MXPA00012879A - Method of preventing bacteriophage infection of bacterial cultures - Google Patents

Abstract

Method of preventing bacteriophage infection of bacterial cultures comprising modified strains, wherein the cultures are completely resistant to bacteriophage attack and have retained their capability of being metabolically active. The method is useful in the manufacturing of food products, feed products or useful metabolite products.

Description

METHOD TO PREVENT BACTERIAL CROPS BACTERIOPHAGEAL INFECTION FIELD OF THE INVENTION The present invention relates to the field of bacterial cultures which are used industrially in the production of, for example, food products or used in metabolite products. In particular, modified bacterial strains are provided, which, when cultured, in a selected substrate material, are not susceptible to bacterial attack, and retain their ability to be metabolically active.

BACKGROUND OF THE INVENTION Failures in the production of bacterial cultures caused by bacteriophage infection are considered to be one of the major problems in the industrial use of bacterial cultures. Bacteriophages have been found in many of the bacterial strains used Ref. 126106 in the industry, such as species of the lactic acid bacteria for example, Lactococcus spp., Lactobacillus spp. , Leuconostoc spp. , Pediococcus spp., And Streptococcus spp., Propionibacterium spp., Bifidobacterium spp., Staphylococcus spp., Or Micrococcus spp. In addition, bacteriophage infections are also well known in other industrially employed species such as Bacillus spp., Enterobacteriaceae spp., Including E. coli., Corynebacterium spp., Actinomycetes spp. and Brevibacterium spp.

In the food industry, bacterial starter cultures of lactic acid are widely used for food fermentations. It seems that among the elements of lactic acid the bacterium Lactococcus spp. Is more devastated by bacteriophage infections. One factor, which leads to frequent bacteriophage infections in bacterial starter cultures of lactic acid, is the fact that the fermentation conditions in the food industry including the dairy industry are not generally sterile. Thus, it has not yet been possible to eliminate contamination of bacteriophages bao these industrial conditions The lytic development of phages involves the adsorption of phages to the host cell surface, the injection of phage DNA into cells, the synthesis of phage proteins, the replication of phage DNA, assembly of progeny phage and release of the progeny from the host. The mechanisms of interference mediated by the cell with any of these events can prevent a phage infection. The ability of bacterial cultures to resist infection of bacteriophages during industrial use depends on a broad extension in the characteristics of the host strain that affects one or more of the above mechanisms.

Thus, it has been shown that bacteriophage resistance or defense mechanisms exist in bacterial strains, which ensure a certain level of protection against bacteriophage attack. These natural defense mechanisms include the inhibition of phage adsorption, prevention of phage DNA penetration, restriction of phage DNA and abortive infection.

The prevention of productive contact between phages and bacterial cells due to altered cell surface receptors for phages greatly reduces the ability of phages to attack cells. The adsorption of phages to the cell surface is not always sufficient for the translocation of phage DNA. It has been shown that specific cell membrane proteins are involved in preventing the penetration of phage DNA.

The restriction / modification is a mechanism that operates by the cooperation of two enzymatic systems, a DNA restriction restriction enzyme, and a DNA modification enzyme, usually a methylase. The mechanism works by unfolding the phage DNA, when it enters the cell.

The abortive phage infection is described as a mechanism that interferes with phage development after phage display has begun. This can eventually lead to a reduced level or termination of the production of the viable phage progeny.

However, like many other assays of bacterial strains which are important for industrial performance, the natural phage defense mechanisms described above have been shown to be unstable characteristics, since they can be mediated by plasmids. In addition, these defense mechanisms are often phage-specific, that is, they are only active against a limited range of bacteriophage types. Accordingly, the prior art is not aware of a mechanism of resistance associated with general and stably maintained cells against bacteriophage infection.

Based on natural defense mechanisms, the industry has designed and implemented strategies to possibly reduce the bacteriophage infection of bacterial cultures, including starter cultures for the fermentation of milk products. Strategies currently used include the use of mixed starter cultures, and alternate use of strains that have different phage susceptibility profiles (rotation of strains).

Traditionally, starter cultures in the dairy industry are mixtures of bacterial strains of lactic acid. The complex composition of mixed starter cultures ensures that a certain level of resistance to phage attack is present. However, repeated subcultivation of cultures of mixed strains leads to unpredictable changes in the distribution of the individual strains and eventually in the domain of the undesirable strains. This, in turn, can lead to increased susceptibility to phage attack and the risk of fermentation failures.

The rotation of the selected bacterial strains which are sensitive to different phages is another scope to limit phage development. However, it is difficult and cumbersome to identify and select a sufficient number of strains having different phage-type profiles to provide an efficient and reliable rotation program. In addition, the continuous use of strains requires careful monitoring by new infectious phages and the need to rapidly replace a strain which is infected by the new bacteriophage with a phage-resistant strain. In processing plants, where large quantities of starter cultures in volume are processed beyond time, such a response is not usually possible quickly.

Studies have shown that a reduced growth capacity of a bacterial culture such as lactic acid bacteria deficient in proteinase results in reduced phage proliferation (Richardson et al., 1983, 1984). However, such bacterial strains are still grown and are thus still susceptible to phage attack.

In addition, the industry is not in possession of any reliable strategy to ensure that such bacterial cultures used for industrial processing of food products or other products, are resistant against attack by bacteriophages. However, none of the currently used strategies prevents infections by any type of bacteriophage and none of these strategies are able to exclude that bacteriophages, due to a mutational event, avoid the resistance mechanisms of strains of bacterial cultures.

It is therefore a significant object of the present invention to provide a method of preventing the infection of bacteriophage bacterial cultures which are used in the manufacture of food products and other products, where the cultures are completely resistant to attack by all types of bacteriophages.

