MXPA00011440A - Control of sporocyte or meiocyte formation in plants - Google Patents

Abstract

The present invention provides genes and encoded proteins that are involved in meiocyte formation during the growth of plants. The transformation of plants and plant-related hosts with these genes in altered or unaltered form, or the mutation of these genes in endogenous form, renders a plant capable during growth of bearing seedless fruits and/or pollenless flowers. The invention further provides methods of producing transgenic plants which are capable of bearing seedless fruits and/or pollenless flowers.

Description

CONTROL OF TRAINING OF SPORTS OR MIOTICS IN PLANTS AND USES OF THE SAME FIELD OF THE INVENTION The present invention relates to genes and encoded proteins involved in the fertility of plants. More particularly, the present invention relates to the use of genes and encoded proteins involved in the formation of myocytes in plants to convert plants capable of producing seeds without fruits and / or flowers without pollen.

BACKGROUND OF THE INVENTION A fundamental part of the life cycle of higher plants is the alternation between a diploid, sporophytic generation and a haploid, gametophytic generation. In flowering plants, the gametophytic generation consists of pollen grains and the embryo sac within the ovary. The transition from the sporophytic phase to the gametophytic phase in higher plants consists of two procedures, sporogenesis and gametogenesis. Gametogenesis mainly involves the differentiation of haploid spores into mature gametophytes. Consult, G.N. Drews, et al, Plant Cell 10 (5) (1988). Endogenesis is characterized by the differentiation of hypodermic cells into anthers and ovule primordia into arc-spiral cells that are further developed into microshopriods (pollen stem cells). See J. Bowman, (1994) Arabidopsis, An Atlas of Morphology and Development. Microsphocytes and megasporocytes (collectively known as myocytes) undergo meiosis to produce spores. The formation of myocytes thus comprises a very important step in the reproduction of plants. In Arabidopsis, sporogenesis and gametogenesis (also known as megaesporogenesis and megagametogenesis) have been well described. See Bowman, J., 1994, Arabidopsis, An Atlas of Morphology and Development. In the sporogenesis bitegmic ova and tenuinucelados arise as finger-like structures on the placenta in the ovary (carpel) of the plant. A single hypodermic cell in the upper part of the ovule primordia becomes more prominent than surrounding cells due to its slightly larger size, denser cytoplasm and more prominent nucleus, and differs in an arc-spherical cell in flowers of stage 10-11 . The arc-spherical cell then lengthens and polarizes its cellular components longitudinally and differentiates into a sporocyte or megasporous (MMC) stem cell: MMC then undergoes meiosis to form four haploid megaspores (tetrads). Shortly after the cerebrospinal cell becomes visible, in the stage 11 flowers, the inner and outer integuments are formed from the epidermal cells at the base of the nucleus. In gametogenesis, the outer integument over passes in growth to the inner integument and both inner and outer integuments envelop the nucleus in which the female gametophyte (embryo sac) develops during stage 13. In the mature stage, the inner cell layer The inner integument differs in a nutritive endothelium (integumentary mat). Although the above is well known, little is known about the mechanisms that regulate and control sporogenesis, especially the formation of myocytes. The identification of genes that regulate and control the formation of myocytes could help to understand these mechanisms and find ways to manipulate the fertility of plants. An object of the present invention is therefore to provide isolated nucleic acids and encoded proteins that are involved in the formation of myocytes in plants, which can be used to manipulate the fertility of plants. Another object of the present invention is to produce plants in which the myocyte formation has been affected during growth to convert the plant capable of producing altered fruits and / or altered flowers, including seedless fruits and plants without pollen.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to the identification of a new Sporocyteles (SPL) gene that is involved in the formation of myocytes in both male and female organs in plants. The SPL gene, its encoded proteins and polypeptides, and their homologs, can be used to regulate and control the formation of myocytes in plants in order to produce altered plants, including plants that are capable of producing seedless fruits and plants without pollen, or fruits and flowers that are substantially seedless and without pollen, respectively. In accordance with one embodiment of the present invention, isolated nucleic acids and their complements encoding proteins involved in the formation of myocytes in plants are provided. Those isolated nucleic acids include DNA, or portions thereof, of the SPL gene isolated from the plant Arabidopsis thaliana ecotype landsberg erecta and other plant species. The invention also provides homologs of the SPL gene from Arabidopsis and other plant species that can hybridize to the SPL gene DNA. These homologues show SPL-like function and can be identified through the plant kingdom. The DNA according to the present invention can exist in various forms, including exogenous DNA that encodes a protein involved in the regulation or control of myocyte formation in a plant. The DNA of the present invention can also be exogenous DNA that has been altered by mutation or other means to affect the formation of myocytes in a plant. In a preferred embodiment, the present invention provides for the insertion of genetic elements, such as Ds sequences (with or without active Ac sequences) into the nucleic acids described above.

The present invention further provides for the alteration or mutation of an exogenous DNA of the plant responsible for the formation of myocytes, by direct or target mutagenesis, or another technique, which may also affect the formation of myocytes. A plant that contains the mutated gene 5 may therefore be able to produce seeds without fruits and / or flowers without pollen. In accordance with the present invention, polypeptides or proteins involved in myocyte formation in plants are also provided. These polypeptides or proteins can regulate or control the formation of myocytes and include the SPL protein, or portions thereof, of plant origin. The SPL protein of most or all plant species, or homologs of those proteins that demonstrate the same or similar regulatory function (ie, myocyte formation) as the SPL protein, are also encompassed by this invention. A homologous polypeptide is defined in Present as one having an amino acid sequence with at least 80% or more of homology to the amino acid sequence drawn in Figure 3. (SEQ ID NO: 4). In another aspect, this invention relates to antibodies that bind the polypeptides and proteins described herein. Sayings antibodies can be used to locate sites of regulatory activity in plants. According to another embodiment of the invention, fusion proteins comprising the SPL protein and a peptide can also be used additional, such as a protein tag, to detect SPL protein / protein interaction sites in plants. The present invention also provides isolated nucleic acids and their complements useful as hybridization probes to detect homologous nucleic acids that are involved in myocyte formation in plants. The present invention further provides plant-related plants and hosts, including seeds, plant tissue culture, and plant parts, which contain DNA that can be altered or exogenous unaltered DNA, or endogenous altered DNA, or portions thereof, in which in many ways may be able to affect the formation of myocytes during the growth of the plant. In a further method of the present invention, methods are provided for producing transgenic plants in which the formation of myocytes is affected or controlled, and more particularly methods for producing transgenic plants capable of producing seedless fruits and / or flowers without pollen. . The invention also provides the SPL gene promoter which can be used to direct the expression of the SPL gene or a foreign gene in microsporocytes and megasporocytes of plants. The promoter can be used to allow the expression of the transgene in the reproductive cells of the plant so as to render the plant sterile. The promoter can also be used to express certain genes to result in the next generation of plant seeds having an altered DNA structure from the original plant.

