MXPA01000450A - Amino polyol amine oxidase polynucleotides and related polypeptides andmethods of use - Google Patents

Abstract

The present invention provides polynucleotides and related polypeptides of the enzyme APAO isolated from Exophiala spinifera. Additionally, the polynucleotide encoding for the APAO enzyme can be used to transform plant cells normally susceptible to Fusarium or other toxin-producing fungus infection. Plants can be regenerated from the transformed plant cells. Additionally, the present invention provides for expressing both APAO and a fumonisin esterase in a transgenic plant. In this way, a transgenic plant can be produced with the capability of degrading fumonisin, as well as with the capability of producing the degrading enzymes. In addition, the present invention provides methods for producing the APAO enzyme in both prokaryotic and non-plant eukaryotic systems. Methods for detoxification in grain, grain processing, silage, food crops and in animal feed and rumen microbes are also disclosed.

Description

POLYOLYLOPHONOIDS OF AMINO POLYOL AMINE OXIDASE AND RELATED POLYPEPTIDES AND METHODS OF USE DESCRIPTION OF THE INVENTION The present invention relates generally to the detection and isolation of fumonisin and enzymes that degrade API and to compositions and methods for detoxification in vivo or degradation of fumonisin or its product of API hydrolysis. This method has wide application in agricultural biotechnology and crop agriculture and in the improvement of the quality of food grains. Mushroom diseases are common problems in crop farming. Many advances have been made against plant diseases as exemplified by the use of hybrid plants, pesticides and improved agricultural practices. However, as any farmer or home gardener can confirm, fungal disease problems in plants continue to cause difficulties in the cultivation of vegetables. Thus, there is a continuing need for new methods and materials to solve the problems caused by plant fungal diseases. These problems can be met through a variety of proposals. For example, infectious organisms can be controlled through the use of agents that are selectively biocides for pathogens. Another method is interference with the mechanism by which the pathogen invades the host plant of culture. Still another method, in the case of pathogens that cause crop losses, is the interference with the mechanism by which the pathogen causes damage to the host plant culture. Yet another method, in the case of pathogens that produce toxins that are undesirable to mammals or other animals that feed on crop plants, is interference with toxin production, storage or activity. This invention falls within the last two categories. 10 Since its discovery and structural elucidation in 1988 (Bezuidenhout et al., Journal Chem Soc, Chem Commun 1988: 743-745 (1988)), fumonisins have been recognized as a potentially serious problem in cattle fed corn. They are linked to various animal toxicoses that include leukoencephalomalacia (Marasas et al., Onderstepoort Journal of Veterinary Research 55: 197-204 (1988); ilson, et al, American Association of Veterinary Laboratory Diagnosticians: Abstracts 33rd Annual Meeting, Denver, Colorado, October 7-9, 1990 , Madison, Wisconsin, USA) and porcine pulmonary edema (Colvin, et al, Mycopa thologia 117: 79-82 (1992)). It is also suspected that fumonisins are carcinogenic (Geary W (1971) Coord Chem Rev 1: 81; Gelderblom, et al. , Carcinogenesis 12: 1247-1251 (1991); Gelderblom, et al. , Carcinogenesis 13: 433-437 (1992)). Fusarium isolates in Liseola section produce fumonisins in cultivation at levels of 2 a > 4000 ppm (Leslie, et al, Phytopa thology 82: 341-345 (1992)). Maize isolates (predominantly mating population A) are among the highest producers of fumonisin. (Leslie et al., Supra). Fumonisin levels detected in corn grown in the field have fluctuated widely depending on the location and period of growth, but pre-harvest and post-harvest studies of field corn have indicated that there is potential for high levels of fumonisins (Murphy, et al, J Agr. Food Chem 41: 263-266 (1993)). Studies of food and feed products have also detected fumonisin (Holcomb, et al., Food J Agr Chem 41: 764-767 (1993), Hopmans, et al., Food J Agr Chem 41: 1655-1658 (1993). Sydenham, et al., J Agr Food Chem 39: 2014-2018 (1991)). The etiology of Fusarium ear mold is poorly understood, although physical damage to the ear and certain environmental conditions may contribute to its presence (Nelson, Mycopa thologia 117: 29-36 (1992)). Fusarium can be isolated from most of the cultivated corn, even when the mold is not visible. The relationship between the infection of the seed plant and the diseases of the stem and the ear caused by Fusarium is unclear. The genetic resistance to visible almond mold has been identified (Gendloff, et al., Pytopathology 76: 684-88 (1986); Holley, et al., Plant Dis 73: 578-580 (1989)), but the relationship between Visible mold and fumonisin production must still be elucidated. _ ¿¿¿^ * ^ 3a_i_ _¡_j_tt¿iA ^ fc¿íii_ ^? _ ^^ Fumonisins have been shown in studies of in vitro mammalian cells that inhibit the biosynthesis of sphingolipids through the inhibition of the enzyme sphingosine N-acetyl transferase, resulting in the accumulation of the sphinganine precursor (Norred, et al. , Mycopa thlogia 117: 73-78 (1992), Wang, et al., Biol Chem 266: 14486 (1991), Yoo, et al, Toxicol Appl Pharmacol 114: 9-15 (1992), Nelson, et al., Annu Rev Phytpa thol 31: 233-252 (1993)). It is likely that the inhibition of this route explains at least some of the toxicity of furnomycin, and support for this comes from sphinganine measurements: sphingosine ratios in animals fed purified fumonisin (Wang, et al, J Nutr 122: 1706 1716 (1992)). Fumonisins also affect the growth of plant cells (Abbas, et al., Need Technol 6: 548-5S2 (1992), Vanasch, et al, Phytopa thology 82: 1330-1332 (1992), Vesonder, et al., Arch. Environ Contam Toxicol 23: 464-467 (1992)). Kuti et al. , (Abstract, Annual Meeting American Phytopathological Society Memphis TN APS Press 1993) reported on the ability of exogenously added fumonisins to accelerate the development of the disease and increase the sporulation of Fusarium moniliforme and Fusarium oxysporum in tomato. Enzymes that degrade fungus fumonisin toxin in its de-esterified form (eg, FBI API) have been identified in US Pat. No. 5,716,820, ^ = É ^ _jjai _ ^ = M --g - = M-í-a- --S - aa --- ^ "^ ^ ~" ^ - ww. • * ***** • *), X issued on February 10, 1998, the North American patent no. 5,792,931 issued on August 11, 1998; and pending US applications. 08 / 888,950 and 08 / 888,949, both filed July 7, 1997, and all incorporated herein by reference. It is understood that API as used herein refers to the hydrolyzed form of any fumonisin, FBI, FB2, FB3, FB4, or any other API-like compounds, including synthetically produced API-like compounds, containing an amine group C- 2 or Cl and one or more adjacent hydroxyl groups. Plants that express a fumonisin esterase enzyme, infected by fungi that produce fumonisin, and tested by fumonisin and API were found to have low levels of fumonisin but high levels of API. API is less toxic than fumonisin to plants and probably also to animals, but API contamination is still a concern. The preferred result would be the complete detoxification of fumonisin in a non-toxic form. Accordingly, enzymes capable of degrading API are necessary for the further detoxification of fumonisin. The present invention provides recently discovered related polypeptide polynucleotides of aminopolyol amino oxidase (abbreviated APAO, formerly known as API catabolase, U.S. Patent No. 5,716,820, supra, U.S. Patent No. 5,792,931, supra; pending US applications. 08 / 888,950 and 08 / 888,949, supra; trAPAO is the abbreviation for a truncated, but still functional APAO), capable of oxidatively deaminating the API to a compound identified as the 2-oxo derivative of the API or its cyclic ketal form (abbreviated as 2-OP, formerly called AP1-N1 , U.S. Patent No. 5,716,820 supra, and U.S. Patent No. 5,792,931 supra; US applications pending Nos. 08 / 888,950 and 08 / 888,949, supra), isolated from Exophiala spinifera, ATCC 74269. The partially purified APAO enzyme from Exophiala spinifera has low or no activity on the FBI intact, a form of fumonisin. However, the recombinant APAO enzyme from Exophiala spinifera expressed in E. coli, has significant but reduced activity on intact FBI and other fumonisin B series. APAO or trAPAO could thus potentially be used without fumonisin esterase since the amine group is the main target of detoxification. Alternatively, fumonisin esterase and APAO (or trAPAO) can be used together to degrade toxins. APAO is a type of flavin amino oxidase (Enzyme Nomenclature 1992, Recommendations of the Nomenclature Committee of the IUBMB on the Nomenclature and Classification of Enzymes, Academic Press, Inc. (1992).) Flavin amin oxidases are known in mammals such as monoaminoxidases, in * £ ¡k > i »-tA feaj!« - ?. ». «Si-ü:»; -. ..fk. ^. jtf ^ gli? i * ^^ ^ * ^^^^ where they participate in the conversion of amines involved in neuronal function. A prokaryotic flavin amino oxidase that deaminates putrecine has been described (Ishizuka et al., J. Gen Microbiol., 139: 425-432 (1993)). A single fungus gene from Aspergillus niger has been cloned (Schilling et al, Mol Gen Genet 247: 43-438 (1995)). It deaminates a variety of alkyl and aryl amines, but when tested for its ability to oxidize API, it was found not to contain API oxidant activity. The toxicity of fumonisins and their widespread potential occurrence in foods and food makes them imperative to find detoxification or elimination strategies to eliminate the compound from the food chain. The present invention provides polynucleotides, related polypeptides, and all conservatively modified variants of newly discovered APAOs. The nucleotide sequences of APAOs comprise the sequence found in SEQ. FROM IDENT. US. 5, 10, and 22. The SEC. FROM IDENT. NO.5 contains the nucleotide sequence of trAPAO, SEC. FROM IDENT. DO NOT. 10 contains the nucleotide sequence trAPAO with an additional lysine and SEC. FROM IDENT. DO NOT. 22 contains the long-length nucleotide sequence of APAO. For expression in a plant, the nucleotide sequence of APAO or trAPAO is fused to a plant signal sequence. The preferred plant signal sequences are sequences of signals whose object the apoplast or a peroxisome. Other signal sequences may also be used, depending on requirements, which include mitochondrial or plastids. It is an object of the present invention to provide transgenic plants and plant cells comprising the nucleic acids of the present invention. Therefore, in one aspect, the present invention relates to an isolated nucleic acid comprising an isolated polynucleotide sequence encoding an APAO enzyme. In a further aspect, the present invention is selected from: (a) an isolated polynucleotide that encodes a polypeptide of the present invention; (b) a polynucleotide comprising at least 20 contiguous bases of the polynucleotides of the present invention; (c) a polynucleotide having at least 40% identity with the polynucleotides of the present invention; (d) a polynucleotide comprising at least 20 nucleotides in length that hybridize under conditions of low stringency with the polynucleotides of the present invention; and (e) a polynucleotide comprising a polynucleotide selected from SEQ. FROM IDENT. US. 5, 7, 10, 22, and 32; and f) a polynucleotide which is complementary to the polynucleotide of (a) to (e). Additional polynucleotides of the present invention include a combined APAO enzyme in a fumonisin esterase. Fumonisin esterase is preferably ESP1 or BEST1. In another aspect, the present invention relates to a recombinant expression cassette comprising a nucleic acid as described, supra. Additionally, the present invention relates to a vector containing the recombinant expression cassette. In addition, the vector containing the recombinant expression cassette can facilitate the transcription and translation of the nucleic acid in a host cell. In yet another embodiment, the present invention is directed to a transgenic plant or plant cells, which contains the nucleic acids of the present invention. In another embodiment, the transgenic plant is a maize plant or plant cells. In yet another modality are the seeds of the transgenic plant. This invention also provides an isolated polypeptide comprising (a) a polypeptide comprising at least 25 contiguous amino acids of a polypeptide of the present invention; (b) a polypeptide comprising at least 55% identity sequences in a polypeptide of the present invention, (c) a polypeptide encoded by a nucleic acid of the present invention; (d) a polypeptide characterized in that a polypeptide selected from SEQ. FROM IDENT. US. 6, 11, 23, and 33; and (e) a conservatively modified variant of a polypeptide of the present invention. Another embodiment of the subject invention, comprises a ! .. «-» «..-. B ?. a? * .- í,. & £ j »^« * - ^ i - ,. j »t < Lt éBy c-j. • J ?? .. ", *," ** »- -, **,« * ", g, rf_A, ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^^^^ or a structurally related mycotoxin transferring the nucleic acids of the present invention to a plant either by themselves or in combination with a nucleic acid encoding a fumonisin esterase. In addition, two plants, one of which is transformed with an APAO of the present invention and the other transformed with a fumonisin esterase, can be cross-linked to produce a silver expressing fumonisin esterase and APAO. This invention further provides methods for degrading a fumonisin, a failure product, structurally related mycotoxin or a mycotoxin failure product, comprising the step of reacting the mycotoxin with the degradation enzymes of the present invention. Additionally, fumonisins can be degraded by application of fumonisin esterase enzymes and APAO enzyme. Mycotoxins can be degraded in grain harvested during the processing of harvested grain, in animal feed, or in plant tissue such as, for example, during the use of the plant for silage or as a spraying on grain, fruit or vegetables. Another embodiment of the invention in question is a host cell transformed by a polynucleotide construct as described above, and a method of making a polypeptide of a recombinant gene comprising: - t a) provide a population of host cells; and b) culturing the cell population under conditions whereby the polypeptide encodes the cassette sequence is expressed; 5 c) isolating the resulting polypeptide. A number of expression systems that use the host cells can be used, but not limited, microbial, (mammalian), plant or insect. Alternatively, the fumonisin degraded enzymes can be isolated and purified from the planting or parts of the plant of a plant that expresses the enzyme. The polynucleotides of the present invention can also be used as a selectable marker for plant transformation. By transforming plant cells with an expression cassette containing the polynucleotide of the present invention and then placing the plant cells on the medium containing FBI, API or a phytotoxic analogue, only the plant cells expressing the polynucleotide of the present invention would survive. Another embodiment of the present invention is the use of the enzyme fumonisin esterase and APAO by themselves or in combination as reagents for detecting fumonisin and structurally related toxins. Unless defined otherwise, all technical and scientific terms used in the present have the same meaning as commonly understood by someone with common experience in the art to which this invention pertains. Unless otherwise mentioned, the techniques employed or contemplated herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are only illustrative and not limiting. The following is presented by way of illustration and is not intended to limit the scope of the invention. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microbiology, tissue culture, molecular biology, chemistry, biochemistry and recombinant DNA technology, which are within the skill of the art. Such techniques are fully explained in the literature. See, for example, J. H. Langenheim and K. V. Thimann, Botany: Plant Biology and Its Relationship to Humman Affairs (1982) John Wiley; Cell Cul ture and Soma tic Cell Genetics of Plant s, Vol. 1 (I. K. Vasil, ed., 1984); R V. Stanier, J., L. Ingraham, M., L. Wheelis, and P. R Painter, The Microbial World, (1986) 5 Ed., Prentice-Hall; O. D. Dhringra and J. B. Sinclair, Basic Plant Panthology Methods, (1985) CRC Press; Maniatis, Fritsch & Sambrook, Molecular Cloning: A Laborotory Manual (1982); DNA Cloning, Vols. I and II (D. N. Glover ed., 1985); Oligonucleotide Syn thesis (M. J. Gait ed., 1984); Nucleic Acid Hybridization (B. i m? ? u & ?? bt. ^. *, **, - »*. * m .t í *. ~ ¿.. > a,? .. ^. g? * .t *. * t ... * '"?. * *, * -,, * *.,. . . »» F.; i Aj8 < D. Hames & S. J. Higgins eds 1984); and the series Methods in Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.). Units, prefixes and symbols can be denoted in their accepted form YES. Unless otherwise indicated, nucleic acids are written from left to right in 5 'to 3' orientation; the amino acid sequences are written from left to right in amino to carboxy orientation, respectively. The numerical ranges are inclusive of the numbers that define the range. In the present, amino acids can be referred to by their commonly known three-letter symbols or by the letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, can be referred to by their commonly accepted simple letter codes. The terms defined below are defined more fully in reference to the specification as a total. In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below. By "microbe" is meant any microorganism (which includes eukaryotic and prokaryotic microorganisms), such as fungi, yeasts, bacteria, actinomycetes, algae and protozoa, as well as other unicellular structures.

A "microbe that produces fumonisin" is any microbe capable of producing the mycotoxin fumonisin or analogues thereof. Such microbes are generally members of the genus Fusarium fungi, as well as recombinantly derived organisms, which have been genetically altered to allow them to produce fumonisin or analogs thereof. By "degrading fumonisin" is meant any modification of fumonisin, or API molecule that causes a decrease or loss in its toxic activity, such as degradation to less than 1%, 5%, 10%, or 50% of original toxicity , preferring less than 10%. Such a change may comprise the cleavage of any of the various bonds, oxidation, reduction, addition or deletion of a chemical portion, or any other change that affects the activity of the molecule. In a preferred embodiment, the modification includes hydrolysis of the ester linkage in the molecule as a first step and then oxidative deamination. In addition, chemically altered fumonisin can be isolated from microbial cultures that produce an enzyme of this invention, such as by culturing the organisms on media containing radiolabelled fumonisin, tracing the label and isolating the degraded toxin for further study. The degraded fumonisin can be compared to the active compound for its phytotoxicity or mammalian toxicity in sensitive species known, such as pigs, rabbits, and horses or in cell or tissue culture tests. Such toxicity tests are known in the art. For example, in plants a full leaf bioassay can be used in which active and inactive compound solutions are applied to the leaves of sensitive plants. The leaves can be treated in situ or, alternatively, cut leaves can be used. The relative toxicity of the compounds can be estimated by classifying the damage that occurs to the plant tissues and measuring the size of the the injuries formed within a given period of time. Other known tests can be performed at the cellular level, which employ standard tissue culture methodologies, for example using cell suspension cultures. By "fumonisin esterase" means any enzyme capable of hydrolyzing the ester bond in fumonisin or a structurally similar molecule such as the AAL toxin. Two examples of such enzymes are ESP1 and BEST1 found in the North American patent application no. 5,716,820, issued on February 10, 1998, the North American patent no. 5,792,931, issued August 11, 1998; and pending US applications. 08 / 888,950 and 08 / 888,949, both filed July 7, 1997. By "structurally related mycotoxin" is meant any mycotoxin having a structure chemical related to a fumonisin or API such as the toxin aA -m > -i? «Éitt? nr - * ioJi? . , t, ü, »-... w.

AAL, fumonisin Bl, fumonisin B2, fumonisin B3, fumonisin B4, fumonisin Cl, fumonisin Al and A2, and their analogues or forms 1 hydrolysates, as well as other mycotoxins having cellular chemical structures including synthetically synthesized analogues containing a C-2 or Cl amine group and one or more adjacent hydroxyl groups, which are expected to be degraded by the activity of an enzyme of the present invention. The present invention is the first known flavin amino oxidase that attacks a primary amine not located in C-1 (ie C-2 API) and resulting in an aceto product rather than an aldehyde product. It is understood that "API" or "aminopolyol" as used herein is to designate the hydrolyzed form of any fumonisin, FBI, FB2, FB3, FB4, AAL, or any other compound similar to API, which includes a synthetically produced compound , containing a C-2 or C-1 amine group and one or more adjacent hydroxyl groups. By "amplified" it is meant the construction of multiple copies of a nucleic acid sequence or multiple complementary copies of the nucleic acid sequence that uses at least one of the nucleic acid sequences as a template. Amplification systems include the polymerase chain reaction (PCR) system, ligase chain reaction (LCR) system, amplification based on the nucleic acid sequence (NASBA, Cangene, Mississauga, Ontario), systems of Q-Beta Replicase, amplification system based on transcription (TAS), and strand displacement amplification (SDA). See, for example, Diagnostic Molecular Microbiology: Principles and Applications, D. H. Persing et al. , Ed., American Society for Microbiology, Washington, DC (1993). The amplification product is called an amplicon. The term "conservatively modified variants" is applied to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refer to those nucleic acids that encode identical or conservatively modified variants of the amino acid sequences. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For example, the GCA, GCC, GCG and GCU codons all encode the amino acid alanine. Thus, in each position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such variations of nucleic acids are "silent variations" and represent a kind of clinically modified variation. Each nucleic acid sequence herein that encodes a polypeptide also describes any possible silent variation of the nucleic acid. Someone with common experience will recognize that each codon in a nucleic acid (except AUG which is ordinarily the only codon) ll? Al? ** * ií * * k ??? X? . % .. *? &? i í * *. J », Mj-jt; ^ J ,. ..-? .-. «... < > t ... t J .., - «. * & * -. - - * - > .. " "U J -w» -ftafe 4. ».? ? j fr ^^^ for methionine, one exception is Micrococcus rubens, for which GTG is the methionine codon (Ishizuka, et al., J. Gen '1 Microbiol, 139: 425-432 (1993)) can be modified to produce a functionally identical molecule. Accordingly, each silent variation of a nucleic acid encoding a polypeptide of the present invention is implicit in each polypeptide sequence described and incorporated herein for reference. According to the amino acid sequences, someone with The experience will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide or protein sequence, which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence that is a "variant".

"When the alteration results in the substitution of an amino acid with a chemically similar amino acid, any number of amino acid residues selected from the group of integers consisting of 1 to 15 can be altered in this way. example, 1, 2, 3, 4, 5, 7, or 10 alterations can be made. The conservatively modified variants typically provide similar biological activity as the sequence of unmodified polypeptides from which they are derived. For example, substrate specificity, enzymatic activity, or ligand / receptor binding is generally at least 30%, 40%, 50%, 60%, 70%, 80%, or 90%, preferably 60-90% of the native protein by its native substrate. Conservative substitution tables that provide functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), glumatic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W) See also, Creighton (1984) Proteins W.H. Freeman and Company. As used herein, "consisting essentially of" means the inclusion of additional sequences to an object polynucleotide wherein the additional sequences do not selectively hybridize, under severe hybridization conditions, to the same cDNA as the polynucleotide and wherein the conditions of hybridization include a washing step at 0. IX SSC and 0.1% sodium dodecyl sulfate at 65 ° C. By "coding" or "encoded", with respect to a specific nucleic acid, it can be said to comprise information for translation within the specific protein. A nucleic acid encoding a protein may comprise untranslated sequences (eg, introns) within the translated regions of the nucleic acid, or such interventional untranslated sequences may be missing (eg, as in cDNA). The information by which a protein is encoded is specified by the use of condoms. Typically, the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code. However, variants of the universal code, such as the one that is present in a certain plant, animal, and fungal mitochondria, the bacterium Mycoplasm capricol um. { Proc. Na ti. Acad Sci. (USA), 82: 2306-2309 (1985)), or the ciliate Macronucleus, can be used when the nucleic acid is expressed using these organisms. When the nucleic acid is synthetically prepared or altered, advantage can be taken of the known codon preferences of the intended host where the nucleic acid will be expressed. For example, although the nucleic acid sequences of the present invention can be expressed in monocotyledonous and dicotyledonous plant species, the sequences can be modified to explain the specific codon preferences and GC content preferences of monocotyledonous plants or dicotyledonous plants since these preferences have shown to differ (Murray et al., Nucí Acids Res. 17: 477-498 (1989) and are incorporated herein by reference). Thus, the preferred corn codon for a particular amino acid could be derived from known gene sequences of corn. The use of corn codon for 28 genes of maize plants is listed in Table 4 of Murray et al. , supra. As used herein, "heterologous" in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if it is of the same species, is substantially modified from its native form in composition and / or genomic location by deliberate human intervention. For example, a promoter operably linked to a heterologous structural gene is from a different species from which the structural gene was derived, or, if it is from the same species,. one or both are substantially modified from their original form. A heterologous protein may originate from a foreign species, or, if it is from the same species, is substantially modified from its original form by deliberate human intervention. By "host cell" or "recombinantly designed cell" is meant a cell, which contains a vector and supports the replication and / or expression of the expression vector. The host cells can be prokaryotic cells such as E. col i, or eukaryotic cells such as yeast, insect, plant, amphibian, or mammalian cells. Preferably, the host cells are monocotyledonous or dicotyledonous plant cells, including but not limited to corn, sorghum, sunflower, soybean, wheat, alfalfa, rice, cotton, barley, barley, millet, and tomato. A particularly preferred host cell monocotyledone is a maize host cell. The term "hybridization complex" includes reference to a duplex nucleic acid structure formed by two single-stranded nucleic acid sequences selectively hybridized with each other. The term "introduced" in the context of inserting a nucleic acid into a cell means "transfection" or "tansformation" or "transduction" and includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell wherein the Nucleic acid can be incorporated into the genome of the cell (eg, chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous, or temporarily expressed replicon (eg, transfected mRNA). The term "isolated" refers to a material, such as a nucleic acid or a protein, which is substantially or essentially free of components, which normally accompany or interact with it, as found in its naturally occurring environment. The isolated material optionally comprises material not found with the material in its natural environment. Nucleic acids that are "isolated" as defined herein are also referred to -3 »I -rf '* é *? ** & : • »a¡« .1¡ - - < », * > , £ ** *. .-. , »..,« J .__. J ..? Üuti. ,. i. . », -. , - * a, »A, i? as "heterologous" nucleic acids. Unless otherwise indicated, the term "APAO nucleic acid" means a nucleic acid comprising a polynucleotide ("APAO polynucleotide") that encodes an APAO polypeptide. The term APAO, unless otherwise indicated, may encompass both APAO and the truncated functional version of APAO designated trAPAO. As used herein, "nucleic acid" includes reference to a deoxyribonucleotide or ribonucleotide polymer in the form of a double or single strand, and unless otherwise limited, encompasses known analogs having the essential nature of the natural nucleotides in which they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids). By "nucleic acid library" is meant a collection of isolated DNA or RNA molecules, which comprise and substantially represent the complete transcribed fraction of a genome of a specified organism. The construction of examples of nucleic acid libraries, such as genomic libraries and cDNA, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol 152 Academic Press Inc., San Diego CA (Berger); Sambrook et al. , Molecular Cloning -A Labora tory Manual, 2nd ed., Vol 1-3 (1989); and Curren t Protocols in Molecular Biology, F.M. Ausbel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and Jhon Wiley & Sons, Inc. (1994 Supplement). As used herein, "operably linked" includes reference to a functional link between a promoter and a second sequence, wherein the promoter sequence initiates and measures the transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that nucleic acid sequences that are linked are contiguous and, where it is necessary to join two regions encoding protein, contiguous and in the same reading structure. As used herein, the term "plant" includes reference to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds and plant cells and progeny thereof. Plant cell, as used herein includes, without limitation, seed suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. The class of plants, which can be used in the methods of the invention, is generally as broad as the class of higher plants subject to transformation techniques, which include monocotyledonous and dicotyledonous plants which include species of the genus: Cucurbi ta, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Cítrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hioscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Oats, Hordeum, Sécale, Allium, and Triticum. A particularly preferred plant is Zea mays. As used herein, "polynucleotide" includes reference to a deoxyribopolinucleotide, ribopolynucleotide, or analogs thereof having the essential nature of a native ribonucleotide in which they hybridize, under conditions of severe hybridization to substantially the same nucleotide sequence as nucleotides that occur naturally and / or allow translation within the same amino acid (s) as the naturally occurring nucleotide (s). A polynucleotide can be full-length or a subsequence of a structural or regulatory native or heterologous gene. Unless otherwise stated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNA or RNA with spinal columns modified for stability or for other reasons are "polynucleotides" as that term is intended herein. In addition, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name but two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term "polynucleotide" as used herein encompasses such chemically, enzymatically, or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia, simple and complex cells. The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to polymers of amino acids in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as naturally occurring amino acid polymers. As used herein, "promoter" includes reference to a region of DNA toward the 5 'end from the start of transcription and involved in the recognition and binding of RNA polymerase and other proteins to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. Examples of plant promoters include, but are not limited to, those obtained from plants, plant viruses, and bacteria comprising genes expressed in plant cells such as Agrobacterium or Rhizobium. Examples are promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids, or sclerenchyma. Such promoters are referred to as "preferred tissue". A specific promoter "cell type" mainly drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An "inducible" or "regulatable" promoter is a promoter, which is under environmental control. Examples of environmental conditions that can effect transcription by inducible promoters include anaerobic conditions or the presence of light. Another type of promoter is an environmentally regulated promoter, for example, a promoter that drives expression during pollen development. Preferred tissue promoters, cell type specific, environmentally regulated, and inducible, constitute the "non-constitutive" class of promoters. A "constitutive" promoter is a promoter which is active under most environmental conditions. The term "APAO polypeptide or trAPAO polypeptide" refers to one or more amino acid sequences. The term is also inclusive of fragments, homologous variants, alleles or precursors (e.g., preproproteins or ptroproteins) thereof. An "APAO or trAPAO protein" comprises an APAO or trAPAO polypeptide. As used herein "recombinant" includes reference to a cell or vector, which has been modified by the introduction of a heterologous nucleic acid or that the cell is derived from a cell so modified. Thus, for example, genes expressing recombinant cells that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise expressed abnormally, under expression or non-expression as a result of the deliberate human intervention. The term "recombinant" as used herein does not encompass alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation)., transformation / transduction / natural transposition) such as those that occur without the deliberate human intervention. As used herein, a "recombinant expression cassette" is a nucleic acid construct, recombinantly or synthetically generated, with a series of specified nucleic acid elements, which allow the transcription of a particular nucleic acid in a target cell. The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the portion of the recombinant expression cassette of an expression vector tj ^^ tS ^^^^^^^^^ l ^^ íí ^ rá | áf¿ «^^^^ * ^ g * ¡^ j ^^ g ^^^^^^^^^^ includes, among other sequences, a nucleic acid to be transcribed, and a promoter. The term "residue" or "amino acid residue" or "amino acid" is used interchangeably herein to refer to an amino acid that is incorporated within a protein, polypeptide, or peptide (collectively "protein"). The amino acid may be an amino acid that occurs naturally and, unless otherwise limited, may encompass known analogs of natural amino acids that can function in a manner similar to naturally occurring amino acids. The term "selectively hybridizes" includes reference to hybridization, under severe hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater extent (eg, at least 2 times the base) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-objective nucleic acids. Selective hybridization sequences typically have about at least 40% sequence identity, preferably 60-90% sequence identity, and most preferably 100% sequence identity (ie, complementary) to each other. The terms "severe conditions" or "severe hybridization conditions" include reference to conditions under which a probe will hybridize to its target sequence, to a detectably greater extent than other sequences (for example at least 2 times on the base). Severe conditions are sequence dependent and will be different in different circumstances. By controlling the severity of the hybridization and / or washing conditions, objective sequences can be identified that can be up to 100% complementary to the probe (homologous probe). Alternatively, the severity conditions can be adjusted to allow some mismatch in the sequences so that lower grades are detected of similarity (heterologous sounding). Optimally, the probe is approximately 500 nucleotides in length, but may vary greatly in length from less than 500 nucleotides up to the full length of the target sequence. Typically, severe conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically around 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 ° C to short probes (for example, 10 to 50 nucleotides) and at least approximately 60 ° C for long probes (for example, greater than 50 nucleotides). Severe conditions can also be achieved with the addition of destabilizing agents such as formamide or Denhardt. Examples of conditions of low severity include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (dodecyl sulfate ^^^^^^^^^^^ Í ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^ g ^^^^^^^ ^ 3j & Sodium) at 37 ° C, and a wash at IX to 2X SSC (20X SSC = 3.0 M NaCl / 0.3 M trisodium citrate) at 50 to 55 ° C. Examples of conditions of moderate severity include hybridization in 40 to 45% of formamide, 1M of NaCl, 1% of SDS at 37 ° C, and a wash in 0.5X to IX of SSC at 55 to 60 ° C. Examples of high severity conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 ° C, and a wash in 0. IX SSC at 60 to 65 ° C. The specificity is typically the function of the post-hybridization washes, the critical factors being the ionic strength and the temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the Meinkoth and Wahl equation, Anal Biochem. , 138: 267-284 (1984): Tra = 81.5 ° C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% form) - 500 / L; where M is the molarity of the monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in pairs of bases. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence is hybridized to a perfectly matched probe. Tm is reduced by approximately 1 ° C for every 1% mismatch; thus, the Tm conditions of hybridization and / or washing can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with 90% identity are searched for, the Tm can be decreased by 10 ° C. Generally, | ^^^^^ | ^^^^^^ _ ^ _ ^^^^^^^^^^^ g ^ ^^^^^^^! J ^^^^^ i ^^^^^ ^^^^^^ _ ^^^^^ _ ^ ^ ^ ^ ^^^^^^ g ^ ^^^^^ severe conditions are selected to be approximately 5 ° C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, stringently severe conditions may utilize a hybridization and / or wash at 1, 2, 3, or 4 ° C less than the thermal melting point (Tm); moderately severe conditions can utilize a hybridization and / or wash at 6, 7, 8, 9, or 10 ° C less than the thermal melting point (Tm); Low severity conditions can use hybridization and / or washing at 11, 12, 13, 14, 15, or 20 ° C less than the thermal melting point (Tm). Using the equation, the hybridization and washing compositions, and the desired Tm, those of ordinary experience will understand that variations in the severity of hybridization and / or wash solutions are inherently described. If the desired degree of mismatch results in a Tm of less than 45 ° C (aqueous solution) or 32 ° C (formamide solution) it is preferred to increase the concentration of SSC so that a higher temperature can be used. An extensive guide to nucleic acid hybridization is found in Tijssen Laborotory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2"Overview of Principles of Hybridization and the Strategy of Nucleic Acid Testing", Elsevier, New York (1993), and Curren t Protocol s in Molecular Biology, Chapter 2, Ausubel, et al. , Eds Greene Publishing and ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ 4 ^^^^^^^^^^^^^^^^^^^^^^ Wiley-Interscencie, New York (1995). Unless otherwise indicated, in the present application high severity is defined as hybridization in 4X SSC, 5X Denhardt (5g Ficoll, 5g, polyvinylpyrrolidone, 5g bovine serum albumin in 500 ml water), 0.1 mg / ml boiled salmon sperm DNA, and 25 mM Na phosphate at 65 ° C, and a wash at 0. IX SSC, 0.1% SDS at 65 ° C. As used herein, "transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated into the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide can be integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, callus, tissue, part of the plant or plant, the genotype of which has been altered by the presence of heterologous nucleic acid that includes those transgenic initially so altered as well as those created by sexual crossings or asexual propagation of the initial transgenic. The term "transgenic" as used herein does not cover alteration of the genome (chromosomal or extrachromosomal) by conventional plant propagation methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, bacterial transformation not recombinant, non-recombinant transposition, or spontaneous mutation. As used herein, "vector" includes reference to a nucleic acid used in the transfection of a host cell and into which a polynucleotide can be inserted. Vectors are frequently replicons. Expression vectors allow transcription of a nucleic acid inserted therein. The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides or polypeptides: (a) "reference sequence", (b) "comparison window", (c) "sequence identity", (d) "percentage of sequence identity", and (e) "substantial identity". (a) As used herein, "reference sequence" is a defined sequence used as a basis for the comparison of sequences. A reference sequence can be a subset or the whole of a specific sequence; for example, as a segment of a full-length cDNA or a gene sequence, or the sequence of the entire gene or cDNA. (b) As used herein, "comparison window" means that it includes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence can be compared to a reference sequence and wherein the portion of sequence Bí ^ ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ The polynucleotide in the comparison window may comprise additions or deletions (ie, voids) compared to the reference sequence (which does not comprise additions or deletions). for the optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally it can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to the inclusion of voids in the polynucleotide sequence, a vacuum sanction is typically introduced and subtracted from the number of equals. Methods of alignment of nucleotide and amino acid sequences for comparison are well known in the art. The local homology algorithm (Best Fit) of Smith and Waterman, Adv. Appl. Math can drive the optimal alignment of sequences for comparison. 2: 482 (1981); by the alignment homology algorithm (GAP) of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970); by the search by the similarity method (Tfasta and Fasta) of Pearson and Lipman. Proc. Na ti. Acad. Sci. 85: 2444 (1988); by computerized implementations of these algorithms, which include, but are not limited to: CLUSTAL in the PC / Gene program by Intelligenetics, Mountain View, California, GAP BESTFIT, FASTA, and TFASTA in the Wisconsm Genetics Software Package, Genetics Computer Group (GCG ), 575 Science Dr. , Madison, Wisconsin, USA; the program CLUSTAL is well described by Higgins and Sharp, Gene 73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al. , Nucleic Acids Research 16: 10881-90 (1988); Huang, et al. , Computer Applications in the Biosciences 8: 155-65 (1992), and Pearson et al. , Methods in Molecular Biology 24: 307-331 (1994). The preferred program to be used for the optimal global alignment of multiple sequences is PileUp (Feng and Doolittle, Journal of Molecular Evolution, 25: 351-360 (1987) which is similar to the method described by Higgins and Sharp, CABIOS, 5: 151-153 (1989) and incorporated herein by reference). The BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide interrogation sequences against nucleotide database sequences; BLASTX for nucleotide interrogation sequences against protein database sequences; BLASTP for protein interrogation sequences against protein database sequences; TBLASTN for protein interrogation sequences against nucleotide database sequences; and TBLASTX for nucleotide interrogation sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al. , Eds Greene Publishing and Wiley-Interscience, New York (1995). GAP uses the algorithm of Needleman and Wunsch (J. Mol. ? á ~ ¿Á £ - al-e * i ~ fc &a. * -.- u ***,. * 'it «et ?, i; Í., - i Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of equals and decrease the number of voids. GAP considers all possible alignments and empty positions and creates the alignment with the largest number of equalized bases and the fewest empty ones. It allows the provision of a creation of vacuum sanction and an extension of the vacuum sanction in units of equalized bases. GAP must make a profit from the creation of the number of peer sanction gaps for each gap that is inserted. If an extension of the vacuum sanction larger than zero is chosen, GAP must, in addition, make a profit for each vacuum inserted from the length of the vacuum by the extension of the vacuum sanction. Omission values for creation of penalty gaps and creation of sanction void values in Version 10 of the Winsconsin Genetics Software Package are 8 and 2, respectively. The creation of gaps and empty gap sanctions can be expressed as a whole number selected from the group of integers consisting of 0 to 100. Thus, for example, the creation of gaps and empty gap sanctions can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or larger. GAP presents a member of the family of the best alignments. There may be many members of this family, but no other member has better quality. GAP presents four figures of merit for the alignments: Quality, Relation, Identity, and Similarity. Quality is the maximized metric to align the sequence. The Relationship is the quality divided by the number of bases in the shortest segment. The percent identity is the percentage of the symbols that currently coincide. The percent of similarity is the percentage of the symbols that are similar. The symbols that are through the gaps are ignored. A similarity is recorded when the register matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The registration matrix used in Version 10 of the Wisconsin Genetics Software Package is BLOSUM62. { see Henikoff & Henikoff (1989) Proc. Na ti. Acad. Sci. USA 89: 10915). Unless stated otherwise, the sequence identity / similarity values provided herein refer to the value obtained using the BLAST 2.0 series of programs that use omission parameters. Altschul et al. , Nucleic Acids Res. 25: 3389-3402 (1997). As those of common experience in the art will understand, BLAST seeks to assume that proteins can be modeled as random sequences. However, many real proteins comprise regions of non-random sequences, which can be made homopolymeric, short period repeats, or regions enriched in one or more amino acids. Such low complexity regions can be aligned between unrelated proteins even when other regions of the protein are »L irf ^ * j, * - í *. -JsA to completely unequal. A number of low complexity filter programs can be used to reduce such low complexity alignments. For example, the low complexity filters SEG (Wooten and Federhen, Comput. Chem., 17: 149-163 (1993)) and XNU (Claverie and States, Comput Chem., 17: 191-201 (1993)) can be used alone or in combination. (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acids or polypeptide sequences includes reference to the residues in the two sequences, which are the same when aligned for maximum correspondence over a specific comparison window. When the percentage of sequence identity is used in reference to proteins, it is recognized that residual positions that are not identical often differ in conservative amino acid substitutions, where the amino acid residues are replaced by other amino acid residues with similar chemical properties (for example, loading or hydrophobicity) and therefore do not change the functional properties of the molecule. Where the sequences differ in conservative substitutions, the percent sequence identity can be adjusted upward to correct the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". The means to make this adjustment are well known to those i .j *, ¿¿¿¿. . », Itta4, .a., ¿Jií & Á * of experience in the technique. Typically this involves registering a conservative substitution as a partial rather than a complete mismatch, thereby increasing the percentage of sequence identity. Thus, for example, where an identical amino acid is given a record of 1 and a non-conservative substitution is given a zero record, a conservative substitution is given a record between zero and 1. The record of conservative substitutions is calculates, for example, according to the algorithm of Meyers and Miller, Computer. Applic. Biol. Sci. , 4: 11-17 (1988) for example, as implemented in the PC / GENE program (Intelligenetics, Mountain View, California, USA.). (d) As used herein, "percent sequence identity" means the value determined by comparing two optimally aligned sequences on a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (ie empty) compared to the reference sequence (which does not comprise additions or deletions) for the optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino acid residues occur in both sequences to produce the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window and multiplying the result by 100 to produce the sequence identity percentage. (e) (i) The term "substantial identity" of the polynucleotide sequences means that a polynucleotide comprises a sequence having between 50-100% sequence identity, preferably at least 50% sequence identity, preferably at least 60% % sequence identity, preferably at least 70%, more preferably at least 80%, more preferably at least 90% and most preferably at least 95%, compared to a reference sequence using one of the alignment programs described using standard parameters. One of experience will recognize that these values can be appropriately adjusted to determine the corresponding identity of proteins encoded by two nucleotide sequences taking into account codon degeneracy, amino acid similarity, position of the reading structure and the like. The substantial identity of the amino acid sequence for these purposes normally means a sequence identity of between 50-100%, preferably at least 55%, preferably at least 60%, more preferably at least 70%, 80%, 90%, and more preferably at least 95%. Another indication that the nucleotide sequences are substantially identical is if two molecules hybridize to each other under severe conditions. Degeneration ^^ &! ^^^ S & or $ ^^^^^ of the genetic code allows many amino acid substitutions that lead to a diversity in the sequence of nucleotides that encode the same amino acid, consequently, it is possible that the sequence DNA can encode the same polypeptide but not hybridize to each other under severe conditions. This can occur, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy allowed by the genetic code. An indication that two nucleic acid sequences are substantially identical is that the polypeptide, which encodes the first nucleic acid, is an immunologically cross-reactive reaction with the polypeptide encoded by the second nucleic acid. (e) (ii) The terms "substantial identity" in the context of a peptide indicates that a peptide comprises a sequence of between 55-100% sequence identity with a reference sequence preferably at least 55% sequence identity, preferably 60%, preferably 70%, more preferably 80%, more preferably at least 90% or 95% sequence identity with the reference sequence over a specific comparison window. Preferably, optimal alignment is conducted using the alignment homology algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970). An indication that two peptide sequences are substantially identical is that a peptide is immunologically reactive with raised antibodies i ^^^^ J ^^^^^ against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, wherein the two peptides differ only by a conservative substitution. In addition, a peptide can be substantially identical to a second peptide when they differ by a non-conservative change if the epitope that the antibody recognizes is substantially identical. Peptides that are "substantially similar" share sequences as noted above, except that residual positions that are not identical may differ by conservative amino acid changes. Organisms that degrade Fumonisin The present invention is based on the discovery of organisms with the ability to degrade the mycotoxin fumonisin. In a search by biological means to detoxify fumonisins, several demariety hyphomycetes of corn kernels grown in the field were isolated. The fungi were able to grow on fumonisin Bl or B2 (FBI or FB2) as the sole carbon source, degrading it partially or completely in the process. One species, identified as Exophiala spinifera, a "black yeast", was recovered from maize seeds from various locations in the south east and south central United States. The active enzyme strain of Exophiala spinifera (ATCC 74269) was deposited (see U.S. Patent Application No. 5,716,820, issued February 10, 1998, U.S. Patent No. 5,792,931 issued on August 11, 1998; and pending US applications. 08 / 888,950 and 08 / 888,949, both filed on July 7, 1997). Nucleic Acids The present invention provides, inter alia, nucleic acids isolated from RNA, DNA, and analogs and / or chimeras thereof, comprising an APAO or trAPAO polynucleotide. The present invention also includes polynucleotides optimized for expression in different organisms. For example, for the expression of the polynucleotide in a corn plant, the sequence can be altered to explain specific codon preferences and to alter the GC content according to Murray et al. , supra. The use of corn codon for 28 maize vegetable genes is listed in Table 4 of Murray, et al. , supra. The APAO or trAPAO nucleic acids of the present invention comprise isolated APAO or trAPAO polynucleotides which are inclusive of: (a) a polynucleotide encoding an APAO or trAPAO polypeptide of the sequences found in SEQ. FROM IDENT.

