MXPA00011560A - Carotenoid ketolase genes and gene products, production of ketocarotenoids and methods of modifying carotenoids using the genes - Google Patents

Abstract

A purified nucleic acid sequence which encodes for a protein having ketolase enzyme activity and has the nucleic acid sequence of SEQ ID NO:1 or 3, or has a sequence which encodes the amino acid sequence of SEQ ID NO:2 or 4, as well as vectors and host cells containing them. Methods of use of the nucleic acid sequences to produce ketocarotenoid in host cells and methods of use of the nucleic acid sequences to modify the production of carotenoids in a host cell are included.

Description

CETOLASA CAROTENOID GENES AND GENE PRODUCTS, PRODUCTION OF CETOCAROTENOIDS AND METHODS TO MODIFY CAROTENOIDS USING THE GENES BACKGROUND OF THE INVENTION Carotenoids are widely distributed natural pigments, responsible for many of the yellow, orange and red colors seen in living organisms. They have important commercial uses as coloring agents in the food industry, as feed and food additives, in cosmetics and as precursors of provitamin A. The plant species Adonis aestivalis produces flowers with dark red and almost black petals at the base of the plants. petals due to the accumulation of ketocarotenoids and other carotenoid pigments. (Neamtu et al., Rev. Roum, Biochim 6: 157, 1969). This pattern of carotenoid accumulation explains the common name of some varieties of these species: summer pheasant eye. Among the carotenoids identified in the petals of the red petal varieties of these various species is the ketocarotenoid astaxanthin (3,3 '-dihydroxy-4,4' -diceto-β, β-carotene, see Figure 1). Other various ketocarotenoids (see Figure 1) including 3-hydroxyquinoline (3-hydroxy-4-keto-β, β-carotene), adonirubin (3-hydroxy-4,4 '-diceto-β, β-carotene), adonixanthin (3, 3 '-dihydroxy-4-keto-β, β-carotene) and isozeaxanthin (4,4' -dihydroxy-β, β-carotene: see TW Goodwin, Carotenoid Biochemistry, volume I. Plants, 2nd edition, 1980, page 147) have also been notified. The last compound is congruent with the speculation that 4-hydroxy can be an intermediate in the formation of the 4-keto group.

SUMMARY OF THE INVENTION There is a great interest in the biological production of carotenoids, in particular the orange ketocarotenoids such as astaxanthin and canthaxanthin (figure 1), and in the modification of the carotenoid composition. For this reason, the cDNA library of a flower A. aestivalis was constructed and classified xespect to the cDNAs that code for enzymes (hereinafter the "ketolases", although the specific biochemical activity has not yet been established) involved in the conversion of b-carotene to orange compounds with absorption properties similar to those exhibited by common ketocarotenoids, such as canthaxanthin (figure 1). Two distinct cDNAs from the Adonis aestivalis were obtained from a number of cDNAs that were selected according to this basis.

Thus, a first aspect of the present invention is a purified nucleic acid sequence that encodes a protein having ketolase enzyme activity and having the nucleic acid sequence SEQ ID NO: 1 or 3. The invention also includes a purified nucleic acid sequence encoding a protein having ketolase enzyme activity and having the amino acid sequence SEQ ID NO: 2 or 4. The invention also includes vectors comprising any portion of the nucleic acid sequences indicated in advance, and host cells transformed with said vectors. Another aspect of the present invention is a method for producing a ketocarotenoid in a host cell; the method comprises: inserting a vector into the host cell comprising a heterologous nucleic acid sequence encoding a protein having ketolase enzyme activity and comprising (1) SEQ ID NO: 1 or 3 or (2) a sequence encoding the amino acid sequence of SEQ ID NO: 2 or 4, wherein the heterologous nucleic acid sequence is operably linked to a promoter; and expressing the heterologous sequence of the nucleic acid, thereby producing the ketolase enzyme.

Another object of the present invention is a method for modifying the production of carotenoids in a host cell, relative to an untransformed host cell; this method comprises: inserting a vector into a host cell which already produces carotenoids and which comprises a heterologous nucleic acid sequence which codes for a protein having ketolase enzyme activity and comprises (1) SEQ ID NO: 1 or 3 or (2) ) a sequence encoding the amino acid sequence of SEQ ID NO: 2 or 4, wherein the heterologous nucleic acid sequence is operably linked to a promoter; and expressing the heterologous nucleic acid sequence in the host cell to modify the production of carotenoids in the host cell, relative to an untransformed host cell.