BRIEF DESCRIPTION OF THE FIGURES AND LIST OF SEQUENCES Figure 1A (SEQ ID NO: 2), shows a portion of the genomic sequence of the SPL gene that immediately flanks the sequence Ds (indicated by bold letters). The insertion of the Ds sequence causes a duplication of 4 base pairs (indicated by underlining) at the insertion site. Figure 1 B (SEQ ID NO: 3), shows the sequence Ds, as shown in Figure 1A (SEQ ID NO: 2). Figure 2 (SEQ ID NO: 1) shows the cDNA sequence of the SPL gene. The codons in bold, atg and taa, indicate the codons of principle and height, respectively, of the open reading frame. The underlined sequence, gcta, indicates the insertion site of the sequence Ds. Figure 3 (SEQ ID NO: 4) shows the amino acid sequence of the SPL polypeptide, as deduced from the DNA sequence of Figure 2 (SEQ ID NO: 1). The Val Leu codons (in bold) are located at the insertion site of the Ds sequence. Figure 4 (SEQ ID NOs: 5-14) illustrates the alignment of the first 18 amino acids of the MADS domains from various MADS box transcription factors with amino acids 64 to 80 of the SPL protein.

Figure 5 (SEQ ID NO: 15) shows the DNA sequence of the SPL gene promoter and the coding region of the gene. The promoter sequence starts at 2690 nucleotides upstream of the start codon of the SPL gene. The first nucleotide of the ATG start codon is designated as the +1 position. The start ATG codon and the high TAA codon are underlined, and two exons are shown in bold.

DETAILED DESCRIPTION OF THE INVENTION As stated above, the present invention provides isolated nucleic acid molecules (eg, DNA or DNA) that encode proteins that are involved in, and may be essential for, the formation of myocytes in the male and female organs of plants. The nucleic acid molecules described herein are useful to produce Sporocyte proteins (SPL) and SPL proteins of plant origin when said nucleic acids are incorporated into any of a variety of protein expression systems known to those skilled in the art. An isolated SPL gene according to the present invention is shown in Figure 2 (SEQ ID NO: 1). The sequence of the promoter region of the SPL gene, as well as the coding region of the gene are shown in Figure 5 (SEQ ID NO: 15). An "isolated" or "substantially pure" nucleic acid (e.g., RNA, DNA or mixed polymer) is one that is separate ^ Sattata. substantially other cellular components that naturally accompany an original human protein or sequence, eg, ribosomes, polymerases, many other genome and protein sequences. The term encompasses a nucleic acid or protein sequence that has been removed from its naturally occurring environment, and includes cloned or recombinant DNA isolates and chemically synthesized analogues or analogs synthesized biologically by heterologous systems. A polynucleotide is said to "encode" a polypeptide if, in its original state or when manipulated by methods well known to those skilled in the art, it can be transcribed and / or translated to produce the mRNA for and / or the polypeptide or a fragment of it. The anti sense chain is the complement of said nucleic acid, and the coding sequence can be deduced from it. The term "SPL" represents the wild type, while "spf represents the mutated form of an SPL gene.The term" SPL "(without italics) represents the wild-type form of the protein described herein. used herein, a "portion" or "fragment" of the SPL gene is defined as having a minimum size of at least about eight nucleotides, or preferably about 15 nucleotides, or more preferably at least 25 nucleotides, and may have a size minimum of at least 40 nucleotides, this definition includes all sizes on the scale of 8-40 nucleotides as well as larger than 40 nucleotides.Therefore, this definition includes nucleic acids of 8, 12, 15, 20, 40, 60 , 80, 100, 200, 300, 400, 500 nucleotides, or nucleic acids having any number of nucleotides within those value scales (eg, 9, 10, 11, 16, 23, 30, 38, 50, 72 , 121, etc. nucleotides), or nucleic acids that they have more than 500 nucleotides. The present invention includes all novel nucleic acids having at least 8 nucleotides derived from FIGS. 1A (SEQ ID NO: 2) or 2 (SEQ ID NO: 1) with the proviso that they do not include nucleic acids that exist in the art. previous. The SPL gene according to one embodiment of the present invention can be derived from a dicotyledon, Arabidopsis thaliana. The polypeptide encoded by this gene can regulate or control, and may be necessary for, the formation of myocytes in a plant. By mutation of the SPL gene, a plant becomes incapable or less able to produce spores, embryo sac and pollen grain. Therefore, the isolated SPL gene of the present invention can be used to generate modified plants, including plants that produce fruit without seeds, flowers without pollen and / or have a larger biomass. The present invention provides isolated nucleic acids or their complements that encode a protein involved in myocyte formation, characterized in that said nucleic acids include: (a) DNA encoding the amino acid sequence set forth in Figure 3 (SEQ ID NO: 4) ), or (b) naturally occurring DNA, or DNA that degenerates into naturally occurring DNA, that hybridizes to the DNA of (a) under moderately stringent conditions, in which the naturally occurring DNA has the minus 70% identity to the DNA of (a), and wherein said naturally occurring DNA encodes protein involved in myocyte formation. The present invention also comprises isolated nucleic acids or their complements that encode a protein involved in the formation of myocytes in plants, in which the nucleic acids comprise DNA that occurs naturally, or DNA that degenerates to the DNA that occurs naturally, to starting from plants that hybridize to the DNA of (a) Figure 1A (SEQ ID NO: 2) or a portion thereof or (b) Figure 2 (SEQ ID NO: 1) or a portion thereof, under moderately stringent conditions , in which the naturally occurring DNA has at least 70% identity to the DNA of (a) or (b), and in which said naturally occurring DNA encodes said protein. The present invention further provides isolated nucleic acids or their complements having at least 70% identity to (a) nucleotides 81-1024 of Figure 2 (SEQ ID NO: 1) or a portion thereof, or (b) variations of (a) which encode the same amino acid sequence as encoded by (a), but use different codons for some amino acids, and in which the nucleic acids encode a protein involved in myocyte formation in plants. Hybridization refers to the binding of complementary strands of nucleic acid (ie, sense: antisense or probe: target DNA chains) to one another through hydrogen bonds, similar to the bonds that occur naturally in chromosomal DNA. The levels of severity that are used to hybridize a given probe with target DNA can be easily varied by those skilled in the art. As used in the present, the phrase hybridization "moderately severe" refers to conditions that allow target DNA to be linked to a complementary nucleic acid having about 60%, preferably about 70%, more preferably about 75%, even more preferably about 85% homology to the target DNA; with more than 90% homology to the target DNA being especially preferred. Preferably, moderately severe conditions are equivalent to hybridization conditions in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42 ° C, followed by washing in 0.2 x SSPE, 0.2% SDS, at 65 ° C. The Denhart and SSPE solution (see, for example, Sambrook et al, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) are well known to those skilled in the art as well as other suitable hybridization regulators. The terms "homology" or "homologous", or to say that a nucleic acid or fragment thereof is "homologous" to another nucleic acid, means that when it is aligned optimally (with insertions or deletions of suitable nucleotides) with the other acid nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 50% of the nucleotide bases, usually at least about 70%, more usually at least about 80%, preferably at least 90%, and more preferably at least 95-98% of the nucleotide bases. To determine the homology between two different nucleic acids, the percentage of homology can be determined using the BLASTN program "BLAST 2 sequences". This program is available for public use from the National Center for Biotechnology Information (NCBI) on the Internet (http: //www.ncbi.nlm.nih.gov/gorf/b12.html) (Altschul et al, 1997). The parameters to be used include the combination of the following parameters that yield the highest percentage of homology calculated (as calculated below with the error parameters shown in parentheses): Program - Blastn Matrix - OR BLOSUM62 Reward for an equalization - 0 or 1 (1) Margin of error for an inequality - 0, -1, -2 or -3 (-2) Margin of error of open space - 0, 1, 2, 3, 4 or 5 (5) Margin of error space extension - 0 or 1 (1) Space x detachment - 0 to 50 (50) Wait - 10 Along with a variety of other results, the BLASTN program shows a percent identity across the entire chains or across regions of the two nucleic acids that equalize.