NO: 6 and 22 and conservatively modified and polymorphic variants thereof; (b) a polynucleotide that selectively hybridizes to a polynucleotide of (a) or (b); 25 (c) a polynucleotide having at least 40% ^ - »- iil-i-afÍÍK? W S-a ^ * '' a- ^ > H3Affa- ^ M > ^ * A t - .. Jte.-ti. . - > -... r. " í **. s * »A, < * áís¿A: **., ^, .- > .-- " - - «. -% * > sequence identity with the polynucleotides of (a) or (b); (d) complementary polynucleotide sequences of (a), (b), or (c); and (e) a polynucleotide comprising at least 15 contiguous nucleotides of a polynucleotide of (a), (b), (c), or (d). In addition, polynucleotides that are a fusion of an APAO or trAPAO polynucleotide and the polynucleotide of a fumonisin esterase are presented. The invention encompasses the sequences of Exophiala as well as the sequences that have similarity of sequences with such sequences. It is recognized that the sequences of the invention can be used to isolate corresponding sequences in other organisms. Methods such as PCR, hybridization, and the like can be used to identify sequences having substantial sequence similarity to the sequences of the invention. See, for example, Sambrook, et al. , (1989) Molecular Cloning: A Labora tory Manual. (2d ed., Cold Spring Harbor Laboratory, Press Planview, New York) and Innis et al. , (1990) PCR Protocols: Guide to Methods and Applications (Academic Press, New York). Coding sequences isolated based on their sequence identity to the sequences encoding complete fumonisin degradation indicated herein or to fragments thereof are encompassed by the present invention. It is recognized that the sequences of the invention can ^^? ^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ i ^ ^ ¿gg ¿^ ¿Js ^^^^^. * k.J **** ^ *** ** • "Ab ^ t-j * fei be used to isolate similar sequences from other organisms that degrade fumonisin. In the same way, sequences of other organisms that degrade fumonisin can be used in combination with the sequences of the present invention. See, for example, the co-pending application entitled "Compositions and Methods for Fumonisin Detoxification" in the North American application serial number 60 / 092,953, filed concurrently therewith and incorporated herein by reference. Plasmids containing the polynucleotide sequences of the invention were deposited with the American Type Culture Collection (ATCC), Manassas, Virginia, and assigned access numbers 98812, 98813, 98814, 98815, 98816, and PTA-32. These deposits will be kept under the terms of the Budapest Teatry on the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure. These deposits were made merely as a convenience to those of skill in the art and are not an admission requiring a deposit under 35 U.S.C. § 112. Construction of Nucleic Acids The isolated nucleic acids of the present invention can be made using (a) standard recombinant methods, (b) synthetic techniques, or combinations thereof. In some embodiments, the polynucleotides of the present invention will be cloned, amplified or otherwise constructed from a fungus or bacterium. and you. l, -, i *. * í * - *** j.® **. * - jjtf? -J .. J- «.-« A * - ». »- *», »-. , £. ? t ?. - ^ * *., < to "S ^ J ^^ S ^^^^ J ^ S ^ Í ^! ^ S ^ Í ^ _ ^ Í_¡? _ ^^^ ^^ ^ The nucleic acids can conveniently comprise sequences in addition to a polynucleotide of the present invention. For example, a multicloning site comprising one or more endonuclease restriction sites can be inserted into the nucleic acid to aid in isolation of the polynucleotide. Also, translatable sequences can be inserted to assist in the isolation of the translated polynucleotide of the present invention. For example, a marker sequence of hexahistidine provides a convenient means for purifying the proteins of the present invention. The nucleic acid of the present invention excluding the polynucleotide sequence - is optionally a vector, adapter, or linker for cloning and / or expression of a polynucleotide of the present invention. Additional sequences can be added to such cloning and / or expression sequences to optimize their function in cloning and / or expression to aid in the isolation of the polynucleotide, or to improve the introduction of the polynucleotide into a cell. Typically, the length of a nucleic acid of the present invention minus the length of its polynucleotide of the present invention is less than 20 kilobase pairs, frequently less than 15 kb, and often less than 10 kb. The use of cloning vectors, expression vectors, adapters, and linkers is well known in the art. Examples of nucleic acids include vectors such as: M13, lambda ZAP Express, lambda ZAP II, lambda gtlO, lambda gtll, pBK-CMV pBK-RSV, pBluescript II, lambda DASH II, lambda EMBL 3, lambda EMBL 4, pWE15, SuperCos 1, SurfZap, Uni-ZAP, pBC, pBS + / -, pSG5, pBK, pCR-Script, pET, pSPUTk, p3'SS, pGEM, pSK + / -, pGEX, pSPORTI and II, Poprsvi CAT, p013 CAT, pXTl, pSG5, pPbac, pMbac, pMClneo, p0G44, pOG45 , pFRTßGAL, pNEOßGAL, pRS403, pRS404, pRS405, pRS406, pRS413, pRS414, pRS415, pRS416, lambda MOSSlox, and lambda MOSElox. Optional vectors for the present invention include but are not limited to lambda ZAP II and pGEX. For a description of various nucleic acids see, for example, Stratagene Cloning Systems, Catalogs 1995, 1996, 1997 (La Jolla, CA); and Amersham, Life Sciences, Inc., Catalog '97 (Ariington Heigsths, IL). Synthetic Methods for Constructing Nucleic Acids The isolated nucleic acids of the present invention can also be prepared by direct chemical synthesis by methods such as the phosphotriester method of Narang et al. , Meth Enzyrmol. 68: 90-99 (1979); the phosphodiester method Brown et al. , Meht Enzymol 68: 109-151 (1979); the diethylphosphoramidite method of Beaucage et al. , Tetra Let t. 22 (20) 1859-1862 (1981); the solid phase phosphoramidite triester method described by Beaucage and Caruthers, Tetra. Let ts. 22 (20): 1859-1862 (1981), for example, using an automated synthesizer, for example, as described in Needham-VanDevanter et al. , Nucleic Acids Res. , 12: 6159-6168 (1984); and, the solid support method of the North American Patent no. • 4,458,066. Chemical synthesis generally produces a single-stranded oligonucleotide. This can be converted to double-stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. Someone with experience will recognize that while chemical synthesis of DNA is limited to sequences of approximately 100 bases, longer sequences can be obtained by ligation of shorter sequences. UTRs and Codon Preference In general, translation efficiency has been found to be regulated by specific sequence elements in the 5 'uncoded or untranslated region (5 * UTR) of the RNA. The motifs of the positive sequence include translation initiation consensus sequences (Kozak, NucJ eic Acids Res. 15: 8125 (1987)) and cap structure 5 < G > 7 methyl GpppG RNA (Drummond et al., Of Nucleic Acids Res. 13: 7375 (1985)). Negative elements include stable intramolecular 5 'UTR loop-stem structures (Muesing et al., Cell 48: 691 (1987)) and AUG sequences or short open reading frames preceded by an appropriate AUG in the 5' UTR (Kozak , supra Rao et al., Mol and Cell Biol. 8: 284 (1988)). Accordingly, the present invention provides 5 'and / or 3' UTR regions for the modulation of the translation of heterologous coding sequences. Additionally, the segments encoding polypeptides of the polynucleotides of the present invention can be modified to alter codon usage. The use of altered codon can be employed to alter the translation efficiency and / or to optimize the coding sequence for expression in a desired host or to optimize codon usage in a heterologous sequence for expression in maize. The codon usage in the coding regions of the polynucleotides of the present invention can be analyzed statistically using commercially available software packages, such as "Codon Preference" available from the University of Wisconsin Genetics Computer Group (see Deveraux et al., Nucleic Acids Res. 12: 387-395 (1984)) or MacVector 4.1 (Eastman Kodak Co., New Haven, Conn.). Thus, the present invention provides a codon usage frequency characteristic of the coding region of at least one of the polynucleotides of the present invention. The number of polynucleotides (3 nucleotides per amino acid) that can be used to determine a codon usage frequency can be any integer from 3 up to the number of polynucleotides of the present invention as provided herein. Optionally, the polynucleotides will be full length sequences. An example of number of sequences for statistical analysis can be at least 1, 5, 10, 20, 50, or 100.

Sequence Redistribution The present invention provides methods for redistribution of sequences using polynucleotides of the present invention, and compositions resulting therefrom. The redistribution of sequences is described in PCT publication no. 96/19256. See also, Zhang, J.- H., et al. Proc. Na ti Acad Sci. USES . 94: 4504-4509 (1997) and Zhao, et al. , Na ture Biotech 16: 258-261 (1998). Generally, sequence redistribution provides a means to generate libraries of polynucleotides having a desired characteristic, which can be selected or chosen. The libraries of recombinant polynucleotides are generated from a population of related sequences of polynucleotides which comprise sequential regions, which have substantial sequence identity and can be recombined homologously in vi tro or in vivo. The population of recombined sequence polynucleotides comprises a subpopulation of polynucleotides which possess desired or advantageous characteristics and which can be selected by a suitable selection method of choice. The characteristics may be any property or attribute capable of being selected for or detected in a system of choice, and may include properties of: an encoded protein, a transcriptional element, a sequence that controls transcription, RNA processing, RNA stability, conformation of chromatin, translation, or other property »^ T- ^ -i - fc» j Ufa, > of expression of a gene or transgene, a replicative element, a protein binding element, or the like, such as any characteristic that confers a selectable or detectable property. In some embodiments, the selected feature 5 will be a Km and / or Kcat altered the native type protein as provided herein. In other embodiments, a protein or polynucleotide generated from the redistribution of sequences will have a larger binding affinity to the substrate than the native non-native polynucleotide. redistributed. In still other embodiments, a protein or polynucleotide generated from the redistribution of sequences will have an altered optimal pH compared to the non-redistributed native type polynucleotide. The increase in such properties may be at least 110%, 120%, 130%, 140% or greater than 150% of the value of native type. Recombinant Expression Cassettes The present invention additionally provides recombinant expression cassettes comprising a nucleic acid of the present invention. An acid sequence The nucleic acid encoding the desired polynucleotide of the present invention, for example a cDNA or a genomic sequence encoding a polypeptide long enough to encode an active protein of the present invention, can be used to construct a recombinant expression cassette on the Which can be introduced into the desired host cell. A ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ G ^^^^^^^^^ recombinant expression cassette will typically comprise a polynucleotide of the present invention operably linked to transcriptional initiation regulatory sequences which will direct transcription of the polynucleotide in the intended host cell, such as tissues of a transformed plant. For example, plant expression vectors can include (1) a cloned plant gene under the control of transcription of 5 'and 3' regulatory sequences and (2) a dominant selectable marker. Such plant expression vectors may also contain, if desired, a regulatory promoter region (eg, one that confers inducible or constitutive expression, environmentally or relative to develop-regulated, or cell-or specific / selective tissue), a site of initiation of transcription initiation, a ribosome binding site, an RNA processing signal, a transcription termination site, and / or a polyadenylation signal. A plant promoter fragment which will direct the expression of a polynucleotide of the present invention in all tissues of a regenerated plant can be employed. Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and cell development or differentiation states. Examples of constitutive promoters include the 1'- or 2'-promoter derived from T-DNA of • mmm ^ * ~ * ?. u * ^. Jmi.hfÉi.

Agroba cterium tumefaciens, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Patent No. 5,683,439), the Nos promoter, the rubisco promoter, the GRP1-8 promoter, the 35S promoter of the cauliflower mosaic virus (CaMV), as described in Odell et al, (1985), Na ture, 313: 810-812, rice actin (McElroy et al., (1990), Plant Cell, 163-171); ubiquitin (Christensen et al., (1992), Plant Mol. Biol. 12: 619-632; and Christensen, et al., (1992), Plan t Mol. Biol. 18: 675-689); pEMU (Last, et al., (1991), Theor, Appl. Genet, 81: 581-588); more (Velten et al., (1984), EMBO J. 3: 2723-2730); and histone H3 from corn (Lepetit et al., (1992), Mol Gen. Genet 231: 276-285, and Atanassvoa et al., (1992), Plan t Journal 2 (3): 291-300), ALS promoter, as described in published PCT application WO 96/30530, and other transcription initiation regions of various plant genes known to those of experience. For the present invention, ubiquitin is the preferred promoter for expression in monocotyledonous plants. Alternatively, the plant promoter may direct the expression of a polynucleotide of the present invention in a specific tissue or may be otherwise under more precise environmental or developmental control. Such promoters are referred to herein as "inducible" promoters. Environmental conditions that can effect transcription by inducible promoters include pathogen attack, ^^^^ É ^^^^^^^^^^^^^^^^^^^^ W ^^^^^^^^^^^^^ a ^^ g ^ t? ^^^ s ^^^^^^^^^^^^^^ j ^^^^^^^^^^^ anaerobic conditions, or the presence of light. Examples of inducible promoters are the Adhl promoter, which is inducible by hypoxia or cold stress, the Hsp70 promoter, which is inducible by heat stress, and the PPDK promoter, which is inducible by light. Examples of promoters under development control include promoters that initiate transcription only, or preferably, in certain tissues such as leaves, roots, fruits, seeds, or flowers. The operation of a promoter also may vary depending on its location in the genome. Thus, an inducible promoter can become fully or partially constitutive in certain locations. If expression of the polypeptide is desired, it is generally desirable to include a polyladenylation region in the 3 'end of a region encoding polynucleotides. The polyadenylation region can be derived from a variety of plant genes, or from T-DNA. The 3 'end sequence to be added may be derived from, for example, the nopalinsynthase or octopinsynthase genes, or alternatively from other plant genes, or less preferably from any other eukaryotic gene. Examples of such regulatory elements include, but are not limited to, 3 'termination and / or polyadenylation regions such as those of the Agrobacterium tumefaciens nopalinsintasa (nos) gene (Bevan et al., (1983), Nucí.

Acids Res 12: 369-385); the potato proteinase inhibitor gene ^^ a ^^^^^^^^^^^^^^^^^^^^^^^^^^^^ a ^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^ i ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ II (PINII) (Keil, et al., (1986), Nucí Acids Res. 14: 5641-5650; and An et al., (1989), Plant Cell 1: 115-122); and the CaMV 19S gene (Mogen et al., (1990), Plant Cell 2: 1261-1272). An intron sequence can be added to the 5 'untranslated region or the coding sequence of the partial coding sequence to increase the amount of mature message that accumulates in the cytosol. The inclusion of a spliced intron in the transcription unit in plant and animal expression constructs has been shown to increase gene expression at mRNA and protein levels up to 1000-fold. Buchman and Berg, Mol. Cell Biol. 8: 4395-4405 (1988); Callis et al. , Genes Dev. 1: 1183-1200 (1987). Such intron improvement of gene expression is typically greatest when placed near the 5 'end of the transcription unit. The use of intron corn introns Adhl-S 1, 2, and 6, the intron Bronze-1 are known in the art. See generally, The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, New York (1994). Plant signal sequences, including, but not limited to, DNA / RNA sequences encoding the signal peptide whose target proteins are in the extracellular matrix of the plant cell (Dratewka-Kos, et al., (1989), J. Biol. Chem 264: 4896-4900), the extension gene of Nicotiana plumbagini folia (DeLoose, et al., (1991), Gene 99: 95-100), signal peptides that select proteins to the vacuole as ^^ > ^ j ^^^ £ ^^^^ t ^ the sweet potato sporamin gene [fíatsuka, et al., (1991), PNAS 88: 834) and the barley lectin gene (Wilkins et al., (1990) , Plant Cell, 2: 301-313), signal peptides that cause proteins such as that of PRIb to be secreted (Lind, et al., (1992), Plant Mol. Biol. 18: 47-53), or barley alpha amylase (BAA) (Rahmatullah, et al., Plant Mol Biol. 12: 119 (1989)) and hereby incorporated by reference), or of the present invention, the signal peptide of the ESP1 or BEST1 gene , or signal peptide that select proteins from plastids such as that of linase enoyl-Acp reductase (Verwaert, et al., (1994), plan t Mol. Biol. 26: 189-202) are useful in the invention. The barley alpha-anilase signal sequence fused to the trAPAO or APAO polynucleotide (see SEQ ID NO: 20) is the preferred construct for expression in corn for the present invention. The vector comprising the sequences of a polynucleotide of the present invention will typically comprise a marker gene, which confers a selectable phenotype on plant cells. Typically, the selectable marker gene will encode resistance to antibiotics, with suitable genes including genes that encode resistance to the antibiotic spectinomycin (eg, the aadase gene), the streptomycin phosphotransferase (SPT) gene that encodes streptomycin resistance, the neomycin gene phosphotransferase (NPTII) that codes for resistance to kanamycin or geneticin, the hygromycin phosphotransferase (HPT) gene that codes for hygromycin resistance, genes that code for resistance to herbicides which act to inhibit the action of acetolactate synthase (ALS), in particular sulfonylurea type herbicides (for example the acetolactate synthase gene (ALS) containing mutations that lead to such resistance, in particular the S4 and / or Hra mutations), genes that code for resistance to herbicides that act to inhibit the action of glutamin synthase, such as phosphinothricin or coarse (for example, the bar gene), or other such genes known in The technique. The bar gene codes for resistance to the coarse herbicide, and the ALS gene codes for resistance to the herbicide chlorosulfuron. Alternatively, the invention, itself, could be used as a method for the selection of transformants, in other words as a selectable marker. An APAO or trAPAO polynucleotide operably linked to a promoter and then transformed into a plant cell by any of the methods described in the present invention would express the degradative enzyme. When the plant cells are placed in the presence of fumonisin, API, or a phytotoxic analog in cultures only the transformed cells would be able to grow. In another embodiment, the plant cells could be transformed with a polynucleotide for APAO and a polynucleotide for fumonisin esterase. The agent selective in this case could s§ £ either API or fumonisin or any structural analog. Thus, the growth of plant cells in the presence of a mycotoxin favors the survival of plant cells that have been transformed to express the coding sequence that codes for one of the enzymes of this invention and degrades the toxin. When the APAO or trAPAO cassette with or without the fumonisin esterase polynucleotide is cotransformed with another gene of interest and then placed in the presence of fumonisin, API or a The phytotoxic analogue of this invention would allow the selection of only those plant cells containing the gene of interest. In the past, antibiotic resistance genes have been used as selectable markers. Given the current concerns of consumers and environmentalists On the use of antibiotic genes and the possibility of the emergence of resistant microorganisms due to this use, a non-antibiotic resistant selectable marker system such as the present invention satisfies this very important need. Typical vectors useful for the expression of genes in higher plants are well known in the art and include vectors derived from the tumor-inducing plasmid (Ti) of Agrobacterium tumefaciens described by Rogers et al. , Meth. In Enzymol., 153: 253-277 (1987). These vectors are vectors of plant integration in which in the transformation, vectors they integrate a portion of the DNA vector within the genome of the host plant. Examples of vectors of A. tumefaciens useful herein are the plasmids of pKYLX6 and pKYLX7 of Schardl et al. , Gene, 61: 1-11 (1987) and Berget et al. , Proc. Nati Acad. Sci. U.S.A., 86: 8402-8406 (1989). Another useful vector herein is plasmid pB1101.2 which is available from CLONTECH Laboratories, Inc. (Palo Alto, CA). Expression of Proteins in Host Cells Using the nucleic acids of the present invention, one can express a protein of the present invention in a recombinantly designed cell such as bacteria, yeast, insect, mammalian, or preferably plant cells. The cells produce the protein in a non-natural condition (for example, in quantity, composition, location, and / or time), because they have been genetically altered through human intervention to do so. Those of skill in the art are expected to be cognizant of the numerous expression systems available for the expression of a nucleic acid encoding a protein of the present invention. No attempt will be made to describe in detail the various known methods for the expression of proteins in prokaryotes or eukaryotic In brief summary, the expression of isolated nucleic acids encoding a protein of the present invention will typically be obtained by operably linking, for example, the DNA ...? .- l ii. or cDNA to a promoter (which is either constitutive or inducible), followed by incorporation into an expression vector. The vectors may be suitable for replication and integration into prokaryotids or eukaryotic. The typical 5 expression vectors contain transcription and translation terminators, initiation sequences, and promoters useful for the regulation of the expression of the DNA encoding a protein of the present invention. To obtain high level of expression of a cloned gene, it is desirable construct expression vectors containing, at a minimum, a strong promoter, such as ubiquitin, to direct transcription, a ribosome binding site for translation initiation, and a transcription / translation terminator. Constitutive promoters are classified as providing a range of constitutive expression. Thus, some are weak constitutive promoters, and others are strong constitutive promoters. Generally, by "weak promoter" a promoter that drives the expression of a coding sequence at a low level is attempted. By "low level" one tries to levels of approximately 1 / 10,000 copies up to approximately 1 / 100,000 copies up to approximately 1 / 500,000 copies. Reciprocally, a "strong promoter" drives the expression of a "high level" coding sequence, or approximately 1/10 copies up to approximately 1/100 copies up to approximately 1 / 1,000 copies.

One of experience will recognize that modifications can be made to a protein of the present invention without diminishing its biological activity. Some modifications can be made to facilitate the cloning, expression, or incorporation of the target molecule into a fusion protein. Such modifications are well known to those skilled in the art, include, for example, a methionine added at the amino terminus to provide an initiation site, or additional amino acids (eg, poly His) placed in each term to create restriction sites located conveniently or termination codons or purification sequences. TO . Expression in Probing beats Prokaryotic cells can be used as hosts for expression. Prokaryotids are more frequently represented by various strains of E. coli; however, other microbial strains can also be used. Commonly used prokaryotic control sequences, which are defined herein to include promoters for the initiation of transcription, optionally with an operator, together with the ribosome binding site sequences, include such commonly used promoters, such as beta promoter systems lactamase (penicillinase) and lactose (lac) (Chang et al., Nature 198: 1056 (1977)), the tryptophan (trp) promoter system (Goeddel et al., Nucleic Acids Res. 8: 4057 (1980)) and the PL promoter lambda derivative and the ribosome binding site N-gene (Shimatake et al., Nature 292: 128 (1981)). The inclusion of selection markers in transfected DNA vectors in E. Col i is also useful. Examples of such labels include genes that specify resistance to ampicillin, tetracycline, or chloramphenicol. The vector is selected to allow introduction of the gene of interest into the appropriate host cell. Bacterial vectors are typically of plasmid or phage origin. Appropriate bacterial cells are infected with phage vector particles or transfected with the naked phage vector of DNA. If a plasmid vector is used, the bacterial cells are transfected with a plasmid DNA vector. Expression systems for expressing a protein of the present invention are available using Bacillus sp. and Salmonella (Palva et al., Gene 22: 229-235 (1983); Mosbach, et al., Na ture 302: 543-545 (1983)). The pGEX-4T-1 plasmid vector from Pharmacia is the expression vector E. preferred coli for the present invention. B. Expression in Eukaryotic A variety of eukaryotic expression systems such as yeast cells, insect cell lines, plants and mammals are known to those skilled in the art. As briefly explained in the following, the present invention can be expressed in these systems eukaryotic In some embodiments, the transformed / transfected plant cells, as discussed infra, are employed as expression systems for the production of the proteins of the current invention. The synthesis of heterologous proteins in yeast is well known. Sherman, F., et al. , Methods in Yeas t Genetics, Cold Spring Harbor Laboratory (1982) is a well-recognized work that describes the various methods available to produce the protein in yeast. Two yeasts widely used for the production of eukaryotic proteins are Saccharomyces cerevisiae and Pichia pastoris. Vectors, strains and protocols for expression in Saccharomyces pichia are known in the art and available from commercial suppliers (eg, Invitrogen). Suitable vectors usually have expression control sequences, such as promoters, including 3-phosphoglycerate kinase or alcohol oxidase, and an origin of replication, termination sequences and the like as desired. A protein of the present invention, once expressed, can be isolated from yeast by lysing the cells and applying standard protein isolation techniques to lysates or granules. Monitoring of purification processes can be achieved using Western staining or radioimmunoassay techniques or other standard immunoassay techniques. The sequences encoding the proteins of the present invention can also be ligated to various expression vectors for use in transfecting cell cultures of, for example, mammalian, insect, or plant origin. Mammalian cell systems will often be in the form of monolayers of cells although suspensions of mammalian cells can also be used. A number of suitable host cell lines capable of expressing intact proteins have been developed in the art and include HEK293, BHK21, and CHO cell lines. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter (e.g., the CMV promoter, a tk HSV promoter or a pgk (phosphoglycerate kinase) promoter), an enhancer (Queen et al., Immunol Rev. 89:49 (1986)), and the necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites (eg, a T-addition site. Ag poly A SV40), and transcriptional terminator sequences. Other animal cells useful for the production of proteins of the present invention are available, for example, from the American Type Culture Collection Catalog of Cell Lines and Hybridomas (7th edition, 1992). Suitable vectors for expressing the proteins of the present invention in insect cells are usually derived from the SF9 baculovirus. Suitable insect cell lines include larval cell lines of > :? .-, tea 4 * a ** & mosquito, silkworm, worm worm, moth and Drosophila lines such as a Schneider cell line (See Schneider, J. Embryol, Exp Morphol 27: 353-365 (1987).) As with yeast, when cells are used In the case of plant or higher animal hosts, polyadenylation sequences or transcription terminator sequences are typically incorporated within the vector.An example of a terminator sequence is the polyadenylation sequence of the bovine growth hormone gene. of the copy can also be included.An example of a splicing sequence is the intron VP1 of SV40 (Sprague, et al., J. Virol. 45: 773-781 (1983)).

Additionally, gene sequences for controlling replication in the host cell can be incorporated into the vector such as those found in bovine papilloma virus type vectors. Saveria-Campo, M., Bobine Papilloma Virus DNA to Eukaryotic Cloning Vector in DNA Cloning Vol. II a Practical Approach, D.M. Glover, Ed, IRL Press, Ariington, Virginia pp. 213-238 (1985). In addition, one of the genes for fumonisin esterase or APAO or trAPAO placed in the appropriate plant expression vector can be used to transform the plant cells. The enzyme can then be isolated from plant callus or the transformed cells can be used to regenerate transgenic plants. Such transgenic plants can be harvested, and ^ ii ^ ai ^^^ i ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^ _ ^^ - ^ __ g ^^^^ g ^^^ - ^ appropriate tissues (seed or leaves, for example) can undergo large-scale protein extraction and purification techniques, and enzymes from Fumonisin or APAO degradation can be isolated for use in detoxification processes of the fumonisin hydrolysis product. Methods of Plant Transformation Numerous methods for introducing foreign genes into plants are known and can be used to insert an APAO or trAPAO polynucleotide into a plant host, including biological and physical plant transformation protocols. See, for example Miki et al., (1993), "Procedure for Introducing Foreing DNA into Plants," In: Methods in Plan t Molecular Biology and Biotechnology, Glik and Thompson, eds., CRC Press, Inc., Boca Raton, pages 67-88., The methods chosen vary with the host plant, and include chemical transfection methods such as calcium phosphate, gene transfer mediated by microorganisms such as Agrobacterium (Horsch, et al., (1985), Science 227: 1229-1231), electroporation, micro-injection, and biolistic bombardment. Expression cassettes and vectors are known and available and in in vitro culture methods for plant cells or tissue transformation and plant regeneration. See, for example, Gruber, et al., (1993), "Vectors for Plant Transformation" In: Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds. CRC Press, ^ g ^^ to ^^^^^^ w ^^^? »^?. * ^^^^^^^^^^^^^ > __e __ ^ - ^^ j ^. ^ ._ ^ -_ ^^^ g ^^ j? ^^ 5i3 ^^^^^^ ^^^^^^^^^^^^^^^^^ U- ™ / Inc., Boca Ratón, 89-119. Agrobacterium-mediated transformation The most widely used method to introduce an expression vector into plants is based on the natural transformation system of Agrobacterium. A. t umefa ciens and A. rhizogenes are pathogenic soil bacteria of plants, which genetically transform plant cells. The Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for the genetic transformation of plants. See, for example Kado, (1991), Crit. Rev. Plant Sci. 10: 1 Descriptions of Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are provided in Gruber et al., Supra; Miki, et al., Supra; and Moloney et al., (1989), Plant Cell Reports 8: 238. Similarly, the gene can be inserted into the T-DNA region of a Ti or Ri plasmid derived from A. tumefaciens or A. rhizogenes, respectively. Thus, the expression cassettes can be constructed as in the above, using these plasmids. Many control sequences are known which when coupled to a heterologous coding sequence and transformed into a host organism show fidelity in the expression of the gene with respect to the tissue / organ specificity of the original coding sequence. See, for example, Benfey, P. N., and Chua, N., H.

