MXPA01000693A - Regions of papilloma virus e1 helicase involved in e1 oligomerization - Google Patents

Abstract

There is provided an amino acid sequence comprised within the PV E1 protein region A delineated by amino acids 352 and 439, and any derivative variant or fragment thereof, necessary for the oligomerization of the E1 protein. This amino acid sequence is capable of self-association and of associating with the full length E1 protein and any derivative, variant or fragment thereof comprising the sequence of this invention. A specific aspect of this first embodiment, the amino acid domain of this invention delimited by amino acids 353 to 438 of the PV E1 protein. More particularly, the amino acid domain of this invention is as defined by SEQ ID NO. 2. There is also provided a cross-linking assay to directly measure the level of oligomerization (or inhibition thereof) of the E1 protein. In accordance with a fourth embodiment of this invention, there is provided a N-terminally truncated E1 protein. More particularly, one aspect of this fourth embodiment encompasses the E1 protein delimited by amino acid 72 to 649 (SEQ ID No. 78).

Description

REGIONS OF THE HELICASE The PAPILLOMA VIRUS INVOLVED IN THE OLIGOMERIZATION OF THE FIELD OF THE INVENTION The present invention relates to an amino acid sequence comprised in the protein El of the papilloma virus, necessary for homo-olomerization of the El protein. This oligomerization is an essential step in the initiation of the replication of the viral DNA. In addition, the invention describes a screening method and a tracking system capable of selecting agents capable of interfering with this protein-protein interaction. Moreover, the invention further relates to a system for the selection of agents capable of modulating this protein-protein interaction for use in the treatment and control of PV infections (caused by the papilloma virus) in animals.

BACKGROUND OF THE INVENTION Papillomaviruses (PV) are virus-DNA lacking envelope, which induce hyperproliferative lesions of the epithelia. Papillomaviruses Ref: 126260 they are widespread in nature and have been recognized in higher vertebrates. Viruses have been characterized, among others, in humans, livestock animals, rabbits, horses and dogs. The first papillomavirus was described in 1933 as the "cottontail" rabbit papillomavirus (CRPV). Since then, the cottontail rabbit as well as the type I bovine papillomavirus (BPV-1) have served as experimental prototypes in papillomavirus studies. The majority of animal papillomaviruses are associated with purely epithelial proliferative lesions, and most lesions in animals are cutaneous. In humans, there are more than 75 types of papillomavirus (HPV) that have been identified and have been cataloged by the site of infection: cutaneous epithelium and mucosal epithelium (oral and genital mucosa). Diseases classified as cutaneous include flat warts, plantar warts, etc. Diseases classified as mucosal include laryngeal papillomas and anogenital diseases comprising cervical carcinomas (Fields, 1996, Virology, 3rd ed. Lippincott-Raven Pub., Philadelphia, N.Y.).

There are more than 25 types of HPV that are involved in anogenital diseases, classifying them into "low risk" and "high risk" types. The low-risk types include HPV type 6, type 11, and type 13 and induce mainly benign lesions such as condyloma to cumin ta (genital warts) and low-grade squamous intraepithelial lesions (SIL). In the United States there are approximately 5 million people with genital warts of which 90% are attributed to HPV-6 and HPV-11. Approximately 90% of SIL is also caused by low risk types 6 and 11. The remaining 10% of SIL is caused by high-risk HPVs. High-risk types are associated with high-grade SIL and cervical cancer and include HPV types 16, 18, 31, 33, 35, 45, 52 and 58 most often. The progression from low-grade SIL to high-grade SIL is much more frequent for HPV-16-containing lesions and 18 at high risk, compared with those containing low-risk HPV types. In addition, only four types of HPV are detected frequently in cervical cancer (types 16, 18, 31 and 45). Approximately 500,000 new cases of invasive cervical cancer worldwide are diagnosed annually (Fields, 1996, upra).

Treatments for genital warts include physical removal such as cryotherapy, C02, laser, electrosurgery or surgical removal. Cytotoxic agents such as trichloroacetic acid (TCA), podophyllin or podofilox can also be used. Immunomodulatory agents such as Inferieron or Imiquimod are also available. These treatments are not completely effective in removing all viral particles and either incur a high cost or produce unpleasant side effects. In fact, there is currently no effective antiviral treatment for HPV infection. With all current therapies, recurrent warts are common (Beutner & amp;; Ferenczy, 1997, Amer. J. Med., 102 (5a): 28 -37). The ineffectiveness of current methods for treating HPV infections has demonstrated the need to identify new means to control or eliminate such infections. In recent years, efforts have been directed to the search for antiviral compounds, and especially compounds capable of interfering with viral replication (Hughes and Romans, 1993, Nucleic Acids Res. 2Jd 5817-5823; Clark et al., Antiviral Res. , 1998, 37 (2): 97-106; Hajduk et al., 1997, J. Med. Chem., 49 (20): 3144-3150 and Cowsert and col., 1993, Antimicrob, Agents, Chemother., 37 (2): 171-177). For this purpose, it has been important therefore to study the genetics of HPV in order to identify potential chemotherapeutic targets to contain and possibly eliminate all diseases caused by HPV infections. The life cycle of PV is closely coupled to the differentiation of keratinocytes. It is believed that the infection occurs at a site of tissue breakage in the basal epithelium. Unlike normal cells, cell division continues while the cell undergoes vertical differentiation. As the infected cells undergo a progressive differentiation, the cellular machinery is maintained which allows viral gene expression to increase, ending with late gene expression and splicing of the virions into finally differentiated keratinocytes and with the release of viral particles (Fields, s upra). The coding chain for each of the papillomaviruses contains approximately ten open reading frames (ORF) designated translations that have been classified as either early ORFs or late ORFs. The E8 genes are expressed early in the cycle of viral replication. The two late genes (Ll and L2) encode the majority and minority proteins of the envelope, respectively. The gene products El and E2 function in the replication of viral DNA, while E5, E6 and E7 modulate the proliferation in the host cell. Ll and L2 are involved in the structure of the virion. The functions of the gene products E3, E4 and E8 are currently to be clarified. HPV studies have shown that the El and E2 proteins are the only viral proteins required for viral DNA replication in vi t ro (Kuo et al., 1994, J. Biol. Chem. 30: 24058-2 065).

This requirement is similar to that of bovine papillomavirus type 1 (BPV-1). In fact, there is a high degree of similarity between the El and E2 proteins and the ori sequences of all the papillomavirus (PV) independently of the viral species and the type (Kuo et al., 1994, supra). In particular, El is the most highly conserved protein in PV and it is presumed that its enzymatic activity will be similar for all types of PV (Jankins, 1996, J. Gen. Virol. 77: 1805-1809). Therefore, it is expected that all gene products of different PV have similar structure and function.

In addition, the PV protein has similarities of sequence and structure with the long T protein of pol iornavi rus and simian virus 40 (Clertant and Seif, 1984, Nature 311: 276-279 and Mansley et al., 1997, J. Virology 71: 7600-7608). The E2 protein is a transcriptional activator that binds to the El protein, and these two proteins and the ori sequence form a ternary complex (Mohr et al., 1990, Secience 250: 1694-1699). It is believed that E2 enhances the binding of El to the origin of BPV replication (Seo and Col., 1993b, Proc Nati Acad Sci., 90: 28865-2869). In HPV, Lui et al., Suggested that E2 stabilizes the binding of El to ori (1995, J. Biol. Chem. 270 (45): 27283-27291 and McBride et al., 1991, J. Biol. Chem. 266 : 18411-18414). The evidence emanating from the BPV-1 studies has shown that El possesses ATPase and helicase activities that are necessary in the initiation of viral DNA replication (Seo et al., 1993a, Proc. Nati. Sci. USA 90: 702-706; Yang et al., 1993, Proc. Nati, Acad. Sci. 90: 5086-5090, and MacPherson et al., 1994, Virology 204: 403-08). The BPV protein is a phosphorylated nuclear protein that has functions related to replication. These include DNA and ATP binding and ATPase and helicase activities. Studies of deletion maps have identified amino acids 121-311 as the region necessary for DNA binding. Mutations within this region obviate the binding to DNA by the full-length protein (Leng et al., 1997, J. Virol 7_l: 848-752 and Thorner et al., 1993, Proc. Nati. Acad. Sci USA 9_0_: 898-902). The second function, ATP binding and ATPase activity, is essential for DNA replication. Mutations at a point within conserved regions in the ATP-binding domain inactivate the ability shown by El to bind to ATP or to hydrolyze it, with the consequent loss of DNA replication (MacPherson et al., 1994, Virology 204: 403-408; Raj and Stanley, 1995, J. Gen. Virol. 7_6: 2949-2956 and Sun et al., 1990, J. Virol 64_: 5093-5105). The third activity possessed by the protein El is the helicase activity or the unwinding of the DNA in front of the replication fork. There are studies that predict that the helicase activity resides in the DNA binding domain, amino acid 121 through the ATPase / nucleotide binding region, approximately 530 amino acid (Sverdrup and Myers, Human Papillomaviruses, 1997, Published by Theoretical Biology and Biophysics). When viral DNA replication occurs in vitro, and when an excess of El protein is present, replication occurs in the absence of E2. In vivo, in the presence of a large amount of cellular DNA, replication requires the presence of both El and E2. E2 acts as a specificity factor directing El to the origin of replication (Sedman and Stenlund, 1995, Embo. J. dd 6218-6228). The mechanism to initiate in vi replication is believed to involve the cooperating union of El and E2 at the origin, with which El and E2 form a complex. These DNA-protein and protein-protein interactions occur at the origin of DNA replication (Sverdrup and Myers, upra). The understanding of the mechanisms of the protein The helicase presumably capable of unwinding the DNA at the origin and in front of the replication fork, is one of the advantages of this invention. Based on PV studies and SV40 DNA replication, a biphasic model for the initiation of replication for PV has been proposed (Sverdrup and Myers, supra). In a first stage, El and E2 join cooperatively to the origin of replication, thus guaranteeing the binding specificity towards the origin of replication. In a second stage, additional El monomers are recruited at the source with the consequent loss of E2. It is thought that the formation of the homologous Igomeric complex of El at the origin is necessary for the activity of DNA replication and the recruitment of the cellular replication machinery in the initiation of DNA synthesis (Sverdrup and Myers, upra). As there is still no effective therapeutic agent to prevent, control, diminish or eliminate PV infection, it has become important to study the PV life cycle in greater detail and specifically develop a better understanding of viral DNA replication. Surprisingly, there is little knowledge about the oligomerization mechanism of El in vivo or vi vi. The prior art does not manifest itself as to the location of the region along the protein which is necessary for this protein-protein interaction, in the formation of the oligomeric complex of El. Thus, there remains a need to provide an understanding of the mechanism and the element (s) involved in this oligomerization. Knowledge of this procedure provides a potentially novel therapeutic target against PV. Therefore, one of the advantages of the present invention is to identify a region of amino acids in the protein that is necessary for this apparent self-association.

In addition, the location of this region by the applicant provides a new potential therapeutic target in the treatment of PV infections. Therefore, a further advantage of the invention is to provide a screening method for identifying agents capable of modulating this new target and a system for selecting at least one agent of this class capable of interfering with the replication of the PV DNA. The present invention relates to a number of documents, the content of which is incorporated herein by reference.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to the elucidation of some of the steps necessary to initiate the replication of papillomavirus DNA. More particularly, the role of the El protein (a.a. 1-649) (SEQ ID No. 1) in the replication of viral DNA.

Most particularly, the need for oligomerization of the PV protein as a step preceding the unwinding of viral DNA and DNA replication. Therefore, according to the first embodiment of the present invention, it is provided an amino acid sequence comprised within the A region of the PV protein, delineated by amino acids 352 and 439, and any derivative, variant or fragment thereof, necessary for the oligomerization of the El protein. This amino acid sequence is capable of self-associating and associating with the full length protein and any derivative, variant or fragment thereof, comprising the sequence of this invention. According to this first embodiment, a necessary amino acid sequence is provided for the oligomerization of the PV protein. This region or amino acid domain, numbered from the amino acid sequence of human papilloma virus (HPV) type 11, is delineated by amino acids 352 and 439. Any derivative, variant or fragment of this amino acid region capable of presenting the Structural and functional activity itself is within the scope of this invention. In a particular aspect of this first embodiment, the amino acid sequence is further delineated by amino acids 352 and 432. In a more particular aspect of this first embodiment, the amino acid sequence is further delineated by amino acids 352 and 417. The applicant was the first to identify this domain comprised within the El protein, which is an essential previous step in the initiation of viral DNA replication. Therefore, a specific aspect of this first embodiment is the amino acid domain of this invention delimited by amino acids 353 to 438 of the El protein of PV. More particularly, the amino acid domain of this invention is that defined by SEQ ID NO. 2. The applicant was also the first to recognize that the elucidation of this amino acid sequence provides a new therapeutic target for the control, prevention, elimination and treatment of PV infections in mammals. Therefore, according to a second embodiment of this invention, a screening assay is provided to evaluate the El / DNA binding (and hence the oligomerization of the El protein) by detection and / or measurement of the amount of coprecipitated DNA. with the El protein. Without intending to be bound by any theory, the applicant has hypothesized that the measurement of El auto-oligomerization can be correlated indirectly by measurement of the co-immunoprecipitated DNA with this El protein. By analogy with The BPV, the applicant anticipated that the oligomerization of occurred after binding to the origin so that the measurement of the amount of ori bound to El would be an indirect measure of the oligomeric protein. The Applicant has now proved that this hypothesis is correct by designing a crosslinking assay and showing the correlation between this crosslinking assay and the oligomerization assay according to the first embodiments of this invention. Therefore, according to a third embodiment of this invention, a crosslinking assay is provided to directly measure the level of oligomerization (or inhibition thereof) of the El protein. According to a fourth embodiment of this invention, a truncated protein is provided in its N-terminal region. More particularly, one aspect of this fourth embodiment encompasses the El protein bounded by amino acids 72 to 649 (SEQ ID NO: 78). Other objects, advantages and aspects of the present invention will become more apparent upon reading the following non-restrictive description of the preferred embodiments with reference to the accompanying drawings, which is illustrative and should not be construed as limiting the scope of the present invention. .

BRIEF DESCRIPTION OF THE DRAWINGS Having thus described the invention in a general manner, reference will now be made to the accompanying drawings, which show by way of illustration a preferred embodiment thereof, and in which: FIGURE IA shows the results of the El-El interaction in the system of two yeast hybrids used to represent the region of the protein that is necessary for the protein-protein interaction. In this system, a fusion product of the activating domain of GAL4 (AD) and a full-length protein (amino acids 1-649, SEQ ID NO: 1) is co-transfected with fusion products consisting of a series of deletions. at the N-terminal end of the HPV-11 protein and the DNA binding domain (BD) of GAL4. The high transcriptional activity is present only when the interaction of the two proteins in the hybrid molecules int sufficiently sufficiently to put the AD and BD of GAL4 and in close proximity in order to allow the transcriptional activity of GAL4. A diagram of the El protein is shown in the upper part of the Figure. The gray boxes marked A, B, C and D represent regions of El that have a large sequence similarity with SV40 large T antigens and polyomavirus. The black boxes indicate the position of the DNA binding domains and the ATP in El. The portions of El comprised in these fusion proteins are indicated. Β-galactosidase activity levels are measured in yeast cells cotransformed with the two plasmids, a fusion protein with the BD of GAL4 and a fusion protein with the AD of GAL4. As can be seen, the first 71 amino acids of the N-terminal end of El in the hybridized molecule of the BD, have been eliminated to avoid transcription of the Lac Z reporter gene due to the presence of an activation domain within this amino acid region. from El. FIGURE IB shows a diagram of the El protein at the C-terminal end, which indicates the position of the conserved regions A to D. The truncated molecules of the N-terminus, which have a series of C-terminal deletions are fused to the AD of GAL4 and co-transfected with a truncated N-terminus (330-649 of SEQ ID No. 1) fused to the BD of GAL4. The portions of El comprised in these fusion products are indicated, as are the levels of β-galactosidase activity. In this experiment, it is shown that the fusion product formed by the protein fragment (353-416; SEQ ID NO: 4) leads to measurable β-galactosidase activity. FIGURE IC shows the self-association of El fragments in yeast. Three different fragments of El that have N and C-terminal truncations are tested in the yeast two-hybrid system. For comparison, each El-Ad fusion was also tested for the interaction with El (330-649 of SEQ ID No. 1) fused to the BD of GAL4 or with the BD of GAL4 alone. The β-galactoside activity levels obtained show that the El region (amino acids 353-416; SEQ ID NO: 4) is sufficient for self-association as well as interaction with a larger region of the El protein (330-649 of SEQ ID No. 1). FIGURE 2 shows the effect of amino acid substitutions in the conserved ATP binding domain on the El-El interaction. Using the yeast two-hybrid system, β-galactosidase activity was measured in yeast cells co-transfected with wild type El (WT) (330-649) fused to the AD of GAL4 and a wild-type El (353 -649; SEQ ID NO: 5) or a mutant derivative [P479S (SEQ ID NO: 6), K484E (SEQ ID NO: 7) and K484Q (SEQ ID NO: 8)] fused to the BD of GAL4. As controls, they were used plasmids with the AD of GAL4 and with the BD of GAL4 alone. It is indicated that substitutions in the Waiker A pool (P loop) of El, decrease the amount of β-galactosidase activity, demonstrating that these substitutions compromise El's ability to self-associate. FIGURE 3A shows the results of an assay to monitor the binding of El to the HPV DNA replication origin. Protein-DNA complexes were formed, or with wild-type El (amino acids 1-649; SEQ ID NO: 1), or a Truncated at its N-terminal end (El * = amino acids 72-649; SEQ ID NO. 78), or in the absence of El (-El). The complexes The DNA was immunoprecipitated with an antibody directed against El, and the co-precipitated DNA, together with 0.5% of the amount of probe used in the binding reaction, were visualized by electrophoresis and autoradiography. Radioradiography indicates that the truncated protein at its N-terminal end (SEQ ID No. 78) has a higher affinity for the origin than the full-length protein. An arrow indicates the fragment of the probe that contains the origin. FIGURE 3B shows the effect of amino acid substitutions in the DNA binding domain of El on the binding of El to the origin using the co-immunoprecipitation of DNA. The position of the two different double amino acid substitutions in El are indicated along with the El main sequence between amino acids 280 and 300. The binding reactions were carried out as described for Figure 3A. The results of the autoradiography show that these substitutions abolished the union of El at the origin. FIGURE 3C shows the effect of a triple mutation of nucleotides at the origin of HPV-11 on the binding of El to the origin. The origin of HPV-11 is represented schematically with the three I E2 binding sites (black boxes marked "E2"), the El binding site (gray box) and an AT-rich region (open box). The sequence of a portion of the El binding site is indicated along with the position of three nucleotide changes in the mutant origin. The binding reactions were carried out as described for Figure 3A. The autoradiography shows that the presence of a triple mutation in the origin of HPV replication inhibited the binding of the El protein to the origin. FIGURE 4A shows a schematic representation of the series of deletions generated to represent the domain of El required for the union to the viral origin of DNA replication in vi tro. Truncated in vi tro proteins were produced and assayed for binding to viral origin as described for Figure 3A. Truncated proteins at their N-terminus were immunoprecipitated using a polyclonal antibody directed against the C-terminus of El. The proteins truncated at the C-terminal end were labeled at their N-terminus with the FLAG epitope and immunoprecipitated using an anti-FLAG monoclonal antibody. FIGURE 4B shows the results of the deletions indicated in 4A. The autoradiograph demonstrates that the El region necessary for the binding to the origin comprises amino acids 191-649 which includes the amino acid sequence of this invention necessary for El-El oligomerization. Deletions at the C-terminus abolish the union to the origin. FIGURE 5A shows a SDS-PAGE stained with Coomassie blue of the thioredoxin fusion proteins (TRX) containing the indicated portion of El expressed in E. col i and purified by nickel affinity chromatography. The amino acid region of each fragment is indicated at the top of the streets. For each fusion protein, two independent preparations were analyzed.