The program shows as part of the results an alignment and identity of the two chains that are compared. If the chains are of the same length, the identity will be calculated through the full length of the nucleic acids. If the chains are of unequal lengths, the shortest nucleic acid length is used. If the nucleic acids are similar through only a portion of their sequences, the BLASTN program will show an identity through only those similar portions, which are reported individually. For purposes of determining homology in the present, the percentage of homology refers to the shortest of the two sequences that are compared. If any region is shown in different alignments with different identity percentages, the alignments that yield the greatest homology are used. Alternatively, there is "homology" when a nucleic acid or fragment thereof will hybridize to another nucleic acid (or a strand) complementary to it) under selective hybridization conditions, to a chain, or to its complement. Hybridization selectivity exists when hybridization occurs that is substantially more selective than total lack of specificity. Typically, selective hybridization will occur when there is at least 55% homology over an extension of at least 14 nucleotides, preferably at least about 65%, more preferably at least about 75%, and more preferably at least about 90%. See Kanehisa, 1984, Nucí. Acids Res. 12: 203- 13. The length of homology comparison, as described, can be ^ ü ^ j sg & ÃE ^ on larger extensions, and in certain embodiments will often be on an extension of at least about nine nucleotides, usually at least 20 nucleotides, more usually at least 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36 or more nucleotides. Nucleic acid hybridization will be affected by conditions such as salt concentration, temperature, or organic solvents, in addition to the composition of the base, the length of the complementary strands, and the number of nucleotide base inequalities between the nucleic acids. of hybridization, as will be readily appreciated by those skilled in the art. Rigorous temperature conditions will generally include temperatures of more than 30 ° C, typically of more than 37 ° C, and preferably of more than 45 ° C. The stringent salt conditions will normally be less than 1000 mM, typically less than 500 mM, and preferably less than 200 mM. However, the combination of parameters is much more important than the measurement of any single parameter. The stringency conditions depend on the length of the nucleic acid and the composition of the nucleic acid base and can be determined by techniques well known in the art. See, for example, Watmur and Davidson, 1968, J, Mol. Biol. 31: 349-70. The probe sequences can also hybridize specifically to double DNA under certain conditions to form triplets or ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^ l ^^^^^^^^^^^^^^^^^^^^ ^^^^^^^ l other DNA complexes of higher order. The preparation of such probes and the suitable hybridization conditions are well known in the art. The SPL nucleic acid can be the one shown in Figure 2 (SEQ ID NO: 1) or it can be an allele or a variant or derivative that differs from that shown by a change that is one or more of an addition, insertion, deletion and substitution of one or more nucleotides of the sequence shown. Changes to the nucleotide sequence may result in an amino acid change at the protein level, or not, as determined by the genetic code. In this manner, the nucleic acid according to the present invention may include a sequence different from the sequence shown in Figure 2 (SEQ ID NO: 1), but it encodes a polypeptide with the same amino acid sequence as shown in Figure 3 (SEQ ID NO: 4). That is, the nucleic acids of the present invention include sequences that are degenerate as a result of the genetic code. On the other hand, the encoded polypeptide may comprise an amino acid sequence that differs by one or more amino acid residues from the amino acid sequence shown in Figure 3 (SEQ ID NO: 4). Nucleic acid encoding a polypeptide that is a variant, of the amino acid sequence, derivative or allele of the amino acid sequence shown in Figure 3 (SEQ ID NO: 4) is also provided by the present invention. c. ^ The SPL gene also refers to (a) any DNA sequence that (i) hybridizes to the complement of the DNA sequences encoding the amino acid sequence set forth in 3 (SEQ ID NO: 4) under conditions Highly stringent (See Ausubel et al, 1992, Current Protocols in Molecular Biology, (John Willey and Sons, New York, New York)) and (ii) encode a gene product functionally equivalent to SPL protein, or (b) any sequence of DNA which (i) hybridizes to the complement of the DNA sequences encoding the amino acid sequence set forth in 3 (SEQ ID NO: 4) under less stringent conditions, such as moderately stringent conditions (Ausubel et al, 1992) and (ii) it encodes a gene product functionally equivalent to SPL protein. The invention also includes nucleic acid molecules that are complementary to the sequences described herein. According to a preferred embodiment of the present invention, an isolated nucleic acid or its complement is provided which comprises the same contiguous nucleotide sequence as set forth in Figure 2 (SEQ ID NO: 1), or a portion thereof, which encodes a protein involved in myocyte formation in plants. Also provided is an isolated nucleic acid sequence or its complement or hybrid to said sequence comprising the contiguous nucleotide sequence as set forth in Figure 2 or a portion thereof which is preceded by a nucleic acid sequence that provides the gene promoter region. A nucleotide sequence that provides the region of . i. »- i.