BRIEF DESCRIPTION OF THE INVENTION Accordingly, the invention provides in a first aspect, a method of modifying a substrate material by means of a bacterial culture, which is capable of being metabolically active in said substrate, wherein the bacterial culture is not susceptible to attack by bacteriophages, the method comprises (i) isolation of a bacterial strain, which is not capable of DNA replication, RNA transcription or protein synthesis in said substrate material, but is capable of metabolically modifying the substrate material. (ii) propagation of the selected strain in a medium where the strain is capable of replication to obtain a culture of said strain, (iii) adding the bacterial culture thus obtained to the substrate material and maintaining the material under conditions where the culture is metabolically active, thus, if the substrate material is contaminated with a bacteriophage, the metabolic activity of the bacterial culture is not substantially affected by the bacteriophage.

The invention pertains in another aspect to a modified lactic acid bacterium that is modified to become incapable of performing DNA replication, RNA transcription or protein synthesis in a specially defined substrate material, which is limited with respect to to at least one compound that is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis, said strain "'" "- - - - - - --- --- bacterial modified is capable of being metabolically active in said substrate material, thereby, the strain is not susceptible to attack by bacteriophages, subject to limitation, such that the bacterium of lactic acid 5 is not strain DN 105 (DSM 12289).

In additional aspects, a starter culture composition comprising the lactic acid bacterium is provided in accordance with The invention and a starter culture composition comprising a lactic acid bacterium obtainable by the method according to the invention in combination with at least one additional lactic acid bacterium. In a further aspect, there is provided a method of making a food product or food comprising the addition of a starter culture composition according to the invention. to a food product or food initiator material and maintaining the initiator material thus inoculated under conditions wherein the lactic acid bacteria is metabolically active.

The invention relates in one aspect Further, to a method for preventing the bacterial starter culture of lactic acid from being infected by bacteriophages in the manufacture of a food product or food, the method comprises addition as a starter culture of a lactic acid bacterium obtained by the method of compliance with the invention to a food product or food starting material, which is limited with respect to at least one compound that is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis and to maintain the initiator material as well inoculated, under conditions wherein the lactic acid bacterium is metabolically active, thereby, if the substrate material is contaminated with a bacteriophage, the metabolic activity of the bacterial culture is not substantially affected by the bacteriophage.

In yet a further aspect, the invention pertains to the use of a culture as obtained in the method of the invention or a lactic acid bacterium according to the invention, as a starter culture in the preparation of a product selected from the group consisting of of a milk flavor, a cheese flavoring product, a food product and a hair product DETAILED DESCRIPTION OF THE INVENTION 5 Thus, in its broadest aspect, the invention provides a method of modifying a substrate material by means of a bacterial culture, which is capable of being metabolically active in said In this way, the bacterial culture is not susceptible to attack by bacteriophages, said method comprises the steps of (i) to (iii) as mentioned above. As used herein, the expression "modification of a substrate material" is used interchangeably with the term "processing", and refers to any aerobic or anaerobic breakdown of organic compounds by a bacterial culture with the production of a final product. In addition, it will be appreciated that the expression "Metabolically active" refers to the ability of the bacterial culture to convert a substrate material such as, for example, milk or sugar.

In the present context, the expression "not susceptible to attack by bacteriophages" includes the ability of a cellular host to be metabolically activated even through an uptake of the bacteriophage on the host cell surface and injecting its DNA into the host cell. As used herein, the term "bacteriophage" refers to any class of viruses that infect the bacterium, including the group of bacteriophages labeled prolates, isotope labeled bacteriophages and the P335 group of bacteriophages. In accordance with the invention, the method comprises in one aspect, the isolation of a bacterial strain which is not capable of DNA replication, RNA transcription or protein synthesis in a substrate material specifically defined, but is capable of metabolically modifying said material. It will be understood that this context, the expression "a specifically defined substrate material" refers to a substrate material in the Which is limited with respect to L least a nutrient compound that is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis. Obviously, it is a very surprising finding that is possible Provide such bacterial strains not - Oji & a * ¡¡^^^^ proliferating, which are not able to grow on substrate materials specifically defined, but which have retained their ability to be metabolically active. As used herein, the term "non-proliferating bacterial strain" refers to a bacterial strain which is not capable of multiplication in a specifically defined substrate material.

In a particularly employed embodiment of the present invention, the above specific substrate material is limited with respect to at least one nutrient compound that is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis. Such compounds include nitrogenous bases or amino acids, such as purine and pyrimidine bases.

Thus, the growth of the bacterial strain is prevented due to the lack of the ability of the strains to synthesize the specific compound with respect to which the substrate is limited. Such a mutant strain, which has essentially lost the ability to synthesize de novo such compounds, is also referred to in the art as "auxotrophic strain". Therefore, in preferred embodiments, the bacterial strain is a mutant strain that is auxotrophic with respect to a compound which is not present in the substrate material and which is required by the strain for DNA replication, transcription of the DNA or protein synthesis.

The substrate material used in method 10 of the invention may, in a further useful embodiment, contain at least one compound that inhibits DNA replication, RNA transcription or protein synthesis of the bacterial strain. Examples of such compounds include chloramphenicol and erythromycin, which affect the ribosomes of bacterial cells and thus inhibit the synthesis of proteins.

According to the invention, the propagation of the strain selected before its use in the present method requires a medium in which the strain is capable of replication to obtain a culture of said strain. It is assumed that a medium containing the specific compound, in which the mutant is not capable of being synthesized, will restore the capacity of the ^ * ^ Hg ^ XJ &A A AX. & í í t- &. mutant to grow, that is, the ability of DNA replication, RNA transcription and / or protein synthesis.

In a further aspect of the method according to the invention, the bacterial culture obtained above is added to the above substrate material and maintained under conditions where the culture is metabolically active. It will be understood that in this context, the term "conditions" includes the temperature, pH, appropriate composition of the substrate material or presence / absence of an inducing substance, in which the metabolic activity of the bacterial culture is optimal.

Bacteriophages require hosts with intact DNA replication, RNA transcription, and protein synthesis to proliferate. Accordingly, the bacterial cultures used in the method of the invention are incapable of performing one of the above activities, which make such bacterial cultures substantially completely resistant to the attack of bacteriophages. In addition, the metabolic activity of the bacterial culture is not substantially affected even if the substrate material is contaminated with bacteriophages. As used herein, the term "substantially unaffected" indicates that by use of conventional detection methods no changes or only minor changes in metabolic activity can be detected.