FIGURE 5B shows the effect of the excess TRX-E1 fusion products on the binding of El (72-649 of SEQ ID No. 1) to the viral origin. The binding reactions were carried out as described in Figure 4A. To the binding reactions, TRX fusion proteins, or TRX alone, were added at a concentration of approximately 8 μM, which corresponds to a 300-fold molar excess relative to El (72-649). The TRX-E1 fusion molecule (353-431; SEQ ID NO: 3) indicated the maximal inhibitory effect and the TRX-E1 fragment (353-416; SEQ ID NO: 4) showed no apparent inhibition. TRX alone did not show any measurable union at the origin. FIGURE 5C shows the effect of a different concentration of the TRX-El fusion molecule (353-431; SEQ ID NO: 3) on the binding of El to the origin. Decreasing concentrations of TRX-E1 (353-649, SEQ ID NO: 5) were used to estimate the IC50 at which this fusion protein inhibits El binding to the viral origin. From these data the IC 50 was estimated at approximately 3 μM. FIGURE 6A shows the effect of temperature and nucleotides on the binding of El * to the viral origin. The binding of El * (SEQ ID No. 78) to the viral origin was carried out at three different temperatures (4 °, 23 ° and 37 ° C) and in the presence of (+ ATP / Mg) or absence (-ATP / Mg) of ATP / Mg at a concentration of 5 and 3 mM, respectively. In the absence of ATP / Mg the binding of El to the origin seems to be partially inhibited at 4 ° C, unchanged at 23 ° C and drastically decreased at 37 ° C. The addition of ATP / Mg at 37 ° C reverses this temperature-related effect. FIGURE 6B shows that only ADP and ATP in combination with magnesium are capable of stimulating the binding of El to the origin. The binding of El to the origin was performed in the absence of nucleotide (-nuc) or in the presence of the indicated nucleoside triphosphate at a concentration of 5 mM. "Adeno." It indicates adenosine and "cAMP" indicates cyclic AMP. FIGURE 6C shows the effect of the union of The at the origin in the absence of nucleotide (-nuc) and in the presence of nucleotides (CTP, GTP and UTP) and deoxynucleotides (dATP, dCTP, dGTP and dTTP). The results of the autoradiograph indicate that the nucleotides and deoxynucleotides are capable of stimulating the binding of El to the origin. The non-hydrolysable analogs (ATP-y-S and GTP-y-S) are also stimulators, which indicates that the binding of the substrate, but not its hydrolysis, is necessary for the binding of El to the origin.

FIGURE 7A indicates a schematic representation of the El protein. The gray boxes indicate the positions of region A, B, C and D that have great sequence similarity with large SV40 and polyomavirus T antigens, and of the DNA binding domain . The positions of the conserved A and C groupings that are present in members of the superfamily 3 of the NTP-binding proteins are indicated along with an alignment of these sequences from the SV40 T antigen, BPV-1 and HPV-11. and HPV-6b. The consensus amino acid sequence of each grouping is indicated. The remains that were mutated are indicated by an arrow. FIGURE 7B shows the results of El * (SEQ ID NO: 78), or the indicated mutant derivatives, tested for binding to the viral origin as described in Figure 4A. The results indicate that substitutions in the conserved residues in cluster A reduced the ability of El to bind to the origin, indicating that the binding of ATP to El is important in the binding of El to the origin. The substitutions in cluster C did not seem to affect the union of El at the origin. FIGURE 8A shows the effect of substitutions on the conserved A region of El on the binding of El. to the viral origin. A schematic representation of the protein in which the gray boxes indicate the positions of regions A, B, C and D that have high sequence similarity with large T antigens from polyomaviruses, and of the DNA binding domain. An alignment of conserved A region from SV40 T antigen is shown, BPV-1 and HPV-11. The highly conserved remains of this region are contained in gray boxes. The remains that were mutated are also indicated. FIGURE 8B shows the effect of six independent substitutions in region A, on the binding of El to the origin. The * (SEQ ID NO: 78), or the indicated mutant derivatives, were tested for binding to the viral origin essentially as described in Figure 4A. The binding reactions were carried out either at 23 ° C in the absence of ATP / Mg with supplement, or 37 ° C in reactions supplemented with ATP / Mg at concentrations of 5 and 3 mM, respectively. All tested substitutions decreased binding, indicating that the conserved A region is important for El to bind to the origin. FIGURE 9A shows the effect of substitutions in the conserved A region of El on the formation of the E1-E2 complex, ori vi, and on a replication of HPV DNA in cells. Effect on the formation of the El-E2-ori in vi t ro complex. DNA-protein complexes are formed without El (-El), either with El wild-type El (1-649; SEQ ID NO: 1) or with the indicated mutant substitutions are carried in the conserved A region. The complexes were immunoprecipitated with an antibody directed against El, and the bound DNA was visualized by electrophoresis and autoradiography. Three of the substitutions Y389A (SEQ ID NO 9); F393A (SEQ ID NO: 10) and N389A (SEQ ID NO: 11) show a substantial reduction in complex formation. Two substitutions A390G (SEQ ID No. 12) and Q399A (SEQ ID No. 13) show a modest effect. These results indicate that this conserved A region plays a role in the formation of the El-E2-ori complex. FIGURE 9B shows the effect of the six substitutions on the temporal replication of HPV. The amount of plasmid containing the replicate origin (ori), or of the internal control plasmid (plasmid expressing El, El), was detected by quantitative PCR analysis. PCR amplification was performed on genomic DNA isolated from cells transfected with a plasmid expressing El (-E2), or transfected with a combination of plasmids expressing E2 and El (either wild type or mutant proteins). indicated). All cells were also transfected with the pN9 plasmid containing the origin. The PCR products were visualized by electrophoresis and autoradiography. Proteins The mutants with substitutions F378A (SEQ ID NO.14), A390G (SEQ ID NO.12) and Q399A (SEQ ID NO.13) indicate reduced levels of replication, the other three mutants showed no replication activity. These results indicate that region A is important for the temporary replication of HPV DNA. Figure 10. Crosslinking of radiolabeled El * demonstrating the formation of oligomers, which correspond in size to monomer (1), dimer (2), trimer (3), tetramer (4), pentamer (5) and hexamer (6) of He*. The formation of El * oligomers is stimulated when (+) single-stranded DNA is added to the reaction. The oligomers are detected only in the presence (+) of the crosslinking agent BMH. Figure 11. Protein crosslinking The truncated radiolabeled. The various truncated proteins used in this assay are depicted schematically in panel A. The results of the crosslinking experiments are indicated in panel B. The crosslinking was performed as described in Example 12, in the presence (+) or absence ( -) of ss DNA.

Figure 12. Effect of amino acid substitutions in the ATP-binding domain of El * on oligomerization. The position of the various amino acid substitutions made in the ATP-binding domain of El * are summarized in panel A. The results obtained from the cross-linking of these El * mutant proteins (72-649) in the presence of ss DNA are indicated in panel B. Figure 13. Effect of amino acid substitutions on the conserved A region of El * on oligomerization. Six different * proteins, each carrying a single amino acid substitution in the conserved A region (indicated above each lane of the gel), were tested by crosslinking for their oligomeriZar activity in the presence of ss DNA as described in Example 12.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Definitions Unless otherwise indicated, the scientific and technological terms and the nomenclature used herein have the same meaning as commonly understood by one skilled in the art to which this invention refers. Generally, the procedures for cell culture, infection, molecular biology methods and the like are current methods used in the art. Such classical techniques can be found in reference manuals such as for example Sambrook et al. (1989, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratories) and Ausubel et al. (1994), Current Protocols in Molecular Biology, Wiley, New York). The nucleotide sequences are presented here by mono-chains, in the 5 'to 3' direction, from left to right, using the one-letter symbols for the nucleotides, as is commonly used in the art and in accordance with the recommendations of the Commission of IUPAC-IUB Biochemical Nomenclature (Biochemistry, 1972, 11: 1726-1732). The present disclosure refers to a number of terms of recombinant DNA technology (rDNA) routinely used. However, definitions of selected examples of such rDNA terms are provided for reasons of clarity and uniformity. The term "recombinant DNA" or "recombinant plasmid" as known in the art refers to a DNA molecule resulting from the joining of the DNA segments. This is often referred to as genetic engineering.

The term "segment or molecule or DNA sequence" is used herein to refer to molecules constituted by the deoxyribonucleotides adenine (A), guanine (G), thymine (T) and / or cytosine (C). These segments, molecules or sequences can be found in nature or obtained by synthetic methods. When read according to the genetic code, these sequences can encode a stretch or linear sequence of amino acids that can be designated polypeptide, protein, protein fragment and the like. As used herein, the term "gene" is well known in the art and refers to a nucleic acid sequence that defines a single protein or polypeptide. The polypeptide can be encoded by a full length sequence or by any portion of the coding sequence, provided the functional activity of the protein is conserved. A "structural gene" defines a DNA sequence that is transcribed into RNA and translated into a protein that has a specific amino acid sequence, resulting in a specific polypeptide or protein. "Restriction endonuclease or restriction enzyme" is an enzyme that has the ability to recognize a specific sequence of bases (usually 4, 5 or 6 base pairs in length) in a DNA molecule, and against the DNA molecule anywhere this sequence appears. An example of the enzyme is EcoRI, which recognizes the GAATTC / CTTAAG base sequence and cuts a DNA molecule at this recognition site. "Restriction fragments" are DNA molecules produced by the digestion of DNA with a restriction endonuclease. Any given genome or DNA segment can be digested by a particular restriction endonuclease by forming at least two discrete molecules or restriction fragments. "Agarose gel electrophoresis" is an analytical method to split double-stranded DNA molecules based on size. The method is based on the DNA molecules migrating through a gel as if it were a sieve, so that the smallest DNA molecule has the highest mobility and moves through the gel to the furthest point. The sieve characteristics of the gel slow down the larger DNA molecules so that they have less mobility. The fractionated DNA can be visualized by gel staining using methods well known in the art, nucleic acid hybridization or by labeling the fractionated DNA molecules with a detectable label. All of these methods are well known in the art, and specific methods can be found in Ausubel et al. (supra) "Oligonucleotide" is a molecule consisting of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. The exact size of the molecule will depend on many factors, which in turn depend on the function or final use of the oligonucleotide. An oligonucleotide can be produced by synthesis, by cloning or by amplification. "Amplification of a sequence" is a method for generating large quantities of a target sequence. In general, one or more amplification primers are annealed with a nucleic acid sequence. Using appropriate enzymes, sequences that are in adjacent position or between the primers are amplified. One method of amplification used here is the polymerase chain reaction (PCR). "Amplification primer" refers to an oligonucleotide, capable of reassociating with a region of DNA adjacent to a target sequence and serving as an initiation primer for DNA synthesis under suitable conditions well known in the art. He The extension product of the synthesized primer is complementary to the target sequence. The term "domain" or "region" refers to the specific amino acid sequence that defines either a specific function or a specific structure within a protein. An example given here is the oligomerization domain of this invention which is comprised within the papillomavirus protein. The term "delineated" as used herein refers to a segment of protein or peptide that is comprised among the amino acids referred to excluding the delineating amino acids. For example, a protein delineated by amino acids 30 to 100 refers to any segment of protein or peptide of any length that would be located between amino acid 30 (exclusively) and amino acid 100 (exclusively) or any variant, derivative or fragment thereof. The term "delimited" as used herein means a segment of protein or peptide that is constituted by the referred amino acids including the delimiting amino acids. For example, a protein bounded by amino acids 31 to 99 refers to a protein or peptide fragment comprising amino acids 31 to 99 or any variant or derivative thereof.

The term "fusion protein" as defined herein refers to at least two polypeptide segments that are not linked together in nature. Non-limiting examples of such "fusion proteins" according to the present invention include the El protein and any variant, fragment or derivative thereof, fused to thioredoxin. For the purposes of this invention, the use of thioredoxin allows the fused protein or any fragment, variant or derivative thereof to be purified in soluble form. Therefore, any protein capable of solubilizing the protein can be used for the purposes of this invention. Another example of fusion proteins for the purposes of the present invention is the fusion of the El protein and any variant, derivative or fragment thereof to the GAL protein. These fused polypeptides can be further fused to a polypeptide of an "affinity tag". In some embodiments, it may be beneficial to introduce an additional cleavage site between the two polypeptide sequences that have been fused. Such cleavage sites between two or more heterologously fused proteins are well known in the art.

The terms "vector" or "DNA construction" are commonly known in the art and refer to any genetic element, including but not limited to, plasmid DNA, phage DNA, viral DNA and the like which may incorporate the oligonucleotide sequences, or sequences of the present invention and serve as a DNA vehicle in which the DNA of the present invention can be cloned. There are numerous types of vectors and they are well known in the art. The term "expression" defines the procedure by which a structural gene is transcribed into mRNA (transcription), the mRNA (translation) then being translated into a polypeptide (or protein) or more than one. The term "expression vector" defines a vector or vehicle as described above but designed to allow the expression of an inserted sequence after its transformation into a host cell. The cloned gene (inserted sequence) is usually placed under the control of sequences of control elements such as promoter sequences. Such expression control sequences will vary depending on whether the vector is designed to express the gene operably linked in a prokaryotic or eukaryotic host agent or both (transporter vectors) and may additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue specificity elements and / or translation initiation and termination sites. By "eukaryotic expression system" is meant the combination of an appropriate expression vector and a eukaryotic line that can be used to express a protein of interest. In some systems the gene for the protein can be inserted into the genome of a virus that can infect the type of cell that is being used. Plasmid vectors containing the desired gene can also be used. In all cases the vector will contain appropriate control elements (promoters) to express the protein in the cell type of interest. In certain expression systems additional components may also be necessary, for example a vector or viral genome is yeast (eg, Saccharomyces cerevi s i a e, Pi s ch i a pa s tori s) transfected with a plasmid vector; insect cells (for example SF9, SF21) infected with baculovirus (Au ographa ca li forn i ca or Bombyx mori) (Luckow, Curr Op. Biotech., 1993, 4: 564-572; Griffiths and Page, 1994, Methods in Molec, Biol. 75: 427-440, and Merrington and col., 1997, Molec. Biotech 8 (3): 283-297); mammalian cells infected with adenovirus, vaccinia virus, Sindbis virus or "semliki forest" virus; and mammalian cells transfected with DNA vectors for temporal expression or constitutive. Here, the Saccharomyces cerevisiae yeast system is particularly preferred, and the mammalian cells derived from Chinese hamster ovary cells (CHO). A host cell or an indicator cell has been "transfected" by exogenous or heterologous DNA (e.g., a DNA construct) when the DNA has been introduced into the cell. The transfectant DNA may or may not be integrated (covalently linked) into the chromosomal DNA constituting the genome of the cell. In prokaryotes, yeasts and mammalian cells, for example, the transfecting / transfecting t rans DNA can be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, an example of a stably transfected cell is one in which the transfected DNA has been integrated into a chromosome and is inherited by daughter cells through chromosomal replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprising a population of daughter cells that contain the transfected DNA. Transfection methods are well known in the art (Sambrook et al., 1989, supra; Ausubel et al., 1994, supra). The expression "affinity marker" or "affinity tag" as used herein refers to a tag that is specifically trapped by a complementary ligand. Examples of affinity ligand / affinity tag pairs include but are not limited to: protein that binds to maltose (MBP) / maltose; glutathione S transferase (GST) / glutathione; poly-hist idine (His) / metal. The metal used as the affinity ligand can be selected from the group consisting of cobalt, zinc, copper, iron and nickel (Wong et al., 1991, Separation and Purification Methods, 20 (1), 49-106). Preferably, the selected metal is nickel. The affinity ligand can be applied to columns to facilitate separation by affinity chromatography. The affinity tag can be placed at the N or C-terminus of the protein, but preferably at the N-terminus of the protein. Nucleotide sequences and polypeptides useful for practicing the invention include, without limitation, mutants, homologs, subtypes, alleles and similar. It will be understood that, in general, the sequences of the present invention encode an interaction domain. It will be clear to a person skilled in the art that the interaction domain of the present invention and any variant, derivative or fragment thereof, can be easily determined using the techniques and assays of the present invention and the art in general. As used herein, the designation "variant" denotes in the context of this invention a sequence of either nucleic acid or amino acids, a molecule that retains a biological activity (either functional or structural) that is substantially similar to that of the original sequence. This variant or equivalent may be of the same species or of a different species and may be a natural variant or prepared synthetically. These variants include amino acid sequences that have substitutions, deletions or additions of one or more amino acids, as long as the biological activity of the protein is retained. The same applies to variants of nucleic acid sequences that may have substitutions, deletions or additions of one or more nucleotides, provided that the biological activity of the sequence or its translated protein is generally maintained.

The term "derivative" is intended to include any of the variants described above when they comprise an additional chemical moiety that does not normally form part of these molecules. These chemical residues may have various purposes including improving the solubility of a molecule, absorption, biological half-life, decreasing toxicity and eliminating or diminishing undesirable side effects. Moreover, these residues may be used for the purpose of marking, binding, or may be included in the fusion product (s). Different residues capable of mediating the effects described above can be found in Remington's The Science and Practice of Pharmacy (1995). Methodologies for coupling such moieties to a molecule are well known in the art. The term "fragment" refers to any segment of a DNA, RNA or amino acid sequence identified and / or any segment of any of the variants or derivatives described hereinbefore. The terms "variant", "derivative" and "fragment" of the present invention refers here to proteins or nucleic acid molecules that can be isolated / purified, chemically synthesized or produced through DNA technology recombinant. All these methods are well known in the art. As illustrated hereinafter, the nucleotide sequences and polypeptides used in the present invention can be modified, for example by mutagenesis in vi t ro, to segregate the relationship between the catalytic function and the structure thereof and to allow a better design and identification of the resulting proteins. "Oligomerization" refers to an interaction between at least two molecules. The molecules can be the same or different. In the present invention the term "self-oligomerization" refers to the interaction between the protein El and any derivative, variant or fragment thereof. "Trace sequence" is defined herein as an amino acid sequence that is capable of oligomerization with itself or with a PV protein (including a derivative, fragment or variant thereof). This sequence comprises a component of a screening method for selected agents that modulate oligomerization. "DNA co-immunoprecipitation assay" is an assay for the detection of the protein-DNA interaction. The protein-DNA complex is immunoprecipitated with an antibody against the protein comprised in the complex. The immunoprecipitated product comprising the DNA can be detected / measured or visualized by methods well known in the art, such as agarose gel electrophoresis followed by radiological or colorimetric techniques.