The promoter is shown in Figure 5. Specifically, the promoter comprises the sequences that are located within the nucleotide positions -2690 to -1 of the sequence set forth in Figure 5 (SEQ ID NO: 15), or functional fragments thereof capable of regulating the expression of a gene chained in an operative manner. In one embodiment of this invention, the isolated SPL promoter can be operably linked to and control the expression of foreign gens. According to another preferred embodiment of the present invention, there is provided an isolated nucleic acid or its complement comprising the same contiguous nucleotide sequence as set forth in nucleotides 81-1024 of Figure 2 (SEQ ID NO: 1), or a portion thereof, which encodes a protein involved in myocyte formation in plants. According to another preferred embodiment of the present invention, an isolated nucleic acid and its complements encoding polypeptides and proteins that are involved in myocyte formation in plants are provided. Such involvement may include regulating or controlling the formation of myocytes. The polypeptides and proteins encoded by the isolated nucleic acids comprise an amino acid sequence having at least 80%, more preferably about 90% amino acid identity to the reference amino acid sequence in Figure 3 (SEQ ID NO: 4); with more than about 95% identity with the amino acid sequence being especially preferred. In a preferred embodiment, the present invention provides an isolated nucleic acid and its complement comprising a nucleic acid encoding a protein comprising the same amino acid sequence as set forth in Figure 3 (SEQ ID NO: 4). The SPL polypeptide of the invention may therefore be the one shown in Figure 3 (SEQ ID NO: 4), which may be in isolated and / or purified form, free or substantially free of material with which it is naturally associated. The polypeptide can, if produced by expression in a prokaryotic cell or is produced synthetically, lacking the original post-translation processing, such as glycolization. Alternatively, the present invention is also directed to polypeptides which are variants of sequences, alleles or derivatives of the SPL polypeptide. Said polypeptides may have a sequence of amino acid that differs from that set forth in Figure 3 (SEQ ID NO: 4) by one or more of addition, substitution, deletion or insertion of one or more amino acids. Substitution variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and can be designed to modulate one or more properties of the polypeptide, such as stability against proteolytic cleavage, without the loss of other functions or properties. Amino acid substitutions can be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or da t¡ ™ * ^^^^^^^^^^^^^^^^^^^^^^^^^^ * ¡^^^^^^^^^^^^^ ^ Amphipathic nature of the waste involved. The substitutions that are preferred are those that are conservative, that is, an amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and tyrosine, phenylalanine. Certain amino acids can be replaced by other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen binding regions of antibodies or binding sites on substrate molecules or protein binding sites. that interact with the SPL polypeptide. Because it is the interactive ability and the nature of a protein that defines the biological functional activity of that protein, certain amino acid substitutions can be made in a protein sequence, and its underlying DNA coding sequence, and yet obtain a protein with similar properties. By making such changes, the hydrophobic amino acid index can be considered. The importance of the hydrophobic amino acid index to confer interactive biological function on a protein is generally understood in the art. Consult, Kyte and Doolittle, 1982, J. Mol. Biol. 157: 105-32. Alternatively, substitution of similar amino acids can be done effectively on the basis of hydrophilicity. The importance of hydrophilicity in conferring interactive biological function of a protein is generally understood in the art. (U.S. Patent No. 4,55,101). The use of the hydrophobic index or hydrophilicity to design polypeptides is described further in U.S. Patent No. 5,691, 198. In another embodiment of the present invention, isolated DNA molecules comprising DNA having at least eight consecutive base nucleotides 81-1024 of Figure 2 (SEQ ID NO: 1), or a complement thereof, are provided. In a more preferred embodiment of the present invention, the isolated DNA molecules have at least 15 consecutive base nucleotides 81-1024 of Figure 2 (SEQ ID NO: 1). According to another embodiment of the invention, isolated nucleic acids, or their complements, are provided, comprising nucleic acid encoding a mutant SPL polypeptide that blocks, reduces or increases the formation of myocytes in a plant. According to another embodiment of the present invention, a method is provided for the recombinant production of SPL and SPL-like proteins by expressing the nucleic acid sequences described above in suitable host cells. The proteins can be expressed under the control of the SPL gene promoter. In another embodiment of the present invention, methods are provided for producing transgenic plants that are capable of producing seedless fruits and / or flowers without pollen, or fruits and flowers that are substantially seedless and without pollen, respectively. Those methods include the step of transforming a plant with a suitable expression system comprising the nucleic acid sequences described above, in altered form (e.g., by mutation), to block, reduce or increase the formation of myocytes in the plant. Those of ordinary skill in the art can easily determine the appropriate expression systems. For example, genes under the control of a suitable promoter can be easily transformed in most culture plants by Agrobacterium-mediated methods and / or biolistic methods. See P. Christou, Trends in Plant Science 1: 423-431. Additional embodiments of methods for producing transgenic plants that are capable of producing seedless fruits and / or flowers without pollen in a plant include the step of transforming a plant with the nucleic acid sequences described above to block, reduce or increase the formation of myocytes through the use of antisense and related techniques. Sense and antisense technology are routine methods to alter the development and metabolism of the plant. For example, consult Jorgensen, R.A. et al, Plant Mol. Biol. 31 (5): 957-73 (1996). The sense and antisense constructs can be easily introduced into plant cells by methods mediated by Agrobacterium and / or biolistic methods. See P. Christou, Trends in Plant Science 1: 423-431. In another embodiment, the present invention relates to methods for producing seedless fruits and / or flowers without pollen in a plant comprising the step of expressing in the plant the nucleic acid sequences described above in altered form to affect the formation of myocytes. on the floor In a preferred embodiment of the present invention, the method described above comprises the step of transforming a plant with an expression system comprising a nucleic acid or its complement involved in the formation of myocytes, comprising: (a) nucleic acid encoding a protein according to Figure 3 (SEQ ID NO: 4), (b) a nucleic acid as set forth in Figure 2 (SEQ ID NO: 1), or a portion thereof, or (c) a nucleic acid as set forth in nucleotides 81- 1024 of Figure 2 (SEQ ID NO: 1), or a portion thereof, in which the nucleic acids are mutated to block, reduce or increase the formation of myocytes in the plants, thereby rendering the plants capable of produce fruits without seeds or flowers without pollen. In another embodiment of the present invention, there is provided a method for producing a plant capable of producing seedless fruits or flowers without pollen, comprising the step of mutating endogenous DNA from the plant responsible for the formation of myocytes, in which the formation of myocytes is affected and the plant becomes capable of producing fruit without seeds or flowers without pollen, or fruits and flowers that are substantially free of seeds and without pollen, respectively. In a preferred embodiment of the invention, the endogenous DNA has been mutated by direct mutagenesis. See Mazzucato, A., et al, Development 125 (1): 107-114 (1998).