BRIEF DESCRIPTION OF THE DRAWINGS The invention will be more readily appreciated, as well as many of the concomitant advantages thereof and will be better understood by reference to the following detailed description, when considered in connection with the accompanying drawings. Figure 1 illustrates the biochemical structures and pathways that start from ß-carotene to several of the ketocarotenoids mentioned in the text. The conversion of β-carotene to astanxanthin by an enzyme hydroxylase (Hl) and a ketolase enzyme (keto) can be achieved through any or all of the various possible routes, depending on the order of the reactions. Figure 2 illustrates the β-carotene beta-ring structure and various modifications of this matrix ring that can be produced through the action of the ketolase cDNA products of A. aestivalis. Also shown is the epsilon ring structure, which did not turn out to be a substrate of the ketolases of A. aestivalis and present in the carotenoids, such as d-carotene, e-carotene, a-carotene and lutein. Figure 3 shows the results obtained with the separation in TLC (thin layer chromatography) of the carotenoid pigments extracted from E. coli cultures, previously manipulated to produce β-carotene, but which now also contain ketolase cDNA from A. aestivalis and / or other introduced genes and cDNA. The figure indicates the empty plasmid vector pBluescript SK- (SK-), the ketolase 1 cDNA of Adonis aestivalis in this plasmid vector (Ad keto 1), the ketolase cDNA of Haematococcus pluvialis in this plasmid vector (Hp keto), or the Β-carotene hydroxylase cDNA from Arabidopsis (At Ohase). The bands that were orange are shown here with a darker fill than those of yellow color. The identities of several bands are indicated to the right of the band. Figure 4 shows the spectrum of absorption of one of the orange carotenoids produced from ß-carotene through the action of Adonis ketolases and make clear the similarity of the spectrum with that of canthaxanthin. The absorption spectra (in acetone) of ß-carotene, canthaxanthin and an unknown orange product (orange band # 1: the orange lower band in the first lane of figure 3) extracted from cultures after the introduction of the keto-1 cDNA Adonis aestivalis (SEQ ID NO: 1) in E. coli cells that otherwise produce and accumulate β-carotene. The absorption spectrum of the unknown resembles that of canthaxanthin, but the compound migrates to a position lower than that of echinenone in the RP18 TLC plates developed with a mobile phase of methanol: acetone (1: 1 by volume). The absorption spectrum of orange band # 2 is similar to that of canthaxanthin but migrates more rapidly than canthaxanthin, indicating that it is probably a more polar compound. Figure 5 shows SEQ ID NO: 5 (the sequence shown in this figure includes SEQ ID NO: 1 and also includes some of the flanking DNA of the adapter DNA and the multiple cloning site (SCM) of the cloning vector for the library, whose sequence is shown in bold). Figure 6 shows SEQ ID NO: 6 (the sequence shown in this figure includes SEQ ID NO: 2 and also includes the resulting amino acid translation of the DNA adapter and the multiple cloning site (SCM) of the cloning vector for the library and the start codon of the plasmid vector pTrcHis, whose sequences are shown in bold and with capital letters). Figure 7 shows SEQ ID NO: 7 (the sequence shown in this figure includes SEQ ID NO: 3 and also includes some flanking DNA from the DNA adapter and the multiple cloning sites (SCM) of the cloning vector for the library, whose sequences are shown in bold). Figure 8 shows SEQ ID NO: 8 (the sequence shown in this figure includes SEQ ID NO: 4 and also includes the resulting amino acid translation of the DNA adapter and the multiple cloning site (SCM) of the cloning vector for the library and the start codon from the plasmid vector, whose sequences are shown in bold and with capital letters). Figure 9 shows a gap alignment (Gaps) of the two Adonis ketolase sequences of the invention. This figure shows a truncated version of SEQ ID NO: 1 for comparison purposes, and it is named SEQ ID NO: 9. It is calculated that the identity percentage is 91.107. Figure 10 shows a gap alignment (Gap) of SEQ ID NO: 2 and 4. The following results were obtained: Gap weighting: 12 average correspondence: 2,912 Length weighting: 4 lack of correspondence -2,003 average: Quality: 1440 Length: 307 Index: 4,691 Hollow: 0 Similarity percentage: 92 182 Identity percentage: 90,228 Figure 11 shows a comparison between SEQ ID NO: 2 and the β-carotene hydroxylase enzyme of Arabidopsis thaliana (GenBank U58919) (SEQ ID NO: 10). Figure 12A shows a gDNA (SEQ ID NO: 11) immediately downstream of the cDNA of SEQ ID NO: 3. The sequence was obtained from a PCR product generated using the Genome alker kit from Clontech Laboratories, Inc. (1020 East Meadow Circle, Palo Alto, CA 94303-4230) and