Preferred realizations In a particularly preferred embodiment, there is provided a sequence of amino acids and any derivative, variant or fragment thereof, comprised within region A of the protein El of PV, necessary for the oligomerization of El. Oligomerization of the protein El is demonstrated in this application using amino acid fragments of various sizes of the A region of the El protein. These fragments are all within the scope of the present invention. According to this first embodiment, an amino acid sequence necessary for the oligomerization of the PV protein delineated by amino acids 352 and 439, according to the HPV-11 numbering, is provided. Alternatively, the amino acid sequence is delimited by amino acids 353 to 438 according to HPV-11 numbering. Moreover, alternatively, the amino acid sequence is defined according to SEQ ID NO. 2. In a preferred aspect of this first embodiment, the amino acid sequence is further delineated by amino acids 352 and 432. Alternatively, the amino acid sequence is delimited by amino acids 353 to 431 according to the HPV-11 numbering. Moreover, alternatively, the amino acid sequence is defined according to SEQ ID NO. 3. In a more particular aspect of the first embodiment, the amino acid sequence is further delineated by amino acids 352 and 417. Alternatively, the amino acid sequence is delimited by amino acids 353 to 416 according to the HPV-11 numbering. Moreover, alternatively, the amino acid sequence is defined according to SEQ ID NO. 4. In accordance with the above embodiment of the amino acid sequences, all variants, derivatives and fragments thereof functionally equivalent to the sequences described herein are within the scope of this invention. A further embodiment of this invention is that the amino acid sequences of this invention can self-associate. In addition these sequences are capable of forming oligomers with the full-length El protein and any derivative, variant or fragment thereof, comprising the sequence of this invention. Therefore, according to a second embodiment of this invention, a screening assay is provided to evaluate the DNA binding (and hence the oligomerization of the El protein) by detection and / or measurement of the amount of DNA with -precipitated with the protein El. According to a specific aspect of this second embodiment, an assay is provided to screen for an agent capable of inhibiting El oligomerization by measuring the decrease of co-immunoprecipitated DNA with the El protein. More particularly, this second embodiment provides an assay of oligomerization comprising the steps of: a. combine El protein with a DNA fragment, and incubate for a period of time to allow protein El and DNA to form a complex, b. Isolate the protein complex The un-complexed DNA / DNA c. detect DNA, where the presence of DNA is an indication of the binding of protein to DNA, and is therefore co-related to oligomerization of El. The one used for this assay can be selected from: the amino acid sequences of this invention, the full-length protein, the N-terminally truncated (El *) protein and any derivative, variant or fragment thereof. Preferably, the DNA fragment used in this particular embodiment contains an origin of replication to enhance the specificity of the binding of El. More preferably, the El is combined with a mixture of two DNA fragments, one of which contains an origin of replication and the second is constituted by a DNA of different length such that it is distinguishable from the DNA containing ori and that the amount of El bound to the DNA containing ori can be compared to the amount of non-specific binding. Particularly, the El-DNA complex is isolated from free DNA by column chromatography, centrifugation, extraction, filtration or immunoprecipitation. More preferably, the El-DNA complex is isolated by immobilization of the antibody in a solid medium such as a SPA bead or the bottom of a well of a test plate so that when the medium is separated, so does the free DNA. Particularly, the El is immunoprecipitated or immobilized using a polyclonal antibody. More particularly, the polyclonal antibody is K71 or K72. Preferably, before the complexed DNA is detected, the DNA is released from the El / DNA complex. This release can be carried out, for example, by organic extraction. In a specific aspect of this second embodiment, the DNA can be detected by methods including gel electrophoresis, spectrophotometry and radiological imaging. Accordingly, depending on the detection means chosen, the DNA is labeled by any suitable means known in the art, including fluorescent dyes or radioactive isotopes. Preferably, the DNA is radiolabelled and detected by gel electrophoresis followed by radiological imaging. Alternatively, the DNA is labeled with a colorimetric material and is detected spectrophotometrically, or the DNA is labeled with a fluorescent material and detected by scintillation proximity technology (SPA).

Particularly, the DNA is labeled before complex formation after immunoprecipitation or after the DNA is separated from the immunoprecipitation complex. In a particular aspect of this second embodiment, the assay is provided as described above adapted to screen for an agent capable of inhibiting El oligomerization, this assay further comprising the steps of: a. contacting an agent with the El protein before combining it with the DNA fragment and incubating for a sufficient period of time to allow the El / DNA protein to form a complex, and e. compare the results with a control sample, where the control sample is treated in a similar manner but without the addition of the agent. More particularly, the selected agent is capable of interfering with oligomerization and more particularly such an agent is inhibitory to the oligomerization of the El protein and any derivative, variant or fragment thereof as described above.

According to the third embodiment of this invention, a crosslinking assay is provided to directly measure the level of oligomerization (or inhibition thereof) of the El protein. In particular, this oligomerization assay comprises the steps of: a. combine the labeled protein with a DNA fragment and incubate for a sufficient period of time to allow the protein El and the DNA to form a complex, b. crosslink the El protein and the DNA in the complex with a crosslinking agent, c. Separate the protein electrophoretically so that the migration of El is an indication of the oligomerization level of El. Preferably, the El / DNA complex is isolated from the free DNA before carrying out the separation. Particularly, the protein used in this oligomerization assay is a truncated protein at its N-terminus. More preferably, its first 70 N-terminal amino acids are deleted. More preferably, this protein El is bounded by amino acids 72-649.

Preferably, the El protein is labeled with a radioisotope. More preferably, it is labeled with 35S and detected on the gel by radiological imaging techniques, well known in the art. Preferably, the crosslinking agent is bismaleimidohexane (BMH). According to a fourth embodiment of this invention, a truncated protein is provided at its N-terminus. In particular, approximately the first 70 N-terminal amino acids are deleted from the El protein. More particularly, one aspect of this fourth embodiment encompasses the El protein bounded by amino acids 72 to 649 (SEQ ID NO: 78). Since it has been shown that the El protein has similarities with other papillomaviruses and with the T antigens of SV40 and the polyomavirus, the invention encompasses any amino acid sequence necessary for the oligomerization of a protein that is necessary to initiate viral DNA replication, which has functional and / or structural similarities to the amino acid sequence of the present invention. In a further preferred embodiment of this invention, a region in the protein is necessary for its oligomerization having function and / or structure similar is present in the bovine papillomavirus, in the papillomavirus of the cottontail rabbit or in the human papillomavirus. In a specific aspect of the embodiments of this invention, the PV DNA is HPV. In a more preferred embodiment, the region of the protein El is selected from HPV of the low risk or high risk type; the types of high risk are constituted by types 16, 18, 31, 35, 45, 52 and 52; and the low risk types are constituted by types 6, 11 and 13. In a more preferred embodiment of this invention, the amino acid sequence of this invention is of a low-risk type 11 human papilloma virus. specific to the embodiments of this invention, the protein El can be obtained by different means. In a non-limiting example, the protein is synthesized by transcription / translation coupled in a rabbit reticulum lysis product or prepared by recombinant technology. According to an application of this invention, the screening method and the tracking system are carried out at low temperatures in the presence or absence of ATP / Mg or at high temperatures in the presence of ATP / Mg. More preferably, at low temperatures of about 4th and 23 ° C, and at a high temperature of approximately 37 ° C. In addition, the protein El can be prepared by transcription / translation in vi t ro or by recombinant technology and comprises amino acids 72-649 (SEQ ID NO: 78), although other means known in the art can be used to provide the amino acid sequence for tracking. In an application of this invention, the amino acid sequence of this invention and any variant, derivative or fragment thereof, can be used on an affinity column for the selection of any protein or molecule capable of binding thereto. Non-limiting examples are antibodies, polypeptides, nucleic acid sequences and chemical compounds. Preferably, the agent selected using the embodiments of this invention affects viral DNA replication, specifically replication of papillomavirus DNA and more particularly HPV. In a particular application of this invention it is contemplated that one or more of the selected agents may be used in a pharmaceutical composition for the treatment of papillomavirus infection. Although some specific technical means are exemplified here, it is contemplated that any means known to a person skilled in the art for the purposes of this invention is included within the scope of this invention.

EXAMPLES EXAMPLE 1: YEAST OF YEAST, MEANS AND GENETIC METHODS The Y153 strain of Saccharomyces cerevisiae was used (MATa leu2-3, 112 ura3-52 trpl-901 his3-? 200 ade2-101 gal4? Gal? O? URA3 :: GAL-LacZ LYS :: GAL-HIS3) for the analysis of two yeast hybrids (Durfee et al., 1993, Genes / Dev. 7_: 555-569). Transformation of yeast strain Y153 was effected using the LiAc method essentially as described in the Clontech Matchmaker Library Protocol. Cells that were co-trans formed with a combination of two plasmids were selected at 30 ° C for 3 to 5 days in SD medium (described by Sherman et al 1979, Methods in Yeast Genetics, Cold Spring Harbor, NY) which lacked leucine and tryptophan but it was complemented with the other required amino acids.

Example 2: ß-galactosidase assays The transformed yeast cells were previously grown in SD medium that lacked leucine and tryptophan and then used to inoculate YPD cultures (Sherman et al Supra). These cultures were grown at 30 ° C until they reached an optical density of approximately 0.6 to 600 nm (D0600) • The cells were then harvested, washed and permeabilized by two freezing cycles (liquid nitrogen) and thawing. The activity of β-galactosidase (at 578 nm) was then measured rofotometically using the red chlorophenyl-β-D-galactopyranoside substrate (CRPG, Boehringer Mannheim) as described in the Ma ch chiller Libra r and Pro to col from Clontech . Enzymatic activity was calculated using the equation: Miller Units = (1,000 x D? 57e) / (minutes elapsed x 1.5 ml of culture x DOßoo) • Example 3: Plasmid constructions A. Plasmids for transcription / translation ± nv ± tro Constructs and primers for amplification are summarized in Table 1. The plasmids used for the synthesis of El and E2 of HPV-11 in vi tro were obtained from, or pCR3 (Invitrogen, CA) or pTMl (obtained from Bernard Moss, NIH). In these plasmids, the protein coded can be expressed in vi tro from the T7 promoter located upstream of the open reading frame (ORF). When used in a coupled transcription / translation system (TNT Coupl ed Recyclic ocyte Lysa te System, Promega), the plasmids obtained from pTMl directed the synthesis of higher levels of proteins. Presumably, this occurs because this plasmid encodes the EMCV IRES (site of entry into the internal ribosome of the encephalomyocarditis virus) that stimulates translation (data not indicated). To construct pCR3-El and pCR3-E2, the whole ORFs of El and E2 of HPV-11 were amplified separately by polymerase chain reaction (PCR), although any methods capable of amplifying DNA for the purposes of this invention are suitable. . The following pairs of oligonucleotides were used in the amplification reaction: E1: CAAGGATGGCGGACGATTCA (SEQ ID NO.15), and TCTTCATAAAGTTCTAACAAC. { SEQ ID NO.16) E2: GAAGAJGGAAGCAATAGCCAA (SEQ ID NO.17), and ATGGJTACAATAAATGTAATGAC (SEQ ID NO.18) (The ATG and termination codons of El and E2 are underlined) The DNA templates used for PCR were the AcllEl or AcllE2 baculovirus constructs (obtained from R. Rose, U. of Rochester). The PCR products of El and E2 were each cloned under the control of the immediate early promoter of cytomegalovirus in the plasmid PCR3, using the TA cloning kit (Invitrogen) to generate pCR3-El and pCR3-E2. Plasmid pCR3-FLAG-El (the FLAG epitope is from Eastman Kodak Co.) expressing El (amino acids 2-649) fused at its N-terminus to the FLAG epitope (Met Asp Tyr Lys Asp Asp Asp Asp Lys) was constructed by PCR amplification of the ORF of The with the following two oligonucleotides: CATGGACTACAAGGACGACGATGACAAGGCGGACGATTCAGGTACAGAAAAT (SEQ ID NO.19), and GGGATCCTTATTATAAAGTTCTAACAACTGATCCTGGCAC (SEQ ID NO. (the portion encoding the FLAG epitope is underlined).

The resulting PCR product was cloned into the plasmid pCR3 (Invitrogen) using the TA cloning kit (Invitrogen). To construct the pTM-1-El plasmid, the ORF was amplified by PCR using the following two oligonucleotides: GTACGATCCCATGGCGGACGATTCAGGTACAGAAAAT (SEQ ID NO.21), and GTACGATGGGATCCTTATTATAAAGTTCTAACAACTGATCCTGGCAC (SEQ ID NO.22) The resulting PCR product was run with the restriction enzymes Ncol and BamHl (the restriction sites are encoded by the two oligonucleotides) and inserted between the Ncol and Ba Hl sites of the pTMl plasmid. Plasmid pTMl-FLAG-The one that expresses (amino acids 2-649) fused at its N-terminus to the FLAG epitope (Met Asp Tyr Lys Asp Asp Asp Asp Lys) was constructed by PCR amplification of the ORF of El with the following two oligonucleotides: CCCATGGACTACAAGGACGACGATGACAAGGCGGACGATTCAGGTACAGAAAAT (SEQ ID No. 23), and GGGATCCTTATTATAAAGTTCTAACAACTGATCCTGGCAC (SEQ ID No. 24) (the portion encoding the FLAG epitope is underlined).

The resulting PCR product was run with Ncol and BamHl (encoded by the two oligonucleotides) and inserted between the Ncol and Ba Hl sites of the pTMl plasmid. Plasmids expressing the truncated proteins at their N-terminal end in vitro were constructed by amplification of the desired portion of the ORF of El with specific primers carrying a Ncol site (direct primer) and a BamHI site (reverse primer).

The PCR products were digested with Ncol and BamHl and inserted between the Ncol and BamHl sites of the pTMl plasmids. The sequences of the different direct primers that were used, and those of the common reverse primer, are described below. The indicated in parentheses is the first amino acid of El that is encoded by each of these oligonucleotides: Direct primers: CCCGGATCCTAATGGCGGACGATTCAGGT (aa1) (SEQ ID NO.25) GGCTGGATCCATGGCGGATGCTCATTATGCG (aa72) (SEQ ID NO.26) GGCTGGATCCATGGCCATTAAACTTACAACACAG (aa112) (SEQ ID NO.27) GGCTGGATCCATGGGCTATTCGTGGAAG (AA138) (SEQ ID N0.28) GGCTGGATCCATGGGGAGGGACATAGAGGGT ( aa166) (SEQ ID NO.29) GGCTGGATCCATGGACACATCAGGAATATTAGAA (aa191) (SEQ ID NO.30) GGCTGGATCCATGGACAGTCAATTTAAATTAACT (aa353) (SEQ ID N0.31) GGCTGGATCCATGGACAGTGTAGGTAACTGG (aa435) (SEQ ID NO.32) Reverse primer: CCCGGATCCTCATAAAGTTCTAACAACT (a.a.649) (SEQ ID NO.33) Plasmid pTMl-FLAG-El (72-649) encoding a truncated HPV-11 protein lacking the 71 N-terminal amino acids, but which is marked at its N-terminus with the FLAG epitope, was constructed by PCR amplification using an oligonucleotide encoding the FLAG epitope: GGGGGCCATGGACTACAAGGACGACGACGACAAGGCGGATGCTCATTATG (SEQ ID NO.34) (the FLAG epitope sequence is underlined) and the following reverse primer was used: CCCGGATCCTCATAAAGTTCTAACAACT (SEQ ID NO.33) Plasmids similar to pTMl-FLAG-E1 (72-649) were constructed but they encode El proteins with a C-terminus truncated by PCR amplification of the desired portion of the ORF of El with specific primers carrying an Ncol site (forward primer) and a BamHl site (reverse primer). The PCR products were digested with Ncol and BamHl and inserted, in frame, between the Ncol and BamHl sites of pTMl plasmids. The sequence of the direct primer of El common (coding for the FLAG epitope) is described below. The sequences of the different reverse primers of El that were used are also described. The indicated in parentheses is the last amino acid of El that is encoded by each of these inverse primers.

Direct primer: GGGGGCCATGGACTACAAGGACGACGACGACAAGGCGGATGCTCATTATG (SEQ ID NO.34) (the FLAG epitope sequence is underlined) Inverse primers: CCCGGATCCTCATAAAGTTCTAACAACT (SEQ ID NO.33) CCCGGATCCTCATGCATCAGTTCATATACTG (aa608) (SEQ ID NO.35) CCCGGATCCTCAGCTAATGTCTATATTGTAACC (aa572) (SEQ ID N0.36) CCCGGATCCTCATAAAAATGGAATAAATTCTATGTTTG (aa458) (SEQIDNO. 37) CCCGGATCCTCACTGGCGCGTTATCCATTCCGGC (aa344) (SEQ ID NO.38) CCCGGATCCTCAAATGCCTGTCCTAAACCAATAC (aa327) (SEQ ID NO.39) B. Plasmids from two yeast hybrids The constructs and primers used for amplification are summarized in Tables 2 and 3. Unless otherwise indicated, HPV-11 DNA fragments were amplified by PCR with specific primers carrying a site Ncol (direct primer) and a site (BamHl) reverse primer). The PCR products were digested with Ncol and BamHl and inserted, in frame, between the Ncol and BamHl sites of the yeast two-hybrid vectors pASl (GAL4 DNA binding domain) and pACT2 (activation domain) GAL4) (Durfee et al., 1993, Genes, Dev. 7: 555-569). Two hybrid plasmids encoding the Complete protein (amino acids 1-649) in a similar way with the exception that the forward primer contained a BamH1 site instead of an Ncol site. In this case, the PCR product was cut with BamHl and inserted, in frame, into the BamHl sites of pASl and pACT2. Similarly, but using a mutated gene as a template for PCR (see below the description of the mutations in El) plasmids of two hybrids carrying a mutated ORF were generated (P479S, K484E or K484Q). The various forward and reverse primers that were used are described below.

Direct primers CCCGGATCCTAATGGCGGACGATTCAGGT (aa1) (SEQ ID NO.25) GGCTGGATCCATGGCGGATGCTCATTATGCG (aa72) (SEQ ID NO.26) GGCTGGATCCATGGGCTATTCGTGGAAG (AA138) (SEQ ID NO.28) GGCTGGATCCATGGACACATCAGGAATATTAGAA (AA191) (SEQ ID NO.30) GGCTGGATCCATGGCAAGTACAGTTATAGGGG ( aa330) (SEQ ID NO.31) GGCTGGATCCATGGACAGTCAATTTAAATTAACT (aa353) (SEQ ID NO.40) GGCTGGATCCATGGCATAAAATTTGTG (aa365) (SEQ ID NO.41) GGCTGGATCCATGGCATTTATGCACAGCG (aa377) (SEQ ID NO.42) GGCTGGATCCATGGGAGACTTTCCAATGC (aa384 ) (SEQ ID NO.43) GGCTGGATCCATGGACTCCAATGCAAGGGCC (aa387) (SEQ ID No.44) GGCTGGATCCATGGATTGTGCAATTATGTGCAG (aa405) (SEQ ID NO.45) GGCTGGATCCATGGCAGAAAAAAGATGTC (aa416) (SEQ ID NO.46) GGCTGGATCCATGGACAGTGTAGGTAACTGG (aa435) ( SEQ ID NO.32) Inverse primers: CCCGGATCCTCATAAAGTTCTAACAACT (a.a.649) (SEQ ID NO.33) CCCGGATCCTCAGCTAATGTCTATATTTGATGTAACC (a.a.572) (SEQ ID NO.36) CCCGGATCCTCAATATGTATCCATATATGTCCA AC (a.a.536) (SEQ ID NO.32) CCCGGATCCTCATAAAAATGGAATAAATTCTATGTTTTGATG (a.a.458) (SEQIDNO.

CCCGGATCCTATCACACAATTGGCTTCCAGTTACC (a.a.444) (SEQ ID NO.48) CCCGGATCCTATCAACCTACACTGTCAACTTTAG ((a.a.4381SEQ ID NO.49) CCCGGATCCTATCAACCCCTATACTTAATCCATTG (a.a.431) (SEQ ID NO.50) CCCGGATCCTATCATGCATGTTTATAATGTCTGCAC (a.a.416) (SEQ ID NO.51) Using a different strategy two plasmid-derived plasmids derived from pASl and pACT2 encoding sequences 353-572, 353-536 and 353-458 from El were constructed in two stages. In the first stage, El sequences were amplified by PCR using the two primers following: GGCTGGATCCATGGACAGTCAATTTAAATTAACT (a.a.353) (SEQ ID NO.40) and, CCCGGATCCAGTGTGATGGATATCTGCAG (SEQ ID NO.52) (pCR3).

The PCR templates were PCR3 plasmids expressing an Elf truncated ORF: the amino acids of 1-572, 1-536 or 1-458. One of the two oligonucleotides used for PCR amplification is hybridized on codon 353 of El. The other oligonucleotide is hybridized in the polylinker region of PCR3, downstream of the truncated ORF. The PCR products were digested with Ncol and BamHl and cloned between the Ncol and BamHl sites of pASl and pACT2. The plasmids that were used as templates in these three PCR reactions were constructed by amplifying the ORF of El with the following oligonucleotide: CAAGGATGGCGGACGATTCA (SEQ ID NO.15) (El ATG is underlined) and one of three oligonucleotides that hybridize on codon 572, 536 and 458, respectively, of El. The sequences of these oligonucleotides are given below: GGATCCTCATTAGCTAATGTCTATATTTGATGT (a.a.572) (SEQ ID NO.53) GGATCCTCATTAATATGTATCCATATA (a.a.536) (SEQ ID NO.54) GGATCCTCATTATAAAAATGGAATAAATTCTATG (a.a.458) (SEQ ID NO.55) The resulting PCR products were cloned in PCR3, using the TA cloning kit (Invitrogen).

