MXPA00012787A - Newcastle disease virus infectious clones, vaccines and diagnostic assays - Google Patents

Abstract

The invention relates to the process for generating infectious Newcastle disease virus (NDV) entirely from cloned full-length cDNA and to the use of vaccines and diagnostic assays generated with and derived from said process. The process offers the possibility to modify the NDV genome by means of genetic modification and allows the introduction of mutations, deletions, and/or insertions. The process can be used to modify the virulence of NDV, thereby generating new attenuated live vaccines with enhanced properties. The process can be used to modify the antigenic make-up of NDV, thus allowing the generation of live NDV marker vaccines which can be serologically distinguished from NDV field strains.

Description

INFECTIOUS CLONES OF THE VIRUS OF NEWCASTLE DISEASE, VACCINES AND DIAGNOSTIC TESTS Description of the invention The invention relates to the infections of poultry by the virus of the disease of Ne cast le. The Newcastle disease virus (NDV) is one of the most diverse and deadly avian pathogens. The almost simultaneous appearance of Newcastle disease as a new and apparent disease in several different geographical regions and the great variation in the type and severity of the disease. disease has caused some problems with the nomenclature. The disease has been called pseudopeste of poultry, pseudoplague of poultry, avian pest, avian distemper and pneumoencephalitis avian falitis. The importance of the disease is mainly due to the development of the poultry industry during the twentieth century in a highly efficient international industry which is dependent on trade. intensive between countries.

Ref: 125991 It is generally assumed that the first outbreaks of Ne castle disease occurred in 1926 in Java, Indonesia, and in Newcast le-upon-Tyne, England (Kraneveld, 1926; Doyle, 1927). The name Newcastle disease was coined by Doyle as a temporary name to avoid a descriptive name that could be confused with other diseases. Later . It became clear that other less severe diseases were caused by viruses indistinguishable from NDV. In the United States, a relatively mild respiratory disease was called neur. avian encephalitis and was shown to be caused by the NDV (Beach, 1944). Within a few years, numerous NDV isolates that caused extremely mild disease or lack of disease in chickens were carried out around the world. The following methods have been implicated in the spread of the disease: 1) movement of live birds, wild birds, sport birds, pigeon hornbills and commercial poultry; 2) the movement of people and equipment; 3) the movement of L S products of poultry; 4) dispersion carried by air; 5) contaminated poultry feed; 6) contaminated water; 7) heterogeneous or incompletely inactivated vaccines. According to the OIE, Ne castle disease is a disease of poultry caused by a virus of the avian paramyxovirus serotype 1 (APMV-1) 5 which has an intracerebral pathogenicity index (ICPI) in day-old chickens of 0.7 or higher. Virulent virus can also be confirmed by the presence of multiple basic amino acids at the C-terminus of the F2 and F protein. (phenylalanine) at residue 117, the N-terminus of the Fl protein. Failure to demonstrate this amino acid sequence may require characterization by ICPI tests. The word "poultry" refers to domestic birds, turkeys, chickens, guinea, ducks, geese, quails, pigeons, pheasants, partridges and ratites that are bred or kept in captivity for breeding, the production of meat or eggs for consumption, or for the replenishment of game supplies. 20 According to Alexander (1988) three panzooties of Newcastle disease have occurred since the first recognition of the disease. The first represented the essential outbreaks of the disease and seems to have emerged in Southeast Asia. Isolated shoots, such ^ &^ g ^ ¡A As one in England in 1926, they were opportunistic introductions beyond the mainstream that moved slowly from Asia to Europe. A second panzootia seems to have started 'in the Middle East in the late 1960s and reached most countries by 1973. The fastest dispersion of the second panzootia was probably triggered by the main revolution of the poultry industry with considerable international trade. The third panzootia mainly affected domesticated birds such as pigeons and pigeons (Vindevogel and Duchatel, 1988). The disease apparently arose in the Middle East in the 1970s. By 1981 it had reached Europe and then spread rapidly to all parts of the world, mainly as a result of contact between racing birds and exhibits and the international trade of such birds. Today, Ne castle disease is still widespread in many countries in Asia, Africa, the Americas and Europe. Only the countries of Oceania appear to be relatively free of the disease (Spradbrow, 1988). - - * - - • * • - * - * «> - áilli r, i m--? A'f \ * i 1 *** í ~? Mi? t and ¿m?. * ME? ^^ ??? * NDV belongs to the order Mononegavirales, family Paramyxovlrldae, subfamily Paramyxovirinae, genus Rubulavirus. Apart from the NDV, generally called avian paramyxovirus type-1, 5 can be distinguished other eight serotypes, designated for avian myxoviruses type-2 to -9, based on their antigenic relationship in tests of inhibition of hemagglutination and serum neutralization tests ( Alexander, 1993). 10 Despite the consistency of the serological grouping, there are some cross-relationships between the viruses of different serotypes. The NDV genome is a single-stranded RNA molecule of negative polarity, complementary to messenger RNAs that code for viral proteins. The RNA genome is approximately 15,200 nucleotides in size and codes for the following gene products (listed from the 3 'end to the 5' end of the RNA genomic): the nucleocapsid protein (NP), the phosphoprotein (P), the matrix protein (M), the fusion protein (F), the hemagglutinin-neuraminidase (HN), and the large polymerase protein (L) (Chambers et al., 1986). aMi? iA * j *. -,, i i.-.-. , - .., t,. -...- «.-.,., .- ..

The RNA is complexed with the NP, P and L proteins to form a ribonucleocapsid particle (RNP) that is surrounded by an envelope that is coated on the inside by the M protein. The envelope contains the F and HN proteins that they are involved in the coupling and penetration of the host cell. The replication of NDV is similar to the strategy used by other paramyxovirinae. The initial step is the coupling of the virus to the receptors of the host cell, mediated by the HN protein. The fusion of the viral envelope with the membrane of the host cell is dependent on the action of the HN and F proteins and results in the release of the RNP into the cytoplasm where the replication of the virus takes place. RNA-dependent RNA polymerase (which is part of the RNP) produces complementary transcripts that act as mRNAs and are used by the cell's translation machinery for the synthesis of viral proteins. Due to the accumulation of the NP protein, the RNA polymerase complex changes from transcription to replication, resulting in the synthesis of full length antigenomic and genomic RNA molecules. The newly formed RNP 's are encapsulated in the cell membrane by the action of the 5 M protein and the F and HN proteins that have accumulated in the cellular plasma membrane. The newly formed viral particles are released from the infected cell by a shoot or bud mechanism. For more detailed information regarding the replication of the NDV see 10 Peeples (1988). For a recent review of the molecular biology of paramyxovirinae see Lamb and Kolakofsky (1996). Apart from commercial domestic poultry (for example, chickens, turkeys, pheasants, 15 guinea fowl, ducks, geese, chicks), a wide range of captive, semi-nomadic and free-living birds, including migratory waterfowl, they are susceptible to NDV and can be primary sources of infection (Kaleta and Baldauf, 20 1988). The pathogenicity of NDV strains differs greatly with the host. The most resistant species appear to be waterfowl while the most susceptible are the gregarious birds that form seasons of permanent flocks. The ^ asf¿. ^ - ^ - ^ ¿¿¿^ ^ - ^ - ^. .., ^? - * ^^^^^^^^^^^ - ^^^^^^ | ^^^ - ^ i ^ $ ^ chickens are highly susceptible but ducks and geese can be infected and show few or no signs clinical, even with strains that are lethal to chickens. The disease of Ne castle is complicated since different isolates and strains of the virus can induce enormous variation in the severity of the disease. Beai and Hanson (1984) grouped strains of NDV and the isolates in different pathotypes that refer to the signs of the disease that can be observed and: fully susceptible chickens: 1) viscerotropic velalogical NDV, which produces acute lethal infections in the which are prominent hemorrhagic lesions in the intestine; and the velogenic neurotropic NDV, which produces high mortality due to respiratory and neurological signs, but not lesions in the intestine; ) NDV mesogenic, which produces low mortality, acute respiratory nfertiedad and nervous signs in some birds; 3) lentogenic NDV, which produces mild or non-apparent respiratory infections or even asymptomatic enteric NDV, avirulent viruses that seem to replicate mainly in the intestinal tract. It has been reported true .. rfdtíHfil overlap between the signs associated with the different groups. The virus enters the body and into the respiratory tract and intestinal tract or via the eye. In the trachea, the virus is spread by ciliary action and cell-to-cell diffusion. After initial multiplication at the site of introduction, the virus is taken during episodes of viremia to the spleen, liver, kidneys and lungs. The viruses of some strains reach vital organs such as the liver and kidney very quickly, so that birds can die before the symptoms of the disease are evident. Most viruses reach the central nervous system via the blood before there are significant amounts of the antibody. A prolonged asthmatic carrier state that is presumed to occur in psittacines constitutes a potential threat to the poultry industry. A long-term carrier state of lentogenic and velogenic viruses can also exist in chickens (Heuschele and Easterday, 1970). During the replication of NDV it is necessary that the Fo precursor glycoprotein be cleaved to Fl and F2 so that the progeny of the virus are . ..--. - - .. ---! .-. . "._...... - ... .--. I.-,, -, ... -.- .. -", .---- -., -. -.-. Í. -_ ... ".. - t..tJ ?? faM - infectious (Rott and Klenk, 1988). This post-translational cleavage is mediated by the proteases of the host cells. If the excision fails to take place, non-infectious viral particles are produced and viral replication can not proceed. The Fo protein of virulent viruses can be cleaved by a wide range of proteases, but the Fo proteins in low virulence viruses are restricted to their sensitivity and these viruses can only develop in certain types of host cells and in general not they can be developed in vi t ro. The lentogenic viruses only replicate in areas with trypsin-like enzymes such as the respiratory and intestinal tracts, whereas virulent viruses can replicate in a range of tissues and organs resulting in fatal systemic infection. The amino acid sequencing of the Fo precursor has shown that the low virulence viruses have a simple arginine (R) that binds to the F2 and Fl chains, while the virulent strains possess the additional basic amino acids that form two pairs such as K / RXK / RRF at the cleavage site. Besides, the - ¿--------------------- '"" < * > "*» *> F2 chain of the virulent strains generally starts with a phenylalanine residue while that of the non-virulent strains generally starts with a leucine.5 For a few strains of NDV the HN protein is also produced by a precursor that requires excision to be biologically active (Garten et al., 1980: Miller et al., 1988).

F and HN proteins, other viral factors may contribute to pathogenicity. Madansky and Bratt (1978, 1981a, 1981b) have shown that alterations in transcription and translation could modulate the growth and dispersion of cell to cell of the virus and / or the ci topa togenicity. The initial immune response to infection with NDV is mediated by cells and may be detectable as early as 2-3 days after infection in live vaccine strains.

This presumably explains early protection against the challenge that has been recorded in vaccinated birds before a measurable antibody response is observed (Gough and Alexander, 1973). Approximately one week after the infection, the circulating antibodies can ^ j ^^^ & gg &^^^ j ^ jgji * protect the host from reinfection. In the early phase, IgM is involved, followed by IgG. The titles and protection rise after approximately 3 weeks and gradually decline if there is no reinforcement. This means that for older birds, revaccinations are necessary. Only live vaccines and administered by the respiratory route stimulate the antibody on all mucosal surfaces, as well as in the serum. The inactivated vaccine, even when applied via the intramuscular route, does not promote local resistance in the respiratory tract, despite the high concentrations of the antibody in serum. This emphasizes the importance of live vaccines capable of presenting the viral antigen to the upper respiratory tract, to induce local and systemic immunity. The small droplets penetrate into the lower respiratory tract which causes a primarily humoral immune response, while the larger droplets stimulate local immunity in the upper respiratory tract. For this, aerosols with a wide range of droplet sizes generate the best local immunity and complete humoral.

It should be noted, however, that despite intensive vaccination with the current vaccines creating high levels of antibody titers, the viruses can still be recovered from the mucosal surfaces. The identification of Newcastle disease in the United States led to the use of inactivated vaccines (Hofstad, 1953). The observation that some of the enzootic viruses produced only mild disease resulted primarily in the development of the live mesogenic vaccine of Roakin (Beaudette et al., 1949) and, subsequently, the development of the milder Hitchner Bl strains (Hitchner and Johnson, 1948) and LaSota (Goldhaft, 1980), which are now the most widely used live vaccines. Live NDV vaccines can be divided into two groups, lentogenic and mesogenic. Mesogenic strains are only suitable for the secondary vaccination of birds due to its greater virulence. The immune response increases as the pathogenicity of the live vaccine increases. Therefore, to obtain the desired level of protection without serious reaction, the vaccination programs currently they involve the sequential use of progressively more virulent vaccines, or live vaccines followed by inactivated vaccines. One of the main advantages of the 5 live vaccines is that they can be administered by cheap mass application techniques. A common method of application is via drinking water. However, the application of drinking water must be carefully checked periodically since the virus can become inactivated by excessive heat and light and by virulent impurities in the water. The mass application of live vaccines by sprays and aerosols is also very popular because of the ease with which large numbers of birds can be vaccinated in a short time. It is important to achieve the correct particle size by controlling the conditions under which the particles are generated. 20 The live vaccines currently used have several disadvantages. The vaccine can still cause signs of disease, depending on environmental conditions and the presence of infections that become complicated. Therefore, it is important to use extremely mild viruses to i f a-ffMÉü- ,. • * - -, ". i, ". , +, **? ,. .. ^ _., -. "^ ---. - -... «. ... -. The primary vaccination and, as a result, multiple vaccinations are usually necessary. In addition, maternally derived antibodies can prevent successful primary vaccination with 5 lentogenic live vaccines. Inactivated vaccines are usually produced from infectious allantoic fluid that is treated with formalin or beta-propiolactone to kill the virus and mixed with an adjuvant. adequate. Inactivated vaccines are administered by injection, either intramuscularly or subcutaneously. Inactivated vaccines are expensive to produce and apply. However, inactivated vaccines emulsion in oil are not as adversely affected by maternal immunity as live vaccines, and these can be used in one-day-old chickens. The advantages of inactivated vaccines are the low level of adverse reactions in birds vaccinated, the high level of protective antibodies, and the long duration of protection. None of the above vaccines can be serologically differentiated from wild-type NDV. The development of viral vaccines recombinants has been of interest to the industry ¿Ül. & t tia. », -. . »,. ^?, I. . , "...., -,, v" JUt-t,. .-, - 11 | ^^^^ j ^^ ^ u-, of poultry for a number of years. The concept is to insert genes of critical immunization epitopes of a disease agent, of interest, into a non-essential gene of a vector virus. Vaccination with the recombinant virus thus results in immunization against the vector virus as well as the disease agent of interest. Several types of viruses have been evaluated as potential live viral vaccines for poultry. Two avian viruses that have received the most attention are the fowlpox virus (FPV) and turkeys herpesvirus (HVT). The avian pox virus is a DNA virus that has a large genome and therefore is considered to have ample space to carry foreign genes. When it dims, FPV does not cause clinical disease and is commonly used as a vaccine in chickens. HVT is also a DNA virus and is classified as serotype III of the Marek's disease virus (MDV) family. HVT is non-pathogenic for chickens with a cross-protection route against MDV and is commonly used to vaccinate chickens against Marek's disease. . - - - i, _ ^ __ ^ ^^ ___ ^^^^^^^^^^^^^^^^^^^^^^^^^^ - It has been shown that the Protection against Newcastle disease can be induced by the use of HVT or FPV vaccines (Morgan et al., 1992, 1993, Heckert et al., 1996, Boursnell et al., 1990, 5 Taylor et al., 1990). However, the initiation of protection against Newcastle disease after vaccination with such recombinant vaccines expressing either the NDV F protein or the proteins F and HN, was severely delayed compared to that after vaccination with a conventional inactivated live NDV vaccine, possibly because the recombinant vaccines do not provide a sufficiently broad immunological spectrum of antigenically relevant NDV epitopes different from those found in the NDV protein that is expressed by the recombinant vaccine or are not properly presented to the immune system. In addition, local protection (mucosal, respiratory or enteric) was not effectively induced in birds vaccinated with the recombinants. This is a serious drawback since vaccines used for primary vaccination against respiratory diseases should induce immunity local to prevent infection and dispersion of virulent viruses that infect chickens reared under field conditions. Antibodies against NDV that are able to protect the host can be measured in the 5 virus neutralization tests. However, since the neutralization response appears parallel to the inhibition response of hemagglutination (Hl), the latter is frequently used to evaluate the protective response, especially after vaccination. Antibodies against F and HN proteins can neutralize NDV. However, the antibodies against the F protein seem to induce greater neutralization than those directed against HN in tests vi n and vi n vi tro (Meulemans et al., 1986). The presence of antibodies specific for NDV in the serum of a bird gives little information about the infectious strain of NDV and therefore has limited the diagnostic value. The omnipresence of lentogenic NDV strains in birds in most countries and the almost universal use of live vaccines that can not be distinguished, at least not serologically of the wild-type NDV, means that the mere n-.n? l? lim-1-r-rnr 'r i i r i - m, i? l -np 111? ^ aia ^ afc ^^ > ^^^ - Mj. ^ A - ^^ e? Ii ^ iM¿fa ^^ tMl ^ í ^ _? H ^ _ ^^. ^. ^ J ^^ iaá ^ ^^^^^^ demonstration of infection is rarely adequate cause for control measures to be imposed. Since the disease in the field can be an unreliable measure of the true virulence of the virus, it is necessary to further characterize the virus that is found. To date, the only method of diagnosis of Newcastle disease that allows the characterization of the infectious strain, is the isolation of the virus followed by the pathogenicity test. To date, three tests have been used for this purpose: 1) average time of death (MDT) in eggs; 2) intracerebral pathogenicity index (ICPI) in one-day-old chickens; 3) Intravenous pathogenicity index (IVPI) in birds of 6 weeks of age. These tests suffer from a number of drawbacks, such as the availability of the animals, poor reproducibility, and the relatively long duration of the tests. The last but least important of these tests does not allow simple serological identification of poultry vaccinated with a vaccine or infected with a wild-type strain.