AJUÍ, i feato-- ». - «.-I .. *.» »*. *, - > . *. J »i ... -t ^ .í ^ z ~. * TaktHi ??» &? J ?? ».» *. - » »-. ~ »I. - £ a t &? -B8W-W-H- (1989) Science 244: 174-181. Particularly suitable control sequences for use in these plasmids are promoters for the specific expression of the constitutive leaf of the gene in the various target plants. Other useful control sequences include a promoter and a terminator of the nopalin synthase (NOS) gene. The NOS promoter and terminator are present in the plasmid pARC2, available from the American Type Culture Collection and designated ATCC 67238. If such a system is used, the virulence gene (vir) of the Ti or Ri plasmid must also be present, together with the T-DNA, or by means of a binary system in which the vir gene is present in a separate vector. Such systems, vectors for use therein, and methods for transforming plant cells are described in US Patent no. 4,658,082; North American application no. of Series 913,914, filed October 1, 1986, as referenced in U.S. Patent 5,262,306, issued November 16, 1993 to Robeson, et al .; and Simpson, R. B., et al. (1986) Plant Mol. Biol. 6: 403-415 (also referred to in the '306 patent); all incorporated for reference in their entirety. Once constructed, these plasmids can be placed inside A. rhizogenes or A. tumefaciens and these vectors can be used to transform cells of plant species, which are ordinarily susceptible to Fusarium or Al ternarla infection. Various transgenic plants are also . ~ ! ~. * ?? á *, t Here., * J ... contemplated by the present invention which include but are not limited to soy, corn, sorghum, alfalfa, rice, clover, cabbage, banana, coffee, celery, tobacco, chickpea, cotton, melon and pepper. The selection of A. tumefaciens or A. rhizogenes will depend on the vegetable transformed with it. In general A. tumefaciens is the preferred organism for transformation. Most dicotyledonous plants, some gymnosperms, and some monocotyledonous plants (for example certain members of Liliales and Árales) are susceptible to infection with A. tumefaciens. or A. rhizogenes also have a wide range of hosts, which encompass most of the dicots and some gymnosperms, which includes members of Leguminosae, Compositae, and Chenopodiaceae. The monocotyledonous plants can now be transformed with some success. Publication of European Patent Application no. 604 662 Al for Hiei et al. describes a method for transforming monocotyledons using Agrobacterium. Saito et al. describes a method for transforming monocotyledons with Agrobacterium using the scutellum of immature embryos (European Application 672 752 Al). Ishida et al. discusses a method to transform corn by exposing immature embryos to A. tumefaci ens (Ishida et al., Na ture Biotechnology, 1996, 14: 745-750). Once transformed, these cells can be used to regenerate transgenic plants, capable of degrading fumonisin. For example, whole plants can become infected l? &? ltti? i? i ***, ».« ¿»» -? fc- - A., - < * * -. . * i * &M. IAJ-S r - £ * - > * »R * *». «-. , »- > ^ .fa «» Ja J «fcfetjl '> - > with these vectors wounding the plant or then introducing the vector into the wound site. Any part of the plant can be injured, including leaves, stems and roots. Alternatively, plant tissue, in the form of an explant, such as cotyledonary tissue of leaf discs can be inoculated with these vectors, and cultured under conditions, which promote plant regeneration. Roots or shoots transformed by inoculation of plant tissue with A. rhizogenes or A. tumefaciens, containing the gene that codes for the fumonisin degradation enzyme, can be used as a source of plant tissue to regenerate transgenic plants resistant to fumonisin, either by somatic embryogenesis or organogenesis. Examples of such methods for regenerating plant tissue are described in Shahm, E.A. (1985) Theor. Appl. Genet 69: 235-240; US Patent no. 4,658,082; Simpson, R. B., et al. (1986) Plant Mol. Biol. 6: 403415; and the North American patent applications no. of Series 913,913 and 913,914, both filed October 1, 1986, as referenced in U.S. Patent 5,262,306, issued November 16, 1993 to Robeson, et al .; the full descriptions therein incorporated herein by reference. Direct Gene Transfer Despite the fact that the host range for Agrobacterium-mediated transformation is wide, some major varieties of crop cereal and gymnosperms have generally been recalcitrant to this mode of gene transfer, even though some success has been achieved. recently achieved in rice (Hiei et al., (1994), The Plant Journal 6: 271-282). Various methods of plant transformation, collectively referred to as direct gene transfer, have been developed as an alternative for Agrobacterium-mediated transformation. A generally applicable method of plant transformation is the microprojectile-mediated transformation, wherein the DNA is carried on the surface of microprojectiles that measure approximately 1 to 4 μm. The expression vector is introduced into plant tissues with a biolistic device that: accelerates the microprojectiles at speeds of 300 to 600 m / s which is sufficient to penetrate the walls and membranes of the plant cell. (Sanford et al., (1987), Part Sci. Technol. 5:27, Sanford, 1988, Trends Biotech 6: 299, Sanford, (1990), Physiol. Plant 79: 206, Klein et al., (1992). ), Biotechnology 10: 268). Another method for the physical delivery of DNA to plants is the sonication of target cells as described in Zang et al., (1991), BioTechnology 9: 996. Alternatively, liposome or spheroplast fusions have been used to introduce expression vectors into vegetables. See, for example Deshayes et al., (1985), EMBO J. 4: 2731; and Christou et al., (1987), PNAS USA 84: 3962. Direct uptake of DNA into protoplasts has also been reported using precipitation with CaCl2, polyvinyl alcohol, or poly-L-ornithine. See, for example, Hain et al., (1985), Mol. Gen Genet 199: 161; and Draper et al., (1982), Plant Cell Phisiol. 23: 451. The electroporation of protoplasts and whole cells and tissues has also been described. See, for example, Donn et al., (1990), In: Abstracts of the Vllth In t 'l. Congress on Plan ts Cell and Tissue Cul ture IAPTC, A2-38, page 53; D'Halluin et al., (1992), Plant Cell 4: 1495-1505; and Spencer et al., (1994), Plant Mol. Biol. 24:51 -61. Thus, a polynucleotide that encodes a polypeptide capable of inactivating fumonisin or API can be isolated and cloned into an appropriate vector and inserted into an organism normally sensitive to Fusarium or its toxins. In addition, the polynucleotide imparting fumonisin degrading activity or API can be transferred into a suitable plasmid, and transformed into a plant. Thus, a transgenic plant that degrades fumonisin or API can be produced. Organisms expressing the polynucleotide can be easily identified by their ability to degrade fumonisin or API. The protein capable of degrading fumonisin or API can be isolated and characterized using techniques well known in the art. t? ?? ju ta * a i? £ .- < - * fia? Ban- -, •. », ^, < l < u * - »» «_ H.» < u »J < l-? μ ', a & »» »-.lú. to. ** -. »-« & _ »-» * &- »i¡A ** APAO or trAPAO in a Transgenic Plant Fumonisin esterase reduces but does not eliminate the toxicity of fumonisin. Therefore a second enzymatic modification to further reduce or abolish toxicity is desirable. The partially purified APAO enzyme from Exophiala spinifera has little or no activity in intact FBI, a form of fumonisin. However, the recombinant APAO enzyme from Exophiala spinifera, expressed in E. coli, has significant but reduced activity in intact FBI and other fumonisins series B. APAO or trAPAO could thus potentially be used without fumonisin esterase since the amino group is the main target of detoxification. Alternatively, the two genes, fumonisin esterase and APAO (or trAPAO) can be used together to degrade toxins. It is predicted that APAO is an enzyme that, when by itself or co-expressed in a heterologous expression system together with fumonisin esterase (either ESP1 or BEST1), will result in the production of 2-oxo penteol (2-OP) from fumonisin Bl. The substrate range of APAO expressed in E. Lecombinant coli is limited to fumonisins and their hydrolysis products and does not include amino acids, sphingolipid precursors such as phytosphingosine, or polyamines such as spermidine. Thus, APAO is highly specific for amines similar to fumonisin, and thus would have little detrimental effect on other cellular metabolites. In addition, if it is located extracellularly, it will limit - & & * - Ssc Sto. e) Any contact with biologically important amines that could also be substrates. The final result will be a more effective detoxification of fumonisin than can be achieved with esterase alone. The oxidase activity of APAO is predicted to result in the generation of hydrogen peroxide in stoichiometric amounts relative to API or oxidized fumonisin. This may prove to be an additional benefit of this enzyme, since hydrogen peroxide is antimicrobial and is thought to contribute to the emergence of a defense response in plants (Przemylaw, Biochem J., 322: 681-692 (1997), Lamb, et al. , Ann Rev Plant Physiol Plant Mol Bio 48: 251-275 (1997), and Alverez, et al. , Oxida tive Stress and the Molecular Biology of Antioxidant Defenses, Cold Spring Harbor Press, 815-839 (1997)). Since one of the embodiments of the present invention is to have a polynucleotide fumonisin esterase and an APAO or trAPAO polynucleotide present in a plant, there are various ways to introduce more than one polynucleotide into a plant. One way is to transform plant tissue with the polynucleotides for fumonisin esterase and APAO or trAPAO at the same time. In some tissue culture systems it is possible to transform the callus with a polynucleotide and then establish a stable culture line containing the first polynucleotide, transform the callus a second time with the second polynucleotide. One can also transform plant tissue with a polynucleotide, regenerate whole plants, then transform the second polynucleotide into a plant tissue and regenerate whole plants. The final step would then be to cross a plant containing the first polynucleotide with a plant containing the second polynucleotide and select the progeny containing both polynucleotides. Another method is to create a fusion protein between esterase and APAO or trAPAO, preferably with a spacer region between the two polypeptides. Both enzymes would be active although locked together. In addition, an enzymatic cleavage site designed in the spacer region would allow cleavage by an endogenous or introduced protease. Transgenic plants containing a fumonisin esterase enzyme and / or the APAO enzyme and thus capable of degrading fumonisin or a structurally related mycotoxin would be able to reduce or eliminate the pathogenicity of any microorganism using fumonisin or a structurally related mycotoxin as a mode of entry to infect a plant. Pathogenic fungi often use toxins to damage plants and weaken cell integrity to gain entry and spread infection in a plant. By preventing the damage induced by a toxin, a plant would be able to prevent the establishment of the pathogen and thereby become tolerant or resistant to the pathogen. Another benefit of fumonisin degradation is the production of hydrogen peroxide. When fumonisin breaks down to 2-OP, hydrogen peroxide is produced as a by-product. The production of hydrogen peroxide can trigger improved resistance responses in a number of ways. 1) Hydrogen peroxide has direct antimicrobial activity. 2) Hydrogen peroxide acts as a substrate for peroxidases associated with the polymerization of lignin and consequently the strengthening of the cell wall. 3) By means of mechanisms that are still to be determined, hydrogen peroxide acts as a signal for the activation of the expression of genes related to defense, which include those that result in the stimulation of the accumulation of salicylic acid. It is thought that salicylic acid acts as an endogenous signal molecule that triggers the expression of genes that encode various kinds of protein related to pathogenesis. In addition, the acid The salicylic acid can start the oxidative burst and thus act in a feedback loop improving its own synthesis. Salicylic acid may also be involved in hypersensitive cell death acting as a catalase inhibitor, an enzyme that removes hydrogen peroxide. 4) Hydrogen peroxide can trigger the production of a ^^ ß ^^^^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^^^^^^^^ - ^^^^^ - ^ _ ^ ---- ^^^^ ß- ^ ¡^ - - ^ - ^ - ^ - ^ - i - ^ -! - ^ - ^ - ^ - ^ - ^ - ^ - ^ - ^ - ^ - ^ - ^ - ^ - ^ - ^ additional defense compounds such as phytoalexins, low molecular weight antimicrobial compounds. For a review of the role of oxidative burst and salicylic acid please see Lamb, C. and Dixon, RA, Ann. Rev. Plant Phisiol. Plan t Mol. Biol. , 48: 251-275 (1997). Detoxification of Cropped Grain, Silage or Contaminated Food Cultivation The present invention also relates to a method for detoxifying a fumonisin or a mycotoxin structurally related to an APAO enzyme by Exophilia spinifera, ATCC 74269) during the processing of the grain for animal consumption or food. human, during the processing of plant material for ensila or food crops contaminated with a toxin-producing microbe, such as but not limited to, tomato. Since the atmospheric ammonia of corn has proven to be an ineffective method of detoxification (see B. Fitch Haumann, INFORM 6: 248-257 (1995)), such methodology during processing is particularly critical when transgenic detoxification is not applicable. In one embodiment of the present invention, the enzymes that degrade fumonisin are presented to the grain, plant material for silage, or a contaminated food culture or during the processing process, in appropriate process steps and in effective amounts for the detoxification of fumonisin. and structurally related mycotoxins. Detoxification by enzymes, microbial strains, or a designed microorganism can occur not only during the processing of, but also at any time before or during the feeding of the grain or plant materials to an animal or incorporation of the grain or food crop into a human food product, or before or during the ingestion of the food crop LCÍO. Another embodiment of the present invention is the design of a bacterium or fungus to express the detoxification enzymes and then use the bacteria or fungus more than the enzyme itself. There are a number of microbes that could be designed to express the polynucleotides of the present invention. Some could also activate, either inducibly or constitutively, the endogenous genes for fumonisin esterase or APAO of Exophilia. By overexpressing the degradative anzimas and then treating the plants, seeds or silage with the mocroorganismo, it would be possible to degrade the fumonisina in si tu. The polynucleotides of the invention can be introduced into microorganisms that are mutilated on plants (epiphytes) to deliver the enzymes to the potential target cultures. The epiphytes can be gram positive or gram negative bacteria, for example. Microorganisms that have been genetically altered to contain at least one degradative polynucleotide and the resulting polypeptide can be used to protect crops and agricultural products. In an aspect of the inventionwhole, ie unused, cells of the transformed organism are treated with reagents that prolong the activity of the enzyme produced in the cell when the cell is applied to the environment of a target plant. A secretion leader can be used in combination with the gene of interest such that the resulting enzyme is secreted out of the host cell for presentation to the target plant. The degradative enzymes can be fermented in a bacterial host and the resulting bacteria processed and used as a microbial sprinkler. Any suitable microorganism can be used for this purpose. See, for example Gaertner, et al. (1993) in Advance Engineered Pests, (ed. Kim, Marcel Dekker, New York). Enzymes or microorganisms can be introduced during processing in appropriate forms, for example as a wash or spray, or in dry or lyophilized form or in powder form, depending on the nature of the milling process and / or the processing step in the which is carried out the enzymatic treatment. See, generally Hoseney, R.C., Principles of Cereal Science and Technology, American Assn. of Cereal Chemists, Inc., 1990 (especially Chapters 5, 6 and 7); Jones, J.M., Food Safety, Eagan Press, St. Paul, MN, 1992 (especially Chapters 7 and 9); and Jelen, P., Introduction to Food Processing, Restan Publ. Co., Reston, VA, 1985. Processed grain or silage can be used for animal feed, it can be treated with an effective amount of the enzymes in the form of an inoculant or probiotic additive, for example, or in any form recognized by those experts in the art for use in animal feed. The enzymes of the present invention are expected to be particularly useful in detoxification during processing and / or in animal feed before use, since the enzymes exhibit a relatively wide range of pH activity. The esterase of Exophiala spinifera, ATCC 74269, shows a range of activity from about pH 3 to about pH 6, and the esterase of the ATCC 55552 bacterium shows a range of activity from about pH 6 to about pH 9 (US Patent no. 5,716,820, supra). The APAO enzyme from Exophiala spinifera (ATCC 74269) has a pH range of activity from pH 6 to pH 9. Genetic Design of Ruminant Microorganisms Ruminant microorganisms can be genetically engineered to contain and express either the fumonisin esterase or APAO enzymes isolated from Exophiala spinifera, ATCC 74269, or a combination of enzymes. Genetic engineering of microorganisms is now a recognized technique, and the ruminant microorganisms thus designed can be added to the food in any form of recognized technique, for example, as a probiotic or inoculant. In addition, microorganisms capable of functioning as bioreactors can be designed to be capable of producing mass either fumonisin esterase or the APAO enzyme found in Exophiala spinifera, ATCC 74269. Use of Fumonisin Esterase and APAO Enzymes for the Detection of Reagents for Fumonisins and Related Compounds Another embodiment of the present invention is the use of the enzymes of the present invention as detection reagents for Fumonisins and related compounds. The enzymes of the present invention can be used as detection reagents due to the high specificity of the enzymes esterase and deaminase, and the fact that the hydrolysis followed by the oxidation of amine can be monitored by the detection of hydrogen peroxide or ammonia using reagents standard (analogous to a glucose detection test using glucose oxidase). Hydrogen peroxide is often measured by linking a hydrogen peroxide-dependent peroxidase reaction to a colored or otherwise detectable peroxidase product (eg Demmano, et al., European Journal of Biochemistry 238 (3): 785-789). (nineteen ninety six)). Ammonia can be measured using ion-specific electrodes: Fritsche, et al. , Analytica Chimica Acta 244 (2): 179-182 (1991); West, et al. , Analytica Chemistry 64 (5): 533-540 (1992), and all incorporated herein by reference) or by GC or other method < . ~ * & *. ? *? * 4 > . t * ¿í ** & chromatographic For example, the recombinant or non-recombinant fumonisinesterase (SP1 or BEST) and APAO proteins are added in catalytic amounts to a sample tube containing an unknown amount of fumonisins (FBI, FB2, FB3, FB4, or partial hydrolysis products). complete of them). The tube is incubated under conditions of pH and temperatures sufficient to convert any fumonisin in the sample to API, and correspondingly the API to 2-OP, ammonia, and 0 hydrogen peroxide. Then add suitable reagents for the quantification of hydrogen peroxide or ammonia that were generated stoichiometrically from the fumonisins. Compared to control tubes that did not receive esterase or APAO enzyme, the amount of fumonisin present can be calculated in direct molar ratio to hydrogen peroxide or ammonia detected, relative to a standard curve. This invention can be better understood with reference to the following non-limiting examples. It will be appreciated by those skilled in the art that other embodiments of the invention may be practiced without departing from the spirit and scope of the invention as described and claimed herein. Example 1 5 Isolated from fungi and bacteria. Isolated from IIÉMÜ ^ ^ i ^^. 'L¿ - ^ -.- Í | Í ^ - ^^ - j = ^^^^^ - ^^ - ^ - ^ - ^ --- ^ - ^ ------ ^^^^^^^^^ ^ ^ ^ ^ ^^^^^^^ '* "^ - * -» Exophiala corn were isolated as described in US Pat. No. 5,716,820 issued on February 10, 1998 and pending US applications No. 08 / 888,950 and 08 / 888,949, both filed on July 7, 1997, and incorporated in the submission for reference: Isolation methods: Direct isolation of black yeasts from seeds succeeded in sowing 100 microliters of seed washing fluid on YPD agar or Sabouraud augmented with cycloheximide (500 mg / liter) and chloramphenicol (50 mg / liter) Plates were incubated at room temperature for 7-14 days and colonies were counted individual pigments were cultured for analysis of fumonisin degradation capacity as described in US Pat. No. 5,716,820 issued February 10, 1998, and US applications pending Nos. 08 / 888,950 and 08 / 888,949, Mba presented on July 7, 1997. Analysis of fumonisins and metabolism products. Analytical thin-layer chromatography was performed on 100% silanized silica C18 plates (Sigma # T-7020, 10 x 10 cm, 0.1 mm thickness) by a modification of the published Rottinghaus method (Rottinghaus et al., J Vet Diagn Invest, 4: 326 (1992), and incorporated herein by reference). To analyze the activity of fumonisin esterase, sample lines were pre-moistened with methanol to facilitate the application of the sample. After the application of 0.1 to 2 μl of aqueous sample, the plates were air-dried and developed in MeOH: 4% KCl (3: 2) or MeOH: 0.2 M KOH (3: 2) and then sprayed successively with 0.1 M sodium borate (pH 9.5) and fluorescamine (0.4 mg / ml in acetonitrile). The plates were air dried and observed under long wave UV. For analysis of the APAO activity, an alternative method was used. Equal volumes of sample and 14 C-AP1 (1 mg / ml, pH 8, 50 mM sodium phosphate) were incubated at room temperature for one to six days. Analytical thin layer chromatography was carried out on C60 HPK silica gel plates (Whatman # 4807-700, 10 x 10 cm, 0.2 mm thick). After application of 0.1 to 2 (1 of aqueous sample, the plates were air-dried and developed in CHC13: MeOH: CH3COOH: H20 (55: 36: 8: 1) The plates were then air dried and exposed to Phosphorlmager screen (Molecular Dynamics) or autoradiographic film. A Phosphorlmager Storm ™ was used (Molecular Dynamics) to examine the image produced on the screen. Alkaline hydrolysis of FBI in API. FBI or unrefined fumonisin C8 material was suspended in water at 10-100 mg / ml and added to an equal volume of 4N NaOH in a capped tube. The tube was sealed and incubated at 60 ° C for 1 hour. The hydrolyzate was cooled to RT and mixed with a Í -.Í? ** i * .i '., equal volume of ethyl acetate, was centrifuged at 1000 RCF for 5 minutes and the organic layer (top) was recovered. The combined ethyl acetate layers of two successive extractions were dried under N2 and resuspended in distilled H20. The resulting material (the FBI aminopentol or "API") was analyzed by TLC. Enzymatic activity of cultivated filtrate and mycelium. Isolate from Exophiala spinifera 2141.10 grew on YPD agar for 1 week, and conidia was harvested, suspended in sterile water, and 105 conidia per ml were used to inoculate sterile Fries mineral salts medium containing 1 mg / ml purified FBI (Sigma Chemical Co.). After 2 weeks of incubation at 28 ° C in the dark, the cultures were filtered through 0.45 micron cellulose acetate filters, and washed with mineral salts of Fries. The mycelium of the fungus was suspended in 15 mL of 0.1% FBI, pH 5.2 + 1 mM EDTA + 3 (g / mL of Pepstatin A + 1.5 (g / mL of Leupeptin and disorganized in a Bead Beater ™ using beads of 0.1 mn and one minute pulses, with ice cooling, Hyphal pieces were collected by filtration through Spin X ™ (0.22 (m)), and the original culture filtrates and the supernatant mycelium were tested by modification of fumonisin by the methods outlined above Preparation of the unrefined cultivated filtrate Agar cultures grown as above were used for tt inoculate cultures of YPD broth (500 ml) in conical flasks at a final concentration of 105 conidia per ml of culture. The cultures were incubated for 5 days at 28 ° C without agitation and the mycelium was harvested by filtration through 0.45 micron filters under vacuum. The filtrate was discarded, the mycelium entangle was washed and resuspended in a medium low in carbon-free mineral salts (1 g / liter of NH3N04, 1 g / liter of NaH2P04; 0. 5 g / liter of MgCl 2; 0.1 g / liter of NaCl; 0.13 g / liter of CaCl2; 0.02 g / liter of FeS04-7H20, pH 4.5) containing 0.5 mg / ml alkaline hydrolyzed FBI unrefined. After 3-5 days at 28 ° C in the dark without agitation the cultures were filtered through 0.45 micron filters of low binding to protein to recover the cultured filtrate. Phenylmethyl sulfonyl fluoride (PMSF) was added at a concentration of 2.5 mm and the cultured filtrate was concentrated using an Amicon ™ YM10 membrane in a stirred cell at room temperature, and resuspended in 50 mM sodium acetate, pH 5.2 containing 10 mM of CaCl2. The unrefined cultivated filtrate (concentrated approximately 200 times) was stored at -20 ° C. To obtain preparative amounts of fumonisin hydrolyzed by enzymes, 10 mg of FBI (Sigma) was dissolved in 20 mL of 50 mm sodium acetate at pH 5.2 + 10 mM CaCl2, and 0.25 mL of 200x concentrated crude concentrate was added. of 2141.10. The solution was incubated at 37 ° C for 14 hours, and then cooled to room temperature.

The reaction mixture was brought to about pH 9.5 by the addition of 0.4 mL of 4N KOH, and the mixture was extracted twice with 10 mL of ethyl acetate. The combined organic layers were dried under N2 and resuspended in dH20. 2.5 milligrams of extracted organic material were analyzed by mass spectrometry with Fast Atom Bombardment (FAB). The resulting mass spectrum showed a major ion in M / z (+1) = 406 mass units, indicating that the main product of the enzymatic hydrolysis was API which has a calculated molecular weight of 405. Example 2 Preparation of induced mycelium and not API API Liquid cultures of Exophiala spinifera 2141.10 isolate were prepared from YPD agar plates (Yeast Extract 10 gm, Bacto-Peptone 20 gm, Dextrose 0.5 gm, and Bacto-Agar 15 gm per liter of water). Aliquots (400-500 (L) of an aqueous suspension of E. Spinifera YPD agar cells were uniformly brushed onto 150 x 15 mm YPD agar plates with sterile glass beads of 4 mm.The plates were incubated at room temperature. environment for 6-7 days The mycelia / conidia were transferred from the agar plates in a Mineral Salts Medium (MSM) (Na2HP0 • 7H20 0.2 gm, 1.0 gm of NH4C1, 0.01 gm of CaCl2-2H20, 0.02 gm of FeS04 .7H20 per liter of distilled water, pH 4.5) and centrifuged at 5000 xg, 4 ° C, 20 minutes to pellet the cells.The cell pellet was washed -jfeM-a-Ss «á li¿ - ?. á-i -íí ^. ? * ^ * MbA.Aa »SSs ^^^. ", ..» .._ ju 8 * - »» - > . ^^. a ^ j? . < -) _ .. ^ «S jfait A- -. Ái ** once in 40 ml of MSM and recentrifuged. The washed cell pellet was used to inoculate MSM at a 1:19 packed cell: MSM ratio. The culture to be induced was supplemented with API at a final concentration of 0.5-1.0 mg / ml and incubated at 28 ° C, 100 rpm, in the dark to induce catabolic enzymes. The non-induced cultures did not receive API but were placed in a medium containing 4-ABA at the same API concentrations. The supernatants were removed by filtration through cellulose acetate at 0.45. The remaining entanglement of mycelium was washed with sterile MSM and then frozen in liquid nitrogen for storage. EXAMPLE 3 Effect of FBI and API on corn coleoptiles Corn Coleoptiles from germinated corn seeds grown in the dark 4 days were cut above the growth point and placed in microtitre plates of 96 wells in the presence of 60 microliters of distilled water sterile containing FBI or API at approximately equimolar concentrations of 1.5, .5, .15, .05, .015, .005, .0015, or .0005 millimolar, together with water controls. After 2 days in the dark at 28 ° C the coleoptiles were placed in the light and incubated another 3 days. The damage or lack thereof was evaluated as follows: .0005 .0015 .005 .015 .05 .15 .5 1.5 mM FBI +/- API + = necrotic brown coleoptile discoloration - = no symptoms (the same as water control) The results indicate that there is at least a 30-fold difference in toxicity between FBI and API to the corn coleoptiles of this genotype. This is in general agreement with other studies where the toxicity of the two compounds was compared for plant tissues: In Lemna tissues, API was approximately 40 times less toxic (Vesonder et al., "Arch Environ Con tam Toxicol 23: 464-467 (1992).). Studies with AAL toxin and FBI in tomato also indicate that the hydrolyzed version of the molecule is much less toxic (Gilchrist et al., Mycopathologia 117: 57-64 (1992)). Lamprecht et al. , also observed an approximately 100-fold reduction in tomato toxicity by API versus FBI (Lamprecht et al., Philopa thology 84: 383391 (1994)). Example 4 Effect of FBI and API on cultured corn tissue cells (Dulce Mexicano Negro, BMS) FBI or API was added at various concentrations to suspensions of BMS cells growing in a liquid culture medium in 96-well polystyrene plates. After 1 Li ^ nlil. ^ ^. ^^ .. week the cell density in the wells was observed under a low amplification power and the wells treated with toxins were compared with the control wells that received water. Growth of BMS cells was significantly inhibited at 0.4 micromolar FBI, but no inhibition was observed up to 40 micromolar API. This represents a roughly 100-fold difference in toxicity to cells grown in corn tissue. Similarly, Van Asch et al. (VanAsch et al., Phi topa thology 82: 1330-1332 (1992)) observed significant inhibition of corn callus grown on solid medium at 1.4 micromolar FBI. However, API was not tested in that study. Example 5 APAO Activity A cell-free extract containing the deaminase activity was obtained by subjecting Exophiala spinifera cells induced by substrate to disorganization using a Bead Beater ™ in 50 mM Na phosphate, pH 8.0, and recovering the cell-free supernatant. by centrifugation and filtration .45 microns. The catabolic activity was tested by incubating the extracts with API (fumonisin hydrolyzed base column Bl) or API labeled with 1C with the extract and evaluating by TLC on C18 or C60 silica. The 2-OP product has an Rf less than API and is detected either by radiolabeling test or by spraying H2S04 / carbonization of the TLC plate. 2-OP no ^ ¡¡¡¡¡Mm m M hm ^^^^^^^^^^^^^^^^^^^^ k ^ ^ a ^^^^^^^^^^^^^^^ M ^ ^^^^ ^^^^^ k é ^ reacts with the amine reagent, which is routinely used fluorescamma to detect API on TLC plates, suggesting that the amine group is missing or chemically modified. The activity is larger at 37 ° C than at room temperature, but 5 after 30 minutes at 65 ° C or 100 ° C (no API catabolic activity remained). The activity is maximum at pH 9. At pH 9, the complete conversion to 2-OP occurred in 30 minutes. The activity is retained by a membrane of cut of 30,000 daltons of molecular weight, but it is only partially retained by a membrane cutting of 100,000 daltons molecular weight. Other substrates containing amine were tested by modification by unrefined extract. Fumonisin, (with tricarboalylic acids bound), was not modified by the extract, initiating that ester-hydrolysis should first occur for APAO to be able to be effective in the FBI modification. Other long chain bases (sphingosine, sphinganine, phytosphingosine and) are apparently not modified by the APAO unrefined, suggesting that the enzyme (s) is specific for the fumonisin column base. The preparatory amounts of product, named 2-OP, have also been purified and analyzed by C13 rmn. The results indicate that 2-OP have a keto group on carbon 2 instead of an amine, consistent with an oxidative deamination by an amine oxidase. The C13 nmR data also indicate that 2-OP spontaneously forms an internal hemicetal between C-1 and C-5, '^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^? ^^^^ j ^ ^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ . All other assignments are carbon and API and 2-OP is a compound of composition C22H4406, FW 404. The product of the enzyme acting on fumonisin 5 hydrolysed not expected to present no significant toxicity. Other enzymes were tested for their ability to modify API. All enzymes were tested by radiolabeled TLC, as described above, under conditions optimal at 37 ° C Celsius, during the night or longer. The results are as follows: Deamination EC Source Result Monoamine oxidase 1.4.3.4 negative bovine plasma 5 D-amino oxidase 1.4.3.3 porcine kidney; Type X negative L-amino oxidase 1.4.3.2 C adamanteus venom; Type I oxidase negative Tiramino 1.4.3.4 Athrobacter spp dehydrogenase negative Methylamino 1.4.99.3 Paracoccus denitrificans dehydrogenase negative Aralkylamino 1.4.99.4 Alcaligenes faecalis 20 negative Phenylalanine ammonia lyase Rhodotorula glutinis 4.3.1.5; Type I Histidinamonialiasa 4.3.1.3 negative negative Pseudomonas fluorescens aspartase L-4.3.1.1 hafnia (Bacterium cadaveris) oxidase negative Tyrosine 1.14.18.1 Lysine oxidase negative strain Trichoderma viride 1.4.3.14 Diamine oxidase negative 5 1.4.3.6 negative porcine kidney The results were negative for each enzyme tested. Therefore, isolates were collected from the American Type Culture Collection (ATCC). Selected ATCC isolates were enlisted as containing enzymes that modify amine or were capable of growth / utilization of amine-containing substrates. The isolates were tested to determine if they could grow on or use API as the sole carbon source, and if any could modify API in a new compound (s). The nitrogen sources that were used in the liquid cultures were 0.1% API (weight / volume), 0.1% s-butylamine (volume / volume), 0.1% n-butylamine (volume / volume), and 0.2% ammonium nitrate (weight / volume). They were prepared in Vogel's Minimal Media (without NH4N03) containing 2% sucrose. The isolates were inoculated into different media and were observed by growth for 2-3 weeks. They were also tested with the C14 radiolabeled TLC test for API modification. In summary, none of the tested isolates showed modification of API in vivo. Clearly the APAO enzyme of the Exophiala spinifera is unique and unusual in its ability to modify the API toxin. EXAMPLE 6 Isolation of the trAPAO polynucleotide The trAPAO polynucleotide was identified using a patented image copying method that compares the patterns copy in two samples and allows the cloning of the llliÉfTf ^^ * *, ** - * - ». ... * ... ^^. ^. A- ^. ^, ^ A .Í ,. differentially expressed fragments. This technology was developed by CuraGen® (New Haven, CT). (see published PCT patent application No. WO 97/15690, published May 1, 1997, and hereby incorporated by reference) 5 fragments of fluorescently labeled PCR amplified cDNAs representing expressed copies can be visualized as bands or peaks on a tracer gel, and the differentially expressed band cDNA (induced or deleted) can be recovered from a duplicated, cloned and sequenced gel. The cDNAs can be identified without the need for cloning, by matching the predicted size and the partially known sequence of specific bands on the tracer. In the present invention, two RNA samples were obtained from cultures of E. spinifera grown during a Specific period in mineral salts medium containing either API (induced condition), or gamma-aminobutyric acid (ABA, on uninduced condition) as the sole carbon source. In the induced condition, the activities of the enzymes fumonisinesterase and APAO were detected, whereas in the condition not induced these activities were not detected. The methods used for the induction of APAO and the detection of activity were described above (see Example 2 and Example 5). RNA was extracted from mycelium induced by Tri-reactive methods (Molecular Research Center Inc., Cincinnati, Ohio) only by grinding a frozen suspension of tissue and tri-reactive with a mortar and pestle until almost melting and adding an additional extraction after phase separation by extracting the aqueous phase once with phenol, and twice with a mixture of phenol: chloroform: isoamyl alcohol. The RNAs were subjected to copy of CuraGen® images to detect cDNA fragments that are specifically induced in the presence of API. In the resulting gel tracing several bands were found that showed induction of at least 2 times and up to 79 times or even 100 times or more in API. In the tracing of the resulting gel, several bands were found that showed induction of at least 10 times in cells grown in API compared with cells grown in ABA. The sequence of two highly induced bands can be found in Table 1 TABLE 1 Nucleotide sequence of two CuraGen® bands that were identified as strongly induced API in cultures of Exophiala spinifera. > k0n0.395.5_b (. SEQ ID NO: 1) GGGCCCCGGCGTTCTCGTAGGCTGCGCGGAGTTGGTCCCAGACAGACTTTTGTCGTACCTGCT TGGACTGTTGGGACCACTTCCGTCCCGGGTCTCCGACCATGAAACAGGTAATGGACCATTGTC GATCGACGTCGATGCTGGTATCTCTGGCAAATGAGATGGGGTCACAGCTCGATTGGAGGACGC CCGAGAGCCTTGTTCGCGCCACCACGGCTTGTCCCATACGAAGACTATCTTGCTATAGTAGCC CAGGATAGAATTTTCCGCCAATGCTTGCTTCTCGGCGGGAAGAGGTGGTGAAAATGTCAAGGT GGGATACAAGGTTGTCGGTAACGAAACCANCACCTTTTTGCTTCGGAACACGGCGC > r0c0-182.3 6 (SEQ ID NO: 2) GAATTTTCCGCCAATGCTTGCTTCTCGGCGGGAAGAGGTGGTGAAAATGTCAAGGTGGGATAC AAGGTTGTCGGTAACGAAACCACCACCTTTTTGCTTCGGAACACGGCGCCCGAGGCCGATCGT ACTGTACAGCCGGATGCCGACTGCTCAATTTCAGCGACGGGGGTGTTGAGGTGCAC Two of the most highly induced bands Kono-395.5, and 182.3 ROCO-showed significant sequence homology to a family of enzymes, flavin amine oxidases containing (EC 1. 4.3.4), which oxidize primary amines to an aldehyde or ketone, releasing ammonia and hydrogen peroxide (Table 2). TABLE 2 Identification of a putative flavin aminooxidase from E. spinifera: copy fragments induced by API with aminooxidase homology. Omission parameters BLAST 2.0.

The chemical structure of the main product of API deamination is considered to be a 2-keto compound which is cyclized in a hemicetal in carbons 2 and 5. Therefore, it is predicted that this enzyme is responsible for the deamination of API. Using the sequence derived from kOnO-395.5, a partial cDNA was obtained by 3 'and 5'. RACE-PCR (Chenchik, et al., (Chenchik, et al., CLONTECHniques X 1: 5-8 (1995); Chenchik, et al.) A new method for cloning full length cDNA by PCR. In A Labora tory Guide to RNA: Isolation, Analysis, and Syn thesis. Ed. Krieg, P. A. (Wiley-Liss, Inc.), 273-321 (1996)). A CLONTECH RACE cloning team was used to obtain the RACE amplicons. Briefly, poly A + RNA is transcribed to make the first strand of cDNA using a synthetic synthesis primer. poly T cDNA, "closed down", the second strand is synthesized and the Marathon cDNA adapter is ligated at both ends of the cDNA. The diluted template is then used with the Marathon adapter primer and in separate reactions either íiiifi'-iiniiitriíriii • i p rr • i ^ Á i? " .- ^ .. fe-.a-a Gen 5 'Specific Primer (GSP) or a 3' GSP is used to produce the 31st RACE 5 'amplicon. After characterization of the RACE cDNA product or products and complete sequencing, they can be generated by 1) end-to-end PCR using the GSPs with the cDNA-linked adapter as template, or 2) the 5 'and 3' RACE cloned fragments can digested with a restriction enzyme that cuts only in the translocation region, the fragments are isolated and ligated. Subsequently, the full-length cDNAs generated by RACE 1) and 2) can be cloned into a suitable vector. In combination with the supplied adapter primer, the following gene-specific primers were used: for 3 'RACE the oligonucleotide N21965: 5'-TGGTTTCGTTACCGACAACCTTGTATCCC-3' (SEQ ID NO: 3) and for 5 'race, the oligonucleotide N21968: 5'-GAGTTGGTCCCAGACAGACTTTTGTCGT-3 '(SEQ ID NO: 4) The polynucleotide sequence of the trAPAO polynucleotide, kOnO-395_6.5, from Exophiala spinifera is shown in SEQ ID NO: 5 The sequence of trAPAO polypeptides is shown in SEQ ID NO: 6 A second clone of APAO containing a spliceless intron was also found.The trAPAO-I polynucleotide sequence, k0n0-395_5., The intron that contains clone, from Exophiala spinifera, can be found in SEQ ID NO: 7. The trAPAO-I polypeptide sequence with the intron ^^^^ and spliced shown in the SEC. DE IDENT NO .: 8. The sequence of polypeptides of trAPAO-I without the spliced intron is shown in SEQ. FROM IDENT. NO .: 9. EXAMPLE 7 Heterologous expression of trAPAO The protein alignments generated with PileUp (GCG) indicate that k0n0-395_6.5 (trAPAO) is similar in size to another flavine aminooxidase and is close to being full length with respect to amino terminus of its protein class. The sequence k0n0-395_6.5 contains a full duplex ß-a-β that is required for the dinucleotide linkage (FAD) near the amino terminus. The kOnO-395 sequence appears to lack only a variable amino terminal segment varying in length of 5 amino acids in rat monoaminoxidases A & B up to 40 amino acids long in Aspergillus MAO-N. The function of these amino terminal extensions is not known; they are not recognizable as secretion signals. Based on the probability of localization of the Exophiala APAO outside the cell membrane, the prediction is that kOnO-395 would have a signal sequence similar to that of fumonisin esterase cloned from the same organism (U.S. Patent No. 5,716,820, supra). Using GenomeWalker ™, it is possible to clone the 5 'end of the copy and genomic regulatory elements towards the 5' end. However, the signal sequence is not expected to be critical to the functionality of the enzyme; In fact, the jg ^^^^ j ^ ^^^^^^^ a ^ g ^ preferred strategy for heterologous expression in corn and Pichia pastoris involves the replenishment of the endogenous signal sequence (if present) with a signal sequence optimized for the organism, for example alpha amylase from barley for corn and the yeast alpha factor secretion signal for Pichia. In maize transformed with fumonisin esterase, the barley alpha amylase signal sequence gave higher amounts of functional protein than the native fungal signal, therefore the replenishment of the native mushroom signal sequence is a logical optimization step. Since many of the aminooxidases have a positively charged amino acid near the N-terminus and towards the 5 'end of the dinucleotide binding site, an additional optimization step includes adding a codon for the lysine (K) to the N-terminal of the clone of the trAPAO (k0n0-395_6.5, SEQ ID NO: 5). This clone is designated K: trAPAO and can be seen in SEC. FROM IDENT. NOS .: 10 and 11. The extra lysine is in amino acid 1 and nucleotides 1-3. EXAMPLE 8 Expression in Pichia of trAPAO For the optimal expression of trAPAO in Pichia pastoris the signal peptide of the alpha equivalence factor was fused in the structure with the coding sequence K: trAPAO and can be seen in SEC. FROM IDENT. NOS .: 16 and 17. The nucleotide sequence of the clone pPicZalphaA: K: trAPAO contains an insert ? t k? .j. »* 4-4 *. . *. - ^ - •• *. - .. -, > , .. ^ A < -A «-tt.-i¿i ..» «« -_. * ~. "» .-, », .-, ^ *. ? .r. *. Ti * m * »* my PCR amplified comprising the open reading structure kOnO-395 with an additional lysine residue at the amino terminus, with a 51 EcoRI site and a 3 'Notl site for cloning within the structure within the alpha factor secretion vector pPicZalphaA. The nucleotides 1-267 contain the secretion signal of the yeast alpha equivalency factor. The amino acid sequence shown in SEQ. FROM IDENT. N0..17 contains the trAPAO polypeptide produced from pPicZalphaA: K: trAPAO after transformation into Pichia pastoris. For cloning within the Pichia pastoris expression vectors, two cloning strategies were used. The k0n0-395_5.4 cDNA was generated by using end-to-end PCR using the distal 5 'and 3' GSPs with the ds cDNA linked to the adapter as a pPicZalphaA template, the distal oligonucleotide primers were designed with 5 'restriction enzymatic sites containing a 23-25 bp overlap anchored at the 5' end (sense strand) and 3 'end (antisense strand) to clone into the open reading structure of kOnO-395; the 3 'primer also includes the detection codon. The primer sequences are N23256: 5'ggggaattcAAAGACAACGTTGCGGACGTGGTAG-3 '(SEQ ID NO: 12) and N23259: 5' ggggcggccgcCTATGCTGCTGGCACCAGGCTAG-3 '(SEQ ID NO: 13). A second method was used to generate kOnO- 25 395_6.5. 5 'RACE and 31 RACE products were generated using a distal primer containing the necessary restriction enzymatic sites, nonsense codon, etc., as described above and paired with a "medial" GSP. The "mediating primers" N21965: 5 '-TGGTTTACGTTACCGACAACCTTGTATCCC-3' (SEQ ID NO: 14) for 3 'RACE and oligonucleotide N21968: 5' -GAGTTGGTCCCAGACAGACTTTT-3 '(SEQ ID NO. fifteen). The double-stranded cDNA linked to the adapter was used as a template. The 5 'and 3' -RACE isolated fragments were digested with a restriction enzyme that cuts only in the translapation region, in this case Bgl 1, were isolated and ligated into the expression vector. The digestible restriction sites allow insertion of the inserts into the structure within EcoRI / Notl digested pPicZalphaA. pPicZalphaA is an expression vector of E. coli compatible with Pichia that contains a signal of secretion of functional yeast alpha factor and peptide processing sites, allowing high efficiency of inducible secretion within the Pichia culture medium. The resulting 1.4 kb bands were cloned into the EcoRI / Notl plasmid digested pPicZalphaA. The SEC. FROM IDENT. NO .: 16 contains the polynucleotide sequence of the clone pPicZalphaA: K: trAPAO, an amplified PCR insert comprising the open reading structure kOnO-395 with an additional lysine residue at the amino terminus, and an EcoRI site and a 3 site 'Notl for cloning into the structure within the alpha factor secretion vector pPicZalphaA. The SEC. FROM IDENT. NO .: 17 contains the amino acid sequence of the trAPAO polypeptide produced from pPicZalphaA: K: trAPAO after transformation into Pichia pastoris. The secretion signal of alpha factor and a lysine are added. Pichia was transformed as described in Invitrogen Manual, Easy Select ™ Pichia Expression kit, Version B, # 161219, with the trAPAO polynucleotide as described above with either an intron (trAPAO-I, negative control, no expression of active trAPAO post that Pichia does not splice introns very efficiently) or without an intron (capable of making an active APAO protein) Pichia culture fluids and pellets were tested by APAO activity as described above. The set of frozen six-day Pichia culture cell pellets contains two samples with intron (SEQ ID NO: 7) in the constructs of gene # 11, # 14, and two samples without intron in the gene construction (SEC DE IDENT NO.:5), # 6, # 52. The six-day culture fluids of the same cultures were used to seed with the unrefined fungal enzyme for positive controls. The 50 μl cell pellets were resuspended in 150 μl of cold Na-50mM phosphate, pH 8.0, and divided into two fresh 500 μl tubes. One tube was maintained on ice without treatment, the pellet suspension, and one tube was used for lysis. An equal volume of 0.1 mm zirconia-silica beads i? ate, t, ..., -J -. . t MJi,. . ., "...--.,, ... * * * ^ -....., * *. .-. .. ^ - ^ ^ .l.l ^ fijgfofc i-i was added to each tube. The tubes were BeadBeat ™ for 15 minutes and then chilled on ice for 5 minutes. This was repeated three times. The unrefined lysate was then transferred to another tube for lysate test or suspension. 5 The TLC tests were performed as follows, the samples are 1) pellet suspensions; 10 μl; 2) lysate suspensions; 10 μl; 3) 5 μl of media mixed with media controls with 5 μl of unrefined fungal enzyme; 10 μl; 4) undiluted enzyme from unrefined fungus used for positive control; 10 μl; 5) 50mM Na phosphate used for substrate control, pH 8.0; 10 μl. Ten microliters of each sample plus 10 μl of C-APl (1 mg / ml, 50mM Na phosphate, pH 8) were incubated at room temperature for 6 days. One microliter of the sample was placed on the C18 and C60 plates of TLC. Plates 15 of C18 were developed in Me0H: 4% KCl (3: 2). The C60 plates were developed in CHC13: MeOH: CH3COOH: H20 (55: 36: 8: 1). The plates were then air dried and then exposed to a PhosphorScreen ™ for 2-3 days. A Storm ™ Phosphorlmager was used to reveal the images. 20 A positive TLC result is obtained if an additional radioactive blot appears at a lower Rf of the previously produced API modification identified as 2-OP, an API deaminated product. In samples # 6 and # 52 (without intron) API modifying enzyme activity (conversion of API to 2-OP) 25 was detected in pellet suspensions, although most of the * > - * > * * -a ** u ^^^ g ^ ^ d * "* - * - ** - * - *., :: - Í *, l A, ¿, .--« = ¿. < á , activity was associated with pellet suspensions.In samples # 11 and # 14 (with intron) a minimum amount of API modifying enzymatic activity was detected in the # 14 pellet lysate only, which indicates that Pichia can not process the intron efficiently This experiment verified that the activity of APAO can be detected in Pichia transformants which verifies that trAPAO as described works correctly to degrade API activity is associated with suspensions of cells, which show greater activity than The pellets used may show less activity due to the release of endogenous proteases during cell lysis EXAMPLE 9 Expression of trAPAO in E. coli The vector to express K: trAPAO in E. coli is pGEX -4T-1 This vector is a prokaryotic glutathione S-transferase (GST) fusion vector for the expression int Racelular high-level inducible genes or gene fragments such as fusions with Schistosoma japonicum. GST gene fusion vectors include the following characteristics, a lac promoter for high level inducible expression; an internal lac Iq gene for use in any E host. coli; and factor Xa thrombin or Protease PreScission recognition sites for the cleavage of the desired protein from the product of -U-i- ^ M ^ i. fusion. The insert of interest, k0n0-395_6. (K: trAPAO), was subcloned into the 51 EcoRI site and a 3 'NotI site allowing expression in the structure of the fusion peptide GST: K: trAPAO or GST: APAO. The polynucleotide sequence of the GST: K: trAPAO fusion can be found in SEQ. FROM IDENT. NO .: 18. GST fusion with polylinker can be found in nucleotides 1 to 687. The K: trAPAO can be found in nucleotides 688 to 2076. The resulting polypeptide for the GST: K: trAPAO fusion can be seen in SEC. FROM IDENT. NO.:19 Amino acids 1 to 229 represent the GST fusion plus the polylinker and amino acids 230 to 692 represent the K: trAPAO portion of the fusion. E. coli was transformed with the vector pGEX-4T-l containing K: trAPAO as described in the BRL catalog, Life Technologies, Inc; Hanahan, D., J. Mol Biol 166: 557 (1983) Jessee, J., Focus 6: 4 (1984); King, P.V. and Blakesley, R., Focus 8: 1, 1 (1986), and incorporated herein by reference. The e . Transformed coli was induced by the addition of IPTG (isopropyl b-D-thiogalactopyranoside). Four samples of Soluble extract and four insoluble inclusion body samples were tested for trAPAO activity as described in Example 9. APAO activity was present in all soluble samples and two insoluble samples. The highest activity was found at 10 μM IPTG. So the vector pGEX-4T-l containing the construction kOnO-395__6.5 is capable of produce active APAO enzyme in E. coli. EXAMPLE 10 The Complete Nucleotide Sequence of the Exophiala APAO Gene Using the Walker Genome, the complete nucleotide sequence of the Exophiala APAO gene was recovered. The nucleotide sequence described in SEQ. FROM IDENT. N0.:5 loses a portion of the 5 'end of the native gene. The loss portion of the 5 'end of the native gene is not necessary for the expression of an active APAO enzyme, as can be seen in Examples 9 and 10. The complete nucleotide sequence of APAO can be seen in SEQ. FROM IDENT. NO.:22 The translation of the SEC. FROM IDENT. NO.:22 can be found in the SEC. FROM IDENT. NO.:23. EXAMPLE 11 Expression of APAO and ESP1 in transgenic corn callus 15 One of the preferred constructs for expression in corn is the nucleotide sequence of trAPAO fused to the alpha amylase signal sequence of barley. The nucleotide sequence of the translation fusion of K: trAPAO with the barley alpha amylase signal sequence for the expression and secretion of the mature trAPAO in corn can be seen in SEC. FROM IDENT. NO.:20 Nucleotides 1-72 represent the signal sequence of barley alpha amylase; nucleotides 73-75 represent the receipt of aggregated lysine; and nucleotides 76-1464, represent the cDNA of trAPAO. The translation of the amino acid sequence of SEC. FROM IDENT.

^ Mft * ^ ¿> *!, .i A kjmu * A * - "- '* t - ^ * - NO .: 20 can be found in SEQ ID NO: 21, amino acids 1 to 24 represent the alpha signal sequence barley amylase and amino acids 25 to 463 are the sequence of K: trAPAO.5 Corn embryos were transformed with linear DNA (insert, lacking a bacterial antibiotic resistance marker), derived from constructs containing three transcription units: 1) a selectable marker gene PAT (Wohlleben et al., Gene 70, 25-37 (1988)), 2 ) fumonisin SP1 fused to the barley alpha amylase signal sequence, and 3) full length APAO with or without an amino terminal barley alpha amylase signal sequence, (P13603, comprising a selectable PAT marker fused to a 35S promoter , fumonisin esterase ESP1 fused to a Signal sequence of barley alpha amylase and the ubiquitin promoter, and APAO fused to the ubiquitin and P13611 promoter, comprising a selectable marker PAT 35S, promoter, ESP1 fumonisin esterase fused to a barley alpha amylase signal sequence and the promoter ubiquitin and the APAO fused to a barley alpha amylase signal sequence and the ubiquitin promoter). In these constructs, ESP1 and APAO were linked to the maize ubiquitin promoter and the first intron. In a third construct, the same three transcriptional units were cloned into an Agrobacterium vector TI vector (P15258, the construction comprises a marker selectable PAT, ESP1 fumonisin esterase fused to a barley alpha amylase signal sequence and APAO). The stably transformed callus or regenerated TO plants of ESP1 were tested by ESP1 and APAO activity in regulated extracts of 5 leaf tissues, using radiolabelled FBI and / or API and C18 thin layer chromatography. The positive controls consist of non-transformed tissue seeded with recombinant ESP1 expressed in E. coli or APAO. The results indicate that the activities of ESP1 and APAO can be detected in 10 plants and transgenic corn callus.