It will be appreciated that such auxotrophic bacteria can be provided by subjecting a native-type bacterial strain that, under appropriate conditions, is capable of growing on a substrate material with or without the need for the specific compound for DNA replication, RNA transcription. or synthesis of the protein to a mutagenization treatment and selection of a strain that is substantially incapable of growing in the absence of said specific compound.

Suitable mutagenesis includes conventional chemical mutagens and UV light. Thus, as an example, a chemical mutagen can be selected from (i) a mutagen that is associated with or becomes incorporated into the DNA such as an analogous base, for example 2-25 aminopurine or an intercalating agent such as ICR- 191, (ii) a mutagen that reacts with the DNA that includes the alkylating agents such as nitrosoguanidine or hydroxylamine, or ethylethane sulfonate (EMS). As an alternative, the autoxtrophic bacterium can be provided by the selection of spontaneously originating mutants which, compared to the original strain, have a growth requirement for a compound necessary for DNA replication, RNA transcription or synthesis. proteins It will be understood that it is also possible Provide an auxotrophic mutant for site-directed mutagenesis, for example, by the use of recombinant DNA techniques, such as gel hitting techniques, whereby the specific gene is cut off and provided nonfunctional in the bacteria. It is also possible to construct the mutated bacterial strains according to the method of the present invention by techniques which involve the loss of part of the chromosome or a base of nucleotides or bases in the DNA sequences, which provides the specific or functional gene in ^ ^ ^^^^^^^^^ fes ^^^^ the bacteria. An illustrative example of t-to suppression strategy is described in detail in the following Examples.

The original strain of the above bacterial wild type can be selected from any industrially suitable bacterial species, that is, the strain can be selected from a group consisting of Lactococcus spp. , which include L. lactis, Lactobacillus spp., Leuconostoc spp., Pediococcus spp. , Streptococcus spp. Propionibacterium spp., Bifidobacterium spp. • Staphylococcus spp. , Micrococcus spp. , Bacillus spp. , Actinomyces spp. , Enterobacteriaceae spp. , including E. coli, Corynebacterium spp., and Brevibacterium spp.

In a specific embodiment of the method according to the invention, a Pur 'mutant, including strain Lactococcus lactis DN 105 (DSM 12289) is used.This acidic DN 105 bacterial strain is an auxotrophic purine mutant capable of aicidifying milk, even though the strain is not able to grow due to its purine requirements, which is not present in the milk in sufficient quantities to support the growth of a bacterium. j & Bajgte! ^ ^ ^ shown in Example 1 below, strain DN105 is able to acidify the milk under purine suppression conditions even in the presence of a high concentration of bacteriophages.

In a further employed embodiment of the method according to the invention, a thyA mutant is used, including the strain La c t ococcus l a c ti s MBP71 (DSM 12891). This MBP71 acidifying bacterial strain is an auxotrophic thymidine mutant, which is capable of acidifying the milk, even though the strain is not able to grow, due to its requirement for thymidine, which is not present in milk in sufficient quantities to support the growth of such a mutant. As shown in Example 2 below, the MBP71 strain is capable of acidifying the milk under thymidine suppression conditions even in the presence of a high concentration of bacteriophages.

It is convenient to provide the above bacterial strains both when used as food or food production strains, as a production strain for metabolites, as a composition comprising the bacterial strain selected for the specific use. Typically, such compositions contain the bacteria in concentrated form for example, at a concentration of viable cells (colony forming units, CFUs) which are in the range of 105 to 1013 per g of the composition such as in the range of 106 to 1012 per g. Additionally, the culture composition may contain additional components such as bacterial nutrients, cryoprotectants or other substances that increase the viability of the bacterial active ingredient during storage. The composition can be in the form of a liquid, dry composition by cooling or freezing.

As mentioned above, a characteristic of the bacterial culture as used in the method of the invention is to be able to metabolically modify a specifically defined substrate material even though the strain is capable of growing on such a substrate. When the lactic acid bacteria is used in the method of the invention, the bacterial culture obtained typically has an acidification rate in the milk, which is at least 10% of that of said culture when it is -W? ' t > present in a substrate material which is capable of DNA replication, RNA transcription and / or protein synthesis. In preferred embodiments, the bacterial strain has an acidification rate in the milk, which is at least 1% including at least 5%, such as at least 10%, for example at least 15%, such as at least 20%, including at least 25% of that culture when it is present in a substrate material where it is capable of DNA replication, RNA transcription and / or protein synthesis.

Typically, the bacterial strain used in the method of the invention is added to the substrate material at a concentration in the tango of 105 to 109 CFU / ml or g of the material. Such as at least 105 CFU / ml og of the material, including at least 10 6 CFU / ml og of the material, such as at least 10 7 CFU / ml og of the material, for example, at least 10 8 CFU / ml og of the material, including minus 109 CFU / ml of the material.

Thus, obtaining a bacterial culture which is completely resistant to bacteriophage attack according to the method of the invention, can be used in all contexts «Fr > where the proliferation of the crop in the substrate material is not a requirement. The milk fermentations of milk is such an example of an industrial manufacturing process, as the proliferation of the lactic acid bacteria during the fermentation of the milk is not a requirement, if it is desired to obtain the taste and acidification of the fermentation product. Therefore, in embodiments employed, the substrate material in a starter material for an edible product including milk, a plant material, a meat product, a must, a fruit juice, a vine, a dough and a pastry mix.

In additional embodiments, the substrate material is a starter material for an animal feed such as silages eg pasture, cereal material, shelters, alfalfa or sugar beet leaves, where the bacterial cultures are inoculated into the food crop for be ensiled in order to obtain a preservation of this, or in a protein-rich animal waste products such as slaughter of animals for viscera and sacrifice of fish also within the fields of preservation of these viscera for animal feeding purposes .

Yet another significant application of the method according to the present invention is the use of bacterial cultures as the so-called probiotics. By the term "probiotic" is meant in this present context, a microbial culture, which when ingested in the form of viable cells by humans or animals, confers a condition of improved health, for example, by the suppression of dangerous microorganisms in the gastrointestinal tract, by the increase of the immune system or by the contribution of the digestion of nutrients.