As an alternative to in vi ve testing, the polymerase chain reaction (PCR) has been successfully used to distinguish between virulent and non-virulent isolates (Staüber et al., 1995, Kant et al., 1997), without However, serological differentiation is not possible again. The raising of poultry and the trade of their ¡. codex is now organized on an international basis, often under the management of multinational companies. The threat of Ne castle's disease has imposed a great restriction on such commerce. Successful control of Newcastle disease will only be achieved when all countries report outbreaks. However, international agreements are not simple due to the enormous variation in the degree of survival of the disease in different countries. Some countries do not vaccinate and may not want any form of NDV introduced into domestic poultry because the vaccinated birds can not be distinguished from those infested with the wild type NDV. Other vaccines allow the use of specific live vaccines and consider other vaccines as unacceptably virulent. Other countries have more . i and a, * and »* ~ A-? • > . - > . . . -. . . i, Jt-fc-to. the continued presence of highly virulent viruses in circulation, which is not recognized as such because the patent disease is masked by vaccination. In many countries there is legislation to control outbreaks of Newcastle disease that may occur. The national control measures are aimed at the prevention of introduction and dissemination. Most countries have restrictions on trade in poultry products, eggs, and live birds. Most countries have established quarantine procedures for importation, especially for psittacine birds. Some countries have adopted eradication policies with mandatory killing of infected birds, their contacts and their products. Others require prophylactic vaccination of birds even in the absence of outbreaks, while some have a ring vaccination policy around the outbreaks to establish a buffer zone. Clearly, there is a need for better vaccines and for better diagnostic methods that can be used to control Newcastle disease. Due to the large differences in the dose that is received by individual birds during mass application of live vaccines and variation in maternal immunity levels in young chickens, vaccination reactions with live vaccines are unavoidable. This is one of the main problems of farmers in countries where vaccination is mandatory. In addition, many vaccines are mixtures of subpopulations. When cloned, these subpopulations can differ significantly from one another in immunogenicity and pathogenicity (Hanson, 1988). However, the biggest drawback of currently used live vaccines and inactivated vaccines is the fact that vaccinated animals can not be distinguished from infected animals with currently used screening techniques such as hemagglutination inhibition tests. or neutralization of the virus. Virulent virus in the field can still be dispersed in vaccinated flocks, since the symptoms of the disease are masked by vaccination. Since virus isolation and characterization of virulence by viral techniques is not feasible on a large scale, there is a great need for new and effective attenuated live vaccines which can be serologically discriminated against wild-type viruses. Such vaccines, called NDV marker vaccines (and the methods and diagnostic equipment that accompany them), that must provide the most complete immunological spectrum of epitopes NDV, antigenically relevant, and must still be serologically distinct from wild-type NDV, are not yet available. The invention provides a method for modifying an avian paramyxovirus genome by genetic modification, provides genetically modified avian paramyxovirus and a marker vaccine of avian paramyxovirus. The advent of modern molecular biology techniques has allowed the modification genetics of many RNA viruses, including negative-strand RNA viruses. This technique is often referred to as "reverse genetics." A copy of the cDNA (full length) of the viral RNA is provided first, after which this DNA is transcribed into susceptible cells to produce infectious RNA which can again replicate to produce infectious viral particles. In general, by prior modification of the cDNA with standard molecular biology techniques, it is possible to obtain a genetically modified RNA virus. However, it has never materialized for NDV or other avian paramyxoviruses, and has not yet been possible. generate minigene fragments or plasmids from genomic fragments of avian paramyxovirus to study the replicative events of avian paramyxovirus, thereby creating an understanding of how to construct infectious copies of the virus. 15 Surprisingly, although in this description it has now been fully established that the avian paramyxovirus genome is the smallest of all paramyxovirus genomes sequenced so far, especially the sequence at the 5'-terminus of the NDV genome, is much longer than that previously established and was expected by comparison with other Pa ramyxovi ri da e. The invention now for the first time provides a complete sequence of a genome of avian paramyxovirus and provides the cDNA of full length or minigenomic length of such a virus. The invention provides here the avian paramyxovirus cDNA comprising at least a nucleic acid sequence corresponding to the 5'-terminal end of the avian paramyxovirus genome that allows the generation of an infectious copy of the avian paramyxovirus, said cDNA preferably comprising a CDNA length complete. However, the invention also provides cDNA comprising at least one nucleic acid sequence corresponding to the 5'-terminal end of the avian paramyxovirus genome thereby allowing generation of a Avian paramyxovirus minigenome in replication. Such minigenomes can be advantageously used to transfer RNA and / or express protein from modified nucleic acid sequences. The invention provides a cDNA of According to the invention at least partially derived from the Ne castle disease virus, for example wherein the Newcastle disease virus is a lentogenic virus, preferably derived from a vaccine strain, such as the strain ATCC VR-699 from LaSota.

The invention further provides a cDNA according to the invention additionally provided with a modification, such as a deletion, insertion, mutation, reversion, or otherwise in a nucleic acid. For example, a cDNA is provided wherein the modification comprises a nucleic acid encoding a modified protease cleavage site, for example wherein said cleavage site is a protease cleavage site of the fusion protein (F). In yet another embodiment, the invention provides a cDNA according to the invention wherein said modification comprises a nucleic acid encoding a hybrid viral protein, such as a hybrid hemagglutinin-neuraminidase (HN) protein as described in the experimental part of the invention. The invention also provides a cDNA according to the invention wherein said? Oodication comprises a deletion in a nucleic acid encoding a viral protein, such as a matrix protein (M). The inver. The ion also provides a cDNA according to the invention additionally provided with a nucleic acid encoding an antigen.

Heterologous, preferably where the antigen is ^^^ 6 ^^ * ^^ - ^^ - ^^ - ^^^^^ ------- ^^ --- ^ ------------- ---- ^ ---- ^^^^^^^^^^^^^^^^^^^^^^^^ derived from a pathogen for poultry, as described for example later. An RNA, and the protein derived therefrom, obtained from a cDNA according to the invention, is also provided. In recent years, a number of negative strand RNA viruses, unsegmented, have been completely disrupted and the fundamental work on the replication and expression of their genomes has culminated in the ability to generate infectious viruses completely by transfecting cells with the cloned cDNA of the virus (reviewed by Conzelmann, 1996). To date, the infectious virus of the non-segmented, negative strand RNAs has been generated from the cloned cDNA, for example from the rabies virus (Schnell et al., 1994, Conzelmann; EP0702085A1). (Schnell et al., 1994; EP0702085A1), vesicular stomatitis virus (Lawson et al., 1995; Whelan et al., 1995), Sendai virus (Garcin et al., 1995), measles virus (Radecke et al., 1995; Schneider et al., 1997; EP0780475A1), human respiratory syncytial virus (CollLns et al., 1995), blood bilious fever virus (Baron and Barrett, 1997), and the parainfluenza virus human type 3 (Hoffman and Banerjee, 1997, Conzelmann; P0702085A1) (Schnell et al., 1994; EP0702085A1). However, all previous infectious viral copies are able to develop in vitro, as well as in hosts, tissues or cells, of various origins, allowing easy transfection and replication of the cDNA, and the generation of particles infectious viral over a suitable cell line. Such a possibility does not exist for NDV, certainly not for lentogenic NDV strains which can provide a vaccine. The virulence of such NDV strain is associated with its ability to replicate in a wide range of cells, reflected by the fact that virulent strains can easily replicate in vi t ro ein vi ve, while vaccine strains can only replicate in alive . In this way, with NDV, a deceptive situation is apparent. While attempts to generate a virus of infectious copies from the infectious cDNA for example, can possibly result in infectious virus, such a virus is generally not suitable for it. use as a vaccine because the infectious virus generated from this ---------------------------------- __aüi_ iU¿ ----- mode is by default too virulent to be used as a vaccine; the fact that it can be generated and replicated after transfection of the cDNA on a cell line reflects its easy cleavability of the Fo protein in Fl and F2, as discussed above a remarkable mark of the virulence of an NDV. Using a vaccine strain as a parent material for the cDNA could not solve this problem; A strain of vaccine, especially of the lentogenic type, does not contain an easily cleavable Fo protein, making it impossible for the first generation virus to continue replicating. The cell used for transfection simply will not be able to support one or more rounds of replication of the vaccine virus with an uncleaved Fo protein. The invention now elegantly provides a solution to this problem, and thereby provides the infectious NDV copy, for example for use in a vaccine. The invention provides a method for generating infectious copies of the Newcastle Disease Virus, which comprises transfection cells capable of expressing the viral NP, P and L proteins to be complexed with the viral RNA with full-length or genomic-length cDNA. of said virus, and further comprising the incubation of said cells in the growth medium comprising the proteolytic activity that allows the cleavage of the Fo protein from said virus. In the present system, transfection of a plasmid of NP expresses could be omitted. Is It is likely that NP will be expressed from the full-length cDNA because the NP gene is the first gene after the 5 'end of the antigenomic RNA. Since eukaryotic mRNAs are usually monocistronic, the expression of distal genes is not expected. However, it is possible to generate the full-length cDNA in which the relative positions of the NDV genes are changed. If the first gene of such a cDNA is the P or L gene, it is not necessary to express the corresponding gene product from a cotransfected plasmid. As an alternative to the use of full-length cDNA, it is possible to use two or more subgenomic cDNAs which generate subgenomic RNAs competent for replication, and Am - ^ - jwa '- - -? • * ~ '* - * • - _A_ ~ * "* • afa * - which together express the complete complement of avian paramyxovirus proteins Even if the RNAs are packaged separately, the resulting virus-like particles can be used for successive rounds of replication by means of co-infection and complementation of gene functions In a preferred embodiment, the invention provides a method wherein the proteolytic activity is derived from an enzyme, such as an enzyme similar to the trypsin, or is derived from a composition comprising said proteolytic activity In a much more preferred embodiment, the growth medium comprises allantoic fluid comprising proteolytic activity.The cleavage of the Fo protein is required for the generation of the infectious virus. generate the infectious virus from the lentogenic strain without the addition of exogenous proteolytic activity. transfected cells within the allantoic cavity of the embryonated eggs, the proteolytic activity that is present in the allantoic fluid is able to cleave the Fo protein to generate the competent fusion complex Fl-F2. Virions with such ^ ¡¡¡¡¡¡¡¡¿¡¡F protein F activated are capable of infecting susceptible cells and replication in cells expressing the desired proteolytic activity produces infectious progeny. As an alternative to provide the desired proteolytic activity to the supernatant of the transfected cells, it is for example possible to use a cell that is permissive for NDV and which already expresses said proteolytic activity. Such cell line is used to produce infectious lentogenic NDV, without the addition of exogenous proto-lithic activity. Such a cell line can also be generated by stable transfection of a cell line with a gene specifying said activity. In addition, it is possible to generate a transfected, stable cell line that expresses the wild-type F protein in the viral envelope, thereby providing infectious particles (the same ones not provided with the genetic information that codes for the wild-type F protein). ) with means to enter a cell. The rescue of infectious lentogenic viruses is also possible due to the infection of the t: n cells. infected with an NDV helpervirus. An essential requirement for such a helpervirus could be that it can be selected against, fc- * i-. a- s »- ^ for example by means of neutralizing antibodies that eliminate the helpervirus but do not react with the lentogenic virus. Finally, one can construct a stably transfected cell line that expresses one, two, or all three essential NDV proteins, which are NP, P, and L. Such cell lines require the coexpression of only a subset of three essential proteins or not the coexpression of everything to support the generation of infectious viral copies. In a preferred embodiment, the invention provides a method wherein said cells used for transfection are derived from primary or secondary chicken cells or cell lines. The description provides for example CER or CEF cells, which, as in most cells in vi t ro in general, lack the appropriate proteases which are required to cleave the NDV Fo protein, for example from the strain LaSota. However, cells derived for example from other birds can also be used. The invention further provides a method for generating infectious copies of the Newcastle disease virus comprising cells in ------ t ---- ta¿iiÍÉÉfiirffa¡M transfection with the cloned cDNA, full-length or genomic-length of said virus as for example identified in figure 3 and further comprising incubating the cells eri growth medium comprising proteolytic activity that allows the excision of the Fo protein of said virus, further comprising the recovery of the infectious virus when culturing the cells and inoculating the material derived from the cells incubated in the allantoic cavity of embryonated eggs. Said material for example comprises (harvested or frozen-thawed) cell debris cells or supernatant derived from the cell culture. For example, the description describes a method to recover infectious virus, wherein the supernatant of transfected CEF monolayers was inoculated into the allantoic cavity of embryonated eggs. Four days later the allantoic fluid was harvested, analyzed in a haemoglutination assay and subsequently passed to eggs. In addition, the invention provides a method that also comprises the passage of the infectious copy of the Newcastle Disease Virus when harvesting. the allantoic fluid and the embryonated eggs In a preferred embodiment of the invention, there is provided a method wherein said virus is a lentogenic virus, for example derived from an avirulent NDV field case or an NDV vaccine strain, such as LaSota strain of NDV. In addition, a method is provided for modifying an avian paramyxovirus genome by modification genetics that allows the introduction of one or more mutations, deletions, and / or insertions or other modifications. For example, the method is provided to attenuate or modify the virulence of avian paramyxovirus by modifying the cDNA, by example encoding a viral protein such as the protein V, and cloning said modified cDNA into full-length cDNA and generating infectious copy virus from full-length cDNA, thereby generating new strains of NDV or new live attenuated vaccines with improved properties. Apart from the attenuation by modification of gene products, it is also possible to attenuate avian paramyxovirus by modifying the nucleotide sequences that are involved in - ^^ - * ¿- ^? »»? * - «« a lia transcription and / or replication. Such modifications result in attenuated strains expressing F-like proteins of the wild type which are cleavable in a wide range of cells and as a result are more immunogenic than classical vaccine strains. In a preferred embodiment, the invention provides a method for attenuating or modifying the virulence of an avian paramyxovirus such as the Newcastle Disease Virus., which comprises modifying a viral protein protease cleavage site, by modifying the cDNA encoding said cleavage site, further comprising the cloning of the cDNA into a genomic-length cDNA for example from the disease virus. Newcastle and the generation of infectious viral copies of Newcastle disease. Said cleavage site is for example a cleavage site by protease in the F protein or HN of the Newcastle disease virus. Attenuation is generally restricted to the reduction of virulence, however, it is now also possible to use a relatively virulent strain of the NDV and provide the progeny of such strain with ^ _ ^ _ increased virulence, for example by providing it with an increased tendency to replicate in a specific cell type. It is now possible in this way to assign different virulence attributes to NDV. The invention provides a method for antigenically modifying the avian paramyxovirus such as a Newcastle Disease Virus, which comprises purifying the cDNA encoding at least a portion of a viral protein harboring at least one immunodominant epitope, further comprising the cloning of the cDNA into the genomic-length cDNA of the Newcastle disease virus and the generation of infectious copy of the Newcastle disease virus. For example, the invention provides a method for modifying (additionally) the NDV, for example by using a method for producing an infectious copy of NDV (vaccine) that has been provided, a method for producing a marker, recombinant NDV vaccine is also provided. , a marker vaccine containing the most complete or possible immunological spectrum possible of antigenically relevant NDV epitopes, and which is still serologically distinct from the NDV type "" A '! ": + ** £ to £ *, iL- ~~ A., *.,.,. ....",.,.,. -, 4 wild due to an epitope or A serologically relevant, distinct marker that has been eliminated by recombinant techniques The invention provides a method for modifying the antigenic constitution of avian paramyxovirus such as NDV, thereby allowing for the generation, for example, of a live NDV marker vaccine which can be distinguished from wild strains of avian paramyxoviruses In one embodiment, the invention provides infective copies of NDV wherein the NDV HN protein has been modified by recombination of cDNA encoding a portion of the HN protein with the cDNA that codes for a part of the HN protein deduced from an avian paramyxovirus, for example, type 2 or type 4. Said hybrid HN protein serves as a serological marker for the infectious copy NDV strain obtained in this way, or it can serve to change the tropism of the paramyxoviruses and j-ar to the other cells and / or tissues. These, called marker strains as provided by the invention, allow the generation of da / - cots that are an invaluable tool for assessing the prevalence of NDV in commercial flocks around the world. Further, nt? f? a? t kmfa t t T. 1. . li l. t - lil r r -i ^, - r, r-,,,. , ^ - ^ < ^ < . -,. ^ ..... - - .. -. -. -. * - ^ Large-scale application of such marker vaccines will lead to the complete eradication of NDV through a process of intensive selection and complete elimination of infected flocks or flocks. In addition, a method is provided for generating an NDV strain of infectious copies that expresses one or more antigens from other pathogens, and which can be used to vaccinate against multiple diseases. Such an infectious copy of the NDV virus for example comprises a heterologous cDNA encoding a heterologous protein obtained for example from Avian Influenza (AI) (Hemagglutinin (H5 and H7) and Neuraminidase), avian leukosis virus (ALV) (env protein (gp85)), chicken anemia virus (CAV) (VP1 + VP2), Marek's disease virus (MDV) (glycoprotein B (gB) , gH), Infectious laryngotracheitis virus (ILT) (gB, gH, gD), Infectious bursal disease virus (IBDV) (VP2 and VP3), Turkey rhinotracheitis virus (TRT) (fusion protein (F)), Avian paramyxovirus-2, -3, -6 (PMV) (protein F) , Hemagglutinin neuraminidase (HN), or others, the Infectious bronchitis virus (IBV) (protein peplomer, nucleoprotein), Reovirus (sigma protein), Adenovirus, Pneumovirus, Salmonella enteritidis, Campylobacter jejuni, Escherichia coli, Bordetella avium (formerly Alcaligenes faecalis), Haemphilus paragallinarum, Pasteurella multocida, Orni thobacterium rhinotracheale, Riemerella (formerly Pasteurella) anatipestifer, MycopLasmata (M. gallisepticum, M. synoviae, M. mereagridis, M. io ae), or Aspergilli (A. flavus, A. fumigatus). The invention herein provides the avian paramyxovirus or strains derived therefrom, which can be used as a vaccine vector for the expression of antigens from other bird pathogens. Several properties make the NDV an ideal vaccine vector for vaccination against respiratory or intestinal diseases. 1) The NDV can be easily cultivated at very high titers in embryonated eggs. 2) Mass culture of NDV in embryonated eggs is relatively inexpensive. 3) NDV vaccines are relatively stable and can be administered in a simple manner by mass application methods such as with water for drinking by spray or aerosol formation. 4) The natural route of NDV infection is through the respiratory and / or intestinal tract which are also the main natural routes of infection of many other bird pathogens. 5) NDV can induce local immunity despite the presence of circulating maternal antibody. It has been shown that NDV has potent antineoplastic properties as well as immunostimulatory (for a review see Schirrmacher et al., 1998) [Schirrmacher, V., Ahlert, T., Steiner, H.-H., Herold-Mende, C, Gerhards, R. and Hagmüller E. (1998) Immunization with virus-modified tumor cells. Seminars i n On cology 25: 677-696]. Although NDV does not appear to be able to replicate productively in normal human cells, a selective NDV-mediated killing of human cancer cells was noted. After local therapy with NDV, viral oncolysis and complete remissions of human tumor genografts in nude mice were observed. This has led to the use of NDV for tumor therapy. However, a problem is that such an application may be restricted to local treatment. NDV infection induces interferons, chemokines, and other potentially important gene products, and introduces pleiotropic immunostimulatory properties within tumor cells. This concept has been used for the production of autologous tumor cell vaccines, consisting of fresh operative specimens that have been infected with NDV. This type of vaccine is called NDV of autologous tumor vaccine, or ATV-NDV (Schirrmacher et al., 1998). Cells infected with NDV are inactivated by gamma irradiation which prevents cell division, but which still allows the replication of NDV in the cytoplasm of infected cells. After the inoculation of patients with ATV-NDV, the T cells are recruited through chemokines induced by NDV. Some of these T cells can express a T cell receptor that can interact with the peptides derived from antigens associated with the tumor complexed with the class I molecules of the major histocompatibility complex on the cell surface. This interaction results in the induction of a cytotoxic T cell response which results in the specific death of the autologous tumor cells. The invention provides that the repertoire and the amount of chemokines and proteins **, tfe * - '- - "-. - - i -i - *. **.,.» ».». ", -» < t .. J -, -, ^... > . »» «* .1 Uj ^ Ju ^, ^. immune stimulators induced by infection with NDV, are modulated. The present invention provides a method for generating recombinant NDV that has been modified to incorporate and express one or more heterologous genes. Such recombinant NDV can be used to modify the repertoire and the amount of immunostimulatory proteins in infected cells. In one embodiment, the invention provides a recombinant NDV that incorporates and expresses the genes coding for human interferons, chemokines, or other stimulatory proteins of the immune system. Said recombinant NDV is used for the production of ATV-NDV which is more potent than conventional ATV-NDV. For example: the cytokines IFN-a, -β, TNF-α, IL-1, IL-6; RANTES chemokines, IP-10; other genes such as HSP, ACTH, endorphin, iNOS, EPA / TIMP, NFKB). The pleyotropic immunostimulatory properties of NDV can also be used as an adjuvant for the vaccination of animals and humans against infectious diseases. In one embodiment of the invention, foreign genes that code for one or more relevant antigens of one or more infectious agents are introduced into the NDV gertoma and When the simultaneous expression of the antigen and the immunostimulatory proteins by infected cells, they can induce a powerful immune response against the infectious agent. In yet another embodiment of the invention, the Immunostimulatory properties of NDV can be further enhanced by the use of recombinant NDVs that express simul- taneously antigens and specific immunostimulatory proteins. In a preferred embodiment, the invention is used to generate a vaccine against AIDS (Acquired Immune Deficiency Syndrome) by the use of recombinant NDVs that express relevant antigens of the human immunodeficiency virus (HIV), either alone or in combination with immunostimulatory proteins. NDV is also used as an adjuvant for the vaccination of animals and humans against infectious diseases. In one embodiment of the invention, the heterologous or foreign genes which code for one or several relevant antigens of one or more infectious agents are introduced into the MDV genome and the simultaneous expression of the antigen and the immunostimulatory proteins by the cells. infected, can induce a potent immune response against the agent In yet another embodiment of the invention, the immunostimulatory properties of NDV are further enhanced by the use of NDV recombinants that simultaneously express antigens and antigens. the specific immunostimulatory proteins In a preferred embodiment, the invention is used to generate a vaccine against AIDS (Acquired Immunodeficiency Syndrome) by the use of recombinant NDVs expressing relevant antigens of the human immunodeficiency virus (HIV), either alone or in combination with immunostimulatory proteins. Also, a method is provided for generating a lethal NDV deletion mutant, conditional, which can be used as a non-transmissible, self-restricted (carrier) vaccine. A mutant by deletion of NDV was generated, which is unable to express the matrix protein (M) which is involved in the outbreak of NDV in the inner cell membrane. The invention provides for example a phenotypically complemented NDV strain that is unable to express the M protein that is still capable of infecting the cells and diffusing by means of the transmission from cell to cell. However, the > j.