specific nested primers for ketolases from Adonis aestivalis (cagaatcggtctgttctattagttettcc (SEQ ID NO: 17) and caatttgaggaatatcaaggttccttfttctc (SEQ ID NO: 18) .The stop codon in the 5 'direction and within the The start codon (TAA at positions 204-206) is shown in bold type The start codon (ATG) is also shown in bold type Figure 12B (SEQ ID NO: 12) indicates that the total length of the polypeptide SEQ ID NO: 4 starts with MAA amino acids (shown in bold) immediately preceding the ketolase sequence shown in Figure 8. A similar sequence of MAA amino acids immediately prior to SEQ ID NO: 1 is also provided. Figure 13 sample to an alignment of the SEQ ID NO: 2, SEQ ID NO: 12, an enzyme of β-carotene hydroxylase (expected product by GenBank U58919) (SEQ ID NO: 13), a putative second hydroxylase from Arabidopsis predicted by the genomic DNA sequence (GenBank AB025606: the exon / intron junctions were selected with reference to the cDNA product U58919 β-carotene hydroxylase of Arabidopsis (SEQ ID NO: 14)), and two β-carotene hydroxylases of Capsicum annuum (products provided by GenBank Y09722 and Y09225) (SEQ ID NO: 15 and 16).

DESCRIPTION OF THE PREFERRED MODALITIES The present invention is directed to a purified nucleic acid sequence encoding a protein having ketolase enzyme activity and having the nucleic acid sequence SEQ ID NO: 1 or 3. The invention also includes a sequence of purified nucleic acid encoding a protein having ketolase enzyme activity and having the sequence SEQ ID NO: 2 or 4. Two closely related but different nucleic acids have been isolated. The sequences of the longest example of each are shown herein. Subsequent sequencing of the genomic DNA in the 5 'direction indicates that SEQ ID NO: 3 lacks the bases to encode the first three amino acids (MAA, see Figure 12). This is probably also the case of SEQ ID NO: 1, but genomic sequences in the 5 'direction have not yet been obtained for this nucleic acid. The two different Adonis ketolases marked in SEQ ID NO: 1 and 3 are similar in sequence, sharing about 91% identity, as determined by the Gap program detailed below (see Figure 9). The predicted amino acid sequences for the enzymes marked in SEQ ID NO: 2 and 4 share about 92% similarity and about 90% identity, also as determined by the Gap program (see Figure 10). Therefore, it is evident that certain modifications of SEQ ID NO: 1 or 3 or SEQ ID NO: 2 or 4 can be carried out without destroying the activity of the enzyme. Note also that it was found that certain truncated versions of the cDNA of SEQ ID NO: 1 or 3 were functional (ie, these cDNAs retained the property of causing the conversion of β-carotene to orange compounds). Likewise, the ß-carotene hydroxylase from Arabidopsis (GenBank U58919), aligned with the ketolase SEQ ID NO: 2 in Figure 11, retains the catalytic function when truncated to produce a polypeptide that lacks the first 129 amino acids (Sun and others, 1996). Therefore, according to the alignment in Figure 11, this would suggest that the two ketolases of the invention retain some catalytic activity after truncation to remove the bases encoding the first 132 amino acids. Thus, the present invention is aimed at including those nucleic acid sequences of ketolase and amino acids in which the substitutions, deletions, additions or other modifications have taken place, as compared to SEQ ID NO: 1 or 3 or SEQ ID NO: 2 or 4, without destroying the activity of the ketolase enzyme. Preferably, the substitutions, deletions, additions or other modifications take place in those positions that already show some dissimilarity between the present sequences. For SEQ ID NO: 1, as shown in Figure 9, these positions are as follows: positions 7, 20, 23, 35, 53, 63, 65, 67, 76, 78, 85, 86, 91, 107, 109-111, 135, 140, 144, 146, 160, 168, 217, 219, 241, 249, 254, 256, 271, 291, 296, 349, 389, 400, 406, 431, 448, 449, 460, 471, 499, 530, 589, 619, 643, 653, 654, 667, 679, 709, 731, 742, 784, 787, 836, 871, 883, 896, 911, 919, 928, 930, 939, 943, 967, 969, 978, 979, 982, 988, 995, 1005, 1006, 1012-1014, 1017, 1019-1021, 1023, 1025, 1049, 1050, 1054, 1060-1068, 1070-1073, 1075, 1094, 1100, 1101, 1106, 1107, 1109 and 1111-1176. For SEQ ID NO: 3, as shown in Figure 9, these positions are as follows: positions 7, 20, 23, 35, 53, 63, 65, 67, 76, 78, 85, 86, 91, 107, 109-111, 135, 140, 144, 146, 160, 168, 217, 219, 241, 249, 254, 256, 271, 291, 296, 349, 389, 400, 406, 431, 448, 449, 460, 471, 499, 530, 589, 619, 643, 653, 654, 567, 679, 709, 731, 742, 784, 787, 836, 871, 883, 896, 911, 919, 928, 930, 939, 943, 966, 967, 970, 979, 980, 983, 989, 996, 1006, 1007, 1013-1015, 1018, 1020-1022, 1024, 1026, 1050, 1051, 1055, 1062-1065, 1067, 1086, 1092, 1093, 1098, 1099, 1101 and 1103-1112. For SEQ ID NO: 2 and 4, as shown in Figure 10, the following amino acids can be substituted or deleted, or additions or other modifications can