MXPA00011494A

MXPA00011494A - Transgenic plants producing a pap ii protein

Info

Publication number: MXPA00011494A
Application number: MXPA/A/2000/011494A
Authority: MX
Inventors: Nilgun E Tumer; Pinger Wang
Original assignee: Rutgers The State University; Nilgun E Tumer; Pinger Wang
Priority date: 1998-05-22
Filing date: 2000-11-22
Publication date: 2001-11-21

Abstract

Disclosed are recombinant plant cells, plant cell parts, plant parts and transgenic plants containing a DNA molecule comprising a sequence encoding a Pokeweed Antiviral Protein (PAP) II protein. PAP II proteins include full length, wild-type PAP II and substantially nontoxic mutants or analogs including fragments thereof truncated at the C-terminus and other PAP II proteins having an intact catalytic active site amino acid residue E172 but that also have at least one amino acid substitution or deletion, and possess anti-viral and/or anti-fungal activity. DNA molecules comprising sequences encoding the mutants or analogs, as well as the isolated and purified PAP II proteins per se, are also disclosed. Methods of identifying nontoxic PAP II mutants are further disclosed. Transgenic plants that produce a PAP II protein exhibit anti-viral and/or anti-fungal activity. Virtually all flowering plants are included. Seed derived from the transgenic plants are also provided.

Description

TRANSGENIC PLANTS THAT PRODUCE A PAP II PROTEIN GOVERNMENT SUPPORT The work in the invention described herein was supported in part by the National Science Foundation Grant No. 96-31 308. Therefore, the Government may have certain rights in the invention.

TECHNICAL FIELD This invention relates generally to agricultural biotechnology, and more specifically to methods and genetic materials for conferring resistance to viruses and / or fungi in plants.

BACKGROUND OF THE INVENTION Many commercially valuable agricultural crops are prone to infection by plant viruses. These viruses are capable of causing significant damage to a crop in a given season, and in this way can drastically reduce its economic value. The reduction in economic value for the farmer in turn results in a higher cost of goods for the final buyers. Several published studies have addressed the expression of the capsid proteins of the plant virus in a plant in an effort to confer virus resistance. See, for example, Abel, e al. , Science 232: 738-743 (1986); Cuozzo, e. Al., Bio / Technology 6: 549-557 (1988); Hemenway, et al., EMO J. 7: 1273-1280 (1988); Stark, ee al., ítiíflfef eIF ^^^ "* ^^ • Bio / Technology 7: 1257-1262 (1989) and Lawson ei al, Bio / Technology 8: 1 27-1 34 (1 990) However, plants.. transgenic show resistance only to the homologous virus and related virus, and no virus unrelated Kawchuk I ef al Mol Plant-Microbe Interactions 3 (5 / "... 301 -307 (1990), describes the expression of protein gene of wild type potato leaf curl virus (PLRV) coating in potato plants Although the infected plants showed resistance to PLRV, all transgenic plants that were inoculated with PLRV were infected with the virus and thus allowed the virus transmission continues so that the high resistance levels could not be expected See US Patent 5,304,730 Lodge of the Proc Natl Acad Ei Sci. USA 90:...... 7089-7093 (1993) report mediated transformation Agrobacterium tumefaciens of tobacco with an antiviral protein of carmine grass type wild type (PAP) that encodes cDNA and the resistance of transgenic tobacco plants to unrelated viruses. PAP is a protein that inhibits the ribosome (RIP) Type 1, found in the cell walls of Phytolacca americana (carmine grass). It is a unique polypeptide chain that catalytically removes a specific adenine residue from a highly conserved stem wave structure in the 28S rRNA of eukaryotic ribosomes, thereby interfering with the binding of the Elongation Factor-2 and blocking the synthesis of cellular protein. See, for example, Irvin went to. Pharmac. Ther. 55: 279-302 (1992); I am going to al. , Biophys. Res. Comm. 750: 1 032-1036 (1998); - "AA ^ Aa- • ^ J ^ ** >? **** ¡i ^ and Hartley, et al., FEBS Lett.290: 65-68 (1991). Acute contrast with previous studies reporting that transgenic plants expressing a viral gene were resistant to that virus and closely related virus only See also Beachy et al., Ann. Rev. Phytopathol 28: 451-474 (1990); ..... and Golemboski, ef al, Proc Natl Acad Sci USA 87: 631 1 -6315 (1990) Lodge also reported, however, that plants snuff expressing PAP (ie, above 1 0 ng. / mg of protein) tend to have a mottled, stunted phenotype and that other transgenic tobacco plants that accumulated the highest levels of PAP were sterile.There remains, therefore, a need for a means by which resistance to the virus is conferred. from broad spectrum to plants, which solves the problems associated with known methods, and particularly that would require a minimum number of and transgenes, the expression of which would not cause sterility or death of the plant cell.

SUMMARY OF THE INVENTION A first aspect of the present invention is directed to a recombinant plant cell or part thereof, for example, a protoplast, containing a DNA molecule comprising a sequence encoding a PAP II protein. PAP II proteins, include full-length wild type PAP II, fragments of which are truncated at term C and other analogs and mutants that have at least one deletion or amino acid substitution, but which have an amino acid residue on site catalytic active, intact E 1 72. PAP II proteins confer anti-viral and / or anti-fungal properties to plants. DNA molecules comprising 5 sequences encoding fragments and mutants or analogs, as well as purified PAP II proteins isolated per se, are also provided. Another aspect of the present invention is directed to transgenic plants that produce a PAP II protein, and shows activity anti-viral and / or anti-fungal. The parts of the plant, for example, leaves, stems and rods, which contain a DNA molecule comprising a sequence encoding a PAP II protein; from which whole plants expressing DNA can be regenerated, they are also provided. Virtually all plants are included that bloom. Seed derived from transgenic plants is also provided. A further aspect of the present invention is directed to a method for identifying PAP II proteins that have substantially no toxicity (eg, phytotoxicity). The method results in providing a transformed eukaryotic cell, transformed with a DNA molecule encoding the mutagenized PAP II protein. The transformed cell is grown in a medium containing an inducer to cause expression of the DNA molecule. The toxicity of the PAP II protein encoded by the DNA is determined if the cell culture survives in the presence of the PAP I I protein.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a graph showing the susceptibility of transgenic plants expressing PAP II for Rhizoctonia solani; and Figure 2 is a bar graph showing the levels of salicylic acid in Samsun cv N. Tabacum plants expressing PAP II and in untransformed plants.

BEST MODE FOR CARRYING OUT THE INVENTION Transgenic plants expressing DNAs encoding PAP II protein show anti-viral and / or antifungal activities with substantially reduced phytotoxicity compared to transgenic plants that produce PAP ("PAP I"). Thus, transgenic plants expressing a heterologous PAP II DNA show a fertile and normal phenotype as opposed to the mottled, squat phenotype characteristic of transgenic plants that produce mature PAP, particularly at relatively high levels (as described in Lodge et al. al., Proc. Nati, Acad. Sci. USA 90: 7089-7093 (1 993)). By "wild-type PAP" is meant the amino acid sequence of PAP 1 -262, the N-terminal signal peptide of 22 amino acids ("the N-terminal signal sequence of wild-type PAP") and the extension of the C-terminal of 29 amino acids (amino acids listed 263-291), all illustrated in Table 1 below as SEQ. ID. NO: 2 The nucleotide sequence corresponding is established as SEQ. ID. NO: 1. Thus, by the terms "mature PAP, wild type", or "mature PAP", the amino acid sequence of PAP 1 -262 shown in Table 1 is included. TABLE 1 5'CTATGAAGTCGGGTCAAAGCATATACAGGCTATGCATTGTTAGAAACATTGATGCCTCTGATCC CGATAAACAATACAAATTAGACAATAAGATGACATACAAGTACCTAAACTGTGTATGGGGGAGT GAAACCTCAGCTGCTAAAAAAACGTTGTAAGAAAAAAAGAAAGTTGTGAGTTAACTACAGGGCG AAAGTATTGGAACT AGCTAGTAGGAAGGGAAG ATG AAG TCG ATG CTT GTG GTG ACA ATA TCA ATA Met Lys Ser Met Leu Val Val Thr He Ser He (67) TGG CTC ATT CTT GCA CCA ACT TCA ACT TGG GCT GTG AAT ATÁ ATC ATT 10 Trp Leu He Leu Ala Pro Thr Ser Thr Trp Wing Val Asn Thr I lie Tyr (1) (100) AAT GTT GGA AGT ACC ACC ATC AGC AAA TAC GCC ACT TTT CTG AAT GAT CTT Asn Val Gly Ser Thr Thr lie Ser Lys Tyr Wing Thr Phe Leu Asn Asp Leu (10) (20) CGT AAT GAA GCG AAA GAT CCA AGT TTA AAA TGC TAT GGA ATA CCA ATG CTG Arg Asn Glu Ala Lys Asp Pro Ser Leu Lys Cys Tyr Gly He Pro Met Leu (30) (40) 15 CCC AAT ACÁ AAT ACÁ AAT CCA AAG TAC GTG TTG GTT GAG CTC CAA GGT TCA Pro Asn Thr Asn Thr Asn Pro Lys Tyr Val Leu Val Glu Leu Gln Gly Ser (50) AAT AAA AAA ACC ATC ACÁ CTA ATG CTG AGA CGA AAC AAT TTG TAT GTG ATG Asn Lys Lys Thr He Thr Leu Met Leu Arg Arg Asn Asn Leu Tyr Val Met (60) (70) GGT TAT TCT GAT CCC TTT GAA ACC AAT AAA TGT CGT TAC CAT ATC TTT AAT Gly Tyr Ser Asp Pro Phe Glu Thr Asn Lys Cys Arg Tyr His He Phe Asn (8 0) (90) GAT ATC TCA GGT ACT GAA CGC CAA GAT GTA GAG ACT ACT CTT TGC CCA AAT 20 Asp He Ser Gly Thr Glu Arg Gln Asp Val Glu Thr Thr Leu Cys Pro Asn (100) GCC AAT TCT GTT AGT AAA AAC ATA AIT TIT GAT AGT CGA TAT CCA ACA Wing Asn Ser Arg Val Ser Lys Asn He Asn Phe Asp Ser Arg Tyr Pro Thr (110) (120) TTG GAA TCA AAA GCG GGA GTA AAA TCA AGA AGT CAG GTC CAA CTG GGA ATT Leu Glu Ser Lys Wing Gly Val Lys Ser Arg Ser Gln Val Gln Leu Gly He (130) (140) CAA ATA CTC GAC AGT AAT ATT GGA AAG ATT TCT GGA GTG ATG TCA TTC ACT Gln He Leu Asp Ser Asn He Gly Lys He Ser Gly Val Met Ser Phe Thr 25 (150) ^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^ s ^^^^^^^^^^^^^ s ^^^^^ s ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ Val Ala He Gln Met Val Ser Glu (160) (170) GCA GCA AGA TTC AAG TAC ATA GAG AAT CAG GTG AAA ACT AAT TTT AAC AGA Wing Wing Arg Phe Lys Tyr He Glu Asn Gln Val Lys Thr Asn Phe Asn Arg (180 ) (190) GCA TTC AAC CCT AAT CCC AAA GTA CTT AAT TTG CAA GAG HERE TGG GGT AAG Wing Phe Asn Pro Asn Pro Lys Val Leu Asn Leu Gln Glu Thr Trp Gly Lys (200) (210) ATT TCA ACA GCA ATT CAT GAT GCC AAG AAT GGA GTT TTA CCC AAA CCT CTC He Ser Thr Ala He His Asp Ala Lys Asn Gly Val Leu Pro Lys Pro Leu (220) GAG CTA GTG GAT GCC AGT GGT GCC AAG TGG ATA GTG TTG AGA GTG GAT GAA Glu Leu Val Asp Wing Ser Gly Wing Lys Trp He Val Leu Arg Val Asp Glu (230) (240) ATC AAG CCT GAT GTA GCA CTC TTA AAC TAC GTT GGT GGG AGC TGT CAG ACÁ He Lys Pro Asp Val Ala Leu Leu Asn Tyr Val Gly Gly Ser Cys Gln Thr (250) (260) ACT TAT AAC CAA AAT GCC ATG TTT CCT CAA CTT ATA ATG TCT ACT TAT TAT Thr Tyr Asn Gln Asn Wing Met Phe Pro Gln Leu He Met Ser Thr Tyr Tyr (262) (270) AAT TAC ATG GTT AAT CTT GGT GAT CTA TTT GAA GGA TTC TGATCATAAACA Asn Tyr Met Val Asn Leu Gly Asp Leu Phe Glu Gly Phe (SEQ ID NO: 2) (280) (290) TAATAAGGAGTATATATATATTACTCCAACTATATTATAAAGCTTAAATAAGAGGCCGTGTTAAT TAGTACTTGTTGCCTTTTGCTTTATGGTGTTGTTTATTATGCCTTGTATGCTTGTAATATTATCTAG AGAACAAGATGTACTGTGTAATAGTCTTGTTTGAAATAAAACTTCCAATTATGATGCAAAAAAAA AAAAAAA3 '(SEQ ID NO: 1) Table 1 also shows flanking sequences uncoded 5' and 3 '. After expression in eukaryotic cells, the N-terminal 22 amino acid sequence of wild type PAP is co-translationally segmented, yielding a polypeptide having a molecular weight of approximately 32 kD, which is then processed by cleaving the 29 amino acids terminal C ("the C-type extension of wild-type PAP" or "PAP (263-292")), producing a mature wild-type PAP (hereinafter, "PAP (1 -262)") (ie , which is isolated from the leaves of Phytolacca americana), having a molecular weight of approximately 29 kD.