Mutant virus is unable to generate infectious progeny on cells without complementation. This shows that the phenotypically complemented NDV suppression mutants can be used as safe self-restricted vaccines which are unable to diffuse into the environment. Such non-transmissible vaccine combines the most important advantage of live vaccines, for example, efficacy, with the most important advantage of the dead vaccines, for example, safety. The invention provides the Newcastle Disease Virus, strains derived therefrom, for example, by passage or further culture in embryonated eggs or cells Appropriate, that is, derived from the infectious viral copies obtainable by a method provided by the invention. For example, NDV is provided that has been modified in at least one way to generate a copy Infectious of the Newcastle Disease Virus that is attenuated, modified in virulence, antigenically modified, expressing a heterologous antigen or that are non-transmissible, or combinations thereof.

With this, the invention provides the NDV vaccines, characterized for example because they carry different attributes of virulence or different antigenic characteristics, be it for marker vaccine purposes and / or to express heterologous antigens derived from other pathogens, either in a transmissible and / or non-transmissible form. Such a vaccine can be a dead vaccine or a live vaccine. Preferably, such a vaccine is a live vaccine, however, the killed vaccines as provided by the invention are beneficial under those circumstances where a live vaccine is not or only is not applicable, for example due to commercial restrictions or other conditions established by the authorities that control diseases. The invention herein also provides a diagnostic method, and the corresponding test equipment, for detecting the antibodies against the epitope or immunodominant marker, serologically relevant, provided therewith the methods and means for executing a method for controlling and / or Eradicate the NDV and / or other diseases of poultry. The invention provides the new and effective vaccines which can be serologically isolated from wild-type and ancient-type vaccines. Such novel vaccines, called NDV marker vaccines, provide the most complete immunological spectrum possible of the antigenically relevant NDV epitopes, and are still serologically distinct from wild-type NDV by the application of accompanying diagnostic methods and the corresponding equipment. The invention provides a method for distinguishing unvaccinated or vaccinated animals with an NDV vaccine according to the invention, from animals infected with wild-type NDV or those vaccinated with a strain of A non-modified, mesogenic or lentogenic NDV vaccine, comprising taking at least one sample (such as serum, blood, eggs or ocular fluid) from the animal and determining in said sample the presence of antibodies directed against an epitope or marker.

Immunodominant expressed by wild-type or non-modified NDV, but not by a vaccine according to the invention. The invention provides a method wherein said antibodies are directed against the HN or F protein of NDV, for example a protein MiwiaaÉiií ^ Haüíaitb hybrid as described in the experimental part of this description. The invention provides for example a. diagnostic method wherein said animal is selected from the group consisting of 5-corral birds, preferably chickens. The invention also provides diagnostic equipment for use in a method for serologically distinguishing between animals. In one embodiment of the invention, a test is used simple and rapid inhibition of hemagglutination (Hl) to distinguish between vaccinated animals and infected animals. Animals vaccinated by a marker vaccine in which the complete globular head of the NDV HN has was replaced by the corresponding part of the HN of another serotype that will not induce antibodies to NDV HN, and therefore will not inhibit the hemagglutination of the erythrocytes by the NDV virions. 20 By using virions from the marker vaccine in the Hl test, the antibodies against the hybrid HN protein are detected and can be used as a measure for the effectiveness of the vaccination. As an alternative, a ELISA test that detects antibodies against tiß * í m ?? a * * m ---- l ------ Í ------ -? ÍI¡ - l - i ..., .--. ». ,,. «AA --..-, the F protein of the NDV, to measure the effectiveness of vaccination. Apart from the Hl test, an ELISA test can be used to determine the presence of antibodies against NDV HN. The antigen that can be used in such a test is for example NDV HN which is expressed by the recombinant DNA techniques, or "conserved peptide of the NDV HN. A 0 blocking ELISA can also be used. In this case one or more moroconal antibodies against the conserved epitopes of NDV HN are used to determine if the competent antibodies are present in samples from vaccinated animals. ELISA tests can be used advantageously if the marker vaccine contains a chimeric HN protein only or when a few epitopes of NDV HN are replaced. The invention is further explained in the experimental part 0 of this description without limiting the invention to this t ** M * '' "- * '* * *** - *' - - --- '-« - -. -. * - <... -. - .-. --.- .. .. .....;, M ^ AJtj EXPERIMENTAL PART MATERIALS AND METHODS Standard cloning procedures were carried out according to Sambrook et al. (1989) unless otherwise stated. All constructs involving the DNA fragments that were generated by the polymerase chain reaction (PCR) were verified by sequential analysis. In the primer sequences given below, the underlined nucleotides correspond to the NDV sequences and the position within the NDV genome is indicated. The nucleotide sequence of the restriction sites that were used for cloning is indicated in bold.

Cells and Viruses CER cells (Smith et al., 1976) were developed in GMEM / EMEM (1: 1) containing 5% fetal calf serum and 2% of a mixture of antibiotics containing 1000 U / ml penicillin, 1000 μg. / ml Streptomycin, 20 μg / ml Fungizone, | ^^ fo ^ fe 500 μg / ml of Polymyxin B, and 10 mg / ml of Kanamycin. QT35 cells (Moscovici et al., 1977; Cho, 1982) were developed in the medium supplied by GibcoBRL / Life Technologies (Cat. No. 041-91536; the Fort Dodge proprietary composition) supplemented with 5% FCS and 2% mixture of antibiotics. The QM5 cells (Antin and Ordahl, 1991) were developed in M199 medium supplemented with 10% tryptose phosphate broth, 10% FCS and 2% antibiotic mixture. Strain NDV LaSota was obtained from ATCC (ATCC VR-699) and was passed twice in embryonated eggs. Before the cDNA was constructed and cloned, the virus was plaque purified by three rounds of plaque purification on primary chicken embryo fibroblasts (CEF). For this purpose, the virus was titrated on CEF cells grown in GMEM / EMEM (1: 1) containing 5% fetal calf serum, 2% antibiotic mixture, 5% allantoic fluid, 30 mM magnesium chloride, 200 μg / ml DEAE-dextran (Sigma) and 0.8% agar Nobel (Difco). The third round virus of plaque purification (designated clone E13-1) was developed in embryonated eggs and four days after inoculation the allantoic fluid was harvested and stored in aliquots at -70 ° C. The recombinant virus of chicken pox fpEFLT7pol (Britton et al., 1996, hereinafter referred to as FPV-T7), which expresses the T7 RNA polymerase, was a donation of Dr. Michael Skinner and it was developed on QT35 cells.

Isolation of viral RNA 10 All manipulations were carried out in RNase-free glass or plastic material, and all solutions were constituted with RNase-free water that was treated with 1% of diethyl pyrocarbonate (DEPC) and sterilized by heating in an autoclave. The virus was concentrated from the allantoic fluid by centrifugation at 21,000 rpm for 70 minutes in a Beckman SW40 centrifuge at 4 ° C. The button or concentrate was resuspended in the homogenization buffer (50 mM Tris-HCl pH 7.5, 50 mM sodium chloride, 5 mM EDTA, 0.5% SDS) and treated with Proteinase K (200 μg / ml) for 90 minutes at 37 ° C during constant agitation. The lysate was extracted twice with an equal volume of phenol / chloroform * X¿Lt **** & ia * ...,. *? -. ».» ..... . . to.. . ^. , ¿? " "_ ,," -., .j- ^, - ,,, > -, .. .--- ¿^ ---! ^ ¿? ^^^ fcg? (1: 1) pH 5.4 and once with an equal volume of chloroform. The viral RNA was precipitated from the aqueous phase by the addition of 0.1 volume of 3M sodium acetate pH 5.3, and 2.5 volumes of 100% ethanoi. The precipitate was collected by centrifugation, washed once with 70% ethanol, and resuspended in water, and stored in aliquots at -70 ° C.

Reverse transcription The viral RNA (1.5 μg) was mixed with 500 ng of the primer in a volume of 12 μl and incubated for 10 minutes at 70 ° C. Four μl of RT 5x buffer (250 mM Tris-HCl, pH 8.3, 375 mM potassium chloride, 15 M magnesium chloride, GibcoBRL / Life Technologies), 2 μl of 0.1 M DTT and 2 μi of 10 M dNTP's were added. 2.5 mM each), the mixture was incubated for 2 minutes at 42 ° C. Reverse transcription was performed in a final volume of 20 μl by the addition of 200 units of reverse transcriptase (Superscript II, GibcoBRL / Li fe Technologies) followed by incubation for 60 minutes at 42 ° C.

Polymerase Chain Reaction (PCR) All the PCR reactions that were used to determine the 3 'and 5' end of the NDV genome (see below) were carried out by using the Taq DNA polymerase (Perkin Eimer). For the cloning of the individual NDV genes or the large subgenomic cDNAs, either the Pv / or test 10 DNA polymerase, or mixtures of Taq and Pwo (Aita Loyalty Expansion Team or Template Expansion Team) were used. Large) according to the supplier's instructions (Boehringer Mannheim). All samples were incubated for 2 minutes at 94 ° C before the start of the indicated number of PCR cycles. After the indicated number of PCR cycles, the samples were incubated at the elongation temperature for at least 3x the duration of the PCR cycle elongation time. The PCR fragments were purified directly by using the Highly Pure PCR Product Purification Kit (Boehringer Mannheim) or after the agarose gel electrophores by using the QiaexII extraction equipment (Qiagen) essentially as shown in FIG. described by the providers.

? ? * ~ -.Mt ?????????? . TO . - i í. ^ i, -. . < and ^ ", - - _ ,, -, t, > - ...- ^ .-a. "-jj - ^^ ----- ^^ | ggj Sequential Analysis All sequences were determined by using the PRISM (Perkin Eimer) Rapid Reaction Dye Deoxy Terminator Cycle Sequencing Kit. The reaction mixtures (5 μl) were subjected to 25 cycles of amplification l nc il (10 seconds at 94 ° C, 5 seconds at 50 ° C, and 4 minutes at 60 ° C) in a GeneAmp2400 thermocycler. Subsequently, the reaction mixtures were precipitated with ethanol, washed once with 70% ethanol, resuspended in 15 μl of TSR buffer (Perkin Elmer) and heated for 2 minutes at 94 ° C before being loaded onto an Applied Biosystems autologous sequencer. AB310. The nucleotide sequences of the primers that were used to sequence the complete genome with the NDV LaSota strain were either derived from the published sequences or from the sequences established during this sequencing project. The primers are shown in Table I.

Cloning and sequencing of the 3 'and 5' ends of the NDV genome strain LaSota The nucleotide sequence of the 3 '5 and 5' ends of the NDV genome was determined by the use of the RACE (rapid amplification of the cDNA ends) procedures. The NDV RNA was used in a reverse transcription reaction in a final volume of 20 μl by using the primer p360 (5 '-GGCGATGTAATCAGCCTAGTGCTT-3'; nt 14756-14779) which was derived from the published sequence of the NDV L gene (Yusoff et al., 1987). The single-stranded cDNA (2.5 μl of the RT mixture) was added to 8 pmol of the anchor primer ALG3 (5 '-CACGAATTCACTATCGATTCTGGATCCTTC-3') and ligated overnight at room temperature in 20 μl of a reaction mixture containing 50 mM Tris-HCl, pH 8.0, 10 mM magnesium chloride, 10 μg / mL BSA , 25% PEG, 1 mM HCC, 20 μM ATP and 10 units of T4 RNA-20 (New England Biolabs) as described by Tessier et al. (1986). One μl of the ligation reaction was used as a template in a PCR reaction using the primers p375 (5'- CAATGAATTCAAAGGATATTACAGTAACT-3 '; nt 14964-14983) and ALG4 (5 '-GAAGGATCCAGAATCGATAG-3'). The last ** "*** ^ - * >» * «*.».,.,,,, ... .. .. .. .. primer is complementary to the anchor primer ALG3. The PCR conditions (40 cycles) were as follows: 1 minute at 94 ° C, 1 minute at 55 ° C, and 2 minutes at 72 ° C. The PCR products were purified and cloned into the vector T pBluescriptI I-TSK (Ichihara and Kurosawa, 1993). Alternatively, the purified PCR products were treated with Klenow DNA polymerase I to create blunt ends and cloned into the HincII site of plasmid pGEM4Z (Promega). Thirteen independent clones (8x pBluescript I I-TSK and 5x pGEM4Z) were sequenced to determine the nucleotide sequence of the 5 'end of the NDV genome strain LaSota. The nucleotide sequence of the 3 'end was determined by two independent methods. In method I, the ALG3 primer was ligated to the 3 'end of the viral RNA by the use of the A.RN-ligase T4 as described by Schütze et al. (nineteen ninety five) . The reaction mixture (final volume of 10 μl) contained 2.5 μg of NDV RNA, 100 pmol of ALG3, 1 μl of T4 lOx RNA-ligase buffer (500 mM Tris-HCl, pH 7.8, 100 mg magnesium chloride mM, 100 mM DTT, 10 mM ATP), 1 μl of DMSO, 1 μl of 10 μM test-cobalt chloride, 1 μl of RNasin (Promega) and 10 25 units of T4 RNA-ligase (New England Biolabs). am - * - »« .- .. ^ M j .. . . ^. t -.- ^ ..... ., - ..., "- ,, w -. t- ». , .- - «_. . ., -. . . ,, ,, -a ..--, and-, -. || rtf ||| The mixture was incubated overnight at room temperature and 5 μl of the ligation reaction was used as a template in a reverse transcription reaction by the use of ALG4 as the primer. One μl of the RT reaction was used in a PCR reaction using the primers ALG4 and p376 (5 '-GAGCCTTAAGGAGCTGCTCGTACTGATC-3'; nt 137-164) which was derived from the published sequence of the 3 'end of the NDV (Ishida et al., 1986). The PCR conditions were as described above for 5 'RACE. In method II, the 3 'and 5' ends of the viral NDV RNA were linked to each other by the use of a T4 RNA-ligase using the same conditions as the described above for method I. Five μl of the ligation mixture was used as the template in a reverse transcription reaction using the p360 primer. One μl of the RT reaction was used in a PCR reaction by using the primers p375 and p376 and the PCR conditions described above for the 5'-RACE. The PCR products were treated with Kienow DNA polymerase I to create the blunt ends and cloned into the HincII site of the pGEM4Z plasmid (Promega). They were sequenced 10 --MMti-iiilM. independent clones (4 from method I and 6 from method II) to determine the nucleotide sequence of the 3 'end of the NDV genome strain LaSota.

Construction of the transcription vector A low copy number transcription vector was constructed by using plasmid pOK12 (Vieira and Messing, 1991) as the replicon basic. Plasmid pOK12 was digested with PvuII and the DNA fragment containing the origin of replication and the Kanamycin resistance gene was isolated. This DNA fragment was ligated to an Eco47 I I I-AfII I fragment (the AfIII site was made blunt by the use of Klenow DNA polymerase I) from the transcription vector 2.0 (a kind donation by Dr Andrew Ball, Pattnaik et al., 1992). From the resulting plasmid, a fragment of Xbal-Nhel was deleted to eliminate as many unique restriction sites as possible. The resulting plasmid was designated pOLVTV5 (Figure 1). The transcription vector pOLTV5 contains the promoter of the RNA-polymerase dependent on the T7 DNA, followed by the sites of unique restriction Stul and Smal, the ribozíma • Autocatalytic hepatitis delta virus virus (HDV) and transcription termination signal from bacteriophage T7. The DNA fragments cloned between the Stul and Smal restriction sites can be transcribed either in vi tro or in vi through the use of T7 RNA polymerase. After transcription, the 5 'end of the resulting transcripts contains two G residues encoded by the plasmid. Due to the autocatalytic action of the HDV ribozyme, the 3 'end of the transcripts corresponds to the exact terminal nucleotide of the cloned DNA fragment (Pattnaik et al., 1992).