be made, without destroying the activity of the ketolase enzyme: positions 7, 8, 12, 18, 21, 22, 25, 26, 36, 37, 45, 47-49, 56, 73, 83, 85, 97, 99, 130, 144, 150, 157, 166, 218, 244, 279, 299 and 304. In this way, the present invention is also aimed at covering the amino acid sequences where said changes have been made. In each case, the similarity and identity of the nucleic acid and amino acid sequence is measured using computer programs for sequence analysis, for example, Sequence Analysis, Gap or BestFit computer program packages from the Genetics Computer Group ( Center for Biotechnology, University of Wisconsin, 1710 University Avenue, Madison, Wisconsin 53705), MEGAlign (DNAStar, Inc., 1228 S. Park St., Madison, Winsconsin 53715), or MacVector (Oxford Molecular Group, 2105 S. Bascom Avenue, Suite 200, Campbell, California 95008). Said counting programs use algorithms to equalize similar sequences by assigning degrees of identity to various substitutions, deletions and other modifications, and include detailed instructions regarding useful parameters, etc., so that those skilled in the art can easily compare the similarities and identities of the sequences. An example of a useful algorithm in this regard is the Needleman and Wunsch algorithm, which is used in the Gap program mentioned above. This program finds the alignment of two complete sequences that maximizes the number of correspondences and decreases the number of gaps. Another useful algorithm is the Smith and Waterman algorithm, which is used in the BestFit program mentioned above. This program creates an optimal alignment of the best segment of similarity between two sequences. Optimal alignments are discovered by inserting gaps to maximize the number of correspondences using Smith and Waterman's local homology algorithm. Conservative (ie, similar) substitutions usually include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid, glutamic acid, asparagine and glutamine; serine and threonine; lysine and arginine, and phenylalanine and tyrosine. Substitutions may also be made on the basis of hydrophobicity or hydrophilicity (see Kyte and Doolittle, J. "Mol. Biol. 157: 105-132 (1982), or on the basis of the ability to assume a similar secondary polypeptide structure (cf. Chou and Fasman, Adv. Enzymol 47: 45-148 (1978) If a comparison is made between the nucleotide sequences, preferably the sequence comparison length will be at least 50 nucleotides, more preferably at least less than 60 nucleotides, at least 75 nucleotides or at least 100 nucleotides, it will have superlative preference if comparison is made between the nucleic acid sequences encoding the enzyme coding regions necessary for enzymatic activity. the amino acid sequences, preferably the comparison length will be at least 20 amino acids, more preferably at least 30 amino acids, at least 4 0 amino acids or at least 50 amino acids. It will have superlative preference if the comparison is made between the amino acid sequences in the enzyme coding regions necessary for the enzymatic activity. While the two different Adonis ketolase enzymes of the present invention are similar in sequence, the bacterial β-carotene ketolase enzymes described above (Misawa et al., 1995), cyanobacterials (Fernández González et al., 1997), and green algae (Haematococcus pluvialis: Lotan et al., 1995; Kaj iwara et al., 1995). The ß-carotene ketolase enzymes show little similarity with the Adonis ketolases, although certain histidine motifs and characteristics of the planned secondary structure are common to the polypeptides contemplated by both groups (Cunningham and Gantt, 1998). The present invention also includes vectors containing nucleic acids of the invention. Suitable vectors according to the present invention comprise a gene encoding a ketolase enzyme as described above, wherein the gene is operatively linked to a suitable promoter. Suitable promoters for the vector can be constructed using techniques well known in the art (see, for example, Sambrook et al., Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, Codl Spring Harbor, NY 1080, Ausubel, et al. Current Protocols in Molecular Biology, Green Publishing and Wiley Interscience, New York, 1991). Suitable vectors for eukaryotic expression in plants are described in Fray et al., (1995; Plant J. 8: 693-701) and Misawa et al., (1994; Plant J. 6: 481-489). Suitable vectors for prokaryotic expression include pACYC 184, pUC119 and pBR322 (available from New England BioLabs, Bevery, MA) and pTrcHis (Invitrogen) and pET28 (Novagen) and derivatives thereof. The vectors of the present invention may further contain elements for regulation such as promoters, repressors, selectable markers such as antibiotic resistance genes, etc., whose construction is well known in the art. The genes encoding the ketolase enzymes as described above, when cloned into a suitable expression