^ Ju ^ .JÜ * ^ rr1 (t? N .f,? T¡A «*, <. -? ÍJ ,: 1 í. * M? .At * t? *? ~? ^, - »..... ...... ..A" *, * * * * * * * Transgenic plants were regenerated from the positive transgenic callus for both activities of ESP1 and APAO by standard methods known in The enzymatic activity was tested as previously described, as can be seen below, transgenic corn plants can successfully express both enzymes ESP1 and APAO.

Expression of ESP1 and APAO in transgenic corn plants (TO) Another preferred construction for the expression of APAO in a plant is to select the APAO for the perixosome. The corn embryos were bombarded with inserts containing APAO operably linked to the ubiquitin promoter and a peroxisomal selection sequence (Gould, et al., J Cell Biol 108: 1657-1664 (1989)); ESP1 operably linked to the ubiquitin promoter and the barley alpha amylase signal sequence; and a selectable marker of PAT operably linked to the 35S promoter (construction number 114952). The negative controls were embryos / callus not bombarded. The positive controls were non-bombarded embryos / callus seeded with purified enzyme. The transformed callus was then tested for ESP1 or APAO activity as previously described. Out of the 67 samples tested 18 samples contain activity ^ "» "- JAi '' * - ESP1 and APAO activity The APOO selected Peroxisomally and the fumonisin esterase selected apoplast can be expressed successfully in a plant cell Another preferred construct for the expression of APAO in a plant is to select the APAO for The mitochondrial membrane A C-terminal extension is required to select MAO-A and MAO-B monoaminooxidases for mammalian external mitochondrial membranes A MAO-A, MAO-B, or functionally similar C-terminal extension can be fused in the APAO structure or TRAPAO to facilitate the localization of this enzyme in the mitochondrial membrane of corn or other transformed species EXAMPLE 12 Comparison of the APAO Sequence with Other Sequences The Exophiala cDNA of APAO (SEQ ID NO: 22) contains 1800 bp open reading frame coding for a 600 amino acid polypeptide (SEQ ID NO: 23) with divergent homology to two classes of proteins. APAO quarter (amino acids 137 to 593) is strongly homologous to flavin aminooxidases, a group of enzymes that catalyze the oxidative deamination of primary amines on carbon 1. The aminooxidase function of the carboxy terminal domain was confirmed by the expression of a truncated APAO polypeptide ( from 137 to 600) in Pichia pastoris and E coli, using API as a substrate (see Example 9). The amino portion APAO terminal, in contrast, (from approximately 5 to 134) shows significant homology to a group of small reduced open reading structures (ORF) reported in various bacteria and blue-green algae, as well as various 5 higher organisms. These ORFs code for small proteins of unknown function, ranging in size from 14 to 17 kDa. The juxtaposition of these divergent homologies in a single polypeptide has not been previously reported. Flavine aminooxidases (E.C 4.1.4.3) are a group of flavoenzymes found in higher and lower organisms, and serve a variety of functions in catabolism. They catalyze the oxidative deamination of primary amino groups located in the C-1 position of a variety of substrates, which result in an aldehyde plus ammonia product and hydrogen peroxide. The APAO enzymes of the present invention are the first known flavine aminooxidase that attacks a primary amine not located in the C-1 (ie C-2 API) and which results in a keto product rather than an aldehydic product. However, the amino acid oxidases, while are not closely related to the flavin amino oxidases, they are flavoenzymes that oxidize an amine of C-2 adjacent to a carboxyl group of C-1. The monoamine oxidase MAO A & amp; B, (from human, bovine and trout), are located in the outer mitochondrial membrane of higher organisms and regulate the level of ^ Ma ^ n ^ .. t * .- »*, ** ...., - .., a» "". "," ..._...._.... a *, ..- í,. ^ .. ..... ^ .. **. ^ * ^ -, ^ to > .., * +. *. , M? ^ > .s. A-fc ---- »¡-i-neurotransmitters. Microbial examples include a fungal ammooxidase. { Aspergill us niger (niger) MAO-N) involved in the catabolism of amines, and a putrecine bacterial oxidase of a gram (+) bacteria. { Micrococcus rubens). The major polypeptides vary in length from 478 to 527 amino acids, and share regions of high amino acid sequence conservation at the 5 'end as well as at various points throughout the coding region. Alignments of proteins generated with (GCG) indicate that trAPAO contains all the conserved domains found in this class of proteins that include those near the 5 'end. The aminooxidase domain of trAPAO contains several key features shared by this class of enzymes, including an amino terminal dinucleotide binding region (ADP) characterized by a beta-alpha-beta dilation containing three invariant glycines (GXGXXG) in the beta round -alpha. In trAPAO, this sequence is (DVVVVGAGLSG). This region is involved in the FAD link. Several unique features of mammalian aminooxidase are absent, including essential cysteine residues (Wu et al., Mol Pharm 43: 888 (1993)), one of which (Cys-406 of MAO-A) is involved in the covalent bond of FAD and a carboxy terminal extension that has been shown to be involved in the transport and anchorage of MAO in the outer mitochondrial membrane. The enzyme of Aspergillus MAO-N has been shown to ^^ ^^^^^ contains non-covalent FAD, and also lacks conserved cysteine. Therefore it is possible that the APAO Exophiala enzyme has a non-covalent FAD. The MAO-N of Aspergillus has a carboxy terminal tripeptide Ala-Arg-Leu which is involved in the selection and localization, eg, oxyzomal; this sequence is absent from APAO Exophiala. The domain aminooxidase trAPAO contains a total of seven cysteines, compared to ten for the enzyme Aspergill us and only two for the enzyme Micrococcus. The MAO enzymes mammalian 10 containing varying numbers of cysteines (at least ten), some of which are highly conserved (including FAD binding residue mentioned above). The trAPAO sequence also has two putative glycosylation sites (NDS, NQS) towards the amino terminus. 15 The purpose of the amino terminal extension of APAO and the basis for its homology to a group of 14-17 kDa proteins is not clear. In Synechocystis, a polypeptide like ORF is located immediately to the 5 'end of the NADP dependent dehydrogenase glutamine (gdhA) and has been shown that is required for the functional expression of gdhA (Chavez et al, 1995). However, in TRAPAO the domain is clearly not necessary for enzymatic activity, as shown by the results of expression experiments using truncated APAO. An interesting clue comes from the association frequent of this small ORF with clusters of genes involved ^ ^ ^ '^' ¿¡¿^^, ^ t's ..i sa = te in oxidoreductase activity in bacteria, or heat stress induced in mice, suggesting a possible role in the redox protection. A byproduct of aminooxidase activity is hydrogen peroxide. Flavoenzymes and other redox enzymes are frequently susceptible to inactivation by hydrogen peroxide (Schrader et al., App Microb Biotechnol 45: 458; Aguiree, et al, J Bacteriol 171: 6243 (1989)), and it is possible that this protein Take a protective role against oxidants such as hydrogen peroxide. Alternatively, this domain could be involved in the enzymatic function, localization or association of the enzyme with other structures. No signal peptide region can be detected in this amino terminal region. In the multiple sequence alignment using GCG PileUp, trAPAO is more similar to the putrecine oxidase from Micrococcus rubens, accession number Swissprot P40974, (30% identical amino acids, 40% similar). Homology with various mammalian monoamin oxidases A and B, accession numbers Swissprot P21397. { Homo sapiens mao a), P19643. { Ra t your norvegicus mao b), P21396. { Ra t your norvegicus mao a), and P21398. { Bos taurus mao a), is somewhat smaller, varying from 25 to 28% identity and 36 to 40% similarity. The homology to the only other known flavine aminooxidase fungus, MAO-N from Aspergill us niger (accession number Swissprot P46882), is somewhat smaller (24% identical, 34% similar). The microbial enzymes are considerably divergent from one another, while mammalian monoaminooxidases share 65 to 87% identity. The amino terminal domain (ATD) of APAO also shows homology to a 14.5 kD protein of human and rat phagocytes showing inhibition of translational activity in vi tro (accession number Swissprot # P52758, P52759) Schmiedeknecht, et al. , Eur J Biochem 242 (2), 339-351 (1996)), and includes a mouse heat responsive protein (Samuel, et al. a. , Hepa tology 25 (5), 1213-1222 (1997)). This suggests that this family of proteins is involved in the regulation of cellular metabolism. There is no example in which this domain is merged into a larger protein domain, however, making APAO unique. Without trying to be limited by the theory, all this suggests, that this domain plays a regulatory role in the expression of the APAO gene, possibly to prevent translation of the message when it is not needed. This raises the question of how message translation is restored when the active enzyme is required by the cell Exophiala. Possibly there are alternative start sites that start towards the 3 'end of the inhibitory domain; or proteolysis, complex formation, degradation, or phosphorylation / dephosphorylation of the inhibitory domain when it is not needed. The first possibility is less likely due to that there are no other ATG codons before the ATG in 122-124 that r nttr? HÉltft, li'A '-? '"? ***" • * • * - constitutes the predicted start site of APAO. The second possibility can not be easily proven, although there is a casein kinase site in the ATD. Alternative roles for ATD include oligomerization of the APAO protein, or anchoring the protein to some intracellular site, such as the membrane. A parallel example of regulatory control over another flavoenzyme, human flavin monooxygenase 4 (FMO-4), by a C-terminal extension has been reported (Itagaki, et al., J of 10 Biol Chem 271 (33): 20102-20107 ( nineteen ninety six)). In this case the introduction of a nonsense codon before the base 81 of C-terminal extension allows the expression of the active enzyme in heterologous systems. However, the role of the C-terminal portion was not elucidated. In another example, the splice Alternative leads to a shorter gene product than that which complexes with and interferes with the function of the normally spliced version (Quinet, et al., J of BioJ Chem 268 (23): 16891-16894 (1993)) . In another case, an insert generated by alternative splicing in another protein leads to inhibition of cell gro(Bhat, et al., Protein Engineering 9 (8): 713-718 (1996)). In yet another variation, fas / Apol splice variants prevent apoptosis, apparently through a domain of 49 amino acids shared by all variants ((Papoff, et al., J of Immunology 156 (12): 4622-4630 (1996)). - - • * --- *** - * «« ** »- * • '• ....-.- -. »... * ...-- * - .., .. .. - * .... ifa.iija EXAMPLE 13 Making a fusion protein containing fumonisin esterase activity and AP amino oxidase in the same polypeptide Enzymatic activities of fumonisin esterase and 5 AP amine oxidase can be combined into a single polypeptide using the open reading frames together with or without a spacer region between the two polypeptides. This creates a hybrid protein with dual enzymatic activities that can be exported as a unit to the apoplast, and will allow both enzymatic activities are conveniently located in the same area of the cell wall. The two cDNAs can be combined in any order, but the preferred method is to link them in the order NH3-Esterase: APAO-COOH. The spacer, if present, may consist of a short dilation of amino acids such as GGGSGGGS, or a set of amino acids comprising a protease cleavage site that can be influenced by an apoplastic protease. This would result in the production of stoichiometric amounts of both esterase and APAO enzymes in the apoplast. 20 The fusion protein esterase-APAO can be made with either the fumonisin esterase of E. spinifera 2141.19 (ESP1) or fumonisin esterase from bacterium 2412.1 (BEST1). Since the pH range for maximum activity of BEST1 is similar to that of APAO (range 6.0 to 8.0), these may present the most effective combination in a merged form. As described - ^. ^ ^ ái ^^^ S ..,. *,,. ,,., 4 .. ^., ..,, .. to._.,, _ ..... i .. ^ , .. - .. ...- ^ «« A. In previous examples, these fusion sequences can be placed in the appropriate expression vectors and used to express proteins in bacteria or plants. The nucleotide sequence of ESP1 contains three 5 nucleotide differences and three that correspond to amino acid differences for the ESP1 sequence described in pending US applications. 08 / 888,950 and 08 / 888,949, both filed July 7, 1997. Both sequences described in the present application and the sequences described in pending North American applications contain functional fumonisin esterase genes. For the purposes of the present invention, the original ESP1 sequences or the ESP1 sequences described can be used in combination with the APAO sequences or in fusion sequences.

The nucleotide sequence of a BAA: ESP1: K: trAPAO construct for a plant expression can be found in SEC. FROM IDENT. NO.:24 and the translation in the SEC. FROM IDENT. NO .: 25. The nucleotide sequence for a BAA construction: BESTl: K: trAPAO for plant expression can be found in the SEC. FROM IDENT. NO.:26 and the translation in the SEC. FROM IDENT. NO .: 27. The nucleotide sequence of a GST: ESP1: K: trAPAO fusion for bacterial expression in a pGEX-4T-1 or the similar vector can be found in SEC. FROM IDENT. NO .: 28 and the translation in the SEC. FROM IDENT. NO.:29 Sequence of the nucleotide for a GST fusion: BEST1: K: RAPAO for the bacterial expression in a pGEX-4T-1 or the similar vector can be seen in SEC. FROM IDENT. NO .: 30 and the translation in SEC. FROM IDENT. NO .: 31. EXAMPLE 14 APAO Substrate Studies The following test was used to determine the substrate specificity of the APAO enzyme. Reaction mixture: 436 μl of 200 mM Na-phosphate, pH8.0; 50 μl of substrate (10 mM); 2 μl of Amplex Red (1 mg in 200 μl DMSO); and 2 μl Peroxidase (5000 U / ml). The APAO enzyme was a recombinant enzyme produced as GST fusion in E. coli, purified on a glutathione affinity column and split with thrombin to eliminate GST. All the components were mixed at room temperature. The initial velocity was determined in a spectrophotometer at 572 nm for one minute per absorbance units / second (BLANK). 10 microliters of APAO at 70 ug / ml was added and mixed. The initial velocity was determined again at 572 nm for one minute in absorbance units / second (SAMPLE). The speeds were converted into absorbance units / minute. The BLANK value was subtracted from the SAMPLE value. The absorbance units were converted to μM H202 of 1 μM H202 equals 0.138 absorbance units at pH 8.0. .-. a * ..,. », *, .. * i .. aa¿i SUBSTRATES FOR APAO SUBSTRATES SPEED uM H202 / min 1 mM Fumonisin Bl 0.1429 1 mM API 0.8876 0.5mg / mL Fumonisin B2 0.3058 1 mM Fumonisin B3 0.1449 0.5mg / mL Fumonisin B4 0.1728 1mM norepinephrine 0.0087 1mM epinephrine 0.0071 1mM dopamine 0.0040 1mM spermine. 0.0002 NO SUBSTRATE FOR APAO (defined as compounds that result in less than 1% conversion to hydrogen peroxide by APAO in relation to API under similar conditions of time, pH, temperature, and substrate concentration): 2-phenylethylamine, spermidine, EDTA-Na2., Tryptamine, putrecin, benzamidine, serotonin, cadaverine, Pefabloc SC, tyramine, 1, 3-diaminopropane, leupeptin, histamine, hydroxylamino, aprotinin, deprenyl, Fumoninisin C4, isoniazid, sphingosine, phenelzine, sphinganine, phytosphingosine, D-alanine, DL-alanine, L-arginine, L-asparagine, aspartic acid, D-aspartic acid, L-cysteine, L-glutamine, L-glutamic acid, glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, DL-lysine, L-methionine, DL-methionine, L-phenylalanine, L-proline , L-threonine, í * .i .. t .. * .. *, * & , ^ ^ y •: j * J.Iai ...? . < * > Mi.i.i.i.r.f L-tryptophan, L-tyrosine, L-valine. EXAMPLE 15 Elimination of glycosylation sites of APAO. Some cytosolic enzymes, when designed for secretion by fusion with a heterologous signal peptide, lack fusion due to glycosylation at one or more potential glycosylation sites (amino acid consensus sequence NXS / T) that are not normally glycosylated at the native environment (Farrell LB, Beachy RN, Plant Mol Biol 15 (6): 821-5 (1990)). Since APAO lacks a recognizable signal sequence, it can be located cytoplasmically in Exophiala spinifera, although secretion by some other method that does not involve a signal peptide can not be excluded. APAO contains two potential glycosylation sites, which can potentially be glycosylated, when APAO is secreted in a vegetable or other eukaryotic cell. These glycosylation sites can be eliminated without accepting the function of the protein by site-directed mutagenesis using standard protocols (such as equipment available from CLONTECH Laboratories, Inc. (Palo Alto, CA)). The SEC. FROM IDENT. NO.:33 shows the amino acid sequence of a GST: APAO in which two amino acids of APAO have been changed by site-directed mutagenesis to eliminate two potential glycosylation sites. The polynucleotide sequence of SEQ. FROM IDENT. NO .: 33 can be ^^^ Ü ^^ ....... > .......... found in the SEC. FROM IDENT. NO .: 32. The first mutation changes asparagine at amino acid 201 from APAO to serine, and the second mutation changes serine at amino acid 206 from APAO to asparagine. Other mutations either at amino acids 200, 201, 202, 203, 204, 205, 206, or 207 of APAO, or a combination thereof, can also be designed to achieve the elimination of the glycosylation signal (Mellquist, JL Kasturi , L., Spitalnilc, SL, and Shakin-Eshelman, SH, 1998. The amino acid that follows a sequence of Asn-X-Ser / Thr is an important determinant of glycosylation efficiency of n-linked nucleus Biochemistry 37: 6833) . Other modifications for APAO can be made to improve its expression in a plant system, which includes site-directed mutagenesis to eliminate selected cysteine residues, which can be detrimental to proper folding when the protein is secreted into the endomembrane system to deliver to the apoplast . The cysteines are present in residues 64, 109, 167, 292, 351, 359, 387, 461, and 482, and may or may not be involved in the disulphide lattice in mature bent APAO. Using standard methods of site-directed mutagenesis, one or more of these residues can be substituted with alanine or other suitable amino acids, resulting in a modified version of APAO that retains its activity and specificity but exhibits better activity and stability in an extracellular environment. it's possible UM¡-ki-ri - iMíÍ --- i • ^ - '* • - "- * •" »« * ^ - ^ that one or more cysteines are involved in the covalent binding of the FAD portion to the protein APAO and the elimination of cysteine would be expected to reduce or repeal the activity. All publications and patent applications in this specification are indicative of the level of ordinary skill in the art to which this invention pertains. All publications and patent applications are incorporated herein for reference to the same extent as if each Individual publication or patent application was specific and individually indicated for reference. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be understood that many variations can be made and modifications while remaining within the spirit and scope of the invention.

^^^ H-É-U-tt-r-IIJI-? Iáli-Éi LIST OF SEQUENCE < 110 > Pioneer Hi-Bred International, Inc. nd CuraGen Corporation < 120 > Amino polyol amine oxidase polynucleotides and related polypeptides and methods use el30 > 0875-PCT < 150 > 60/092, 3ß < 151 > 1998-07-1S < 160 > 33 < 170 > FastSEQ for Windows Version 3.0 < 210 > 1 < 211 > 372 < 212 > DNA < 213 > Exophiala spimfera. < 400 > 1 gggccccggc gttctcgtag gctgcgcgga gttggtccca gacagacttt tgtcgtacct 60 gcttggactg ttgggaccac ttccgtcccg ggtctccgac catgaaacag gtaatggacc 120 attgtcgatc gacgtcgatg ctggtatctc gatggggtca tggcaaatga cagctcgatt 180 ggaggacgcc cgagaagcct tgttcgcgcc accacsgctt gtcccatacg aagactatct 240 gcccaggata tgctatagta gaattttccg ccaatgcttg cttctcggcg ggaagaggtg 300 gtgaaaatgt caaggtggga tacaaggttg tcggtaacga aaccapcacc tttttgcetc ggaacacggc 360 372 gs < 210 > 2 < 211 > 182 < 212 > DNA < 213 > Exophiala spinifera. < 400 > 2 gaattttccg ccaatgcteg cttctcggcg ggaagaggtg gtgaaaatgt caaggtggga 60 tacaaggttg tcggtaacga aaccaccacc tttttgcttc ggaacacggc gcccgaggcc 120 gatcgtactg cacagccgga tgccgactgc tcaatttcag cgacgggggt gttgaggtgc 180 ac 182 < 210 > 3 < 211 > 29 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Designed oligonucleotide for 3 'RACE, 2196S < 400 > 3 tggtttcgtt accgacaacc ttgtatccc 29 < 210 > 4 < 211 > 28 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Desiged ol gonucleotide for S 'RACE, N21968 <; 400 > 4 gagttggtcc cagacagact tttgtcgt 28 < 210 > 5 < 211 > 1389 < 212 > DNA < 213 > Exophiala spinifera < 220 > < 221 > CDS < 222 > (1) ... (1386) < 400 > 5 gac aac gtt gcg gac gtg gta gtg gtg ggc gct ggc ttg age ggt ttg 48 Asp Asn Val Wing Asp Val Val Val Gly Wing Gly Leu Ser Gly Leu 1 5 10 15 gag acg gca cgc aaa gtc cag gcc gcc ggt ctg tcc tgc ctc gtt < : tt 96 Glu Thr Wing Arg Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val Leu 20 25 30 gag gcg atg gat cgt gta ggg gga aag act ctg age gta ca g te ggt 144 Glu Ala Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly 35 40 45 ecc ggc agg acg act ate aac gac ctc ggc gct gcg tgg ate aat gac 192 Pro Gly Arg Tbr Thr lie Asn Asp Leu Gly Ala Wing Trp lie Asn Asp 50 55 60 age aac caa age gaa gta tcc aga ttg ttt gaa aga ttt cat ttg gag 240 Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu 65 70 75 80 ggc gag ctc cag agg acg act gga aat tea ate ca ca ca gca gca ca gac 288 Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser lie His Gln Wing Gln Asp 85 90 95 ggt here acct here gct ect tat ggt gac tcc ttg ctg age gag gag 336 Gly Thr Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Sex Glu Glu 100 105 110 gtt gca gt gt gt gt ctc gaa ctc ctc ecc gta tgg tet cag ctg ate 384 Val Ala Ser Ala Leu Ala Glu Leu Pro Val Trp Ser Gln Leu lie 115 120 125 gaa gag cat age ctt caa gac ctc aag gcg age ec t cag gcg aag cgg 432 Glu Glu Hie Ser Leu Gln Asp Leu Lys Wing Pro Pro Gln Wing Lys Arg 130 135 140 ctc gac agt gtg age ttc gcg falls tac tgt gag aag gaa cta aac ttg 480 Leu Asp Ser Val Ser Phe Ala His Tyr Cys Glu Lys Glu Leu Asn Leu 145 150 155 160 ect gct gtt ctc ggc gta gca aac cag ate a cgc gct ctg ctc ggt 528 Pro Wing Val Leu Gly Val Wing Asn Gln lie Thr Arg Wing Leu Leu Gly 165 170 175 gtg gaa gcc falls gag ate age atg ctt ttt ctc acc gac tac ate aag 576 Val Glu Ala His Glu lie Met Leu Phe Leu Thr Asp Tyx lie Lys 180 185 15C ¿¿¿& df? Agt gcc acc ggt ctc agt aat att ttc teg gac aag aaa gac ggc ggg 624 Ser Ala Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Aep Gly Gly 195 200 205 cag tat atg cga tgc aaa here ggt atg cag teg att tgc cat gcc atg 672 Gln Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys Hie Wing Met 210 215 220 tea aag gaa ctt gtt cea ggc tea gtg falls ctc aac acc ecc gtc gct 720 Ser Lys Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val Wing 225 230 23S 240 gaa att gag cag teg gea tcc ggc tgt here gta cga teg gcc teg ggc 768 Glu He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Ser Wing Ser Gly 245 250 255 gcc gtg ttc cga age aaa aag gtg gtg gtt teg tta ceg here acc ttg 816 Wing Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu 260 265 270 tat ecc acc ttg here ttt tea cea ect ctt ecc gcc gag aag ca gca 864 Tyr Pro Thr Leu Thr Phe Ser Pro Pro Leu Pro Wing Glu Lys Gln Wing 275 280 285 ttg gcg gaa aat tet ate ctg ggc tac tat age aag ata gtc ttc gta 912 Leu Ala Glu Asn Ser He Leu Gly Ty r Tyr Ser Lys He Val Phe Val 290 295 300 tgg gac aag ceg tgg tgg cgc gaa ca ggc ttc teg ggc gtc ctc ca 960 Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln 305 310 315 320 teg age tgt gac ecc ate tea ttt gec aga gat acc age ate gac gtc 1008 Ser Ser Cys Asp Pro Be Ser Phe Wing Arg Asp Thr Ser He Asp Val 325 330 335 gat cga cagg tgg tcc att acc tgt ttc atg gtc gga gac ceg gga cgg 1056 Asp Arg Gln Trp Ser He Thr Cys Phe Met Val Gly Asp Pro Gly? Rg 340 345 350 aag tgg tcc ca g tc c a g cag gta c aga t a g tc ggg tgg gac 1104 Lys Trp Ser Gln Gln Ser Lye Gln Val Arg Gln Lys Ser Val Trp? Sp 355 360 365 caá ctc cgc gca gcc tac gag aac gcc ggg gcc ca gtc cea gag < : cg 1152 Gln Leu Arg Ala Ala Tyr Glu Asn Ala Gly Ala Gln Val Pro Glu Pro 370 375 380 gcc aac gtg ctc gaa ate gag tgg teg aag cag tat ttc ca gga 1200 Wing Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Clly 385 390 395 400 gct ceg age gcc gtc tat ggg ctg aac gat ctc ctc ate ate ctg ggt t.cg 1248 Wing Pro Ser Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Ser 405 410 415 gcg ctc aga acg ceg ttc aag agt gtt cat ttc gtt gga acg gag acg 1296 Wing Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr 420 425 430 tet tta gtt tgg aaa ggg tat atg gaa ggg gcc ata cga teg ggt caa 1344 Ser Leu Val Trp Lys Gly Tyr Met Glu Gly Ala He Arg Ser Gly Clin ^^^ gjg g 435 440 44S cga ggt gct gca gaa gtt gtg gct age etg gtg cea gca gca gca 1386 Arg Gly Ala Ala Glu Val Val Ala Ser Leu Val Pro Ala Ala 450 455 460 tag 1389 < 210 > 6 < 211 > 462 < 212 > PRT < 213 > Exophiala spinifera < 400 > 6 Asp Asn Val Wing Aep Val Val Val Val Gly Ala Gly Leu Ser Gly Leu 1 5 10 15 Glu Thr Wing Arg Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val Leu 20 25 30 Glu Wing Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly 35 40 45 Pro Gly Arg Thr Thr lie Asn Asp Leu Gly Wing Wing Trp He Asn? Sp 50 55 60 Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu 65 70 75 ÍIO Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Wing Gln? Sp 85 90 95 Gly Thr Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu Olu 100 105 110 Val Wing Wing Wing Leu Wing Glu Leu Pro Val Trp Be Gln Leu lie 115 120 125 Glu Glu His Ser Leu Gln Asp Leu Lys Wing Pro Pro Gln Wing Lys Arg 130 135 140 Leu Asp Ser Val Ser Phe Wing Hie Tyr Cys Glu Ly3 Glu Leu Asn Leu 145 150 155 160 Pro Wing Val Leu Gly Val Wing Asn Gln He Thr Arg Wing Leu Leu Gly 165 170 175 Val Glu Wing His Glu He Being Met Leu Phe Leu Thr Asp Tyr He Lys 180 185 190 Being Wing Thr Gly Leu Being Asp He Phe Being Asp Lys Lys Asp Gly Gly 195 200 20 5 Gln Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Wing Met 210 215 220 Ser Lye Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val Wing 225 230 235 240 Glu He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Ser Wing Ser Gly 245 250 255 Wing Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu 260 265 270 Tyr Pro Thr Leu Thr Phe Pro Pro Pro Leu Pro Wing Glu Lys Gln Wing 275 280 285 Leu Ala Glu Asn Be He Leu Gly Tyr Tyr Ser Lys He Val Phe Val 290 295 300 Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln 305 310 315 320 Be Ser Cys Asp Pro Be Ser Phe Ala Arg Asp Thr Ser He Asp Val 325 330 335 Asp Arg Gln Trp Be He Thr Cys Phe Met Val Gly Asp Pro Gly Arg 340 34S 350 Lys Trp Ser Gln Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp Aep 355 360 365 Gln Leu Arg Wing Ala Tyr Glu Asn Ala Gly Ala Gln Val Pro Glu Pro 370 375 330 ^ ^ ^ ^ E ^^ jS ^^^^^^^^^^ _ ^^ ^ ^ ^^^^^ * ^^^ _ ^^^ ---__ ^ - ^^^ - ^^ - ^^^ _ ^ _ ^ - ^^^^^ ^ - ^^ gaa - i_ -am-j. «i Wing Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly 335 390 395 400 Wing Pro Be Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Ser 405 410 415 Wing Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr 420 425 430 Ser Leu Val Trp Lys Gly Tyr Met Glu Gly Wing He Arg Ser Gly Gln 435 440 445 Arg Gly Ala Ala Glu Val Val Ala Ser Leu Val Pro Ala Ala 450 455 460 < 210 > 7 < 211 > 1442 < 212 > DNA < 213 > Exophiala spinifera < 220 > < 221 > CDS < 222 > (1) ... (646) < 221 > intron < 222 > (647) ... (699) < 221 > CDS < 222 > (700) ... (1439) < 400 > 7 gac aac gtt gcg gac gtg gta gtg gtg ggc gct ggc ttg age ggt ttg 48 Asp Asn Val Wing Asp Val Val Val Gly Wing Gly Leu Ser Gly Leu 1 5 10 15 gag acg gca cgc aaa gtc cag gcc gcc ggt ctg tcc tgc ctc gtt ctt 96 Glu Thr Ala Arg Lys Val Gln Ala Wing Gly Leu Ser Cys Leu Val Leu 20 25 30 gag gcg atg gat cgt gta ggg gga aag act ctg age gta cag teg ggt 144 Glu Wing Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly 35 40 45 ecc ggc agg acg act ate aac gac ctc ggc gct gcg tgg ate aat gac 192 Pro Gly Arg Thr Thr He Asn Asp Leu Gly Wing Wing Trp He Asn Asp 50 55 60 age aac ca age gaa gta tcc aga ttg ttt gaa aga ttt cat ttg gag 240 Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu 65 70 75 80 ggc gag ctc cag agg acg act gga aat tea ate cat caca gca ca gac 288 Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Ala Gln Asp 85 90 95 ggt here ac act gct ect tat ggt gac tcc ttg age gag gag 336 Gly Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu 100 105 110 gtt gca gt gt gt ctt geg gaa ctc ctc ecc gta tgg tet cag ctg ate 384 Val Ala Be Ala Leu Ala Glu Leu Leu Pro Val Trp Ser G n Leu He 115 120 12S gaa gag cat age ctt caa gac ctc aag gcg age ect cag gcg aag cgg 432 Glu Glu His Ser Leu Gln Asp Leu Lys Ala Ser Pro Gln Ala Lys Arg 130 135 140 i i. s% ctc gac agt gtg age ttc gcg falls tac tgt gag aag gaa cta aac ttg 480 Leu Asp Ser Val Ser Phe Ala His Tyr Cys Glu Lys Glu Leu Asn Leu 145 150 155 160 ect gct gtt ctc ggc gta gca aac cag ate here cgc gct ctg ctc ggt 528 Pro Wing Val Leu Gly Val Wing Asn Gln He Thr Arg Wing Leu Leu Gly 165 170 175 gtg gaa gcc falls gag ate age atg ctt ttt ctc acc gac tac ate aag S76 Val Glu Ala His Glu He Ser Met Leu Phe Leu Thr Asp Tyr He Lys 180 185 190 agt gcc acc ggt ctc agt aat att ttc teg gac aag aaa gac ggc ggg 624 Ser Ala Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Asp Gly Gly 195 200 205 cag tat gtg cga tgc aaa here gtgcgtgtgg tgtcgtctca ggtgggggac 676 Gln Tyr Val Arg Cys Lys Thr 210 215 tcgtttctca gtggtcattc cag gt atg cag teg att tgc cat gcc atg tea 728 Gly Met Gln Ser He Cys His Wing Met Ser 220 225 aag gaa ctt gtt cea ggc tea gtg falls ctc aac acc ecc gtc gct gaa 776 Lys Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val Ala Glu 230 235 240 att gag cag teg gca tcc ggc tgt here gta cga teg gcc teg ggc gcc 824 He Glu Gln Be Wing Be Gly Cys Thr Val Arg Be Wing Be Gly Wing 245 250 2S5 gtg ttc cga age aaa aag gtg gtg gtt teg tta ceg here acc ttg tat 872 Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr 260 265 270 ecc acc ttg here ttt tea cea ect ctt ecc gee gag aag caa gca ttg 920 Pro Thr Leu Thr Phe Ser Pro Pro Leu Pro Wing Glu Lys Gln Wing Leu 275 280 285 gcg gaa aat tet ate ctg ggc tac tat age aag ata gtc ttc gta tgg 968 Wing Glu Asn Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp 290 295 300 305 gac aag ceg tgg tgg cgc gaa ca ggc ttc teg ggc gtc ctc ca te te 1016 Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser 310 315 320 age tgt gac ecc ate tea ttt gcc aga gat acc ate ate gac gtc gat 1064 Be Cys Aep Pro Be Ser Phe Ala Arg Asp Thr Ser He Asp Val Asp 325 330 335 cga cagg tgg tcc att acc tgt ttc atg gtc gga gac ceg gga cgg aag 1112 Arg Gln Trp Ser He Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys 340 345 350 tgg tcc caá cag tcc aag c ag gta cga caa aag tet gtc tgg gac ca 1160 Trp Ser Gln Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln 355 360 365 ctc cgc gca gcc tac gag aac gcc ggg gcc ca gtc cea gag ceg gcc 1208 6 i.