This is, as mentioned above, an important objective of the present invention, to provide a method of preventing infection of bacteriophage from bacterial cultures which are metabolically active by the use of non-proliferating bacterial cells. In order to be of industrial interest, such metabolic activity should result in the production of a substantial amount of the desired final product. Thus, one possibility of increasing such production by the use of a non-proliferating cell is an increase in the flow through the metabolic trajectories.

Accordingly, in one embodiment employed, the bacterial culture employed in the method of the invention comprises a genetically modified strain, which, relative to its original strain, is increased in at least one metabolic pathway. Such increased metabolic activity may be, for example, obtained through an increased glycolytic path and / or an increased flow through a pentose phosphate path.

An approach for stimulating flow through the glycolytic pathway is by increasing the expression of ATPase activity, i.e., an increased conversion of ATP to ADP, as described in WO 98/10089. So, in one In the embodiment employed of the invention, the genetically modified strain has, relative to its original strain, an increased ATPase activity.

In one embodiment of interest of the present invention, the genetically modified strain in one in • x > riz i .- &xyyy. where the gene coding for ATPase is under the control of an adjustable promoter. As used herein, the term "regulatable promoter" is used to describe a promoter sequence possibly including regulatory sequences for the promoter, in which the promoter is regulatable by one or more factors present in the environment of the strain. Such factors include the pH of one or more factors present in the environment of the strain. Such factors include the pH of the growth medium, the temperature of growth, a temperature change that stimulates the expression of the heat-shock genes, the composition of, growth medium including the content of the ionic strength / NaCl and the phase of growth / speed of growth of the bacteria. Such regulatable promoters can be the native promoter or can be an inserted promoter not naturally related to the gene either isolated from the same bacterial species or can be a heterologous promoter sequence, i.e., a sequence derived from different bacterial species.

Cells such as "restart cells" or "non-dividing cells" represent other types of non-proliferating cells which are used in the method of the invention and where the previous increase of the flow through the trajectories is used. metabolic Such cells are incapable of mitosis or meiosis, for example, due to the deficiency of DNA, RNA and / or protein necessary for cell separation. Thus, in a particularly employed embodiment, the bacterial culture is one which comprises a bacterial strain which is capable of increasing the size of the cells without mitosis.

In addition, the invention encompasses non-proliferating strains which under specific conditions are unable to grow. Thus, in an interesting embodiment, the bacterial culture comprises a strain which is a conditional mutant, i.e., a mutant which under predetermined conditions does not perform at least one activity is read from the group consisting of DNA replication, transcription of the RNA and protein synthesis. Such predetermined conditions include pH, temperature, composition of the substrate material and presence / absence of inducing substances.

A possible means of providing such conditional mutants in which they are temperature sensitive is subjecting a bacterial strain which under appropriate conditions is capable of growing on a material substrate, for example at a temperature below 30 ° C at a mutagenization treatment and selection of a mutant strain that is substantially unable to grow at temperatures below 30 ° C, but is capable of growing at 10 high temperatures.

In a further aspect of the invention, a modified lactic acid bacterium is provided which is modified to become incapable of performing DNA replication, RNA transcription or protein synthesis in a specifically defined substrate material, which is limited with respect to at least one compound that is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis, said modified bacterial strain is capable of being metabolically active in said substrate material, thereby, the strain is not susceptible to attack by bacteriophages, subject to limitation, 25 since lactic acid bacteria is not the jAAeaiJ-ii-d. < - < ! . i .. - - * jbzj ^^ Í g ^ * Í A¡¿S & ^. strain DN105 (DSM 12289).

In embodiments employed, the lactic acid bacterium according to the invention is a mutant strain that is auxotrophic with respect to a compound which is not present in the substrate material and which is required by the strain for replication.

The currently preferred lactic acid bacteria according to the invention are mutant strains, which are thyA mutants including La c t ococcus l a ti c MBP71 strain, deposited under accession number DSM12891.

The modified lactic acid bacterium according to the invention is used as a starter culture in the production of food and food products. Accordingly, in a further important aspect the invention relates to a starter culture composition comprising the lactic acid bacterium according to the invention.

As is normal in the production of -, x. i x- -x -. .and Z , . . . ,. í. - - i ^ X - -. and Z . - -to..

Bacterial fermentation processes of lactic acid applied to lactic acid bacteria from mixed cultures, a composition in certain modalities will comprise a multiplicity of strains either carrying the same species or carrying different species. Accordingly, in a further important aspect, the invention relates to a starter culture composition comprising a lactic acid bacterium obtainable by the method according to the invention, in combination with at least one additional lactic acid bacterium. A typical example of such is an employed combination of the lactic acid bacteria in a starter culture composition is a mixture of the bacteria obtainable by the method according to the invention and one or more of Lactococcus spp. such as Lactococcus lactis subsp. lactis or Lactococcus lactis subspecies lactis biovar, diacetylactis or Leuconostoc spp. Such mixed culture can be used in the manufacture of fermented milk products such as milk and cheese whey.

In one embodiment, the composition according to the invention is one in which it further comprises at least one component that increases viability the bacterial active ingredient during storage that includes a bacterial nutrient or a cryoprotectant.

It is also an object of the present invention to provide a method for the manufacture of a food product or food in the use of the modified bacterium of the invention. Thus, in its broadest aspect, such method comprises the addition of a starter culture composition according to the invention to a foodstuff or food starting material and keeping the starter material thus inoculated, under conditions wherein the lactic acid bacteria It is metabolically active. In a particularly used embodiment, the starting material of the food product is milk.

In additional aspects, the invention relates to the use of a culture as obtained in the method according to the invention as a starter culture in the preparation of a product selected from the group consisting of a milk flavoring, a flavoring product of cheese, a food product and a food product.

The invention will now be described in further details in the following non-limiting examples and drawings where Figure 1 shows acidification of reconstituted skimmed milk (RSM) by strain DN105 The pH is after the time in the cultures RSM contains the strain Lactococcus lactis DN105 involved at 1%, 10%, 25% and 50% vol / vol.