"Transgenic plants" includes plants that contain endogenous or exogenous DNA or RNA that does not occur naturally in the wild type (original) of the known plant or variants, or that contains additional or inverted copies of DNA that occurs naturally which it is introduced as described herein, its progeny, whether produced from seeds, by vegetative propagation, cell culture, tissue or protoplast, or the like. The transgenic plants of the present invention may contain DNA encoding SPL protein or SPL-like proteins involved in myocyte formation in the plant. For example, when introduced into and / or present in plant cells, the expression of SPL DNA or altered versions of SPL DNA can produce a plant that lacks myocytes or that has more than the normal number of myocytes that is found in non-transformed plants of the same variety. For example, the macl corn mutant that has an excess number of myocytes causes complete male sterility and partial female sterility. The mechanism by which an excess of myocytes results in sterility is currently unknown. See Sheridan, W.F. et al, Gentiles 142: 1009-1020 (1966). The DNA according to the present invention may be exogenous DNA added in a sense or antisense orientation and which encodes a protein involved in, and which may be required for, the formation of myocytes in a plant. See Jorgensen, R.A. et al, Plant Mol. Biol. 31 (5): 957-73 (1996). The DNA of the present invention may also be exogenous DNA that has been altered (eg, by mutation) so as to block, reduce or increase the formation of myocytes. For example, the insertion of genetic elements, such as Ds sequences (with or without active Ac sequences) can affect myocyte formation, and is therefore of particular use in the present invention. The present invention also provides direct or target mutagenesis of the endogenous DNA of a plant responsible for myocyte formation, which can also affect the formation of myocytes. Exogenous and endogenous DNA involved in the formation of myocytes that has been mutated by direct mutagenesis differs from the corresponding wild-type (naturally occurring) DNA in that those sequences contain a substitution, deletion or addition of at least one nucleotide and can encode proteins that they differ from the corresponding wild type protein by at least one amino acid residue. As used herein, the term "nucleotide" includes a DNA or RNA residue. Exogenous DNA, in altered or unaltered form, can be introduced into the target plant by well-known methods, such as Agrobacterium-mediated transformation, microprojectile bombardment, micro injection or electrophoration. See Wiikinson, J.O., et al, Nature Biotechnology 15 (5): 444-447 (1997). Plant cells that carry exogenous SPL or SPL type DNA, or Endogenous SPL DNA mutated by direct mutagenesis, can be used to generate transgenic plants in which myocyte formation is blocked, reduced or increased, and therefore be sources of additional plants, either through seed production means or asexual reproduction means, without seed (ie, cutting, tissue culture, and the like). The present invention also provides plants, plant cells and plant seed transformed with the nucleic acid sequences described above. The formation of myocytes can be affected in said transformed plants, plant cells, and plant seeds during the formation of myocytes and during the growth of plants. According to another embodiment of the present invention, a family of isolated proteins is provided which can regulate or control the formation of myocytes in male and female organs in plants. These proteins include proteins that they are functionally and structurally related to SPL and therefore are able to return to a plant capable of producing seedless fruits and / or flowers without pollen by interference with the SPL function. These proteins also include related proteins from other plant species that are functional and structural equivalents of SPL in these species and perform the same function as SPL performed in Arabidopsis. An amino acid structure illustrative of the proteins of the present invention is set forth in Figure 3 (SEQ ID NO: 4). The proteins of the present invention are involved in the formation of myocytes in plants and comprise an amino acid sequence that has at least 80%, more preferably about 90% amino acid identity to the reference amino acid sequence in Figure 3 (SEQ ID NO: 4); with more than 95% amino acid sequence identity being especially preferred. In a preferred embodiment, the invention provides proteins comprising or having the same amino acid sequence as set forth in Figure 3 (SEQ ID NO: 4). According to another embodiment of the present invention, antibodies generated against the proteins described above are provided. Such antibodies can be used in several applications, including to locate sites of regulatory activity in plants. In another embodiment of the present invention, fusion proteins are provided which can comprise any of the amino acids described above, and in a preferred embodiment, an SPL or SPL type protein. The fusion proteins according to the present invention may also comprise an additional polypeptide, such as a protein tag, which can be used to detect SPL protein / protein interaction sites in plants. According to yet another embodiment of the invention, the nucleic acid molecules described herein (or fragments thereof) can be labeled with an easily detectable substituent and used as hybridization probes to analyze the presence and / or the amount of SPL or SPL type DNA or RNA in a sample of a given plant species. In a preferred embodiment of the invention, the isolated nucleic acid useful as a hybridization probe comprises a nucleic acid having a nucleotide sequence as set forth in Figures 1A (SEQ ID NO: 2) or 2 (SEQ ID N0: 1). ) or a portion thereof. In a more preferred embodiment of the invention, the hybridization probe can be a nucleic acid comprising a nucleic acid having a nucleotide sequence as set forth in nucleotides 81-1024 of Figure 2 (SEQ ID NO: 1) or a portion of it. The nucleic acid molecules described herein, and fragments thereof, are also useful as primers and / or standards in a PCR reaction to amplify gens encoding SPL protein or SPL-like proteins described herein. Another embodiment of the invention provides a promoter isolated from the SPL gene. A DNA fragment extending from 2690 nucleotides upstream of the start codon of the SPL gene has been identified as a regulator of expression of the SPL gene. The sequence of this promoter is shown in Figure 5 (SEQ ID NO: 15) as the sequence from the base pair -2690 to -1 in the sequence. The first nucleotide of the start ATG codon is designated as the +1 position in the sequence. The sequence from -2690 to -1 is sufficient to give specific expression of SPL in megaesporocytes and microsporocytes. As used herein, "promoter" includes this sequence, a sequence that hybridizes to this sequence and promotes the expression of a coding sequence operably linked to it, and functional fragments of this sequence that are capable of promoting or regulate the expression of a coding sequence operably linked to it. The promoter can be operably linked to a coding sequence if it is chained to the ATG start codon of the coding sequence. The SPL gene promoter can be used to direct the expression of the SPL gene or a foreign gene in microsporocytes and megaesporocytes of plants. One utility of the promoter is to allow the expression of transgenes in a specific manner in the reproductive cells of the plant. If a transgene, such as a gene encoding a ribonuclease, is expressed under the control of the SPL promoter, the plants will become sterile. Alternatively, the SPL promoter can be used to express genes encoding transposases or recombinases (proteins that catalyze DNA rearrangements) specifically in the reproductive cells (sporocytes), such that the next generation of seeds will have an altered DNA structure. of the original plant. For example, a plant carrying a Cre recombinase under the control of the SPL promoter can be used to cut segments of transgenic DNA specifically from sporozoites. As a result, the original plant will carry the transgenes, but the progeny will lack the transgenes. This result is useful when you want to avoid the propagation of transgenes from one generation to the next. The following studies were conducted in connection with the present invention and should not be considered as limiting the scope of the present invention. Mutations in the recessive spl gene were identified during the evaluation of lines that trap genes in Arabidopsis thaliana ecotype landsberg erecta. From a discovery that these mutations caused male and female sterility in the plant, it was concluded that the SPL gene plays a pivotal role in plant reproduction. The homozygous spl plants also exhibited a total morphology that was similar to the morphology of wild type plants, except for a delay in senescence in the homozygous spl plants. Additionally, the flowers of the homozygous spl plants were found to have a normal number of organs, as in the wild-type plants, except that the flowers of the homozygous spl plants include white, flat anthers and lack visible pollen grains in them. the anthesis in stage 13-14. See D.R.Smyth, J.H. Bowman, E.M. Meyerowitz, 1990, Plant Cell 2, 755. The carpel of these homozygous spl plants also appears morphologically normal, although it is infertile when pollinated with wild-type pollen grains. The orthological studies using complete assembly of elimination techniques and section formation show that the myocyte formation was affected in the antero and carpel of homozygous spl plants. Studies of homozygous spl plants also revealed that in mutant spl flowers the hypodermic cell of the antero was slightly elongated in stage 7 and differentiated into an arc-spherical cell, as normally occurs in wild-type flowers. The arc-spherical cell later differentiated and was sometimes divided perillinally to form the PPC layer and the PSC layer. The PPC layer was occasionally split an additional time to produce two layers of secondary parietal cells that ceased dividing. However, cells closer to the center of the antero became vacuolated, and the development of microsporocytes and tapetum was not observed. Additionally, in the anthesis in stages 13-14, the anthers were composed of highly vacuolated parenchymal cells, and in some cases, several vascular cells were also present. In contrast, the results of the previous studies differ from those of the wild type Arabidopsis in which it was discovered that the wild type exhibits microsporogenesis as typically exhibited by dicotyledonous plants. Specifically, in mature flowers in stage 7, a single hypodermic cell at each corner of the anterior locules expanded radially and differentiated into an arc-spherical cell. The arcoesporial cell passed a periclinal division, resulting in an inner primary sporoginous cell (PSC) layer and an outer layer of primary parietal cell (PPC). The PPC layer was subsequently split perilinally and anticlinally to form two layers of secondary parietal cell (SPC), while the inner SPC layer was differentiated in the tapetum. The outer SPC layer was then divided periclinally an additional time to form two layers more called the endothecium, which lies on the outer side, and the intermediate layer, which lies internally. None of these layers that descend from the PPC or primary parietal cell layer have any direct role in the formation of spores, although they are important for the maturation of pollen grains. The spores were formed from the cells of the PSC layer (primary spore layer) which differs directly into microsporocytes (male myocytes) also referred to as pollen stem cells (PMCs) in late stage 8 flowers. During stage 9, the PMCs were separated from one another by the deposition of callus on the cell wall, and passed miosis subsequently. See Bowman, J., 1994, Arabidopsis, An Atlas of Morphology and Development. At the same time, the tapetum became visible and appeared binucleate due to endomitosis. It was concluded from the previous studies with the mutant spl in comparison to the wild type plants that the microsporogenesis in spl mutant plants is blocked during the transition from the PSC layer to microsporocytes, resulting in a phenotype lacking any microsporocytes. In the spl mutants that were studied according to the present invention it was also discovered that ovule primordia formed in a normal manner, and the superior hypodermic cell increased slightly in size. The arc-spherical cell was formed as in the wild-type plant, but was unable to elongate longitudinally to develop into megaesporocyte or female myocyte. Therefore, the mutant spl failed to form megaesporocytes, and as a result, the nucleus was arrested. However, the interior and exterior integuments were differentiated in a normal way as in the flowers of the wildflower type. The endothelium also differed from the inner cell layer of the inner integument. Shortly after the integument developed in the stage 13 flowers, the upper epidermal cell of the arrested nucleus lengthened and began to divide transversally and mitotically, and immediately the two epidermal neighborhood cells were also divided transversely. As a result, the nucleus grew into microfilm to produce a three-layered finger-like structure over a longitudinal section of the ovule in and after flowers of stage 14. The spl mutation prevented the transition from the arc-spherical cell to mega-porpoise during mega-porogenesis, This was evident in part due to the absence of callus deposition on the carpel at different flower stages, as observed during complete assembly stain with aniline blue. However, this did not affect the development of sporotic tissues such as integument, thus indicating that the spl mutation specifically blocked the arc-spherical cell-megaesporocyte transition in the plant. The SPL gene product therefore seems to play a pivotal role in the formation of microsporocytes in the male plant and megaesporocytes in female plants. Genetic studies, including Southern blot analysis using the 5 'Ds sequence as a probe, showed that the sterile spl phenotype was caused by a single Ds insert. Additional reversion experiments confirmed that the mutant spl gene is marked by the Ds element. The elimination of this Ds element by the Ac transposase gene restored sporozoite formation and normal fertility. In those experiments, ten independent revertant plants were isolated, which were completely fertile. In each case, it was determined that the Ds element within the SPL gene has undergone precise elimination, restoring the wild-type sequence and function. The genomic sequences flanking the Ds element were detected by the use of the interlaced thermal asymmetric PCR (TAIL PCR) technique, as described by Liu, et al, The Plant J., 8: 457 (1995). As shown in Figures 1A and 1B (SEQ ID NOS: 2 and 3) the fragments immediately flanking each of the 3 'and 5' ends of the Ds element were sequenced and found to contain, as expected, the 3 'and 5' portions of the sequence Ds. The above PCR fragments were used as a probe to evaluate a cDNA library from Arabidopsis thaliana landsberg erecta flower. A cDNA clone of the SPL gene was isolated and sequenced. As shown in Figure 2 (SEQ ID NO: 1), it was found that the full length of the cDNA clone is 1302 bp in length and that it encodes a 314 amino acid polypeptide having a molecular weight of 34 kDa, as shown in Figure 3 (SEQ ID NO: 4). Additionally, searches of protein sequence databases revealed that the SPL protein, as shown in Figure 3 (SEQ ID NO: 4), was not homologous to any known protein, thus confirming the novelty of the SPL protein. Specifically, it was discovered that a 33 amino acid domain from positions 149 to 181 of the SPL protein is homologous to an amino acid region of Sacchromyces cerevisiae SWE1, a mitosis inhibitor, with 45% identity. Another region of 15 amino acids from positions 119 to - * »-" ¿a * -Aa ^ AAaaB * i • * - * - * '-' • - • - - * - - 133 of the SPL protein was found to be homologous, with 73% identity, a an amino acid region of the rat precursor 3-hydroxyisobutyrate dehydrogenase, however, both regions of the above amino acids are unrelated proteins and have an unknown function.In addition, there is a predicted helix region in the SPL protein from amino acids 64 to 85 which has limited homology with the first helix region of the protein motif called the MADS domain that binds DNA.The MADS domain is a highly conserved region of about 57 amino acids that is found in a family of transcription factors called MADS box factors ( see, for example, Kramer et al, Genetics, 149: 765-783 (1998) SPL does not have the entire MADS domain, but shows good conservation for the first 18 amino acids in this domain A comparison of amino acids 64 to 80 SP L with the first amino acids of the MADS domain from known regulatory proteins of this class from a variety of species is shown in Figure 4 (SEQ ID NOS: 5-14). As shown in Figure 4, the listed MADS box transcription factors are the AP3, AG, AGL5, and AGL11 proteins of Arabidopsis, DEFA and GLO proteins of Antirrhinum (dragonera); BOAP1 of Brassica olerácea; Petunia FBP11; MCM1 proteins, RLM1, SMP1 of embryo yeast; and human proteins SRF and MEF2D.