Leu Arg Wing Ala Tyr Glu Asn Wing Gly Wing Gln Val Pro Glu Pro Wing 370 375 380 385 aac gtg ctc gaa ate gag tgg teg aag cag tat ttc ca gga get 1256 Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Jila 390 395 400 ceg age gcc gtc tat ggg ctg aac gat ctc ctc ate ctc ggt teg gcg 1304 Pro Ser Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Ser? La 405 410 415 ctc aga acg ceg ttc aag agt gtt cat ttc gtt gga gga acg gag acg t: ct 1352 Leu Arg Thr Pro Phe Lys Ser Vai His Phe Val Gly Thr Glu Thr Ser 420 425 430 tta gtt tgg aaa ggg tat atg gaa ggg gcc ata cga teg ggt caa cga 1400 Leu Val Trp Lys Gly Tyr Met Glu Gly Wing He Arg Ser Gly Gln? Rg 435 440 445 ggt gct gca gaa gtt gtg gct age ctg gtg cea gca gca tag 1442 Gly Ala Ala Glu Val Val Ala Ser Leu Val Pro Ala Ala 450 455 460 < 210 > 8 < 211 > 462 < 212 > PRT < 213 > Exophiala spinifera < 400 > 8 Asp Asn Val Wing Asp Val Val Val Val Gly Wing Gly Leu Ser Gly Leu 1 5 10 15 Glu Thr Wing Arg Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val Leu 20 25 30 Glu Wing Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly 35 40 4S Pro Gly Arg Thr Thr He Asn Asp Leu Gly Wing Wing Trp He Asn? Sp 50 55 60 Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Cilu 65 70 75 .10 Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Wing Gln Asp 85 90 95 Gly Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu 100 105 110 Val Wing Wing Wing Leu Wing Glu Leu Pro Val Trp Ser Gln Leu He 115 120 125 Glu Glu His Ser Leu Gln Asp Leu Lys Wing Pro Pro Gln Wing Lys Arg 130 135 140 Leu Asp Ser Val Ser Phe Wing His Tyr Cys Glu Lys Glu Leu Asn Leu 145 150 155 360 Pro Ala Val Leu Gly Val Wing Asn Gln He Thr Arg Wing Leu Leu Gly 165 170 175 Val Glu Wing His Glu He Being Met Leu Phe Leu Thr Asp Tyr He Lys 180 185 190 Being Wing Thr Gly Leu Being Asn He Phe Being Asp Lys Lys Asp Gly Clly 195 200 205 Gln Tyr Val Arg Cys Lys Thr Gly Met Gln Ser He Cys His Wing Met 210 215 220 Ser Lys Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Value 225 230 235 .'40 Glu He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Ser Ala Ser Gly 24S 250 255 Wing Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu 260 265 270 Tyr Pro Thr Leu Thr Phe Ser Pro Pro Leu Pro Wing Glu Lys Gln Wing 275 280 285 Leu Ala Glu Asn Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val 290 295 300 Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln 305 310 315 320 Be Ser Cys Asp Pro Be Ser Phe Wing Arg Asp Thr Ser He Asp Val 325 330 335 Asp Arg Gln Trp Be He Thr Cys Phe Met Val Gly Asp Pro Gly? Rg 340 345 350 Lys Trp Ser Gln Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp? Sp 355 360 '365 Gln Leu Arg Ala Ala Tyr Glu Asn Ala Gly Ala Gln Val Pro Glu Pro 370 375 380 Wing Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly 385 390 39S «00 Ala Pro Ser Ala Val Tyr Gly Leu Asn Asp Leu He Tnr Leu Gly Ser 405 410 415 Ala Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr 420 425 430 Ser Leu Val Trp Lys Gly Tyr Met Glu Gly Wing He Arg Ser Gly Gln 435 440 445 Arg Gly Ala Ala Glu Val Val Ala Ser Leu Val Pro Ala Ala 450 455 460 < 210 > 9 < 211 > 458 < 212 > PRT < 213 > Exophiala spinifera < 400 > 9 Asp Asn Val Asp Val Val Val Val Gly Ala Gly Leu Ser Gly teu 1 5 10 15 Glu Thr Wing Arg Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val Leu 25 30 Glu Ala Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly 40 45 Pro Gly Arg Thr Thr He Asn Asp Leu Gly Ala Wing Trp He Asn Asp 50 55 60 Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu 65 70 75 B0 Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Wing Gln Asp 85 90 95 Gly Thr Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu 100 105 110 Val Ala Be Ala Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu He 115 120 125 Glu Glu His Ser Leu Gln Asp Leu Lys Ala Ser Pro Gln Ala Lys Arg 130 135 140 Leu Asp Ser Val Ser Phe Wing His Tyr Cys Glu Lys Glu Leu Asn Leu 145 150 155 160 Pro Ala Val Leu Gly Val Ala Asn Gln He Thr Arg Ala Leu Leu Gly 165 170 175 Val Glu Ala His Glu He Met Met Leu Phe Leu Thr Asp Tyr He Lys 180 185 190 Being Wing Thr Gly Leu Being Asn He Phe Being Asp Lys Lys Asp Gly Gly 195 200 205 Gln Tyr Val Arg Cys Lys Thr Gly Wing Cys Gly Val Val Ser Gly Gly 210 215 220 Gly Leu Val Ser Gln Trp Ser Phe Gln Val Cys Ser Arg Phe Wing Met 8 »& ^^^ 225 230 235 240 Pro Cys Gln Arg Asn Leu Phe Gln Wing Gln Cys Thr Ser Thr Pro Pro 245 250 255 Ser Leu Lys Leu Ser Ser Arg His Pro Wing Val Gln Tyr Asp Arg Pro 260 265 270 Arg Wing Pro Cys Ser Glu Wing Lys Arg Trp Trp Phe Arg Tyr Arg Gln 275 280 285 Pro Cys He Pro Pro His Phe His His Leu Phe Pro Pro Arg Ser Lys 290 295 300 His Trp Arg Lys He Leu Ser Trp Wing Thr He Wing Arg Ser Being Tyr 305 310 315 320 Gly Thr Being Arg Gly Gly Wing Asn Lys Wing Being Arg Wing Being Ser Asn 325 330 335 Arg Wing Val Thr Pro Ser His Leu Pro Glu He Pro Wing Ser Thr Ser 340 345 350 He Asp Asn Gly Pro Leu Pro Val Ser Trp Ser Glu Thr Arg Asp Gly 355 360 365 Ser Gly Pro Asn Ser Pro Ser Arg Tyr Asp Lys Ser Leu Ser Gly Thr 370 375 380 Asn Be Wing Gln Pro Thr Arg Thr Pro Gly Pro Lys Ser Qln Ser Arg 385 390 395 400 Pro Thr Cys Ser Lys Ser Ser Gly Arg Ser Ser Ser Be Ser Lys Glu 405 410 415 Leu Arg Pro Wing Pro Met Gly Thr He Ser Ser His Trp Val Arg Arg 420 425 430 Ser Glu Arg Arg Ser Arg Val Phe He Se r Leu Glu Arg Arg Arg Leu 435 440 445 Phe Gly Lys Gly He Trp Lys Gly Pro Tyr 450 455 < 210 > 10 < 211 > 1392 < 212 > DNA < 213 > Exophiala spinifera < 220 > < 221 > CDS < 222 > (1) ... (1389) < 22l > misc_feature < 222 > (1) ... (3) < 223 > Extra lysine in K: trAPAO < 400 > 10 aaa gac aac gtt gcg gac gtg gta gtg gtg ggc ggc ggc gt ggt 48 Lys Asp Asn Val Wing Asp Val Val Val Gly Wing Gly Leu Ser Gly 1 5 10 15 ttg gag acg gca cgc aaa gtc cag gcc gcc ggt ctg tcc tgc ctc gtt 96 Leu Glu Thr Wing Arg Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val 20 25 30 ctt gag gcg atg gat cgt gta ggg gga aag act ctg age gta caa teg 144 Leu Glu Wing Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser 35 40 45 ggt ecc ggc agg acg act ate aae gac ctc ggc gct gcg tgg ate aat 192 Gly Pro Gly Arg Thr Thr He Asn Asp Leu Gly Ala Wing Trp He Asn 50 55 60 gac age aac ca age gaa gta tcc aga ttg ttt gaa aga ttt cat ttg 240 Asp Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu ^ «Aal» 65 70 75 80 gag ggc gag ctc cag agg acg act gga aat tea ate cat ca g ca ca 288 Glu Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Ala Gln 85 90 95 gac ggt here ac act ac gct ect tat ggt gac tcc ttg ctg age gag 336 Asp Gly Thr Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu 100 105 110 gag gtt gca gt gt gt gtc gaa ctc ctc ecc gta gt tgg tet cag ctg 384 Glu Val Wing Be Ala Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu 115 120 125 ate gaa gag cat age ctt caa gac ctc aag gcg age ect cag gcg aag 432 He Glu Glu His Ser Leu Gln Asp Leu Lys Ala Ser Pro Gln Ala Lys 130 135 140 cgg ctc gac agt gtg age ttc gcg falls tac tgt gag aag gaa cta aac 480 Arg Leu A = p Ser Val Ser Phe Ala His Tyr Cys Glu Lys Glu Leu Asn 145 150 155 160 ttg ect gct gtt ctc ggc gta gca aac cag ate here cgc gct ctg ctc 528 Leu Pro Wing Val Leu Gly Val Wing Asn Gln He Thr Arg Ala Leu Leu 165 170 175 ggt gtg gaa gcc falls gag ate age atg ctt ttt ctc acc gac tac ate 576 Gly Val Glu Ala His Glu He is Met L eu Phe Leu Thr Asp Tyr He 180 185 190 aag agt gcc acc ggt ctc agt aat att ttc teg gac aag aaa gac ggc 624 Lys Ser Ala Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Asp Gly 195 200 205 ggg cag tat atg cga tgc aaa here ggt atg cag teg att tgc cat gcc 672 Gly Gln Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Wing 210 215 220 atg tea aag gaa ctt gtt cea ggc tea gtg falls ctc aac acc ecc gtc 720 Met Ser Lys Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val 225 230 235 240 gct gaa att gag cag teg gca tcc ggc tgt here gta cga teg gcc teg 768 Wing Glu He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Be Ala Ser 245 250 255 ggc gcg gtg ct age cg age aa g a g gtg gtg gtt teg tta ceg here aec 816 Gly Ala Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr 260 265 270 ttg tat ecc acc ttg here ttt tea cea ect ctt ecc gcc gag aag ca 864 Leu Tyr Pro Thr Leu Thr Phe Ser Pro Pro Leu Pro Wing Glu Lys Gln 275 280 285 gca ttg gcg gaa aat tet ate ctg ggc tac tat age aag ata gtc ttc 912 Ala Leu Ala Glu Asn Be He Leu Gly Tyr Tyr Ser Lys He Val Phe 290 295 300 gta tgg gac aag ceg tgg tgg cgc gaa ca gcc tcc teg gcc gtc ctc 960 Val Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu 305 310 315 320 10 eaa teg age tgt gac ecc ate tea ttt gcc aga gat acc ate ate gac 1008 Gln Ser Ser Cys Asp Pro Be Ser Phe Wing Arg Asp Thr Ser He Asp 325 330 335 gtc gat cga cag tgg tcc att acc tgt ttc atg gtc gga gac ceg gga 1056 Val Asp Arg Gln Trp Be He Thr Cys Phe Met Val Gly Asp Pro Gly 340 345 350 cgg aag tgg tca cag tcc aag cag gta cga caa aag tet gtc tgg 1104 Arg Lys Trp Ser Gln G ln Ser Lys Gln Val Arg Gln Lys Ser Val Trp 355 360 365 gac cac ccc cgc gca gcc tac gag aac gcc ggg gcc ca gtc cea gag 1152 Asp Gln Leu Arg Ala Ala Tyr Glu Asn Ala Gly Ala G n Val Pro Glu 370 375 380 ceg gcc aac gtg ctc gaa ate gag tgg teg aag cag tat ttc caa 1200 Pro Wing Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln 385 390 395 400 gga gct ceg age gcc gtc tat ggg ctg aac gat ctc tie here ctg ggt 1248 Gly Ala Pro Ser Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly 405 410 415 teg gcg ctc aga acg ceg ttc aag agt gtt cat ttc gtt gga acg gag 1296 Be Ala Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu 420 425 430 acg tet tta gtt tgg aaa ggg tat atg gaa ggg gcc ata cga teg ggt 1344 Thr Ser Leu Val Trp Lys Gly Tyr Met Glu Gly Wing He Arg Ser Gly 435 440 445 caá cga ggt gct gca gaa gtt gtg gct age ctg gtg cea gca gca 1389 Gln Arg Gly Ala Ala Glu Val Val Ala Ser Leu Val Pro Ala Ala 450 455 460 tag 1392 <;: 210 > 11 < : 211 > 463 < : 212 > PRT < : 213 > Exophiala spiml Eera < : 220 > < : 223 > Extra lysine in the polypeptide sequence of K: trAPAO, 463 aa. < • i00 > 11 Lys Asp Asn Val Wing Asp Val Val Val Gly Wing Gly Leu Ser Gly 1 5 10 15 Leu Glu Thr Wing Arg Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val 20 25 30 Leu Glu Wing Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser 35 40 45 Gly Pro Gly Arg Thr Thr He Asn Asp Leu Gly Wing Wing Trp He Asn 50 55 60 Asp Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu 65 70 75 80 Glu Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Wing Gln 85 90 95 Asp Gly Thr Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu 100 105 110 11 Glu Val Ala Be Ala Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu 115 120 125 He Glu Glu His Ser Leu Gln Asp Leu Lys Ala Ser Pro Gln Ala Lys 130 135 140 Arg Leu Asp Ser Val Ser Phe Ala His Tyr Cys Glu Lys Glu Leu Asn 145 150 155 160 Leu Pro Wing Val Leu Gly Val Wing Asn Gln He Thr Arg Wing Leu Leu 165 170 175 Gly Val Glu Wing His Glu He Being Met Leu Phe Leu Thr Asp Tyr He 180 185 190 Lys Ser Wing Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Asp Gly 195 200 205 Gly Gln Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Wing 210 215 220 Met Ser Lys Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val 225 230 235 240 Wing Glu He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Ser Wing Ser 245 250 255 Gly Wing Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr 260 265 270 Leu Tyr Pro Thr Leu Thr Phe Ser Pro Pro Leu Pro Wing Glu Lys Gln 275 280 285 Wing Leu Wing Glu Asn Ser He Leu Gly Tyr Tyr Ser Lye He Val Phe 290 295 300 Val Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu 305 310 315 320 Gln Ser Ser Cys Asp Pro Be Ser Phe Wing Arg Asp Thr Ser He Asp 325 330 335 Val Asp Arg Gln Trp Be He Thr Cys Phe Met Val Gly Asp Pro Gly 340 345 350 Arg Lys Trp Ser Gln Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp 355 360 365 Asp Gln Leu Arg Wing Wing Tyr Glu Asn Wing Gly Wing Gln Val Pro Glu 370 375 380 Pro Wing Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln 385 390 395 400 Gly Wing Pro Be Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly 405 410 415 Be Ala Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu 420 425 430 Thr Ser Leu Val Trp Lys Gly Tyr Met Glu Gly Ala He Arg Ser Gly 435 440 445 Gln Arg Gly Wing Wing Glu Val Val Wing Ser Leu Val Pro Wing Wing 450 455 460 < 210 > 12 < 211 > 34 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > First sequence designed for cloning DNA into expression vectors, N23256 < 400 > 12 ggggaattca aagacaacgt tgcggacgtg gtag 34 < 210 > 13 < 211 > 34 < 212 > DNA < 213 > Artificial Sequence 12 $ íd¡ < 220 > < 223 > First sequence designed for cloning DNA into expression vectors, N23259 < 400 > 13 ggggcggccg cctatgctgc tggcaccagg ctag 34 < 210 > 14 < 211 > 29 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Designed oligonucleotide for 3 'RACE, N21965 < 400 > 14 tggtttcgtt accgacaacc ttgtatccc 29 < 210 > 15 < 211 > 28 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Deeigned oligonucleotide for 5 'race, N 1968 < 400 > 15 gagttggtcc cagacagact tttgtcgt 28 < 210 > 16 < 211 > 1673 < 212 > DNA < 213 > Exophiala spinifera < 220 > < 221 > sig_peptide < 222 > (1) ... (267) < 223 > yeast alpha ma ing factor secretion signal. < 221 > CDS < 222 > (1) ... (1662) < 400 > 16 atg aga ttt ect tea att ttt act gct gtt tta ttc gca gca tcc tcc 48 Met Arg Phe Pro Be He Phe Thr Wing Val Leu Phe Wing Wing Ser Be -85 -80 -75 gca tta gct gct cea gtc aac act here gaa gat gaa acg gca caa 96 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Wing Gln -70 -65 -60 att ceg gct gaa gct gtc ate ggt tac tea gat tta gaa ggg gat ttc 144 He Pro Ala- Glu Ala Val He Gly Tyr Ser Asp Leu Glu Gly Asp Phe -55 -50 - 45 gat gtt gct gtt ttg cea ttt tcc aac age aa aat aac aac ggg tta ttg 192 Asp Val Wing Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu -40 -35 -30 ttt ata aat act act att gcc age att gct gct aaa gaa gaa ggg gta 240 Phe He Asn Thr Thr He Wing Be Wing Wing Wing Lys Glu Glu Gly Val -25 -20 -15 -10 13 *? -A- á. * tet ctc gag aaa aga gag gct gaa gct gaa ttc aaa gac aac gtt gcg 288 Ser Leu Glu Lys Arg Glu Wing Glu Wing Glu Phe Lys Asp Asn Val Wing -5 1 5 gac gtg gta gtg gtg ggc gct ggc ttg age ggt ttg gag acg gca cgc 336 Asp Val Val Val Gly Ala Gly Leu Ser Gly Leu Glu Thr Ala Arg 10 15 20 aaa gtc cag gcc gcc ggt ctg tcc tgc ctc gtt ctt gag gcg atg gat 384 Lys Val Gln Ala Wing Gly Leu Ser Cys Leu Val Leu Glu Wing Met Asp 25 30 35 cgt gta ggg gga aag act ctg age gta cag teg ggt ecc ggc agg acg 432 Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr 40 45 50 55 act ate aac gac ctc ggc gct gcg tgg ate aat gac age aac caa age 480 Thr He Asn Asp Leu Gly Wing Wing Trp He Asn Asp Ser Asn Gln Ser 60 65 70 gaa gta tcc aga ttg ttt gaa aga ttt cat ttg gag ggc gag ctc cag 528 Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln 7S 80 85 agg acg act gga aat ate ate caca gca ca gac ggt ac ac action 576 Arg Thr Thr Gly Asn Ser He H s Gln Ala Gln Asp Gly Thr Thr Thr Thr Thr Thr 90 95 100 here gct tct gct gct gac tcg ttg age gag gag gtt gca agt gca 624 Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Wing Wing Ala 105 110 115 ctt gcg gaa ctc ctc ecc gta tgg tet cag ctg ate gaa gag cat age 672 Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser 120 125 130 135 ctt caa gac ctc aag gcg age ect cag gcg aag cgg ctc gac agt gtg 720 Leu Gln Asp Leu Lys Wing Pro Pro Gln Wing Lys Arg Leu Asp Ser Val 140 145 150 age ttc gcg falls tac tgt gag aag gaa cta aac ttg ect gct gtt ctc 768 Ser Phe Wing His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Wing Val Leu 155 160 165 ggc gta gca aac cag ate here cgc gct ctg ctc ggt gtg gaa gcc falls 816 Gly Val Ala Asn Gln He Thr Arg Ala Leu Leu Gly Val Glu Ala His 170 175 180 gag ate age atg ctt ttt ctc acc gac tac ate aag agt gcc acc ggt 864 Glu He Ser Met Leu Phe Leu Thr Asp Tyr He Lys Ser Wing Thr Gly 185 190 195 ctc agt aat att ttc teg gac aag aaa gac ggc ggg cag tat atg cga 912 Leu Ser Asn He Phe Ser Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg 200 205 210 215 tgc aaa here ggt atg cag teg att tgc cat gcc atg tea aag gaa ctt 960 Cys Lys Thr Gly Met Gln Ser He Cys His Wing Met Ser Lye Glu Leu 220 225 230 gtt cea ggc tea gtg falls ctc aac acc ecc gtc gct gaa att gag cag 1008 14 Val Pro Gly Ser val His Leu Asn Thr Pro Val Wing Glu He Glu Gln 235 240 245 teg gca tcc ggc tgt here gta cga teg gcc teg ggc gcc gtg ttc cga 1056 Ser Ala Ser Gly Cys Thr Val Arg Ser Ala Ser Gly Ala Val Phe Arg 250 255 260 age aaa aag gtg gtg gtt teg tta ceg acta acc ttg tat ecc acc ttg 1104 Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu 265 270 275 here ttt tea ce ect ctt ecc gcc gag aag ca gca ttg gcg gaa aat 1152 Thr Phe Pro Pro Pro Leu Pro Wing Glu Lys Gln Wing Leu Wing Glu Asn 280 285 290 295 tet ate ctg ggc tac tat age aag ata gtc ttc gta tgg gac aag ceg 1200 Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro 300 305 310 tgg tgg cgc gaa ca ggc ttc teg ggc gtc ctc cag teg age tgt, .gac 1248 Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp 315 320 325 CCC ate ate ttt gcc aga gat aga gtc gat gat gtc gat caga tgg 1296 Pro He Ser Phe Wing Arg Asp Thr Ser He Aep Val Asp Arg Gln Trp 330 335 340 tcc att acc tgt ttc atg gt c gga gac ceg gga cgg aag tgg tcc ca 1344 Ser He Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln 345 350 355 cag tcc aag cag gta cga caa aag tet gtc tgg gac ca a ctc cgc gca 1392 Gln Ser Lys Gln Val Arg Gln Lye Ser Val Trp Asp Gln Leu Arg Wing 360 365 370 375 gcc tac gag aac gcc ggg gcc ca gtc cea gag ceg gee aac gtg ctc 1440 Wing Tyr Glu Asn Wing Gly Wing Gln Val Pro Glu Pro Wing Asn Val Leu 380 385 390 gaa ate gag tgg teg aag cag cag tat ttc ca gga gct ceg age gcc 1488 Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Wing Pro Ser Wing 395 400 405 gtc tat ggg ctg aac gat ctc ate ate ctg ggt teg gcg ctc aga acg 1536 Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Ser Ala Leu Arg Thr 410 415 420 ceg ttc aag agt gtt cat ttc gtt gga acg gag acg tet tta gtt tgg 1584 Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp 42S 430 435 aaa ggg tat atg gaa ggg gcc ata cga teg ggt caga cga ggt gct gca 1632 Lys Gly Tyr Met Glu Gly Wing He Arg Ser Gly Gln Arg Gly Wing the 440 445 450 455 gaa gtt gtg gct age ctg gtg cea gca gca taggcggccg c 1673 Glu Val Val Ala Ser Leu Val Pro Ala Ala 460 465 < 210 > 17 < 211 > 554 15 < 212 > PRT < 213 > Exophiala spinifera < 220 > < 221 > SIGNAL < 222 > (1) ... (89) < 223 > yeast alpha mat ng factor secretion signal. < 400 > 17 Met Arg Phe Pro Be He Phe Thr Ma Val Leu Phe Wing Wing Being -85 -80 -75 Wing Leu Ala Wing Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Wing Gln -70 -65 -60 He Pro Wing Ala Glu Wing Val He Gly Tyr Ser Asp Leu Glu Gly Asp Phe -55 -50 -45 Asp Val Wing Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu -40 -35 -30 Phe He Asn Thr Thr He Wing Be He Wing Wing Lys Glu Glu Gly Val -25 -20 -15 -10 Ser Leu Glu Lys Arg Glu Wing Glu Wing Glu Phe Lys Asp Asn Val? -5 1 5 Asp Val Val Val Val Gly Wing Gly Leu Ser Gly Leu Glu Thr Wing? rg 10 15 20 Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val Leu Glu Wing Met Asp 25 30 35 Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr 40 45 50 55 Thr He Asn Asp Leu Gly Ala Wing Trp He Asn Asp Ser Asn Gln Ser 60 65 70 Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln 75 80 85 Arg Thr Thr Gly Asn Ser He His Gln Wing Gln Asp Gly Thr Thr Thr 90 95 100 Thr Ala Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Ala Ser? La 105 110 115 Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser 120 125 130 135 Leu Gln Asp Leu Lys Ala Ser Pro Gln Ala Lys Arg Leu Asp Ser Val 140 145 150 Ser Phe Ala His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Wing Val Leu 155 160 165 Gly Val Wing Asn Gln He Thr Arg Wing Leu Leu Gly Val Glu Wing His 170 175 180 Glu He Being Met Leu Phe Leu Thr Asp Tyr He Lys Ser Wing Thr Gly 185 190 195 Leu Ser Asn He Phe Ser Asp Lye Asp Gly Gly Gln Tyr Met? Rg 200 205 210 215 Cys Lys Thr Gly Met Gln Ser He Cys His Wing Met Ser Lys Glu Leu 220 225 230 Val Pro Gly Ser Val His Leu Asn Thr Pro Val Wing Glu He Glu Gln 235 240 245 Ser Wing Be Gly Cys Thr Val Arg Ser Wing Wing Gly Wing Val Phe? Rg 250 255 260 Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu 265 270 275 Thr Phe Ser Pro Pro Leu Pro Wing Glu Lys Gln Ala Leu Ala Glu? Sn 280 285 290 295 Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lye Pro 300 305 310 Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cye Aep 315 320 325 Pro He Ser Phe Wing Arg Asp Thr Ser He Asp Val Asp Arg Gln Trp 16 330 335 340 Be He Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln 345 350 355 Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Wing 360 365 370 37S Wing Tyr Glu Asn Wing Gly Wing Gln Val Pro Glu Pro Wing Asn Val Leu 380 385 390 Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Wing Pro Ser Wing 395 400 405 Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Ser Wing Leu Arg Thr 410 415 420 Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp 425 430 435 Lys Gly Tyr Met Glu Gly Wing He Arg Ser Gly Gln Arg Gly Wing Wing 440 445 450 455 Glu Val Val Wing Ser Leu Val Pro Wing Wing 460 465 < 210 > 18 < 211 > 2079 < 212 > DNA < 213 > A nown < 220 > < 221 > CDS < 222 > (1) ... (2076) < 223 > GST: K: trAPAO 2079 nt. Translation starting at nt. 1-687, gst fusion + polylin er; 688-2076, K: trAPAO; 2077-2079, stop codon. By bacterial expression. < 22l > misc_feature < 222 > (1) ... (687) < 223 > gst merger + polylinker < 22l > misc_feature < 222 > (688) ... (2076) < 223 > K: trAPAO < 221 > miec_feature < 222 > (688) ... (690) < 223 > Extra lysine < 400 > 18 atg tcc ect ata cta ggt tat tgg aaa att aag ggc ctt gtg ca ecc 48 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 act cga ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg 96 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 tat gag cgc gat gaa gg gat aaa tgg cga aac aaa aag ttt gaa ttg 144 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lye Lys Phe Glu Leu 35 40 45 ggt ttg gag ttt ecc aat ctt ect tat tat att gat ggt gat gtt aaa 192 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 tta here cag tet atg gcc ate ata cgt tat ata gct gac aag falls aac 240 17 Leu Thr Gln Ser Met Wing He He Arg Tyr He Wing Asp Lys His Asn 65 70 75 80 atg tg ggt ggt tgt cea aaa gag cgt gca gag att tea atg ctt gaa 288 Met Leu Gly Gly Cys Pro Lys Glu Arg Wing Glu He Ser Met Leu Glu 85 90 95 gga gcg gtt ttg gat att aga tac ggt gtt teg aga att gca tat agt 336 Gly Ala Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ala Tyr Ser 100 105 110 aaa gac t'tt gaa act ctc aaa gtt gat ttt ctt age aag cta ect gaa 384 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 atg ctg aaa atg ttc gaa gat cgt tta tgt cat aaa tat tat ata 432 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 ggt gat cat gta acó cat ect gac ttc atg ttg tat gac gct ctt gat 480 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 1S5 160 gtt gtt tta tac atg gac cea atg tgc ctg gat gcg ttc cea aaa tta 528 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Wing Phe Pro Lys Leu 165 170 175 gtt tgt ttt aaa aaa cgt att gaa gct ate cea caa att gat aag tac 576 Val Cys Phe Lys Lys Arg He Glu Wing He Pro ßln He Asp Lys Tyr 180 185 190 ttg aaa tcc age aag tat ata gca tgg ect ttg cag ggc tgg ca gcc 624 Leu Lys Ser Ser Lys Tyr He Wing Trp Pro Leu Gln Gly Trp Gln Wing 195 200 205 acg ttt ggt ggt ggc gac cat ect cea aaa teg gat ctg gtt ceg cgt 672 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 gga tcc ceg gaa ttc aaa gac aac gtt gcg gac gtg gta gtg gtg ggc 720 Gly Ser Pro Glu Phe Lys Asp Asn Val Wing Asp Val Val Val Val Gly 225 230 235 240 gct ggc ttg age ggt ttg gag acg gca cgc aaa gtc cag gcc gcc ggt 768 Wing Gly Leu Ser Gly Leu Glu Thr Wing Arg Lys Val Gln Wing Wing Gly 245 250 255 ctg tcc tgc ctc gtt ctt gag gcg atg gat cgt gta ggg gga aag act 816 Leu Ser Cys Leu Val Leu Glu Wing Met Asp Arg Val Gly Gly Lys Thr 260 265 270 ctg age gta caa teg ggt ecc ggc agg acg act ate aac gac ctc ggc 864 Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He Asn Asp Leu Gly 275 280 285 gct gcg tgg ate aat gac age aac caa age gaa gta tcc aga ttg ttt 912 Ala Ala Trp He Asn Asp Ser Asn Gln Ser Glu Val Ser Arg Leu Phe 290 295 300 gaa aga ttt cat ttg gag ggc gag ctc cag agg acg act gga aat tea 960 Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser 305 310 315 320 18 ate cat caca gca ca gac ggt here acc acct gct ect tat ggt gac 1008 He H s Gln Wing Gln Asp Gly Thr Thr Thr Thr Wing Pro Tyr Gly Asp 325 330 335 tcc ttg ctg age gag gag gtt gca agt gca ctt gcg gaa ctc ctc ecc 1056 Ser Leu Leu Ser Glu Val Ala Wing Ala Wing Leu Glu Leu Leu Pro 340 345 350 gta tgg tet cag ctg ate gaa gag cat age ctt caa gac ctc aag gcg 1104 Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln Asp Leu Lys. Ma 355 360 365 age ect cag gcg aag cgg ctc gac agt gtg age tcc gcg cae tac tgt 1152 Ser Pro Gln Ala Lys Arg Leu Asp Ser Val Ser Phe Wing His Tyr Cys 370 375 380 gag aag gaa cta aac ttg ect gct gtt ctc ggc gta gca aac cag ate 1200 Glu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val Wing Asn Gln He 385 390 395 400 here cgc gct ctg ctc ggt gtg gaa gcc falls gag ate age atg ctt ttt 1248 Thr Arg Ala Leu Leu Gly Val Glu Ala His Glu He Ser Met Leu Phe 405 410 415 ctc acc gac tac ate aag ag t gcc acc ggt ctc agt aat att ttc teg 1296 Leu Thr Asp Tyr He Lys Ser Wing Thr Gly Leu Ser Asn He Phe Ser 420 425 430 gac aag aaa gac ggc ggg cag tat atg cga tgc aaa here ggt atg cag 1344 Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys Thr Gly Met Gln 435 440 445 teg att tgc cat gcc atg tea aag gaa ctt gtt cea ggc tea gtg falls 1392 Ser He Cys His Wing Met Ser Lys Glu Leu Val Pro Gly Ser Val His 450 455 460 ctc aac acc ecc gtc gct gaa att gag cag teg gca ccc ggc tgt here 1440 Leu Asn Thr Pro Val Wing Glu He Glu Gln Ser Wing Ser Gly Cys Thr 465 470 475 480 gta cg teg gcc teg ggc gcc gtg ttc cga age aaa aag gtg gtg gtt 1488 Val Arg Ser Ala Ser Gly Ala Val Phe Arg Ser Lys Lys Val Val Val 485 490 495 teg tta ceg here acc ttg tat ecc acc ttg here ttt tea cea ect ctt 1536 Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe Ser Pro Pro Leu 500 505 510 ecc gcc gag aag ca gca ttg gcg gaa aat tet ate ctg ggc tac tat 1584 Pro Ala Glu Lys Gln Ala Leu Ala Glu Asn Ser He Leu Gly Tyr Tyr 515 52 0 525 age aag ata gtc ttc gta tgg gac aag ceg tgg tgg cgc gaa ca ggc 1632 Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly 530 535 540 ttc teg ggc gtc ctc cag teg age tgt gac ecc ate tea ttt gcc aga 1680 Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro He Ser Phe Wing Arg 545 550 555 560 gat acc age ate gac gtc gat cga ca tgg tcc att acc tgt ttc atg 1728 19 > - ^^ -Asp Thr Ser He Asp Val Asp Arg Gln Trp Ser He Thr Cys Phe Met 565 570 575 gtc gga gac ceg gga cgg aag tgg tcc ca g acc caag gta ega 1776 Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser Lys Gln Val Arg 580 585 590 caa aag tet gtc tgg gac cac ctc cgc gca gcc tac gag aac gcc ggg 1824 Gln Lys Ser Val Trp Asp Gln Leu Arg Wing Ala Tyr Glu Asn Wing Gly 595 600 605 gcc ca gtc cea * ceg gcc aac gtg ctc gaa ate gag tgg teg aag 1872 Wing Gln Val Pro Glu Pro Wing Asn Val Leu Glu He Glu Trp Ser ys 610 615 620 cag tat ttc ca g gct gct ceg age gcc gtc tat ggg ctg aac gat 1920 Gln Gln Tyr Phe Gln Gly Wing Pro Ser Wing Val Tyr Gly Leu? Sn? Sp 625 630 635 640 ctc ate here ctg ggt teg gcg ctc aga acg ceg ttc aag agt gtt oat 1968 Leu He Thr Leu Gly Be Wing Leu Arg Thr Pro Phe Lys Ser Val His 645 650 655 ttc gtt gga acg gag acg tet tta gtt tgg aaa ggg tat atg gaa ggg 2016 Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly Tyr Met Glu «ly 660 665 670 gcc ata cga teg ggt caa cga ggt gct gca gaa gtt gtg gct age c-tg 2064 Ala He Arg Ser Gly Gln Arg Gly Ala Ala Glu val Val Ala Ser l < eu 675 680 685 gtg cea gca gca tag 2079 Val Pro? La Ala 690 < 210 > 19 < 211 > 692 < 212 > PRT < 213 > Unknown < 220 > < 223 > GST:: K: trAPAO; GST + linXer, aa 1-229; K:: RAPAO, aa 230--692 < 400 > 19 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu H s leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 Leu Thr Gln Ser Met Wing He He Arg Tyr He Ala? Sp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu He Ser Met Leu Glu 85 90 95 Gly Ala Val Leu Asp He Arg Tyr Gly Val Ser Arg He Wing Tyr Ser 100 105 110 Lye Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 20 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Wing Phe Prc Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg He Glu Wing He Pro Gln He Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr He Wing Trp Pro Leu Gln Gly Trp Gln Wing 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 Gly Ser Pro Glu Phe Lys Asp Asn Val Wing Asp Val Val Val Val Gly 225 230 235 240 Wing Gly Leu Ser Gly Leu Glu Thr Wing Arg Lys Val Gln Wing Wing Gly 245 250 255 Leu Ser Cys Leu Val Leu Glu Wing Met Asp Arg Val Gly G ly Lys Thr 260 265 270 Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He Asn Asp Leu Gly 275 280 285 Wing Wing Trp He Asn Asp Ser Asn Gln Ser Glu Val Ser Arg Leu Phe 290 295 300 Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser 305 310 315 320 He His Gln Wing Gln Asp Gly Thr Thr Thr Wing Pro Tyr Gly Asp 325 330 335 Ser Leu Leu Ser Glu Glu Val Wing Ser Ala Leu Ala Glu Leu Leu Pro 340 345 350 Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln Asp Leu Lys Wing 355 360 365 Ser Pro Gln Wing Lys Arg Leu Asp Ser Val Ser Phe Wing His Tyr Cys 370 375 380 Glu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val Wing Asn Gln He 385 390 395 400 Thr Arg Wing Leu Leu Gly Val Glu Wing His Glu He Being Met Leu Phe 405 410 415 Leu Thr Asp Tyr He Lys Ser Wing Thr Gly Leu Ser Asn He Phe Ser 420 425 430 Asp Lys Lys Asp Gly Gly G n Tyr Met Arg Cys Lys Thr Gly Met Clin 435 440 445 Ser He Cys His Wing Met Ser Lys Glu Leu Val Pro Gly Ser Val His 450 4S5 460 Leu Aen Thr Pro Val Wing Glu He Glu Gln Se r Wing Ser Gly Cys Thr 465 470 475 4180 Val Arg Ser Wing Ser Gly Wing Val Phe Arg Ser Lys Lys Val Val Val 485 490 495 Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe Ser Pro Pro I, eu 500 505 510 Pro Wing Glu Lys Gln Wing Leu Wing Glu Asn Ser He Leu Gly Tyr Tyr 515 520 525 Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp Arg Glu Gln CSly S30 535 540 Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro Be Ser Phe Ala? Rg 545 550 555 560 Asp Thr Ser He Asp Val Asp Arg Gln Trp Ser He Thr Cys Phe Met 565 570 575 Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser Lys Gln Val? Rg 580 585 590 Gln Lys Ser Val Trp Aep Gln Leu Arg Wing Wing Tyr Glu Asn Wing Gly 595 600 605 Wing Gln Val Pro Glu Pro Wing Asn Val Leu Glu He Glu Trp Ser Lys 610 615 620 21.1 i Gln Gln Tyr Phe Gln Gly Wing Pro Ser Wing Val Tyr Gly Leu Asn Asp 625 630 635 640 Leu He Thr Leu Gly Be Wing Leu Arg Thr Pro Phe Lys Ser Val His 645 650 655 Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly Tyr Met Glu Gly 660 665 670 Wing He Arg Ser Gly Gln Arg Gly Wing Wing Glu Val Val Wing Ser Leu 675 680 685 Val Pro Wing Wing 690 < 210 > 20 < 211 > 1464 < 212 > DNA < 213 > Onknown < 220 > < 221 > sig_peptide < 222 > (1) ... (72) < 223 > Barley Alpha Amylase signal sequence. < 221 > m? sc_feature < 222 > (73) ... (1464) < 223 > K: trAPAOcDNA < 221 > CDS < 222 > (1) ... (1461) < 223 > Nucleotide sequence of K: trAPAO translational fusion with barley alpha amylase signal seguence, for expression and secretion of saturation trAPAO in maize. Nucleotides 1-72, barley alpha amylase signal eeguence, nucleotides 73-75, added lysine residue; nucleotides 76-1464, trAPAO cDNA. < 22l > misc_feature < 222 > (73) ... (75) < 223 > Added lysine reeidue < 400 > 20 atg gcc aac aag fall ctg age ctc tcc ctc ttc ctc gtg ctc ctc ggc 48 Met Wing Asn Lys His Leu Ser Leu Ser Leu Phe Leu Val Leu Leu Gly -20 -15 -10 ctc tcc gcc tcc ctc gcc age ggc aaa gac aac gtt gcg gac gtg gta 96 Leu Ser Wing Ser Leu Wing Ser Gly Lys Asp Asn Val Wing Asp Val Val -5 1 5 gtg gtg ggc gct ggc ttg age ggt ttg gag acg gca cgc aaa gtc cag 144 Val Val Gly Ala Gly Leu Be Gly Leu Glu Thr Wing Arg Lys Val Gln 10 15 20 gcc gcc ggt ctg tcc tgc ctc gtt ctt gag gcg atg gat cgt gta ggg 192 Wing Wing Gly Leu Ser Cys Leu Val Leu Glu Wing Met Asp Arg Val Gly 25 30 35 40 gga aag act ctg age gta cag teg ggt ecc ggc agg acg act ate aac 240 Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He Asn 45 50 55 gac ctc ggc gct gcg tgg ate aat gac age aac caa age gaa gta tcc 288 Asp Leu Gly Wing Wing Trp He Asn Asp Ser Asn Gln Ser Glu Val Ser 22 60 65 70 aga ttg ttt gaa aga ttt cat ttg gag ggc gag ctc cag agg acg.ict 336 Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr Thr 75 80 85 gga aat tea ate ca ca gca ca g ga ggt here ac act gct ect 384 Gly Asn Ser He His Gln Wing Gln Asp Gly Thr Thr Thr Thr Wing Pro 90 95 100 tat ggt gac tcc ttg age gag gag gag gtt gca agt gca ctt gcg gaa 432 Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Ala Ser Ala Leu Ala Glu 105 110 115 120 ctc ctc ecc gta tgg tet cag ctg ate gaa gag cat age ctt ca gac 480 Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln? Sp 125 130 135 ctc aag gcg age ect cag gcg aag cgg ctc gac agt gtg age ttc gcg 528 Leu Lys Ala Pro Pro Gln Ala Lys Arg Leu Asp Ser Val Ser Phe.? La 140 145 150 falls tac tgt gag aag gaa cta aac ttg ect gct gtt ctc ggc gta gca 576 His Tyr Cye Glu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val? La 155 160 165 aac cag ate here cgc gct ctg gt gtg gaa gcc falls gag ate age 624? sn Gln He Thr Arg Wing Leu Leu Gly Val Glu Wing His Glu He Ser 170 175 180 atg ctt ttt ctc acc gac tac ate aag agt gcc acc ggt ctc agt aat 672 Met Leu Phe Leu Thr Asp Ty r He Lys Ser Wing Thr Gly Leu Ser Asn 185 190 195 200 att ttc teg gac aag aaa gac ggc ggg cag tat atg cga tgc aaa here 720 He Phe Ser Asp Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys Thr 205 210 215 ggt atg cag teg att tgc cat gcc atg tea aag gaa ctt gtt cea ggc 768 Gly Met Gln Ser He Cys His Wing Met Ser Lys Glu Leu Val Pro Gly 220 225 230 tea gtg falls ctc aac acc ecc gtc gct gaa att gag cag teg gca t.cc 816 Ser Val His Leu Aen Tnr Pro Val Wing Glu He Glu Gln Ser Wing Ser 235 240 245 ggc tgt here gta cga teg gcc teg ggc gcc gtg ttc cga age aaa aag 864 Gly Cys Thr Val Arg Ser Ala Ser Gly Wing Val Phe Arg Ser Lys Lys 250 255 260 gtg gtg gtt teg tta ceg here acc ttg tat ecc acc ttg here ttt tea 912 Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe Ser 265 270 275 280 cea ect ctt ecc gcc gag aag ca gca gtg gcg gaa aat tet ate ctg 960 Pro Pro Leu Pro Wing Glu Lys Gln Wing Leu Wing Glu Asn Ser He Leu 285 290 29S ggc tac tat age aag ata gtc ttc gta tgg gac aag ceg tgg t gg cgc 1008 Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp Arg 300 305 310 gaa ca ggc tcg teg ggc gtc ctc ca teg age tgt gac ecc ate tea 1056 Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro lie- Ser 315 320 325 ttt gcc aga gat gat age ate gac gtc gat cga caa rgg tcc att acc 1104 Phe Wing Arg Asp Thr Ser He Asp Val Asp Arg Gln Trp Ser He Thr 330 335 340 tgt ttc atg gtc gga gac ceg gga cgg aag tgg tcc cag tcc aag 1152 Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser Lys 345 350 355 360 cag gta cga caa aag tet gtc tgg gac cac ccc cgc gca gcc tac 1200 Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Ala Wing Tyr Glu 365 370 375 aac gcc ggg gcc ca gtc cea ceg gcc aac gtg ctc gaa ate 1248 Asn Wing Gly Wing Gln Val Pro Glu Pro Wing Asn Val Leu Glu He Glu 380 385 390 tgg teg aag cag tat ttc ca gga gct ceg age gcc gtc tat ggg 1296 Trp Being Lys Gln Gln Tyr Phe Gln Gly Wing Pro Being Wing Val Tyr Gly 395 400 405 ctg aac gat ctc ate ctc ggt teg gcg ctc aga acg ceg ttc aag 1344 Leu Asn Asp Leu He Thr Leu Gly Ser Ala Leu Arg Th r Pro Phe Lys 410 415 420 agt gtt cat ttc gtt gga acg acg tet tta gtt tgg aaa ggg tat 1392 Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly Tyr 425 430 435 440 atg gaa ggg gcc ata cga teg ggt caga cg ggt gct gca gaa gtt gtg 1440 Met Glu Gly Ala He Arg Ser Gly Gln Arg Gly Ala Ala Glu Val Val 445 450 455 gct age ctg gtg cea gca gca tag 1464 Ala Ser Leu Val Pro Ala Ala 460 < 210 > 21 < 211 > 487 < 212 > PRT < 213 > Dn novm < 220 > < 221 > SIGNAL < 222 > (1) ... (24) < 223 > K: trAPAO translational fusion with barley alpha amylase signal sequence, for expression and secretion of the mature trAPAO in raaize. < 400 > 21 Met Ala? Sn Lys His Leu Ser Leu Ser Leu Phe Leu Val Leu Leu Gly -20 -15 -10 Leu Ser Wing Ser Leu Wing Ser Gly Lys Asp Asn Val Wing Asp Val Val -5 1 5 Val Val Gly Wing Gly Leu Ser Gly Leu Glu Thr Wing Arg Lys Val Gln 10 15 20 Wing Wing Gly Leu Ser Cys Leu Val Leu Glu Wing Met Asp Arg Val Gly 24 ^ ¿< t * & k & amp; amp; amp; 25 25 35 35 Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He Asn 45 50 55 Asp Leu Gly Wing Wing Trp He Asn Asp Ser Asn Gln Ser Glu Val Ser 60 65 70 Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr Thr 75 80 85 Gly Asn Ser He His Gln Wing Gln Asp Gly Thr Thr Thr Thr Wing Pro 90 95 100 Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Wing Ser Ala Leu Wing Glu 105 110 115 120 Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln Aep 125 130 135 Leu Lys Wing Pro Pro Gln Wing Lys Arg Leu Asp Ser Val Ser Phe Wing 140 145 ISO His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val Wing 155 160 165 Asn Gln He Thr Arg Wing Leu Leu Gly Val Glu Wing His Glu He Ser 170 175 180 Met Leu Phe Leu Thr Asp Tyr He Lys Ser Wing Thr Gly Leu Ser Asn 185 190 195 200 He Phe Ser Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys Thr 205 210 215 Gly Met Gln Ser He Cys His Wing Met Ser Lys Glu Leu Val Pro Gly 220 225 230 Ser Val Hxs Leu Asn Thr Pro Val Wing Glu He Glu Gln Be Wing Ser 235 240 245 Gly Cys Thr Val Arg Ser Wing Wing Gly Wing Val Phe Arg Ser Lys Lys 250 255 260 Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe Ser 265 270 275 280 Pro Pro Leu Pro Wing Glu Lys Gln Ala Leu Ala Glu Asn Ser He Leu 285 290 295 Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp Arg 300 305 310 Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro He Ser 315 320 325 Phe Wing Arg Asp Thr Ser He Asp Val Asp Arg Gln Trp Ser He Thr 330 335 340 Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser Lys 345 350 355 360 Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Wing Ala Tyr Glu 365 370 375 Asn Wing Gly Wing Gln Val Pro Glu Pro Wing Asn Val Leu Glu He Glu 380 385 390 Trp Ser Lys Gln ßln Tyr Phe Gln Gly Wing Pro Ser Wing Val Tyr Gly 395 400 405 Leu Asn Asp Leu He Thr Leu Gly Be Wing Leu Arg Thr Pro Phe Lys 410 415 420 Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly Tyr 425 430 43S 440 Met Glu Gly Wing He Arg Ser Gly Gln Arg Gly Ala Ala Glu Val Val 445 450 455 Ala Ser Leu Val Pro Ala Ala 460 < 210 > 22 < 211 > 1803 < 212 > DNA < 213 > Exophiala spinifera < 220 > 25 * í < 221 > CDS < 222 > (1) .. (1800) < 400 > 22 atg gca ctt gca ceg age tac ate aat ecc cea aac gtc gcc ccc cea 48 Met Ala Leu Ala Pro Ser Tyr He Asn Pro Pro Asn Val Ala Ser Pro 1 5 10 15 gca ggg tat tet falls gtc ggc gta ggc cea gac gga ggg agg tat gtg 96 Wing Gly Tyr Ser His Val Gly Val Gly Pro Asp Gly Gly Arg Tyr Val 20 25 30 here ata gct gga cag att gga caa gac gct teg ggc gtg here gac ect 144 Thr He Wing Gly Gln He Gly Gln Asp Wing Ser Gly Val Thr Asp Pro 35 40 45 gcc tac gag aaa cag gtt gcc caca gca ttc gee aat ctg cga gct tgc 192 Wing Tyr Glu Lyß Gln Val Wing Ala Gln Wing Phe Wing Asn Leu Arg Wing Cys 50 55 60 ctt gct gca gtt gga gcc act tea aac gac gtc acc aag ctc aat tac 240 Leu Wing Wing Val Gly Wing Thr Ser Asn Asp Val Thr Lys Leu Asn Tyr 65 70 75 80 tac ate gtc gac tac gcc ceg age aaa ctc acc gca att gga gat ggg 288 Tyr He Val Asp Tyr Wing Pro Ser Lys Leu Thr Wing He Gly Asp Gly 85 90 95 ctg aag gct acc ttt gcc ctt gac agg ctc ect ect tgc acg ctg gtg 336 Leu Lys Wing Thr Phe Wing Leu Asp Arg Leu Pro Pro Cys Thr Leu V at 100 105 110 cea gtg teg gcc ttg tet toa ect gaa tac ctc ttt gag gtt gat gcc 384 Pro Val Ser Ala Leu Ser Ser Pro Glu Tyr Leu Phe Glu Val Asp Wing 115 120 125 acg gcg ctg gtg ceg gga falls acg acc cea gac aac gtt gcg gac gtg 432 Thr Wing Leu Val Pro Gly His Thr Thr Pro Asp Asn Val Wing Asp Val 130 135 140 gta gtg gtg ggc gct ggc ttg age ggt ttg gag acg gca cgc aaa gtc 480 Val Val Val Gly Ala Gly Leu Be Gly Leu Glu Thr Wing Arg Lys Val 145 150 155 160 cag gcc gcc ggt ctg tcc tgs ctc gtt ctt gag gcg atg gat cgt gta 528 Gln Ala Wing Gly Leu Ser Cys Leu Val Leu Glu Wing Met Asp Arg Val 165 170 175 gg ga aag act ctg age gta cag teg ggt ecc ggc agg acg act ate 576 Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He 180 185 190 aac gac ctc ggc gct gcg tgg ate aat gac age aac caa age gaa gta 624 Asn Asp Leu Gly Wing Wing Trp He Asn Asp Ser Asn Gln Ser Glu Val 195 200 205 tcc aga ttg ttt gaa aga ttt cat ttg gag ggc gag ctc cag agg acg 672 Ser Arg Leu Phe Glu Arg Phß His Leu Glu Gly Glu Leu Gln Arg Thr 210 215 220 act gga aat ate ate cat ca gca ca g ga g gt here ac act ac gct 720 Thr Gly Asn Ser He His Gln Ala Gln Asp Gly Thr Thr Thr? La 26 ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^ 225 230 235 240 ect tat ggt gac tcc ttg ctg age gag gag gtt gca agt gca ctt gcg 768 Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Ala Be Ala Leu .Ma 245 250 255 gaa ctc ctc ecc gta tgg tet cag ctg ate gaa gag cat age ctt caa 816 Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln 260 265 270 gac ctc aag gcg age ect cag gcg aag cgg ctc gac agt gtg age ttc 864 Asp Leu Lys Wing Pro Pro Gln Wing Lys Arg Leu Asp Ser Val Ser Phe 275 280 285 gcg falls tac tgt gag aag gaa cta aac ttg ect gct gtt ctc ggc gta 912 Ala His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val 290 295 300 gca aac cag ate here cgc gct ctg ctc ggt gtg gaa gcc falls gag ate 960 Wing Asn Gln He Thr Arg Wing Leu Leu Gly Val Glu Wing His ßlu He 305 310 315 320 age atg ctt ttt ctc acc gac tac ate aag agt gcc acc ggt ctc agt 1008 Ser Met Leu Phe Leu Thr Asp Tyr He Lys Ser Wing Thr Gly Leu Ser 325 330 335 aat att ttc teg gac aag aaa gac ggc ggg cag tat atg cga tgc aaa 1056 Asn He Phe Be Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys 340 345 350 here ggt atg cag teg att tgc cat gcc atg tea aag gaa ctt gtt cea 1104 Thr Gly Met Gln Ser He Cys His Ala Met Be Lys Glu Leu Val Pro, 355 360 365 ggc tea gtg fall ctc aac acc ecc gtc gct gaa att gag cag teg gca 1152 Gly Ser Val His Leu Asn Thr Pro Val Wing Glu He Glu Gln Ser Wing 370 375 380 tcc ggc tgt here gta cga teg gcc teg ggc gcg gtg ttc cga age aaa 1200 Ser Gly Cys Thr Val Arg Ser Ala Ser Gly Wing Val Phe Arg Ser Lys 385 390 395 400 aag gtg gtg gtt teg tta ceg here acc ttg tat ecc acc ttg here ttt 1248 Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe 405 410 415 tea cea ect ctt ecc gcc gag aag ca gca ttg gcg gaa aat tet ate 1296 Ser Pro Pro Leu Pro Wing Glu Lys Gln Wing Leu Wing Glu Asn Ser He 420 425 430 ctg ggc tac tat age aag ata gtc ttc gta tgg gac aag ceg tgg tgg 1344 Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp 435 440 445 cgc gaa ca ggc ttc teg ggc gtc ctc cag teg age tgt gac ecc ate 1392 Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro He 450 455 460 tea ttt gcc aga gat ate age ate gac gtc gat cga ca tgg tcc att 1440 Ser Phe Wing Arg Asp Thr Ser He Asp Val Aep Arg Gln Trp Ser He 465 470 47S 480 27 M- > "~ >? 'I .s-aa ^ a ^ acc tgt ttc atg gtc gga gac ceg gga cgg aag tgg aka caa cag ecc 1488 Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser G n Gln Ser 485 490 495 aag cag gta cga ca aag tet gtc tgg gac caa ctc cgc gca gcc tac 1536 Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Ala Ala Tyr 500 505 510 gag aac gcc ggg gcc caa gtc cea gag ceg gcc aac gtg ctc gaa tie 1584 Glu Asn Ala Gly Ala Gln Val Pro Glu Pro Ala Asn Val Leu Glu I 515,520,525 gag TGG TEG AAG cag cag tat ttc EAA GGA GCT ceg age gcc gtc tat 1632 Glu Trp Ser Lys Gln ßln Tyr Phe ßln Gly Ala Pro Ser Ala Val Tyr 530 S35 540 ggg CTG aac gat ctc ate here CTG GGT TEG GCG ctc aga ACG ceg ttc 1680 Gly Leu Asn Asp Leu He Thr Leu Gly Ser Ala Leu Arg Thr Pro Phe 545550555560 AAG AGT GTT cat ttc gtt gga acg gag acg tet tta gtt tgg aaa ggg 1728 Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly 565 570 575 tat atg gaa ggg gcc ata cga teg ggt caa cga ggt gct gca gaa gtt 1776 Tyr Met Glu Gly Ala He Ar g Ser Gly Gln Arg Gly Wing Wing Glu Val 580 585 590 gtg gct age ctg gtg cea gca gca tag 1803 Val Ala Ser Leu Val Pro Ala Ala 595 600 < 210 > 23 < 211 > 600 < 212 > PRT < 213 > Exophiala spinifera < 400 > 23 Met Ala Leu Ala Pro Ser Tyr He Asn Pro Pro Asn Val? La Ser Pro 1 5 10 15 Wing Gly Tyr Ser His Val Gly Val Gly Pro Asp Gly Gly Arg Tyr Val 20 25 30 Thr He Wing Gly Gln He Gly Gln Asp Ala Ser Gly Val Thr Asp Pro 35 40 45 Ala Tyr Glu Lys Gln Val Ala Gln Ala Phe Ala Asn Leu Arg Ala Cys 50 55 60 Leu Ala Ala Val Gly Ala Thr Ser Asn Asp Val Thr Lys Leu Asn? r 65 70 75 80 Tyr He Val Asp Tyr Wing Pro Ser Lys Leu Thr Wing He Gly Asp Gly 85 90 95 Leu Lys Wing Thr Phe Wing Leu Asp Arg Leu Pro Pro Cys Thr Leu Val 100 105 110 Pro Val Be Ala Leu Ser Ser Pro Glu Tyr Leu Phe Glu Val Asp Ma 115 120 125 Thr Wing Leu Val Pro Gly Hie Thr Thr Pro Asp Asn Val Wing Asp Val 130 135 140 Val Val Val Gly Wing Gly Leu Ser Gly Leu Glu Thr Wing Arg Lys Val 145 150 155 160 Gln Ala Wing Gly Leu Ser Cys Leu Val Leu Glu Wing Met Asp Arg Val 165 170 175 Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He 28 180 185 190 Asn Asp Leu Gly Wing Wing Trp He Asn Asp Ser Asn Gln Ser ßlu Val 195 200 205 Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr 210 215 220 Thr Gly Asn Ser He His Gln Wing Gln Asp Gly Thr Thr Thr Thr Wing 225 230 235 240 Pro Tyr Gly Asp Ser Leu Leu Ser Glu Val Glu Ala Ser Ala Leu a 245 250 255 Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser Leu Clin 260 265 270 Asp Leu Lys Ma Pro Pro Gln Ma Lys Arg Leu Asp Ser Val Ser Phe 275 280 285 Ma His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val 290 295 300 Ma Asn Gln He Thr Arg Ma Leu Leu Gly Val Glu Ma His Glu He 305 310 315 320 Being Met Leu Phe Leu Thr Asp Tyr He Lys Being Wing Thr Gly Leu Being 325 330 335 Asn He Phe Be Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys 340 345 350 Thr Gly Met Gln Ser He Cys His Ma Met Ser Lys Glu Leu Val Pro 355 360 365 Gly Ser Val His Leu Asn Thr Pro Val Ma Glu He Glu Gln Ser Wing 370 375 380 Ser Gly Cys Thr Val Arg Ser Ma Ser Gly Ma Val Phe Arg Ser Lys 385 390 395 400 Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe 405 410 415 Be Pro Pro Leu Pro Ma Glu Lys Gln Ma Leu Wing Glu Asn Be He 420 425 430 Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp 435 440 445 Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro He 450 455 460 Ser Phe Ma Arg Asp Thr Ser He Asp Val Asp Arg Gln Trp Ser He 465 470 475 480 Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser 485 490 495 Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Ma Ma Tyr 500 505 510 Glu Asn Ma Gly Ma Gln Val Pro Glu Pro Ma Asn Val Leu Glu He 515 520 525 Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Wing Pro Ser Ma Val Tyr 530 535 540 Gly Leu Asn Asp Leu He Thr Leu Gly Ser Ma Leu Arg Tnr Pro Phe 545 550 555 5S0 Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys GLy 565 570 575 Tyr Met Glu Gly Ma He Arg Ser Gly Gln Arg Gly Ma Ma Glu Val 580 585 590 Val Ma Ser Leu Val Pro Ala Ma 595 600 < 210 > 24 < 211 > 3003 < 212 > DNA < 213 > Onnown < 220 > < 223 > Sequence to a barley alpha amylase signal sequence: espl mat. an artificial spacer sequence 29 and K: trAPAO < 22l > sig_peptide < 222 > (1) ... (72) < 223 > Barley alpha amylase signal sequence < 223 > espl mat < 221 > misc_feature < 222 > (1576) .. (1611) < 223 > spacer sequence < 221 > misc_feature < 222 > (1612) ... (3000) < 223 > K: trAPAO < 221 > CDS < 222 > (1) ... (3000) < 22l > misc_feature < 222 > (1612) ... (1614) < 223 > Extra lysine < 400 > 24 atg gcc aac aag falls ctc age ctc tcc ctc ttc ctc gtg ctc ctc ggc 48 Met Ma Asn Lys His Leu Ser Leu Ser Leu Phe Leu Val Leu Leu Gly -20 -15 -10 ctc tcc gcc tcc ccc gcc age ggc gct cct act gtc aag att gat gct 96 Leu Ser Ma Ser Leu Ma Ser Gly Wing Pro Thr Val Lys He Asp Ma -5 1 5 ggg atg gtg gtc ggc acg act act act gtc ecc ggc acc act gcg acc 144 Gly Met Val Val Gly Thr Thr Thr Thr Thr Thr Thr Thr Thr Thr Ma Thr 10 15 20 gtc age gag ttc ttg ggc gtt ect ttt gcc gcc tet ceg here cga ttt 192 Val Ser Glu Phe Leu Gly Val Pro Phe Ma Ma Pro Pro Thr Arg Phe 25 30 35 40 gcg ect ect act cgt ecc gtg ect tgg tea ac g ect tt g ca gcc act 240 Ma Pro Pro Thr Arg Pro Val Pro Trp Ser Thr Pro Leu Gln Ma Thr 45 50 55 gca tat ggt cea gca tgc ect caaca ttc aat tac ecc gaa gaa ctc 288 Wing Tyr Gly Pro Ma Cys Pro Gln Gln Phe Asn Tyr Pro Glu Glu Leu 60 65 70 cgt gag att acg atg gcc tgg ttc aat here ceg ecc ceg tea gct ggt 336 Arg Glu He Thr Met Ma Trp Phe Asn Thr Pro Pro Pro Ser Ala Gly 75 80 85 gaa agt g ag gac tgc ctg aac ctc aac ate tac gtc cea gga act gag 384 Glu Ser Glu Asp Cye Leu Asn Leu Asn He Tyr Val Pro Gly Thr Glu 90 95 100 aac aac aaaa gcc gtc atg gtt tgg atag ggt ggt gg gg cg 432 Asn Thr Asn Lys Wing Val Met Val Trp He Tyr Gly Gly Ala Leu Glu 105 110 115 120 30 tat ggt tgg aat tea ttc falls ctt tac gac ggg gct agt ttc gc gcc 480 Tyr Gly Trp Asn Ser Phe His Leu Tyr Asp Gly Ma Ser Phe Ma Ma 125 130 135 aat cag gat gtc ate gcc gtg acc ate aac tac a g ac t a ct a ct g 528 Asn Gln Asp Val He Ma Val Thr He Asn Tyr Arg Thr Asn He Leu 140 145 150 ggg ttc ect gct gcc ect cag ctt cea ata here cag cga aat ctg ggg 576 Gly Phe Pro Wing Wing Pro Gln Leu Pro He Thr Gln Arg Asn Leu Gly 155 160 165 ttc cta gac caa agg ttt gct ttg gat tgg gta cag cgg aac ate gca 624 Phe Leu Aep Gln Arg Phe Ma Leu Asp Trp Val Gln Arg Asn He Ma 170 175 180 gcc ttt ggc ggt gat ect cg aag gtc here ata gtt ggg cag agg gg 672 Phe Gly Gly Asp Pro Arg Lys Val Thr He Phe Gly Gln Ser Ma 185 190 195 200 gcaa agt gtc gac gtc ctc ttg acg tet atg cea cae aac cea 720 Gly Gly Arg Ser Val Asp Val Leu Leu Thr Ser Met Pro His Asn Pro 205 210 215 ecc ttc cga gca gca ate atg gag tcc ggt gtg gct aac aac tac aac ttc 768 Pro Phe Arg Ma Ala He Met Glu Ser Gly Val Ma Asn Tyr Asn Phe 220 225 230 ecc aag gga gat ttg tcc gacc ect tgg aac ac act gtt ca gct cct 816 Pro Lys Gly Asp Leu Ser Glu Pro Trp Asn Thr Thr Val Gln Ala Leu 235 240 245 aac tgt acc acc ttt ttg ttg ttg agt tgt atg aga aga gtc gat 864 Asn Cys Thr Thr Ser He Asp He Leu Ser Cys Mßt Arg Arg Val Asp 250 255 260 ctc gcc act ctg atg aac acg ate gag cat ctc gga ctt ggg ttt gag 912 Leu Ma Thr Leu Met Asn Thr He Glu Gln Leu Gly Leu Gly Phe Glu 265 270 275 280 tac acg ttg gac aac gta acg gct gtg tac cgt tet gaa acg gct cgc 960 Tyr Thr Leu Asp Asn Val Thr Ma Val Tyr Arg Ser Glu Thr Ma Arg 285 290 295 acg act ggt gac att gct cgt gta ect gtt ctc gtc ggg acg gtg gcc 1008 Thr Thr Gly Asp He Ma Arg Val Pro Val Leu Val Gly Thr Val Ma 300 305 310 aac gac gga ett ctc ttt gtc ctc ggg gag aat gac acc ac gca tat 1056 Asn Asp Gly Leu Leu Phe Val Leu Gly Glu Asn Asp Thr Gln Ma Tyr 315 320 325 ctc gag gag gca ate ceg aat cag ecc gac ctt tac cag act ctc ctt 1104 Leu Glu Glu Ma He Pro Asn Gln Pro Aep Leu Tyr Gln Thr Leu Leu 330 335 340 gga gca tat ecc att gga tcc cea ggg ate gga teg ect caa gat cag 1152 Gly Ma Tyr Pro He Gly Ser Pro Gly He Gly Ser Pro Gla Asp Gln 345 350 355 360 att gcc gcc att gag acc gag gta aga ttc cag tgt ect tet gcc ate 1200 He Wing Wing He Glu Thr Glu Val Arg Phe Gln Cys Pro Wing I'm 31 365 370 375 < * gtg gct cag gac tcc cgg aat cgg ggt ate ect tet tgg cgc tac tac 1248 Val Ala Gln Asp Ser Arg Asn Arg Gly He Pro Ser Trp Arg Tyr Tyr 380 385 390 tac aat gcg acc ttt gag aat ctg gag ctt tec ect ggg tcc gaa gtg 1296 Tyr Asn Ma Thr Phe Glu Asn Leu Glu Leu Phe Pro Gly Ser Glu Val 395 400 405 tac falls age tet gaa gtc ggg atg gtg ttt ggc acg tat ect gtc gca 1344 Tyr His Ser Ser Glu Val Gly Met Val Phe Gly Thr Tyr Pro Val Ma 410 415 420 agt gcg acc gcc ttg gag gcc cag acg age aaa tac atg cag ggt gcc 1392 Ser Ala Thr Ma Leu Glu Ma Gln Thr Ser Lys Tyr Met Gln Gly Ma 425 430 435 440 tgg gcg gcc ttt gcc aaa aac ecc atg aat ggg ect ggg tgg aaa caa 1440 Trp Ala Ma Phe Ma Lys Asn Pro Met Asn Gly Pro Gly Trp Lys Gln 445 450 455 gtg ceg aat gtc gcg gcg ctt ggc tea cea ggc aaa gcc ate cag gtt 1488 Val Pro Asn Val Ma Ma Leu Gly Ser Pro Gly Lys Ma lie Gln Val 460 465 470 gac gtc tet cea gcg here ata gac caga cga tgt gcc ttg tac acg cgt 1536 Asp Val Ser Pro Wing Thr He Asp Gln Arg Cys Ma Leu Tyr Thr Arg 475 480 485 tat tat act tg gt ggc here gcg ceg agg a cá TTT GGC GGA GGC 1584 Tyr Tyr Thr Glu Leu Gly Thr I Ala Pro Arg Thr Phe Gly Gly Gly 490,495,500 age GGC GGA GGC age GGC GGA GGC age aaa gac aac GTT GCG GAC GTG 1632 Ser Gly Gly Gly Ser Gly Gly Gly Ser Lys Asp Asn Val Ma Asp Val 505 510 515 520 gta gtg gtg ggc gct ggc ttg age ggt ttg gag acg gca cgc aaa gtc 1680 Val Val Val Gly Ma Gly Leu Ser Gly Leu Glu Thr Ma Arg Lys Val 525 530 535 cag gcc gcc ggt ctg aka tgc ctc gtt ctt gag gcg atg gat cgt gta 1728 Gln Ma Ma Gly Leu Ser Cys Leu Val Leu Glu Ma Met Asp Arg Val 540 545 550 AAG ac ctg age gta caa teg ggt ecc ggc agg acg act ate 1776 Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He 555 560 565 aac gac ctc ggc gct gcg tgg ate aat gac age aac caa age gaa gta 1824 Asn Asp Leu Gly Ma Ma Trp He Asn Asp Ser Asn Gln Ser Glu Val 570 575 580 tcc aga ttg ttt gaa aga ttt cat ttg gag ggc gag ctc cag agg acg 1872 Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr 585 590 595 600 act gga aat tea ate cat caca gca ca gac ggt here ac act gpt 1920 Thr Gly Aen Ser He His Gln Wing Gln Asp Gly Thr Thr Thr Thr Ma 605 610 615 32 ? ^^^^? iM¡ &2¡ ^ ¡¡¡¡* ti ^ ect tat ggt gac tcc ttg ctg age gag gag gtt gca agt gca ctt gcg 1968 Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Ala Ser Ma Leu Ma 620 625 630 gaa ctc ctc ecc gta tgg tet cag ctg ate gaa gag cat age ctt caa 2016 Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln 635 640 645 gac ctc aag gcg age ect cag gcg aag cgg ctc gac agt gtg age ttc 2064 Asp Leu Lys Ma Ser Pro Gln Ala Lys Arg Leu Asp Ser Val Ser Phe 650 655 660 gcg falls tac tgt gag aag gaa cta aac ttg ect gct gtt ctc ggc gta 2112 Ma His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Ma Val Leu Gly Val 665 670 675 680 gca aac cag ate here cgc gct ctg ctc ggt gtg gaa gcc cae gag ate 2160 Ma Asn Gln He Thr Arg Ma Leu Leu Gly Val Glu Ma His Glu He 68S 690 695 age atg ctt ttt ctc acc gac tac ate aag agt gcc acc ggt ctc agt 2208 Being Met Leu Phe Leu Thr Asp Tyr He Lye Ser Ma Thr Gly Leu Ser 700 705 710 aat att ttc teg gac aag aaa gac ggc ggg cag tat atg cga tgc aaa 2256 Asn He Phe Ser Asp Lys Lye Asp Gly Gly Gln Tyr Met Arg Cys Lys 715 720 725 here ggt atg cag teg att tgc cat gcc atg tea aag gaa ctt gtt cea 2304 Thr Gly Met Gln Ser He Cys His Ma Met Ser Lys Glu Leu Val Pro 730 735 740 ggc tea gtg falls ctc aac acc ecc gtc gt gaa att gag cag teg gca 2352 Gly Ser Val His Leu Asn Thr Pro Val Ma Glu He Glu Gln Ser Ma 745 750 755 760 tcc ggc tgt here gta cga teg gcc teg ggc gcc gtg ttc cga age aaa 2400 Be Gly Cys Thr Val Arg Be Wing Be Gly Ma Val Phe Arg Ser Lys 765 770 775 aag gtg gtg gtt teg tta ceg here acc ttg tat ecc acc ttg here ttt 2448 Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe 780 785 790 tea cea ect ctt ecc gcc gag aag ca gca ttg gcg gaa aat tet ate 2496 Ser Pro Pro Leu Pro M Glu Lys Gln Ma Leu Ma Glu Asn Ser lie 795 800 805 ctg ggc tac tat age aag ata gtc ttc gta tgg gac aag ceg tgg tgg 2544 Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp 810 815 820 egc gaa ca ggc tcc teg ggc gte ctc cac teg age tgt gac ecc ate 2592 Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro He 825 830 835 840 tea ttt gcc aga gat gat age ate ate gcc gat cga caa tgg tcc att 2640 Be Phe Ma Arg Asp Thr Be He Asp Val Asp Arg Gln Trp Be He 845 850 855 acc tgt ttc atg gtc gga gac ceg gga cgg aag tgg tcc ca cag tcc 2688 Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser 33 860 865 870 aag cag gta cga caa aag tet gtc tgg gac cac ccc gc gcc tac 2736 Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Ma Ma Tyr 875 880 885 gag aac gcc gcc ca gtc cea gag ceg gcc aac gtg ctc gaa ate 2784 Glu Asn Ala Gly Ala Gln Val Pro Glu Pro Ma Asn Val Leu Glu lie 890 895 900 gag tgg teg aag cag tat ttc gg gg gg gg gg gtc gtc gtc tat 2832 Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Ma Pro Ser Ma Val Tyr 905 910 915 »20 ggg ctg aac gat ctc ate ate ctg ggt teg gcg ctc aga acg ceg ttc 2880 Gly Leu Asn Asp Leu He Thr Leu Gly Ser Ma Leu Arg Thr Pro Phe 925 930 935 aag agt gtt cat ttc gtt gga acg gag acg tet tta gtt tgg aaa ggg 2928 Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly 940 945 950 tat atg gaa ggg gcc ata cga teg ggt caa cga ggt gct gca gaa gtt 2976 Tyr Met Glu Gly Ma He Arg Ser Gly Glg Arg Gly Ma Ma Glu Val 9S5 960 965 gtg gct age gtg gtg cea gca gca tag 3003 Val Ala Ser Leu Val Pro Ma Ma 970 975 < 210 > 25 < 211 > 1000 < 212 > PRT < 213 > ünknown < 220 > < 221 > SIGNAL < 222 > (1) ... (24) < 400 > 25 Met Ma Asn Lys His Leu Ser Leu Ser Leu Phe Leu Val Leu Leu Gly -20 -15 -10 Leu Ser Ma Ser Leu Ma Ser Gly Ma Pro Thr Val Lys He Asp Ma -5 1 5 Gly Met Val Val Gly Thr Thr Thr Thr Val Pro Gly Thr Thr Ma Thr 10 15 20 Val Ser Glu Phe Leu Gly Val Pro Phe Ma Ma Pro Pro Thr Arg Phe 25 30 35 40 Ma Pro Pro Thr Arg Pro Val Pro Trp Ser Thr Pro Leu Gln Ala Thr 45 50 55 Ma Tyr Gly Pro Wing Cys Pro Gln Gln Phe Asn Tyr Pro Glu Glu Leu 60 65 70 Arg Glu He Thr Met Ma Trp Phe Asn Thr Pro Pro Pro Ser Ma Gly 75 80 85 Glu Ser Glu Asp Cys Leu Asn Leu Asn He Tyr Val Pro Gly Thr Glu 90 95 100 Asn Thr Asn Lys Ala Val Met Val Trp He Tyr Gly Gly Ma Leu Glu 105 110 115 120 Tyr Gly Trp Asn Ser Phe His Leu Tyr Asp Gly Ala Ser Phe Ala Ma 125 130 135 Asn Gln Asp Val He Ala Val Thr He Asn Tyr Arg Thr Asr. He Leu 34 140 145 150 Gly Phe Pro Ma Ma Pro Gln Leu * ro He Thr Gln Arg Asn Leu Gly 155 160 165 Phe Leu Asp Gln Arg Phe Ma Leu Asp Trp Val Gln Arg Asn He Ma 170 175 180 Wing Phe Gly Gly Asp Pro Arg Lys Val Thr He Phe Gly Gln Ser Ma 185 190 195 .200 Gly Gly Arg Ser Val Asp Val Leu Leu Thr Ser Met Pro His Asn Pro 205 210 215 Pro Phe Arg Ma Ma He Met Glu Ser Gly Val Ma Asn Tyr Asn Phe 220 225 230 Pro Lys Gly Asp Leu Ser Glu Pro Trp Asn Thr Thr Val Gln Ala Leu 235 240 245 Asn Cys Thr Thr Ser He Asp He Leu Ser Cys Met Arg Arg Val Asp 250 255 260 Leu Wing Thr Leu Met Asn Thr He Glu Gln Leu Gly Leu Gly Phe Glu 265 270 275 280 Tyr Thr Leu Asp Asn Val Thr Ma Val Tyr Arg Ser Glu Thr Ma Arg 285 290 295 Thr Thr Gly Asp He Ma Arg Val Pro Val Leu Val Gly Thr Val Ma 300 305 310 Asn Asp Gly Leu Leu Phe Val Leu Gly Glu Asn Asp Thr Gln Ma Tyr 315 320 325 Leu Glu Glu Ma He Pro Asn Gln Pro Asp Leu Tyr Gln Thr Leu Leu 330 335 340 Gly Wing Tyr Pro He Gly Ser Pro Gly He Gly Ser Pro Gln Asp Gln 345 350 355 360 He Wing Wing He Glu Thr Glu Val Arg Phe Gln Cys Pro Ser Ma He 365 370 375 Val Ma Gln Asp Ser Arg Asn Arg Gly He Pro Ser Trp Arg Tyr Tyr 380 385 390 Tyr Asn Wing Thr Phe Glu Asn Leu Glu Leu Phe Pro Gly Ser Glu Val 395 400 405 Tyr His Ser Ser Glu Val Gly Met Val Phe Gly Thr Tyr Pro Val Ma 410 415 420 Ser Ma Thr Ma Leu Glu Ma Gln Thr Ser Lys Tyr Mßt Gln Gly Ma 425 430 435 440 Trp Ma Ma Phe Ma Lys Asn Pro Met Asn Gly Pro Gly Trp Lys Gln 445 450 455 Val Pro Asn Val Wing Ma Leu Gly Ser Pro Gly Lys Ma He Gln Val 460 465 470 Asp Val Ser Pro Ma Thr He Asp Gln Arg Cys Ma Leu Tyr Thr Arg 475 480 485 Tyr Tyr Thr Glu Leu Gly Thr He Ma Pro Arg Thr Phß Gly Gly Gly 490 495 500 Ser Gly Gly Gly Ser Gly Gly Gly Ser Lys Asp Asn Val Ma Asp Val 505 510 515 S20 Val Val Val Gly Ala Gly Leu Ser Gly Leu Glu Thr Ma Arg Lys Val 525 530 535 Gln Ma Ala Gly Leu Ser Cys Leu Val Leu Glu Ala Met Asp Arg Val 540 545 550 Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He 555 560 565 Asn Asp