A ^ .iJ ^, ^ - ^ ^ _, .-. , -,,. . - ..., - * ^ »**** ^^^ ... ^ See Irvin, e al., Pharmac. Ther. 55: 279-302 (1992); Dore, e to al. , Nuc. Acids Res. 27 (18): 4200-4205 (1992); Monzingo ei al., J. Mol. Biol. 233: 705-715 (1993); and Turner, e to al., Proc. Nati Acad. Sci. USA 92: 8448-8452 (1995). The term "PAP-M protein" means including the "immature" wild-type polypeptide of 31 0 amino acids described in Poyet, et al. , FEBS Letters 247: 268-272 (1994) and amino acid residues 26-31 0 containing polypeptide of 285 amino acids of the immature polypeptide (ie, "PAP II (1 -285)" or mature PAP II "including the signal sequence of twenty-five N-terminal amino acids.) The nucleotide sequence and the corresponding amino acid sequence of wild-type PAP II are set forth in Table 2. They are indicated as SEQ ID NOS: 3 and 4, respectively.

TABLE 2 PAPII ATGAAGATOftAGOTGTTAC5MGTAGrr3GGTTGGCAATATC ATATGGCrGATGC ^ 55 + + + + + + H4 TACTTCTACTTCCAC ^ TCTTCATCAACCCAAaxn ^^ M K M K V L E V V G A I S I W L M L T CCACCAOCTTCrTC3U CATAQTCTrtr0ACsrTGAt3A TQC ^ + + + + 115 + + 174 175 + PPASSNIVFDVENATPETYS GGTOGTCGAAGAACTmGTATCACAAACTGCAACTCre ^^ + -? + + + - + 234 TTAAAAGACTGATC AAOGCTCOTCQACACTTTCTCy ^ ^ NFLTSLREAVKDKKLTCHGM 10 ATAATOGCCAC CCCTCACTOAAa ATGTGTTGGTTGACCTa G ^ CCO 235 + + + +??? ? + + 294 TATTACCGCTGTTaSGAGTGACTTGTTGGGTTt TACACAACCAACTQGA IMATTTEQPKYV 1. I. KFG TCTOQAACATTCACATTAGOATCAGAAGGGGAAACTrATATTTGGAßaQC VD + + + + 295 + + + 354 AGACCTTGTJ GTGTAATCGTTAGTCrtCCCCTTTOAA SGTFTLAIRRGN l, AND I. BGYSD ATTTACAATaaAAAATGTraTTATCGOAT 15 < _TratóGGA ^ 355 + + + + + + 4 TAAATCTTACCTrTTACAGCA? TAaCXrrAGAAGp ^ X Y N G K C R Y R X F K D S B S D A Q E ACCOTTTGCCCCGGGOACAAAAGC ^ VAsCCTGGCACTCAaAATAATATCCCCTATaAAAAa 415 + + + + + + 474 TGGCAAACGGGGCCCCTGTTTT < XTTaK3ACCX? TGAGTCTrrATTAT 20 T V C P G D K S K P G T Q N N I P Y E K AaTTAa? VAGGGATGGAATCAAAGGGTGGGGCTAGAACTAAATTAGGGTTAGGAAAGATA 475 + + - + + + + 534 ta? TsttrccCTACcttAGitrcca? Cccx ^ S Y K G M E S K G G A R T K G L G K I ACACGCAAGAGTCGAATGGC? GAAAATCTACGG? AAX3ATGCAACGGATCAGAAGCAGTAT 535 + + + + + + 594 25 T I. TGTGAQTTCTCAQCTTACCCATTrTAQATGCCXlTTCCTACX3TTGC rAaTCTTCGTCATA? fi »M ß? t? H.H ? A T i »o? n? ^^^^^^^^! ^^^^^^^^^^^^^^^? ^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^ ?? ^^^^^^^ - CAAAA? AATGAGGCTGAATTO2 rmT? < X: a ^^ 595 + + .. - .-. + - * .-. + + 654 < n TTr rACTCaSACTTAAAGA? Q ?? AT < ^ Q K N E A E F L? A V Q M V T E? MR TTCAAATACArrG? G /? AUlAGTFU ^ CTAA ^ 655 + + - + + + + 714 AAGTTTATGTAACTCTK? TCACTGCCC-ATTTAAACTACGACG ^ F K Y I E N K V K A K F D D A N G Y Q P GATCCTAAAGCTATTTCCCTAGAGAAAAATTG < K "" TGTTTCTAAGSTCATTGCAAAA 715 + + + + + + 77 CTAWSATTTCGATAAAQGGATCTCTTTTTAACC ^ D P K A I S L B K N W D S V S K V I A K Srt "K" CCTCO »3TCATAGTACTGTTACTTTAC ^^ 775 + + + + + + 834 10 CAACCGTGGAGGCCACTATC TGACAATGAAATGGACCTCTGGATTTTCTA G V Q T S G D S T V T L P G D L K D E H N AAASN * GGC3ACTAOGGCCACCATGAAC <?; ??? ^ CCGTAAGAACGACATTATGGCAC ^ 835 + + + • + + + 894 TTTGGAACCTX »TGCCssTGOT CTTGCIX3 ^ K P M T T A T M N D L K N D I N L L T 15 CACGTTACTTGCAAGGTTAAAAOTTCCAT TTCCCI AAATTATGTCCTATTATTATAGG 895 + - • + + - + + ~ _ ~ + 954 GTGCAATGAACKTTCCAATrTTaU ^ GGTAC3UiQsGACTTrAATACA0GATAATAATAT H V T C K V K S S M F P E I M S Y Y Y R ACTAGTATTAGTAACCTTGGTGAATTCGAGTGAT 955 + + + 988 TGATCATAATCATTGGAACCACrrAAGCTCACTA (SEQ ID H0: 3) TSISNLGEFE * - (SEO ID NO: 4) 20 The term "protein PAP II" also means include mutants or analogs of the polypeptide wildtype such as fragments (e.g., deleted from terminal C) and deleted and / or amino acid substitutions. The non-wild type polypeptides contain the amino acid residue E172 wild type (see, Poyet, ei al., Biochem, Biophys. Res. Comm. 259: 582-587 (1998)) and substantially has PAP II properties as described herein. Without attempting to join any theory of operation, the Applicants believe that this amino acid residue is necessary for anti-viral and / or anti-fungal activity. The PAP II proteins wildtype preferred include PAP II (1 -285, G72D), PAP II (1 -285, L254R), PAP II (1 -285, L254A), PAP II (1 -237), PAP II ( 1 -238), PAP II (1 -239), PAP II (1 -240), PAP II (1 -241), PAP II (1 -242), PAP II (1 -243), PAP II (1 - 244), PAP II (1 -245), PAP II (1 -246), PAP II (1 -247), PAP II (1 -248), PAP II (1 -249), PAP II (1 -250), PAP II (1 -251), PAP II (1 -252), PAP II (1 -253), PAP II ( 1 -254), PAP II (1 -255), PAP II (1 -256), PAP II (1 -257), PAP II (1 -258) and PAP II (1 -259). PAP II proteins can be prepared by preparing hosts with the DNAs, culturing the transformed hosts, and isolating the expression product, all in accordance with standard techniques. Figure 2 of Poyet e al. (1998) illustrates that the amino acid sequences PAP and PAP II share 33% sequence similarity. The Requesters have shown that 41% sequence similarity. However, there is much greater similarity between the sites actives of these respective polypeptides. That is to say, the active sites are conserved substantially. In this way, it could have been expected that the PAP II cytotoxicity was approximately equal to that of PAP, despite the lack of total sequence similarity. PAP II shows anti-viral activity. The expression of a PAP II protein in a transgenic plant confers resistance to the virus broad spectrum, ie, resistance to or the ability to suppress infection by a number of unrelated viruses, including but not limited to RNA viruses, for example, potexvirus such as (PVX, potato virus X), potyvirus (PVY ), virus cucumber mosaic (CMV), mosaic virus snuff (TMV), dwarf virus yellow barley (BYDV), mosaic virus wheat line, curl potato leaf (PLRV) virus, plumpox, melon mosaic virus, zucchini yellow mosaic virus, papaya ring virus, yellow beet virus, soybean seed dwarf virus, carrot leaf read virus and plant DNA viruses such as abnormal yellow leafy tomato lupine virus. See also Lodge, e al. , supra. , Tomlinson, et al., J. Gen, Virol. 22: 225-232 (1 974) and Chen, ei al., Plant Pathol. 40: 612-620 (1991). PAP II also shows anti-fungal activity. PAP II proteins confer fungal broad-spectrum resistance to plants. PAP II provides increased resistance to diseases caused by plant fungi, including those caused by Phytium (one of the causes of seed rot, rot of nurseries and root rot), Phytophthora (the cause of late potato wilt and of root rot, and wilting of many other plants), Bremia, Peronospora, Plasmopara, Pseudoperonospora and Sclerospora (which causes mildew), Erysiphe graminis (which causes white bad of cereals and fats), Verticillium (which causes wilting '^ ki ^ e? ^^ ?? *, ^^ .- "tja ^^^ .... ^^,., .. vascular plants, flowers, crop plants and trees), Rhizoctonia (which causes the disease rot of many plants and coffee planting disease of grasses for lawns), Fusarium (which causes bean root rot, dry potato rot ), Cochliobolus (which causes rotting of the foot and root, and also wilt of cereals and fats), Giberella (which causes wilting of seedlings and foot, or rotting of the petiole of corn and small grains), Gaeumannomyces (which causes the disease of white heads and take all of the cereals), Schlerotinia (which causes crown rot and wilting of flowers and vegetables and grass dollar spot disease for lawns), Puccinia (which causes rotting of the wheat stem and other small grains ), Ustilago (which causes corn blight), Magnaporthae (which causes the summer planting of herbs for lawns) and Schierotium (which causes the southern wilting of herbs for cépedes) guests). Other important fungal diseases include those caused by Cercospora, Septoria, Mycosphoerella, Glomerella, Colletotrichum, Helminthosporium, Alterneria, Botrytis, Cladosporium and Aspergillus. The Applicants believe that PAP II proteins confer increased resistance to other plant pests including insects, bacteria and nematodes. Important bacterial diseases to which PAP II imparts increased resistance include those caused by Pseudomonas, Xanthomonas, Erwinia, Clavibacter and Streptomyces. ^^^^^^^^^^^^^^^^^ > ^^^^^^ gÉ ^^^^^^ j ^^^ g |! ^^^^^ | DNAs encoding PAP II proteins can be synthesized according to standard techniques. See Ausubel et al (eds.), Vol. 1, Chap. 8 in Current Protocols in Molecular Biology, Wiley, NY (1990). DNAs can also be prepared through PCR techniques. See PCR Protocols, Innis, et al. (eds.), Academic Press, San Diego, CA (1990). The PAP II DNA (e.g., a cDNA) is preferably inserted into a plant transformation vector in the form of an expression cassette containing all the elements necessary for the transformation of plant cells. The expression cassette typically contains, in an appropriate reading structure, a functional promoter in plant cells, a 5 'untranslated guiding sequence, mutant PAP DNA, and a 3' untranslated functional region in plants to cause the addition of polyadenylated nucleotides at the 3 'end of the RNA sequence. Functional promoters in plant cells can be obtained from a variety of sources such as plants or plant DNA viruses. The selection of a promoter used in the expression cassettes will determine the pattern of temporal and spatial expression of the construction in the transgenic plant. The selected promoters may have constitutive activity and these include the CaMV 35S promoter, the actin promoter (McEIroy, et al., Plant Cell 2: 1 63-1 71 (1990); McEIroy, et al., Mol. Gen. Genet 237: 150-160 (1991); Chibbar, et al., Plant Cell Rep. 72: 506-509 (1993), and the ubiquitin promoter (Binet, et al., Plant Science 79: 87-94 (1991), Christensen, et al., Plant Mol Biol. 72: 619-632 (1989); Taylor, e al. ^ ñ ^^ S ^ ^ ^ * m ^ Sm Plant Mol. Biol 22: 573-588 (1993), Logemman, et al. Plant CeU 7: 1 51-1 58 (1989), Rohrmeier, et al., Plant Mol. Biol. 22: 783-792 (1 993), Firek, ei al. , Plant Mol. Biol. 22: 129-142 (1993), Warener, et al. , Plant J. 3: 1 91-201 (1 993)) and thus lead to the expression of the mutant PAP gene at the wound or pathogen infection sites. Other successful promoters are expressed in specific cell types (such as epidermal leaf cells, meosophil cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example). Patent publication WO 93/07278, for example, describes the isolation of the maize trpA gene which is preferentially expressed in marrow cells. Hudspeth, to the. , Plant Mol. Biol. 72: 579-589 (1989), describes a promoter derived from the maize gene encoding phosphoenolpyruvate carboxylase (PEPC) that directs expression in a leaf-specific manner. Alternatively, the selected promoter can drive the expression of the gene under a temporary or light-induced regulatory promoter. An additional alternative is that the selected promoter is chemically regulated. A variety of transcriptional polyadenylation and cleavage sites are available for use in expression cassettes. These are responsible for the correct processing (formation) of the 3 'end of mRNAs. Suitable transcriptional polyadenylation and segmentation sites known to work in plants include the CaMV 35S polyadenylation and segmentation sites, the polyadenylation and segmentation sites ,,. ^., 8 ^ ~ ^ ~? ~~ ^ -.... "-" - - ^, - A..