C. Plasmids for the temporary replication of HPV The plasmids that were used in the HPV DNA temporal replication assays to express El and E2 in transfected cells were all obtained from pCR3: pCR3-El, pCR3-FLAG-El (The wild type (WT) and mutant) and pCR3-E2. These plasmids have been described above.

Plasmid pN9 (Lu et al., 1993, J. of Virol. 67: 7131-7139) was obtained from D. McCance (U.

Rochester) and contains the complete origin of replication of HPV-11 (nucleotides 7884 to 61) cloned in pBluescript 11 SK + (Stratagene).

D. Plasmid for the expression of fusion proteins with thioredoxin Three El fragments (a.a. 353-416 / 353-431 / 353-438) were expressed in E. col i as fusion proteins with thioredoxin (TRX). Plasmids for expressing these fusion proteins were constructed by PCR amplification of the relevant portion of the ORF of El using a subset of the forward and reverse oligonucleotides described above. The PCR products were digested with Ncol and BamHl and subcloned between the Ncol and BamHl sites of the pET-32a-c (+) plasmids (Novagen) encoding the TRX.

Example 4: Site-directed Mutagenesis Site-directed mutagenesis was performed with the site-directed mutagenesis kit on a Qu i ck Chan ge site (Stratagene) according to the instructions supplied by the manufacturer. For each mutagenesis, a pair of oligonucleotides was used complementary For each pair the sequence of the oligonucleotide corresponding to the coding strand is described below. The substitution of the resulting amino acids is also indicated.

E1 F378A GTGAGATAGCAGCTGAATATGCACAGCG (SEQ ID NO.56) E1 Y380A GAGATAGCATTTGAAGCTGCGCAGCGTGGAG (SEQ ID NO.57) E1 N389A GACTTTGACTCCGCGGCAAGGGCC (SEQ ID NO.58) E1 A390G GGAGACTTTGACTCCAACGGCCGGGCCTTTTTAAATAG (SEQ ID NO.59) E1 F393A GCAAGGGCCGCGTTAAATAGTAATATGC (SEQ ID NO.60) E1 Q399A CCTTTTTAAATAGTAATATGGCGGCTAAATATGTAAAAG (SEQ ID NO.61) E1 P479S CCATTGTAGGGTCACCTGACACTGG (SEQ ID No.62) E1 K484E CTGACACTGGGGAGTCGTGCTTTTG (SEQ ID No.63) E1 K484Q CTGACACTGGGCAGTCGTGCTTTTG (SEQ ID No.64) E1 K484H CCTGACACTGGGCACTCGTGCTTTTGC (SEQ ID NO.65) E1 K484I CCTGACACTGGGATCTCGTGCTTTTGC (SEQ ID NO.66) E1 K484R CCTGACACTGGGCGGTCGTGCTTTTGC (SEQ ID NO.67) E1 F509A CCTGCAGCCACGCGTGGCTACAGCC (SEQ ID NO.68) E1 T566A CCGCTACTGGTTGCTAGCAATATAGACATTAGC (SEQ ID NO.69) E1 N568A CTACTGGTTACATCAGCAATTGACATTAGCAAAG (SEQ ID NO.70) E1 K286A / R288A GGTTTAAAGTAAATGCTAGCGCATGTACCGTGGCACG (SEQ ID NO.71) E1 A292L / R293E CAGATGTACCGTGCTCGAGACATTAGGTACG (SEQ ID NO.72) The triple point mutation at the origin of HPV-11 was introduced into the pN9 plasmid using the following oligonucleotide: CATATTTCCTTCTTATACTGCAGAACAATCTTAGTTTAAAAAAGAGG (SEQ ID NO.73) and its complement (the mutant nucleotides are underlined).

Example 5: Assay of binding to the origin of El We used the lysis product system of coupled reticulocytes TNT (Promega) to produce the El protein by transcription / translation associated in vi t ro. The lysis product was programmed with 2 μg of the appropriate plasmid per 50 μl of reticulocyte lysis product TNT, and following the protocol supplied by the manufacturer. When necessary, the El protein was radiolabeled by incorporation of 36S-methionine. The binding reactions were made by mixing 30 μl of the lysis product containing El, 200 to 400 ng of a DNA probe radiolabeled with 33P and 7.5 μl of a DNA binding buffer x 10 (200 mM Tris-HCl, pH 7.6 , 1 M NaCl, 10 mM EDTA, 10 mM DTT) in a final volume of 75 μl. The binding reactions were allowed to proceed at the indicated temperature for 90 minutes. When indicated, ATP (or a similar nucleotide) and MgCl2 were added as supplements to the binding reactions at a final concentration of 5 mM and 3 mM, respectively. The DNA-protein complexes were immunoprecipitated either with the antibody monoclonal anti-FLAG M2 (Eastman Kodak) when using The labeled with FLAG, or with the polyclonal antibody K72 which was prepared in rabbits against a peptide obtained from the 14 amino acids of C-terminal HPV11 El. The amino acid sequence of this peptide is QAFRCVPGSVVRTL (SEQ ID No. 79). Before their use in immunoprecipitation, the antibodies were previously bound either to protein G sepharose beads (when anti-FLAG was used) or to protein A-sepharose beads (for K72). The immunoprecipitation of the protein-DNA complexes was carried out for 1 h at the temperature of the binding reaction. The complexes were washed 3 times with 200 μl of wash buffer (50 mM Tris, pH 7.6, 100 mM NaCl, 0.1% Triton X-100). The DNA present in these complexes was extracted with phenol-chloroform and precipitated with ethanol in the presence of yeast tRNa as carrier. The precipitated radiolabeled DNA fragments were resolved on a TBE gel with 5% polyacrylamide and visualized by autoradiography. The radiolabelled probe that was used in these experiments consists of two DNA fragments and was prepared in two stages. In the first step, the plasmid pN9 was linearized by digestion with Xmal and the ends were labeled with the Klenow fragment of DNA polymerase I in the presence of 5 μCi of a32P-dCTP and a 0.1 mM concentration of each of: dTTP, dATP, dGTP. The labeled DNA was purified on QIAquick PCR purification columns (QIAGEN). In the second step, the linear radiolabelled pN9 was digested with Pvull to generate two labeled fragments: a fragment of 370 base pairs (bp) containing the origin of replication of HPV-11 and a control fragment of 186 bp that lacks the origin .

Example 6: Assay of binding to the origin of the E2 dependent The conditions for the formation of the El-E2-ori ternary complex were essentially the same as those described above for the origin-to-El binding assay. The only major differences were that 7.5 μl of the E2 protein translated in vi t was added to the binding reaction and that full-length protein (a.a. 1-649) was used in these experiments. The wild-type and mutant proteins used in these experiments were produced from plasmids obtained from pCR3. Minimal modifications included the fact that in vitro translations were programmed with twice the amount of DNA (2 μg / 25 μl of reaction) and that only 100 ng of probe was used per assay.

Example 7: Purification of Trx-El fusion proteins from E. coll. E cells. col i (BL21 :: DE3 [pLysS]) that contained a plasmid that encoded one of the three TRX-El fusion proteins (see above) or that encoded only TRX [pET32a-c (+), Novagen], were made Grow overnight in LB medium containing ampicillin (100 μg / ml) and chloramphenicol (34 μg / ml). 3 ml of these overnight cultures were diluted 40 times with fresh medium (120 ml) and incubated at 30 ° C until D.0.6oo = 0.5. The expression of the protein was then induced with 1 mM IPTG for 3 hours at 30 ° C (until the cultures reached a D.O.β or = 2.0). The bacterial cells were collected by centrifugation at 5,000 g for 10 minutes. The bacterial pellets were resuspended in 1 μl of lysis buffer (60 mM Tris, pH 7.6, 300 mM NaCl, 10 mM imidazole) and sonicated. The resulting lysis products were centrifuged at 16,000 g to release the cellular debris and the insoluble material. The supernatants were loaded onto previously equilibrated Ni-NTA spin columns (QIAGEN) and purified according to the manufacturer's protocol for purification of native protein. Briefly, after loading, each column was washed with 2 x 600 μl of wash buffer (60 mM Tris, pH 7.6, 300 mM NaCl, 20 mM imidazole) and the bound proteins were eluted 2 times with 200 μl of elution buffer (60 mM Tris, pH 7.6, 300 mM NaCl, 250 mM imidazole) . The purified proteins were then analyzed by 10% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE). Then all the fusion proteins were diluted with elution buffer to a final concentration of 500 ng / μl.

Example 8: HPV DNA temporal replication assay CHO-Kl cells (obtained from the American Type Culture Collection) were grown at 40% -60% confluence in 35 mm tissue culture plates in Ham F12 medium containing 10% fetal bovine serum and sodium sulfate. gentamicin. The cells were transfected with 250 ng of pCR3-El (or pCR3-FLAG-El (or pCR3-FLAG-The mutant), 25 ng of pCR3-E2 and 250 ng of pN9 plasmids using lipofectamine (Gibco BRL). FLAG epitope at the N-terminus of El does not affect its ability to support the temporal replication of HPV DNA (data not indicated) The cells were collected 72 h after transfection and the total DNA was isolated using the QlAmp blood kit (Qiagen) The plasmid DNA pN9 replicated PCR was amplified from a fragment containing the origin using Dpnl-digested total DNA as template and the following primer pairs: CTGCAACCGGTTTCGGTTACCCACACCCT (SEQ ID NO: 74) (corresponding to nucleotides 7885-7913 of the HPV-11 genome) and CGTTCCACTGAGCGTAGACCCCGTAGAA (SEQ ID NO: 75) (corresponding to nucleotides 1848-1820 of pSK +). As a control, a fragment of the plasmid pCR3-Else was amplified in the same PCR reaction with the next pair of primers that hybridize within the ORF of the GCTTTGGGCTGTCATTTG (SEQ ID NO: 76) and TGTCAGGTGGCCCTACAA (SEQ ID NO. nucleotides 1475-1492 and 2275-2258, respectively, of the HPV-11 genome). The PCR conditions consisted of an initial stage of denaturation at 95 ° C for 1 minute, followed by 20 rounds of: denaturation at 94 ° C for 30 s, annealing at 51 ° C for 1 minute and extension at 72 ° C for 1 minute 30 seconds, ending with a final extension at 72 ° C for 3 minutes. The PCR products were made radioactive by adding [a33P] dCTP to the PCR reactions and visualized by agarose gel electrophoresis and autoradiography.

Example 9: EL / DNA co-immunoprecipitation assay 1. JOINT In a 96-well U-bottom plate and polypropylene, 5 μl of compound (or mixture) at a concentration of 150 μg / ml in DMSO is added to 60 μl of master binding mixture (20 mM Tris, pH: 7.4, 100 mM NaCl, 5 mM ATP, 23 mM MgCl, 1 mM DTT, 5ng HPV11 ori + probe). Reactions begin with the addition of 10 μl of HPV11 El translated in vi tro (72-649). The plate is sealed and then stirred for 5 minutes and incubated at 37 ° C for 1 h. 2. IMMUNOCAPTURE Previous binding of antibodies to protein A-sepharose: For each test well, 1 μl of anti-El polyclonal antibody is added to 10 μl of 10% suspension of protein A-sepharose (20 mM Tris, pH 7.0). The suspension is stirred at room temperature for 1 hour. The beads are sedimented by rapid centrifugation, washed with 10 μl of 1 x binding buffer and then resuspended in 50 μl of 1 x binding buffer (+ 5 mM ATP + 1 mM DTT).

Capture: In a second 96-well U-bottom polypropylene plate, 50 μl of antibody is deposited K71 or K72-protein A-sepharose previously bound in each well. Once the binding reaction is complete, the entire binding reaction is transferred to the plate containing the antibody-protein A-sepharose beads. The plate is then sealed, incubated at 37 ° C and stirred for 1 h. The anti-El polyclonal antibodies used for the purposes of this invention are referred to herein as K71 and K72. These are the antiserum produced in rabbits against a peptide corresponding to the last 14 amino acids (C-terminal end) of El HPV-11. 3. INSULATION OF COMPLEXES BY FILTRATION First, a 96-well MHVB N45 filtration plate from Millipore is equilibrated by filtering 100 μl of 1 x binding buffer. The complexes are then transferred, filtered and washed three times with 200 μl of 1 x binding buffer. The residual liquid is separated by drying the plate with a paper towel. Finally, 150 μl of MicroScint 20 is added to each well and the counts are detected by TopCount using a protocol with 33P.

RESULTS El-El interaction in yeast (Figure 1) The two-hybrid system (Fields and Song, 1989, Nature, 34_0 (6230): 245-246 and Durfee, s upra) was used to test if the HPV can self-associate in yeast and to represent a domain of El involved in this interaction (Figure 1). As can be seen in Figure IA, a fusion protein consisting of the whole molecule (amino acids 1-649) fused the DNA binding domain (BD) of GAL4 is suitable for activating the transcription of the LacZ reporter gene driven by UASGa ? in yeast strain Y153. The shorter fusion proteins lacking the 71 N-terminal amino acids of El did not activate transcription, indicating that the N-terminus of El may contain a transcriptional activation domain. These shorter fusion proteins could be used to test an interaction with the whole protein fused to the activation domain of GAL4 (AD) (Figure IA). The interaction of these shorter fusion proteins with the whole molecule gave rise to only low levels of β-galactosidase, although reproducibly higher than the background (Figure IA and data not indicated) indicating that He can self-associate in yeast. A series of deletions were used to represent the interaction domain up to the C terminal region of El (amino acids 353-649). The self-association of El was more easily detectable between fusion proteins containing only the C-terminal portion of El (amino acids 330-649 and 353-649) (Figure IB). A series of deletions was used to refine the position of the El interaction domain (Figure IB). In this way, an El interaction domain, long, 64 amino acids, was identified between amino acids 353-416 (Figure IB). A fragment of the C-terminal (amino acids 435-649) that lacked this domain of 64 amino acids was unable to associate with El (330-649) (Figure IB) although it retained the ability to interact with E2. The El-El small interaction domain (353-416) was able not only to interact with the longer fragment of El (330-649), but also with itself (Figure IC). This last result indicated that residues 353-416 are necessary and sufficient for the homotypic interaction of El. The interaction of this small domain with El (330-649), or with itself, resulted in lower levels of β-activity. galactosidase that the interaction between the longest fragments (353-649 and 330-649) (Figure ÍC). This result was consistent with the notion that residues between amino acids 435-649, although not sufficient for interaction with El, may contribute to the strength of the interaction.

Role of the El ATP binding domain in self-association (Figure 2) The results presented above created the possibility that El residues 435-649, which are located in the C-terminal position with respect to the El-El interaction domain (353-416), may also contribute to the resistance of the El-El interaction in yeast. Since residues 435-649 encompass the El ATP binding domain, the applicant company mutated three highly conserved amino acids involved in ATP binding and tested the effect of these amino acid substitutions on the self-association of El in yeast. These substitutions exchanged two residues from the Waiker A pool (El P loop): proline 479 was changed to serine and lysine 484 was exchanged for glutamic acid and glutamine. As can be seen in Figure 2, these three substitutions decreased the El-El interaction in yeast. These results indicate that the integrity of the domain of ATP binding is important for the self-association of the El protein.

El domains required for binding to the viral origin In v ± tro (Figures 3 and 4) Previous studies in yeast suggested that at least two regions of El participate in self-association: a self-association domain (amino acids 435- 416) and an ATP binding domain. To investigate the role of these two regions in the oligomerization of El in vi tro, the applicant company used an assay that detects the binding of El to the origin of HPV. By analogy with the BPV, the applicant company anticipated that oligomerization of El would occur after joining the origin. In this assay, the HPV11 El protein that is synthesized by transcription / translation coupled in a reticulocyte lysis product of rabbits is incubated with a mixture of two radioactive DNA fragments, one of which contains the HPV11 origin. The El-DNA protein complexes that are formed in this reaction are then immunoprecipitated with an antibody against El and the co-precipitated DNA is visualized by gel electrophoresis and autoradiography. In these experiments, a series of truncated proteins were used in addition to the protein type wild, in order to define the minimum domain capable of forming a complex with the origin. All El proteins were expressed at similar levels (data not indicated). Three observations were made. First, using the wild type El, only a small number of El-ori complexes could be formed under the conditions of the assay (Figure 3A). This is probably due to the large excess of competing DNA present in these reactions (in the form of plasmids used to program the lysis products) and to the low sequence specificity of El by the origin. Second, it was observed that a protein that lacked the 71 N-terminal residues had increased its affinity (approximately 5 times) for the origin compared to the wild-type protein (Figure 3A) (hereinafter referred to as El *). ). The mechanism by which the deletion of the N-terminus increases the affinity of El for the origin is still under investigation. The binding of the truncated molecule to the origin was specific since it was affected by two substitutions of double amino acids on the El-DNA binding surface (Figure 3B). These two amino acid substitutions are similar to those of BPV-1 that abolish the binding of BPV El to the origin (Thorner et al., 1988, J. Virol. 62: 2474-2482).

Specificity was also demonstrated by the observation that a triple mutation at the origin decreased El binding (Figure 3C). Previously, it was demonstrated that, using the fingerprint analysis with DNase I, that the triple point mutation fell in the El binding site of the origin and affected the binding of El (Sun et al., 1995, Virology 216: 219-222). The third observation made was that the smallest domain of El that could bind to the origin was constituted by amino acids 191-649 (Figure 4). The additional deletion of this domain at the N or C terminus abolished the binding to the origin (Figure 4). The simplest interpretation of these results is that the binding and oligomerization of El at the origin requires a DNA binding surface (located between residues 191 and 300) and an oligomerization domain (amino acids 353-649).

A fusion protein containing the El-El interaction domain inhibits the binding of El to the origin (Figure 5) If amino acids 353-431 of El encode an El-El domain that is required for oligomerization at the origin, then it should be anticipated that this domain, a variant, a derivative or fragment of the The same, alone, when provided in excess, would inhibit in tran s the union of El * (72-649) to the origin. To test this hypothesis, they were expressed in E. col i El fragments: 353-416, 353-431 and 353-438 and purified in soluble form as fusions with thioredoxin. In the absence of thioredoxin as co-fusion partner, these three El fragments were insoluble (data not indicated). The fusion proteins contained a polyhist idine sequence that allows its purification by affinity chromatography with nickel (Figure 5A). The three fusion proteins were then assayed for their ability to inhibit the binding of El * (72-649) to the origin, at a concentration of 8 mM (a molar excess of about 300 times the El). As can be seen in Figure 5B, TRX-E1 (353-431) and TRX-E1 (353-438) inhibited the binding of El to the origin. TRX-E1 (353-416) was not inhibitory at a concentration of 8 μM, perhaps because this fusion protein is densely proteolyzed or because it has a lower affinity for El as suggested by the studies with two hybrids (see Figure 2B ). Under the same conditions, TRX alone had no effect (Figure 5B). In these experiments, two independent preparations of each fusion protein were tested with similar results (Figure IA and no data indicated). The 50% inhibitory concentration for TRX-El (353-431) as measured was approximately 3 μM (Figure 5C). These results reinforce the notions that region A is necessary for the oligomerization of El at the origin and that El (353-431) encodes an El-El interaction domain.