Construction of the minigenomic plasmids In order to examine the requirements for the replication and transcription of the NDV, minigenomic plasmids were constructed which contained the 3 'and 5' end regions of the NDV flanking a reporter gene that replaced all the NDV genes (Figure 2). The DNA fragments corresponding to the 3 'and 5' end regions of NDV were generated by means of PCR by the use of Pwo DNA polymerase (30 cycles, 15 seconds at 94 ° C, 30 seconds at 50 ° C, and 30 seconds). seconds at 72 ° C) and using the plasmids containing the 3 'and 5' RACE fragments as templates (see above). The 3 'region (nucleotides 1-119) was generated by the use of the primers 3UIT (5'- 5 ACCAAACAGAGAATCCGTGAGTTACGA-3', nt 1-27) and SEAP3 (5'-AGCGAGACGGGGC? GC? GGCTGGCAGAAGGCTTTCTCG-3 ', nt 102-119). The 5 'region (nt 14973-15186) was generated by the use of primers SEAP5 (5'-GCAGGCGGACCAGG ^ GCGAGATTACAGTAACTGTGACT-3', nt 14973-1099990) and 5NDV (5'-ACCAAACAAAGATTTGGTGAATGACGA-3 ', nt 15158- 15186). The two DNA fragments were joined in an overlap PCR (the overlap is shown in italics in the sequences of the primers shown above) by the use of the 3UIT and 5NDV primers. The resulting DNA fragment, which is a fusion of the 3 'and 5' end of NDV separated by 20 nucleotides, was phosphorylated by treatment with the polynucleotide-C mass T4 and cloned in both orientations in the transcription plasmid pOLTV5 ( Figure 1) the lime was excised with Stul and Smal and dephosphorylated with intestinal calf phosphatase (Boehringer Manr.ue im). Finally, the SEAP gene (coding for secreted alkaline phosphatase) was recovered from the pSEAP-Basic plasmid (Clontech) --- a ---- a-¿-s = aaáb - i ------- - -. .--- ^ - ^ - ^; - ^ - ^ _. -._._._? t & * ^. ^^^. . » . - £ t,. Finally, by digestion with Sphl and Clal, and cloned between the Sphl and Clal sites between the 3 'and 5' ends of the NDV. The resulting plasmids were designated pOLTV535 and pOLTV553, respectively. Transcription in vi tro or in vi tro using the T7 RNA polymerase of the plasmid pOLTV535 gives rise to the antigenomic RNA ([+] - RNA), while the transcription of the plasmid pOLTV553 gives rise to the genomic RNA ([-] - RNA) . The plasmids pOLTV535N0 to -N5 and pOLTV553N0 to -N5 were generated by inserting the complementary oligonucleotides at the Clal site located between the SEAP gene and the 5 'end of NDV in pOLTV535 and pOLTV553, respectively (see Figure 2). The oligonucleotides used were: NO, 5'-CGCGAGCTCG-3 '; NI, 5 '-CGCGAGSCTCG-3'; N2, 5'-CGCGAGCGCTCG-3 '; N3, 5 '-CGCGAGC GCTCG-3'; N4, 5'-CGCGAGCATGCTCG-3 '; N5, 5 '-CGCGAGCASTGCTCG- 3' (= A or T; S = C or G).

Modification of the T7 promoter in plasmids pOLTV535 and POLTV553 To generate the JD transcripts vi tro or in vi vo that contain the authentic 5 'and 3' ends of . « ,. *, i? *, r, ... . . ,. .. .- > . ^ -..., -, -. ^. ,. In the NDV, the T7 promoter in plasmids pOLTV535 and pOLTV553 was modified such that transcription could start at the first nucleotide at the 3 'or 5' terminal end of NDV. Primers containing 5 were designed, 1) a Bgll restriction site, 2) the T7 promoter sequence (shown in italics) that was modified such that the two G residues at the end of the T7 promoter were replaced by a residue A, and 3) the 3 'end (nt 1-21) or the 5 'end (nt 15164-0 151856) of NDV. The primers BGL3F2 (5'GATATGGCCATTCAGGCGTAATACGACGCACGATAACCAAACAGAGAATCCGTGAG-3 ') and SEAP3 (see above) were used to generate a DNA fragment containing the modified T7 promoter and the complete 3' end of NDV up to 5 the start of the SEAP gene in pOLTV535. Similarly, a DNA fragment containing the modified T7 promoter and the complete 5 'end of NDV was generated to the SEAP gene endpoint in pOLTV553 by using the primers BGL5F2 (5'- or GATATGGCCATTCAGGCGGAAGACGACGCACGAGAACCAA? CAAAGATTTGGTGAATG-3') and SEAP5. The resulting fragments were digested with Bgl and Sphl (3 'end) or Bgl and Clal (5' end), respectively, and used to replace the Bgll-Sphl fragment in pOLTV535, or the BglI-Clal fragment in pOLTV553. The plasmids ... «> .-. -, .- 1 ... I.15 * ,. The resulting MÉLMBI products were designated pOLTV735 and pOLTV753, respectively. Plasmids pOLTV735N3 and pOLTV753N3 were generated by the insertion of a self-complementary oligonucleotide (5'- 5 CGCGAGCWGCTCG-3 '; W = A or T) in the Clal site located between the SEAP gene and the 5' end of NDV in POLTV735 and pOLTV753, respectively.

Construction of the reporter plasmids of SEAP 10 The plasmid pCIneoSEAP was constructed by cloning an Xhol-Clal fragment (Clal site was made blunt by the use of Klenow DNA polymerase I) containing the SEAP gene from the pSEAP-Basic plasmid (Clontech) between the Xhol and Smal sites of the pCIneo eukaryotic expression vector (Promega). The last plasmid contains the human cytomegalovirus promoter (hCMV) in addition to the bacteriophage T7 promoter. With In order to examine and quantify SEAP expression by the transcripts generated from the T7 promoter alone, another plasmid lacking the hCMV promoter was constructed. For this purpose, the hCMV promoter was deleted from pCIneo by partial digestion with HindIII followed by digestion - ^ ¡^ j ^ complete with Bglll. The DNA fragment (nt 756-5469 according to the Clontech numbering) from which the hCMV promoter was deleted was isolated, treated with T4 DNA polymerase to generate blunt ends, and recircularized by using the T4 DNA ligase. The resulting plasmid was designated pCIneoD. Finally, the SEAP gene was recovered from pSEA-Basic as an Mlul-Accl fragment and cloned into the pCIneoD between the Mlul and Clal sites. The resulting plasmid was designated pCIneoD SEAP.

Transfections The cells were separated in 24-well culture dishes, grown overnight at 60-80% confluence, and infected at one m.o.i. of 1 with FPV-T7 for 1 hour at 37 ° C. The cells were transfected with 0.5 μg of the minigenemal plasmid DNA by using 3 μl of LipofectAMINEMR and OptiMem essentially as described by the supplier (GibcoBRL / Life Technologies). After incubation for 4 hours (CER cells) or 16 H (QM5 cells) at 37 ° C, the cells were either infected with NDV (Dutch virulent isolate number 152608; 200 μl per well) for 1 hour at 1 m.o.i. of 5, or they were left uninfected. The inoculum was aspirated and replaced by 1 ml of complete medium and the cells were further incubated at 37 ° C. For co-trans fections, the cells were grown in 6-well culture boxes and infected with FPV-T7 as described above. The cells were co-transfected with 0.25 μg of minigenomic plasmid DNA, 0.4 μg. of pCIneoNP, 0.2 μg of pCIneoP and 0.2 μg of pCIneoL (c) or pCIneo by using either 8 μl of LipofectAMINE or 9 μl of FuGeneMR6 (Boehringer Mannheim). In order to generate infectious viruses, the minigenomic plasmid was replaced by a Transcription plasmid containing the full-length NDV cDNA.

Quantification of SEAP activity The amount of SEAP that was secreted into the middle of the transfected cells was measured in disposable 96-well plates by using the Phospha LightMR Chemiluminescence Reporter Assay for Secreted Alkaline Phosphatase Equipment, essentially as described by the provider ^ i ^ ßÉÜIi ^ fa ^^^^^^ i ^^^^^^^^^^^^^^^^^^^^^^^^ tís ^^^^^^^^^^^ ^ iB ^ aj (Tropix). The chemiluminescence was quantified by the use of a liquid scintillation counter (Wallac 1450 microbeta PLUS).

Cloning and sequencing of cDNAs that span the entire genome of NDV strain LaSota To clone and sequence the complete genome of the NDV strain LaSota, large subgenomic cDNA clones were generated by RT-PCR and cloned into pGF.M-T. Synthesis of the first strand cDNA was performed using the 3UIT primer as described above, and 1 μl of the RT reaction was used in a PCR reaction using the Long Expansion Template ™ PCR equipment. Boehringer Mannheim) .. The PCR consisted of 5 cycles of 10 seconds at 94 ° C, 30 seconds at 58 ° C, and 6 minutes at 68 ° C, followed by 10 cycles of 10 seconds at 94 ° C, 30 seconds at 58 ° C, and 6 minutes at 8 ° C, at which time the Elongation at C8 ° C was increased by 20 seconds per cycle. or PCR fragments were cloned into pGEM-T by using the pGEM-T cloning kit essentially as described by the supplier (Promega). The ligation mixtures were transformed into E. col i strain SURE II (Stratagene). Two independent RT-PCR reactions (A and B) were performed and each produced a similar group of cDNA clones. The 5 nucleotide sequence of the subgenomic cDNA clones was determined by the use of the NDV-specific primers (Table 1) and by the primers flanking the inserts. After the comparison of the nucleotide sequence of series A and B of clones, the remaining ambiguities were resolved by sequencing the relevant regions of a third independent cDNA series (C series). The nucleotide sequence of the NDV strain LaSota is shown in Figure 3. 15 Construction of a genomic cDNA clone, full length, NDV The full length NDV cDNA was assembled into the transcription plasmid pOLTV5 by using pOLTV535 as the initial plasmid. The DNA fragments were joined in overlaps by the use of common restriction enzymes as detailed in Figure 4B. In a series of cloning steps, a ¡ÉasMiiiiafaBj ^^^^^ i ------------ ^ - ^ ---- ^ ---, -. ^ - ^, _ ^ -_ - ^ ...... A ^. ...-- ..--- ,, - ..- jMrJ gftfr plasmid (designated p535-DI) containing nucleotides 1-3521 and 12355-15186 separated by a ClaI site that was generated by joining the? Clal sites at positions 3521 and 12355. in another series of five cloning steps, a plasmid (designated pGEM-B) which contained part of the NDV genome including 3521- 12355 (ClaI fragment) was constructed nucleotides. To facilitate cloning, the last Clal fragment was labeled with the chloramphenicol resistance gene (Cm) from the plasmid pACYC184 (Chang and Cohen, 1978). To this end the Cm gene from pACYC184 was recovered by means of PCR by using primers CAT-F (5'- 15 GCGTACGTCTAGACTGGTGTCCCTGTTGATACCGG-3 ') and CAT-R (5'- GCTCTAGACGTACGACCCTGCCCTGAACCGACG-3'). The PCR was carried out with the Pwo DNA-plimerase and consisted of 30 cycles of 30 seconds at 94 ° C, 45 seconds at 60 ° C, and 60 seconds at 72 ° C. The resulting PCR fragment 20 was digested with BsiWI and cloned into the unique BsiWI site of pGEM-B, producing pGEM-B (CAT). The ClaI fragment of pGEM-B (CAT) was cloned into the unique Clal site of p535-DI, producing pNDFL (CAT). Finally, the Cm 25 gene was removed from this plasmid by digestion with ^ f ^ teM z? z ^ * ^. . .. . . ... ..,. _,. ,,. ",. . ,, - ^^ g BsiWI followed by the reliquiation and transformation of the E strain. col i DH5a. The resulting plasmid was designated pNDFL + and contains the complete NDV cDNA sequence cloned between the T7 promoter and the HDV ribozyme in the transcription plasmid pOLTV5.

Cloning and expression of individual NDV genes The DNA fragments containing each of the NDV genes of LaSota were generated by means of RT-PCR and cloned in pCIneo. After cloning, all fragments were sequenced by using primers flanking the inserts and by gene-specific primers. Gen NP: Primer 386 (5'-GAGCAATCGAAGTCGTACGGGTAGAAGGTG-3 ', nt 40-69) was used for reverse transcription. Primers 365 (5'-GTGTGAATTCCGAGTGCGAGCCCGAAG-3 '; nt 77-94) and 892 (5'-TTGCATGCCTGCAGGTCAGTACCCCCAGTC- 3'; nt 1577-1593) were used for PCR by using Pwo DNA polymerase. The following PCR profile (30 cycles) was used; 30 seconds at 95 ° C, 40 seconds at 65 ° C, and 45 seconds at 72 ° C. The resulting DNA fragment was digested with EcoRI and cloned in pCIneo between the EcoRI and Smal sites. NP expression was verified in an immunoperoxidase monolayer assay (IPMA) as described by Peeters et al. (1992) by the use of monoclonal antibody 38 (Russell et al., 1983). Gene P: Primer pRTl (5'-CAAAGAATTCAGAAAAAAGTACGGGTAGAA-3 '; nt 1794-1814) was used for reverse transcription. The primers pRTl and p2 (5'-GCAGTCTAGATTAGCCATTCACTGCAAGGCGC-3 '; nt 3053-3071) were used for PCR by using Pwo DNA polymerase. The following PCR profile (30 cycles) was used; 30 seconds at 95 ° C, 40 seconds at 65 ° C and 60 seconds at 72 ° C. The resulting DNA fragment was digested with EcoRI and Xbal and cloned in pCIneo between the EcoRI and Xbal sites. The expression of P was verified in an IPMA by the use of the monoclonal antibody 688 (Russell et al., 1983). Gen M: Primer 3UIT (5 '-ACCAAACAGAGAATCCGTGAGTTACGA-3'; nt 1-27) was used for reverse transcription. The primers NDV5M (5'-GGGTGCTAGCGGAGTGCCCCAATTGTGCCAA-3 '; nt 3268-3288) and NDV3M (5'-TCTCCCCGGGGCAGCTTATTTCTTAAAAGGAT-3'; nt 4368-4389) were used for PCR by using the HiFi Expansion equipment. PCR ^ s & ^ consisted of 10 cycles of 15 seconds at 95 ° C, 30 seconds at 55 ° C, and 2 minutes at 68 ° C, followed by 15 cycles in which the elongation time at 68 ° C was increased by 20 seconds per cycle. The resulting DNA fragment was treated with T4 DNA polymerase to create blunt ends, digested with Nhel, and cloned in pCIneo between the Nhel and Smal sites. The expression of the M protein was verified in an IPMA by the use of the antibody monoclonal 424 (Russell et al., 1983). Gen F: Primer 3UIT (see above) was used for reverse transcription. The primers NDV5F (5'-ACGGGCTAGCGATTCTGGATCCCGGTTGG-3 '; nt 4508-4526) and NDV3F (5'-ACTACCCGGGAAACCTTCGTTCCTCAT-3'; nt 6212- 15 31) were used for PCR by using the Hi-Fi Expansion equipment using the conditions described above for the M gene. The resulting DNA fragment was treated with T4 DNA polymerase to create blunt ends, digested with Nhel, and cloned in pCIneo between the Nhel and Smal sites. The expression of the F protein was verified in an IPMA using the monoclonal antibody 8E12A8C3 (ID-DLO, Department of Avian Virology).

HN gene: the 3UIT primer was used for reverse transcription. The primers NDV5HN (5'-GTAGGCTAGCAAGAGAGGCCGCCCCTCAAT-3 '; nt 6335-6354) and NDV3HN (5' -CGAGCCCGGGCCGGCATTCGGTTTGATTCTTG-3 '; nt 5 8205-8227) were used for PCR by using the Hi-Fi Expansion equipment using the conditions described above for the M gene. The resulting DNA fragment was treated with T4 DNA polymerase to create blunt ends and after Xmal digestion it was cloned in pCIneo between the blunt Nhel site (Klenow DNA polymerase). ) and the Xmal site. The expression of the HN protein was verified in an IPMA by the use of the monoclonal antibody 86 (Ruesell et al., 15 1983). Gene L: The j- gene was recovered from clone pGEM-L7a of the cDNA (Figure 4?) By digestion with SacII and SalI. Prior to digestion with Sali, the SacII site was blunted by treatment with DNA polymerase 14. The resulting fragment was cloned into pCIne ^ between the chromated Nhel site (Kieno DNA polymerase, and the Sali site). 'untranslated between the T7 promoter and the ATG start codon of the L gene contained 2 of the structural ATG codons that can interfere with expression m imm * ¡* í *? .. ai »^. of the L protein. Therefore, a new plasmid was constructed in which the first ATG was missing and in which the second ATG was changed to AAG by PCR mutagenesis as follows. 5 The primers 5LE (E) 5'- CAATGGAATTCAAGGCAAAACAGCTCAAGGTAAATAATACGGG-3 '; nt 8332-8374) and 3LE (B) 5'- GTGAATCTAGAATGCCGGATCCGTACGAATGC-3 '; nt 8847-8870) were used in a PCR reaction using the plasmid pGEM-L7a (Figure 4) as a template. PCR was carried out by using the Pwo DNA polymerase and consisted of 30 cycles of 30 seconds at 94 ° C, 45 seconds at 60 ° C, and 60 seconds at 72 ° C. The resulting DNA fragment was digested with EcoRI and Xbal and was cloned in pCIneo between the EcoRI and Xbal sites, generating the plasmid pCIneo (N). Subsequently, the BsiWI-Sall fragment from pGEM-L7a, which contains the remaining part of the L gene (nt 8852-15046), was cloned in pCIneoL (N) between the sites BsiWI and Salí, generating the plasmid pCIneoL (c). Since antibodies against the L protein are not available, the expression of L could not be verified by immunochemistry. 25 ¿^ Á ^^^ S¿¿ ^^ S ^^^^^ - ^^ J ^^: Introduction of a genetic marker in the F gene To unambiguously show that the infectious virus can be generated from the full-length, cloned cDNA, a genetic tag was introduced into the F gene by means of PCR mutagenesis. For this purpose, the F gene was cloned by using two overlapping PCR fragments. The first PCR fragment was generated by the use of the NDVSF primers (see above) and the F5R primer (5'- AAAGCGCCGCTGGCTCCGCCCTCCAGATGTAGTCAC-3 '; nt 4859-4894). Residues shown in bold are changes that were introduced into the primer in order to change the amino acid sequence of the proteolytic cleavage site between Fl and F2 from that of the LaSota NDV strain (GGRQGR IL) to that of the consensus cleavage site for virulent NDV strains (GRRQRR IF). The second PCR fragment was generated by the use of the primers F3F (5'-GGAGGAGACAGCGGCGCTGGATAGGCGCCATTATTGG-3 '; nt 4875-4911) and IV09 (5'-CTCTGTCGACACAGACTACCAGAACTTTCAC-3'; nt 6246-6266). The PCR was performed with the Pwo DNA polymerase and consisted. of 25 cycles of 15 seconds at 94 ° C, 30 seconds at 55 ° C, and 2 minutes at 72 ° C. The two overlapping PCR fragments (the overlap is shown in italics in the primer sequences) were joined in a second PCR using the primers NDV5F and IV09 and by using 5 of the same PCR conditions. The resulting fragment, which contains the complete ORF of the F gene and which codes for a virulent consensus cleavage site, was digested with Nhel and Sali and cloned in pCIneo between the Nhel and Salí sites, producing pCIneoFwt. The Stul-Notl fragment (nt 4646-4952) -Lent of pCIneoFwt was used to replace the corresponding fragment in the plasmid p535-S which had been constructed by the insertion of Clal-Sacl (nt 3521-10311) to from pGEM-B in p535-DI between the Clal and Seal sites (see Figure 4C). The resulting plasmid was designated p535-S [Fwtc]. A PCR fragment containing the Cm resistance gene from pACYC184 (see above) was cloned as a fragment Xbal within the unique Xbal site (position 6172 in the NDV sequence) of the plasmid p535-S [Fwtc], producing the plasmid p535-S [Fwtc] Cm. Subsequently, the Apal-Spel fragment labeled with Cm (nt 2285-8094) of this plasmid was used for replace the corresponding fragment of the clone "*, ^ a * ilteA ^ f-Jjgffi ^ pNDFL + of the full-length cDNA Finally, the Cm gene was removed from this plasmid by digestion with Xbal followed by recirculation using the T4 DNA ligase. which contains the full-length, genetically-labeled NDV cDNA was designated pNDFL + [Fwt].