Í? ^ SÜ £ ^^, ", .. - ,, ..,«, * .,, ^. i ". ^ > ^ > ... ^. ^ .... ",. ^^ .. ^, ~ ..» - ^ - tml, polyadenylation and segmentation sites of nopaline synthase, polyadenylation sites and segmentation E9 rbcS of pea. These can be used in both monocotyledons and dicotyledons. It has been found that numerous sequences increase the expression of the gene from within the transcriptional unit and these sequences can be used in conjunction with the genes of this invention to increase their expression in transgenic plants. It has been shown that several intron sequences increase expression, particularly in monocotyledonous cells. For example, it has been discovered that the introns of the maize Adh 1 gene significantly increase the expression of the wild type gene under its analogous promoter when introduced into maize cells. Intron 1 has been found to be particularly effective and increases expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis, et al., Genes Develop 7: 1 1 83-1 200 (1987) .In the same experimental system, the intron of the maize bronze-l gene had a similar effect to increase expression (Callis, et al., supra.) Intron sequences have been incorporated in a Routinely in plant transformation vectors, typically within the untranslated guide. A number of untranslated leader sequences derived from viruses are also known to increase expression, and these are particularly effective in dicotyledonous cells. Specifically, it has been shown that the leader sequences of Virus of Tobacco Mosaic (TMV, the "O-sequence"), Chlorotic Corn Stain Virus (MCMV), and Alfalfa Mosaic Virus (AMV) are effective in increasing expression (for example, Gallie et al., Nucí. Acids Res. 75: 8693-871 1 (1987); Skuzeski, et al., Plant Mol. Biol. 75: 65-79 (1990)). Numerous transformation vectors are available for plant transformation, and the genes of this invention can be used in conjunction with any such vector. The selection of the vector to be used will depend on the preferred transformation technique and the target species for the transformation. For certain target species, different herbicide or antibiotic selection markers may be preferred. Selection markers routinely used in transformations include the nptll gene that confers resistance to kanamycin (Messing, et al., Gene 79: 259-268 (1982); Bevan, et al., Nature 304: 1 84-1 87 (1983)), the bar gene that confers resistance to herbicidal phosphinothricin (White, et al., Nuci, Acids Res. 78, 1062 (1990), Spencer, et al., Theor. Appl. Genet. 79: 625-631 (1990)), the hph gene that confers resistance to antibiotic hygromycin (Blochinger, et al., Mol Cell Biol .. 4: 2929-2931), and the dhfr gene, which confers resistance to methotrexate. Vectors suitable for the transformation of Agrobacterium typically carry at least one T-DNA boundary sequence. This includes vectors such as pBIN 1 9 and pCIB200 (EP 0 332 1 04). The transformation without the use of Agrobacterium tumefaciens surrounds the requirement of T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be used in addition to vectors such as those described above which contain T-DNA sequences. Transformation techniques that do not depend on Agrobacterium include transformation through bombardment of particles, protoplast uptake (eg, PEG and electroporation) and microinjection. The choice of vector depends greatly on the preferred selection of the species to be transformed. For example, pCIB3064 is a vector derived from pUC suitable for the direct gene transfer technique in combination with the selection by the herbicide phloem (or phosphinothricin). It is described in WO 93/07278 and Koziel, et al., Biotechnology 7 7: 1 94-200 (1 993). An expression cassette containing the DNA of the mutant PAP gene encoding the various elements described above can be inserted into a plant transformation vector by standard recombinant DNA methods, alternatively, some or all of the elements of the expression cassette can be present in the vector, and any remaining element can be added to the vector as needed. Transformation techniques for dicotyledons are well known in the art and include techniques based on Agrobacterium and techniques that do not require Agrobacterium. The techniques without Agrobacterium include the uptake of exogenous genetic material directly by protoplasts or cells. This can be carried out by PEG or uptake mediated by electroporation, microinjection or mediated delivery by particle bombardment. Examples of these techniques are described in Paszkowski, et al., EMBO J 3: 2717-2722 (1988), Potrykis, et al., Mol. Gen. Genet. 799: 169-1 77 5 (1985); Reich, et al., Biotechnology 4: 1 001 -1 004 (1 986) and Klein, et al. , Nature 327: 70-73 (1987). In each case the transformed cells are regenerated to whole plants using standard techniques. The transformation mediated by Agrobacterium is a preferred technique for the transformation of dicotyledons due to its original transformation efficiency and its wide utility with many different species. The many crop species that are routinely transformed by Agrobacterium are tobacco, tomato, sunflower, cotton, oily seed grape, potato, soybean, alfalfa and poplar (EP 0 31 7 51 1 (cotton), EP 0 249 432 (tomato), WO 87/07299 (Brassica), US 4,795,855 (poplar). The transformation of Agrobacteriγm typically includes the transfer of the binary vector carrying the foreign DNA of interest (eg, pCIB200 or pCIB2001) to an appropriate Agrobacterium strain that may depend on the complement of the vir genes carried by the Agrobacterium host strain either in a co-resident or chromosomally plasmid (e.g., strain CIB542 for pCIB200 (Uknes, et al., Plant Cell 5: 1 59-169 (1993)) The transfer of the recombinant binary vector, Agrobacterium is carried out by a triparental coupling procedure using E. coli that carries the recombinant binary vector, a strain of E. coll helper that IÉÍ _____ Í _________ Í ^^ carries a plasmid such as pRK201 3 that is able to mobilize the recombinant binary vector -aa the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (Höfgen, et al., Nucí 5 Acids Res. 76: 9877 (1 988)). The transformation of the target plant species by recombinant Agrobacterium usually includes co-cultivation of the Agrobacterium with tissues excised and maintained in plant culture and follows procedures known in the art. The tissue The transformed is regenerated in a selectable medium carrying an antibiotic or herbicidal resistance marker present between the limits of T-DNA of binary plasmid. The preferred transformation techniques for monocotyledons include direct gene transfer in protoplasts using PEG or electroporation techniques and bombardment of particles in callus tissue. The transformation can be started with a single species of DNA or multiple species of DNA (ie, co-transformation) and both of these techniques are suitable for use with this invention. The co-transformation may have the advantage of avoiding the complex construction of the vector and of generating transgenic plants with unlinked sites for the gene of interest and the selectable marker, allowing the removal of the selectable marker in subsequent generations, if this is considered desirable. However, a disadvantage of the use of co-transformation is at least 1 00% of frequency with which Separate DNA species are integrated into the genome (Schocher, et al., Biotechnology 4: 1 093-1 096 (1986)). The International and European Published Patent Applications WO 93/07278, EP 0 392 225 and EP 0 292 435 describe techniques for the preparation of corn callus and protoplasts, the transformation of protoplasts using PEG or electroporation, and the regeneration of the plants of corn of transformed protoplasts. Gordeon-Kamm, I went to. , Plant Cell 2: 603-618 (1990), and Fromm, ei al. , Biotechnology 7 7: 194-200 (1992), describe the techniques for the transformation of selected innate corn lines by particle bombardment. Rice transformation can also be started by direct gene transfer techniques using protoplasts or particle bombardment. Protoplast-mediated transformation has been described by the types Indica and types of Japan (Zhange, et al., Plant Cell Rep. 7: 739-384 (1988); Shimamoto, et al., Nature 338: 274-277 (1989). ); Datta, et al., Biotechnology 8: 736-740 (1990)). Both types are also routinely transformed using particle bombardment (Christou, et al., Biotechnology 9: 957-962 (1991)). European Patent Application EP 0 332 581 describes the techniques for the generation, transformation and regeneration of Pooideae protoplasts. In addition, wheat transformation has been described in Vasil, et al., (Biotechnology 70: 667-674 (1992)) using particle bombardment in type C cells of regenerable callus. long term, and in Vasil, et al., (Biotechnology 7 7: 1 553-1 558 (1993)) and Weeks, et al. (Plant Physiol. 702: 1 077-1 084 (1992)) using bombardment of immature embryo particles and callus derived from immature embryo. The transformation of monocotyledonous cells such as Zea mavs can be achieved by bringing the monocotyledonous cells in contact with a multiplicity of needle-like bodies in which these cells can impale, causing a break in the cell wall thus allowing entry DNA transformation in cells. See Patent of U. No. 5,302,523. Transformation techniques applicable to both monocotyledons and dicotyledons are also described in the following U.S. Patents: 5,240,855 (particle injector); 5,204,253 (microprojectiles accelerated by cold gas shock); 15 5, 179.022 (biolistic apparatus); 4,743,548 and 5,1, 14,854 (microinjection); and 5, 149.655 5, 120.657 (transformation mediated by accelerated particle); 5,066,587 (projectile accelerator driven by gas); 5.01 5.580 (particle-mediated transformation of soybean plants); 5,013, 660 (beam-mediated transformation laser); and 4,849,355 and 4,663,292. The transformed plant cells or vegetable tissue then grow in whole plants according to standard techniques. The transgenic seed can be obtained from transgenic flowering plants according to standard techniques. Of the same way, non-flowering plants such as potatoes and beets can spread by a variety of known procedures. See for example, Newell, et al. , Plant Cell Rep. 70: 30-34 (1991) (which describes the transformation of the potato by germinal culture). PAP II proteins confer resistance to the virus and / or broad-spectrum fungus to a wide variety of plant types, including monocotyledons (eg, cereal crops) and dicotyledons. Specific examples include corn, tomato, grass for turf, asparagus, papaya, sunflower, rye, beans, ginger, lotus, bamboo, potato, rice, peanut, barley, malt, wheat, alfalfa, soybeans, oats, eggplant, pumpkin, onion, broccoli, sugar cane, beets, apples, oranges, grapefruit, pear, plum, peach, pineapple, grape, rose, carnation, daisy, tulip, Oregon pine, cedar, white pine, pine, spruce, peas , cotton, linen and coffee. As an alternative to prepare transgenic plants containing an exogenous PAP II gene (or a PAP II transgene), PAP II can be applied directly to plants. Other PAP II proteins that show substantially no toxicity, eg, phytotoxicity can be identified using a selection system in eukaryotic cells as described in U.S. Patents 5,756,322 and 5,880,329 in connection with PAP. In a preferred embodiment, a PAP II DNA molecule, operably linked to a functional inducible promoter in the eukaryotic cell, is randomly mutagenized according to standard techniques. The cell is then transformed with the mutagenized PAP II construct. The cell thus transformed is then cultivated .. ^^, - ^ ...