Figure 2 illustrates the development of pH in RSM when inoculated with 25% vol / vol of the strain Lactococcus lactis CHCC373 or Lactococcus lactic strain DN105, in the presence of bacteriophage strain 836 a concentration of at least 108 PFU / ml; Figure 3A-H illustrates the pH development in the RSM when inoculated with 25% vol / vol of the strain Lactococcus lactis DN105 with or without the addition of the hypoxanthine purine compound to the culture medium, in the presence of at least 108 PFU / ml of the following bacteriophages: CHPC836 (3A); CHPC412 (3B); CHPC783 (3C); CHPC795 (3D); CHPC710 (3R); CHPC12 (3F); CHPC708 (3G); CHPC814 (3H); Figure 4 shows the acidification of RSM by the strain Lactococcus lactis MBP71 inoculated to different concentrations. The pH of 200 ml of the RSM cultures comprising the MBP71 strain inoculated to 1%, 5%, 10%, 25% and 50% (v / v) monitored online; Y Figure 5 shows the acidification of RSM 10 comprising the bacteriophages and / or thymidine, by strains Lactococcus lactis MBP71 and CHCC373, which were inoculated at a concentration of 25% (v / v) in a volume of 100 mole of RSM . The thymidine concentration was 20 mg / l and the bacteriophage CHPC733 was added at a concentration of 2xl08 PFU / ml. The pH was monitored by the collection of the 2.5 ml samples.

EXAMPLE 1 20 The use of a strain of purine auxotrophic Lactococcus lactis for obtaining resistance against bacteriophages in milk fermentations 1.1 Materials and methods Sg ^^ (I) Bacterial strains, media and growth conditions The strain La ctococcus lac ti s DN105 is an auxotrophic purine mutant (Pur ") derived from the wild type strain CHCC373 described in Nilsson and Lauridsen (1992) .A sample of the strain La ct ococcus lac ti s DN105 is deposited with Deutsche Smmlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg Ib, D-38124 Braunschweig, Germany on June 30, 1998, under access No. DSM 12289.

The Lact ococcus l acti s was grown in M17 (Terzaghi &Sandine, 1975) in chemically defined DN medium (Dickley et al., 1995) or in reconstituted skimmed milk (RSM) containing 9.5% (w / vol) ) of fat skimmed milk powder at 30 ° C. For the propagation of DN105 acepa, the medium is supplemented with hypoxanthine for a final concentration of 15-50 mg / l. The "Pur" phenotype of strain DN105 was tested for its ability to grow in a DN medium with and without hypoxanthine supplementation. (ii) Bacteriophages and their manipulation The bacteriophages were purified by three stages of isolation of single plates. Lysates of higher titrant bacteriophages were prepared by consecutive infections of host strain CHCC373 with the bacteriophage at an MOI (multiplicity of infection) of 0.1 to 1.0. After infection the culture was grown at 30 ° C in an M17 supplemented with 10 mM CaCl 2 until the lysis was complete. The lysates were centrifuged for 15 minutes at 6,000 rpm and the sterile supernatant was filtered (0.45 μm, Schleicher und Schuell). (iii) Determination of bacteriophage titrators For the determination of bacteriophage titrators (plaque forming units per ml), the double-agar method was used (Adams M.H., 1959, Interscience Publishers, Inc. New York). The bacteriophages used for the acidification tests are listed in Table 1 below: Table 1. Bacteriophages and phage titulators (iv) Test for acidification of RSM by strain DN105 -400 ml of a culture that grows more than strain DN105 in M17 was harvested by centrifugation, washed twice with a sterile solution of 0.9% NaCl to remove the residual purine compounds and resuspend in 10-400 ml of RSM. to give the same cell density as in the M17 culture that grows the most. The resuspended material was used for the inoculation of fresh RSM at volume / volume concentrations typically in the range of 10 to 100% (v / v). The pH was monitored either online or by measuring the pH of 3 ml samples collected at intervals. 1. 2 Results of acidification of RSM by the strain La ctococcus lacti s DN105 In general, the lactic acid bacterial cells which do not have the DNA replication systems intact, RNA transcription and protein synthesis are unable to grow and acidify the milk. Nilsson and Lauridsen (1992) demonstrated that the DN105 auxotrophic purine mutant is unable to grow in a purine-free medium. It has also been reported that the auxotrophic purine mutants of La ct ococcus l a c ti s that did not grow in milk are unable to acidify such a substrate material (Dickley et al., 1995). To test the ability of strain DN105 to acidify a milk-based medium, the strain was inoculated in amounts that vary in RSM as described in Materials and Methods and the pH of the substrate material was monitored (Fig. 1).

The results shown in Figure 1 clearly demonstrate that strain DN105 was able to acidify the milk at least at pH 5.0 even under purine suppression conditions. 1. 3 Studies of the resistance of bacteriophages of the strain La c tococcus l a c ti s DN105 in RSM As is generally known, a bacteriophage requires a susceptible host cell which has intact DNA replication systems, RNA transcription and protein synthesis for development. If a potential host is not able to perform at least one of these activities, the bacteriophages can not be proliferated in the cells.

Figure 2 shows the development of pH in RSM when inoculated with 25% vol / vol of the wild-type strain CHCC373 or the mutant strain DN105 in the presence of the bacteriophage CHPC836 at a concentration of at least 108 PFU / ml.

In further experiments, the resistance of strain DN105 against several bacteriophages was studied in RSM with and without adding hypoxanthine. The bacteriophages were added to RSM at 108 to 109 bacteriophages / ml.

The addition of hypoxanthine was used as a positive control for the infection of the bacteriophage, as the addition of this purine compound allows the attack of the bacteriophage (Fig. 3A-H). In all cultures without adding hypoxanthine, strain DN105 acidified the milk to approximately pH 5.0, while with the addition of hypoxanthine, none of the cultures reached a pH below 5.4. 1. 4 Discussion This example shows that the suppression of a Pur strain of L. Lac s for puncta, causes total resistance to a range of bacteriophages and that the Pur strain of L. Lac ti s is capable of effectively acidif the milk in the presence of a large number of bacteriophages for which the corresponding wild type is susceptible.