Role of ATP and the ATP-binding domain of El at the junction at the origin (Figures 6 and 7) Since the self-association of El in yeast requires an intact ATP-binding domain (see above), the role of ATP / Mg in the formation of the El-ori in vi t ro complex. This was done by supplementing the binding reactions with an ATP / Mg at concentrations of 5 and 3 mM, respectively. The reactions were carried out at three different temperatures (4, 23 and 37 ° C). As can be seen in Figure 6A, in the absence of ATP / Mg, the binding of El to the origin decreased drastically at high temperature (37 ° C). This inhibition by elevated temperature could be alleviated by addition of ATP / Mg (Figure 6A). At lower temperatures (23 and 4 ° C) ATP / Mg had only a modest effect. Different types of nucleotides, combined with magnesium, were tested for their ability to stimulate the binding of El to the origin. Instead of ATP I could use ADP, but not AMP or adenosine (Figure 6B). Similarly, the other three nucleotides (CTP, GTP, UTP) as well as the four deoxynucleotides (dATP, dCTP, dGTP, dTTP) could stimulate the binding to the origin (Figure 6C). Two non-hydrolysable analogs, ATP-y-S and GTP-y-S, were also stimulators indicating that the binding of the substrate, but not its hydrolysis, is necessary for El to bind to the origin (Figure 6C). The amino acid substitutions in the ATP-binding domain of El were tested for their effect on the binding of El to the origin (Figure 7). Some substitutions affect highly conserved residues of the Waiker A cluster (Figure 7A), which is probably involved in the binding of the triphosphate tail of the substrate nucleotide (Gorbalenya and Koonin, 1993, Current Opinion in Structural Biology 3: 419-429) . As can be seen in Figure 7, these substitutions, including those that avoid the self-association of El in yeast (P479S, K484Q and K484E), decreased the binding of El to the origin. Together with the results presented above, these findings indicate that binding to ATP is necessary for El to bind to the source. In these experiments, the effect of changing highly conserved residues in the C group as well as 509 phenylalanine from El. These remains are conserved between members of the superfamily 3 but their function is unknown. As can be seen in Figure 7B, the replacement of these amino acids by alanine did not abolish the binding of El to the origin, indicating that they are not essential for this process or for binding to ATP.

The conserved A region of El is necessary for the binding of El to the origin (Figure 8) The El-El interaction domain that was represented in yeast consisted of amino acids 353-416. This region of El encompasses the conserved A region, one of four regions of high frequency similarity between the various papilloma viruses and the large T antigens of the SV40 and polyomavirus viruses (Clertant and Seif, 1984). To determine if this region is essential for El to bind to the origin, six independent amino acid substitutions were created in this domain (F378A, Y380A, N389A, A390G, F393A, Q399A) (Figure 8A) and tested for their effect on the formation of the El-ori complex. Four of the six substitutions affect the remains that are invariant between papilloma and polyomavirus (N389A, A390G, F393A, Q399A) (Figure 8A).

The other two substitutions (F378A and Y380A) affect the hydrophobic residues that are part of a cluster that binds to zinc in a large T antigen (Figure 8A), which is necessary for oligomerization (Loeber et al, 1991, J Virology, 65 (6): 3167-3174). Although this grouping of the zinc finger is not conserved in the papillomaviruses, F378 and Y380 fall in a region of El, which, as in the analogous region in large T, is predicted to fold into an alpha helix (data not indicated). The binding of these proteins The mutants at the origin were tested both at 23 ° C in the absence of ATP / Mg completely, and at 37 ° C in reactions supplemented with ATP / Mg (5 and 3 mM, respectively). Under both sets of conditions, the results were very similar. Three of the substitutions, Y380A, N389A and F393A, drastically decreased the binding of El to the origin (Figure 8B). Two other substitutions, A390G and Q399A, were also perjury and resulted in only a modest amount of El binding at the origin. Only one substitution, F378A, had little effect of binding El to the origin. These results indicated that the structural integrity of the conserved A region of El is necessary for El to bind to the origin.

The conserved A region of El is required for the formation of the El-E2-ori ternary complex (Figure 9A). To test whether the conserved A region of El is necessary for the E2 dependent binding of El at the origin, a similar assay was used. to the binding assay of the origin to El described above, with the following changes: in the reaction E2 is included, prepared by in vi tro translation, and •• the full length protein (1-649) is used. As can be seen in Figure 9A, three of the substitutions (Y380A, N389A, F393A) drastically decreased complex formation. Two other substitutions (A390G and Q399A) had a less pronounced effect. A substitution, F378A, had only a modest effect on the formation of the El-E2-ori complex. These results indicate that the structural integrity of the conserved A region is necessary in the formation of the El-E2-ori ternary complex.

Effect of substitutions on the conserved A region of El on the temporal replication of HPV DNA (Figure 9B) Proteins The mutants that are carriers of substitutions in the conserved A region, together with E2, were tested for their ability to support the replication of a plasmid that contains the origin in temporarily transfected cells. As can be seen in Figure 9B, three of the El mutants, F378A, A390G and Q399A, were able to support HPV DNA replication, albeit at reduced levels compared to the wild-type El in the case of A390G and Q399A. Three of the El mutants, Y380A, N389A and F393A, were unable to support replication. These results indicated that the conserved A region of El is necessary for the temporal replication of HPV DNA. The ability of El mutants to support the temporal replication of HPV DNA was well co-related to their ability to bind to the origin either in the absence or in the presence of E2 (see above). A potential warning in these experiments is that the stability of various mutant proteins, compared to the wild type El, could not be evaluated due to the low levels of El expression (data not indicated). Therefore, it is possible that the low level of replication observed with some mutant proteins may also be related to an effect on protein accumulation.

Example 10: El oligomerization assay using protein The recombinant The assay is the same as that presented in Example 9 but was performed with 75 ng of HPV11 El * (72-649) labeled with purified His, recombinant, produced in cells of Sf21 insect infected with baculovirus and 200 ng of plasmid DNA as a competitor. CHAPS was also added in the binding mixture at a final concentration of 0.15%.

Example 11: Purification of Recombinant El * (72-649) El * was produced in Sf21 insect cells by infection with recombinant baculovirus expressing an El * (72-649) labeled with histidine (6 histidines). Infected cells were harvested by centrifugation 48 h after infection and then the volume of cell pellet was measured. The cell pellet was frozen on dry ice and stored at -80 ° C. For purification, the cell pellet was thawed and resuspended in a volume (relative to pellet volume) of hypotonic buffer A (20 mM Tris-HCl, pH 8.0, 5 mM β-mercaptoethanol, 5 mM KCl, MgCl 2 1 mM, antipain, leupeptin, pepstatin at 1 μg / ml and Pefabloc at 1 mM). After incubation on ice for 15 minutes, the suspension of cells was subjected to 20 hand strokes of pestle B in a Dounce homogenizer. The cores were then harvested by centrifugation at 2,500 g for 20 minutes at 4 ° C and resuspended at 1.4 volumes (relative to the initial volume of the cell pellet) in buffer B (20 mM Tris-HCl, pH 8.0, β-mercaptoethanol 5 mM; antipain, leupeptin, pepstatin at 2 μg / ml and Pefabloc at 2 mM). Then 1.4 volumes of buffer C (20 mM Tris-HCl, pH 8.0, 5 mM β-mercaptoethanol, 900 mM NaCl) were added and the suspension was mixed and incubated with rocking for 30 minutes at 4 ° C. Then, the extract was centrifuged at 148,000 g for 45 minutes at 4 ° C to pellet the residue. The supernatant was collected and a glycerol was added to a final concentration of 10% before freezing it on dry ice and stored at -80 ° C until chromatography. For chromatography, the cell extract was thawed and loaded onto a 5 ml Hi-Trap column (Pharmacia Biotech) loaded with nickel and equilibrated with 20 mM Tris-HCl, pH 8.0; 5 mM β-mercaptoethanol; 500 mM NaCl; 10% glycerol. After loading the extract, the column was washed with 7-8 volumes of equilibration buffer containing 150 mM imidazole.

The bound El * protein was then eluted with equilibration buffer containing 250 mM imidazole.

Example 12: Oligomerization of the In vitro In order to detect the oligomerization of El in vitro, crosslinking was used with the crosslinking agent bismaleimidohexane (Crosslinking agent, Pierce), which reacts with sulfhydryl. The El * -labeled 35S (72-649) protein prepared by in vitro transcription / translation (TNT-coupled reticulocyte lysis product system, Promega) was incubated in the presence or absence of 50 ng / ml of single-stranded DNA (ss, from English single-stranded) (60 numbers, corresponding to nucleotides 7902 to 34 of origin of HPV-11) during 1 h at two different temperatures, 23 ° and 37 ° C (final binding conditions: 12.5 μl of The translated in a final volume of 37.5 μl containing 20 M Tris, pH 7.6, 100 mM NaCl, 1 mM DTT, 5 M ATP, 3 mM MgCl 2).

Cross-linking was performed by diluting the binding reactions 13 times with phosphate buffer (0.1 M, pH 7.0) containing 100 μM BMH. The crosslinking reactions were stopped after 1 minute by the addition of DTT to a final concentration of 2.5 mM. Then, the El proteins were immunoprecipitated with a polyclonal antibody directed against the 14 amino acids C HPV-11 terminals and analyzed by gel electrophoresis (3% Weber-Osborn polyacrylamide gel [Weber and Osborn, 1969]) and autoradiography. Under these conditions, the single-stranded DNA greatly stimulated the cross-linking of El forming oligomers (Figure 10). In addition to the monomeric, five different bands of proteins were observed that corresponded to oligomers of El. These oligomeric species, when compared with molecular weight patterns, they migrate to the positions expected for dimers, trimers, tetramers, pentamers and hexamers (data not indicated). The same thing happened also when the crosslinking experiments were carried out with truncated proteins (see below) breaking the rule that proteins from the reticulocyte lysis product are part of these complexes. Taken together, these results indicate that HPV-11 has the ability to form hexamers after binding to single-stranded DNA. Finally, it has been observed that oligomerization of El could be stimulated by ss DNA oligonucleotides that were not obtained from the origin of HPV, indicating that the binding of El to DNA ss is, to a large extent, independent of the sequence (data not indicated).

The C-terminus of El is sufficient for oligomerization. A set of truncated proteins (Figure 11) prepared by in vitro translation was then used to represent the minimum domain of El capable of oligomerization. Residues 353-649 of El proved to be sufficient to form oligomers in vi t ro. Interestingly, the oligomerization levels of El (330-649) and El (353-649) were substantial even in the absence of single-stranded DNA and did not increase by the addition of ss DNA. The fact that the C-terminus of El is "constitutively" oligomerized provides a plausible explaon for why this domain, unlike the entire protein, could easily self-associate in the yeast two-hybrid system. The protein The smallest whose oligomerization was dependent on its DNA was constituted by amino acids 191-649. Therefore, the region between residues 191-330 appears to play a critical role in inhibiting oligomerization of the C-terminal domain (330-649) and confering response of the ss DNA.

Effect of amino acid substitutions in the ATP binding domain of El on oligomerization The El region that is sufficient for oligomerization (residues 353-649) encompasses the domain of ATP binding. The role of the ATP binding domain on El oligomerization has been investigated by testing the effect of mutations that change highly conserved residues involved in binding to ATP. These El * mutant proteins (72-649), which were synthesized by in vitro translation, carry amino acid substitutions in one of three residues, called A, B, and C, which characterize the ATP binding domain of the El and other members of the 3 superfamily of proteins that bind to NTP (Figure 12a). Clusters A and B correspond to classical Waiker groupings A and B, which together join ATP as magnesium chelate. The residues in cluster A, also known as the phosphate-binding loop (P loop), interact with the ATP triphosphate tail. Cluster B is involved in the coordion of the magnesium ion associated with the substrate nucleotide. The exact function of the conserved C cluster is unknown but it has been suggested that it may also participate in binding to the ATP. Another * The mutant protein was also tested in which a highly conserved residue, F509, which falls between clusters B and C and whose function is unknown, had been mutated. With the exception of the F509A substitution, all other substitutions decreased El oligomerization to a variable degree (Figure 12B).

Substitutions in cluster A had the greatest effect, indicating that the structural integrity of the P loop is essential for oligomerization. Substitutions in group B or C decreased the formation of oligomers but did not completely abolish it. Taken together, these results indicate that the structural integrity of the ATP-binding domain of El is essential for oligomerization. The ATP binding domain might be necessary to bind ATP, which could regulate the oligomerization at the end of the spectrum. Altervely, or additionally, the integrity of the ATP binding domain could be necessary for proper folding / stability of the entire C-terminal domain. However, the fact that all substitutions affecting oligomerization, with the exception of K484E and K484Q, do not affect the binding of E2 (Titolo et al., 1999), suggest that these substitutions do not drastically alter the global structure of the C-terminal domain.

Effect of amino acid substitutions on the conserved A region of oligomerization of El The effect of amino acids on the conserved A region of El was then tested for its effect on oligomerization of the protein using the crosslinking test. Six El * mutant proteins were synthesized by in vitro translation and assayed for their oligomerization in the presence of ss DNA as described above. Three of the six mutant proteins tested, Y380A, N389A and F393A, were seriously defective in this assay (Figure 13). As expected, these are the same three mutant proteins that were also seriously defective in the binding / oligomerization at the origin of HPV (Figure 9). These results reinforce the notion that the conserved A region of El is necessary for oligomerization.

CONCLUSION Without intending to be bound by any theory, the applicant company believes that the results provided here indicate that the region defined by SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4, is the region that is necessary to Oligomerization of El. Therefore, this region can serve as a target to inhibit the replication of PV DNA for the treatment of PV infection.

Cn O Ul TABLE 1 UJ (a) The upper sequence in this pair of oligonucleotides encodes the direct primer. (b) The lower sequence in this pair of oligonucleotides encodes the reverse primer. (cl These numbers represent the amino acid residues included in the construction.