- ^. ,,., _ .. "." ".., * ... Jl ^ sfe ** ^ _____ ^ ____ i __, M ^. ^ Ugly- ,. in a suitable medium for a predetermined amount of time, for example, sufficient to cause some growth of the cells, in such time an inducer is added to the medium to cause the expression of the mutagenized DNA molecule. An observation is then made that the cultured cell survives the induction of mutagenized PAP II DNA expression. Survival indicates that the mutagenesis resulted in the expression of a non-toxic PAP II mutant. The PAP II mutant can then be tested in vitro or in vivo to determine whether it shows anti-fungal and / or anti-viral activity of PAP II. Preferred in vitro analyzes include eukaryotic translation systems such as reticulocyte lysate systems wherein the degree of inhibition of protein synthesis in the system caused by the PAP II mutant is determined. The preferred host cells are yeast cells such as Saccharomyces cerevisiae. This method can also be conducted with a plurality of randomly mutagenized PAP I I DNAs. PAP II mutants identified as non-toxic and having anti-fungal and / or anti-viral PAP II activity, as determined by subsequent analyzes, they can then be isolated, purified and sequenced according to standard techniques. In another modality, the mutagenesis is carried out after the transformation of the eukaryotic cell. The disadvantage with mutagenizing PAP II DNA after transformation is that the chromosomal DNA of the host can also be mutagenized. For To determine if the mutations of the surviving cells are chromosomal or carry plasmid in nature, this modality requires the step of replacing the PAP II DNA of transformation with wild type PAP II DNA under the control of an inducible promoter, and growing the cells in the presence of the inductor. The mutants that retain the ability to grow are chromosomal mutants, whereas the mutants that fail to grow are mutants that carry plasmid (ie, PAP II). The invention will be further described by reference to the detailed examples. These examples are provided for purposes of illustration only, and are not intended as limiting unless otherwise specified. EXAMPLES Example 1: Cloning of the PAP II Gene and Comparative Toxicities of PAP I and PAP II in Transformed Tobacco PAP was purchased from Calbiochem, PAP II was a generous gift from Dr. James Irvin. Polyclonal antibodies against PAP and PAP II were produced in rabbits. PAP I I IgG was purified using an affinity A protein column (Bio-Rad, Hercules, CA). Alkaline phosphatase (Sigma, St. Louis, MO) was conjugated to PAP II IgG by glutaraldehyde (Harlow, et al., "Immunoblotting." In: Antibodies: A Laboratory Manual, pp. 471-51 0, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1988). Cloning of PAP II cDNA Total RNA was isolated from 1 gram of herb leaves i ^ yí? ^ ^^ g ^ ^ carmine using Tri-Reactive (Molecular Research Center, Cincinnatti, OH). Poly A + RNA was isolated using an oligo-dT affinity resin (Stratagene, La Jolla, CA). The cDNA library was constructed from 5 μg of total mRNA with a ZAP-cDNA synthesis kit according to the manufacturer's instructions (Stratagene, La Jolla, CA). The cDNA library, the main compound of which was 6.25 X 108 pfu / μg, was transferred to nitrocellulose and tested with 8 X 1 06 cpm of 32P-labeled oligonucleotide 5'GGGTTGTTCAGTGAGGGTTGTGGCC3 'corresponding to the N-terminal region of PAP II cDNA (Poyet, et al., FEBS Lett 347: 268-272 (1994)). Four clones with approximately 1 kb of insertions were sequenced using the dideoxy chain termination method. Plant transformation vector and tobacco transformation A full-length PAP II cDNA insert in pBluescript SK +/- was digested with PvuW at its 5 'end and Xho at its 3' end. The Pvu \\ IXho \ fragment containing PAPII was cloned into the Smal site of the plant transformation vector pMON977. The resulting plasmid contained the PAPII transgene under the control of the 35S promoter of cauliflower mosaic virus and selectable marker neomycin phosphotransferase (NPTII) under the control of the nopaline synthase promoter. The recombinant vector NT1 59 was introduced into tobacco (Nicotiana tabacum cv. Samsun (NV) by Agrobacterium-mediated transformation.The generated transgenic plants were selected by ELISA for the expression of NPTII and PAPII.The lines showing expression of both NPTII and PAPII they were self-pollinated and progeny R was obtained. The homozygous R2 progeny were selected by the germination of R seeds on MS plates containing 1 000 μg / ml kanamycin Tests of virus resistance The progeny R of transgenic lines (stage six sheet) was evaluated for its resistance to tobacco mosaic virus (TMV, strain U 1) and potato X virus (PVX) .Two leaves of each plant were inoculated mechanically with each virus in 50 mM regulator. potassium phosphate (pH 7.5) in the presence of carborundum The inoculated plants were placed in a growth chamber for the development of symptoms (conditions: 14 hours of duration per day, 60% humidity, tempera 23 ° C during the day and 1 9 ° C at night). Numbers of lesions in inoculated leaves were scored 4 days after inoculation for TMV and 10 days after inoculation for PVX. Four leaf discs of the inoculated leaves were sampled with a perforacorchos (size 7) and homogenized in 1 50 μl of cold phosphate buffered saline (PBS, pH 7.5) containing protease inhibitors (1 μg / ml leupeptin, 1 μg / ml of pepstatma A, 1 μg / ml of antipain and 1 00 μg / ml of PMSF). The homogenate was placed on ice for 10 minutes, centrifuged at 14,000 rpm in a microfuge for 5 minutes and the supernatant containing soluble proteins was used for western blot or ELISA analysis. - - ^ - - - ... j ^ a ^ ^^^ Fungi resistance tests The fungal cultures (Rhizoctonia solani) were incubated in the dark at 30 ° C for 48 hours on potato dextrose agar plates. The pathogen cultures were homogenized and suspended in sterile water and mixed with sterile soil (5 plates per 3 liters of soil). The control and transgenic plantings of four weeks were transplanted in the inoculated soil. The transplanted plantings were kept under plastic domes to maintain humidity. The development of symptoms of disease was observed for eighteen days and the mortality rate of the planting was calculated. Western blot analysis The total soluble protein (20 μg) was separated on a 12.5% acrylamide gel together with a PAP II standard (10 ng). The resolved proteins were transferred to a nitrocellulose membrane using a BioRad trans-blot apparatus. The membrane was blocked in 5% nonfat milk in PBS buffer containing 0.1% tween-20 (PBS-T9 for one hour, and then incubated with PAP II antiserum (1: 500 deletion) overnight at 4 ° C. After rinsing with PBS-T, the membrane was incubated with horseradish peroxidase conjugated with goat anti-rabbit IgG (1: 5000) at room temperature for 1 hour and developed with chemiluminescence detection equipment "Renaissance" (Dupont, Wilmington, DE) .The membrane was cut into strips by incubation in 8M guanidine hydrochloride at room temperature for 30 minutes. min. The membrane was then rinsed four times (1 5 min each) with PBS-T regulator, blocked in PBS-T containing 5% fat-free milk for 30 min and tested with monoclonal antibodies against PR1 (1: 1000). ELISA analysis The PVX antigen levels were determined by ELISA as described in Hur, et al. , Proc. Nati Acad. Sci. 92: 8448-8452 (1995). An ELISA plate was coated with 1 μg of PAP II IgG per well, to drive PAP II ELISA. Soluble protein plant extracts (1000 μl) prepared as described for virus resistance analysis were added to the plates and the plates were incubated overnight * at 4 ° C. The bound PAP II was detected with anti-PAP II IgG conjugated to alkaline phosphatase (1: 1000). Salicylic acid analysis The leaf tissue (0.3 g) was collected from young expanded leaves of plants of 5 weeks of each line of control and transgenic tobacco, homogenized in liquid nitrogen and extracted as described by Yalpani, et al. , Phytopathology 83: 702-708 (1 993). The leaf tissue of four different wild-type and transgenic plants was analyzed. Total and free SA were detected by high performance liquid chromatography and SA levels were quantified. Yalpani, e to al. , supra. RESULTS Analysis and cloning of PAN cDNA A cDNA library was constructed in the lambda ZAP vector using poly A + RNA from leaves of Phytolacca americana. The cDNA library was selected with a primary corresponding to the 5 'terminal sequence of PAP II. Poyet, ei al., Letters FEBS 347: 268-272 (1 994). Four putative clones that hybridize to the oligonucleotide probe were sequenced. All four clones had the same coding sequence 933 bp and were identical to the PAP II cDNA previously described. See Poyet, e to al. , supra. The predicted protein sequence of the nucleotide sequence of the cDNA clone showed that PAP II has an extra 25 amino acids in its N terminus that do not occur in the mature protein (Bjorn, et al., Biochimica et Biophysica Acta 790: 1 54-63 (1984)). Comparison of PAP II and PAP protein sequences indicated that PAP II has only 41% identity with PAP and only 20% identity within the last 80 amino acids in the term C. PAP II does not have a lipid binding site of putative lipoprotein in its C-terminus as previously described for PAP, Hur, et al., supra. Toxicity and expression of PAPII in transgenic tobacco The full-length PAP II cDNA was inserted into a plant transformation vector under the control of the 35S promoter of cauliflower mosaic virus. The resulting vector, NT1 59 was introduced into Nicotiana tabaccum cv, Samsun NN by transformation mediated by Agrobacterium. The transformation frequencies of N. tabacum, defined as the number of transgenic plants obtained ^^ ^ ai ^ Sfg; at times of initial leaf disc 100, they were only slightly reduced for NT1 59 (5%) compared to vector control (7-10%). The transformation frequencies were significantly higher for NT1 59 containing PAP II (5%) compared to 33617, which contains wild type PAP (0.7%). Lodge, I went to. , Proc. Nati Acad. Sci. 90: 7089-7093 (1993). Eight different lines of independently transformed tobacco were obtained positive for the expression of NPTII and PAP I I by ELISA. All eight Ro lines produced viable seeds. The PAP II protein expressed in transgenic tobacco had the same electrophoretic mobility as mature PAP II isolated from carmine grass, indicating that PAP II expressed in transgenic tobacco was processed in a similar manner as in carmine grass (photograph not shown). The lower cross-reactive molecular weight observed in the wild type plant (W.T.) was not consistently observed in other untransformed tobacco plants (photo not shown). The levels of PAP II expression in the eight independent transgenic lines varied. Progeny plants R. of line 159-9 expressed high levels of PAP II protein (up to 250 ng / mg of protein) by immunoblot analysis, while R-progeny plants of line 159-8 had moderate levels of PAP II expression (20). -100 ng / mg of protein). A few plants of line 159-9 showed chlorotic lesions on their leaves, as previously observed in transgenic plants expressing PAP and variant PAP, Lodge, et al., Supra. For ^ rffc ^ .. ^ ^ _ _____. . It is important to determine if the presence of these lesions correlates with the expression levels of PAP II, the plants of the progeny R. of line 1 59-9 with or without chlorotic lesions were analyzed for PAP II expression using immunoblot analysis. Individual plants that showed chlorotic lesions expressed higher levels of PAP II (above 150 ng / mg of protein) than those that did not have lesions (less than 100 ng / mg of protein) (photo not shown). The progeny R. of line 1 59-8 expressing 1 0-80 ng / mg of PAP II appeared perfectly normal (photo not shown). These results indicate that PAP II is expressed at least at levels 10 times higher than wild-type PAP in transgenic tobacco plants (Lodge, et al., Supra). The higher accumulation of PAP II in transgenic tobacco plants and the higher transformation frequencies observed with PAP II containing vectors indicate that PAP II is less toxic to transgenic plants than PAP. Antiviral activity of transgenic tobacco expressing PAP I I To determine whether transgenic tobacco plants expressing PAP II are resistant to viral infection, the progeny R. Self-fertilized transgenic lines were selected for the presence of PAP II by ELISA, and only PAP II positive plants were used in the virus resistance tests. The progeny R. from line 1 59-9 (159-91), high levels of PAP I I and progeny R. of lines 1 59-8 (1 59-81 and 1 59-82), with lower levels stimulated with 0.1 μg / ml of TMV and 5 μg / ml of PVX. The development of symptoms in both inoculated and superior leaves was visually monitored every day until 21 days after inoculation. The plants of line 1 59-91 with elevated levels of PAP II (1 50 ng of PAP II per mg of total protein per ELISA) were evaluated in the same experiment together with wild type tobacco plants. The results are shown in Table 3. TABLE 3 Susceptibility of Transgenic Tobacco Plants Expressing PAP II for TMV and PVX Infection TMV # PVX or HR Injury Number Injury Number PAP lines ll§ (ng / mg) W. t. 0 90 ± 29 94 ± 6 1 59-91 1 50 ± 20 18 ± 20 1 0 ± 3 W.t. 0 85 ± 34 93 ± 27 159-81 20 ± 5 30 ± 23 41 ± 31 159-82 1 1 ± 2 34 ± 24 52 ± 29 § Five wild type plants and ten progeny plants R. of each line of tobacco were analyzed by ELISA for the expression of PAP