vector, can be used to overexpress these enzymes in a host cell expression system or to inhibit the expression of these enzymes. For example, a vector containing a gene of the invention can be used to increase the amount of ketocarotenoids in an organism and in this way alter the nutritional, commercial or pharmacological value of the organism. A vector containing a gene of the invention can also be used to modify the production of carotenoids in an organism. Thus, the present invention includes a method for producing a ketocarotenoid in a host cell; this method comprises: inserting a vector into a host cell comprising a heterologous nucleic acid sequence encoding a protein having ketolase enzyme activity and comprising (1) SEQ ID NO: 1 or 3 or (2) a sequence encoding the amino acid sequence of SEQ ID NO: 2 or 4, wherein the heterologous nucleic acid sequence is operatively linked to a promoter; and expressing the heterologous nucleic acid sequence, thus producing the ketocarotenoid. The present invention also includes a method for modifying the production of carotenoids in a host cell, relative to an untransformed host cell; this method comprises the insertion of a vector into a host cell that already produces carotenoids comprising a heterologous nucleic acid sequence encoding a protein having ketolase enzyme activity and comprising (1) SEQ ID NO: 1 or 3 or (2) ) a sequence encoding the amino acid sequence of SEQ ID NO: 2 or 4, wherein the heterologous nucleic acid sequence is operatively linked to a promoter; and expressing the heterologous nucleic acid sequence in the host cell to modify the production of carotenoids in the host cell, relative to an untransformed host cell. The term "modifying production" means that the amount of carotenoids produced can be improved, reduced, or conserved in the same way, if compared to a non-transformed host cell. According to one embodiment of the present invention, the composition of the carotenoids (ie, the type of carotenoids produced) changes in front of each other and this change in composition can result in either a net gain, net loss, or no net change in the amount of carotenoids produced in the cell. According to another embodiment of the present invention, the production or biochemical activity of the carotenoids (or the enzymes that catalyze their formation) is enhanced by the insertion of the nucleic acid encoding the enzyme ketolase. In another embodiment of the invention, the production or biochemical activity of the carotenoids (or the enzymes that catalyze their formation) can be reduced or inhibited by a number of different approaches available to those skilled in the art, including but not limited to limiting, to such methodologies or approaches as antisense (eg, Gray et al., (1992), Plant Mol. Biol. 19: 69-87), ribozymes (ie, Wegener et al. (1994) Mol. Gen. Genet. 1994 Nov 15: 245 (4): 465-470), cosuppression (ie, Fray et al. (1993) Plant Mol. Biol. 22: 589-602), predicted breakage of the gene (eg, Schaefer et al., Plant J. 11: 1195-1206, 1997), intracellular antibodies (for example, see Rondón et al. (1997) Annu. Rev. Microbiol. 51: 257-283) or any other approach based on the knowledge or availability of the nucleic acid sequences of the invention, or the enzymes encoded by means of these. The host systems according to the present invention preferably comprise any organism that is capable of producing carotenoids, or that already produces carotenoids. These organisms include plants, algae, certain bacteria, cyanobacteria and other photosynthetic bacteria. The transformation of these hosts with vectors according to the present invention can be carried out using usual techniques. See, for example, Sambrook et al., Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989; Ausubel et al., Current Protocols in Molecular Biology, Green Publishing and Wiley Interscience, New York, 1991. Alternatively, transgenic organisms can be constructed, which include the nucleic acid sequences of the present invention. The incorporation of these sequences allows controlling the carotenoid biosynthesis, content or composition in the host cell. These transgenic systems can be constructed to incorporate sequences that allow overexpression of the various nucleic acid sequences of the present invention. Transgenic systems can also be constructed to allow under-expression of several nucleic acid sequences of the present invention. Such systems may contain antisense expression of the nucleic acid sequences of the present invention. Said antisense expression would result in the accumulation of the substrates of the enzyme encoded by the sense chain. Once this invention has been described in general, the invention can be better understood by reference to certain specific examples that are provided herein by way of exemplification and are not intended to be limiting, unless otherwise specified.