N) L? O O TABLE 2 L? ro M L? L? or TABLE 3 IpASI (GAL4-AD)) i-o IV) Lp o o L? * JD It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. - 1 - LIST OF SEQUENCES < 110 > Boehringer Ingelheim (Canada) Ltd. < 120 > Helicase regions The Papilloma Virus involved in the oligomerization of El < 130 > PCT application for EPO < 140 > < 141 > < 150 > US 60 / 093,626 < 151 > 07-21-1998 < 160 > 79 < 170 > Patentln Ver. 2.1 < 210 > 1 < 211 > 649 < 212 > PRT < 213 > The HPV-11 < 400 > 1 Met Wing Asp Asp Ser Gly Thr Glu Asn Glu Gly Ser Gly Cys Thr Gly 1 5 10 15 Trp Phe Met Val Glu Ala He Val Glu His Thr Thr Gly Thr Gln He 20 25 30 Ser Glu Asp Glu Glu Glu Glu Val Glu Asp Ser Gly Tyr Asp Met Val 35 40 45 Asp Phe He Asp Asp Arg His He Thr sln Asn Ser Val Glu Ala Gln 50 55 60 Wing Leu Phe Asn Arg Gln Glu Wing Asp Wing His Tyr Wing Thr Val Gln 65 70 75 80 Asp Leu Lys Arg Lys Tyr Leu Gly Ser Pro Tyr Val Ser Pro He Ser 85 90 95 Asn Val Ala Asn Ala Val Glu Ser Glu Be Ser Pro Arg Leu Asp Ala 100 105 110 He Lys Leu Thr Thr Gln Pro Lys Lys Val Lys Arg Arg Leu Phe Glu 115 120 125 Thr Arg Glu Leu Thr Asp Ser Gly Tyr Gly Tyr Ser Glu Val Glu Ala 130 135 140 Ala Thr Gln Val Glu Lys His Gly Asp Pro Glu Asn Gly Gly Asp Gly 145 150 155 160 Glu Glu Arg Asp Thr Gly Arg Asp He Glu Gly Glu Gly Val Glu His 165 170 175 Arg Glu Wing Glu Wing Val Asp Asp Ser Thr Arg Glu His Wing Asp Thr 180 185 190 Ser sly He Leu Glu Leu Leu Lys Cys Lys Asp He Arg Ser Thr Leu 195 200 205 His Gly Lys Phe Lys Asp Cys Phe Gly Leu Ser Phe Val Asp Leu He 210 215 220 Arg Pro Phe Lys Ser Asp Arg Thr Thr Cys Wing Asp Trp Val Val Wing 225 230 235 240 Gly Phe Gly He His His Ser He Wing Asp Wing Phe Gln Lys Leu He 245 250 255 Glu Pro Leu Ser Leu Tyr Wing His He Gln Trp Leu Thr Asn Wing Trp 260 265 270 Gly Met Val Leu Leu Val Leu He Arg Phe Lys Val Asn Lys Ser Arg 275 280 285 Cys Thr Val Wing Arg Thr Leu Gly Thr Leu Leu Asn He Pro Glu Asn 290 295 300 .2- His Met Leu He Glu Pro Pro Lys He Gln Ser sly Val Ala Ala Leu 305 -. 305 - 310 315 320 Tyr Trp Phe Arg Thr Gly He Ser Asn Wing Ser Thr Val He Gly slu 325 330 335 Wing Pro Glu Trp He Thr Arg Gln Thr Val He Glu His Ser Leu Ala 340 345 350 Asp Ser Gln Phe Lys Leu Thr slu Met Val Oln Trp Wing Tyr Asp Asn 355 360 365 Asp He Cys Glu Glu Ser Glu He Wing Phe slu Tyr Wing sln Arg sly 370 375 380 Asp Phe Asp Ser Asn Wing Arg Wing Phe Leu Asn Being Asn Met sln Wing 385 390 395 400 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 405 410 415 slu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg Gly Thr 420 425 430 Lys Val Asp Ser Val Gly Asn Trp Lys Pro He Val Gln Phe Leu Arg 435 440 445 His Gln Asn He Olu Phe He Pro Phe Leu Ser Lys Leu Lys Leu Trp 450 455 460 Leu His sly Thr Pro Lys Lys Asn Cys He Wing He Val sly Pro Pro 465 470 475 480 Asp Thr sly Lys Ser Cys Phe Cys Met Ser Leu He Lys Phe Leu Gly 485 490 495 sly Thr Val He Ser Tyr Val Asn Ser Cys Ser His Phe Trp Leu sln 500 505 510 Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp Ala Thr sln Pro 515 520 525 Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu Leu Asp Gly Asn 530 535 540 Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr Leu He Lys Cys 545 550 555 560 Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser Lys Glu Glu Lys 565 570 575 Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr Phe Pro Asn Pro 580 585 590 Phe Pro Phe Asp Arg Asn Gly Asn Wing Val Tyr Glu Leu Ser Asp Wing 595 600 605 Asn Trp Lys Cys Phe Phe Glu Arg Leu Ser Ser Leu Asp He slu 610 615 620 Asp Ser slu Asp slu Olu Asp Oly Ser Asn Ser Oln Wing Phe Arg Cys 625 630 635 640 Val Pro Gly Ser Val Val Arg Thr Leu 645 < 210 > 2 < 211 > 86 < 212 > PRT < 213 > The HPV-11 < 400 > 2 Asp Ser Gln Phe Lys Leu Thr slu Met Val sln Trp Wing Tyr Asp Asn 1 5 10 15 Asp He Cys Clu Glu Ser Glu He Wing Phe Glu Tyr Wing Gln Arg Gly 20 25 30 Asp Phe Asp Ser Asn Wing Arg Wing Phe Leu Asn Being Asn Met Gln Wing 35 40 45 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 50 55 60 -3- Olu Met lys Lys Met Ser He Lys sln Trp He Lys Tyr Arg Gly Thr 65 ~ 70 -? 5 SO Lys Val Asp Ser Val sly 85 < 210 > 3 < 211 > 79 < 212 > PRT < 213 > The HPV-II < 400 > 3 Asp Ser sln Phe Lys Leu Thr Olu Met Val Gln Trp Wing Tyr Asp Asn 1 5 10 15 Asp He Cys Glu Glu Ser slu He Wing Phe Glu Tyr Wing srn Arg sly 20 25 30 Asp Phe Asp Ser Asn Wing Arg Wing Phe Leu Asn Being Asn Met Gln Wing 35 40 45 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 50 55 60 Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg sly 65 70 75 < 210 > 4 < 211 > 64 < 212 > PRT < 213 > The HPV-11 < 400 > 4 Asp Ser Gln Phe Lys Leu Thr Glu Met Val Gln Trp Wing Tyr Asp Asn 1 5 10 15 Asp He Cys slu Glu Ser Glu He Wing Phe Glu Tyr Wing Gln Arg sly 20 25 30 Asp Phe Asp Ser Asn Wing Arg Wing Phe Leu Asn Being Asn Met sln Wing 40 45 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 50 55-60 < 210 > 5 < 211 > 317 < 212 > PRT < 213 > The HPV-11 < 400 > 5 Val He sly slu Pro Wing Glu Trp He Thr Arg Gln Thr Val He Glu 1 5 10 15 His Ser Leu Wing Asp Ser sln Phe Lys Leu Thr Glu Met Val Gln Trp 20 25 30 Wing Tyr Asp Asn Asp He Cys slu slu Ser Olu He Ala Phe Glu Tyr 40 45 Ala Gln Arg sly Asp Phe Asp Ser Asn Ala Arg Ala Phe Leu Asn Ser 50 55 60 Asn Met Gln Ala Lys Tyr Val Lys Asp Cys Ala He Met Cys Arg His 65 70 75 80 Tyr Lys His Wing Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys 85 90 95 Tyr Arg sly Thr Lys Val Asp Ser Val Gly Asn Trp Lys Pro He Val 100 105 lio Gln Phe Leu Arg His Gln Asn He slu Phe He Pro Phe Leu Ser Lys 115 120 125 -4- Leu Lys Leu Trp Leu His Gly Thr Pro Lys Lys Asn Cys He Wing He 130 -. 130 - 135 140 Val sly Pro Pro Asp Thr Gly Lys Ser Cys Phe Cys Met Ser Leu He 145 150 155 160 Lys Phe Leu Gly Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His 165 170 175 Phe Trp Leu Gln Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp 180 185 190 Wing Thr Gln Pro Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu 195 200 205 Leu Asp Gly Asn Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr 210 215 220 Leu He Lys Cys Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser 225 230 235 240 Lys Glu Glu Lys Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr 245 250 255 Phe Pro Asn Pro Phe Pro Phe Asp Arg Asn Gly Asn Ala Val Tyr Glu 260 265 270 Leu Ser Asp Wing Asn Trp Lys Cys Phe Phe Glu Arg Leu Ser Ser Ser 275 280 285 Leu Asp He Glu Asp Ser Glu Asp Olu Glu Asp Gly Ser Asn Ser Gln 290 295 300 Wing Phe Arg Cys Val Pro Oly Ser Val Val Arg Thr Leu '305 310 315 < 210 > 6 < 211 > 317 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: The mutated HPV-11 < 400 > 6 Val He Gly Olu Ala Pro slu Trp He Thr Arg Oln Thr Val He Glu 1 5 10 15 His Ser Leu Ala Asp Ser Gln Phe Lys Leu Thr Glu Met Val Gln Trp 25 30 Wing Tyr Asp Asn Asp He Cys Olu slu Ser Glu He Wing Phe Glu Tyr 35 40 45 Wing Gln Arg Gly Asp Phe Asp Ser Asn Ala Arg Ala Phe Leu Asn Ser 50 55 60 Asn Met Gln Wing Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His 65 70 75 80 Tyr Lys His Wing Glu Met Lys Lys Met Ser He Lys sln Trp He Lys 85 90 95 Tyr Arg Gly Thr Lys Val Asp Ser Val Gly Asn Trp Lys Pro He Val 100 105 lio Gln Phe Leu Arg His Gln Asn He Glu Phe He Pro Phe Leu Ser Lys 115 120 125 Leu Lys Leu Trp Leu His Gly Thr Pro Lys Lys Asn Cys He Ala He 130 135 140 Val Gly Ser Pro Asp Thr sly Lys Ser Cys Phe Cys Met Ser Leu He 145 150 155 160 Lys Phe Leu Gly Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His 165 170 175 Phe Trp Leu Gln Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp 180 185 190 - 5 - Wing Thr Oln Pro Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu 195 200 205 Leu Asp Gly Asn Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr 210 215 220 Leu He Lys Cys Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser 225 230 235 240 Lys Olu Glu Lys Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr 245 250 255 Phe Pro Asn Pro Phe Pro Phe Asp Arg Asn Gly Asn Wing Val Tyr Glu 260 265 270 Leu Ser Asp Wing Asn Trp Lys Cys Phe Phe Glu Arg Leu Being Ser 275 280 285 Leu Asp He Glu Asp Ser slu Asp Olu Glu Asp Gly Ser Asn Ser Gln 290 295 300 Wing Phe Arg Cys Val Pro Gly Val Val Arg Thr Leu 305 310 315 < 210 > 7 < 211 > 317 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: The mutated HPV-11 < 400 > 7 Val He Gly Glu Wing Pro Glu Trp He Thr Arg Oln Thr Val He Glu 1 5 10 15 His Ser Leu Wing Asp Ser Gln Phe Lys Leu Thr slu Met Val Oln Trp 20 25 30 Wing Tyr Asp Asn Asp He Cys Glu Glu Ser Glu He Wing Phe Glu Tyr 40 45 Wing Gln Arg Gly Asp Phe Asp Ser Asn Wing Arg Wing Phe Leu Asn Being 50 55 60 Asn Met sln Ala Lys Tyr Val Lys Asp Cys Ala He Met Cys Arg His 65 70 75 80 Tyr Lys His Ala slu Met Lys Lys Met Ser He Lys sln Trp He Lys 85 90 95 Tyr Arg sly Thr Lys Val Asp Ser Val sly Asn Trp Lys Pro He Val 100 105 110 sln Phe Leu Arg His Gln Asn He slu Phe He Pro Phe Leu Ser Lys 115 120 125 Leu Lys Leu Trp Leu His Gly Thr Pro Lys Lys Asn Cys He Wing He 130 135 140 Val Gly Pro Pro Asp Thr sly Glu Ser Cys Phe Cys Met Ser Leu He 145 150 155 160 Lys Phe Leu Gly Oly Thr Val He Ser Tyr Val Asn Ser Cys Ser His 165 170 175 Phe Trp Leu Gln Pro Leu Thr Asp Wing Lys Val Wing Leu Leu Asp Asp 180 185 190 Wing Thr Gln Pro Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu 195 200 205 Leu Asp Gly Asn Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr 210 215 220 Leu He Lys Cys Pro Pro Leu Leu Val Thr Ser As As He Asp He Ser 225 230 235 240 Lys slu slu Lys Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr 245 250 255 Phe Pro Asn Pro Phe Pro Phe Asp Arg Asn Gly Asn Ala Val Tyr Glu _ 260 265 270 Leu Ser Asp Wing Asn Trp Lys Cys Phe Phe Glu Arg Leu Ser Ser Ser 275 280 285 Leu Asp He Glu Asp Ser Glu Asp Glu Glu Asp sly Ser Asn Ser Gln 290 295 300 Wing Phe Arg Cys Val Pro Gly Ser Val Val Arg Thr Leu 305 310 315 < 210 > 8 < 211 > 317 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: The mutated HPV-11 < 400 > 8 Val He Oly Glu Wing Pro Glu Trp He Thr Arg Gln Thr Val He Glu 1 5 10 15 His Ser Leu Wing Asp Ser Gln Phe Lys Leu Thr Glu Met Val Gln Trp 20 25 30 Wing Tyr Asp Asn Asp He Cys slu Olu Ser Glu He Ala Phe Glu Tyr 40 45 Ala Gln Arg Gly Asp Phe Asp Ser Asn Ala Arg Ala Phe Leu Asn Ser 50 55 60 Asn Met Gln Ala Lys Tyr Val Lys Asp Cys Ala He Met Cys Arg His 65 70 75 80 Tyr Lys His Wing Clu Met Lys Lys Met Ser He Lys sln Trp He Lys 85 90 95 Tyr Arg sly Thr Lys Val Asp Ser Val Oly Asn Trp Lys Pro He Val 100 105 110 Gln Phe Leu Arg His Gln Asn He Glu Phe He Pro Phe Leu Ser Lys 115 120 125 Leu Lys Leu Trp Leu His Gly Thr Pro Lys Lys Asn Cys He Wing 130 135 140 Val Gly Pro Pro Asp Thr Gly Gln Ser Cys Phe Cys Met Ser Leu He 145 150 155 160 Lys Phe Leu Gly Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His 165 170 175 Phe Trp Leu Gln Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp 180 185 190 Wing Thr Gln Pro Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu 195 200 205 Leu Asp sly Asn Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr 210 215 220 Leu He Lys Cys Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser 225 230 235 240 Lys Glu Glu Lys Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr 245 250 255 Phe Pro Asn Pro Phe Pro Phe Asp Arg Asn Gly Asn Ala Val Tyr Glu 260 265 270 Leu Ser Asp Wing Asn Trp Lys Cys Phe Phe Glu Arg Leu Being Ser 275 280 285 Leu Asp He Glu Asp Ser Glu Asp Glu Olu Asp Gly Ser Asn Ser Gln 290 295 300 Wing Phe Arg Cys Val Pro Gly Ser Val Val Arg Thr Leu 305 310 315 .7 - < 210 > 9 < 211 > 649 - < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence:? L of HPV-11 mutated < 400 > 9 Met Wing Asp Asp Ser Gly Thr Glu Asn Glu Gly Ser Gly Cys Thr Gly 1 5 10 15 Trp Phe Met Val Glu Wing He Val Glu His Thr Thr Gly Thr Gln He 25 30 Ser Olu Asp Olu Glu slu Glu Val Glu Asp Ser Gly Tyr Asp Met Val 35 40 45 Asp Phe He Asp Asp Arg His He Thr Gln Asn Ser Val slu Ala Gln 50 55 60 Ala Leu Phe Asn Arg Gln Olu Ala Asp Ala His Tyr Ala Thr Val Gln 65 70 75 80 Asp Leu Lys Arg Lys Tyr Leu Gly Ser Pro Tyr Val Ser Pro He Ser 35 90 95 Asn Val Ala Asn Ala Val Glu Ser Glu He Ser Pro Arg Leu Asp Ala 100 105 110 He Lys Leu Thr Thr Gln Pro Lys Lys Val Lys Arg Arg Leu Phe Glu 115 120 125 Thr Arg Glu Leu Thr Asp Ser Gly Tyr Gly Tyr Ser Glu Val Glu Wing 130 135 140 Wing Thr Gln Val Glu Lys His Gly Asp Pro Olu Asn Gly Gly Asp Gly 145 150 155 160 Glu Glu Arg Asp Thr Gly Arg Asp He Glu Oly slu sly Val Glu His 165 170 175 Arg Glu Wing Glu Wing Val Asp Asp Ser Thr Arg Olu His Wing Asp Thr 180 185 190 Ser Gly He Leu Glu Leu Leu Lys Cys Lys Asp He Arg Ser Thr Leu 195 200 205 His Gly Lys Phe Lys Asp Cys Phe Gly Leu Ser Phe Val Asp Leu He 210 215 220 Arg Pro Phe Lys Ser Asp Arg Thr Thr Cys Ala Asp Trp Val Val Ala 225 230 235 240 Gly Phe Gly He His His Ser He Wing Asp Ala Phe sln Lys Leu He 245 250 255 Olu Pro Leu Ser Leu Tyr Ala His He Gln Trp Leu Thr Asn Ala Trp 260 265 270 Gly Met Val Leu Leu Val Leu He Arg Phe Lys Val Asn Lys Ser Arg 275 280 285 Cys Thr Val Wing Arg Thr Leu Gly Thr Leu Leu Asn He Pro Glu Asn 290 295 300 His Met Leu He Glu Pro Pro Lys He Gln Ser Gly Val Ala Ala Leu 305 310 315 320 Tyr Trp Phe Arg Thr Gly He Ser Asn Ala Ser Thr Val He sly Olu 325 330 335 Wing Pro Glu Trp He Thr Arg Gln Thr Val He Glu His Ser Leu Ala 340 345 350 Asp Ser Gln Phe Lys Leu Thr Glu Met Val Gln Trp Wing Tyr Asp Asn 355 360 365 Asp He Cys Olu slu Ser slu He Wing Phe Glu Wing Wing Gln Arg Gly 370 375 380 Asp Phe Asp Ser Asn Wing Arg Wing Phe Leu Asn Ser Asn Met Gln Wing 385 390 395 400 - 8 - Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 405 410 415 Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg Oly Thr 420 425 430 Lys Val Asp Ser Val Gly Asn Trp Lys Pro He Val Gln Phe Leu Arg 435 440 445 His Gln Asn He Glu Phe He Pro Phe Leu Ser Lys Leu Lys Leu Trp 450 455 460 Leu His Gly Thr Pro Lys Lys Asn Cys He Wing He Val Gly Pro Pro 465 470 475 480 Asp Thr sly Lys Ser Cys Phe Cys Met Ser Leu He Lys Phe Leu sly 485 490 495 sly Thr Val He Ser Tyr Val Asn Ser Cys Ser His Phe Trp Leu Gln 500 505 510 Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp Ala Thr sln Pro 515 520 525 Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu Leu Asp sly Asn 530 535 540 Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr Leu He Lys Cys 545 550 555 560 Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser Lys Olu Glu Lys 565 570 575 Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr Phe Pro Asn Pro 580 585 590 Phe Pro Phe Asp Arg Asn Gly Asn Wing Val Tyr Glu Leu Ser Asp Wing 595 600 605 Asn Trp Lys Cys Phe Phe slu Arg Leu Being Ser Leu Asp He Glu 610 615 620 Asp Ser Glu Asp Glu Glu Asp sly Ser Asn Ser sln Wing Phe Arg Cys 625 630 635 640 Val Pro sly Ser Val Val Arg Thr Leu 645 < 210 > 10 < 211 > 649 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: The mutated HPV-11 < 400 > 10 Met Wing Asp Asp Ser sly Thr slu Asn slu Oly Ser sly Cys Thr Oly 1 5 10 15 Trp Phe Met Val Olu Wing He Val Glu His Thr Thr Gly Thr Gln He 20 25 30 Ser slu Asp slu slu slu Glu Val Glu Asp Ser Gly Tyr Asp Met Val 40 45 Asp Phe He Asp Asp Arg His He Thr Gln Asn Ser Val Glu Wing Gln 50 55 60 Wing Leu Phe Asn Arg sln Glu Wing Asp Wing His Tyr Wing Thr Val Gln 65 70 75 80 Asp Leu Lys Arg Lys Tyr Leu sly Ser Pro Tyr Val Ser Pro He Ser 85 90 95 Asn Val Wing Asn Wing Val Olu Ser Olu He Ser Pro Arg Leu Asp Wing 100 105 lio He Lys Leu Thr Thr Gln Pro Lys Lys Val Lys Arg Arg Leu Phe Glu 115 120 125 -9- Thr Arg slu Leu Thr Asp Ser Gly Tyr sly Tyr Ser Glu Val Glu Ala 130 ~ 135 140 Ala Thr Gln Val Olu Lys His Gly Asp Pro Glu Asn Gly Gly Asp Gly 145 150 155 160 Glu Glu Arg Asp Thr Gly Arg Asp He Glu Gly Glu Gly Val Glu His 165 170 175 Arg Glu Ala Olu Ala Val Asp Asp Ser Thr Arg Glu His Wing Asp Thr 180 185 190 Ser Gly He Leu Glu Leu Leu Lys Cys Lys Asp He Arg Ser Thr Leu 195 200 205 His sly Lys Phe Lys Asp Cys Phe Gly Leu Ser Phe Val Asp Leu He 210 215 220 Arg Pro Phe Lys Ser Asp Arg Thr Thr Cys Wing Asp Trp Val Val Wing 225 230 235 240 sly Phe Gly He His His Ser He Wing Asp Wing Phe sln Lys Leu He 245 250 255 Olu Pro Leu Ser Leu Tyr Ala His He Oln Trp Leu Thr Asn Ala Trp 260 265 270 Gly Met Val Leu Leu Val Leu He Arg Phe Lys Val Asn Lys Ser Arg 275 280 285 Cys Thr Val Wing Arg Thr Leu Gly Thr Leu Leu Asn He Pro slu Asn 290 295 300 His Met Leu He Glu Pro Pro Lys He Gln Ser Gly Val Ala Ala Leu 305 310 315 320 Tyr Trp Phe Arg Thr Gly He Ser Asn Ala Ser Thr Val He Gly Glu 325 330 335 Wing Pro Glu Trp He Thr Arg Gln Thr Val He Glu His Ser Leu Ala 340 345 350 Asp Ser Gln Phe Lys Leu Thr slu Met Val Gln Trp Wing Tyr Asp Asn 355 360 365 Asp He Cys Glu Glu Ser Glu He Wing Phe Glu Tyr Wing Gln Arg Gly 370 375 380 Asp Phe Asp Ser Asn Wing Arg Wing Wing Leu Asn Being Asn Met sln Wing 385 390 395 400 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 405 410 415 Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg Oly Thr 420 425 430 Lys Val Asp Ser Val Gly Asn Trp Lys Pro He Val Gln Phe Leu Arg 435 440 445 His Gln Asn He Olu Phe He Pro Phe Leu Ser Lys Leu Lys Leu Trp 450 455 460 Leu His Oly Thr Pro Lys Lys Asn Cys He Wing He Val Gly Pro Pro 465 470 475 480 Asp Thr Gly Lys Ser Cys Phe Cys Met Ser Leu He Lys Phe Leu Gly 485 490 495 Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His Phe Trp Leu Gln 500 505 510 Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp Ala Thr Gln Pro 515 520 525 Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu Leu Asp Gly Asn 530 535 540 Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr Leu He Lys Cys 545 550 555 560 Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser Lys Glu Glu Lys 565 570 575 Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr Phe Pro Asn Pro 580 585 590 -10- Phe Pro Phe Asp Arg Asn Gly Asn Wing Val Tyr Glu Leu Ser Asp Wing 595-600 605 Asn Trp Lys Cys Phe Phe Glu Arg Leu Ser Ser Leu Asp He Glu 610 615 620 Asp Ser Glu Asp Glu Glu Asp Gly Ser Asn Ser Gln Ala Phe Arg Cys 625 630 635 640 Val Pro Gly Ser Val Val Arg Thr Leu 645 < 210 > 11 < 211 > 649 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: The mutated HPV-11 < 400 > 11 Met Wing Asp Asp Ser Gly Thr Glu Asn Glu Gly Ser sly Cys Thr Oly 1 5 10 15 Trp Phe Met Val Glu Wing He Val Glu His Thr Thr Gly Thr Gln He 25 30 Ser Olu Asp Glu Glu Glu Glu Val Glu Asp Ser Gly Tyr Asp Met Val 35 40-45 Asp Phe He Asp Asp Arg His He Thr Gln Asn Ser Val Glu Ala Gln 50 55 60 Ala Leu Phe Asn Arg sln slu Ala Asp Ala His Tyr Ala Thr Val sln 65 70 75 80 Asp Leu Lys Arg Lys Tyr Leu Gly Ser Pro Tyr Val Ser Pro He Ser 85 90 95 Asn Val Ala Asn Ala Val Glu Ser Glu He Ser Pro Arg Leu Asp Ala 100 105 110 He Lys Leu Thr Thr Gln Pro Lys Lys Val Lys Arg Arg Leu Phe Olu 115 120 125 Thr Arg slu Leu Thr Asp Ser Gly Tyr Gly Tyr Ser Glu Val Glu Wing 130 135 149 Wing Thr Gln Val Olu Lys His Oly Asp Pro Glu Asn Gly Gly Asp Gly 145 150 155 160 Glu Glu Arg Asp Thr sly Arg Asp He slu sly Glu sly Val slu His 165 170 175 Arg Olu Wing Glu Wing Val Asp Asp Ser Thr Arg Glu His Wing Asp Thr 180 185 190 Ser sly He Leu Glu Leu Leu Lys Cys Lys Asp He Arg Ser Thr Leu 195 200 205 His Gly Lys Phe Lys Asp Cys Phe sly Leu Ser Phe Val Asp Leu He 210 215 220 Arg Pro Phe Lys Ser Asp Arg Thr Thr Cys Ala Asp Trp Val Val Ala 225 230 235 240 Gly Phe sly He His His Ser Be Wing Asp Ala Phe Gln Lys Leu He 245 250 255 Glu Pro Leu Ser Leu Tyr Ala His He Gln Trp Leu Thr Asn Ala Trp 260 265 270 Gly Met Val Leu Leu Val Leu He Arg Phe Lys Val Asn Lys Ser Arg 275 280 285 Cys Thr Val Wing Arg Thr Leu Gly Thr Leu Leu Asn He Pro Glu Asn 290 295 300 His Met Leu He Glu Pro Pro Lys He Gln Ser Gly Val Ala Ala Leu 305 310 315 320 - 11 - Tyr Trp Phe Arg Thr Gly He Ser Asn Ala Ser Thr Val He sly Olu 325 33C 335 Wing Pro Glu Trp He Thr Arg Gln Thr Vai He Glu His Ser Leu Wing 340 345 350 Asp Ser Gln Phe Lys Leu Thr slu Met Val Gln Trp Wing Tyr Asp Asn 355 360 365 Asp He Cys slu slu Ser slu He Wing Phe slu Tyr Ala Gln Arg Gly 370 375 380 Asp Phe Asp Ser Wing Wing Arg Wing Phe Leu Asn Being Asn Met Gln Wing 385 390 395 400 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 405 410 415 Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg sly Thr 420 425 430 Lys Val Asp Ser Val sly Asn Trp Lys Pro He Val sln Phe Leu Arg 435 440 445 His sln Asn He Olu Phe He Pro Phe Leu Ser Lys Leu Lys Leu Trp 450 455 460 Leu His Gly Thr Pro Lys Lys Asn Cys He Wing He Val Gly Pro Pro 465 470 475 480 Asp Thr Gly Lys Ser Cys Phe Cys Met Ser Leu He Lys Phe Leu Gly 485 490 495 Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His Phe Trp Leu Gln 500 505 510 Pro Leu Thr Asp Wing Lys Val Wing Leu Leu Asp Asp Wing Thr Oln Pro 515 520 525 Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu Leu