The nuclear localization of SPL and its partial homology with the MADS domain proteins described above suggest that SPL may represent a new class of transcriptional regulatory protein. Northern blot analysis of polyA + RNAs from flowers, roots, leaves, stems and silica of Arabidopsis using the cDNA clone described above as a probe revealed a band of 1.3 kb only in RNA that was extracted from the flower, thus suggesting that the SPL gene is expressed differently in tissues of different plants. In situ hybridization using labeled antisense RNA, synthesized from the SPL cDNA clone, also demonstrated that the SPL gene is expressed in sporogenous cells in flowers, which is consistent with the biological function of the gene. As shown in Figures 1A, 1B (SEQ ID NOS: 2 and 3) and 2 (SEQ ID NO: 1), a comparison of genomic sequences with an Arabidopsis cDNA sequence revealed that the Ds element is inserted between the bases 411 and 412 of the SPL gene. This insertion of the Ds element caused a 4bp duplication of the host sequence at the site of insertion. The sequences that were obtained from more than 10 independent reversion lines revealed a perfect elimination, and no traces, thus indicating the importance of the region comprising the amino acids that immediately flank the site of insertion to the function of the SPL gene. This conclusion is based on the observation that all the revertants of the spl mutation were precise eliminations of the Ds element. When a Ds element is inserted into a gene, there are revertants in which there are typically small deletions, substitutions or insertions of one or two amino acids (Wessier, S.R., Science 242 (4877): 399-405 (October 21, 1988)). The failure to recover said revertants from the spl mutation is evidence that even small changes in the amino acid sequence at the insertion site are detrimental to the function of the SPL protein. Southern hybridization analysis showed that the SPL gene is a simple gene. According to the present invention, the Sporocyteles (SPL) gene of Arabidopsis thaliana therefore seems to play an important, if not essential, role in the transition from arc-spherical cells to myocytes in male and female plant organs. As previously established, sporogenesis is a key step in the reproduction of a plant, and therefore the ability of a plant to control sporogenesis also affects the ability of the plant to produce seeds. The genetic studies of the Arabidopsis spl mutation described herein show that the SPL gene encodes a protein that is important, if not essential, for myocyte formation. Using transposon labeling, the SPL gene was isolated and characterized. Additional Southern analyzes under moderate stringency levels should reveal SPL homologs in other plant species, such as corn and rice, which have the same or similar function as the SPL gene.