II. Average value ± SD is shown, and ng of PAP II is expressed per mg of total vegetable protein. # Ten transgenic plants (Samsun NN) were inoculated with 0.1 μg / ml of TMV. After three days of postinoculation, the numbers of lesions were counted, Ten ten plants (Sansun NN) were inoculated with PVX at 5 g / ml,. ^ "^^ tt After 1 2 days, the numbers of local lesions on the inoculated leaves were counted. * Significantly different from wild type at 1% level. As shown in Table 3 (upper level), the plants of line 1 59-91 showed 80% reduction in TMV lesion numbers compared to the control plants. The plants of lines 159-81 and 159-82, with lower levels of PAP II (20 and 11 ng of PAP II per mg of total protein by ELISA), evaluated in other experiments, showed 65% and 60% reduction in injury numbers by TMV, respectively compared to the control plants (Table 3, lower panel). Similar results were obtained when the transgenic plants expressing PAP II were inoculated with potato X virus (PVX) (Table 3). Line 1 59-91 showed 89% reduction in lesion numbers by PVX, 10 days after inoculation, while lines 159-81 and 1 59-82 showed 56% and 44% reduction in lesion numbers by PVX, respectively. Similarly, a lower percentage of plants expressing PAP II showed PVX lesions on their upper leaves compared to the control plants. These results demonstrate that all the transgenic lines tested had dramatically reduced numbers of lesions by PVX and TMV and the level of resistance to viral infection correlated well with the levels of PAP II protein in transgenic plants. Antifungal activity of transgenic tobacco expressing ^^^^ ^^^^^^^^^^^^ gg ^^^^^^^^^^ G ^^^^^^^^ a ^ ^ PAP II One month after germination, twenty plantings of homozygous progeny (R2 generation) of five different independently transformed lines were transplanted into the soil inoculated with the pathogenic fungus Rhizoctonia solani. The plants were kept under plastic domes throughout the experiment to maintain high relative humidity. The progression of the disease was monitored for three weeks and the percentage of dead plantings was recorded on days six, ten, fourteen and eighteen after the transplant. The mortality of the sowing and the development of disease are shown in Figure 1. Two weeks after the transplant, 90% of the control plantings died. All the transgenic lines tested were less susceptible to disease. The most resistant lines were 159-91, 1 59-92 and 159-81. In these lines, the sowing mortality rate was much lower (30% to 40%) compared to the control (90%). In contrast to the more resistant lines, a transgenic line (1 59-82) showed a lower level of resistance. Six days after transplanting on fungal infested soil, 50% of the control sows died, compared to only 35% on line 159-82. Two weeks after the transplant, 90% of the control plantings died, compared to 75% in line 159-82. The examination of PAP II in the transgenic lines that survived the fungal infection showed that PAP II was expressed in each plant (data not shown). The progeny ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^ homozygous lines 1 59-9 * 1 and 159-92, which expressed the highest levels of PAP II, showed the highest levels of resistance. The homozygous progeny of line 159-81 that survived the fungal infection, expressed PAP II at similar levels as the plants of line 1 59-92. The homozygous progeny of line 1 59-82, which expressed the lowest levels of PAP II, showed the lowest level of resistance. PR expression in transgenic tobacco plants expressing PAP II It was recently shown that proteins related to pathogenesis (PR proteins) are induced in transgenic plants that express PAP. Zoubenko, I went to. , Nature / Biotechnology 75: 992-996 (1997). In many plants including tobacco, the primary infection can trigger a systemic resistance of the plant to subsequent infection by a variety of pathogens. This non-specific resistance is known as systemic acquired resistance (SAR) and is associated with the systemic novo synthesis of a large number of PR proteins. To determine if the PR protein is induced in transgenic plants that express PAP II, the expression of PR1 and PAP II were analyzed in the R progeny. of five different transgenic lines by means of immunoblot analysis using polyclonal antibodies against PAP II and monoclonal antibodies against PR1. All five transgenic lines expressed PAP II and PR1 (photograph not shown). The expression level of PR1 in transgenic lines correlated well ^^^ H ^ | with PAP II protein levels (photo not shown). The lines 1 59-91, 159-92 and 1 5% 93, which expressed elevated levels of PAP II, showed higher levels of PR1 (photograph not shown). Lines 1 59-81 and 1 59-82, which expressed lower levels of PAP II, showed lower amounts of PR1 accumulation (photograph not shown). PR1 levels in lines 1 59-81 and 159-82 were similar to PR1 levels in wild type plants inoculated with TMV (photograph not shown). Analysis of salicylic acid levels in transgenic lines expressing PAP II Protein PR synthesis is induced in response to pathogen attack and correlates well with the induction of SAR that confers non-specific resistance in distant parts of plants against different kinds of pathogens. The activation of SAR 15 in plants is closely linked to the synthesis induction of salicylic acid (SA). To determine if SA levels are elevated in transgenic plants that express PAP II, the levels of total and free SA were analyzed in different transgenic lines. As shown in Figure 2, free SA levels in transgenic plants expressing PAP II were similar to controls. Similar results were obtained when the total SA levels were analyzed (data not shown). PAP II accumulates in the leaves of carmine grass plants grown in the summer. Different expression of PAP II, PAP in carmine grass is induced in the environmental stress (data not .. »-«. -,. - - .. ^ .. = dßHBBa? Ma¡l - ° ¿? £? > ¿¡¡¡! & amp; < £ ¿^^ ± «***** - published). PAP II have a low sequence homology to PAP, suggesting that it may have a different physiological function. The physiological function of RIPs is not known. They are observed as defense-related proteins because some RIPs such as deadenylated PAP ribosomes of all organisms, and their expression in transgenic plants lead to resistance to viral and fungal infection. See Gornhardt, e to al. , Plant J. 8: 97-109 (1995), Lodge, et al., Proc. Nati Aad. Sci. 90: 7089-7093 (1993). Logemann, I went to. , Bio / Technology 70: 305-308 (1992). The expression of several RIPs is induced by environmental stress. See, Reinbothe, et al., Plant Cell 6: 1 197-1209 (1986), Rippman, et al., Plant. Mol. Biol. 35: 701-709 (1997), and Stirpe, et al., FEBS Lett. 382: 309-312 (1996). It has been suggested that these RIPs can regulate protein synthesis during stress. See Gorschen, et al., Planta 202: 470-478 (1 997) and Rippman, et al., Supra. PAP II contains a signal sequence of 25 amino acids in its N terminus and as PAP can also be located in the cell wall. See Ready, e al., Proc. Nati Acad. Sci. 83: 5053-5056 (1986). The results indicate that PAP II is significantly less toxic than transgenic tobacco than PAP in terms of relative transformation frequencies, phenotype of transgenic plants and the level of transgene expression. Since PAP and PAP II have similar N-glycosylase activity in vitro, the differences in their toxicity may not be due to differences in their enzymatic activity. Again, without trying to join by any theory ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ S ^^^ j ^^^^^^^ ^^^^^^^^^ individual operation, the different cytotoxicities of PAP and PAP II may be due to their ability to enter the cytosol. It has been found that the A chain of ricin is translocated from the endoplasmic reticulum to the cytosol via a retrograde transport pathway. Rapak, I went to. , Proc. Nati Sci. E. U.A. 24: 3873-3788 (1 997). It has been previously shown that PAP toxicity is not solely due to enzymatic activity, but includes specific residues in the N-terminal and C-terminal regions of the Hur protein, et al., Proc. Nati Acad. Sci. 92: 8448-8452 (1995). The 25 amino acids of the C-terminus of PAP appear to be critical for cytotoxicity because the deletion of these sequences eliminates toxicity to yeast and transgenic plants (Hur, et al., Supra). PAP and PAP II are only 20% homologous in this region. Low-sequence homology in the C-terminal regions of PAP and PAP II suggests that sequence differences near the C-terminus may account for differences in their toxicity. Two phenotypically normal transgenic tobacco lines expressing the PAP II gene were resistant to both viral and fungal infection. The mechanism of antiviral and antifungal activity of the proteins that inactivate the ribosome of carmine grass remains to be elucidated. Based on the current data, several models could be proposed. Again, without trying to be found by any particular theory of operation, they are as follows. In a model, PAP and PAP II, located in the cell wall, enter the cell together with the pathogen and indirectly inhibit the ' : ijy * k? < ! y: .i r. '* *. and propagation of the pathogen by inactivating the host ribosomes, thus killing the infected cells. Ready, e, al., Supra. In support of this model, positive correlations were reported between clearance of host ribosomes and antiviral activity of RIPs 5 exogenously applied in tobacco against TMV. Taylor, I went to. , Plant J. 5: 827-835 (1 994). Applicants have recently shown, however, that a truncated C-terminal PAP mutant that does not have detectable ribosome-specific clearance activity in vivo, had antiviral activity when expressed in tobacco transgenic, suggesting that the antiviral activity of PAP can be disassociated from its toxicity. Tumer, ei al. , Proc. Nati Acad. Sci 94: 3866-3871 (1997). PAP and other RIPs have been shown to debug DNA and RNA substrates in addition to rRNA. Barbieri, et al., Nucleic Acids Research 25: 518-522 (1997). In this way, PAP and PAP II can directly attack a pathogen by infecting viral nucleic acid or by debugging fungal ribosomes. Another model or hypothesis is that the expression of PAP II or PAP activates the host defense pathways and leads to broad-spectrum resistance to pathogen infection, similar to SAR, which is characterized by the activation of a signal transduction pathway and synthesis of a number of defense gene products. Applicants have previously shown that the expression of PR proteins is induced in transgenic plants expressing PAP and nontoxic PAP mutants. Zoubenko, I went to. , Nature / Biotechnology 75: 992- 25 996 (1 997). These include chitinases and β-1,3-glucanases with "ka *" ", i" - - • - '"* A ^ *« ..., .- ..... ... ... ".. ^ __,. ^ _ ^ .¿ att & fes = i ^^ proven lytic activity against fungal cell walls Thus, it is possible for PAP and PAP II to access the ribosomes of the pathogen by penetrating the cells of invasive hyphae by double action of the transgenes and the host genes that are induced in 5 transgenic plants.The results demonstrate that transgenic tobacco plants expressing PAP II constitutively express the pathogenesis-related protein RP1 in the absence of pathogen infection or hypersensitive response. produced correlates well with the level of expression of PAP II, indicating that the defense mechanisms are activated in transgenic plants that express PAP II. Previously, the Applicants argued that the resistance of the pathogen in transgenic plants expressing PAP is not due to classical SAR. Apparent activation of the defense responses employs a signal transduction pathway different from that which includes salicylic acid. Zoubenko I went to., Supra. This theory is also supported by grafting experiments, in which we show that rhizomes of transgenic tobacco expressing PAP induce resistance to virus infection in both N. tabacum NN wild type and nn rods in the absence of high SA levels. Smirnov, et al., Plant Physiology 7 74: 1 1 13-1 121 (1 997). These results suggest that PAP expression generates a signal that can be translocated through the graft junction and induce non-specific resistance in wild-type plants. Sminorv, e. Al., Supra. It seems that the transgenic PAP II plants show the same type of resistance to the pathogen as reported by transgenic PAP plants. The results demonstrate that although PR1 is expressed constitutively, SA levels are not elevated in transgenic plants that express PAP II. This is in sharp contrast to the five to ten-fold increase necessary for the efficient expression of RP proteins. Yalpani, e to al. , Phytopathology 83: 702-708 (1993). These results follow that both proteins activate a signal transduction pathway different from that which controls SAR or a downstream regulatory signal. Jordanov, e to al., Mol. Cell. Biol .. 