Asp Gly Asn 530 535 540 Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr Leu He Lys Cys 545 550 555 560 Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser Lys Glu Glu Lys 565 570 575 Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr Phe Pro Asn Pro 580 585 590 Phe Pro Phe Asp Arg Asn Gly Asn Wing Val Tyr Glu Leu Ser Asp Wing 595 600 605 Asn Trp Lys Cys Phe Phe Glu Arg Leu Being Ser Leu Asp He Glu 610 615 620 Asp Ser Glu Asp Glu slu Asp Gly Ser Asn Ser Gln Wing Phe Arg Cys 625 630 635 640 Val Pro Gly Ser Val Val Arg Thr Leu 645 < 210 > 12 < 211 > 649 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: The mutated HPV-11 < 400 > 12 Met Wing Asp Asp Ser Gly Thr Glu Asn Glu Gly Ser Gly Cys Thr Gly 1 5 10 15 Trp Phe Met Val Glu Wing He Val Glu His Thr Thr Gly Thr Gln He 20 25 30 Ser Glu Asp Glu Glu Glu Glu Val Glu Asp Ser Gly Tyr Asp Met Val 35 Q 45 -12- Asp Phe He Asp Asp Arg His He Thr Gln Asn Ser Val Glu Ala Gln 50"55 60 Wing Leu Phe Asn Arg Gln Glu Wing Asp Wing His Tyr Wing Thr Val Gln 65 70 75 80 Asp Leu Lys Arg Lys Tyr Leu Gly Ser Pro Tyr Val Ser Pro He Ser 85 90 95 Asn Val Ala Asn Ala Val Glu Ser Glu He Ser Pro Arg Leu Asp Ala 100 105 110 He Lys Leu Thr Thr Gln Pro Lys Lys Val Lys Arg Arg Leu Phe Glu 115 120 125 Thr Arg slu Leu Thr Asp Ser Gly Tyr Gly Tyr Ser Glu Val Glu Ala 130 135 140 Ala Thr Gln Val Olu Lys His Gly Asp Pro Glu Asn Gly Gly Asp Gly 145 150 155 160 Glu Glu Arg Asp Thr Gly Arg Asp He Glu Gly Glu Gly Val Glu His 165 170 175 Arg Glu Wing Glu Wing Val Asp Asp Ser Thr Arg Glu His Wing Asp Thr 180 185 190 Ser sly He Leu slu Leu Leu Lys Cys Lys Asp He Arg Ser Thr Leu 195 200 205 His Cly Lys Phe Lys Asp Cys Phe sly Leu Ser Phe Val Asp Leu He 210 215 220 Arg Pro Phe Lys Ser Asp Arg Thr Thr Cys Wing Asp Trp Val Val Wing 225 230 235 240 Gly Phe Gly He His His Ser He Wing Asp Wing Phe Gln Lys Leu He 245 250 255 Glu Pro Leu Ser Leu Tyr Ala His He Gln Trp Leu Thr Asn Ala Trp 260 265 270 Gly Met Val Leu Leu Val Leu He Arg Phe Lys Val Asn Lys Ser Arg 275 280 285 Cys Thr Val Wing Arg Thr Leu Gly Thr Leu Leu Asn He Pro Glu Asn 290 295 300 His Met Leu He Glu Pro Pro Lys He Gln Ser sly Val Ala Ala Leu 305 310 315 320 Tyr Trp Phe Arg Thr sly He Ser Asn Ala Ser Thr Val He Gly Glu 325 330 335 Wing Pro Glu Trp He Thr Arg sln Thr Val He slu His Ser Leu Ala 340 345 350 Asp Ser sln Phe Lys Leu Thr Glu Met Val Gln Trp Wing Tyr Asp Asn 355 360 365 Asp He Cys Glu Glu Ser Glu He Wing Phe Glu Tyr Wing Gln Arg Gly 370 375 380 Asp Phe Asp Ser Asn Gly Arg Wing Phe Leu Asn Ser Asn Met Gln Wing 385 390 395 400 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 405 410 415 Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg sly Thr 420 425 430 Lys Val Asp Ser Val sly Asn Trp Lys Pro He Val Oln Phe Leu Arg 435 440 445 His sln Asn He Olu Phe He Pro Phe Leu Ser Lys Leu Lys Leu Trp 450 455 460 Leu His sly Thr Pro Lys Lys Asn Cys He Wing He Val Gly Pro Pro 465 470 475 480 Asp Thr Gly Lys Ser Cys Phe Cys Met Ser Leu He Lys Phe Leu Gly 485 490 495 Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His Phe Trp Leu Gln 500 505 510 -13- Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp Ala Thr Gln Pro 515 520 525 Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu Leu Asp Gly Asn 530 535 540 Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr Leu He Lys Cys 545 550 555 560 Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser Lys Glu Glu Lys 565 570 575 Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr Phe Pro Asn Pro 580 585 590 Phe Pro Phe Asp Arg Asn Gly Asn Wing Val Tyr Glu Leu Ser Asp Wing 595 600 605 Asn Trp Lys Cys Phe Phe Glu Arg Leu Ser Ser Leu Asp He Glu 610 615 620 Asp Ser Glu Asp Glu slu Asp Oly Ser Asn Ser Gln Wing Phe Arg Cys 625 630 635 640 Val Pro Gly Ser Val Val Arg Thr Leu 645 < 210 > 13 < 211 > 649 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: The mutated HPV-11 < 400 > 13 Met Wing Asp Asp Ser Gly Thr Glu Asn Glu Gly Ser Gly Cys Thr Gly 1 5 10 15 Trp Phe Met Val Glu Wing He Val Glu His Thr Thr Gly Thr sln He 25 30 Ser Glu Asp Glu Glu Glu Glu Val Glu Asp Ser Gly Tyr Asp Met Val 35 40 45 Asp Phe He Asp Asp Arg His He Thr Oln Asn Ser Val Glu Ala Gln 50 55 60 Ala Leu Phe Asn Arg Gln Glu Ala Asp Ala His Tyr Ala Thr Val Gln 65 70 75 80 Asp Leu Lys Arg Lys Tyr Leu Gly Ser Pro Tyr Val Ser Pro He Ser 85 90 95 Asn Val Ala Asn Ala Val Glu Ser Olu He Ser Pro Arg Leu Asp Ala 100 105 110 He Lys Leu Thr Thr Oln Pro Lys Lys Val Lys Arg Arg Leu Phe Glu 115 120 125 Thr Arg Glu Leu Thr Asp Ser Gly Tyr Gly Tyr Ser Glu Val Glu Wing 130 135 140 Wing Thr Gln Val Glu Lys His Gly Asp Pro Glu Asn Gly Gly Asp Gly 145 150 155 160 Glu slu Arg Asp Thr sly Arg Asp He slu sly slu Oly Val Glu His 165 170 175 Arg Glu Wing Glu Wing Val Asp Asp Ser Thr Arg Glu His Wing Asp Thr 180 185 190 Ser Gly He Leu Glu Leu Leu Lys Cys Lys Asp He Arg Ser Thr Leu 195 200 205 His sly Lys Phe Lys Asp Cys Phe Gly Leu Ser Phe Val Asp Leu He 210 215 220 Arg Pro Phe Lys Ser Asp Arg Thr Thr Cys Ala Asp Trp Val Val Ala 225 230 235 240 - 14-siy Phe Giy He Kis His Ser He Wing Asp Wing Phe Oln Lys Leu He 245 250 255 Glu Pro Leu Ser Leu Tyr Wing His He Gln Trp Leu Thr Asn Wing Trp 260 265 270 Gly Met Val Leu Leu Val Leu He Arg Phe Lys Val Asn Lys Ser Arg 275 280 285 Cys Thr Val Wing Arg Thr Leu Gly Thr Leu Leu Asn He Pro Glu Asn 290 295 300 His Met Leu He Glu Pro Pro Lys He Gln Ser Gly Val Ala Ala Leu 305 310 315 320 Tyr Trp Phe Arg Thr Gly He Ser Asn Wing Ser Thr Val He Gly Glu 325 330 335 Wing Pro Glu Trp He Thr Arg sln Thr Val He Glu His Ser Leu Wing 340 345 350 Asp Ser Gln Phe Lys Leu Thr Glu Met Val Gln Trp Wing Tyr Asp Asn 355 360 365 Asp He Cys Glu Glu Ser Glu He Wing Phe Glu Tyr Ala Gln Arg Gly 370 375 380 Asp Phe Asp Ser Asn Ala Arg Ala Phe Leu Asn Ser Asn Met Ala Ala 385 390 395 400 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 405 410 415 Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg Gly Thr 420 425 430 Lys Val Asp Ser Val Gly Asn Trp Lys Pro He Val Gln Phe Leu Arg 435 440 445 His Gln Asn He Glu Phe He Pro Phe Leu Ser Lys Leu Lys Leu Trp 450 455 460 Leu His Gly Thr Pro Lys Lys Asn Cys He Wing He Val Gly Pro Pro 465 470 475 480 Asp Thr Gly Lys Ser Cys Phe Cys Met Ser Leu He Lys Phe Leu Gly 485 490 495 Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His Phe Trp Leu Gln 500 505 510 Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp Ala Thr sln Pro 515 520 525 Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu Leu Asp Gly Asn 530 535 540 Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr Leu He Lys Cys 545 550 555 560 Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser Lys Glu Glu Lys 565 570 575 Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr Phe Pro Asn Pro 580 585 590 Phe Pro Phe Asp Arg Asn Gly Asn Wing Val Tyr slu Leu Ser Asp Wing 595 600 605 Asn Trp Lys Cys Phe Phe Olu Arg Leu Be Ser Leu Asp He Glu 610 615 620 Asp Ser Glu Asp Glu Glu Asp Gly Ser Asn Ser Gln Ala Phe Arg Cys 625 630 635 640 Val Pro Gly Ser Val Val Arg Thr Leu 645 < 210 > 14 < 211 > 649 < 212 > PRT < 213 > Artificial sequence < 220 > -15- < 223 > Description of the artificial sequence:? L of HPV-11 mutated < 400 > 14 Met Wing Asp Asp Ser Gly Thr Glu Asn Glu Gly Ser Gly Cys Thr Gly 1 5 10 15 Trp Phe Met Val Glu Ala He Val Glu His Thr Thr sly Thr Gln He 25 30 Ser Glu Asp Glu Glu Glu Glu Val Glu Asp Ser Gly Tyr Asp Met Val 35 40 45 Asp Phe He Asp Asp Arg His He Thr Gln Asn Ser Val Glu Ala Gln 50 55 60 Wing Leu Phe Asn Arg Gln Glu Wing Asp Wing His Tyr Wing Thr Val Gln 65 70 75 80 Asp Leu Lys Arg Lys Tyr Leu Gly Ser Pro Tyr Val Ser Pro He Ser 85 90 95 Asn Val Ala Asn Ala Val Glu Ser Glu He Ser Pro Arg Leu Asp Ala 100 105 110 He Lys Leu Thr Thr Gln Pro Lys Lys Val Lys Arg Arg Leu Phe Glu 115 120 125 Thr Arg Glu Leu Thr Asp Ser Gly Tyr Gly Tyr Ser Glu Val Glu Ala 130 135 140 Wing Thr Gln Val slu Lys His Gly Asp Pro slu Asn Oly Gly Asp Gly 145 150 155 160 Glu Glu Arg Asp Thr Gly Arg Asp He slu Oly slu sly Val Glu His 165 170 175 Arg Glu Wing Glu Wing Val Asp Asp Ser Thr Arg Glu His Wing Asp Thr 180 185 190 Ser Gly He Leu Glu Leu Leu Lys Cys Lys Asp He Arg Ser Thr Leu 195 200 205 His Gly Lys Phe Lys Asp Cys Phe Gly Leu Ser Phe Val Asp Leu He 210 215 220 Arg Pro Phe Lys Ser Asp Arg Thr Thr Cys Wing Asp Trp Val Val Wing 225 230 235 240 Gly Phe Gly He His His Ser He Wing Asp Wing Phe Gln Lys Leu He 245 250 255 Olu Pro Leu Ser Leu Tyr Ala His He Gln Trp Leu Thr Asn Ala Trp 260 265 270 Gly Met Val Leu Leu Val Leu He Arg Phe Lys Val Asn Lys Ser Arg 275 280 285 Cys Thr Val Wing Arg Thr Leu Gly Thr Leu Leu Asn He Pro slu Asn 290 295 300 His Met Leu He slu Pro Pro Lys He Oln Ser Gly Val Ala Ala Leu 305 310 315 320 Tyr Trp Phe Arg Thr Gly He Ser Asn Ala Ser Thr Val He Gly Glu 325 330 335 Ala Pro slu Trp He Thr Arg Gln Thr Val He slu His Ser Leu Ala 340 345 350 Asp Ser Gln Phe Lys Leu Thr Glu Met Val Gln Trp Wing Tyr Asp Asn 355 360 365 Asp He Cys Glu Glu Ser Glu He Wing Wing Glu Tyr Wing Gln Arg Gly 370 375 380 Asp Phe Asp Ser Asn Wing Arg Wing Phe Leu Asn Ser Asn Met Gln Wing 385 390 395 400 Lys Tyr Val Lys Asp Cys Wing He Met Cys Arg His Tyr Lys His Wing 405 410 415 Glu Met Lys Lys Met Ser He Lys Gln Trp He Lys Tyr Arg sly Thr 420 425 430 - 16- Lys Val Asp Ser Val Gly Asn Trp Lys Pro He Val Gln Phe Leu Arg 435 ~ 440 445 His Gln Asn He Glu Phe He Pro Phe Leu Ser Lys Leu Lys Leu Trp 450 455 460 Leu His Gly Thr Pro Lys Lys Asn Cys He Wing He Val Oly Pro Pro 465 470 475 480 Asp Thr Gly Lys Ser Cys Phe Cys Met Ser Leu He Lys Phe Leu Gly 485 490 495 Gly Thr Val He Ser Tyr Val Asn Ser Cys Ser His Phe Trp Leu Gln 500 505 510 Pro Leu Thr Asp Ala Lys Val Ala Leu Leu Asp Asp Ala Thr sln Pro 515 520 525 Cys Trp Thr Tyr Met Asp Thr Tyr Met Arg Asn Leu Leu Asp Gly Asn 530 535 540 Pro Met Ser He Asp Arg Lys His Arg Ala Leu Thr Leu He Lys Cys 545 550 555 560 Pro Pro Leu Leu Val Thr Ser Asn He Asp He Ser Lys Glu Glu Lys 565 570 575 Tyr Lys Tyr Leu His Ser Arg Val Thr Thr Phe Thr Phe Pro Asn Pro 580 585 590 Phe Pro Phe Asp Arg Asn Gly Asn Ala Val Tyr Glu Leu Ser Asp Ala 595 600 605 Asn Trp Lys Cys Phe Phe Glu Arg Leu Ser Ser Leu Asp He Glu 610 615 620 - .. Asp Ser Glu Asp Glu Glu Asp Gly Ser Asn Ser GlrtAla Phe Arg Cys 625 630 635: • 640 Val Pro sly Ser Val Val Arg Thr Leu 645 < 210 > 15 < 211 > 20 < 212 > DNA < 213 > synthetic construction < 400 > 15 caaggatggc ggacgattca 20 < 210 > 16 < 211 > 21 < 212 > DNA < 213 > synthetic construction < 400 > 16 tcttcataaa gttctaacaa c 21 < 210 > 17 < 211 > 21 < 212 > DNA < 213 > synthetic construction < 400 > 17 gaagatggaa gcaatagcca to 21 < 210 > 18 < 211 > 23 < 212 > DNA < 213 > synthetic construction < 400 > 18 atggttacaa taaatgtaat gac 3 -17- < 210 > 19 < 211 > 52 < 212 > DNA < 213 > synthetic construction < 400 > 19 catggactac aaggacgacg atgacaaggc ggacgattca ggtacagaaa at 52 < 210 > 20 < 211 > 40 < 212 > DNA < 213 > synthetic construction < 400 > 20 gggatcctta ttataaagtt ctaacaactg atcctggcac 40 < 210 > 21 < 211 > 37 < 212 > DNA < 213 > synthetic construction < 400 > 21 gtacgatccc atggcggacg attcaggtac agaaaat 37 < 210 > 22 < 211 > 47 < 212 > DNA < 213 > synthetic construction < 400 > 22 gtacgatggg atccttatta taaagttcta acaactgatc ctggcac 47 < 210 > 23 < 211 > 54 < 212 > DNA < 213 > synthetic construction < 400 > 23 cccatggact acaaggacga cgatgacaag gcggacgatt caggtacaga aaat 54 < 210 > 24 < 211 > 40 < 212 > DNA < 213 > synthetic construction < 400 > 24 gggatcctta ttataaagtt ctaacaactg atcctggcac 40 < 210 > 25 < 211 > 29 < 212 > DNA < 213 > synthetic construction < 400 > 25 cccggatcct aatggcggac gattcaggt 29 < 210 > 26 < 211 > 31 < 212 > DNA < 213 > synthetic construction < 400 > 26 ggctggatcc atggcggatg ctcattatgc g 31 < 210 > 27 < 211 > 3. 4 - 18- < 212 > DNA < 213 > synthetic construction < 400 > 27 ggctggatcc atggccatta aacttacaac acag 34 < 210 > 28 < 211 > 32 < 212 > DNA < 213 > synthetic construction < 400 > 28 ggctggatcc atgggctatt ctgaagtgga ag 32 < 210 > 29 < 211 > 31 < 212 > DNA < 213 > synthetic construction < 400 > 29 ggctggatcc atggggaggg acatagaggg t 31 < 210 > 30 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 30 ggctggatcc atggacacat caggaatatt agaa 34 < 210 > 31 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 31 ggctggatcc atggacagtc aatttaaatt aact 34 < 210 > 32 < 211 > 31 < 212 > DNA < 213 > synthetic construction < 400 > 32 ggctggatcc atggacagtg taggtaactg g 31 < 210 > 33 < 211 > 28 < 212 > DNA < 213 > synthetic construction < 400 > 33 cccggatcct cataaagttc taacaact 28 < 210 > 34 < 211 > 54 < 212 > DNA < 213 > synthetic construction < 400 > 34 gggggccatg gactacaagg acgacgacga caaggcggat gctcattatg actg 54 < 210 > 35 < 2Í1 > 35 < 212 > DNA < 213 > synthetic construction - 19- < 400 > 35 cccggatcct ^ catgcatctg atagttcata tactg 35 < 210 > 36 < 211 > 37 < 212 > DNA < 213 > synthetic construction < 400 > 36 cccggatcct cagctaatgt ctatatttga tgtaacc 37 < 210 > 37 < 211 > 42 < 212 > DNA < 213 > synthetic construction < 400 > 37 cccggatcct cataaaaatg gaataaattc tatgttttga tg 42 < 210 > 38 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 38 cccggatcct cactggcgcg ttatccattc cggc 34 < 210 > 39 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 39 cccggatcct caaatgcctg tcctaaacca atac 34 < 210 > 40 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 40 ggctggatcc atggacagtc aatttaaatt aact 34 < 210 > 41 < 211 > 35 < 212 > DNA < 213 > synthetic construction < 400 > 41 ggctggatcc atggcatatg ataatgatat ttgtg 35 < 210 > 42 < 211 > 33 < 212 > DNA < 213 > synthetic construction < 400 > 42 ggctggatcc atggcatttg aatatgcaca gcg 33 < 210 > 43 < 211 > 33 < 212 > DNA < 213 > synthetic construction < 400 > 43 ggctggatcc atgggagact ttgactccaa tgc 33 - - - .20- < 210 > 44 < 211 > 31 - < 212 > DNA < 213 > synthetic construction < 400 > 44 ggctggatcc atggactcca atgcaagggc c 31 < 210 > 45 < 211 > 33 < 212 > DNA < 213 > synthetic construction < 400 > 45 ggctggatcc atggattgtg caattatgtg cag 33 < 210 > 46 < 211 > 33 < 212 > DNA < 213 > synthetic construction < 400 > 46 ggctggatcc atggcagaaa tgaaaaagat gtc 33 < 210 > 47 < 211 > 42 < 212 > DNA < 213 > synthetic construction < 400 > 47 cccggatcct cataaaaatg gaataaattc tatgttttga tg 42 < 210 > 48 < 211 > 35 < 212 > DNA < 213 > synthetic construction < 400 > 48 cccggatcct atcacacaat tggcttccag ttacc 35 < 210 > 49 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 49 cccggatcct atcaacctac actgtcaact ttag 34 < 210 > 50 < 211 > 35 < 212 > DNA < 213 > synthetic construction < 400 > 50 cccggatcct atcaacccct atacttaatc cattg 35 < 210 > 51 < 211 > 36 < 212 > DNA < 213 > synthetic construction < 400 > 51 cccggatcct atcatgcatg tttataatgt ctgcac 36 -21 - < 210 > 52 < 211 > 29 < 212 > DNA < 213 > synthetic construction < 400 > 52 cccggatcca gtgtgatgga tatctgcag 29 < 210 > 53 < 211 > 33 < 212 > DNA < 213 > synthetic construction < 400 > 53 ggatcctcat tagctaatgt ctatatttga tgt 33 < 210 > 54 < 211 > 27 < 212 > DNA < 213 > synthetic construction < 400 > 54 ggatcctcat taatatgtat ccatata 27 < 210 > 55 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 55 ggatcctcat tataaaaatg gaataaattc tatg 34 < 210 > 56 < 211 > 28 < 212 > DNA < 213 > synthetic construction < 400 > 56 gtgagatagc agctgaatat gcacagcg 28 < 210 > 57 < 211 > 31 < 212 > DNA < 213 > synthetic construction < 400 > 57 gagatagcat ttgaagctgc gcagcgtgga g 31 < 210 > 58 < 211 > 24 < 212 > DNA < 213 > synthetic construction < 400 > 58 gactttgact ccgcggcaag ggcc 24 < 210 > 59 < 211 > 38 < 212 > DNA < 213 > synthetic construction < 400 > 59 ggagactttg actccaacgg ccgggccttt ttaaatag 38 - - -22- < 210 > 60 < 211 > 28 < 212 > DNA < 213 > synthetic construction < 400 > 60 gcaagggccg cgttaaatag taatatgc 28 < 210 > 61 < 211 > 39 < 212 > DNA < 213 > synthetic construction < 400 > 61 cctttttaaa tagtaatatg gcggctaaat atgtaaaag 39 < 210 > 62 < 211 > 25 < 212 > DNA < 213 > synthetic construction < 400 > 62 ccattgtagg gtcacctgac actgg 25 < 210 > 63 < 211 > 25 < 212 > DNA < 213 > synthetic construction < 400 > 63 ctgacactgg ggagtcgtgc ttttg 25 < 210 > 64 < 211 > 25 < 212 > DNA < 213 > synthetic construction < 400 > 64 ctgacactgg gcagtcgtgc ttttg 25 < 210 > 65 < 211 > 27 < 212 > DNA < 213 > synthetic construction < 400 > 65 cctgacactg ggcactcgtg cttttgc 27 < 210 > 66 < 211 > 27 < 212 > DNA < 213 > synthetic construction < 400 > 66 cctgacactg ggatctcgtg cttttgc 27 < 210 > 67 < 211 > 27 < 212 > DNA < 213 > synthetic construction < 400 > 67 cctgacactg ggcggtcgtg cttttgc 27 - ~ -_ .23- < 210 > 68 < 211 > 25 < 212 > DNA < 213 > synthetic construction < 400 > 68 cctgcagcca cgcgtggcta cagcc 25 < : 210 > 69 < 211 > 33 < 212 > DNA < 213 > synthetic construction < 400 > 69 ccgctactgg ttgctagcaa tatagacatt age 33 < 210 > 70 < 211 > 34 < 212 > DNA < 213 > synthetic construction < 400 > 70 ctactggtta catcagcaat tgacattagc aaag 34 < 210 > 71 < 211 > 37 < 212 > DNA < 213 > synthetic construction < 400 > 71 ggtttaaagt aaatgctagc gcatgtaccg tggcacg 37 < 210 > 72 < 211 > 31 < 212 > DNA < 213 > synthetic construction < 400 > 72 cagatgtacc gtgetegaga cattaggtac g 31 < 210 > 73 < 211 > 47 < 212 > DNA < 213 > synthetic construction < 400 > 73 catatttcct tcttatactg cagaacaatc ttagtttaaa aaagagg 47 < 210 > 74 < 211 > 29 < 212 > DNA < 213 > synthetic construction < 400 > 74 ctgcaaccgg tttcggttac ccacaccct 29 < 210 > 75 < 211 > 28 < 212 > DNA < 213 > synthetic construction < 400 > 75 cgttccactg agcgtagacc ccgtagaa 28 - 24 - < 210 > 76 < 211 > 18 < 212 > DNA < 213 > synthetic construction < 400 > 76 gctttgggct gtcatttg 18 < 210 > 77 < 211 > 18 < 212 > DNA < 213 > synthetic construction < 400 > 77 tgtcaggtgg ccctacaa 18 < 210 > 78 < 211 > 578 < 212 > PRT < 213 > The truncated < 400 > 78 Ala Asp Ala His Tyr Ala Thr Val Gln Asp Leu Lys Arg Lys Tyr Leu 1 5 10 15 Gly Ser Pro Tyr Val Ser Pro He Ser Asn Val Wing Asn Wing Val Glu 20 25 30 Ser Glu He Ser Pro Arg Leu Asp Wing He Lys Leu Thr Thr Gln Pro 35 40 45 Lys Lys Val Lys Arg Arg Leu Phe Olu Thr Arg Glu Leu Thr Asp Ser 50 55 60 Gly Tyr Gly Tyr Ser Glu Val Glu Ala Ala Thr Gln Val Glu Lys His 65 70 75 80 Gly Asp Pro Glu Asn Gly Gly Asp Gly Glu Glu Arg Asp Thr Gly Arg 85 90 95 Asp He Glu Gly Glu Gly Val Glu His Arg Glu Ala Glu Ala Val Asp 100 105 110 Asp Ser Thr Arg Glu His Wing Asp Thr Ser Gly He Leu Glu Leu Leu 115 120 125 Lys Cys Lys Asp He Arg Ser Thr Leu His Gly Lys Phe Lys Asp Cys 130 135 140 Phe Gly Leu Ser Phe Val Asp Leu He Arg Pro Phe Lys Ser Asp Arg 145 150 155 160 Thr Thr Cys Wing Asp Trp Val Val Wing Gly Phe Gly He His His Ser 165 170 175 He Wing Asp Wing Phe Gln Lys Leu He Glu Pro Leu Ser Leu Tyr Wing 180 185 190 His He Gln Trp Leu Thr Asn Wing Trp Gly Met Val Leu Leu Val Leu 195 200 205 He Arg Phe Lys Val Asn Lys Ser Arg Cys Thr Val Wing Arg Thr Leu 210 215 220 Gly Thr Leu Leu Asn He Pro Glu Asn His Met Leu He Glu Pro Pro 225 230 235 240 Lys He Gln Ser Gly Val Wing Wing Leu Tyr Trp Phe Arg Thr Gly He 245 250 255 Ser Asn Wing Ser Thr Val He Gly Wing Glu Wing Pro Glu Trp He Thr Arg 260 265 270 Gln Thr Val He Glu His Ser Leu Wing Asp Ser Gln Phe Lys Leu Thr 275 280 285 Glu Met Val Gln Trp Wing Tyr Asp Asn Asp He Cys Glu Glu Ser Glu 290 295 300 - 25 - He Ala Phe Glu Tyr Ala Gln Arg Oly Asp Phe Asp Ser Asn Ala Arg 305 -. 305 - 310 315 320 Wing Phe Leu Asn Ser Asn Met Gln Wing Lys Tyr Val Lys Asp Cys Wing 325 330 335 He Met Cys Arg His Tyr Lys His Wing Glu Met Lys Lys Met Ser He 340 345 350 Lys Gln Trp He Lys Tyr Arg Oly Thr Lys Val Asp Ser Val Gly Asn 355 360 365 Trp Lys Pro He Val Gln Phe Leu Arg His Gln Asn He Glu Phe He 370 375 380 Pro Phe Leu Ser Lys Leu Lys Leu Trp Leu His Gly Thr Pro Lys Lys 385 390 395 400 Asn Cys He Ala He Val Gly Pro Pro Asp Thr Gly Lys Ser Cys Phe 405 410 415 Cys Met Ser Leu He Lys Phe Leu Gly Gly Thr Val He Ser Tyr Val 420 425 430 Asn Ser Cys Ser His Phe Trp Leu Gln Pro Leu Thr Asp Ala Lys Val 435 440 445 Wing Leu Leu Asp Asp Wing Thr Gln Pro Cys Trp Thr Tyr Met Asp Thr 450 455 460 Tyr Met Arg Asn Leu Leu Asp Gly Asn Pro Met Ser He Asp Arg Lys 465 470 475 480 His Arg Ala Leu Thr Leu He Lys Cys Pro Pro Leu Leu Val Thr Ser 485 490 495 Asn He Asp He Ser Lys Clu Olu Lys Tyr Lys Tyr Leu His Ser Arg 500 505 510 Val Thr Thr Phe Thr Phe Pro Asn Pro Phe Pro Phe Asp Arg Asn Oly 515 520 525 Asn Wing Val Tyr slu Leu Ser Asp Wing Asn Trp Lys Cys Phe Phe slu 530 535 540 Arg Leu Ser Ser Leu Asp He slu Asp Ser slu Asp Glu Glu Asp 545 550 555 560 Gly Ser Asn Ser Gln Wing Phe Arg Cys Val Pro Gly Ser Val Val Arg 565 570 575 Thr Leu < 210 > 79 < 211 > 14 < 212 > PRT < 213 > The C-terminal < 400 > 79 Gln Ala Phe Arg Cys Val Pro Gly Ser Val Val Arg Thr Leu 1 5 10