Thus, the present Example shows that it is possible to develop strains which under appropriate selected conditions, where the strains are unable to grow, are completely resistant to the bacteriophages and that such strains have retained the metabolic ability to acidify the milk. Such bacteriophage resistance system can be introduced into any bacterium for example, Lactococcus spp. , Lactobacillus spp. , Leuconostoc spp. , Pedíococcus spp. , and Streptococcus spp. , Propionibacterium spp., Bifidobacterium spp., Staphylococcus spp. , or Micrococcus spp. , Bacillus spp. , Actinomycetes spp. , Enterobacteriacear spp. , including E. coli, Corynebacterium spp., and Brevibaceterium spp., with respect to for example, the production of a bacterial fermentation product such as lactate, diacetyl, acetoin, metantiol, ethanol, etc. if the proliferation of bacteria is not a requirement.

EXAMPLE 2 The use of a strain The use of thymidine auxotrophic ctococc to obtain resistance against bacteriophages in milk fermentations 2. 1 Materials and Methods (I) Bacterial strains, media and growth conditions The strain La ctococcus l a c ti s MBP71N105 is an auxotrophic thymidine mutant (thyA) derived from the wild-type strain CHCC373 (see Example 1). A sample of the MBP71 strain has been deposited with Deutsche Smmlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg Ib, D-38124 Braunschweig, Germany on June 30, 1998, under accession No. DSM 12289.

Strain CHCC373 was grown routinely at 30 ° C in M17 (Teraghi &Sandine, 1975) supplemented with 0.5% lactose or, in reconstituted skimmed milk (RSM) containing low fat skimmed milk powder 9.5% (p. / v).

For the propagation of the MBP71 strain, the medium is supplemented with 20 mg / l of thymidine, since none of M17 or RSM supports the growth of the ThyA phenotype. During manipulations to construct MB71 strains, 5 mg / l erythromycin was added to the M17-based medium to maintain the plasmid. Also, when grown at 37 ° C, during these manipulations, a medium based on M17 supplemented with 50 mM NaCl was required to increase the growth of E. col i DH5a (Life Technologies Inc., USA), which were grown in an LB medium supplemented with 100 mg / ml erythromycin to maintain the transformed plasmid. The bacteriophage CHPC733 used in growth experiments where phage resistance to the MBP71 strain was tested was tested. For the manipulation of the bacteriophage and the titration of the titrators see Example 1. (ii) Construction of the plasmid with the suppression of thyA from strain CHCC373 An approximately 800 bp fragment, upstream of thyA from strain CHCC373 ^^^^ and ^^ was obtained by PCR on the chromosomal DNA using the primers TATAATCTGCAGGGTCACACTATCAGTAATTG (SEQ ID NO: 1) and TATTTTAAGCTTCACAGTCTGCTATTTTGATTC (SEQ ID NO: 2), which also introduce a Pstl and Hi ndI I I site, respectively, into the terminal fragments. The resulting fragment includes the -35 box of the thyA promoter, but not the box 10. Another approximately 800 bp fragment comprising an inner part of the tyhA coding region was obtained by PCR on the chromosomal DNA using the primers TAAATTAAGCTTCGCAGACAAGATTTTTAAAC. { SEQ ID NO: 3) V ATTTAAGTCGACGGCTCATAGTCCACAAGTTC (SEQ ID NO: 4), which introduce a site Hi ndl I I and Salí, respectively. The resulting fragment includes the entire coding region of thyA except for the first 8 bp and the last 34 bp. The two PCR fragments were purified by using the QIAquick PCR purification kit (QUIAGEN GmbH, Germany), cut with the indicated enzymes, and purified again. The pGhost9 vector (Maguin et al., 1996) was cut with the restriction enzymes Pstl and Salí and purified. Subsequently, approximately 15 ng of the vector and approximately 50 ng of each of the two fragments were ligated overnight at 16 ° C in a total volume of 20 μl. From this mixture, 10 μl was used to transform E. col i DH5a. The plasmid DNA was isolated from possible clones by growing them overnight in an LB medium with 100 mg / l of erythromycin and subsequently using 1.5 ml of these cultures with the protocol of the QIAprep rotary mini-rep kit (QIAGEN GmbH Germany). The purified plasmid DNA was cut with PstI and SalI and one of them, pMBP63, provided a band of approximately 1600 bp. This construct was further verified by PCR with the primers that were used to produce the two fragments, and also with the two external primers. Finally, the construct was verified by sequencing both strands over the suppression region with the two primers GACTGTTGCCCCATAGCG (SEQ ID NO: 5) V GCTTCGATTTTAGTATATGG. { SEQ ID NO: 6).

All primers were from TAG Copenhagen A / S, Copenhagen, Denmark. (iii) Inactivation of the chromosomal thyA gene in strain CHCC373 Approximately 200 ng of pMBP63 were used to transform strain CHCC373. By using the gene replacement feature (Biswas et al., 1993) of the pGhost9 vector, the chromosomal thyA gene of strain CHCC373 was subsequently successfully activated. The resulting strain MBP71 was shown to be an auxotropic thymidine mutant. (iv) Tests for the acidification of RSM by the strains CHCC373 and MBP71.

