- »» is- -fr? uBuJSfiüía »- - ±. ^ "^ Jw ^ - ^ Jt? ~ R airs, k ^^ * ¡^ ^

36. - The method according to claim 31, further characterized in that said selection step is achieved using a polynucleotide sequence comprising an expression cassette containing a promoter that operates in plants operably linked to a nucleotide sequence encoding protein Eligible marker linked to a 3 'transcription termination sequence and plant-operable polyadenylation sequence. 37. The method according to claim 36, further characterized in that said eligible marker protein is selected from the group consisting of herbicide tolerance proteins, antibiotic resistance proteins, proteins that catalyze substrates to generate visually observed colored products, and proteins that catalyze substrates to generate fluorescent or luminescent products. 38. The method according to claim 36, further characterized in that said eligible marker protein is selected from the group consisting of Nptll, GUS, LUX, Hyg, esterase, PhnO, EPSPS and GOX. 39.- A vector comprising a polynucleotide sequence according to claim 1, for use in the transformation of a plant, plant cell or plant tissue, wherein said vector is selected from the group consisting of a plasmid, a bacmid, an artificial chromosome, a single or double linear chain DNA or RNA fragment, and a virus genome.

40. - An isolated and purified polynucleotide sequence comprising an expression cassette containing a linear array of genetic sequences that work together in plant cells to obtain improved expression of at least one insecticidal portion of a protein or amino acid sequence variant of the same from a nucleic acid coding sequence in said plant cells, said protein or variant derived from a Cry3B d-endotoxin from Bacillus thuringiensis, said variant exhibits an insecticidal activity toxic to a coleopteran insect pest that is at least equivalent to said Cry3B, wherein said

10 genetic sequences comprise a promoter operably linked in linear sequence to a leader, untranslated, antron sequence, said nucleic acid coding sequence, and a transcription termination sequence and polyadenylation sequence, wherein said expression cassette improves the expression of the protein or variant in a plant

Transgenic e, increases the number of transgenic events observed to express the protein or variant on a threshold level when said polynucleotide sequence is used to generate transformed plants and wherein said expression cassette is selected from the group consisting of SEQ ID NO : 38, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID

20 NO: 23. 41.- An isolated and purified polynucleotide sequence comprising one or more expression cassettes, each cassette contains genetic sequence elements that function in plant cells for

expressing a desired Bacillus thuringiensis d-endotoxin insecticidal protein, chimera, fusion or variant thereof from a nucleic acid coding sequence, wherein said coding sequence is linked to the 5 'end to a sequence element of promoter, an untranslated leader sequence element, an intron sequence element, and said coding sequence is linked towards the 3 'end to a transcription termination sequence element and polyadenylation sequence, wherein said expression cassette improves the expression of the protein or variant in a transgenic plant and increases the percentage of transgenic events observed to express the desired protein over a threshold level when said polynucleotide sequence is used to generate transformed plants and wherein said expression cassette is selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23. 42.- A method to control infestation of coleopteran insects in a field of crop plants that consists in providing a transgenic plant in which said coleopterous insects are fed, said transgenic plant comprises a polynucleotide sequence comprising an expression cassette containing a linear arrangement of genetic sequences that function together in plant cells to obtain increased expression of at least one insecticidal portion of a protein or variant amino acid sequence thereof from a nucleic acid coding sequence in said plant cells, said

protein or variant are derived from a Cry3B d-endotoxin from Bacillus thuringiensis, said variant exhibits a insecticidal activity toxic to a coleopteran insect pest that is at least equivalent to said Cry3B, wherein said genetic sequences comprise a promoter operably linked in sequence linear to a leader, untranslated sequence, of ntron, said nucleic acid coding sequence, and a transcription termination sequence and polyadenylation sequence, and wherein said expression cassette is selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23. 43.- The method according to claim 42, further characterized in that the genetic sequences that work together in said transgenic plant increase the expression of the protein or variant in a transgenic plant and improve the percentage of transgenic events observed to express the desired protein over a threshold level when said polynucleotide sequence is used to generate transformed plants.