77: 3373-3381 (1 997) report that in mammalian cells, the inactivation of translationally active ribosomes by ribotoxic agents, including the proteins of inactivation of ribosm a-sarcin and A chain of recin, strongly induced the transduction pathway. of signal activated by voltage. In the case of PAP, both the pathogen and the stress-inducible host genes were activated even in transgenic lines expressing non-toxic PAP mutants. Zoubenko, I went to. supra. In PAP II transgenic plants, expression of PR1 was observed in lines expressing low levels of PAP II that are phenotypically normal, suggesting that PR protein expression is not induced due to severe disturbance of plant metabolism. However, the resistance observed in transgenic lines of PAP II and PAP, in the absence of visible voltage signals, may not exclude a complication of at least some components of the pathway. ^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^ signal transduction activated by voltage. Example 2: Expression of Several PAP II Mutants in Construction Yeast for PAP I I Expression in Saccaromyces cerevisiae The plasmid containing wild-type PAP II (NT148) was digested with PvuW and Xhol. After electrophoresis in agarose gel LMP restriction fragment containing PAP II inserts were purified and ligated to the yeast expression vector TKB January 75 Smal digested and Xho. The resulting plasmid NT264, contained the selectable marker TRP and PAP II downstream of the galactose-inducible promoter, GA / .1. PAP II cDNA site-directed mutagenesis Point mutations are introduced into PAP II by site-directed mutagenesis using a kit of Mutagenesis Quick-Change ™ (Stratagene) following the manufacturer's instructions. In each mutagenesis experiment, two complementary primaries containing a desired point mutation were designated. The PCR mixture contained 125 ng of each primer, 100 ng of annealed plasmid DNA containing PAP II cDNA (NT264), 0.5 mM dNTP and 3 units of Pfu DNA polymerase. PCR worked for 16 cycles (95 ° C for 30 sec, 55 ° C for 1 min and 68 ° C for 12 min, for two nucleotide mutations, the time was extended to 18 min). At the end of PCR, 1 unit of the restriction enzyme Dppl was added to the PCR products during the i ^^^ ^^ g faith ^^^^^^^^^^ g ^^^^^^^^^^^^^ digestion of plasmid DNA parenteral metiíado at 37 ° C for 1 hr. Five microliters of the products PCRs digested in Dpnl were used for the transformation of Epicurian Coli XL1 - BlueSuper-Competent cells (Stratagene) and plated on 5 Amp + LB. The mutagenized plasmids were isolated and the presence of the mutated nucleotide was confirmed by sequencing both strands of PAPII using the Sequenase DNA Sequencing 2.0 (Unitated States Biochemical) kit. The primaries for mutagenesis were as follows (wherein the amino acid numbering was designated according to the mature sequence of PAP II): NT288 (G72D) G72DF: TTTGGAGGACTATTCTGAC G72DR: GTCAGAATAG TCCTCCAAA NT268 (E172V) E173F: CCGTTCAAATGGTTACTGTGGCATCAAGGTTC E 1 73R: GACCTTGATGCCACAGTAACCATTTGAACGG NT266 (W238R): 20 W238F: AAACCTTAGACTACGGCCAC W238R: CTGGCCGTAGTCTAAGGTTT NT288 (W238R) W238RF: AAACCTAGGACTACGGCCAC W238RR: GTGGCCGTAG TCCTAGGTTT 25 NT309 (L253A) L253AF: CGACATTATGGCAGCCCTAACCCACGTTAC L253AR: GTAACGTGGGTTAGGGCTGC CATAATGTCG NT280 (L254R) L254RF: CGACATTATGGCACTCCGAACCCACGTTACTTGC L254RR: GCAAGTAACGTGGGTTCGGAGTGCCATAATGTCG NT271 (K260detention): 10 K260F: CACGTTACTTGCTAGGTTAAAGTTCCATGTTCC K260R: GGAACATGGAACTTTTAACCTAGCAAGTAACGTG Toxicity Analysis of PAP II and Its Mutants Five micrograms of plasmid DNA containing PAP II wild type or PAP II mutants were transformed into PSY1 of yeast strain. One half of the transformation mixture was plated in the TRP medium containing 2% raffinose and another half in TRP medium containing 2% galactose. The growth of transformed yeast in the plates was monitored, and the number of transformants was recorded. Expression Analysis of PAP II in Yeast A single colony of the yeast transformation plate was first inoculated into 5 ml of liquid TRP medium containing 2% raffinose and grown to a density of 2 x 106 cells per ml. After collecting, the cells were rinsed with water, and re-suspended in 20 ml of TRP medium containing either 2% of raffinose or 2% galactose. The yeast cells were formed into pellets by centrifugation at 3000 rpm for 5 min in a table top centrifuge. The tubes containing the pills were placed on ice for 5 min and an equal volume of 2 x protein sample buffer containing the protease inhibitor mixture (2 μg / ml Aprotinin, 2 μg / ml Leupeptin, 2 μg / ml of Antipain, and 100 μg / ml of PMSF, Sambrook, et al., Molecular Cloning, A Laboratory Manual (1 989) and 50 μ of vitreous pearls rinsed with acid.The cells were dissolved by the action of Usinas by vortexing the samples twice, each for 2 min, and keeping them on ice for 1 min.The Usinas were boiled for 3 min and centrifuged for 5 min.The aliquots of samples were analyzed by immunoblot using PAP II antiserum, PAP II toxicity Wild type Expressed in Yeast The results indicate that PAP II is significantly less toxic than PAP to transgenic tobacco plants.To determine if PAP II was as toxic to yeast as PAP, a full-length PAP II cDNA was placed under a galactose inducible GAL promoter and a PGK1 polyadenylation sequence at the 3 'end of a yeast expression vector. The wild type PAP gene was introduced in the same vector as a control (NT209). Recombinant vectors NT264 (PAP II) or NT209 (PAP) with Trp selection marker were introduced into Saccaromyces cerevisae. All the transformants harboring NT264 or NT209 were able to ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^ g ^ ^^^^^^^^^ t ^^^^^^^^^^^^^^ g ^^^^^^^^^^^^^^^^^^ ^^^ áa ^^ ¿^^^^ grow on the Trp plate containing 2% raffinose but not on the Trp plate containing 2% galactose. Comparison of growth curves for yeast expressing PAP or PAP II showed that the pattern of growth inhibition by PAP II is similar to that observed with PAP, indicating that PAP II is as toxic as PAP when expressed in yeast. Immunoblot analysis showed that PAP II protein was expressed after induction with galactose. The size of PAP II expressed in yeast is the same as PAP II purified from leaves of carmine grass, indicating that PAP II is processed in yeast as in carmine grass. Mutation Effect of PAP II on its Yeast Toxicity Three three-dimensional structures of many RIPs are similar but not identical. Sequence analysis of PAP II shows that active site residues conserved in all RIPs are also conserved in PAP II. It has been shown that a mutation in the C-terminal region eliminated the toxicity of PAP to yeast (Hur, al., supra). When the deletion mutant of the C-terminus of PAP was expressed in transgenic tobacco plants, the plants were phenotypically normal and were resistant to viral infection, suggesting that the toxicity and antiviral activity could be dissociated. To further dissect the mechanism of toxicity and determine whether these residues important for PAP toxicity are also important for the toxicity of PAP II in yeast, ^^ fe i £ | jgjíia j ^^ made nine mutations of PAP II by site-directed mutagenesis. PAP II genes mutagenized placed under a GAL1 galactose inducible promoter in an expression vector yeast, and the toxicity of PAP I I mutants was observed under both induced and uninduced conditions. The results are shown in Table 4. Table 4 Effect of Mutations in toxicity PAP II Construction Yeast Mutations toxicity NT264 NT288 G72D wild type Yes No No NT266 NT268 E 172V W238detención W238R Yes No NT289 NT309 NT280 L254R L253Adetención No No No NT307 L254RA NT271 K260detention No The N-terminal region of PAP II contains a putative RNA binding region that is critical for recognition of the RNA substrate. Two tyrosines plus two arginine residues upstream are conserved in most RIPs. The Glycin72 mutation in charged aspartic acid eliminated the toxicity of PAP II to yeast (Table 4). It has been shown that Y72 of PAP (Y69 in PAP II) interacts with the adenine ring of the RNA substrate. The G72D mutation can interrupt the interaction of Y72 with the RNA substrate and render it non-toxic to yeast. ^^ _ ¿^^ «A ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ | ^^^^^^ ^^^^^^^^^^ & ^^^ faith ^^^^^^^^^^^ ¿^^^^^^ E172 PAP II is conserved among all RIPs and is a key residue in the active site. In PAP, the mutation of the equivalent residue (E 176V) eliminates the toxicity and enzymatic activity of PAP. A similar mutation (E1 72V) was introduced to PAP II. The 5 results show that the mutation of E172V abolished the toxicity of PAP II to yeast, indicating that this residue plays an important role in the enzymatic activity (Table 4). Previous studies showed that truncation of the 25 amino acids of terminal C converts nontoxic PAP to leaven. Crystallographic data show that most residues in this region are not directly included in substrate bond or catalysis. One hypothesis is that this region can be included in protein-membrane interaction, which is critical for PAP and PAP II to enter the cytosol. A series of mutations of single point and truncations were made in the C terminal region of PAP II. As in PAP, deletion of the C terminal region after W238, a residue was also retained in PAP, which resulted in a non-toxic phenotype. Without attempting to join any particular theory of operation, the Requesters believe that the term C of PAP and PAP II has similar functions. The dileucine motif in many proteins has been shown to be important in protein-protein interactions and in the protein distribution pathway. The Requesters have discovered that PAP II and PAP also have dileucin motifs in the region terminal C, which may be important in distributing PAP II and PAP. , -r ^ r .., íi ^, ..,. ^ .á8gS &táÉK *** ". ^ > . . . ,, ^, ". * ^. . "_ ^ AsAfeáS l ^^ These sequences may be critical in the interaction of PAP and PAP II with the membranes. Dileucine residues are conserved in almost all RIPs, suggesting functional importance of these two residues. To investigate the role of residues dileucine in 5 PAP II, L253 was changed to alanine (NT309) and L254 was mutated to an alanine residue short side chain (NT307), or an arginine residue positive side chain (NT280 ) or a stop codon (NT309). The results in Table 4 show that all these mutations eliminate the PAP II cytotoxicity in yeast, indicating that L253 and L254 are critical for toxicity to yeast residues between L254 and stop codon are critical for toxicity PAP II yeasty, Example 3: Expression of PAP II in turfgrass An expression vector was constructed for transformation of grass for turf including the PAP II cDNA downstream of the corn ubiquitin promoter and intron in the plant expression vector NT168. The waters below the PAP II gene, polyadenylation sequences of the small subunit of the E9 gene of ribulose 1, 5-bisphosphate carboxylase. Grass plants for grass transgenic were generated using particle bombardment. Southern blot analysis identified several independently transformed lines containing PAP II sequences. Immunoblot analysis indicated very high levels of PAP II protein expression in transgenic plants. The expression levels of PAP II were greater than the levels observed with non-toxic PAO mutants.