Generation of stably transformed 10 cell lines expressing individual NDV genes The plasmids pCIneoNP, pCIneoP, pCIneoM, pCIneoF, pCIneoFwt, and pCIneoHN were used for the generation of stably transformed cell lines expressing these proteins individually. The day before transfection, the CER cells were seeded in 6 cm culture dishes and incubated overnight to give a confluence of 60-80%. The cells were transfected with 2 μg of plasmid DNA by using 12 μl of LipofectAmine and OptiMem essentially as described by the supplier (GibcoBRL / Life Technologies). After 48 hours the cells were trypsinized and the dilutions were -tfi ---- iiiit -------- "* * -. *. , ^ .. ^^ sowed in 10 cm culture dishes in medium containing 500 μg / ml of G418 (Boehringer Mannheim). Every 3 days the medium was replaced by fresh medium containing increasing amounts (in increments of 100 μg / ml) of G418 until a concentration of 800 μg / ml was reached. The cells were maintained in a medium containing 800 μg / ml of G418 and three weeks later the individual transfection colonies were collected and transferred to 96-well culture dishes. The cloned cell lines were examined for the expression of the respective NDV gene by the use of an IPMA as described above for studies of transient expression. The cell lines that constitutively expressed NP, P, M or F could be identified and isolated. However, cell lines expressing the HN protein could not be generated. Perhaps, the constitutive expression of HN is toxic to cells.

MrfU &auMb Generation of stably transformed cell lines expressing T7 RNA polymerase The gene coding for T7 RNA polymerase was recovered from plasmid pRT7NT (Rene van Gennip, ID-DLO, Department of Mammalian Virology) by digestion with EcoRI and SalI. The resulting fragment contains the T7 RNA polymerase gene located behind the baculovirus promoter plO. The DNA fragment was cloned into the pCIneoO plasmid between the EcoRI and SalI sites, generating the plasmid pCInec107. Plasmid pCIneoO lacks the T7 promoter and was derived from p Clneo by cleavage with NheT followed by partial cleavage with Seal, filling the sticky ends with the Klenow DNA polymerase and recirculation by the use of the T4 DNA ligase. The baculovirus sequences were removed from pCIneol07 by digestion with EcoRI and Pac], followed by treatment with the T-DNA polymerase to generate blunt ends and recirculation. The resulting plasmid was designated pCIneo007. The expression of the T7 RNA polymerase was verified by co-transduction of the cells with pCIneo007 and pPRhOl. The last plasmid contains the F2 protein of swine fever virus ^^^^^ e ^ j ^ g ^^^^ ^^^ _ classic cloned behind a T7 promoter and contains an entry site to the internal ribosome (Rene van Gennip, personal communication). Expression of E2 was determined in an IPMA by the use of monoclonal antibody V4 (Wensvoort et al., 1986). The stably transformed CER cell lines expressing the T7 RNA polymerase were generated and isolated as described above, except that 10 cm culture dishes were used and the cells were transfected with 5 μg of pCIneo007 DNA and 25 μl of LipofectAmine. To examine the individual cell lines for the expression of T7 RNA polymerase, they were transfected with the plasmid pPRhOl and the expression of E2 (which is dependent on T7 RNA polymerase) was determined in an I PMA by the use of monoclonal antibody V4. Several cell lines that expressed T7 RNA polymerase were identified. A cell line, designated CER-C9, was used for the subsequent experiments. ^^^ ¿feji ^^^^^^^^^ Cloning and expression of HN genes and hybrid HN genes The 3UIT primer was used to synthesize the single-stranded NDV cDNA and the avian paramyxovirus serotype-2 and -4 (APMV2 and APMV) as described above. All subsequent PCR reactions were performed by using 25 cycles of 15 seconds at 94 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C. The complete coding region of the HN gene of APMV2 was recovered by PCR using the primers IV03 (5'-GGGGGAATTCCCCATTCAATGAAGGGTCTAC-3 'and IV05 (5'-GATCCCCGGGTCTTAAACCAGGCTTCGCAATG-3') which were derived from the gene sequence HN of APMV2 (GenBank accession number D14030) The complete coding region of the HM gene of APMV4 was recovered by PCR using the primers IV06 (5 '-GGGGGAATTCTGGTAGGGTGGGGAAGGTAGC-3' and IV08 (5 '-ATTGCCCGGGGGGTAACTAATCAGGATCTCAG- 3 ') that were derived from the sequence of the HN gene of APMV4 (GenBank access number D14031). The resulting PCR fragments were. digested (either directly or after subcloning in pGEM- - * * *. * T), with EcoRI and Xmal and cloned in pCIneo between the EcoRI and Xmal sites. The resulting plasmids were designated pCIneoHN2 and pCIneoHN4, respectively. 5 Hybrids between the HN gene of NDV strain LaSota and the HN genes of APMV2 and -4, were constructed by overlapping PCR, as follows. The N-terminal part (aa 1-141) of the HN gene of NDV strain LaSota was amplified with DNA polymerase Pwo by using the primers IV01B (5'-GTAGGAATTCAAGAGAGGCCGCCCCTCAAT-3 '; nt 6325-6354) and IV10 (5' -AATGAGTTCTTTGCCTATCCCCCC-3 '; nt 6811-6834). The C-terminal part of the HN gene of APMV2 (aa 142-580) was amplified with the Pwo DNA polymerase by the use of the primers IV11B (5'- GGGGGGATAGGCAAAGAACTCATTCAAGGAGATGCATCTGCAGGC-3 ') and IV05. The resulting PCR fragments were joined in an overlap PCR (overlap shown in italics) by using the primers IV01B and IV05 and through the use of the high fidelity expansion enzyme mixture. The resulting PCR fragment was digested (either directly or after subcloning into pGEM-T) with EcoRI and Xmal and cloned into pCIneo between the EcoRI and Xmal. The resulting plasmid containing an HN gene hybrid consisting of aa 1-141 of NDV and aa 142-580 of APMV2 was designated pCIneoHNl / 2141. The C-terminal part of the HM gene of APMV4 (aa 143-569) was amplified by the use of primers IV14B (5'-GGGGGGATAGGCAAAGAACTCATTCTAGATGATGCATCTGCAGGCCTAAATTTCC-3 ') and IV08. This fragment was linked to the N-terminal part of the NDV HN gene (see above) in an overlap PCR by the use of primers IV01B and IV08. The resulting PCR fragment was digested (either directly or after scintilization in pGEM-T) with EcoRI and Xmal and cloned in pCIneo between the EcoRI and Xmal sites. The resulting plasmid containing a hybrid HN gene consisting of aa 1-141 of NDV and aa 143-569 of APMV4 was designated pCIneoHNl / 4141. In analogy to the constructions described above, the hybrid HN genes were constructed, which consisted of aa 1-143 of NDV and aa 144-580 of APMV2, or aa 1-143 of NDV and aa 145-569 of APMV4. For these constructs, PCR fragments were obtained by using the following pairs of primers; NDV aa 1-143, primer IVOIB e? Vi3 (5 '-AGCGACAAGGAGS ^ GCGGGGCCGAGC-3'; nt 6816-6840); APMV2 aa 144-580, primer IV14B Muiad-í ----_ u ___ l __________ ft ^ ta * ^? * T * i¿ ^ á t (5 '-GGGGGAGAGGCAAAGAACGCAGGGGAGAJGATGCATCTGCAGGCCTAAATTTCC-3') and IV05; APMV4 aa 145-569, primer IV15B (5'- GGGGGGAGAGGCAAAGAACGCAGGGTAGAGCAAACAGCTGACTACACAGCAG -3 ') and IV08. The PCR fragments were digested (either directly or after subcloning into pGEM-T) with EcoRI and Xmal and cloned into pCIneo between the EcoRI and Xmal sites. The resulting plasmids were designated pCIneol / 2143 and pCIneol / 4143, respectively. To examine the expression of the HN proteins, the CER cells or the QM5 cells were infected with FPV-T7 for 1 hour at 1 m.o.i. of 1, transfected with the plasmids pCIneoHN, pCIneoHN2, pCIneoHN4, pCIneoHNI / 2141, pCIneoHNI / 2143, pCIneoHNI / 4143 and pCIneoHNI / 4143, and 24 hours after transfection the monolayers were coated with a 1% suspension of chicken erythrocytes in PBS for 45 minutes at room temperature. Subsequently, the monolayers were carefully washed three times with PBS and the adhesion of the erythrocytes to the transfected cells was examined microscopically. To examine the induction of cell fusion after co-expression of the HN and F protein, the CER cells or QM5 cells were co-transfected with pCIneoFwt either with pCIneo-HNl, pCIneoHN2, pCIneoHN4, pCIneoHNl / 2141, pCIneoHNl / 2143 or pCIneoHNl / 4143. After incubation for 2 to 3 days, the monolayers were washed with PBS, stained for 15 minutes with a Giemsa solution (1:30 dilution in water), and examined microscopically.

Cloning of the hybrid genes-HN in the genomic NDV cDNA of longx.ud complete A synthetic linker, designated HN12, was inserted between the Notl and Spel sites of pGEM-T (Promega) by using oligonucleotides HN12a (5 '-GGCCGCATATTCTAGAGTTAACGACTTA-3') and HN12b (5 '-CTAGTAAGTCGTTAACTCTAGAATATGC-3'). A synthetic, desquared HN14 linker was inserted between the Notl and Spel sites of pGEM-T by the use of the oligonucleotide :, HN14a (5'-GGCCGCATATTCTAGAGTTAACGA-3 ') and HN14D (5'-CTAGTCGTTAACTCTAGAATATGC-3'). The resulting plasmids were designated pGEM-HN12 and pGEM-HN14, respectively. These plasmids were digested with N ^ tl and Xbal and used to clone the No l-Spel fragment (nt 3390-7488) of the p535-S [Fwtc] Cm plasmid. The resulting plasmids were designated pGEM-HN1 / 2NS and pGEM-HN1 / 4NS, respectively. The HN genes of these plasmids were replaced by the hybrid HN genes from the plasmids pCIneoHNl / 2143 and pCIneoHNl / 4143, respectively (see section: Cloning and expression of the HN genes and hybrid HN 5 genes). For this purpose, pCIneoHNl / 2143 and pCIneoHNl / 4143 were digested with Nhel and Smal and the resulting fragments (containing the genes HN1 / 2143 and HN1 / 41 3 hybrid) were cloned between the Nhel and Hpal site of the plasmids pGEM-HNl / 2NS and pGEM-HNl / 4NS, resulting in pGEM + HN12 and pGEM + HN14, respectively. The last plasmids were used to introduce the hybrid HN genes into the full-length genomic cDNA clone of NDV. For this purpose, plasmids pGEM + HN12 and pGEM + HN14 were digested with Notl and Spel and the fragment containing either the HN12 or HN14 gene was used to replace the corresponding fragment of pNDFL +, yielding pNDFL + HNI / 2143 Cm and pNDFL + HN1 / 4143 Cm, respectively. The Cm gene was removed from these plasmids by digestion with Xbal followed by recirculation using the T4 DNA ligase. In order to comply with the "rule of six", a linker was inserted into the unique Spel site of these plasmids by using the oligonucleotides ¿? * ^ * 2 &¿g £ fieg * grifck ^ ííi ^ w ^ self-complementary. The H2 linker (5'-CTAGCGAGCGCTCG-3 ') was inserted into the plasmid pNDFL + HNI / 2143 and the H3 linker (5'-CTAGCGAGCWGCTCG-3') was inserted into pNDFL + HNI / 4143, yielding the 5 pNDFL + plasmids HNI / 2143 (H2) and pNDFL + NHl / 4143 (H3), respectively.

Removal of a specific epitope on the NDV HN protein LaSota 10 A specific epitope, for example amino acids 346 to 354 (PDEQDYQIR), on the NDV protein LaSota HN, which is recognized by the monoclonal antibody 4D6 (Long et al., 1986; Meulemans et al., 1986), was eliminated by replacing this sequence with the corresponding sequence of the HN proteins from either APMV-2 (NRTDIQQTI) or APMV-4 (PDPLQDQIL). For this purpose, the pCIneoHN plasmid (see section: Cloning and expression of the individual NDV 20 genes) was used as the template to create overlapping PCR fragments. For the APMV-2 sequence the first PCR fragment was generated by using the primers IV01 (5'-GTAGACGCGTAAGAGAGGCCGCCCCTCAAT-3 ') and primer 3HN2 25 (5'-GATAGTTTGCTGTATATCAGTCCGATTGCATGTGTCATTGTATC- nm? mm * t # r * > 1 * m- *,. ,,. , .-, .. ...-,. .. - ... * -...,. , ".., ¿,", _ ", ...

GCTTGTATATCAC-3 '). The second PCR was generated by the use of the primers 5HN2 (5'-AATCGGACTGATATACAGCAAACTATCATGGCCAAGTCTT-CGTATAAGCCTGGAGCC-3 ') and NDV3-HN (5'- 5 CGAGCCCGGGCCGGCATT-CGGTTTGATTCTTG-3'). The resulting fragments were combined and used as a template for a third PCR using the primers IV01B (5'-GTAGGAATTCAAGAGAGGCCGCCCCTCAAT-3 ') and primer 10 NDV3-HN. For the APMV-4 sequence the first PCR fragment was generated by using the primers IV01 and the primer 3HN4 (5'-TAAGATC-TGATCTTGCAGCGGGTCAGGGCATGTGTCATTGTATCGCTTGTATATCAC-3 '). The second PCR was generated by the use of 5HN4 primers (5'-CCTGA-CCGCTGCAAGATCAGATCTTAATGGCCAAGTCTTCGTATA? GCCTGGAGCC-3 ') and NDV3-HN. The resulting fragments were combined and used as a template for a third PCR using primers IV01B and NDV3-HN. The primers 3HN2 / 5HN2 and 3HN4 / 5HN4 are partially complementary and contain the genetic codes for the sequence HN2 (NRTDIQQTI) and the sequence HN4 (PDPLQDQIL), respectively. PCR reactions were performed by using 25 of the Long Expansion Template PCR kit < li ^ * it **? e my * i ^ l í * Í ^^^^^ J ^ t-tu ^^^^^ ^, ..a ^ ------ ^^^^^, m ... "-. . .. .. .. .......... - ». ».... '-y ^^ (Boehringer Mannheim). The PCR consisted of 30 cycles of 10 seconds at 94 ° C, 30 seconds at 58 ° C and 2 minutes at 68 ° C, followed by a 4 minute cycle at 68 ° C. The PCR fragments were digested with 5 EcoNI and Bsu36I, and cloned between the EcoNI and Bsu36l sites of pCIneoHN. The resulting plasmids were designated pCIneoHNl (NH2e) and pCIneoHNl (HN4e) respectively. The transient expression studied indicated that the modified HN proteins were correctly expressed and transported to the cell surface as judged from the hemadsorption studies using chicken erythrocytes. In addition, the monoclonal antibody 6D4 which is directed against a linear epitope of NDV 15 HN and which consists of (or at least includes, amino acids 346-354) did not react with the modified HN proteins. Plasmids pCIneoHNl (HN2e) and pCIneoHNl (HN4e) were digested with NarI and Spel and fragments containing the modified HN genes were cloned between the NarI and Spel sites of pGEM-HN1 / 2NS and pGEM-HN1 / 4NS, respectively. The resulting plasmids, designated pGEM-HN1 (HN2e), and pGEM-HN1 (HN4e), were digested with Notl and Spel, and used for ~~ * ¿*? ? ^ j ^ ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ pNDFL +. The resulting plasmids were designated pNDFL-HN (HN2e) Cm and pNDFL-HN (HN4e) Cm, respectively. The Cm gene was removed from these plasmids by digestion with Xbal followed by religation. The resulting plasmids were designated pNDFL-HN (HN2e) and pNDFL-HN (HN4e), respectively.

RESULTS Nucleotide sequence of the terminal ends 3 'and 5' of the genome of the NDV strain LaSota The sequence of a putative 3 'end of the NDV genome has been published (Ishida et al., 1986) although from another strain of NDV (D26) different from that used here (LaSota).

Yusoff et al. (1987) have published a sequence of the L gene and a relatively large non-coding region behind the L gene of the NDV strain Beaudette C.

However, as shown herein, this sequence did not include the complete terminal 5 'end of the viral genome which makes it impossible to generate NDV from infectious copies. The 3 'and 5' terminal ends of the negative strand RNA virus genome play an essential role in replication and transcription (Lamb and Kolakofsky, 1996). Thus, in order to generate a full-length NDV cDNA that can be used to generate infectious viruses by means of reverse genetics (Conzelmann, 1996), it is absolutely essential to include the correct 3 'and 5' ends of the genome. viral. Therefore, the exact nucleotide sequence of the 3 'ends was determined and 5 'of the genomic RNA of the NDV strain LaSota by using the 3' and 5 'procedures of RACE (Rapid amplification of the cDNA ends). The 5 'end was recovered by PCR after ligation of a single strand anchor primer (ALG3) to the cDNA -: single strand which was generated by reverse transcription of the 5 'end of the genomic RNA. By using a primer (ALG4) that is complementary. to the anchor primer and a specific primer? of NDV, the PC'R products containing the 5 'end. To clone the 3 'end of NDV, the single-stranded anchor primer ALG3 was ligated to the 3' end of the AW. viral infection by using T4 RNA-ligase and amplified by means of PCR using the use of the ALG4 primer and a specific NDV primer • a ^ Efa * "1" "1 | i '^' * • • '- -' - * - • - - ** • .-..». *, * * * -.