EXAMPLE 1 Isolation of cDNA from ß-carotene-converting plants into compounds with spectra similar to those of ketocarotenoids A cDNA library of the flower of the plant Adonis aestivalis was introduced into a manipulated Escherichia coli strain to accumulate the yellow carotenoid pigment β-carotene (see Cunningham et al., Plant Cell 8: 1613-26, 1996). This strain of E. coli normally forms yellow colonies when the cultures are spread on a solid agar growth medium. The ketocarotenoids that are derived from β-carotene, such as echinaenone and canthaxanthin (Figure 1) are, by comparison, orange to orange-red in color. The colonies that were orange rather than yellow were selected visually and the DNA sequences of the Adonis aestivalis cDNAs within the plasmid vectors contained in these colonies were assessed. Two different cDNAs were obtained from the analysis of the cDNA inserts in the plasmids obtained from approximately 10 selected colonies. The DNA sequences of these two ketolase cDNAs are shown herein.

The products produced by the ketolases of the invention that have been expressed in a strain of Eschericia coli with accumulation of β-carotene have not yet been identified. As many as 5 or 6 bands of different colors, in addition to the ß-carotene substrate, can easily be discerned by the C 8 8 split in TLC (see Figure 3). In order to provide adequate patterns to aid in identification, an H. pluvialis ketolase and a β-carotene hydroxylase from Arabidopsis were introduced separately into E. coli with accumulation of β-carotene to produce equinenone (3-keto- β, β-carotene) and canthaxanthin (3, 3 '-diceto-β, β-carotene) or β-cryptoxanthin (4-hydroxy-β, β-carotene) and zeaxanthin (4, 4 '-dihydroxy-β, β-carotene). None of the compounds formed in the presence of the ketolases of the invention (no difference was observed in products formed in the presence of two different nucleic acid sequences of the invention) migrated in the TLC system and have the expected absorption spectrum for echinenone. , canthaxanthin, ß-cryptoxanthin or zeaxanthin. Two of the color TLC bands produced in the presence of the Adonis ketolase cDNA are orange. Orange band # 1 has an absorption spectrum similar to that of canthaxanthin (see figure 4) but migrates to a position indicating an intermediate polarity between echinenone and ß-carotene. Orange band # 2 also has an absorption spectrum similar to that of canthaxanthin but migrates to a position indicating an intermediate polarity between canthaxanthin and zeaxanthin (see Figure 3). The absorption spectra and the results of the TLC suggest that the two orange products can be desaturated in the 3-4 positions of both rings (3,4, -didehydro, see figure 2). The orange band # 1 (see Figure 3) can then be 3, 4, 3 ', 4' -tetradehydro-β, β-carotene. To substantially affect the substrate absorption spectrum of β-carotene, it is very likely that any modification involves a carbon that lies in conjugation with the conjugated chain of the carbon-carbon double bonds that make up the chromophore (Goodwin, 1980); The Biochemistry of the Carotenoids, volume 1; 2nd edition, Chapman and Hall). For the spectrum obtained, only the carbons in the number 4 position of the two rings appear to be a plausible location for the modification. However, the multitude and TLC migrations of the yellow and orange products produced by the symmetrical β-carotene also indicate that the enzymes of the invention carry out more than one type of reaction. The apparent homology of the ketolases of the β-carotene hydroxylase invention of the Arabidopsis would suggest that compounds with a hydroxyl at the 3 and / or 4 positions of one or both rings are other possible outcomes (see Figure 2) . In fact, said compounds have been identified in Adonis (see above), and it has long been conjectured that a hydroxyl at position 4 is an intermediate in the formation of 4-keto (for example crustaxan ina, a carotenoid 3, 3 ', 4, 4' -tetrahydroxy which could be astaxanthin precursor in the lobster exoskeleton). The histidine motifs and the secondary structure in common with the enzymes hydroxylase and ketolase are characteristic of a large group of iron oxygenates whose members also include examples of desaturating enzymes (J. Shanklin, 1998, Ann. Rev. Plant Physiol. Mol. Biol.), Thus, a 3-4 desaturation (and / or perhaps a 2-3 desaturation in one or more of the yellow compounds) would also appear to be a plausible result. To summarize the results of this example for the Adonis ketolases of the invention, a number of different carotenoids, including two with spectra similar to the ketocarotenoids, are produced from the β-carotene through the action of the products of either of the two different nucleic acids of the invention. These orange compounds seem to be the most important products. The truncation and fusion of the cDNAs to a stronger promoter in the pTrcHis vector (Invitrogen) was detrimental to the growth of E. coli but resulted in an improved production of the more polar orange product (orange band # 2 in Figure 3). ). The introduction of a cyanobacterial ferredoxin did not change the production or the relative amounts of the different products. Without being subject to the theory, it could be that the ketocarotenoids produced in the petals of the Adonis flower do in fact include orange compounds not yet identified that are produced in E. coli using the nucleic acids of the invention.