The transgenic plants were not distinguished from wild type plants in their physical characteristics and appearance, indicating that the expression of PAP II was not toxic to grass for turf. PAP II confers broad-spectrum resistance to 5 numerous pests. This resistance is efficiently provided in that a minimum number of transgenes is required. PAP II is also substantially non-phytotoxic and non-cytotoxic, and thus provides a distinct and unexpected advantage over the use of wild-type PAP. Transgenic plants that express the PAP II gene are substantially more resistant to a variety of pathogens, including viruses, fungi, bacteria, nematodes and insects than comparable plants that express PAP II. In this way, the highest crop products will be obtained. All publications mentioned in this The specification is indicative of the level of experience of persons skilled in the art, to which this invention pertains. All of these publications are incorporated herein by reference to the same degree as if each individual publication was specifically and individually indicated to be incorporated for reference. Various modifications of the invention described herein will be apparent to those skilled in the art. Such modifications are proposed to fall within the scope of the appended claims. INDUSTRIAL APPLICATION The present invention is useful in the genetic engineering of ^. ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ J ^^^^^^^^^ ß? I ^^^^^ ^^^^^^^^^^^^^^^^^^ M ^ plants, particularly crop plants that are susceptible to virus and fungal infestation. ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ : _ ^ _ ^ _ ^ __ ^ fe ^^ _ tíig¿j ^ _SÍj ^^^^^^^ g ^^^^^ g ^. ^^^^