(Method I). Alternatively, the 3 'and 5' ends of the NDV RNA were ligated to each other by the use of T4 RNA-ligase and the resulting concatenated RNA was used for RT-PCR by using 5 of the NDV-specific primers that flanked the ligation point (Method II). The RACE 3 'and 5' products were cloned into the vector T pBluescriptII-TSK (Ichihara and Kurosawa, 1993) or into pGEM4Z and several independent clones were isolated and sequenced. The results are compiled in Table 2. To make possible the comparison of the terminal 3 'and 5' ends, the sequences are shown in the DNA form and the 3 'end of the genomic strain is represented as the 5 'end of the antigenomic strand. At the genomic RNA level, the 3 'end sequence is read 3' -UGGUUUGUCUCUUAG while the 5 'end sequence is read UUUAGAAACAAACCA-5'. The 3 'end sequence is almost similar to the 3' sequence published terminal of the NDV strain D26 (Ishida et al. 1986). However, the 5 'end sequence showed that NDV strain LaSota contains 64 additional nucleotides compared to the published sequence of the L gene of NDV Beaudette strain C (Yusoff et al., 1987). (Figure 6).

Replication of NDV minigenomes by helpervirus To determine whether the 3 'and 5' ends of the 'NDV are functional in replication and transcription, the minigens were constructed consisting of the 3' end of the NDV (nt 1-119), a reporter gene coding for alkaline phosphatase secreted (SEAP), and the 5 'end of NDV (nt 14973-15186) (Figure 2). These minigemons were cloned in both orientations in the transcription vector pOLTV5, generating the plasmids pOLTV535 and pOLTV553, respectively (for details of the construction see Materials and Methods). Plasmid pOLTV5 (Figure 1) contains the T7 RNA polymerase promoter followed by the unique Stul and Smal restriction sites, the autocatalytic ribozyme of hepatitis delta virus (HDV) and the transcription termination signal of bacteriophage T7 (Pattnaik et al., 1992). Transcription in vi vo oin vi tro using the T7 RNA polymerase of the plasmid pOLTV535 gives rise to the antigenomic RNA (or [+] - RNA), while the transcription of the plasmid pOLTV553 gives rise to the genomic RNA (or [-] - RNA ) (Figure 5). ^ aHi ^ daaA ^ MI ^ To examine whether the minigenomic RNAs generated by the plasmids pOLTV535 and pOLTV553 could be replicated and expressed by the use of NDV as helperviruses, the CER cells expressing the T7 RNA polymerase were used either constitutively (CER-C9 cells, see Materials and Methods), or after infection with the recombinant chickenpox fpEFLT7pol (Britton et al., 1995; hereinafter called FPV-T7) which expresses the T7 RNA polymerase. The CER-C9 cells and the CER cells infected with FPV-T7 were transfected with the minigenomic plasmids pOLTV535 or pOLTV553 and after incubation for 3 hours at 37 ° C the cells were already are infected with NDV for 1 hour, or left uninfected. Approximately 24 hours after transfection, a sample was taken from the medium and evaluated for SEAP activity. The results showed that SEAP expression was very high in the cells infected with FPV-T7 which were transfected with pOLTV535. This is not surprising since the transcription pair T7 ANR-polymerase generates [+] - antigenomic RNA which is encased by the enzymes of chicken pox and which is efficiently translated by the host cell. In cells transfected with pOLTV553, transcription by T7 RNA polymerase generates the [-] - genomic RNA which must be converted to [+] - RNA by the helper virus in order to be translated into the 5 SEAP protein (see Figure 5) . In both cases, no increase in SEAP expression could be observed in cells infected with NDV compared to non-infected cells. In contrast, the expression of SEAP in cells infected with NDV was consistently approximately twice less than in non-infected cells (results not shown). For cells transfected with pOLTV535 this can be explained by the already very high level of expression of SEAP by the transcripts generated by the T7 RNA polymerase. However, the cells transfected with pOLTV553, where the efficient expression of SEAP is dependent on the conversion of genomic [J-RNA to the [+ J-RNA antigen or mRNA] Because of the viral polymerase complex, an increase in SEAP expression could be expected after NDV infection. You could think of two reasons why the minigens could not be expressed and replicated by NDV. First, the size of the ^^ s ^^^^ H¿ ^^^^^ Minigenomic RNA does not conform to the so-called "rule of six" (Calain and Roux, 1993, Kolakofsky and collaborators, 1998). According to this rule, the genomes of the paramyxoviruses are only replicated efficiently when they are a multiple of 6 nt in length. Second, the two extra G residues that are present at the 5 'end of the minigeneomic RNAs may interfere with the correct replication and / or transcription by the viral polymerase complex. To find if the replication of the genomes was dependent on the rule of six, a series of short self-complementary oligonucleotides was inserted which increased nt in size in the only Clal site in the plasmids pOLTV535 and pOLTV553 (Figure 2). The resulting plasmids (pOLTV53 a -N5 and pLTV553 to -N5) differ in size from 1 to 6 nt and therefore one of them generates a minigenomic RNA that conforms to the rule of six. The plasmids were used to transfect CER cells or CER-C9 cells infected with FPV-T7 as described above. The results showed that only plasmids pOLTV535N3 and pOLTV553N3 gave rise to increased SEAP activity after NDV infection. The OR-. ÍÍÍ A. "tl" f '' '' - "'*' - > - - - - - - ws .... -.. .i í fc -,. *. * W-.a The length of the minigenomic RNAs generated from the plasmids by the T7 RNA polymerase was calculated as 6n + 2. Since two extra G residues are present at the 5'-end of the minigenomic RNAs, these results suggest that only the size of the RNA sequence that is located between the authentic 3 'and 5' ends of the RNA 's minigei. jmicos, is relevant to the rule of six. This was verified by the construction of mini-centric plasmids, in which the start of the transcription of the T7 RNA polymerase was changed so that the first nucleotide that was incorporated into the RNA was the first nucleotide of the 3 'or 5' end of the NDV (see Materials and Methods). Transfection of these plasmids indicated that only the minigenomic RNAs generated by the plasmids are replicated by the helper virus (results not shown). These findings again indicate that NDV replication is strictly dependent on the six rule. In addition, these eUazgos indicate that the presence of two extra G residues at the 5 'end of the minigenomic RNAs or interferes with correct replication. Har. Similar results have been obtained with the minigenem plasmids (or DI plasmids) - '- - * 1 - «" - ^ * ^ ~ from other paramyxoviridae (Pattnaik et al., 1992; Harty and Palese, 1995) Packaging of NDV minigenomes by 5 helperviruses To determine if the minigeneomic RNAs could be packaged by NDV helperviruses, the medium from the transfected cells was transferred to fresh monolayers and after 1 hour of absorption, the monolayers were washed three times with PBS and subsequently incubated in complete medium. After 24 hours of incubation, the activity of SEAP in the medium was measured. The results showed that SEAP activity was present only in cells that had been treated with the medium from the cells transfected with the minigenomic plasmid pOLTV553N3 (Table 4). This finding indicates that the minigenomic RNAs can be packaged within the NDV shells and that these particles are capable of infecting the cells. In addition, these results show that the packaging is replication dependent, which indicates that only the RNA molecules that are formed in complex with the NP, P and L proteins • ** - ^ a "i" '*' "¡* -». Fr ---, a -t, .... ... * + ...... .. -... -. ... - ... rtnhir? f t-rJ HiÜ. i lii ij? ii are packaged in virus-like particles.

Replication of NDV minigenomes by plasmids 5 that express NP, P and L proteins To determine if the minigenomic RNAs could also be replicated by the plasmids that code for the essential proteins NP, P and L, cotransfection experiments were performed in cells infected with FPV-T7. The cells were transfected with a combination of plasmids consisting of the minigenomic plasmid and plasmids pCIneoNP, -P, and -L (c), respectively. As a Negative control, pCIneoL (c), which codes for the essential L protein, was replaced by the pCIneo plasmid vector. The results (Table 5) indicated that indeed the plasmids coding for NP, P, and L are capable of replicating the minigenomic RNAs. The results also show that, similar to the replication of the minigenome by the helper virus, replication by the NP, P and L proteins is also dependent on the rule of six. 25 , - *.,. • * XsíSait * a * ¿iy > . . _. -. ,. . . .. - > ,, ^ _ _,. »". $ -, Nucleotide sequence of the complete genome of NDV strain LaSota Subgenomic cDNA fragments that span the complete NDV genome were constructed by RT-PCR (Figure 4). To keep the number of PCR errors to a minimum, a mixture of test reading enzyme (Long Expansion Template, Boehringer Mannheim) was used in combination with a limited number of PCR cycles (15 cycles). The 3UIT primer which is complementary to the 3 'end of the NDV RNA was used for reverse transcription, and the specific primers of the genes were used for PCR. To identify possible PCR errors, three independent RT reactions were performed and used to generate three independent subgenomic cDNA groups. The cDNAs, which varied in size of approximately 4 to 7 kb, were cloned into pGEM-T. The nucleotide sequence of the two cDNA groups was determined by using the primers that were either deduced from the published NDV sequences, or by the primers derivatives of the NDV sequence that was deduced during this sequencing project (Table 1). The remaining ambiguities were resolved by sequencing the relevant regions of the third group of cDNA clones. The NDV genome strain LaSota consists of 15,186 nt (Figure 3), which makes it the smallest of all paramyxovirus genomes of which the complete sequence has been established to date (Kolakofsky et al., 1998).

Construction of a full-length NDV cDNA clone in the transcription plasmid pOLTV5 To construct a full-length cDNA clone of NDV LaSota strain, overlapping cDNA clones spanning the complete NDV genome were ligated into the shared restriction sites according to the strategy shown in Figure 4. The complete NDV cDNA it was assembled into the minigenomic plasmid pOLTV535 (see above) which is derived from the transcription plasmid pOLTV5. As can be seen in Figure 4B, the last step in the assembly of the complete NDV cDNA was the cloning of a Clal fragment from .-. Í ... Í i? ^, ^,. approximately 8.8 kb (nt 3521-12355) from pGEM-B within p535-DI containing the NDV sequences flanking the Clal site on either side (eg nt 1-3521 and 12355-15186, 5 respectively). This step proved to be very difficult as it repeatedly failed to generate the correct clones. Therefore, the ClaI fragment of pGEM-B was labeled with the chloramphenicol resistance gene (Cm) from the plasmid pACYC184. The Clal fragment harbors the Cm gene isolated and cloned into the Clal site of p535-DI and the transformants were selected for resistance against both Cm. Since the transformants developed poorly, the The selection of antibiotics was reduced to 15 μg / ml of Cm and 10 μg / ml of Km and the incubation temperature was reduced from 37 ° C to 32 ° C. Finally, the Cm gene was removed from this plasmid by digestion with BsiWI followed by recirculation by the use of the T4 DNA ligase. After the transformation of E. coli, the cells harboring the desired plasmid were identified f notypically by selection for resistance to Km and sensitivity to Cm. The resulting plasmid consisted of the full-length NDV cDNA cloned between the Smal and Stul sites of the transcription plasmid pOLTV5 was designated pNDFL +.

Generation of infectious NDV from full-length cDNA To generate infectious NDV completely from the cloned cDNA, the plasmid pNDLF + was used in the co-transfection experiments with pCIneoNP, -P, and -L (c), as described above for the minigenomic plasmids. The transfection of the CER and CEF cells was checked periodically by the use of the minigenomic plasmid pOLTV553N3 and by measuring the expression of SEAP. As a negative control, pCIneoL (c) was replaced by pCIneo. After cotransfection, the cells were incubated for 3 to 6 days in medium containing 5% allantoic fluid. The addition of the allantoic fluid is necessary because the CER or CEF cells lack the appropriate proteases which are required to excise the F protein of NDV strain LaSota. The cleavage of the F protein is absolutely required for the dispersion from cell to cell and for the generation of infectious viruses.

After 3 days of incubation, an immunoligic staining of the fixed monolayers was performed by the use of a monoclonal antibody against the F protein. The results showed that the cells that were stained with the antibody were only present in the monolayers that had been cotranslated. / ansfected with pNDFL (+), pCIneoNP, -P, and L (c). Lithos results indicated that the replication of the genome and its expression was occurring in these cells. No stained cells were observed when pCIneo (c) was replaced by PCIneo in the cotransfection experiments. To recover the infectious viruses, the supernatant of the transfected CEF monolayers was injected into the allantoic cavity of embryonated eggs. Four days later the allantoic fluid was harvested, analyzed in a hemagglutination test, and subsequently passed on to other eggs. The results showed that only the supernatant of the cells transfected with a combination of pNDFL + and pCIneoNP, -P, and -L (c) produced a positive reaction in the hemagglutin assay inactivated ".. The allantoic fluid that showed a haemagglutination reaction positive was -.-. ... «* -.-- ^ --- ^ --- ^ - ^^^^^^^^^ subsequently analyzed in an assay for hemagglutination inhibition by the use of monoclonal antibodies 7B7, 8C11. 5A1, 7D4, and 4D6 (Long et al., 1986) which can be used to differentiate between the different strains of NDV. The results of this test indicated that the NDV strain that was recovered from the inoculated eggs showed the same reactivity as the original LaSota strain. The virus that was recovered from the inoculated eggs was designated NDFL to distinguish it from the original LaSota strain.

Generation of genetically modified NDV of full-length cDNA 15 To show unambiguously that the co-transfection system could be used to recover infectious virus from the full length cloned NDV cDNA, a marker was introduced gene in the plasmid pNDFL (+). For this purpose, the amino acid sequence of the protease cleavage site in the Fo protein was changed from that of the LaSota strain (GGRQGR I L) to the consensus sequence of the virulent NDV strains (GRRQRR I F) by means of PCR mutagenesis (for details see Materials and methods). The resulting plasmid, pNDFL + [Fwt], was used to generate viruses by using the co-transfection system described above. The infectious virus, designated 5 NDFL [Fwt], was recovered from the allantoic fluid of the embryonated eggs which had been inoculated with the medium of the cotransfected CEF cells. In a Hl test, all MAb 's that include 7D4, which is specific for the LaSota strain, showed the same reactivity with the newly generated virus as with the original LaSota strain. The nucleotide sequence of the region encoding the protease cleavage site of the F protein was determined by means of RT-PCR. The results 15 showed that the nucleotide sequence contained the exact nucleotide changes that were introduced into the mutagenic primer that was used to modify the original LaSota sequence. This finding shows that the virus 20 derived from the plasmid pNDFL + [Fwt] and demonstrates that (genetically modified) NDV can be generated completely from the cloned full-length NDV DNA.

"A.i.í ,,? I-? I '? I?«]? V,.? L, -? É. -inlM ... *,., .. *.,! ,, --- --- - .., - ^ ..-.... ^ -. .. "..-_. . - ---. The protein protease cleavage site of the NDV Fo protein is a key determinant for virulence It is generally assumed that the amino acid sequence of the protease cleavage site of the Fo protein is a key determinant for the virulence of different strains of NDV. The generation of a genetically modified LaSota strain in which the amino acid sequence of the protease cleavage site was changed from a lentogenic (non-virulent) NDV strain to that of a velogenic (virulent) strain offered the only opportunity to prove this alleged . Therefore, the intracerebral pathogenicity index (ICPI) of the newly generated NDFL virus [Fwt] was determined and compared with that of the NDFL strain and the original LaSota strain (clone E13-1). The results showed that the ICPI of the NDFL strain [Fwt] was 1.3 which is much higher than the value for the NDFL strains (ICPI = 0.0) and the E13-1 clone (ICPI = 0.3). These results show that, as expected, the virulence of NDV is largely determined by the amino acid sequence of the protease cleavage site of the Fo protein.

Introduction of the serological marker The envelope glycoproteins F and HN of NDV are the most immunogenic proteins of the virus. 5 After infection, the F and HN proteins promote a strong neutralizing antibody response. The induction of such neutralizing antibody response is the basis of successful vaccination by non-virulent NDV strains (such as the LaSota strain widely used). However, the antibody response against NDV vaccine strains can not be distinguished from the antibody response against wild-type virulent NDV strains. In this way, Infections with virulent wild viruses can not be traced by serological methods. This situation is undesirable since infections by wild viruses are masked by vaccination and clinical signs that are caused by wild strains can be bypassed or even attributed to the vaccine. Since the successful differentiation between vaccination and infection is essential for the eradication of NDV, it was decided to develop the genetically modified NDV strains, which could be used for vaccination, and ^^ ¡^ ¡^ ^ which can be serologically distinguished from the wild strains of NDV (called marker vaccines). In order to develop a NDV marker vaccine, the virus must be genetically modified such that one or more immunodominant epitopes of one of the (major) antigens are either deleted or modified. The suppression of part or parts of the essential protein can lead to the loss of the biological function of that protein. Therefore, it was chosen to modify one of the immunodominant envelope proteins of NDV in such a way that the biological function of the protein was retained, while the repertoire of antibody against the modified protein differed from that against the original protein. For the reasons specified below, it was chosen for one embodiment of the invention to modify the NDV HN protein. NDV infection is initiated by fusion of the virion envelope with the plasma membrane of the host cell. For this process, protein F and protein HN are required. It has been shown that F and HN proteins interact physically, and that this interaction is required for membrane function (Deng et al., 1995). Also I know - "'• ' - - "• ' " - -?.. H.H . ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Y ^^^^^^^^^^^^^^^^^^^^^^. The interaction domain of the NDV HN protein has been localized towards the so-called stem or trunk region of the protein, comprising the first 92 amino acid residues of the t-domain of the HN protein (Deng et al., 1995). Hybrid HN proteins consisting of aa 1-141 of NDV and aa 141-572 of human type 3 parcinfluenza virus (hPIV3) were shown to retain fusion activity when co-expressed with the NDV F protein. This finding suggests that the genetically modified NDV strains the? which harbor a hybrid HN protein consisting of the stem region of NDV followed by the globular head of the HN protein of a different seridype of avian paramyxovirus, may be viable. Moreover, such strains could promote an anti-HN antibody response that is different from that of NDV. Since the neu antibody response; r < The protein against F protein is sufficient to allow efficient protection against challenge virus infection, such genetically modified NDV strains 25 • ° ^ '-' '- ** ••• - * - - - * - • - • * - ». < •,. i * a -. ^. essential requirements of a marker vaccine, for example, protection against disease and serological differentiation. The hybrid HN genes were constructed, which consisted of a fusion of either aa 1-141 of NDV and aa 142-580 of the avian paramyxovirus type 2 (APMV2) (designated HN1 / 2141) or aa 1-143 of NDV and aa 144-580 of AMPV2 (designated HN1 / 2143). Similarly, hybrid genes were constructed which consisted of either aa 1-141 of NDV and aa 143-569 of AMPV4 (designated HN1 / 4141) or aa 1-143 of NDV and aa 145-569 of AMPV4 (designated HN1 / 4143). The hybrid genes were cloned into the pCIneo eukaryotic expression vector and used in experiments of cotransfection with a plasmid that harbors the NDV F protein. For this purpose, the F protein was modified such that the amino acid sequence of the proteoitic cleavage site between F2 and Fl was changed from the LaSota sequence to that of the Consensus sequence of the virulent NDV strains (Fwt, see Materials and Methods section). Co-transfection experiments in CER cells and QM5 cells indicated that HN1 / 2141 and HN1 / 2143 as well as HN1 / 4141 and HN1 / 4143 induced cell fusion when were co-expressed with the Fwt protein. These -1-i ál n n n - - - - mi mi mi mi mi - - - - - - - - - - - - - ----? - «i? I.M?» ^^^^^ air-i? TíÍM? Results indicated that the complexes between the hybrid HN proteins and the F protein were biologically active. The hybrid HN proteins, HN1 / 2143 and HN1 / 4143 were used to replace the original HN gene in the full-length cDNA clone pNDFL +, yielding pNDFL-HNI / 2143 and pNDFL-HN1 / 4143. The last two plasmids were subsequently used for the generation of infectious viruses by using the cotransfection system described above. Viable recombinant viruses (designated NDFL-NH1 / 2143 and NDFL-NH1 / 4143) could be isolated from the allantoic fluid of embryonated eggs which had been inoculated with the supernatant of transfected monolayers. The presence of the hybrid HN gene in each of the two recombinants was verified by means of RT-PCR. Hemagglutination inhibition tests showed that monoclonal antibodies and polyvalent NDV antisera were unable to inhibit the agglutination of chicken erythrocytes by the recombinant viruses NDFL-HN1 / 2143 and NDFL-HN1 / 4143. These results indicate that the NDFL strains -H.N1 / 2143 and NDFL-HN1 / 4143 can be used as vaccines that can be tja * »*** * - * *» < »» Serologically distinguished from classical NDV vaccines.