Leu Gly Ma Wing Trp He Asn Asp Ser Asn Gln Ser Glu Val 570 575 580 Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr 585 590 595 600 Thr Gly Asn Ser He His Gln Wing Gln Asp Gly Thr Thr Thr Thr Thr Ma 605 610 615 Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Wing Ser Ma Leu Ma 620 625 630 Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln 35 635 640 645 Asp Leu Lys Ma Pro Pro Gln Ma Lys Arg Leu Asp Ser Val Ser Phe 650 655 660 Wing His Tyr Cys Glu Lye Glu Leu Asn Leu Pro Wing Val Leu Gly Val 665 670 675 680 Wing As n Gln He Thr Arg Ma Leu Leu Gly Val Glu Ma His Glu He 685 690 695 Being Met Leu Phe Leu Thr Asp Tyr He Lys Ser Ma Thr Gly Leu Ser 700 705 710 Asn He Phe Ser Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys 715 720 725 Thr Gly Met Gln Ser He Cys His Ma Met Ser Lys Glu Leu Val Pro 730 735 740 Gly Ser Val His Leu Asn Thr Pro Val Ma Glu He Glu Gln Ser Wing, 745 750 755 760 Ser Gly Cys Thr Val Arg Ser Ma Ser Gly Ma Val Phe Arg Ser Lys 765 770 775 Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe 780 785 790 Pro Pro Pro Leu Pro Ma Glu Lys Gln Ma Leu Ma Glu Asn Be He 795 800 805 Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp 810 815 820 Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro He 825 830 835 840 Ser Phe Wing Arg Asp Thr Ser He Asp Val Asp Arg Gln Trp Ser He 845 850 855 Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser 860 865 870 Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Ma Ala Tyr 875 880 885 Glu Asn Ma Gly Wing Gln Val Pro Glu Pro Ma Asn Val Leu Glu He 890 895 900 Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Ma Pro Ser Ma Val Tyr 905 910 915 920 Gly Leu Asn Asp Leu He Thr Leu Gly Ser Ma Leu Arg Thr Pro Phe 925 930 935 Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly 940 945 950 Tyr Met Glu Gly Ala He Arg Ser Gly Gln Arg Gly Ma Ma Glu Val 955 960 965 Val Ma Ser Leu Val Pro Ala Ma 970 975 <; 210 > 26 < 211 > 2976 < 212 > DNA < 213 > ün no n < 220 > < 223 > Barley alpha amylase signal sequence: mature BBST1: artificial spacer: and K: trAPAO. For plant expression. < 22l > sig_peptide < 222 > (1) ... (72) < 223 > Barley alpha amylase signal sequence. < 221 > mat_peptide < 222 > (73) ... (1545) < 223 > BEST1 mature 36 í 1 i < 221 > misc_feature < 222 > (1546) ... (1584) < 223 > Artificial spacer sequence < 221 > raisc_feature < 222 > (1585) ... (2973) < 223 > K: RAPAO < 221 > CDS < 222 > (1) ... (2973) < 221 > nusc_feature < 222 > (1585) ... (1587) < 223 > Extra lysine < 400 > 26 atg gcc aac aag falls ctc age ctc tcc ctc ttc ctc gtg ctc ctc ggc 48 Met Ma Asn Lys His Leu Ser Leu Ser Leu Phe Leu Val Leu Leu Gly -20 -15 -10 ctc tcc gcc ccc ccc gcc age ggc acg gat ttt ceg gre cgc agg acc 96 Leu Ser Ma Ser Leu Wing Ser Gly Thr Asp Phe Pro Val Arg Arg Thr -5 i "5 gat ctg ggc cag gtt cag gga ctg gcc ggg gac gtg atg age ttt cgc 144 Asp Leu Gly Gln Val ßln Gly Leu Ma Gly Asp Val Met Ser Phe Arg 10 15 20 gga ata ecc tat gc gcg ceg gg ggc gg gg ctg cgg tgg aag ceg 192 Gly He Pro Tyr Ma Ma Pro Pro Val Gly Gly Leu Arg Trp Lys Pro 25 30 35 40 ecc caá falls gcc cgg ecc tgg gcg ggc gtt cgc ecc gcc acc cat ttt 240 Pro Gln His Wing Arg Pro Trp Ma ßly Val Arg Pro to Thr Gln Phe 45 50 55 ggc tcc gac tgc ttc ggc gcg gcc tat ctt cgc aaa ggc age ctc gcc 288 Gly Ser Asp Cys Phe Gly Ma Ala Tyr Leu Arg Lys Gly Ser Leu Ma 60 65 70 ecc ggc gtg age gag gac tgt ctt tac ctc aac gta tgg gcg ceg tea 336 Pro Gly Val Ser Glu Asp Cys Leu Tyr Leu Asn Val Trp Ma Pro Ser 75 80 85 ggc gct aaa ecc ggc cag tac ecc gtc atg gtc tgg gtc tac ggc ggc 384 Gly Ala Lys Pro Gly Gln Tyr Pro Val Ket Val Trp Val Tyr Gly Gly 90 95 100 ggc ttc gcc ggc ggc acg gcc gcc atg ecc tac tac gac ggc gag gcg 432 Gly Phe Ma Gly Gly Thr Ma Ma Met Pro Tyr Tyr Asp Gly Glu Ma 105 110 115 120 ctt gcg cga cag ggc gtc gtc gtg gtg acg ttt aac tat cgg acg aac 480 Leu Ala Arg Gln Gly Val Val Val Val Thr Phe Asn Tyr Arg Thr Asn 125 130 135 ate ctg ggc ttt ttc gcc cat ect ggt ctc teg cgc gag age cce acc 528 He Leu Gly Phe Phe Ma His Pro Gly Leu Ser Arg Glu Ser Pro Thr 140 145 150 gga act teg ggc aac tac ggc cta ctc gac att ctc gcc gct ctt cgg 576 Gly Thr Ser Gly Asn Tyr Gly Leu Leu Asp He Leu Ala Wing Leu Arg 37 155 160 165 tgg gtg cag age aac gcc cgc gcc ttc gga ggg gac ecc ggc cga gtg 624 Trp Val Gln Ser Asn Ma Arg Ma Phe Gly Gly Asp Pro Gly Arg Val 170 175 180 acg gtc ttt ggt gaa teg gcc gga gcg age gcg ate gga ctt ctg ctc 672 Thr Val Phe Gly Glu Ser Ma Gly Ma Ser Ala He Gly Leu Leu Leu 185 190 195 200 acc teg ceg ctg age aag ggt ctc ttc cgt ggc gct ate ctc gaa agt 720 Thr Ser Pro Leu Ser Lys Gly Leu Phe Arg Gly Wing He Leu Glu Be 205 210 215 cea ggg ctg acg cga ceg ctc gcg acg ctc gcc gac age gcc gcc teg 768 Pro Gly Leu Thr Arg Pro Leu Ma Thr Leu Ma Asp Ser Ma Ma Ser 220 225 230 ggc gag cgc ctc gac gcc gat ctt teg cgc cgc teg acc gac cea 816 Gly Glu Arg Leu Asp Ma Asp Leu Ser Arg Leu Arg Ser Thr Asp Pro 235 240 245 gcc acc ctg atg gcg cgc gcc gcg gcg gcc cgc ceg gca teg cgg gac 864 Ma Thr Leu Met Ma? Rg Ma Asp Ma Ma Arg Pro Ma Ser Arg Asp 250 255 260 ctc cgc agg ceg cgt ceg acc ggc ce gtc cat ggc cat gtg ctg 912 Leu Arg Arg Pro Arg Pro Thr Gly Pro He Val Asp Gly His Va l Leu 265 270 275 2U0 ceg cag acc gac age gcg gcg ate gcg gcg ggg cag ctg gcg ceg gtt 960 Pro Gln Thr Asp Ser Ma Ma He Wing Ma Gly Gln Leu Ma Pro Val 285 290 295 cgg gtc ctg ate gga acc aat gcc gac gaa ggc cgc gcc tcc ctc ggg 1008 Arg Val Leu He Gly Thr Asn Ma Asp Glu Gly Arg Ma Phe Leu Gly 300 305 310 cgc gcg ceg atg gag acg cea gcg gac tac ca gcc tat ctg gag gcg 1056 Arg Ala Pro Met Glu Thr Pro Ma Asp Tyr Gln Wing Tyr Leu Glu Ma 315 320 325 cag ttt ggc gac ca gcc gcc gcc gtg gcg gcg tgc tat ecc ctc gac 1104 Gln Phe Gly Asp Gln Ma Ma Ma Val Ma Ma Cys Tyr Pro Leu Aíf 330 335 340 ggc cgg gcc acg ecc aag gaa atg gtc gcg cgc ate ttc ggc gac aat 1152 Gly Arg Wing Thr Pro Lys Glu Met Val Ma Arg He Phe Gly Asp Asn 345 350 355 360 cag ttc aat cgg ggg gtc teg gcc ttc teg gaa gcg ctt gtg cgc cag 1200 Gln Phe Asn Arg Gly Val Ser Wing Phe Ser Glu Ma Leu Val Arg GXn 365 370 375 ggc gcg ecc gtg tgg cgt tat cag ttc aac ggt aat acc gag ggt gga 1248 Gly Ma Pro Val Trp Arg Tyr Gln Phe Asn Gly Asn Thr Glu Gly Gly 380 385 390 aga gcg ceg gct acc fall gga gcc gaa att ecc tac gtt ttc ggg gtg 1296 Arg Ma Pro Ma Thr His Gly Wing Glu He Pro Tyr Val Phe Gly Val 395 400 405 38 iii * ttc aag ctc gac gag ttg ggt ctg ttc gattgg ceg ecc gag ggg ecc 1344 Phe Lys Leu Asp Glu Leu Gly Leu Phe Asp Trp Pro Pro Glu Gly Pro 410 415 420 acg ecc gcc gac cgt gcg ctg ggc caa ctg atg tcc tcc gcc tgg gtc 1392 Thr Pro to Asp Arg Ala Leu Gly Gln Leu Met Ser Ser Ma Trp Val 425 430 435 440 cgg ttc gcc aag aat ggc gac ecc gcc gac gee ctt acc tgg ect 1440 Arg Phe Ma Lys Asn Gly Asp Pro Wing Gly Asp Ma Leu Thr Trp Pro 445 450 4S5 gcc tat tet acg ggc aag teg acc atg here ttc ggt ecc gag ggc cge 1488 Ma Tyr Ser Thr Gly Lys Ser Thr Met Thr Phe Gly Pro Glu Gly Arg 460 465 470 gcg gcg gcg gtg teg ecc gga ect tcc ecc ect tgc gcg gat ggc 1536 Ma Ala Val Val Ser Pro Gly Pro Ser Pro Pro Cys Ma Asp Gly 475 480 485 gcc aag gcg ggg ggc gga ggc age ggc gga ggc age ggc gga ggc age 1584 Ma Lys Ma Gly Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Ser 490 495 500 aaa gac aac gtt gcg gac gtg gta gtg gtg ggc gct ggc ttg age ggt 1632 Lys Asp Asn Val Ma Asp Val Val Val Val G ly Ma Gly Leu Ser Gly 505 510 515 520 ttg gag acg gca cgc aaa gtc cag gee gcc ggt ctg tcc tgc ctc gtt 1680 Leu Glu Thr Ma Arg Lys Val Gln Wing Ma Gly Leu Ser Cys Leu Val 525 530 535 ctt gag gcg atg gat cgt gta ggg gga aag act ctg age gta cag teg 1728 Leu Glu Ma Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser 540 545 5S0 ggt ecc ggc agg acg act ate aac gac ctc ggc gct gcg tgg ate aat 1776 Gly Pro Gly Arg Thr Thr He Asn Asp Leu Gly Ma Ma Trp He Asn 555 560 565 gac age aac caa age gaa gta tcc aga ttg ttt gaa aga ttt cat ttg 1824 Asp Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu 570 575 580 gag ggc gag ctc cag agg acg act gga aat tea ate cat ca g ca ca 1872 Glu ßly ßlu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Ma Gln 585 590 595 600 gac ggt here ac act gct ect tat ggt gao tcc ttg ctg age gag 1920 Asp Gly Thr Thr Thr Thr Wing Pro Tyr Gly Asp Ser Leu Leu Ser Glu 605 610 615 gag gtt gca agt gca ctt gcg gaa ctc ctc ecc gta tgg tet cag ctg 1968 Glu Val Ma Ser Ala Leu Ma Glu Leu Leu Pro Val Trp Ser Gln Leu 620 625 630 ate gaa gag cat age ctt caa gac ctc aag gcg age ect cag gcg aag 2016 He Glu Glu His Ser Leu Gln Asp Leu Lys Ma Ser Pro Gln Ala Lys 635 640 645 cgg ctc gac agt gtg age ttc gcg falls tac tgt gag aag gaa cta aac 2064 Arg Leu Asp Ser Val Ser Phe Ala His Tyr Cys Glu Lys Glu Leu Asn 39 i ^ s ^ e ^^ '- ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ji ^^^^^^^^ j ^^ j ^^^^^^^ g ^^^^^^^^^^^^^^^^^^ 650 655 660 ttg ect gct gtt ctc ggc gta gca aac cag ate a cgc gct ctg ctc 2112 Leu Pro Wing Val Leu Gly Val Wing Asn Gln He Thr Arg Ma Leu Leu 665 670 67S 680 gt gtg gaa gcc fall gag ate age atg ctt ttt ctc acc gac tac ate 2160 Gly Val Glu Ala His Glu He Met Met Leu Phe Leu Thr Aep Tyr He 685 690 695 aag agt gcc acc ggt ctc agt aat att ttc teg gac aag aaa gac ggc 2208 Lys Ser Ma Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Asp Gly 700 70S 710 ggg cag tat atg cga tgc aaa here ggt atg cag teg att tgc cat gcc 2256 Gly Gln Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Ma 715 720 725 atg tea aag gaa ctt gtt cea ggc tea gtg falls ctc aac acc ecc gtc 2304 Met Ser Lys Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val 730 735 740 gct gaa att gag cag teg gca tcc ggc tgt here gta cga teg gcc teg 2352 Ma Glu He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Ser Ma Ser 745 750 755 760 ggc gcc gtg ttc cga age aaa aa g gtg gtg gtt teg tta ceg here acc 2400 Gly Ma Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr 765 770 775 ttg tat ecc acc ttg here ttt tea cea ect ctt ecc gcc gag aag ca 2448 Leu Tyr Pro Thr Leu Thr Phe Pro Pro Pro Leu Pro Wing Glu Lys Gln 780 785 790 gca ttg gcg gaa aat tet ate ctg ggc tac tat age aag ata gtc ttc 2496 Ma Leu Ma Glu Asn Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe 795 800 805 gta tgg gac aag ceg tgg tgg cgc gaa ca ggc ttc teg ggc gtc ctc 2544 Val Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu 810 815 820 cag teg age tgt gac ecc ate tea ttt gcc aga gat acc age ate gac 2592 Gln Be Ser Cys Asp Pro Be Ser Phe Ma Arg Asp Thr Ser He Asp 825 830 835 840 gtc gat cga cag tgg tcc att acc tgt ttc atg gtc gga gac ceg gga 2640 Val Asp Arg Gln Trp Be He Thr Cys Phe Met Val Gly Asp Pro Gly 845 850 855 cgg aag tgg tcc cag tcc aag cag gta cga caa aag tet gtc tgg 2688 Arg Lys Trp Ser Gln ßln Ser Lys ßln Val Arg ßln Lys Ser Val Trp 860 865 870 gac caá ctc cgc gca gcc tac gag aac gcc ggg gcc ca gtc cea gag 2736 Asp Gln Leu Arg Wing Wing Tyr Glu Asn Ma Gly Wing Gln Val Pro Glu 875 880 885 ceg gcc aac gtg ctc gaa ate gag tgg teg aag cag tat ttc ca 2784 Pro Ala Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln 890 895 900 40 ^ ^ ^ ^ ^ ¡1 ^ ^ * gga gct ceg age gcc gtc tat ggg ctg aac gat ctc ate ctg ggt 2832 Gly Ala Pro Ser Ma Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly 905 910 915 920 teg gcg ctc aga acg ceg ttc aag agt gtt cat ttc gtt gga acg gag 2880 Be Ala Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu 925 93C 935 acg tet tta gtt tgg aaa ggg tat atg gaa ggg gcc ata cga teg grgt 2928 Thr Ser Leu Val Trp Lys Gly Tyr Met Glu Gly Ma He Arg Ser Gly 940 945 950 ca g ct ggt gct gca gaa gtt gtg gct age ctg gtg cea gca gca 2973 Gln Arg Gly Ala Ma Glu Val Val Ma Ser Leu Val Pro Ma Ma 955 960 965 tag 2976 < 210 > 27 < 211 > 991 < 212 > PRT < 213 > Unnown < 220 > < 221 > S1GNAL < 222 > (1) ... (24) < 400 > 27 Met Ma Asn Lys His Leu Ser Leu Ser Leu Phe Leu Val Leu Leu Clly -20 -15 -10 Leu Ser Ma Ser Leu Ma Ser Gly Thr Asp Phe Pro Val Arg Arg Thr -5 1 5 Asp Leu Gly Gln Val Gln ßly Leu Ma Gly Asp Val Met Ser Phe Arg 10 15 20 Gly He Pro Tyr Ala Ma Pro Pro Val Gly Gly Leu Arg Trp Lys Pro 25 30 35 40 Pro Gln His Ma Arg Pro Trp Ma Gly Val Arg Pro Ma Thr Gln Phe 45 50 55 Gly Ser Asp Cys Phe Gly Wing Wing Tyr Leu Arg Lys Gly Ser Leu Wing 60 65 70 Pro Gly Val Ser Glu Asp Cys Leu Tyr Leu Asn Val Trp Ma Pro £ ier 75 80 85 Gly Ma Lys Pro Gly Gln Tyr Pro Val Met Val Trp Val Tyr Gly Gly 90 95 100 Gly Phe Ma Gly Gly Thr Ma Ma Pro Pro Tyr Tyr Asp Gly Glu Jila 105 110 115 120 Leu Ma Arg Gln Gly Val Val Val Val Thr Phe Asn Tyr Arg Thr Han 125 130 135 He Leu Gly Phe Phe Wing His Pro Gly Leu Ser Arg Glu Ser Pro? Hr 140 145 150 Gly Thr Ser Gly Asn Tyr Gly Leu Leu Asp He Leu Ma Ma Leu? Rg 155 160 165 Trp Val Gln Ser Asn Ma Arg Ala Phe Gly Gly Asp Pro Gly Arg Val 170 175 180 Thr Val Phe Gly Glu Ser Ma Gly Wing Be Wing He Gly Leu Leu Leu 185 190 195 200 Thr Ser Pro Leu Ser Lys Gly Leu Phe Arg Gly Ma He Leu Glu Ser 20S 210 215 Pro Gly Leu Thr Arg Pro Leu Wing Thr Leu Wing Asp Being Ma Ma Ser 220 225 230 Gly Glu Arg Leu Asp to Asp Leu Ser Arg Leu Arg Ser Thr Asp Pro 235 240 245 41 Ma Thr Leu Met Ma Arg Ala Asp Ala Ma Arg Pro? La Ser Arg Asp 250 255 260 Leu Arg Arg Pro Arg Pro Thr Gly Pro He val Asp Gly His Val Leu 265 270 275 280 Pro Gln Thr Asp Be Ala Ala Ala Be Ala Ala Gly Gln Leu Ma Pro Val 285 290 295 Arg Val Leu He Gly Thr Asn Wing Asp Glu Gly Arg Wing Phe Leu Gly 300 305 310 Arg Ma Pro Met Glu Thr Pro Wing Asp Tyr Gln Ma Tyr Leu Glu at 315 320 325 Gln Phe Gly Asp ßln Ma Ala Ma Val Ma Ma Cys Tyr Pro Leu? Sp 330 335 340 Gly Arg Ala Thr Pro Lys Glu Met Val Ma Arg He Phe Gly Asp? Sn 345 350 355 360 Gln Phe Asn Arg Gly Val Ser Ma Phe Ser ßlu Ma Leu Val Arg Gln 365 370 375 Qly Ma Pro Val Trp Arg Tyr Gln Phe Asn ßly Asn Thr Glu Gly Gly 380 385 390 Arg Ma Pro Ma Thr His Gly Ala Glu He Pro Tyr Val Phe Gly Val 395 400 405 Phe Lys Leu Asp Glu Leu Gly Leu Phe Asp Trp Pro Pro ßlu Gly Pro 410 415 420 Thr Pro Ma Asp Arg Ma Leu Gly Gln Leu Met Ser Ser Ma Trp Val 425 430 435 440 Arg Phe Ma Lys? Sn Gly Asp Pro Ma Gly Asp Ma Leu Thr Trp Pro 445 450 455 Ma Tyr Be Thr Gly Lys Be Thr Met Thr Phe Gly Pro Glu Gly Arg 460 465 470 Ala Ma Val Val Ser Pro Gly Pro Ser Pro Pro Cys Ma? Sp Gly 475 480 485 a Lys Ala Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser 490 495 500 Lys Asp Asn Val Wing Asp Val Val Val Val Gly Ma Gly Leu Ser Gly 505 510 SIS 520 Leu ßlu Thr Ma Arg Lys Val Gln Ma Ma Gly Leu Ser Cys Leu Val 525 530 535 Leu Glu Ma Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser 540 545 550 Gly Pro Gly Arg Thr Thr He Asn Asp Leu Gly Ma Ma Trp He? Sn 555 560 565 Asp Ser Asn Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu 570 575 580 Glu Gly Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Ma Gln 585 590 595 600 Asp Gly Thr Thr Thr Thr Ala Pro Tyr Gly? Sp Ser Leu Leu Ser Glu 605 610 615 Glu Val Ma Ser Ma Leu Ma Glu Leu Leu Pro Val Trp Ser Gln Leu 620 625 630 He Glu Glu His Ser Leu Gln Asp Leu Lys Ma Pro Pro Gln Ma Lys 635 640 645 Arg Leu? Sp Ser Val Ser Phe Ma His Tyr Cys Glu Lys Glu Leu Asn 650 655 660 Leu Pro Ma Val Leu Gly Val Ma Asn Gln He Thr Arg Ala Leu Leu 665 670 675 680 Gly Val Glu Ma His Glu He Ser Met Leu Phe Leu Thr Asp Tyr He 685 690 695 Lys Ser Ma Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Asp Gly 700 705 710 Gly Gln Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Ma 715 720 725 Met Ser Lys Glu Leu Val Pro Gly Ser Val His Leu? Sn Thr Pro Val 730 735 740 42 Ma Glu He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Ser Ma Ser 745 750 755 760 Gly Ma Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr 765 770 775 Leu Tyr Pro Thr Leu Thr Phe Be Pro Pro Leu Pro Ma Glu Lye Gln 780 785 790 Ma Leu Wing Glu Asn Be He Leu Gly Tyr Tyr Ser Lys He Val Phe 795 800 805 Val Trp Asp Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu 810 815 820 Gln Ser Ser Cys Asp Pro Be Ser Phe Wing Arg Asp Thr Ser He Asp 825 830 835 840 Val Asp Arg Gln Trp Be He Thr Cye Phe Met Val Gly Asp Pro Gly 845 850 855 Arg Lys Trp Ser Gln Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp 860 865 870 Asp Gln Leu Arg Wing Ma Tyr Glu Asn Ma Gly Ma Gln Val Pro Glu 875 880 885 Pro Ma Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe ßln 890 895 900 ßly Ma Pro Ser Ma Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly 905 910 915 920 Be Ala Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu 925 930 935 Thr Ser Leu Val Trp Lys Gly Tyr Met Glu ßly Ma He Arg Se r Gly 940 945 950 Gln Arg Gly Ala Ala Glu Val Val Ma Ser Leu Val Pro Ma Ma 955 960 965 < 210 > 28 < 211 > 3618 < 212 > DNA < 213 > Onknown < 220 > < 223 > gst: espl: ßp: K: trapao, 3618. 1-687, gst + polylinker; 688-2190, splendid; 2191-2226 spacer; 2227-3615, KrtrAPAO, extra lysine; 3616-3618 / stop codon. For bacterial expression. < 221 > CDS < 222 > (1) ... (3615) < 221 > misc_feature < 222 > (1) ... (687) < 223 > gast + polylinker < 22i > mat_peptide < 222 > (688) ... (2190) < 223 > espl mat < 221 > isc_feature < 222 > (2191) ... (2226) < 223 > spacer sequence < 22l > m? sc_feature < 222 > (2227) ... (3615) < 223 > K: trAPAO < 221 > m? sc_feature < 222 > (2227) ... (2229) < 223 > Extra lysine 43 ^^^^ m < 400 > 28 atg tcc ect ata cta ggt tat tgg aaa att aag ggc ctt gtg cac ecc 48 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 act cga ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg 96 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 tat gag cgc gat gaa ggt gat aaa tgg cga aac aaa aag ttt gaa ttg 144 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 ggt ttg gag ttt ecc aat ctt ect tat tat att gat ggt gat gtt aaa 192 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 tta here cag tet atg gcc ate ata cgt tat ata gct gac aag falls aac 240 Leu Thr Gln Ser Met Wing He He Arg Tyr He Wing Asp Lys His Asn 65 70 75 80 atg tg ggt ggt tgt cea aaa gag cgt gca gag att cea atg ctt gaa 288 Met Leu Gly Gly Cys Pro Lys Glu Arg Ma Glu He Ser Met Leu Glu 85 90 95 gga gcg gtt ttg gat att aga tac ggt gtt teg aga att gca tat agt 336 Gly Ma Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ma Tyr Ser 100 105 110 a aa gac ttt gaa act ctc aaa gtt gat ttt ctt age aag cta ect gaa 384 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 atg ctg aaa atg ttc gaa gat cgt tta tgt cat aaa here tat tta aat 432 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 ggt gat cat gta acc cat ect gac ttc atg ttg tat gac gct ctt gat 480 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ma Leu Aep 145 150 155 160 gtt gtt tta tac atg gac cea atg tgc ctg gat gcg ttc cea aaa tta 528 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ma Phe Pro Lys Leu 165 170 175 gtt tgt ttt aaa aaa cgt att gaa gct ate cea ca att gat aag tac 576 Val Cys Phe Lys Lys Arg He Glu Wing He Pro Gln He Asp Lys Tyr 180 185 190 ttg aaa tcc age aag tat ata gca tgg ect ttg cag ggc tgg ca gcc 624 Leu Lys Be Ser Lys Tyr He Ma Trp Pro Leu Gln Gly Trp Gln Ma 195 200 205 acg ttt ggt ggt ggc gac cat ect cea aaa teg gat ctg gtt ceg cgt 672 Thr Phe Gly Gly Gly Asp His Pro Pro Lye Ser Asp Leu Val Pro Arg 210 215 220 gga tcc ceg gaa ttc gct ect act gtc aag att gat gct atg gtg 720 Gly Ser Pro Glu Phe Ma Pro Thr Val Lys He Asp Wing Gly Met Val 225 230 235 240 44 t gtc ggc acg act act act gtc ecc ggc acc act gcg acc gtc age gag 768 Val Gly Thr Thr Thr Thr Val Pro Gly Thr Thr Wing Thr Val Ser Glu 245 250 255 ttc ttg ggc gtt ect ttt gcc gcc tet ceg here cga ttt gcg ect ect 816 Phe Leu Gly Val Pro Phe Wing Wing Pro Pro Thr Arg Phe Ma Pro Pro 260 265 270 act cgt ecc gtg ect tgg tea ac g ect t g g g t tat g gt 864 Thr Arg Pro Val Pro Trp Ser Thr Pro Leu Gln Ma Thr Ma Tyr Cily 275 280 285 cea gca tgc ect caa cata ttc aat tac ecc gaa ctc cgt gag att 912 Pro Ma Cys Pro Gln Gln Phe Asn Tyr Pro Glu Glu Leu Arg Glu He 290 295 300 acg atg gcc tgg ttc aat here ceg ecc ceg tea gct ggt gaa agt gag 960 Thr Met Ma Trp Phe Asn Thr Pro Pro Pro Ser Wing Gly Glu Ser Glu 305 310 315 320 gac tgc ctg aac ctc aac ate tac gtc cea gga act ga ga aac ac aac 1008 Asp Cys Leu Asn Leu Asn He Tyr Val Pro Gly Thr ßlu Asn Thr Asn 325 330 335 aaa gcc gtc atg gtt tgg ata ggt ggt ggg gg ggt ggt tat ggt tgg 1056 Lys Ala Val Met Val Trp He Tyr Gly Gly Ala Leu Gl u Tyr Gly Trp 340 345 3S0 aat tea ttc falls ctt tac gac ggg gct agt ttc gca gcc aat cag gat 1104 Asn Ser Phe His Leu Tyr Asp Gly Ala Ser Phe Ala Ma Aen Gln Asp 355 360 365 gtc ate gcc gtg acc ate aac tac aga acg aac att ctg ggg ttc ect 1152 Val He Ma Val Thr Jle Asn Tyr Arg Thr Asn He Leu Gly Phe Pro 370 375 380 gct gcc ect cag ctt cea ata here cag cga aat ctg ggg ttc cta gac 1200 Ma Ala Pro Gln Leu Pro He Thr Gln Arg Asn Leu Gly Phe Leu Asp 385 390 395 400 caá agg ttt gct ttg gat tgg gta cag cgg aac ate gca gcc ttt ggc 1248 Gln Arg Phe Ma Leu Asp Trp Val Gln Arg Asn He Ma Ma Phß Gly 405 410 415 ggt gat ect cg aag gtc here ata gtt cag agg ggg ggg ggc aga 1296 Gly Asp Pro Arg Lys Val Thr He Phe Gly Gln Ser Ma ßly Gly Arg 420 425 430 agt gtc gac gts ctc ttg acg tet atg cea cae aac cea ecc ttc cga 1344 Ser Val Asp Val Leu Leu Thr Ser Met Pro His Asn Pro Pro Phe Arg 435 440 445 gca gca ate atg gag tcc ggt gtg gct aac tac aac ttc ecc aag gga 1392 Ala Ma He Met Glu Ser Gly Val Ma Asn Tyr Asn Phe Pro Lys Gly 450 455 460 gat ttg tcc gaa ect tgg aac acct gtt cact gct ctc aac tct acc 1440 Asp Leu Ser Glu Pro Trp Asn Thr T r Val Gln Ala Leu Aen Cys Thr 465 470 475 480 acc agt ate gac ate ttg agt tgt atg aga aga gtc gat ccc gcc act 1488 Thr Ser He Asp He Leu Ser Cys Met Arg Arg Val Aep Leu Ala Thr 45 485 490 495 ctg atg aac acg ate gag caa ctc gga ctt ggg ttt gag tac acg ttg 1536 Leu Met Asn Thr He Glu Gln Leu Gly Leu Gly Phe Glu Tyr Thr Leu 500 505 510 gac aac gta acg gct gtg tac cgt tet gaa acg gct cgc acg act ggt 1584 A = p Asn Val Thr Wing Val Tyr Arg Ser Glu Thr Ma Arg Thr Thr Gly 515 520 525 gac att gct cgt gta ect gtt ctc gtc ggg acg gtg gcc aac gac gga 1632 Asp He Ma Arg Val Pro Val Leu Val Gly Thr Val Wing Asn Asp Gly 530 535 540 ctt ctc ttt gtt ctc ggg gag aat gac acc gca tat ctc gag gag 1680 Leu Leu Phe Val Leu Gly Glu Asn Asp Thr Gln Ma Tyr Leu Glu Glu 545 550 555 560 gca ate ceg aat cag ecc gac ctt tac cag act ctc ctt gga gca tat 1728 Ma He Pro Asn Gln Pro Asp Leu Tyr Gln Thr Leu Leu Gly Ma Tyr 565 570 575 ecc att gga tcc cea ggg ate gga teg ect ca g gat gg gcc gcc 1776 Pro He Gly Ser Pro Gly He Gly Ser Pro Gln Asp Gln He Wing Ma 580 585 590 att gag acc gag gta aga ttc cag tgt ect tet gcc ate gtg gct cag 1824 He Glu Thr Glu Val Arg Phe, Gln Cys Pro Ser Ma lie Val Ma Gln 595 600 605 gac tcc cgg aat cgg ggt ate ect tet tgg cgc tac tac tac aat gcg 1872 Asp Ser Arg Asn Arg Gly He Pro Ser Trp Arg Tyr Tyr Tyr Asn Ma 610 615 620 acc ttt gag aat ctg gag ctt ttc ect ggg tcc gaa gtg tac falls age 1920 Thr Phe Glu Asn Leu Glu Leu Phe Pro Gly Ser Glu Val Tyr His Ser 625 630 635 640 tet gaa gtc ggg atg gtg ttt ggc acg tat ect gtc gca agt gcg acc 1968 Ser Glu Val Gly Met Val Phe Gly Thr Tyr Pro Val Wing Ser Ma Thr 645 650 655 gcc ttg gag gcc cag acg age aaa tac atg cag ggt gcc tgg gcg gcc 2016 Ma Leu Glu Ala Gln Thr Ser Lys Tyr Met Gln Gly Ala 'Trp Ma Ma 660 665 670 ttt gcc aaa aac ecc atg aat ggg ect ggg tgg aaa ca gtg ceg aat 2064 Phe a Lys Asn Pro Met Asn Gly Pro Gly Trp Lye Gln Val Pro Asn 675 680 685 gtc gcg gcg ctt ggc tea cea ggc aaa gcc ate cag gtt gac gtc tet 2112 Val Ma Ala Leu Gly Ser Pro Gly Lys Ala He Gln Val Asp Val Ser 690 695 700 cea gcg here ata gac caga cg tgt gcc ttg tac acg cgt tat tat act 2160 Pro Ma Thr He Asp ßln Arg Cys Ala Leu Tyr Thr Arg Tyr Tyr Thr 705 710 715 720 gag ttg ggc here gcg ceg agg here ttt ggc gga cgc age ggc gga 2208 Glu Leu Gly Thr He Ala Pro Arg Tnr Phe Gly Gly Gly Ser Gly Gly 72S 730 735 46 ggc age ggc gga ggc age aaa gac aac gtt gcg gac gtg gta gtg gtg 2256 Gly Ser Gly Gly Gly Ser Lys Asp Asn Val Wing Asp Val Val Val Val 740 745 750 ggc ggc ggc ttg age ggt ttg gag acg gca cgc aaa gtc cag gcc gcc 2304 Gly Ma Gly Leu Ser Gly Leu Glu Thr Ala Arg Lys Val Gln Ma Ala 755 760 765 ggt ctg tcc tgc ctc gtt ctt gag gcg atg gat cgt gta ggg gga aag 2352 Gly Leu Ser Cys Leu Val Leu Glu Ma Met Asp Arg Val Gly Gly Lys 770 775 780 act ctg age gta cag teg ggt cec ggc agg acg act ate aac gac ctc 2400 Thr Leu Ser Val Gln Be Gly Pro Gly Arg Thr Thr He Asn Asp Leu 785 790 795 800 ggc gct gcg tgg ate aat gac age aac caa age gaa gta tcc aga ttg 2448 Gly Ma Ma Trp He Asn Asp Ser Asn Gln Ser ßlu Val Ser Arg Leu 805 810 815 ttt gaa aga ttt cat ttg gag ggc gag ctc cag agg acg act gga aat 2496 Phe ßlu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr Thr Gly? Sn 820 825 830 tea ate caca gca caca gac ggt here acc ct here gct ect tat ggt 2544 Ser He His Gln Ma Gln Asp Gly Thr Thr Thr Ma Pro Tyr GLy 835 840 845 gac tcc ttg age gag gag gtt gca agt gca ctt gcg gaa ctc ctc 2592 Asp Ser Leu Leu Ser Glu Glu Val Ma Ser Ma Leu Ma Glu Leu Leu 850 855 860 ecc gta tgg tet cag ctg ate gaa gag cat age ctt ca gac ctc aag 2640 Pro Val Trp Ser Gln Leu He Glu Glu His Ser Leu Gln Asp Leu Lys 865 870 875 880 gcg age ect cag gcg aag cgg ctc gac agt gtg age ttc gcg falls tac 2688 Wing Pro Pro Gln Ma Lys Arg Leu Asp Ser Val Ser Phe Ma His Tyr 885 890 895 tgt gag aag gaa cta aac ttg ect gct gtt ctc ggc gta gca aac cag 2736 Cys Glu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val Ma Asn Gln 900 905 910 tie here cgc gct ctg gtt gtg gaa gcc falls gag ate age atg ct.t 2784 He Thr Arg Ma Leu Leu Gly Val Glu Ma His Glu He Ser Met Leu 915 920 925 ttt ctc acc gac tac ate aag agt gcc acc ggt ctc agt aat att tt.c 2832 Phe Leu Thr Asp Tyr He Lys Ser Wing Thr Gly Leu Ser Asn He Phe 930 935 940 teg gac aag aaa gac ggc ggg c ag tat atg cga tgc aaa here ggt at.g 2880 Being Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys Thr ßly M.'t 945 950 955 960 cag teg att tgc cat gcc atg tea aag gaa ctt gtt cea ggc tea gt.g 2928 ßln Ser He Cys His Ma Met Ser Lys Glu Leu Val Pro Gly Ser Val falls ctc aac acc ecc gtc gct gaa att gag cag teg gca tcc ggc tgt 2976 His Lea Asn Thr Pro Val Ala Glu He Glu Gln Ser Ma Ser Gly Cys 47 980 985 990 here gta cga teg gcc teg ggc gee gtg ttc cga age aa aag gtg gtg 3024 Thr Val Arg Ser Ala Ser Gly Ala Val Phe Arg Ser Lys Val Val 995 1000 1005 gtt teg tta ceg here acc ttg tat ecc acc ttg here ttt tea cea ect 3072 Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe Pro Pro 1010 1015 1020 ctt cec gcc gag aag ca gca ttg gcg gaa aat tet ate ctg ggc tac 3120 Leu Pro Ma Glu Lys Gln Ma Leu Wing Glu Asn Ser He Leu Gly Tyr 1025 1030 1035 1040 tat age aag ata gtc ttc gta tgg gac aag ceg tgg tgg cgc gaa caa 3168 Tyr Ser Lys lie Val Phe Val Trp Asp Lys Pro Trp Trp Arg Glu Gln 1045 10 50 1055 ggc ttc teg ggc gtc ctc cag teg age tgt gac ecc ate tea ttt gcc 3216 Gly Phe Ser Gly Val Leu Gln Ser Ser Cys Asp Pro Be Ser Phe Ma 1060 1065 1070 aga gat a ct gat gtc gat cga gtc gat cga tgg tcc att acc tgt ttc 3264 Arg Asp Thr Ser He Asp Val Asp Arg Gln Trp Ser He Thr Cys Phe 1075 1080 1085 atg gtc gga gac ceg gga cgg aag tgg tec ca g acc cag gta 3312 Met Val Gly Asp Pro ßly Arg Lys Trp Ser ßln Gln Ser Lys Gln Val 1090 1095 1100 cga caa aag tet gtc tgg gac caá ctc gc gc gcc tac gag aac gcc 3360 Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Ma Ma Tyr Glu Asn Ma 1105 1110 1115 1120 ggg ^ c ca gtc cea gag ceg gcc aac gtg ctc gaa ate gag tgg t.cg 3408 Gly Ala Gln Val Pro Glu Pro Ma Asn Val Leu Glu He Glu Trp Ser 1125 1130 1135 aag cag tat ttc ca gga gct ceg age gcc gtc tat ggg ctg aac 3456 Lys Gln Gln Tyr Phe Gln Gly Ma Pro Ser Ma Val Tyr Gly Leu Asn 1140 1145 1150 gat ctc ate here ctg ggt teg gcg cte aga acg ceg ttc aag agt gtt 3504 Asp Leu He Thr Leu Gly Ser Ma Leu Arg Thr Pro Phe Lys Ser Val 1155 1160 1165 cat ttc gtt gga acg gag acg tet tta gtt tgg aaa ggg tat atg gaa 3552 His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lys Gly Tyr Met Glu 1170 1175 ggg ggg ggg cg cg cg ggt cag ggt ggt gg ggt ggt gt gg gg gg gg ggt age 3600 Gly Gg He Arg Gly Glg Arg Gly Wing Ala Glu Val Val Ma Ser 1185 1190 1195 3200 ceg gtg ce gca gca tag 3618 Leu Val Pro Ma Ma 1205 210 > 29 < 211 > 1205 < 212 > PRT 48 < 213 > Unknown < 400 > 29 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 Tnr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys SO 55 60 Leu Thr Gln Ser Met Ma He He Arg Tyr He Ma Asp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ma Glu He Ser Met Leu Glu 85 90 95 Gly Ma Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ma Tyr Ser 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ma Leu Asp 145 150 155 160 Val Val Leu Tyr Met Aep Pro Met Cys Leu Asp Ma Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg He Glu Ma He Pro Gln He Asp Lys Tyr 180 18S 190 Leu Lys Ser Ser Lys Tyr He Ma Trp Pro Leu Gln Gly Trp Gln Ala 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 Gly Ser Pro Glu Phe Ma Pro Thr Val Lys He Asp Ma Gly Met Val 225 230 235 240 Val Gly Thr Thr Thr Thr Val Thr Gly Thr Thr Thr Thr Val Val Ser Glu 245 250 255 Phe Leu Gly Val Pro Phe Ma Ma Ser Pro Thr Arg Phe Ma Pro Pro 260 265 270 Thr Arg Pro Val Pro Trp Ser Thr Pro Leu Gln Ma Thr Ma Tyr Gly 275 280 285 Pro Ma Cys Pro Gln Gln Phe Asn Tyr Pro Glu Glu Leu Arg Glu He 290 295 300 Thr Met Ma Trp Phe Asn Thr Pro Pro Pro Ser Ma Gly Glu Ser Glu 305 310 315 320 Asp Cys Leu Asn Leu Asn He Tyr Val Pro Gly Thr Glu Asn Thr Asn 325 330 335 Lys Ma Val Met Val Trp He Tyr Gly Gly Ala Leu Glu Tyr Gly Trp 340 345 350 Asn Ser Phe His Leu Tyr Asp Gly Ma Ser Phe Ma Ma Asn Gln Asp 355 360 365 Val He Ala Val Thr He Asn Tyr Arg Thr Asn He Leu Gly Phe Pro 370 375 380 Ma Ma Pro Gln Leu Pro He Thr Gln Arg Asn Leu Gly Phe Leu Asp 385 390 395 400 Gln Arg Phe Ma Leu Asp Trp Val Gln Arg Asn He Ma Ma Phe Gly 405 410 415 Gly Asp Pro Arg Lys Val Thr He Phe Gly Gln Ser Ma Gly Gly Arg 420 425 430 Ser Val Asp Val Leu Leu Thr Ser Met Pro His Asn Pro Pro Phe Arg 435 440 445 Ala Ala He Met Glu Ser Gly Val Ala Asn Tyr Asn Phe Pro Lys Gly 450 455 460 Asp Leu Ser Glu Pro Trp Asn Thr Thr Val Gln Ala Leu Asn Cys Thr 49 465 470 475 480 Thr Ser He Asp He Leu Ser Cys Met Arg Ars Val Asp Leu Ma Thr 485 490 495 Leu Met Asn Thr He Glu Gln Leu Gly Leu Gly Phe Glu Tyr Thr Leu 500 505 510 Asp Asn Val Thr Ma Val Tyr Arg Ser Glu Thr Ma Arg Thr Thr Gly 515 520 525 Asp He Wing Arg Val Pro Val Leu Val Gly Thr Val Ma Asn Asp C? Ly 530 535 540 Leu Leu Phe Val Leu Gly Glu Asn Asp Thr Gln Ma Tyr Leu Glu C! Lu 545 550 555 560 Wing He Pro Asn Gln Pro Asp Leu Tyr Gln Thr Leu Leu Gly Ma Tyr 565 570 575 Pro He Gly Ser Pro Gly He Gly Ser Pro Gln Asp Gln He Wing Ma 580 S85 590 He Glu Thr Glu Val Arg Phe Gln Cys Pro Ser Ma He Val Ala Clin 595 600 605 Asp Ser Arg Asn Arg Gly He Pro Ser Trp Arg Tyr Tyr Tyr Asn Ma 610 615 620 Thr Phe Glu Asn Leu Glu Leu Phe Pro Gly Ser Glu Val Tyr His Ser 625 630 635 640 Ser Glu Val Gly Met Val Phe Gly Thr Tyr Pro Val Ma Ser Ma Thr 645 650 655 Wing Leu Glu Ma Gln Thr Ser Lys Tyr Met Gln ßly Ma Trp Wing Ma 660 665 670 Phe Wing Lys Asn Pro Met Asn Gly Pro Gly Trp Lys Gln Val Pro Asn 675 680 685 Val Wing Ma Leu Gly Ser Pro Gly Lys Ma He Gln Val Asp Val Ser 690 695 700 Pro Ma Thr He Asp Gln Arg Cys Ma Leu Tyr Thr Arg Tyr Tyr Thr 705 710 715 720 Glu Leu Gly Thr He Ma Pro Arg Thr Phe Gly Gly Gly Ser Gly Gly 725 730 735 Gly Ser Gly Gly Gly Ser Lys Asp Asn Val Ma Asp Val Val Val 740 745 750 Gly Ma Gly Leu Ser Gly Leu Glu Thr Ma Arg Lys Val Gln Ma Ala 755 760 765 Gly Leu Ser Cys Leu Val Leu Glu Ma Met Asp Arg Val Gly Gly Lys 770 775 780 Thr Leu Ser Val Gln Ser Gly Pro Gly Arg Thr Thr He Asn Asp Leu 785 790 795 800 Gly Ma Ala Trp He Asn Asp Ser Asn Gln Ser Glu Val Ser Arg Leu 805 810 815 Phe Glu Arg Phe His Leu Glu Gly Glu Leu Gln Arg Thr Thr Gly Asn 820 825 830 Ser He His Gln Ma Gln Asp Gly Thr Thr Thr Thr Ma Pro Tyr Gly 835 840 845 Asp Ser Leu Leu Ser Glu Glu Val Ma Ser Ma Leu Ma Glu Leu Leu 850 855 860 Pro Val Trp Ser Gln Leu He ßlu Glu His Ser Leu Gln Asp Leu Lys 865 870 875 880 Ma Ser Pro Gln Ma Lys Arg Leu Asp Ser Val Ser Phe Ma His Tyr 885 890 895 Cys ßlu Lys Glu Leu Asn Leu Pro Wing Val Leu Gly Val Ma Asn ßln 900 905 910 He Thr Arg Ala Leu Leu Gly Val Glu Ma His Glu He Be Met Leu 915 920 925 Phe Leu Thr Asp Tyr He Lys Ser Wing Thr Gly Leu Ser Asn He Phe 930 935 940 Ser Asp Lys Lys Asp Gly Gly Gln Tyr Met Arg Cys Lys Thr Gly Met 945 950 955 960 Gln Ser He Cys His Wing Met Ser Lys Glu Leu Val Pro Gly Ser Val 50 é á & TfA *. * 965 970 975 His Leu Asn Thr Pro Val Ma Glu He Glu Gln Ser Ma Ser Gly Cys 980 985 990 Thr Val Arg Ser Ma Ser Gly Ma Val Phe Arg Ser Lys Val Val 995 1000 1005 Val Ser Leu Pro Thr Thr Leu Tyr Pro Thr Leu Thr Phe Ser Pro Pro 1010 1015 1020 Leu Pro Ma Glu Lys Gln Ala Leu Wing Glu Asn Ser He Leu Gly Tyr 1025 1030 1035 1040 Tyr Ser Lys He Val Phe Val Trp Asp Lys Pro Trp Trp Arg Glu Gln 1045 1050 1055 Gly Phe Ser Gly Val Leu Gln Be Ser Cys Asp Pro Be Ser Phe Ma 1060 1065 1070 Arg Asp Thr Be As Asp Val Asp Arg Gln Trp Be He Thr Cys Phe 1075 1080 1085 Met Val Gly Asp Pro Gly Arg Lys Trp Ser Gln Gln Ser Lys Gln Val 1090 1095 1100 Arg Gln Lys Ser Val Trp Asp Gln Leu Arg Ma Ma Tyr Glu Asn Ma 1105 1110 1115 1120 Gly Ma Gln Val Pro Glu Pro Ma Asn Val Leu Glu He Glu Trp Ser 1125 1130 1135 Lys Gln Gln Tyr Phe ßln Gly Ma Pro Ser Ma Val Tyr Gly Leu Asn 1140 1145 1150 Asp Leu He Thr Leu Gly Ser Ma Leu Arg Thr Pro Phe Lys Ser Val 1155 1160 1165 His Phe Val Gly Thr Glu Thr Ser Leu Val Trp Lye Gly Tyr Met Glu 1170 1175 1180 Gly Ma He Arg Ser ßly Gln Arg Gly Ma Ma Glu Val Val Ma Ser 1185 1190 1195 1200 Leu Val Pro Ma Ma 1205 < 210 > 30 < 211 > 3591 < 212 > DNA < 213 > uhknown < 220 > < 223 > Open reading fra e of BEST1: K: trAPAO fusion for bacterial expression vector pGEX-4T-l or similar vector. gs: 3ESTl: sp: K: rAPAO fusion, 3591 nt. 1-687 gst + polylinker, 688-2163, SEST1 mature; 2164-2199, spacer, 2200-3588, K: trAPAO < 22l > misc_feature < 222 > (1) ... (687) < 223 > gst + polylinker < 221 > mat_peptide < 222 > (688) ... (2163) < 223 > BEST1 mature < 221 > misc_feature < 222 > (2164) ... (2199) < 223 > spacer sequence < 221 > isc_feature < 222 > (2200) ... (3588) < 223 > K: trAPAO < 221 > CDS 51 _J- > ,, - ^ WM ^^ .... . «,. , _ ^ t ... ** ^ SUto -... "«. , .i < 222 > (1) ... (3588) < 22l > misc_feature < 222 > (2200) ... (2202) < 223 > Extra lysine < 400 > 30 atg tcc ect ata cta ggt tat tgg aaa att aag ggc ctt gtg cac ecc 48 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 act cga ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg 96 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 tat gag cgc gat gaa ggt gat aaa tgg cga aac aaa aag ttt gaa ttg 144 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe ßlu Leu 35 40 45 ggt ttg gag ttt ecc aat tat tat tat gt gat gat gtt aaa 192 ßly Leu ßlu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 tta here cag tet atg gcc ate ata cgt tat ata gct gac aag falls aac 240 Leu Thr Gln Ser Met Ma He He Arg Tyr He Ma Asp Lys His Asn 65 70 75 80 atg tg ggt ggt tgt cea aaa gag cgt gg gag att tea atg ctt gaa 288 Met Leu Gly Gly Cys Pro Lys Glu Arg Wing Glu He Ser Met Leu Glu 85 90 95 gga gcg gtt ttg gat att aga tac ggt gtt teg aga att gca tat agt 336 Gly Ma Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ma Tyr Ser 100 1 05 110 aaa gac ttt gaa act ctc aaa gtt gat ttt ctt age aag cta ect gaa 384 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 atg ctg aaa atg ttc gaa gat cgt tta tgt cat aaa here tat tta aat 432 Met Leu Lyß Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 ggt gat cat gta acc cat ect gac ttc atg ttg tat gac gct ctt gat 480 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ma Leu Asp 145 150 155 160 gtt gtt tta tac atg gac cea atg tgc ctg gat gcg ttc cea aaa tta 528 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Wing Phe Pro Lys Leu 165 170 175 gtt tgt ttt aaa aaa cgt att gaa gct ate cea caa att gat aag tac 576 Val Cys Phe Lys Lys Arg He Glu Wing He Pro Gln He Asp Lys Tyr 180 185 190 ttg aaa tcc age aag tat ata gca tgg ect ttg cag ggc tgg ca gcc 624 Leu Lys Ser Ser Lys Tyr He Wing Trp Pro Leu Gln Gly Trp Gln Ma 195 200 205 acg ttt ggt ggt ggc gac cat ect cea aaa teg gat ctg gtt ceg cgt 672 Thr Phe ßly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 52 gga tcc ceg gaa ttc acg gat ttt ceg gtc cgc agg acc gat ctg ggc 720 Gly Pro Pro Glu Phe Thr Asp Phe Pro Val Arg Arg Thr Asp Leu Gly 22S 230 235 240 cag gtt cag gga ctg gcc ggg gac gtg atg age ttt cgc gga ata cec 768 Gln Val ßln ßly Leu Ma Gly Asp Val Met Ser Phe Arg Gly He Pro 245 250 255 tat gca gcg ceg gg gg ggc ggg ctg cgt tgg aag ceg ecc caca falls 816 Tyr Ala Ala Pro Pro Val Gly Gly Leu Arg Trp Lys Pro Pro Gln His 260 265 270 gcc cgg ecc tgg gcg ggc gtt cgc ecc gcc acca ttt ggc tcc gac 864 Wing Arg Pro Trp Ma Gly Val Arg Pro Ma Thr Gln Phe ßly Ser? Sp 275 280 285 tgc ttc ggc gcg gcc tat ctt egc aaa ggc age ctc gcc ecc ggc gtg 912 Cys Phe Gly Ma Ma Tyr Leu Arg Lys Gly Ser Leu Ma Pro Gly Val 290 295 300 age gag gac tgt ctt tac ctc aac gta tgg gcg ceg tea ggc gct aaa 960 Ser Glu Asp Cys Leu Tyr Leu Asn Val Trp Ma Pro Ser Gly Ala Lys 305 310 315: .20 ecc ggc cag tac ecc gtc atg gtc tgg gtc tac ggc ggc ggc ttc gcc 1008 Pro Gly Gln Tyr Pro Val Val Val Val Val Tyr Gly Gly Gly Gly Phe Wing 325 330 335 ggc ggc acg gcc gcc atc ecc tac tac gac ggc gag gcg ctt gcg ega 1056 Gly Gly Thr Ma Ma Met Pro Tyr Tyr Asp Gly ßlu Ma Leu Ma Arg 340 345 350 cag ggc gtc gtg gtg gtg acg ttt aac tat cgg aeg aac ate ctg ggc 1104 Gln Gly Val Val Val Val Thr Phe Asn Tyr Arg Thr Asn He Leu Gly 355 360 365 ttt ttc gcc cat ect ggt ctc teg cgc gag age cec acc gga act teg 1152 Phe Phe Wing His Pro Gly Leu Ser Arg Glu Ser Pro Thr Gly Thr Ser 370 375 380 ggc aac tac ggc cta ctc gac att ctc gcc gct ctt cgg tgg gtg cag 1200 Gly Asn Tyr Gly Leu Leu Asp He Leu Ma Ma Leu Arg Trp Val Gln 385 390 395 400 age aac gcc cgc gcc ttc gga ggg gac ecc ggc cga gtg acg gtc ttt 1248 Ser Asn Ala Arg Ma Phe Gly Gly Asp Pro Gly Arg Val Thr Val Phe 405 410 415 ggt gaa te gc g gcg age gcg ate gga ctt ctg ctc acc teg ceg 1296 Gly Glu Be Wing Gly Ma Be Wing He Gly Leu Leu Thu Ser Pro 420 425 430 ctg age aag ggt ctc tcc cgt ggc gct ate ctc gaa agt cea ggg ctg 1344 Leu Ser Lys Gly Leu Phe Arg Gly Wing He Leu Glu Ser Pro Gly Leu 435 440 445 acg cg cg cgc gcg acg ctc gcc gac age gcc gcc teg ggc gag cgc 1392 Thr Arg Pro Leu Wing Thr Leu Wing Asp Ser Wing Wing Gly Glu Arg 450 455 460 ctc gac gcc gat ctt teg cg cg cgc teg acc gac cec gcc acc ctg 1440 53 Leu Asp Wing Asp Leu Ser Arg Leu Arg Ser Thr Asp Pro Ma Thr Leu 465 470 475 480 atg gcg cgc gcc gac gcg gcc cgc ceg gca teg cgg gac ctg cgc agg 1488 Met Ma Arg Ma Asp Ma Ala Arg Pro Ma Ser Arg Asp Leu Arg Arg 485 490 49S ceg cgt ceg acc gga ceg ate gtc gat ggc cat gtg ctg ceg cag acc 1536 Pro Arg Pro Thr Gly Pro He Val Asp Gly His Val Leu Pro Gln Thr 500 SOS 510 gac age gcg gcg ate gcg gcg ggg cag ctg gcg ceg gtt cgg gtc ctg 1584 Asp Ser Ma Ma He Ma Ma Gly Gln Leu Ma Pro Val Arg Val Leu 515 520 525 ate gga acc aat gcc gac gaa ggc cgc gcc ttc ctc ggg cgc gcg ceg 1632 He Gly Thr Asn Ma Asp Glu Gly Arg Ala Phe Leu Gly Arg Ma Pro 530 535 540 atg gag acg cea gcg gac tac ca gcc tat ctg gag geg cag ttt ggc 1680 Mßt Glu Thr Pro Ma Asp Tyr Gln Ala Tyr Leu Glu Ma Gln Phe Gly 545 550 55S 560 gac ca gcc gcc gcg gcg gcg tgc tat eco ctc gac ggc cgg gcc 1728 Asp Gln Ma Ma Ma Val Ma Ma Cys Tyr Pro Leu Asp Gly Arg Ma 565 570, 575 acg ecc aag gaa atg gtc gcg cgc ate ttc ggc gac aat cag ttc aat 1776 Thr Pro Lys Glu Met Val M Arg He Phe Gly Asp Asn Gln Phe Asn 580 585 590 og 9g gtc teg gcc ttc teg gaa gcg ctt gtg cgc cag ggc gcg ecc 1824 Arg Gly Val Ser Ma Phe Ser Glu Ala Leu Val Arg Gln Gly Ma Pro 595 600 605 gtg tgg cgt tat cag ttc aac ggt aat acc gag ggt gga aga gcg ceg 1872 Val Trp Arg Tyr Gln Phe Asn Gly Asn Thr Glu Gly Gly Arg Ma Pro 610 615 620 gct acc fall gga gcc gaa att ecc tac gtt ttc ggg gtg ttc aag ctc 1920 Wing Thr His Gly Ma Glu He Pro Tyr Val Phe Gly Val Phe Lys Leu 625 630 635 640 gac gag ttg ggt ctg ttc gat tgg ceg ecc gag ggg ecc acg ecc gcc 1968 Asp Glu Leu Gly Leu Phe Asp Trp Pro Pro Glu Gly Pro Thr Pro Ma 645 650 655 gac cgt gcg ctg ggc caa ctg atg tcc tcc gcc tgg gtc cgg ttc gcc 2016 Asp Arg Ma Leu Gly Gln Leu Met Ser Ser Ma Trp Val Arg Phe Ma 660 665 670 aag aat ggc gac ecc gcc ggg gac gcc ctt acc tgg ect gcc tat tet 2064 Lys Asn Gly Asp Pro Ma Gly Asp Ala Leu Thr Trp Pro Ma Tyr Be 675 680 685 acg ggc aag teg acc atg here tcc ggt ecc gag ggc cgc gcg gcg gtg 2112 Thr Gly Lys Ser Thr Met Thr Phe Gly Pro Glu Gly Arg Ma Ma Val 690 695 700 gtg teg ecc gga ect tcc ate ecc ect tgc gcg gat ggc gcc aag gcg 2160 Val Ser Pro Gly Pro Ser Pro Pro Cys Ma Asp Gly Ma Lys Ma 705 710 715 720 54 g 9 = a ggc age ggc gga ggc age ggc gga ggc age aaa gac aac 2208 Gly Gly Gly Gly Ser Gly Gly Gly Ser ßly ßly ßly Ser Lys Asp Asn 725 730 735 gtt gcg gac gtg gta gtg gtg ggc gct ggc ttg age ggt ttg gag acg 2256 Val Ala Asp Val Val Val Val Gly Ma Gly Leu Ser Gly Leu Glu Thr 740 745 750 gca cgc aaa gtc cag gcc gcc ggt ctg tcc tgc ctc gtt ctt gag gcg 2304 Ma Arg Lys Val Gln Ma Ma Gly Leu Ser Cys Leu Val Leu Glu Ma 755 760 765 atg gat cgt gta ggg ggg aag act ctg age gta ca teg ggt e cc ggc 2352 Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val ßln Ser ßly Pro Gly 770 775 780 agg acg act ate aac gac ctc ggc gct gcg tgg ate aat gac age aac 2400 Arg Thr Thr He Asn Asp Leu Gly Ma Ma Trp He Asn Asp Ser Asn 785 790 795 800 caa age gaa gta tcc aga ttg ttt gaa aga ttt cat ttg gag gag ggc gag 2448 Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu 805 810 815 ctc cag agg acg act gga aat tea ate caca gca ca ga ga ggt here 2496 Leu Gln Arg Thr Thr Gly Aen Ser He His Gln Ma Gln Asp Gly Thr 820 825 830 acc act here gct ect tat ggt gac tcc ttg ctg age gag gag gtt gca 2544 Thr Thr Thr Ma Pro Tyr Gly Aep Ser Leu Leu Ser Glu Glu Val Ma 835 840 845 agt gca ctt gcg gaa ctc ctc ecc gta tgg tet cag ctg ate gaa gag 2592 Ser Ma Leu Ma Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu Glu 850 855 860 cat age ctt ca gac ctc aag gcg age ect cag gcg aag cgg cte gac 2640 His Ser Leu Gln Asp Leu Lys Ma Pro Pro Gln Ma Lys Arg Leu? Sp 865 870 875 880 agt gtg age ttc gcg cae tac t gt gag aag gaa cta aac ttg ect gct 2688 Ser Val Ser Phe Ma His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Ma 885 890 895 gtt ctc ggc gta gca aac cag ate here cgc gct ctg ctc ggt gtg gaa 2736 Val Leu Gly Val Ma Asn Gln He Thr Arg Ma Leu Leu Gly Val Glu 900 905 910 gcc falls gag ate age atg ctt ttt ctc acc gac tac ate aag agt gcc 2784 Ma His Glu He Ser Met Leu Phe Leu Thr Asp Tyr He Lys Ser Ma 915 920 925 acc ggt ctc agt aat att ttc teg gac aag aaa gac ggc ggg cag tat 2832 Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lye Asp Gly Gly Gln Tyr 930 935 940 atg cga tgc aaa here ggt atg cag teg att tgc cat gcc atg tea aag 2880 Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Ma Met Ser Lys 945 950 955 960 gaa ctt gtt cea ggc tea gtg falls ctc aac acc ecc gtc gct gaa att 2928 55 J- ^ - - "•. - - .. ***. *. * * .. *. * ... ... t.?-,« í «-H ** Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val Ma Glu He 965 9"IQ 975 gag cag teg gca tcc ggc tgt here gta cga teg gcc teg ggc gcc gtg 2976 Glu Gln Ser Ma Ser Gly Cys Thr Val Arg Ser Ma Ser Gly Ma Val 980 985 990 ttc cga age aaa aag gtg gtg gtt teg tta ceg here acc ttg tat ecc 3024 Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thu Leu Tyr Pro 995 1000 1005 acc ttg ac ttt te ce ect ctt ecc gcc gag aag caca gca ttg gcg 3072 Thr Leu Thr Phe Ser Pro Pro Leu Pro Wing Glu Lys Gln Wing Leu? 1010 1015 1020 gaa aat tet ate ctg ggc tac tat age aag ata gtc ttc gta tgg gac 3120 Glu Asn Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp 1025 1030 1035 1040 aag ceg tgg tgg cgc gaa ca ggc ttc teg ggc gtc ctc ca teg age 3168 Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser Ser 1045 1050 105S tgt gac ecc ate tea ttt gcc aga gat acc age ate gac gtc gat eyebrow 3216 Cys Asp Pro He Be Phe Ma Arg Asp Thr Ser He Asp Val Asp Arg 1060 1065 1070 cag tgg tcc att ace tgt ttc atg gtc gga gac ecg gga cgg aag tgg 3264 Gln Trp Ser He Thr Cys Phe Met Val Gly Asp Pro Gly Arg Lys Trp 1075 1080 1085 tcc caá cag tcc aag cag gta cga caa aag tet gtc tgg gac cac ctc 3312 Ser Gln Gln Ser Lys Gln Val Arg ßln Lys Ser Val Trp Asp Gln Leu 1090 1095 1100 cgc gca gcc tac gag aac gcc ggg gcc ca gtc cea gag ceg gcc aac 3360 Arg Ala Ala Tyr Glu Asn Ma Gly Ma Gln Val Pro Glu Pro Wing Asn 1105 1110 1115 1120 gtg ctc gaa ate gag tgg teg aag cag tat ttc ca gga gct ceg 3408 Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Ala Pro 1125 1130 1135 age gcc gtc tat ggg ctg aac gat ctc ate here stg ggt teg gcg ctc 3456 Being Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Being Ma Leu 1140 1145 1150 aga acg ceg ttc aag agt gtt cat ttc gtt gga acg gag acg tet tta 3504 Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu 1155 1160 1165 gtt tgg aaa ggg tat atg gaa ggg gcc ata cga teg ggt caa cga ggt 35 52 Val Trp Lys Gly Tyr Met Glu Gly Ma He Arg Ser Gly Gln Arg Gly 1170 1175 1180 gct gca gaa gtt gtg gct age ctg gtg cea gca gca tag 3591 Ma Ma Glu Val Val Ma Ser Leu Val Pro Ma Ma 1185 1190 1195 < 210 > 31 211 > 1196 56 L < 212 > PRT < 213 > Unknown < 400 > 31 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lye Lys Phe Glu Leu 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Ly3 50 55 60 Leu Thr Gln Ser Met Ma He He Arg Tyr He Ma Asp Lys His Asn 65 70 75 80 Met Leu Qly Gly Cys Pro Lys Glu Arg Ma Glu He Met Met Leu Glu 85 90 95 Gly Ma Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ma Tyr Ser 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ma Leu Asp 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cy3 Leu Asp Ma Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg He Glu Ma He Pro Gln He Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr He Ma Trp Pro Leu Gln Gly Trp Gln Ala 19S 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 Gly Ser Pro Glu Phe Thr Asp Phe Pro Val Arg Arg Thr Asp Leu Gly 225 230 235 240 Gln Val Gln Gly Leu Ma Gly Asp Val Met Ser Phe Arg Gly He Pro 245 250 255 Tyr Ma Ma Pro Pro Val Gly Gly Leu Arg Trp Lys Pro Pro Gln His 260 265 270 Wing Arg Pro Trp Ma Gly Val Arg Pro Ma Thr Gln Phe Gly Ser Asp 275 280 285 Cys Phe Gly Ma Ma Tyr Leu Arg Lys Gly Ser Leu Ma Pro Gly Val 290 295 300 Ser Glu Asp Cys Leu Tyr Leu Asn Val Trp Ma Pro Ser Gly Ma Lys 305 310 315 320 Pro Gly Gln Tyr Pro Val Met Val Trp Val Tyr Gly Gly Gly Phe Ma 325 330 335 Gly Gly Thr Ma Ma Met Pro Tyr Tyr Asp Gly Glu Ma Leu Ala Arg 340 345 350 Gln Gly Val Val Val Val Thr Phe Asn Tyr Arg Thr Asn He Leu Gly 355 360 365 Phe Phe Ma His Pro Gly Leu Ser Arg Glu Ser Pro Thr Gly Thr Ser 370 375 380 Gly Asn Tyr Gly Leu Leu Asp He Leu Ma Ma Leu Arg Trp Val Gln 385 390 395 400 Being Asn Ma Arg Ma Phe Gly Gly Asp Pro Gly Arg Val Thr Val Phe 405 410 415 Gly Glu Ser Ma Gly Ma Ser Ala He Gly Leu Leu Leu Thr Ser Pro 420 425 430 Leu Ser Lys Gly Leu Phe Arg Gly Ma He Leu Glu Ser Pro Gly Leu 435 440 445 Thr Arg Pro Leu Ma Thr Leu Wing Asp Ser Ma Ma Ser Gly Glu Arg 450 455 460 57 Leu Asp Ala? Sp Leu Ser Arg Leu Arg Ser Thr Asp Pro Ma Thr Leu 465 470 475 480 Met Wing Arg Ma Asp Wing Wing Arg Pro Ma Being Arg Asp Leu Arg Arg 485 490 495 Pro Arg Pro Thr Gly Pro He Val Asp Gly His Val Leu Pro Gln Thr 500 505 510 Asp Ser Ala Ala He Ma Ma ßly ßln Leu Ma Pro Val Arg Val Leu 515 520 525 He Gly Thr Asn Ma Asp Glu Gly Arg Ma Phe Leu Gly Arg Ala Pro 530 535 540 Met Glu Thr Pro Ma Asp Tyr Gln Ma Tyr Leu Glu Ma Gln Phe Gly 545 550 555 560 Asp Gln Ma Ma Ma Val Ma Ma Cys Tyr Pro Leu Asp Gly Arg Ma 565 570 575 Thr Pro Lys Glu Met Val Ma Arg He Phe Gly Asp Asn Gln Phe Asn 580 585 590 Arg Gly Val Ser Ma Phe Ser Glu Ala Leu Val Arg Gln Gly Ma Pro 595 600 605 Val Trp Arg Tyr Gln Phe Asn Gly Asr. Thr Glu Gly Gly Arg Ala Pro 61 * 0 615 620 Ma Thr His Gly Ma Glu He Pro Tyr Val Phe Gly Val Phe Lys Leu 625 630 635 640 Asp Glu Leu Gly Leu Phe Asp Trp Pro Pro Glu Gly Pro Thr Pro Ma 64S 650 655 Asp Arg Ala Leu Gly Gln Leu Met Being Ser Ma Trp Val Arg Phe? La 660 665 670 Lye Asn Gly Asp Pro Ma Gly Asp Ma Leu Thr Trp Pro Ma Tyr Ser 675 680 685 Thr Gly Lys Ser Thr Met Thr Phe Gly Pro Glu Gly Arg Ma Ma Val 690 695 700 Val Ser Pro Gly Pro Ser Pro Pro Cys Asp Gly Ma Lys? 705 710 715 720 Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Ser Lys Asp? Sn 725 730 735 Val Ala Asp Val Val Val Val Gly Ma Gly Leu Ser Gly Leu Glu Thr 740 745 750 Ma Arg Lys Val Gln Ma Ma ßly Leu Ser Cys Leu Val Leu Glu Ma 755 760 765 Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro Gly 770 775 780 Arg Thr Thr He Asn Asp Leu Gly Ma Ma Trp He Asn Asp Ser? Sn 785 790 795 HOO Gln Ser Glu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly Glu 805 810 815 Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Ma Gln Asp Gly Thr 820 825 830 Thr Thr Thr Ala Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val Ma 835 840 845 Ser Ma Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu He ßlu Glu 850 855 860 His Ser Leu Gln Asp Leu Lys Ma Pro Pro Gln Ma Lys Arg Leu? Sp 865 870 875 880 Ser Val Ser Phe Ala His Tyr Cys Glu Lys Glu Leu Asn Leu Pro Ma 885 890 895 Val Leu Gly Val Ma Aen Gln He Thr Arg Ma Leu Leu Gly Val Glu 900 905 910 Ma His Glu He Ser Met Leu Phe Leu Thr Asp Tyr He Lys Ser? La 915 920 925 Thr Gly Leu Ser Asn He Pbe Ser Asp Lys Lys Aep Gly Gly Gln Tyr 930 935 940 Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Ma Met Ser Lys 945 950 955 960 58 Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val Ala Glu He 965 970 975 Glu Gln Ser Ma Ser ßly Cys Thr Val Arg Ser Wing Ser ßly Ma Val 98C 985 990 Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr Pro 99S 1000 1005 Thr Leu Thr Phß Pro Pro Pro Leu Pro Ma Glu Lys G n Ma Leu Ma 1010 1015 1020 Glu Asn Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp Asp 1025 1030 1035 1040 Lys Pro Trp Trp Arg Glu Gln Gly Phe Ser Giy Val Leu Gln Ser Ser 1045 1050 1055 Cys Asp Pro Be Ser Phe Ma Arg Asp Thr Be As Asp Val Asp Arg 1060 1065 1070 Gln Trp Ser He Thr Cys Pbe Met Val Gly Asp Pro Gly Arg Lys. Trp 1075 1080 1085 Ser Gln Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln Leu 1090 1095 1100 Arg Ala Ma Tyr Glu Asn Ma Gly Ma Gln Val Pro Glu Pro Ma Asn 1105 1110 1115 1120 Val Leu Glu He Glu Trp Ser Lys Gln ßln Tyr Phe Gln Gly Ma Pro 1125 1130 1135 Being Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Being Ma Leu 1140 1145 1150 Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr Ser Leu 1155 USE 1165 Val Trp Lys Gly Tyr Met Glu Gly Ma He Arg Ser Gly Gln Arg Gly 1170 1175 1180 Ma Ala Glu Val Val Ma Ser Leu Val Pro Ma Ma 1185 1190 1195 < 210 > 32 < 211 > 2490 < 212 > DMA < 213 > ünknown < 220 > < 223 > GST: glyc (-) APAO open reading frame, 2490 nt; GST and linker, nt 1-687; Glyc (-) APAO, nt 688-2490; tputation in putative glycosylation site in bold and underlined, nt 1288-1290 (AAT-> TCC) and nt 1303-1305 (AGC-> AAC). < 221 > CDS < 222 > (1) ... (2487) < 221 > raisc_feature < 222 > (1) ... (687) < 223 > GST and linker < 221 > misc_feature < 221 > nautation < 222 > (1288) ... (1290) < 223 > mutation in putative glycosylation site (AAT-> TCC) < 221 > mutation < 222 > (1303) ... (1305) < 223 > mutation in putative glycosylation site (AGC-> AAC) 59 < 400 > 32 atg tcc cet ata cta ggt tat tgg aaa att aag ggc ctt gtg cac ecc 48 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 act cga ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg 96 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu Hie Leu 20 25 30 tat gag cgc gat gaa ggt gat aaa tgg cga aac aaa aag ttt gaa ttg 144 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lye Lhe Phe Glu Leu 35 40 4S ggt ttg gag ttt ecc aat tat tat tat att gat ggt gat gtt aaa 192 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 tta here cag tet atg gcc ate ata cgt tat ata gct gac aag falls aac 240 Leu Thr Gln Ser Met Ma He He Arg Tyr He Ma Asp Lys His Asn 65 70 75 80 atg tg ggt ggt tgt cea aaa gag cgt gg gag att tea atg ctt gaa 288 Met Leu Gly Gly Cys Pro Lys Glu Arg Ma Glu He Ser Met Leu Glu 85 90 95 gga gcg gtt ttg gat att aga tac ggt gtt teg aga att gca tat agt 336 Gly Ala Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ma Tyr Ser 100 105 110 aaa gac ttt gaa act ctc aaa gtt gat ttt ctt age aag cta ect gaa 384 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 atg ctg aaa atg ttc gaa gat cgt tta tgt cat aaa here tat tta aat 432 Met Leu Lys Met Phe Glu Asp Arg Leu Cys Hie Lys Thr Tyr Leu Asn 130 135 140 ggt gat cat gta acc cat ect gac ttc atg ttg tat gac gct ctt gat 480 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ma Leu Asp 145 150 155 160 gtt gtt tta tac atg gac cea atg tgc ctg gat gcg ttc cea aaa tta 528 Val Val Leu Tyr Met Aep Pro Met Cys Leu Asp Ma Phe Pro Lys Leu 165 170 175 gtt tgt ttt aaa aaa cgt att gaa gct ate cea caa att gat aag tac 576 Val Cys Phe Lys Lys Arg He Glu Ma He Pro Gln He Asp Lys Tyr 180 185 190 ttg aaa tcc age aag tat ata gca tgg ect ttg cag ggc tgg ca gcc 624 Leu Lys Ser Ser Lys Tyr He Ma Trp Pro Leu Gln Gly Trp Gln Ma 195 200 205 acg ttt ggt ggt ggc gac cat ect cea aaa teg gat ctg gtt ceg cgt 672 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser A sp Leu Val Pro Arg 210 215 220 gga tcc ceg gaa ttc atg gca ctt gca ceg age tac ate aat ecc cea 720 Gly Pro Pro Glu Phe Met Ala Leu Pro Wing Pro Tyr He Asn Pro Pro 225 230 235 240 aac gtc gcc tcc cea gca ggg tat tet falls gtc ggc gta ggc cea gac 768 60 ?? j if > '< ll * B > i. . -. faw »-a. j. .- "j < ¿... .- i j. ,. . , * -,, - * .-. «. - á. ~. .-- ** * ...? i »« j ».« faith .... -I. , .. *,, -,. tJ .. .. *? * i Asn Val Ala Ser Pro Ma Gly Tyr Ser His Val Gly Val Gly Pro? sp 245 250 255 gga ggg agg tat gtg here ata gct gga cag att gga ca gac gct teg 816 Gly Gly Arg Tyr Val Thr He Wing Gly Gln He Gly Gln Asp Wing Ser 260 265 270 ggc gtg here gac ect gec tac gag aaa cag gtt gcc ca gca tcc gcc 864 Gly Val Thr Asp Pro Ma Tyr Glu Lys Gln Val Ma Gln Ma Phe Ma 275 280 285 aat ctg cga gct tgc ctt gct gca gtt gga gcc act tea aac gac gtc 912 Asn Leu Arg Ma Cys Leu Ma Wing Val Gly Ma Thr Ser Asn Asp Val 290 295 300 acc aag ctc aat tac tac ate gtc gac tac gcc ceg age aaa ctc acc 960 Thr Lys Leu Asn Tyr Tyr He Val Asp Tyr Ma Pro Ser Lys Leu Thr 305 310 315 320 gca att gga gat ggg ctg aag gct acc ttt gcc ctt gac agg ctc ect 1008 Wing He Gly Asp Gly Leu Lys Ma Thr Phe Ma Leu Asp Arg Leu Pro 325 330 335 ect tgc acg ctg gtg cea gtg teg gcc ttg tet tea ect gaa tac ctc 1056 Pro Cys Thr Leu Val Pro Val Ser Ala Leu Ser Ser Pro Glu Tyr Leu 340 345 350 ttt gag gtt gat gcc acg gcg ctg gtg ceg gga falls acg acc cea gac 1104 Phe Glu Val Asp Ma Thr Ma Leu Val Pro Gly His Thr Thr Pro Asp 355 360 365 aac gtt gcg gac gtg gta gtg gtg ggc gct ggc ttg age ggt ttg gag 1152 Asn Val Ala Asp Val Val Val Val Gly Wing Gly Leu Ser Gly Leu Glu 370 375 380 acg gca cgc aaa gtc cag gcc gcc ggt ctg tcc tgc ctc gtt ctt gag 1200 Thr Ma Arg Lys Val Gln Ma Wing Gly Leu Ser Cys Leu Val Leu Glu 385 390 395 400 gcg atg gat cgt gta ggg gga aag act ctg age gta cag teg ggt ecc 1248 Wing Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly E'ro 405 410 415 ggc agg acg act ate aac gac ctc ggc gct gcg tgg ate tcc gac age 1296 Gly Arg Thr Thr He Asn Asp Leu Gly Ma Ma Trp He Ser Asp Ser 420 425 430 aae caa aac gaa gta tcc aga ttg ttt gaa aga ctt cat ttg gag ggc 1344 Asn Gln Asn ßlu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly 435 440 445 gag ctc cag agg acg act gga aat tea ate ca caca gca ca gac ggt 1392 Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Ma Gln Asp Gly 450 455 460 here ac ac here gct ect tat ggt gac tcc ttg gag gag gag gttt 1440 Thr Thr Thr Thr Ala Pro Tyr Gly Asp Ser Leu Leu Ser Glu Glu Val 465 470 475 480 gca agt gca ctt gcg gaa ctc ctc ecc gta tgg tet cag ctg ate gaa 1488 Ma Ser Ala Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu 485 490 495 61 jc i i; gag cat age ctt cac gac ctc aag gcg age ect cag geg aag cgg ctc 1536 Glu His Ser Leu Gln Asp Leu Lys Ma Ser Pro ßln Ma Lys Arg Leu 500 505 510 gac agt gtg age ttc gcg falls tac tgt gag aag gaa cta aac ttg ect 1584 Asp Ser Val Ser Phe Wing His Tyr Cys Glu Lys Glu Leu Asn Leu Pro 515 520 525 gct gtt ctc ggc gta gca aac cag ate here cgc gct ctc gt gtg 1632 Ma Val Leu Gly Val Ma Asn Gln He Thr Arg Ma Leu Leu Gly Val 530 535 540 gaa gcc falls gag ate age atg ctt ttt ctc acc gac tac ate aag agt 1680 Glu Ma His Glu He Ser Met Leu Phe Leu Thr Asp Tyr He Lys Ser 545 550 555 '560 gcc acc ggt cte AGT AAT att ttc TEG gac aag aaa gac GGC GGG cag 1728 Ma Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Asp ßly Gly Gln 56S 570,575 tat atg CGA TGC aaa here GGT atg cag TEG att TGC cat gcc atg Cea 1776 Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys Eis Ma Met Ser 580 585 590 aag gaa ctt gtt cea ggc tea gtg falls ctc aac acc ecc gtc gct gaa 1824 Lys Glu Leu Val Pro Gly Ser Val His Leu Asn Thr Pro Val Ma Glu 59S 600 605 att gag cag teg gca tcc ggc tgt here gta cga teg gcc teg ggc gcc 1872 He Glu Gln Ser Wing Ser Gly Cys Thr Val Arg Ser Ma Ser Gly Wing 610 615 620 gtg ttc cga age aaa aag gtg gtg gtt teg tta ceg here acc ttg tat 1920 Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr 625 630 635 640 ecc acc ttg aea ttt tea cea ect ctt ecc gcc gag aag ca gca ttg 1968 Pro Thr Leu Thr Phe Ser Pro Pro Leu Pro Ma Glu Lys Gln Ala Leu 645 650 655 gcg gaa aat tet ate ctg ggc tac tat age aag ata gtc ttc gta tgg 2016 Ma Glu Asn Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp 660 665 670 gac aag ceg tgg tgg cgc gaa ca ggc ttc teg ggc gtc ctc cac teg 2064 Asp Lys Pro Trp Arg Glu Gln Gly Phe Ser Gly Val Leu Gln Ser 675 680 685 age tgt gac ecc ate tea ttt gcc aga gat acc age ate gac gtc gat 2112 Ser Cys Asp Pro Be Ser Phe Ma Arg Asp Thr Ser He Asp Val Asp 690 695 700 cga cagg tgg tcc att acc tgt ttc atg gtc gga gac ceg gga cgg aag 2160 Arg Gln Trp Ser He Thr Cys Phe Met Val Gly Asp Pro ßly Arg Lys 705 710 715 720 tgg aka caa cag aka aag cag cga gta caa aag tet gtc tgg gac caa 2208 Trp Ser ßln ßln Ser Lys ßln Val Arg Glp Lys Ser Val Trp Asp Gln 725 730 735 ctc cgc gca gcc tac gag aac gcc ggg gcc ca gtc cea gag ceg gcc 2256 62 .k *? i -. i- * Leu Arg Ala Ala Tyr Glu Asn Ala Gly Ma Gln Val Pro Glu Pro? la 740 745 750 aac gtg ctc gaa ate gag tgg teg aag cag tat ttc ca gga gct 2304 Asn Val Leu Glu He Glu Trp Ser Lys Gln Gln Tyr Phe Gln Gly? The 755 760 765 ceg age gcc gtc tat ggg ctg aac gat ctc ate here ctg ggt teg gcg 2352 Pro Ser Ma Val Tyr Gly Leu Asn Aep Leu He Thr Leu Gly Ser Ma 770 775 780 ctc aga acg ecg ttc aag agt gtt cat ttc gtt gga acg gag acg tet 2400 Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr Ser 785 790 795 £ 100 tta gtt tgg aaa ggg tat atg gaa ggg gcc ata cga teg ggt caa ega 2448 Leu Val Trp Lys Gly Tyr Met Glu Gly Ma He Arg Ser Gly G n Arg 80S 810 815 ggt gct gca gaa gtt gtg gct age ctg gtg cea gca gca tag 2490 Gly Ma Ma Glu Val Val Ma Ser Leu Val Pro Ala Wing 820 825 < 210 > 33 < 211 > 829 < 212 > PRT < 213 > Unknown < 400 > 33 Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 Leu Thr Gln Ser Met Wing He He Arg Tyr He Ma Asp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ma Glu He Be Met Leu Glu 85 90 95 Gly Ma Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ma Tyr be 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ma Leu Aep 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ma Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg He Glu Wing He Pro Gln He Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr He Wing Trp Pro Leu Gln Gly Trp Gln Ma 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 * 215 220 ßly Ser Pro ßlu Phe Met Ma Leu Pro Wing Pro Tyr He Asn Pro Ero 225 230 235 240 Asn Val Ma Pro Pro Ma Gly Tyr Ser His Val Gly Val Gly Pro Asp 245 250 255 63 -n * »**» *****. * .., i, ^ - é *. ,., ... . _ ,, .._-., ".., ...., .. ...,. . " . . ? ? ^ l .t j.