The night cultures of M17 with 0.5% lactose and 20 mg / l thymidine were washed twice with an isotonic solution of the same volume as the overnight culture of a volume which was 1/20 of the culture of the night. These resuspended cells were used to inoculate the RSM to give a volume __? identified by the percentage volume of the overnight culture, i.e., a 100% (v / v) inoculation indicates that 5 ml of the resuspended cells have been used to inoculate 100 ml of RSM. The pH was monitored either online or by pH measurement of 2.5 ml samples. 2. 5 Results of the acidification of RSM by the strain La c t ococc us l a c tí MBP71 To test the acidification of RSM by strain MBP71, this strain was inoculated in amounts that vary as described in the materials and methods. The pH of the substrate material was then monitored online, over a period of 20 hours. The results shown in Figure 4, clearly demonstrate that MBP71 is capable of acidifying the milk down to at least pH 4.5 under thymidine suppression conditions. When thymidine was added to the RSM, strain MBP71 acidified the substrate material in a manner similar to strain CHCC373 (details not shown). 2. 3 Studies of bacteriophage resistance of Lactococcus lacti s MBP71 in RSM As described above, a bacteriophage requires a susceptible host cell, which has intact DNA replication systems, transcription RNA and protein synthesis, for development. If a potential host is not able to perform just one of these activities, bacteriophages can not proliferate in the cell. The auxotrophic thymidine auxotrophic strain MBP71 is only capable of DNA replication in the presence of thymidine, or another suitable precursor for dTTP. None of these precursors are present in RSM, and the MBP1 strain is therefore not susceptible to attacking the bacteriophage under these conditions.

Figure 5 shows the pH development in 100 ml of RSM inoculated with the MBP71 strain at a concentration of 25% (v / v). When thymidine was present, it was added to a final concentration of 20 mg / l. When the bacteriophage CHPC733 was present, it was added at a concentration of 2xl08 PFU / ml medium one hour after cell inoculation. This gives a MOI (multiplicity of infection) of 0.2. The results in Figure 5 clearly demonstrate that the MBP71 strain acidifies the RSM without descending thymidine to at least pH 4.6 even in the presence of bacteriophages. However, when thymidine is added to the RSM of strain MBP71, it becomes susceptible to bacteriophage attack and the milk is only acidified down to pH 5.5, which is also close to the pH that is reached for the wild type strain CHCC373 in The presence of bacteriophages. If bacteriophages are omitted, but thymidine is added, strain MBP71 acidifies RSM in a manner similar to strain CHCC373 (See Figure 5, details not shown). 2. 4 Discussion This example shows that the suppression of a thyA strain of L. The thiidine for thiazine causes total resistance to the bacteriophage CHPC733 and that strain thyA of L. The acti is able to effectively acidify the milk under these conditions. This is contrary to the wild type, which is not able to acidify the milk to an acceptable level under the same conditions. Although the MBP71 strain has only been tested for its resistance to a bacteriophage, it is believed that the MBP71 strain is resistant to all, or most, types of bacteriophages.

REFERENCES 1. Biswas, I., A. Gruss, S.D. Ehrlich and E, Maguin, 1993. High-efficiency gene inactivation and replacement system for program-positive bacteria. J. Bacteriol. 175: 3628-3635. 2. Dickley, F., Nilsson, E. B. Hansen and E. Johansen. nineteen ninety five. Isolation of La c t ococc l l ls nonsense suppresors and construction of a food-grade cloning vector. Mol. Microbiol. 15: 839-847. 3. Maguin, E., H. Prévost, S.D. Ehrlich and A. Gruss. nineteen ninety six. Efficient insertional mutagenesis in Lactococci and other gram-positive bacteria. J.

Bacteriol. 178: 931.935. 4. Nilsson, D., and A. A. Lauridsen. L992 Isolation of purine auxothrophic mutants of Lac tococcus l a c ti s and characterization of the gene hpt ^^^^^^ m¡ ^ ¡encoding hypoxanthine guanine phosphoribosyltransferase. Mol Gen Genet. 235: 259-364.

Ricardson, G. H., C.A. Ernstrom, J.M. Kim and C. Daly, 1983. Proteinase negative variants of Streptococcus cremori s for cheese starters. J. Dairy Sci. 66: 2278-2286.

Richardson, G. H., A. Y. Gamay, M.A. Shelaih, J.M. Kim and C. L. Hansen. 1984. Paired and single strain protease negative lactic S trep t ococci for cheese manufacturing. J. Dairy Sci. 67: 518-521.

Terzaghi, B.E., and W. E. Sandine. 1975. Improved medium for streptococci lactic and theri bacteriophages. Appl. Microbiol. 29: 807-813. . -y ^ M ^ J ^ i ^ ^ LIST OF SEQUENCE < 110 > Dan Hilsson Plots Jßnzen < 120 > Method to prevent bacteriophage infection of bacterial cultures < 130 > 21134 PC 1 < 1S0 > PA 1998 00878 < 151 > 1998-07-03 < 150 > US 60/091, 735 < 151 > 1998-07-06 < 160 > 6 < 170 > FastSEQ for Windows Version 3.0 < 210 > i 10 < 211 > 32 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > PCR primer for the construction of the plasmid with the suppression in thyA from strain CHCC373 < 400 > i tataatctgc agggtcacac tatcagtaat tg 32 < 210 > 2 < 211 > 33 15 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > PCR primer for the construction of the plasmid with the suppression in thyA from strain CHCC373 < 400 > 2 tattttaagc ttcaeagtct gcttttttga ttc 33 < 210 > 3 < 211 > 32 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > PCR primer for the construction of the plasmid with the suppression in thyA from strain CHCC373 < 400 > 3 taaattaagc ttcgcagaca agatttttaa ac 32 < 210 > 4 < 211 > 32 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > PCR primer for the construction of the plasmid with the suppression in thyA from strain CHCC373 < 400 > 4 atttaagtcg acggctcata gtccacaag te 32 < 210 > 5 < 211 > 18 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Sequencing of the primer used for the verification of plasmid construction with suppression in thyA from strain CHCC373 < 400 > s gactgttgcc ccatagcg 18 < 210 > 6 < 211 > 20 < 212 > DNA < 2i3 > Artificial Sequence < 220 > < 223 > Sequencing of the primer used for the verification of plasmid construction with suppression in thyA from strain CHCC373 < 400 > 6 gcttcgattt tagtatatgg 20 It is noted that in relation to this date, the best method known by the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. Having described the invention as above, the content of the following is claimed as property.