EXAMPLE 2 Substrate Specification of Adonis Ketolases Carotenoids with e-rings are common in plants. The e-ring differs from the ß-ring only in the position of the double bond within the ring (figure 2). Ring e is reported to be a deficient substrate for the β-carotene hydroxylase of Arabidopsis (Sun et al., 1996). Adonis ketolase cDNAs were introduced into the manipulated E. coli strains (Cunninghan et al., 1996) to accumulate carotenoids with one or two e-rings (d-carotene and e-carotene), or the acyclic carotenoid lycopene. TLC analysis of the acetone extracts revealed that these carotenoids were not modified by the ketolases of Adonis, as indicated by the lack of the formation of a new product. The products produced in E. coli manipulated to accumulate zeaxanthin (Sun et al., 1996) appeared to be the same as for the cultures that accumulated ß-carotene indicating that a 3 -OH is likely to be one of the functional groups introduced in the ß ring by the ketolases of Adonis. The more polar orange band produced from a β-carotene through the action of the Adonis ketolases (eg, the orange band 2 of Figure 3), therefore, could very well be 3, 3 '-dihydroxy -3,4,3 ', 4' -tetradehydro-β, β-carotene. The references mentioned in the application, together with the following references, are reproduced as if they were inserted in the letter: Bouvier F. et al., (1998) Biosynthesis of xanthophyll: molecular and functional characterization of the carotenoid hydroxylases of the fruits of pepper (Capsicum annuum L.) Biochim Biophys Acta 1391: 320-8 Breitenbach J, and others (1996) Expression in Escherichia coli and properties of the ketolase carotene of Haematococcus pluvialis. FEMS Microbiol. Lett. 140: 241-6 Cunningham FX Jr. Gantt E. (1998) Genes and enzymes of carotenoid biosynthesis in plants. Ann Rev Plant Physiol Plant Mol Biol 49: 557-583 Fernandez Gonzalez B, et al. (1997) A new type of ketolase beta-carotene is required which acts asymmetrically for the synthesis of equinenone in the sinecoquistis of the cyanobacterium. Sp. PCC 6803 J. Biol Chem 272: 9728-33 Fraser PD, et al. (1997) characterization in vi tro of biosynthetic astaxanthin enzymes. J. Biol Chem 1997272: 6128-35 Fraser PD, et al. (1998) Enzymatic confirmation of the reactions involved in the routes for the formation of astaxanthin, explained use of a direct substrate in in vitro testing. Eur J. Biochem, 252.229-36 Harker M, et al. (1997) Biosynthesis of ketocarotenoids in transgenic cyanobacteria expressing the alga gene for beta-C-4-oxygenase, crtO, FEBS Lett 404: 129-34 Kajiwara S. and others (1995) Isolation and functional identification of a new cDNA for the biosynthesis of astaxanthin from Haematococcus pluvialis, and synthesis of astaxanthin in Escherichia coli. Plant Mol Biol 29: 343-52 Lotant T, et al. (1995) Cloning and expression in Escherichia coli of the gene encoding beta-C-4-oxygenase, which converts beta-carotene to canthaxanthin ketacarotenoid in Haematococcus pluvialis. FEBS Lett. 354: 125-8 Misawa N, et al. (1995) Biosynthesis of canthaxanthin by the conversion of methylene to keto groups into a beta-carotene hydrocarbon by a single gene. Biochem Biophys Res Commun. 209: 867-76 Misawa N, et al. (1995) Structure and functional analysis of the biosynthesis of the gene group of a marine bacterial carotenoid and a biosynthetic pathway of astaxanthin proposed at the gene level. J Bacteriol. 177: 6575-84 Miura Y, et al. (1998) Production of lycopene, beta-carotene and astaxanthin carotenoids in dietary yeast Candida utilis. Appl Environ Microbiol. 84: 1226-9 Shanklin J, et al. (1997) Mossbauer studies of omega-hydroxylase alkane: test for digestion in an integral membrane enzyme. Proc Nati Acad Sci USA 94: 2981-6 Shanklin J. Cahoon EB (1998) Denaturation and related modifications of fatty acids. Ann Rev Plant Physiol Plant Mol Biol 49: 611-641 Wang CW, and others. Isoprenoid manipulated pathways improves the production of astaxanthin in Escherichia coli. Biotechnol Bioeng. 1999 Jan 20: 62 (2): 235-41.