As stated above, the isolated DNA provided by this invention can be used as a probe to isolate in other plant species DNA sequences that are homologous to the SPL gene and encode regulatory proteins that are involved in the formation of myocytes in the same way or similar as is the protein encoded by the SPL gene. As stated above, the terms "homology" and "homolog" in the present invention mean a total sequence identity of at least 50%. The identification and isolation of SPL-like gens (ie, SPL gene homologs) of other plant species can be carried out according to standard methods and procedures known to those skilled in the art. See, for example, Sambrook, et al, Molecular Cloning, A Laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). By using these and other similar techniques, those skilled in the art can easily isolate not only the SPL gene from different cells and tissues of Arabidopsis, but also SPL gene homologs from other plant species. For example, SPL or SPL-like genes in other plant species can be identified and isolated by preparing a genomic and / or cDNA library of the plant species, followed by probing either or both libraries with all or a portion of any of the sequences shown in Figures 1A (SEQ ID NO: 2) and 2 (SEQ ID NO: 1), or their homologs, identifying the hybridized sequences, and isolating the hybridized DNA to obtain the SPL gene or SPL type. Once identified, these SPL or SPL-like genes from other plant species can be mapped by restriction, sequenced and cloned. The isolated SPL gene, or a homolog thereof, can also be altered and then introduced into Arabidopsis or another plant species to regulate and control the formation of myocytes to produce seedless fruits and / or plants without pollen. For example, a genetically engineered SPL gene can be incorporated into a plant line, which has been grown for other traits, to produce seedless fruits. Myocyte formation can also be blocked by lowering SPL protein expression levels using antisense constructs or co-suppression of the SPL gene. Alternatively, by placing the sense or antisense SPL gene under the control of different inducible promoters, the formation of myocytes can also be controlled, subject to environmental conditions and specific applied chemicals. "Co-suppression" refers to the overexpression of an endogenous or exogenous introduced gene (transgene), in which extra copies of the gene cause coordinated silencing of the endogenous gene and the transgene, thereby reducing or eliminating the expression of a certain trait See, for example, the patents of E.U.A. Nos. 5,034,323 and 5,283,184. The transgene can be introduced in a sense or antisense orientation and does not require full or absolute sequence length homology to the endogenous sequence designed to be deleted.