Expression of a heterologous protein from the recombinant NDV To examine whether foreign genes can be inserted into the NDV genome, a recombinant virus was constructed that carried the SEAP reporter gene. The SEAP gene was derived from plasmid pOLTV535 and was modified to include the typical NDV transcriptional arrest and initiation cells. A DNA fragment containing the SEAP gene followed by the stop and start of transcription cells was inserted into the Xmnl site (nt 109) in the plasmid pNDFL + [Fwt]. The infectious virus, designated NDFL-AP, was generated by means of the cotransfection system, and the presence of the SEAP gene was verified by means of RT-PCR. Cells infected with the NDFL-AP strain expressed very high levels of the SEAP protein. By using the specific activity of the SEAP protein, it was calculated that x% of the proteins expressed in cells infected with NDFL-AP consisted of the SEAP protein. These results show that heterologous genes can be expressed at very high levels from recombinant NDV.

Generation of a mutant by suppression of NDV over a trans-complementation cell line In order to abrogate the expression of the NDV M protein, a large part of the M gene was suppressed by digestion of pNDFL + [Fwt] with BsaAI (nt 3087) followed by partial digestion with HindII (nt 4252). After filling in the HindII end with the Klenow DNA polymerase, the fragment was recircularized by the use of T4 DNA ligase and used to transform E. col i. The plasmid The resultant, designated pNDFL + [Fwt] dM, was used to generate viruses by means of the co-transfection system in the trans-complementation CER-M cells that expressed the NDV M protein. The supernatant of the transfected monolayers is passed three times on CER-M cells and was analyzed for the presence of the virus. The virus was obtained as evidenced by the fact that the culture supernatant of the third pass produced positive results in the tests of haemagglutination (HA) and inhibition of -JU¡ * .Mt ~ * & * S¿ »* HriL *». hemagglutination (Hl). The virus was designated NDFL-dM. When NDFL-dM was used to infect monolayers of CEF cells, the virus was still able to be dispersed by cell-to-cell transmission as observed in an IPMA by the use of a monoclonal antibody against the F protein. As expected, the expression of the M protein could not be demonstrated in an IPMA by the use of monoclonal antibodies against the M protein. When the supernatant was used to infect either the CEF cells or the CER-M cells, we were unable to show the presence of replication virus in these monolayers by means of IPMA. This finding indicates that the infectious virus could not be generated in CEF non-complementation cells. This finding was confirmed by the observation that inoculation of embryonated eggs with supernatant from infected CEF cells did not result in the generation of progeny virus when tested in HA or Hl tests. The need for better NDV vaccines, and especially the need for NDV marker vaccines, prompted us to develop an inverse genetic system which could allow * - »* * - - --- - • -" "- tft ^ w ^ d ^ r ífl.? Ii? IB? I¡ÉMitAdfc > to him? genetic modification of NDV. In this document, the generation of infectious NDV is described completely from the full-length, cloned cDNA. It was shown that the virulence of 5 NDV can be dramatically changed by modifying only three nucleotides that determine the specificity of the protease cleavage site of protein F. In this case, the protease cleavage site was changed from that of the LaSota strain to that of the consensus cleavage site of the virulent NDV strains. By generating this genetically modified NDV strain, the formal test was delivered that the cleavage capacity of the F protein is the key determinant (but not the only determine.te) for the virulence of NDV. By using the same inverse genetic procedure, the cleavage site can be modified, at will, to any other amino acid sequence. This can lead to the generation of a series of NDV strains that show a spectrum of virulence levels.

*** Mtttít., ?? ?? f 1-, l "l; - ?? l l i li i i - -, | r ^^? ^^. ^? i? ^^? ^^? ^ Mi ^^^^^^ ^^ a? ^ M? Í? ^? ^? ^^^^^^ u In vivo As mentioned above, it has been shown that, in addition to the cleavage capacity of F and HN proteins, other viral factors may contribute to pathogenicity. Alterations in transcription and translation can modulate the cell-to-cell development and spread of the virus and / or the cytopathogenicity. The availability of an infectious NDV cDNA allows the systematic modification of sequences that are involved in transcription and replication. This may lead to the design of new NDV vaccines which support optimal immunogenicity to virtually nonexistent virulence. Safety is one of the important properties of live vaccines. However, for many live vaccines, including NDV, immunogenicity is frequently inversely related to virulence. Therefore, the additional attenuation of live vaccines without loss of immunogenicity is one of the most desired alterations for which genetic modification could be used. In this regard, it is worth mentioning that it has been shown J ^^^^ H ^ that the elimination of Sendai virus V protein expression resulted in markedly reduced pathogenicity for mice (Kato et al., 1997). In a manner similar to the Sendai virus, NDV also generates a V protein by a mechanism known as RNA editing (Steward et al., 1993). It is predictable that the elimination of NDV protein V expression may also result in an attenuated phenotype in vivo. Apart from changing the virulence of NDV, it was shown that it is possible to modify the antigenic constitution of NDV in such a way that strains can be generated that can be serologically discriminated from the wild strains of NDV. These, called marker vaccines, are an invaluable tool for assessing the prevalence of NDV in commercial flocks around the world. In addition, the large-scale application of such marker vaccines may ultimately lead to. complete eradication of NDV through a process of intensive selection and eradication of infected flocks. This document shows that foreign genes can be inserted into the NDV genome. These foreign genes can be expressed at very high levels of infected cells. This shows that NDV can be used as a vaccine vector for the expression of antigens from other pathogens (poultry). Several properties 5 make NDV an ideal vaccine vector for vaccination against respiratory or intestinal diseases. 1) NDV can be easily cultivated at very high titers in embryonated eggs. 2) Mass culture of NDV in embryonated eggs is relatively inexpensive. 3) NDV vaccines are relatively stable and can be administered simply by mass application methods such as addition to drinking water or by spray or spray formation. 4) The natural route 15 of the NDV infection is through the respiratory and / or intestinal tract, which are also the main natural routes of infection of many other poultry pathogens. 5) NDV can induce local immunity despite the presence of maternal antibody in circulation. Finally, it was shown that viable NDV deletion mutants can be generated by the use of transcomplementation cell lines. A deletion mutant NDV 25 was generated, which was able to express the gHUlI ^ nn ^^ matrix protein (M) that is involved in the NDV outbreak in the inner cell membrane. It was shown that a phenotypically complemented NDV strain that is unable to express the 5 M protein is still capable of infecting the cells and dispersing via cell-to-cell transmission. However, the mutant virus is unable to generate infectious progeny-over non-complementation cells. This finding shows that the NDV f deletion mutants that are notcompletely supplemented can be used as safe and self-restricted vaccines, which are incapable of spreading to the environment. Such non-transmissible vaccine combines the most important advantage of live vaccines, for example, efficacy, with the most important advantage of dead vaccines, for example, safety.

LEGENDS 20 Figure 1 The transcription vector pOLTV5 is a derivative of the transcription vector described by Pattnaik et al. (1992). See the text for Uft BÍBÜáÉM if it go I t .tiWti-tii r i -ifi. "-, -? ?? -. «*? r »* i- .. *« "» - i- »~." ...., .. x.,, ^ .. ^ ^ details of the construction- -The plasmid conti ne the promoter of the RNA -polymerase dependent on DNA (shown in bold) followed by the unique Stul and Smal restriction sites and the autocatalytic ribozyme of the delta hepatitis virus (HDV). The DNA fragments can be cloned between the Stul and -Smal sites and can be transcribed either in vi tro or in vi via the use of T7 RNA polymerase. The 5 'end of the resulting transcripts contains two extra G residues that are not encoded by the insert. Due to the action of the ribozyme, the 3 'end of the transcripts corresponds e-x-rectly to the last nucleotide of the insert.

Figure 2 Structure of the minigenomic plasmids POLTV535 (Figure 2A) and pOLTV553 (Figure 2B). Minigenomic plasmids are based on the transcription plasmid pOLTV5 (see Figure 1- and contain the 3 'region (nt 1-119) and the 5' region (nt 14970-15186) of NDV LaSota strain flanking the gene coding for the secreted alkaline phosphatase (SEAP) The transcription of pOLTV535 by the RNA- Mui itirtr i j ^ MjgganiMia T7 polymerase produces antigenomic RNA (or [+] - RNA) while the transcription of pOLTV553 produces the genomic RNA (or [-] - RNA). The start (S) and end (E) boxes, which are the start and end signals of viral transcription are indicated. The start codon of the SEAP gene is underlined. The sequences of the insertions (N0-N5) in the ClaI site that generate minigenomic plasmids each differing in a nucleotide of length 10 (pOLTV535NO-N5 and pOLTV553N0-N5, respectively) are also shown.

Figure 3 Nucleotide sequence of the NDV genome strain LaSota and the deduced sequence of the amino acids of the NDV genes. The sequence shown corresponded to the antichobic strand and is shown in the 5 'to 3' direction in the form of ssDNA. The sequence shown in this figure is that of the consensus sequence that was completely determined by sequencing of two independent groups of overlapping subgenomic cDNAs that span the NDV genome. complete. The remaining ambiguities ^^^^ ¡^^^^^^^^. (probably as a result of PCR errors) were resolved by secu-ency over the relevant regions of a third independent group of clones. The sequence of the clone pNDFL + of the full-length cDNA that was assembled from the subgenomic cDNA clones, in overlap (see Figure 4), differs from that of the consensus NDV sequence in the following positions (consensus sequence in parentheses) : nt 1755, G (A); nt 3766, A (G); nt 5109, G (A); nt 6939, T (C) nt 7056, G (A); nt 9337, G (A); nt 9486, A (T); nt 10195, T (C); nt 13075, A (G). -These differences result in 3 amino acid changes (the consensus sequence in parentheses): F protein, R189 (Q); HN protein S200 (P); L-protein N369 (I).

Figure 4 (A) Complete strategy used for the assembly of the full-length NDV cDNA, from overlapping, subgenomic cDNA clones. The cDNA was assembled into plasmid pOLTV535 which already contained the 3 'and 5' ends of NDV strain LaSota (see Figure 2). The resulting plasmid, designated pNDFL +, was used for the generation of infectious NDV. (B) Detailed cloning procedure for the assembly of the full-length NDV cDNA, from overlapping, subgenomic cDNA clones. Cm denotes the chloramphenicol resistance gene which was temporarily introduced as a phenotypic marker (see text for details). 10 (C) Detailed cloning procedure for the generation of full-length, genetically modified NDV cDNA. The modification consists of three nucleotide changes which were introduced into the F gene and which gave as resulted in the modification of the amino acid sequence of the proteolytic cleavage site of the F protein (see text for details).

Figure 5 20 [A) Series pOLTV535 Transcription by means of T7 RNA polymerase produces the antigenomic RNA (or [+] - RNA) which can be directly translated into the SEAP protein by the cell .. After the infection of the cells by the helpervirus (or after co-transfection of the plasmids encoding NP, P, and L), the antigenomic RNA is used by the complex. polymerase = a viral for the synthesis of genomic RNA (or [-] - RNA). The genomic RNA is then used by the viral polymerase complex for the synthesis of the mRNA (by using the boxes or boxes specific for start 10 of the transcript [S] and end [E] and the antigenomic RNA.

(B) pOLTV553 series.

Transcription by means of T7 RNA polymerase produces genomic RNA (or [-] - RNA) which can not be translated into the SEAP protein. After infection of the cells by the helpervirus (or after co-transfection of the 20 plasmids encoding NP, P, and L), the genomic RNA is used by the viral polymerase complex for mRNA synthesis (by using the specific cells for the start of transcription [S] and end [E]) and the antigenomic RNA.

MtM- u? Tí mtítittafí *. - * i ,,,,. »- *.«, * -.,., - ,, ..,. .. .. ..........,. -. -. - .. -. - -. . , j -? > ^ Figure 6.

Alignment of the nucleic acid sequences of the 5 'terminal ends of NDV LaSota and other paramyxoviruses that are given as the sequential comparison of NDV through four members of the genus Rubul to vi rus, three members of the genus Paramyxovi rus, and three members of the genus Morbi lli vi rus. The sequences are presented from the extreme cell of the L gene towards the 5 'end (3' -5 'cDNA). NDV, Newcastle disease virus; hPIV2, human parainfluenza virus 2; MuV, measles virus; SV5 and SV41, simian viruses 5 and 41 respectively; SeV, sendai virus; bovine and human parainfluenza virus bPIV3, and hPIV3, respectively; CDV, canine distemper virus; MeV, RPV of measles virus, haematurian bilious fever virus. The nucleotide sequences (nt) of the complete genomes were obtained as follows (access no.); NDV (AF077761) hPIV2 (X57559); MuV (AB000388); SV5 (AF052755) SV41 (X64275); bPIV3 (D84095); hPIV3 (Z11575) CDV (L13194); MeV (X16565); RPV (Z30697).

REFERENCES Alexander, D. J. (1993) Paramyxovirus infections. In Virus infections of birds. McFerran, J. B and McNulty, M.S. (eds), pp 321-340, Elsevier Science Publishers B. V. Amsterdam. Antin, P. B. and Ordahl, C. P. (1991) Isolation and characterization of avian myogenic cell line.

Dev. Bi ol. 143: 111-121. Baron, M. D. and Barrett, T. (1997) Rescue of rinderpest virus from cloned cDNA. J ".Vol.R.71: 1265-1271. Beach, J. R. (1994) the neutralization in vitro of avian pneumoencephalitis virus by Newcastle disease immune serum. Science 100: 361-362. Beard, C. W. And Hanson, R. P. (1984) Newcastle disease. In M. S. Hofstad et al. (eds) Disease of Pultry, 8th Ed., Pp. 452-470. Iowa State University Press. Ames Beaudette, F. R., Bivins, J.A. and Miller, B. R. (949) Newcastle disease immunization with live virus. Corneli Ve t. 39: 302-334. Boursnell, M. E. G., Green, P. F., Smason, A. C. R., Camphell, J. I. A., Deuter, A., Peters, R. W. Miller, N. S., Emmerson, P. T. and Bins, M. M. '- - • "- •' - '-" • - (1990) A recombinant fowlpox virus expressing the hemagglutinin-neuraminidase gene of Newcastle disease virus (NDV) protects chickens against challenge by NDV. Virology 178: 297-300. Britton, P., Green, P., Kottier, S., Mawditt, KL, Penzes, Z., Cavanagh, D. and Skinner, M. (1996) Expression of bacteriophage T7 RNA polymerase in avian an mammal íc.i cells by a recombinant fowlpox virus. J. Gen. I saw role. 77: 963-967. Calain, P. and Roux, L. (1993) The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. J. Virol. 67: 4822-4830. Chambers, P., Millar, N. S., Bingham, R. W. And Emmerson, P. T. (1986) Molecular cloning of complementary DNA to Newcastle disease virus and nucleotide sequence analysis of the junction between the genes encoding the haemagglutinin-neuraminidase and the large pro 'ein. J. Gen. I saw role. 67: 475-486 Chang, A.C. Y. and Cohen, S.N. (1978) Construction and characteriz-t ion of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Lacteriol. 134: 1141-1156.

Cho, B. R. (1982) Cytopathic effects and focus formation by reticuloendotheliosis viruses in a quail fibroblast cell line. Ai ^ i n Di ses ses 21: 261 Collins, P.L., Hil, M.G., Camargo, E., Grosfeld, H., Chanock, R.M. and Murphy, B.R. (1995) Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for transcription elongation factor from the 5 'proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development. Proc. Na ti. Acad. Sci. USA 92: 11563-11567. Conzelmann, K. K. (1996) Genetic manipulation of non-segemented negative-strand RNA viruses. J. Gen. Virol. 77: 381-389. Cowen, B. S. and Braune, M. 0. (1988) The propagation of avian viruses in a continuous cell line (qT35) of Japanese quail origin. Avi an Di ses ses 32: 282-297. Deng, R., Wang, Z., Mirza, A.M. and lorio, R.M. (1995) Localization of a domain on the paramyxovirus attachment protein required for the promotion of cellular fusion by its homologous fusion protein spike. Virology 209: 457-496.

------ I ^^^ - ^^^^^ Doyle, T. M. (1927) A hitherto unrecorded disease of fowls due to filter-passing virus. J. Comp. Pathol. Ther. 40: 144-169. Garcin, D., Pelet, T., Calain, P., Roux, L., Curran, '5 J. and Kolakofsky, D. (1995) A highly r ecombinogenic system for the record of infectious Sendai paramyxovirus from cDNA: generation of a novel copy-back non-defect ive interfering virus. EMBO J. 14: 6087-6094. 10 Garten, W., Berk, W., Nagai, Y., Rott, R. And Klenk, H. D. (1980) Mutational changes of the protease susceptibility of glycoprotein F of Newcastle disease virus: Effects on pathogenecity, J. Gen. I saw role. 50: 135-147. 15 Goldhaft, T. M. (1980) Historical note on the origin of the LaSota of Newcastle disease virus. Avian Di s. 24: 297-301. Gough, R. E. and Alexander, D. J. (1973) The speed of resistance to challenge induced in chickens vaccinated by different routes with a Bl strain of live NDV. Vet. .Rec. 92: 563-564. Hanson, R. P. (1988) Heterogeneity within strains of Newcastle disease virus: key to survival. In D. J. Alexander (ed.), Newcastle. Dissease, pp. 113-130.