Gly Gly Arg Tyr Val Thr He Ma Gly Gln He Gly Gln Asp Ma Ser 260 265 270 Gly Val Thr Asp Pro Ma Tyr Glu Lys Gln Val Ma Gln Ma Phe Ma 275 280 285 Asn Leu Arg Ma Cys Leu Ala Wing Val Gly Ma Thr Ser Asn Asp Val 290 295 300 Thr Lys Leu Asn Tyr Tyr He Val Asp Tyr Ma Pro Ser Lys Leu Thr 305 310 315 320 Ma He Gly Asp Gly Leu Lys Ma Thr Phe Ma Leu Asp Arg Leu Pro 325 33C 335 Pro Cys Thr Leu Val Pro Val Ser Ma Leu Ser Ser Glu Tyr Leu Phe Glu Asn Val Ma Asp Val Val Val Val Gly Ala Gly Leu Ser Gly Leu Glu 370 375 380 Thr Wing Arg Lys Val Gln Wing Wing Gly Leu Ser Cys Leu Val Leu Glu 385 390 395 too Ma Met Asp Arg Val Gly Gly Lys Thr Leu Ser Val Gln Ser Gly Pro 405 410 415 Gly Arg Thr Thr He Asn Asp Leu Gly Ma Ma Trp He Ser Asp Ser 420 425 430 Asn Gln Asn ßlu Val Ser Arg Leu Phe Glu Arg Phe His Leu Glu Gly 43S 440 44S Glu Leu Gln Arg Thr Thr Gly Asn Ser He His Gln Wing Gln Asp Gly 450 455 460 Thr Thr Thr Ma Pro Tyr ßly Asp Ser Leu Leu Ser Glu Glu Val 465 470 475 480 Ma Be Ala Leu Ala Glu Leu Leu Pro Val Trp Ser Gln Leu He Glu 485 490 495 Glu His Ser Leu Gln Asp Leu Lys Ma Pro Pro Gln Ala Lys Arg Leu 500 505 510 Asp Ser Val Ser Phe Ma His Tyr Cys Glu Lys Glu Leu Asn Leu Pro 515 520 525 Ma Val Leu Gly Val Wing Asn Gln He Thr Arg Ma Leu Leu Gly Val 530 535 540 Glu Ma His Glu He Ser Met Leu Phe Leu Thr Asp Tyr He Lys Ser 545 550 S55 560 Ma Thr Gly Leu Ser Asn He Phe Ser Asp Lys Lys Asp Gly Gly Gln 565 570 575 Tyr Met Arg Cys Lys Thr Gly Met Gln Ser He Cys His Ma Met Ser 580 585 590 Lys Glu Leu Val Pro ßly Ser Val His Leu Asn Thr Pro Val Ma Glu 595 600 605 He Glu Gln Ser Ma Ser Gly Cys Thr Val Arg Ser Ma Ser Gly Wing 610 615 620 Val Phe Arg Ser Lys Lys Val Val Val Ser Leu Pro Thr Thr Leu Tyr 625 630 635 640 Pro Thr Leu Thr Phe Ser Pro Pro Leu Pro Ma Glu Lys Gln Ma Leu 645 650 655 Ma Glu Asn Ser He Leu Gly Tyr Tyr Ser Lys He Val Phe Val Trp 660 665 670 Asp Lys Pro Trp Arp Glu Gln Gly Phe Ser Gly Val Leu Gln Ser 675 680 685 Ser Cys Asp Pro Be Ser Phe Wing Arg Asp Thr Ser He Asp Val Asp 690 695 700 Arg Gln Trp Ser He Thr Cys Phe Met Val Gly Asp Pro Gly Arg ys 705 710 715 720 Trp Ser Gln Gln Ser Lys Gln Val Arg Gln Lys Ser Val Trp Asp Gln 725 730 735 Leu Arg Wing Ma Tyr Glu Asn Ma Gly Ma Gln Val Pro Glu Pro Wing 740 745 750 64 | aj ^^ * .. aA, ii * Asn Val Leu Glu He ßlu Trp Ser Lys Gln Gln Tyr Phe Gln Gly Ma 755 760 765 Pro Ser Wing Val Tyr Gly Leu Asn Asp Leu He Thr Leu Gly Ser Ma 770 775 780 Leu Arg Thr Pro Phe Lys Ser Val His Phe Val Gly Thr Glu Thr Ser 785 790 795 800 Leu Val Trp Lys Gly Tyr Met Glu Gly Wing He Arg Ser Gly Gln Arg 805 810 815 Gly Ma Ma Glu Val Val Ma Ser Leu Val Pro Ma Wing 820 82S 65