Claims (27)

1. A method of modifying a substrate material by means of a bacterial culture, which is capable of being metabolically active in said substrate, wherein the bacterial culture is not susceptible to attack by bacteriophages, the method is characterized in that it comprises (i) isolation of a bacterial strain, which is not capable of DNA replication, RNA transcription or protein synthesis in said substrate material, but is capable of metabolically modifying the substrate material, (ii) propagation of the selected strain in a medium where the strain is capable of replication to obtain a culture of said strain, (iii) adding the bacterial culture thus obtained to the substrate material and maintaining the material under conditions where the culture is metabolically active, thereby, if the substrate material is contaminated with a bacteriophage, the metabolic activity of the bacterial culture is not affected substantially by the bacteriophage.

2. a method according to claim 1, characterized in that the substrate material is limited with respect to at least one compound that is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis.

3. A method according to claim 2, characterized in that the bacterial strain is a mutant strain that is auxotrophic with respect to a compound which is not present in the substrate material and which is required by the strain for replication.

4. A method according to claim 3, characterized in that the mutant strain is a mutant "Pur" that includes the strain .-T », .ft» g. _. . ,, ^. -A aa ^, J Aá¡g «faith | Lact ococcus l acti s DN105 deposited under accession number DSM 12289.

5. A method according to claim 3, characterized in that the mutant strain is a thyA mutant that includes the strain La c t ococcus l acti s MBP71 deposited under accession number DSM12891.

6. A method of conformance with any of strains 2 to 5, characterized in that in said substrate material it is not capable of performing at least one activity selected from the group consisting of DNA replication, RNA transcription and protein synthesis.

7. A method according to claim 1, characterized in that the substrate material contains at least one compound that inhibits DNA replication, RNA transcription or protein synthesis of the bacterial strain.

8. A method according to claim 1, characterized in that the substrate material is a starter material for an edible product, the material is selected from the group consisting of milk, a plant material, a meat product, a must, a Fruit juice, a wine, a dough and a mixture, pastry.

9. A method according to claim 1, characterized in that the bacterial culture is selected from the group consisting of Lactococcus spp., Lactobacillus spp., Leuconostoc spp. , Pediococcus spp. , Streptococcus spp., Propionibacterium spp., Bifidobacterium spp., Staphylococcus spp. , Micrococcus spp. , Bacillus spp., Enterobacteriaceae spp. , including E. coli, Actinomycetes spp. , Corynebacterium spp. , and Brevibacterium spp.

10. A method according to claim 9, characterized in that the bacterial culture is of Lactococcus lactis.

11. A method according to claim 1, characterized in that the bacterial strain is added to the substrate material at a concentration in the range of 105 to 109 CFU / ml or g of the material.

12. A method according to claim 1, characterized in that the culture 10 comprises a genetically modified strain which, relative to its original strain, increases in at least one metabolic path.

13. A method according to claim 12, characterized in that the genetically modified strain has, relative to its original strain, an increased metabolic activity selected from the group consisting of increased glycolytic flow and increased flow through the phosphate path. pentose

14. A method according to claim 13, characterized in that the strain ~ »«. A = »aBjKá > s ,, .._ iate? -. -neither... ". _, "....... "", _, ^,. "Genetically modified z" has, relative to its original strain, an increased activity of ATPase.

15. A method according to claim 1, characterized in that the bacterial culture comprises a strain which is a conditional mutant which at a predetermined condition, does not perform at least one activity selected from the group consisting of DNA replication, RNA transcription , and protein synthesis.

16. A method according to claim 15, characterized in that the predetermined condition is selected from the group consisting of pH, temperature, composition of the substrate material and presence / absence of an inducing substance.

17. A method according to claim 1, characterized in that the culture comprises a bacterial strain which is capable of increasing the size of the cells without mitosis.

18. A modified lactic acid bacterium is modified to become incapable of performing DNA replication, RNA transcription or protein synthesis in a specifically defined substrate material which is limited with respect to at least one compound that is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis, said modified bacterial strain is capable of being metabolically active in said substrate material, thereby, the strain is not susceptible to attack by bacteriophages, subject to the limitation , that the lactic acid bacterium is not a strain selected from the group consisting of strain DN101, DN102, DN103, DN104 and DN105 (DSM12289).

19. A lactic acid bacterium according to claim 18, characterized in that the bacterial strain is a mutant strain that is auxotrophic with respect to a compound which is not present in the substrate material and which is required by the strain for replication. ^ - b. 'k k- -

20. A lactic acid bacterium according to claim 19, characterized in that the mutant strain is a thyA mutant which includes the strain La c tococcus l a c ti s MBP71 deposited under the 5 access number DSM 12891.

21. A starter culture composition, characterized in that it comprises the lactic acid bacteria of any of claims 18-20.

22. A starter culture composition, characterized in that it comprises an acid bacterium Lactic acid obtainable by the method according to claim 1, in combination with at least one additional lactic acid bacterium.

23. A composition according to claim 22, characterized in that it also comprises at least one component that increases the viability of the bacterial active ingredient during storage, including a bacterial nutrient. 25 or a cryoprotectant.

- ^ ^ ^ ^ ^ ^ ^ ^ ^ 24. A method of making a food product or food, characterized in that it comprises the addition of an initiator culture according to any of claims 21-23 to a starting material of foodstuff or food and maintaining the initiator material thus inoculated under conditions wherein the lactic acid bacterium is metabolically active.

25. A method according to claim 24, characterized in that the starting material of the food product is milk.

26. Use of a culture as obtained in the method of claim 1 or a lactic acid bacterium according to any of claims 18-20 as a starter culture in The preparation of a product selected from the group consisting of milk flavoring, a cheese flavoring product, a food product and a food. 25

27. A method to prevent a bacterial starter culture of lactic acid from being infected by bacteriophages in the manufacture of a food product or food, characterized in that the method comprises the addition as a starter culture, a lactic acid bacterium obtained by the method according to claim 1 or a foodstuff or forage starting material which is limited with respect to at least one compound which is required by the bacterial strain for DNA replication, RNA transcription or protein synthesis, and to keep the initiator material thus inoculated under conditions where the lactic acid bacterium is metabolically active, thereby, if the substrate material is contaminated With a bacteriophage, the metabolic activity of the bacterial culture is not substantially affected by the bacteriophage.