Claims (41)

1. '99 CLAIMS Having described the invention as above, property is claimed as contained in. the following claims: 1. An amino acid sequence within the A region of a protein The papillomavirus protein necessary for the oligomerization of an El protein, characterized in that it comprises a sequence delineated by amino acids 352-439, numbered from a protein El of HPV-11, and any variant, derivative or fragment capable of self-associating and associating with a full-chain protein.
2. 2. The amino acid sequence according to claim 1, characterized in that the sequence is further delineated by amino acids 352-432, numbered from an HPV-11 protein, and any variant, derivative or fragment thereof capable to self-associate and associate with a protein The complete chain.
3. 3. The amino acid sequence according to claim 2, characterized in that the sequence is further delineated by amino acids 352-417, numbered from an HPV-11 protein, and any variant, derivative or fragment thereof. 100 capable of self-associating and associating with a protein The complete chain.
4. 4. The amino acid sequence according to claim 1, characterized in that the sequence is delimited by amino acids 353 to 438, numbered from an HPV-11 protein, and any variant, derivative or fragment thereof capable of self-associate and associate with a protein The complete chain.
5. 5. The amino acid sequence according to claim 2, characterized in that the sequence is delimited by amino acids 353 to 431, numbered from an HPV-11 protein, and any variant, derivative or fragment thereof capable to self-associate and associate with a protein The complete chain.
6. 6. The amino acid sequence according to claim 3, characterized in that the sequence is delimited by amino acids 353 to 416, numbered from an HPV-11 protein, and any variant, derivative or fragment thereof capable of self-associate and associate with a protein The complete chain. ??: 101
7. 7. A protein truncated at the N-terminal end characterized by being able to self-associate and associate with a full-chain protein.
8. 8. The protein according to claim 7, characterized in that the protein El has approximately its first 70 N-terminal amino acids deleted.
9. 9. The protein according to claim 8, characterized in that the protein is delimited by amino acids 72-649, numbered from a protein HPV-11, and any variant, derivative or fragment thereof capable of self-associate and associate with a protein The complete chain 15.
10. 10. An amino acid sequence characterized in that it is defined by SEQ ID NO. 2 and any derivative, variant or fragment thereof capable of self-associating and associating with a protein 20 The full chain.
11. 11. An amino acid sequence characterized in that it is defined by SEQ ID NO. 3 and any derivative, variant or fragment thereof capable of self-associating and associating with a protein 25 The full chain. 102
12. 12. An amino acid sequence characterized in that it is defined by SEQ ID NO. 4 and any derivative, variant or fragment thereof capable of self-associating and associating with a full-chain protein.
13. 13. An amino acid sequence characterized in that it is defined by SEQ ID NO. 78 and any derivative, variant or fragment thereof capable of self-associating and associating with a full-chain protein.
14. 14. The amino acid sequence according to claim 1, characterized in that the sequence is derived from a virus selected from the group consisting of: papillomavirus, SV40 virus and polyomavirus.
15. The amino acid sequence according to claim 14, characterized in that the sequence from the papillomavirus protein is from a cottontail rabbit papillomavirus (CRPV), bovine papillomavirus (BPV), or human papillomavirus (HPV) .
16. 16. The amino acid sequence according to claim 15, characterized in that the 103
17. 17. The sequence according to claim 16, characterized in that the HPV El protein originates from the low risk HPV selected from the group consisting of types 6, 11 and 13.
18. 18. The sequence according to claim 16, characterized because the HPV protein originates from the high-risk type of HPV selected from the group consisting of types 16, 18, 31, 33, 35, 42, 52 or 58.
19. 19. The sequence according to claim 17 , characterized in that the HPV protein is of the type 11 of HPV of low risk.
20. 20. The sequence according to claim 18, characterized in that the HPV El protein is of high-risk HPV type 16.
21. 21. The use of the amino acid sequence according to claim 1, 2 or 3, for a new therapeutic target for the control, prevention, elimination and treatment of PV infections in mammals.
22. 22. An oligomerization assay, characterized in that it comprises the steps of: 104 to. combining the protein El selected from the group consisting of SEQ ID No. 1; SEQ ID No. 2; SEQ ID No. 3; SEQ ID No. 4; SEQ ID No. 78; and any derivative, variant or fragment thereof capable of self-associating and associating with a full-length protein with a DNA fragment, and incubating them for a period of time to allow the protein El and the DNA to form a complex, b. isolate the protein complex The DNA of the corresponding non-complexed DNA, c. detect DNA, where the presence of DNA is an indication of the binding of protein to the origin of PV, and therefore is related to the oligomerization of El.
23. 23. An assay to trace an agent capable of inhibiting oligomerization El, characterized in that this test comprises the steps written in accordance with claim 22 and further comprising the steps of: a. contacting an agent with the El as defined in claim 22, before combining it with the DNA fragment and incubating for a period of time 105 enough to allow the protein / DNA to form a complex, and b. compare the results with a control sample, where the control sample is treated in a similar manner but without the addition of the agent.
24. 24. The assay according to claim 22, characterized in that the DNA contains an origin of replication to enhance the specificity of the binding to El.
25. The assay according to claim 24, characterized in that the El is combined with a mixture of two DNA fragments, one of which contains an origin of replication and the second contains a DNA of different length in such a way that it is distinguishable from the DNA containing ori and the amount of DNA bound to ori can be compared with the DNA. amount of non-specific binding.
26. 26. The assay according to claim 22, characterized in that the complex The DNA is isolated from the free DNA by column chromatography, centrifugation, extraction, filtration, immunoprecipitation or immobilized on a solid support using an antibody directed against the El protein. 106
27. 27. The assay according to claim 26, characterized in that the El-DNA is isolated by immobilization of the antibody in a solid medium such as a bead or the bottom of a well of a test plate so that when the medium is separated, the make the DNA free too.
28. 28. The assay according to claim 26, characterized in that the antibody is a polyclonal antibody.
29. 29. The assay according to claim 22, characterized in that the complexed DNA is released from the El / DNA complex before the -DNA is detected.
30. 30. The assay according to claim 29, characterized in that the DNA is labeled with a radioisotope and detected by gel electrophoresis followed by radioactive imaging.
31. 31. The assay according to claim 29, characterized in that the DNA is labeled with a colorimetric dye and the spectrum is detected photometrically.
32. 32. A crosslinking assay for evaluating the oligomerization level of the El protein, characterized in that the assay comprises the steps of: 107 to. combining the protein The selected label from the group consisting of SEQ ID No. 1; SEQ ID No. 2; SEQ ID No. 3; SEQ ID No. 4; SEQ ID No. 78; and any derivative, variant or fragment thereof capable of self-associating and associating with a full length chain protein with a DNA fragment and incubated for a period of time, to allow the protein El and the DNA to form a complex, b. cross-link the El and the DNA in the complex with a cross-linking agent, c. isolate the complex DNA / DNA complexed, d. Separate the electrophoretically so that the migration of El in a gel is an indication of the oligomerization level of El.
33. 33. The assay according to claim 32, characterized in that the DNA fragment is a single-stranded DNA.
34. 34. The assay according to claim 32, characterized in that the El-DNA complex is isolated from free DNA by chromatography in 108 column, centrifugation, extraction, filtration, immunoprecipitation or immobilized on a solid support using an antibody directed against the protein El.
35. 35. The assay according to claim 34, characterized in that the El is immunoprecipitated using a polyclonal antibody.
36. 36. The assay according to claim 32, characterized in that the protein El is labeled with a radioisotope.
37. 37. The assay according to claim 36, characterized in that the El is labeled with 35S and is detected on the gel by radiological imaging techniques.
38. 38. The assay according to claim 32, characterized in that the El wherein the cross-linking agent used is used is bismaleimidohexane (BMH).
39. 39. The assay according to claim 22 or 32, characterized in that the protein It is obtained by: synthesis by transcription / translation coupled in a rabbit reticulocyte lysis product or prepared by recombinant technology.
40. 40. The test according to claim 22 or 23, characterized in that the test 109 it is carried out at low temperature in the presence or absence of ATP / Mg.
41. 41. The assay according to claim 22 or 23, characterized in that the assay is carried out at high temperature in the presence of ATP / Mg.