Claims (41)

126 CLAIMS

1. An isolated polynucleotide sequence that encodes an APAO enzyme.

2. An isolated polynucleotide comprising a member selected from: a) a polynucleotide that encodes a polypeptide selected from SEQ. FROM IDENT. US. 6, 11, 23, and 33; b) a polypeptide comprising at least 20 contiguous bases selected from SEQ. FROM IDENT. US. 5, 10, 22 and 32; c) a polynucleotide having at least 40% identity sequence in a polynucleotide selected from SEQ. FROM IDENT. US. 5, 10, 22 and 32; d) a polynucleotide comprising at least 20 nucleotides in length that hybridizes under conditions of low stringency in a polynucleotide selected from SEQ. FROM IDENT. US. 5, 10, 22 and 32; e) a polynucleotide comprising a polynucleotide selected from SEQ. FROM IDENT. US. 5, 7, 10, 22 and 32; and f) a complementary polynucleotide in a polynucleotide of (a) to (e).

3. The recombinant expression cassette characterized in that it comprises a member according to claim 2. 127

4. The vector characterized in that it comprises the recombinant expression cassette according to claim 3.

5. The host cell characterized in that it comprises the recombinant expression cassette according to claim 3.

6. The host cell according to claim 5, characterized because the cell is a plant cell.

7. The transformed plant cell characterized in that it comprises the polynucleotide according to claim 2.

8. The transformed plant cell according to claim 7, characterized in that the plant cell is selected from the group consisting of corn, sorghum, wheat , tomato, soybean, alfalfa, sunflower, sugarcane, cotton and rice.

9. The plant characterized in that it comprises the polynucleotide according to claim 2.

10. The seed of the plant according to claim 9.

11. The asylated polypeptide comprising a member selected from: a) a polypeptide comprising at least 25 of contiguous amino acids of a polypeptide selected from SEQ. FROM IDENT. NOS: 6, 11, 23, and 33; 128 b) a polypeptide comprising at least 55% of the identity sequence in a polypeptide selected from SEQ. FROM IDENT. NOS: 6, 11, 23 and 33; c) a polypeptide encoded by a nucleic acid according to claim 2; d) a polypeptide characterized by a polypeptide selected from SEQ. FROM IDENT. NOS .: 6, 11, 23 and 33; and e) a conservatively modified variety of a polypeptide selected from SEQ. FROM IDENT. NOS .: 6, 11, 23 and 33.

12. The isolated polynucleotide characterized in that it comprises the polynucleotide according to claim 2, fused to a fumonisin esterase gene.

13. The polynucleotide according to claim 12, characterized in that the fumonisin esterase gene is ESPl.

14. The polynucleotide according to claim 13, characterized in that the polynucleotide is set forth in SEQ. FROM IDENT. NO .: 24.

15. The polynucleotide according to claim 12, characterized in that the fumonisin esterase gene is BEST1.

16. The polynucleotide according to claim 15, characterized in that the polynucleotide is set forth in SEQ. FROM IDENT. DO NOT. 26 A .i .. * «. m .. ** ..- * .. 129

17. The isolated polynucleotide comprises the polynucleotide according to claim 2, characterized in that it is mixed in a plant signal sequence.

18. The polynucleotide according to claim 17, characterized in that the plant signal sequence is the apoplast target sequence.

19. The polynucleotide according to claim 17, characterized in that the plant signal sequence is a target neurogenic sequence.

20. A method for reducing the pathogenicity of a structurally related fumonisin, or mycotoxin producing fungus, comprises comprises: a) transforming a cell plant with a vector comprising a fumonisin esterase encoding the polynucleotide operably linked to a promoter and the polynucleotide according to claim 2 operably linked to a promoter; b) cultivate the plant cell under plant growth conditions; and c) inducing the expression of the polynucleotides for a sufficient time for amounts of fumonisin esterase and APAO enzymes accumulated at levels that can inhibit fungi.

21. A method to reduce the pathogenicity of a 130 fungus that produces structurally related fumonisin, or mycotoxin, characterized comprises comprises: a) transforming a cell plant with a vector comprising the polynucleotide according to claim 2, operably linked to a promoter; b) cultivate the plant cell under plant growth conditions; and c) inducing the expression of the polynucleotides for a sufficient time for amounts of fumonisin esterase and APAO enzymes accumulated at levels that can inhibit fungi.

22. A method for reducing the pathogenicity of a fungus that produces structurally related fumonisin, or mycotoxin, characterized comprises comprises: a) transforming a cell plant with a vector comprising a fumonisin esterase polynucleotide operably linked to a promoter; b) transforming a cell plant with a vector comprising the polynucleotide according to claim 2, operably linked to a promoter; c) growing plant cells of (a) and (b) under plant growth conditions to produce a plant A containing the fumonisin esterase polynucleotide and plant B containing the APAO polynucleotide; and d) crossing plant A with plant B to generate «^^^ * ¡« «131 a generated progeny expressing fumonisin esterase and APAO enzymes.

23. The method of degrading fumonisin, a fumonisin abnormality product, a structurally related mycotoin, or a structurally related myotine abnormality product that comprises reacting mycotoin with the polypeptide according to claim 11.

24. The method according to claim 23, characterized in that structurally related fumonisin or mycotoxin is present in the harvested grain.

25. The method according to claim 23, characterized in that the degradation occurs during the process of the harvested grain.

26. The method according to claim 23, characterized in that the degradation occurs in the processed grain that will be used as animal feed.

27. The method according to claim 23, characterized in that the degradation occurs in the silage.

28. A method of degrading fumonisin, a fumonisin abnormality product, a structurally related mycotoin, or a structurally related myotine abnormality product that comprises reacting mycotoin with the polypeptide according to the invention. claim 11 and a fumonisin esterase.

29. The method according to claim 28, characterized in that structurally related fumonisin or mycotoxin is present in the grain 5 harvested.

30. The method according to claim 28, characterized in that the degradation occurs during the process of the harvested grain.

31. The method according to claim 10 28, characterized in that the degradation occurs in the processed grain that will be used as animal feed.

32. The method according to claim 28, characterized in that the degradation occurs in the silage.

33. The method for making an APAO enzyme characterized in that it comprises the steps of: a) expressing the nucleic acid according to claim 2, in a recombinantly designed cell; and b) purifying the enzyme.

34. The method for making an APAO enzyme 20 characterized in that it comprises the steps of: a) expressing the nucleic acid according to claim 2, in a plant; and b) purifying the enzyme from the seed of the plant or other parts of the plant. 25

35. The method to identify plant cells ^ g ^ ¡Sd ^? ^^^^^^^^^^^^^ iy ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^ ^^ 133 transformants characterized in that it comprises the steps of: a) introducing into cells or tissues of a selected target plant in culture to at least one copy of an expression cassette comprising the polynucleotide of claim 2; operatively linked to a transcription initiation sequence towards the 5 'end and a polyadenylation sequence towards the 3' end which causes the expression of the enzyme in the cells; b) introducing API or a phytotoxic analog into the culture medium; and c) identifying the transformed cells as the surviving cells in the culture.

36. The method for detecting structurally related fumonisin or toxins, the method characterized in that it comprises: a) adding APAO enzymes to a sample containing fumonisin or a structurally related toxin; c) detect the hydrogen peroxide produced.

37. The method according to claim 36, characterized in that the APAO enzyme is selected from the SEC. DE IDENT: N0S.:6, 11, 23 and 33.

38. The method according to claim 36, characterized in that the fumonisin esterase is also added to the sample.

39. A method of detecting fumonisins or toxins IJ tfe '4 £ i .. < t - i structurally related, the method characterized in that it comprises: d) adding the APAO enzymes in a sample containing the fumonisin or a structurally related toxin; e) allow the reaction to occur until the toxin becomes 2-OP; and f) detect the ammonia produced.

40. The method of claim 39, characterized in that the APAO enzyme is selected from SEQ ID. NO: 6 and SEC DE IDENT. NO: 23

41. The method according to claim 39, characterized in that the fumoisin esterase is also added to the sample.