Claims

CLAIMS 1. A recombinant plant cell or part thereof containing a DNA molecule comprising a sequence encoding a PAP II protein.
2. The recombinant plant cell or part thereof according to claim 1, characterized in that said part of the plant cell is a protoplast.
3. The recombinant plant cell according to claim 1, characterized in that said sequence is SEQ ID NO: 3.
4. The recombinant plant cell according to claim 1, characterized in that said sequence encodes PAP II (1-285).
5. The recombinant plant cell according to claim 1, characterized in that said sequence encodes a mutant PAP II protein having catalytic active site amino acid residue, (E 1 72) and shows anti-viral and / or antifungal activity.
6. The recombinant plant cell according to claim 5, characterized in that said sequence encodes a PAP II protein that is PAP II (1-285, G72D).
7. The recombinant plant cell according to claim 5, characterized in that said sequence encodes a PAP II protein that is PAP II (1-285, L254R).
8. The recombinant plant cell according to claim 5, characterized in that said sequence encodes a PAP II protein that is PAP II (1-285, L254A). 9. The recombinant plant cell according to claim 5, characterized in that said sequence encodes a 5 PAP II protein which is PAP II (1-237). 10. The recombinant plant cell according to claim 5, characterized in that said sequence encodes a PAP II protein that is PAP II (1-259). 11. The recombinant plant cell according to claim 5, characterized in that said sequence encodes a PAP II protein selected from the group consisting of PAP II (1-237), PAP II (1-238), PAP II (1-239) , PAP II (1-240), PAP II (1-241), PAP II (1-242), PAP II (1-243), PAP II (1-244), PAP II (1-245), PAP II (1-246), PAP II (1-247), PAP II (1-248), PAP II (1-249), PAP II (1-250), 15 PAP II (1-251), PAP II (1-252), PAP II (1-253), PAP II (1-254), PAP II (1-255), PAP II (1-256), PAP II (1-257), PAP II (1 -258) and PAP II (1-259). 12. A transgenic plant produced from the protoplast according to claim 2. 13. A transgenic plant or part thereof comprising a DNA molecule encoding a PAP II protein that after expression shows anti-viral and / or antifungal activity. . 14. The transgenic plant according to claim 13 25 which is a monocotyledonous plant. The transgenic plant according to claim 14, characterized in that said monocotyledonous plant is a cereal planting plant 16. The transgenic plant according to claim 1 which is a dicotyledonous plant. The seed of the transgenic plant according to claim 13- 1 8. A DNA molecule comprising a sequence encoding a PAP II protein having a residue of 10 amino acid catalytic active site, intact (E 172) and shows anti-viral and / or anti-fungal activity.
9. The DNA molecule according to claim 18, characterized in that said sequence encodes a PAP II protein that is PAP II (1-285, G72D). 20. The DNA molecule according to claim 18, characterized in that said sequence encodes a PAP I I protein that is PAP I I (1-285, L254R). twenty-one . The DNA molecule according to claim 18, characterized in that said sequence encodes a PAP II protein 20 which is PAP II (1 -285, L254A). 22. The DNA molecule according to claim 18, characterized in that said sequence encodes a PAP II protein that is PAP II (1-237). 23. The DNA molecule according to claim 1, characterized in that said sequence encodes a PAP II protein. which is PAP II (1-259). The DNA molecule according to claim 18, characterized in that said sequence encodes a PAP II protein selected from the group consisting of PAP II (1-237), PAP II (1-238), PAP II (1-239), PAP II (1-240), PAP II (1-241), PAP II (1-242), PAP II (1-243), PAP II (1-244), PAP II (1-245), PAP II (1-246), PAP II (1-247), PAP II (1-248), PAP II (1-249), PAP II (1-250), PAP II (1-251), PAP II ( 1-252), PAP II (1-253), PAP II (1-254), PAP II (1-255), PAP II (1-256), PAP II (1-257), PAP II (1- 258) and PAP II (1-259). 25. A purified and isolated mutant PAP II protein that has intact catalytic active site amino acid residue (E172) and shows anti-viral and / or anti-fungal activity. 26. The PAP II protein according to claim 25, which is PAP II (1-285, G72D). 27. The PAP II protein according to claim 25, which is PAP II (1-285, L254R). 28. The PAP II protein according to claim 25, which is PAP II (1-285, L254A). 29. The PAP II protein according to claim 25, which is PAP II (1-237). 30. The PAP II protein according to claim 25, which is PAP II (1-259). 31. The PAP II protein according to claim 25, which is selected from the group consisting of PAP II (1-237), PAP II (1-238), PAP II (1-239), PAP II (1-240) , PAP II (1-241), PAP II (1-242), - A ^ ^ A, PAP II (1 -243), PAP II (1 -244), PAP II (1 -245), PAP II (1 -246), PAP II (1 -247), PAP II (1 -248), PAP II (1 -249), PAP II (1 -250), PAP II (1 -251), PAP II (1 -252), PAP II (1 -253), PAP II (1 -254) ), PAP II (1 -255), PAP II (1 -256), PAP II (1 -257), PAP II (1 -258) and PAP II (1 -259) 32. A vector comprising the molecule of DNA according to claim 25. 33. A method for making a plant having increased resistance to viruses and / or fungi, which comprises preparing a transgenic plant expressing a DNA molecule comprising a sequence encoding a PAP II protein. 34. The method according to claim 33, which comprises stably transforming a protoplast with the DNA molecule, and regenerating the transgenic plant of the transformed protoplast. 35. The method according to claim 33, comprising introducing the DNA molecule into a part of the plant, and regenerating the transgenic plant from the part of the plant containing the DNA molecule. 36. A method for identifying a PAP II protein having reduced cytotoxicity, comprising: (a) providing a eukaryotic cell stably transformed with a DNA molecule comprising a sequence encoding a PAP II protein, operably linked to a promoter inducible functional in said eukaryotic cell; . ".» ». ^ A¿afe ^ .." ^. ^^ j j ^ ai ^^ (b) cultivate the transformed cell in the medium; (c) adding an inductor to said medium; and (d) determining the degree of growth of the cultured cell. The method according to claim 36, characterized in that said eukaryotic cell is a yeast cell.