Claims (20)

1. CLAIMS: 1. A method for producing ketocarotenoids in a host cell, comprising: inserting a vector into a host cell comprising a heterologous nucleic acid sequence encoding a protein having ketolase enzyme activity and having the nucleic acid sequence SEQ ID NO: 1 or 3, wherein the heterologous nucleic acid sequence is operatively linked to a promoter; and expressing the heterologous nucleic acid sequence, thereby producing the ketocarotenoid. The method of claim 1, wherein the host cell is selected from the group consisting of a bacterial cell, an algal cell and a plant cell. 3. A method for producing ketocarotenoids in a host cell, comprising inserting a vector into a host cell comprising a heterologous nucleic acid sequence encoding a protein having ketolase enzyme activity and having a sequence encoding the amino acid sequence SEQ ID NO: 2 or 4, wherein the heterologous nucleic acid sequence is operatively linked to a promoter; and expressing the heterologous nucleic acid sequence, thereby producing the ketocarotenoid. 4. The method of claim 3, wherein the host cell is selected from the group consisting of a bacterial cell, an algal cell and a plant cell. 5. A method for modifying the production of carotenoids in a host cell, relative to an untransformed host cell; the method comprises: inserting a vector into a host cell that already produces carotenoids comprising a heterologous nucleic acid sequence encoding a protein having ketolase enzyme activity and having a nucleic acid sequence SEQ ID NO: 1 or 3, in wherein the heterologous nucleic acid sequence is operatively linked to a promoter; and expressing the heterologous nucleic acid sequence in a host cell to modify the production of carotenoids in the host cell, relative to an untransformed host cell. The method of claim 5, wherein the host cell is selected from a group consisting of a bacterial cell, an algal cell and a plant cell. 7. A method for modifying the production of carotenoids in a host cell, relative to an untransformed host cell; the method comprises: inserting a vector into a host cell that already produces carotenoids comprising a heterologous nucleic acid sequence encoding a protein having ketolase enzyme activity and having a sequence encoding the amino acid sequence SEQ ID NO: 2 or 4, wherein the heterologous nucleic acid sequence is operatively linked to a promoter; and expressing the heterologous nucleic acid sequence in the host cell to modify the production of the carotenoids in the host cell, relative to an untransformed host cell. The method of claim 7, wherein the host cell is selected from a group consisting of a bacterial cell, an algal cell and a plant cell. 9. A purified nucleic acid sequence encoding a protein having ketolase enzyme activity and having the nucleic acid sequence SEQ ID NO: 1. 10. A purified nucleic acid sequence encoding a protein having enzyme activity ketolase and has the nucleic acid sequence SEQ ID NO: 3. 11. A purified nucleic acid sequence encoding a protein having ketolase enzyme activity and having the nucleic acid sequence SEQ ID NO: 2. 12. A sequence of purified nucleic acid encoding a protein having ketolase enzyme activity and having the nucleic acid sequence SEQ ID N0: 4. 13. A vector comprising the nucleic acid sequence of any of claims 9 to 12, wherein the nucleic acid sequence is operably linked to a promoter. 14. A host cell that is transformed with the vector of claim 13. 15. The host cell of claim 14, wherein the host cell is selected from a group consisting of a bacterial cell, an algae cell and a plant cell. 16. The host cell of claim 14, wherein the host cell is a photosynthetic cell. 17. The host cell of claim 14, wherein the host cell contains a ketocarotenoid. 18. The host cell of claim 14, wherein the host cell contains modified levels of carotenoids, relative to an untransformed host cell. 19. A purified ketolase enzyme, encoded by the amino acid sequence SEQ ID NO: 2. 20. A purified ketolase enzyme, encoded by the amino acid sequence SEQ ID NO: 4.