Kluwer Academic Publ., Boston.

Harty, R. N. and Palese, P. (1995) Mutations within noncoding terminal sequences of model RNA 's of Sendai virus: Influence on repórter gene expression. J. Vi role. 69: 5128-5131. 5 Heckert, RA, Riva, J., Cook, S., McMillen, J. and Schwartz, RD (1996) Onset of protective immunity in chicks after vaccination with a recombinant herpesvirus of turkeys vaccine expressing Newcastle disease virus fusion and hemagglutinatinin- 10 neuraminidase antigens. Avan Di s. 40: 770-777. Heuschele, W. P. and Easterday, B.C. (1970) Local immunity and persistence of virus in the tracheas of chickens following infection with Newcastle disease viruses. II. Immunof luorescent and hitopathological studies. J. Inf. Say s. 121: 497-504. Hitchner, S. B. and Johnson, E. P. (1948) A virus of low virulence for immunizing fowls against Newcastle disease (avian pneumoencephali tis). Go t. Med. 43: 525-530. Hoffman, M.A. and Banerjee, A.K. (1997) An infectious clone of human parainfluenza virus type 3. J. Vi rol. 71: 4272-4277.

Hofstad, M. S. (1953) Immunization of chickens against newcastle disease by formalin-inactivated vaccine. Am. J. Ve t. Res. 14: 586-589. Ichihara, Y., and Kurosawa, Y. (1993) Construction 5 of new T vectors for direct cloning of PCR products. Gen e 130: 153-154. Ishida, N., Taira, H., Omata, T., Mizumoto, K., Hattori, S., Iwasaki, K, and Kawakita, M. (1986) Sequence of 2617 nucleotides from the 3 'end of Newcastle disease virus genome RNA and the predicted amino acid sequence of the viral NP protein. Nucí Acids Res. 14: 6551-6564. Kaleta, E. F. and Baldauf, C. (1988) Newcastle Disease in free-living and pet birds. In D. J.

Alexander (ed.), Newcastle Disease, pp. 197-246. Kluwer Academic Publ., Boston. Kant, A., Koch, G., van Roozelaar, D.J., balk, f. and ter Huurne, A. (1997) Differentiation of virulent and non-virulent strains of Newcastle disease virus within 24 hours by polymerase chain reaction. Avian Pathol. 26: 837-849. Kolakofsky, D., Pelet, T., Garcin, D., Hausmann, S., Curran, J. and Roux, L. (1998) Paramyxovirus RNA synthesis and the requirement for hexamer genome -ggm ^ j ^^^^^^ lenght: the rule of six revisited. J. Vi role. 72: 891-899. Kraneveld, F. C. (926) A poultry disease in the Dutch East Indies. Ned. Indi sch Bl. Di ergeneesk. 38: 448-450. Lamb, R. A. and Lolakosfky, D. (1996) Paramyxoviridae: the viruses and their replication, in: Fundamental Virology (Fields et al., Eds), Chapter 20, p. 577-604, Lipincott-Raven Publishers, Philadelphia. Lawson,? D., Stillman, E.A., Whitt, M.A. and Rose, J.K. (1995) Recombinant vesicular stomatitis virus from D? A. Proc. Na ti. Aca d. Sci. USA 92: 4477-4481. Long. L., protetelle, D, Ghysdael, J., Gonze, M., Burny, A. and Meulemans, G. (1986) Monoclonal antibodies to haemagglutinin-neuraminidase and fusion glycoproteins of? Ewcastle disease virus: relationship between glycosylation and reactivity. J. Virol. 57: 1198-1202. Madansky, C. H. and Bratt, M.A. (1978)? Oncytopathic mutants of? Ewcastle disease virus. J. Vi role 26: 724-729. Madansky, C. H. and Bratt, M.A. (1981a)? Oncytopathic mutants of? Ewcastle disease virus are defective in virus-specific RNA synthesis. J. Vi role. 37: 317-327. Madansky, C. H. and Bratt, M.A. (1981b) Relationships among virus spread, cytopathogenicity, and virulence as revealed by the noncytopathic mutants of Newcastle disease virus, J. Vi rol. 40: 691-702. Meulemans, G., Gc-e, M., Carlier, MC, Petit, P., Burny, A. and Long, L. (1986) Protective effects of HN and F glycoprotein-speci fic monoclonal antibodies on experimental Mewcastle disease . Avian Pathol. 15: 761-768. Millar, N. S., Chambers, P. and Emmerson, P. T. (1998) Nucleotide sequences of the fusion and haemagglutin inin-ní uraminidase gene of Newcastle disease virus, Ulster strain: Molecular basis for variations in pathogeneci ty and between strains. J. Gen. I saw role. 69: bl3-6 J. Morgan, R.W., Gelb Jr. , J., Schreurs, C.S., Lütticken, D., Rosenberg, J.K., and Sondermei j er, P. (992) Protectic1 of chickens from Newcastle and Marek 's Diseas;; with a recombinant herpesvirus of turkeys vaccine expressing the Newcastle disease virus fusion protein. Avian Dis. 36: 858-870. .- ^ -, «..-- .i. -, t .1, - ^. A-AM ^ - ^ Morgan, RW Gelb Jr., J., Pope, CR and Sondermeijer, P. (1993) Efficacy in chickens of a herpes virus of turkeys recombinant vaccine containing the fusion gene of Newcastle disease virus: onset of protection and effect of material antibodies. Moscovici, C., Moscovici, M.G., Jiménez, H., Lai, M.M., Haymann, M.J. and Vogt, P. K. (1997) Continuous tissue culture cell lines derived from chemically induced tumors of Japanese quail. Cell 11: 95-103. Pattnaik, A.K., Ball, L.A., LeGrone, A.W. and Wertz, G.W (1992) Infectious defective interfering particles of VSV from transcripts of a cDNA clone. Cell 69: 1011-1020. Peeples, M. E. (1988) Newcastle disease virus replication. In D. J. Alexander (ed.), Newcastle Disease, pp. 45-78. Kluwer Academic Publ., Boston. Peeters, B. N. de Wind, M. Hooisma, F. Wagenaar, A. Gielkens, and R. Moormann. (1992) Pseudorabies virus envelope glycoproteins gp50 and gil are essential for virus penetration, but only gil involved in fusion membrane. J. Virol. 66: 984-905. Radecke, F., Spielhofer, P., Schneider, H., Kaelin, K., Huber, M., Dotsch, C., Christ iansen, G. And á ^ g ^ ^^ j | g | Billeter, M.A. (1995) Rescue of Measles virus from cloned DNA. EMBO J. 14: 5773-5784. Rott, R. and Klenk, H.-D. (1988) Molecular basis of infectivity and pathogenecity of Newcastle disease '5 viruses. In D. J. Alexander (ed.), Newcastle Disease, pp. 98-112. Kluwer Academic Publ., Boston. Russell, P. H., Griffiths, P. C, Goswami, K. K. A., Alexander, D. J., Cannon, M. J. and Russell, W. C. (1983) The characterization of monoclonal antibodies 10 to Newcastle disease virus. J. Gen. I saw role. 64: 2069-2072. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning, a laboratory manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY. 15 Schneider, H., Spielhofer, P., Kaelin, K., Dótsch, C, Radecke, F., Sutter, G. And Billeter, M.A. (1997) Rescue of measles virus using a replication-deficient vaccinia- T7 vector. J. ViroJ. Me th 64: 57-64. 20 Schnell, M.J., Mebatsion, T. and Conzelmann, K.-K. (1994) Infectious rabies virus from cloned cDNA. EMBO J. 13: 4195-4203. Schütze, H., Enzmann, P.-J., Kuchling, R., Mudt. , E., Niemann, H. and Metten.leiter, T. C. (1995) 25 Complete genomic sequence of the fish rhabdovirus ^^ SiSj ^^? ^ --É ..- ^ ---------. * - * * * * 'to-a infections haemetopoietic necrosis virus. J. Gen. Virol. 76: 2519-2527. Smith, A.L., Tignor, G.H., Mifune, K., and Motohashi, T. (1977) Isolation and assay of rabies 5 serogroup viruses in CER cells. Intervirlogy 8: 92-99. Spradbrow, P. B. (1988) Geographical distribution. In D. J. Alexander (ed.), Newcastle Disease, pp. 247-255. Kluwer Academic Publ., Boston. 10 Stáuber, N., Brechtbühl, K., Bruckner, L. and Hofmann, M.A. (1995) Detection of Newcastle disease virus in poultry vaccines using the polymerase chain reaction and direct sequencing of araplified DNA. Vaccine 13: 360-364 Steward, M., Vipond, I.B., 15 Millar, N.S. and E merson, P.T. (1993) RNA editing in Newcastle disease virus, J. Gen. Virol. 74: 2539-2547. Taylor, J., Edbauer, C., King-Senelonge, A., Bouquet, J., Norton, E., Goebel, S., desmetre, P. and 20 Paoletti, E. (1990 ) Newcastle disease virus fusion protein expressed in a flowlpox virus recombinant confers protection in chickens. J. Virol. 64: 1441-1450. Tessier, D. C, Brousseau, R., and Vernet, T. (1986) 25 Ligation of single-stranded - * < * • * > ** * - > - ~~ '' - • - ~ '- - ** - **** ... -. - • • - .- i. i. - • ^ A, ^, - ^. oligodeoxyribonucleotides by T4 RNA Ligase. Anal Bi och em. 158: 171-178. Vieira, J., and Messing, J. (1991) New pUC-derived cloning vectors with different selectable markers and DNA replication origins. Gene 100: 189-194. Vindevogel, H. and Duchatel, J. P. (1988) Panzooti Newcastle disease virus in pigeons. In D. J. Alexander (ed.), Newcastle Disease, pp. 184-196. Kluwer Academic Publ., Boston. Whelan, S. P. J., Ball, L. A., Barr, J. N. and Wertz, G. T. W. (1995) Efficient recovery of infectious vesicular stomatitis virus from cDNA clones. Proc. Nati Acad. Sci. USA 92: 8388-8392. Wensvoort, G., Terpstra, C., Bonstra, J., Bloemraad, M. and Van Zaane, D. (1986) Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis. Vet. Microbiol. 12: 101-108. Yusoff, K., Millar, N. S., Chambers, P., and Emmerson, P. T. (1987) Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses. Nucí Acids Res. 15: 3961-3976.

Table 1. gjg ^ g ^ ^ ^? g «^^ g ^ j Table 1 (continued) , ...-....., «,., ..». ..ü ^^^ i Table 1 (continued) .. ^ 7 ^^^^^.

Table 1 (continued) ^^^ Table 2. Sequence of the ends ter ales .3 'and 5' of the genome of the NDV strain LaSota A. Sequence of the 3 'terminal end (shown as 5' end of the antigenomic DNA strand) Method I. Cion Sequence 04 ACCAAACAGAGAATC 05 ACCAAACAGAGAATC 13 ACCAAACAGAGAATC 21 ACCAAACAGAGAATC Method II. Clone Sequence 26 ACCAAACAGAGAATC 28 ACCAAACAGAGAATC 30 ACCAAACAGAGAATC 31 ACCAAACAGAGAATC 32 ACCAAACAGAGAATC 33 ACCAAACAGAGAATC Consensus .ACCAAACAGAGAATC B. Sequence of the 5 'terminal end (shown as DNA) t - «* < » Clones of pBluescriptII-TSK Clone Sequence r3101-i3 ACC AACAAAGATTT r3101-14 ACCAAACAAAGATTT r3101-15 ACC AACAAAGATTT r2601-17 ACC AACAAAGATTT r2601-lfi ACCAAACAAAGATTT r2601-19 ACCAAACAAAGATTT r2601-20 AACAAGGTGAAGATA r2601-21 ACCAAACAAAGATTT Clones of pGEM4Z Clone Sequence r3101-16 ACCAAACAAAGATTT r3101-17 ACCAAACAAAGATTT r3101-18 ACCAAACAAAGATTT r3101-l_9 ACC AACAAAGATTT r3101-22 ACCAAACAAAGATTT ACCAAACAAAGATTT Consensus Table 3. Minigenomic replication by the NDV helper virus A. SEAP activity. { cp.s). after t-transfection of the CER-C9 cells with the plasmids of the series pOLTV535 and pOLTV553 ..

Plasmid + NDV -NDV Ratio pOLTV535N0 3.5 x 104 7.1 x 104 0.49 pOLTV535Nl 5.9 12.1 0.49 pOLTV535N2 2. 4 6.2 a.39 pOLTV535N3 7.6 5.2 1.46 pOLTV535N4 1.8 4.1 0.44 pOLTV535N5 1.5 3.0 0.50 pOLTV553N0 5.5 x 103 9.6 x 103 0.57 pOLTV553Nl 9.6 27.6 0.35 pOLTV553N2 2..4 3.5 D. 68 pOLTV553N3 15.1 9.5 1.59 pOLTV553N4 3 .. Ú 1.3 0-43 pOLTV553N5 2.9 4.8 0.60 B. SEAP activity (cps) after transfection of the CER cells infected by FPV-T7 with the plasmids of the pOLTV553 series.

Plasmid + NDV -NDV Ratio POLTV553N0 7.2 x 104 8.3 x 104 0.86 POLTV553N1 8.4 12.0 0.70 P0LTV553N2 B .. 9 12. 6 0.71 pOLTV553N3 27.4 8.6 3.19 pOLTV553N4 9.7 10.4 0.93 pOLTV553N5 8.5 8.1 1.05 Table 4 Transfer of SEAP activity (cps) after treatment of the CER cells with the supernatant of the CER cells infected with FPV-T7 which were transfected with the plasmids of the pOLTV553 series and which had been superinf ect? two with NDV (see Table 3). 10 Plasmid pOLTV553N0 2. 4 x 10- POLTV553N1 6.2 POLTV553N2 2.0 15 POLTV553N3 20.6 POLTV553N4 2.0 POLTV553N5 2.1 Table 5 SEAP activity (cps) after co-transfection of the CER cells with the pOLTV553 series of the plasmids, and the plasmids pCIneoNP, pCIneoP and pCIneoL (c) (or pCIneo as a negative control).

Proportion of NP, P and L NP, P and pCIneo plasmid pOLTV553N0 3.1 x 104 2 .7 x 103 11.7 pOLTV553Nl 4.1 5.2 7.9 pOLTV553N2 3-1 3.1 10.0 POLTV553N3 35.9 3.6 100.8 pOLTV553N4 1.9 4.6 4.1 pOLTV553N5 1.0 4.1 2.5 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention. fifteen * "A6 ^ á ^ fe = ag- -. -. *. ... -, - - - - -. ._.- - ....» *.,. «. -.... - * Aa ^ -fc-,

Claims (31)

CLAIMS Having described the invention as above, the content of the following claims is claimed as p-property:

1. An ADUc of avian paramyxovirus, characterized in that it comprises at least one nucleic acid sequence corresponding to the 5'-terminal end of the avian paramyxovirus genome that allows the generation of an infectious copy of the avian paramyxovirus.

2. A compliance cDNA x r > n claim 1, characterized in that it comprises a full-length cDNA.

3. A cDNA, characterized in that it comprises at least one nucleic acid sequence corresponding to the 5 '-terminal end of the avian paramyxovirus genome that allows the generation of an avian paramyxovirus minigenome in replication.

4. A cDNA according to claims 1, 2, or 3, characterized in that it is at least partially derived from the Newcastle disease virus.

5. A cDNA according to claim 4, characterized in that the Newcastle disease virus is a lentogenic virus, preferably derived from a vaccine strain.

6. A cDNA according to claim 5, characterized in that the vaccine strain is a strain LaSota, ATCC VR-699.

7. A cDNA according to any of claims 1 to 6, characterized in that it is further provided with a modification in a nucleic acid.

8. A cDNA according to claim 7, characterized in that the modification comprises a nucleic acid encoding a modified protease cleavage site.

9. A cDNA according to claim 8, characterized in that the site of tm ^ É * • i- i ^ j ^ gjgigí ^? cleavage is a protease cleavage site of the fusion protein (F).

10. A cDNA according to claim 1, characterized in that the modification comprises a nucleic acid encoding a viral protein -hybrid-

11. A cDNA according to claim 10, characterized in that the protein is a hemagglutinin-neuraminidase (HN) protein.

12. A cDNA according to claim 7, characterized in that the modification comprises a deletion in an amino acid that codes for a viral protein.

13. A cDNA according to claim 12, characterized in that the viral protein is a matrix protein (M).

14. A cDNA according to any of claims 1 to 13, characterized in that it is further provided with a nucleic acid encoding a heterologous antigen.

15. A cDNA according to claim 14, characterized in that the antigen is derived from a poultry pathogen.

16. A cDNA according to claim 14 or 15, characterized in that it is further provided with a nucleic acid encoding an immunostimulatory protein or a part thereof.

17. An RNA, characterized in that it is obtained from an AUNc according to any of claims 1 to 16.

18. A method for generating infectious copies of avian paramyxovirus, characterized in that it comprises the transfection of at least one cell with the cDNA according to any of claims 1 to 16.

19. A method according to claim 18, characterized in that the cell is at least capable of expressing the viral nucleocapsid (NP), the phosphoprotein (P), or the large polymerase protein (L).

20. A method according to claim 18 or 19, further characterized in that it comprises permitting cleavage of the fusion protein of said virus.

21. A method according to any of claims I B to 20, further characterized by co. rende incubating the cell in growth medium comprising proteolytic activity.

22. A method according to claim 21, characterized in that the growth medium comprises allantoic fluid comprising proteolytic activity.

23. A method of conformance with any of the rotations I B through 22, characterized in that the cell '* s derived from a chicken cell.

24. An infectious copy of the avian paramyxovirus, characterized in that it is obtainable by a ccr icity method with any of claims 18 to 23.

25. A vaccine, characterized in that it comprises a virus according to claim 24.

26. A live vaccine according to claim 25.

27. A vaccine according to claim 25 or 26, characterized in that the The infectious copy of the avian paramyxovirus is at least partially derived from a Newcastle disease virus (NDV).

28. A method for distinguishing non-vaccinated animals or animals vaccinated with an NDV vaccine, according to claim 27, from animals infected with wild type -N-DV or vaccinated with an unmodified mesogenic or lentogenic NDV strain, characterized the method 20 because it comprises taking at least one sample from said animal and determining in the sample the presence of antibodies directed against an epitope or immunodominant marker expressed by the wild-type or non-modified NDV, but not by the 25 vaccine. fe ^ -fa-Üá-iS

29. A method according to claim 28, characterized in that the antibodies are directed against the HN or F protein of the NDV.

30. A method according to claim 28 or 29, characterized in that the animal is selected from the group consisting of poultry, preferably chickens.

31. A diagnostic equipment for use in a method according to any of claims 28 to 30. fifteen