Additionally, a dominant negative mutant of the SPL protein can be constructed by using a truncated version of the SPL gene that is able to interact with its partners, but is unable to fully realize its biological activity. See Wiikinson, J.O., et al, Nature Biotechnology 15 (5): 444-447 (1997). If this truncated gene is introduced into a plant under the control of a strong promoter, the transgenic plant must reduce or lose its ability to form seeds. Therefore, a dominant negative truncated SPL gene could act as a substitute for the antisense SPL gene. The dominant negative SPL gene method also has advantages over the antisense construct when seedless or non-pollen plants are genetically engineered, including that the antisense strategy depends on initially cloning part or all of the SPL gene of each plant species, followed by the expression of the gene in an inverted orientation. Antisense suppression also depends on the expression of complementary nucleotide sequences, which vary from one species to another. In contrast, the dominant negative strategy depends only on the functional conservation of the protein and its target sites, which is a far less stringent requirement than the conservation of nucleotide sequences. There are several examples of regulatory proteins that can perform a similar function when expressed in widely divergent plant species, as discussed in Lloyd, A.M. et al, (1992), Science 258: 1773-1775; Irish, V.F. and Yamamoto, Y.T., (1995), Plant Cell 7: 1635-1644. This type of functional conservation suggests that the dominant negative version of the SPL gene of Arabidopsis can also work similarly in other plant species. The following examples describe specific aspects of the invention to illustrate the invention and describe methods for isolating and identifying the SPL gene. The examples should not be considered as limiting the invention in any way. All references in this application, including those to materials and methods, are incorporated herein by reference.

EXAMPLE 1 Transposon marking Plants were grown at 22 ° C under a 16 h light / 8 h dark cycle in greenhouses at the Institute of Molecular Agrobiology, 1 Research Link, Singapore. Initiators lines containing Ds or Ac segments for transposers of F2 seeds were crossed and evaluated, according to Sundaresan, V., et al, 1995, Genes and Development, 9: 1797-1810. The mutant spl gene was identified from a collection of transposers by their sterile male and female phenotypes. The genetic analyzes were carried out using techniques recognized in the art. The mutant spl gene showed that it is recessive and caused by a single Ds insertion. The phenotype of the mutant spl gene was characterized by standard cytological methods, as discussed in, for example, O'Brien, T.F. and McCully, M.E., 1981, The Study of Plant Structure: Principles and Selected Methods, Termarcarphi, Melbourne; and by full assembly release methods, as described in Herr, J.J.M., 1982, Strain Technol. 57: 161-169.

EXAMPLE 2 DNA analysis The DNA analysis procedures were performed mainly as described in Sambrook, J. Et al, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, New York. For Southern blot analysis, 100-200ng of Arabidopsis DNA were extracted from flower buds and digested with EcoRI, HindIII, or Xba I and electrophoresed on a 1% agarose gel before transfer to a membrane. nylon. The Ds probe, an EcoRI fragment from the 5 'end of the trap gene construct, DsG (see Sundaresan et al, Genes and Development 9: 1797-1810 (1995), was prepared by digesting the plasmid pWS3l, which contains parts of Ds elements, with EcoRI and separating the resulting fragments by gel electrophoresis An EcoRI fragment of 1.8kb of a Ds 5 'element was cut from the gel and labeled with 32p-CTP, using the Rediprime equipment from Amersham. Southern blot under standard conditions of DNA hybridization.

To isolate the DNA immediately flanking the Ds element, approximately 10ng of DNA from flower buds was used for TAIL PCR (Liu et al, 1995, The Plant J. 8, 457). The amplified fragments were isolated by gel electrophoresis and sequenced. The PCR fragments were labeled with 32p-dCTP and used to evaluate a flower cDNA library. The phages in the library that hybridized to the PCR fragments were purified, and plasmid DNA was removed in vitro according to a standard protocol. The size of the insert was determined by digesting the plasmid with the restriction enzymes EcoRI and Kpnl, both available from Stratagene.

EXAMPLE 3 RNA analysis Northern blot analysis of polyA + RNA from various tissues of Arabidopsis was performed using a 1 kb Hind lll fragment of the cDNA clone of Figure 2 (SEQ ID NO: 1) as a probe. RNA was extracted from different tissues using standard methods. 10 μg of polyA + RNA from each sample was electrophoresed on a 1% agarose gel and transferred to a nylon membrane. The membrane was then hybridized with a 32p-dCTP labeled probe.

EXAMPLE 4 Sequence formation of the SPL gene The cloned SPL cDNA of Figure 2 (SEQ ID NO: 1) was sequenced using the dideoxy method with fluorescently labeled terminators. Oligonucleotide primers T3 and T7, which hybridized to the plasmid vector containing the SPL cDNA, were used to generate initial sequences from the ends of the clone. Then, additional primers were designed within the SPL gene, based on the above sequences, and used for sequence formation of the central region of the SPL gene. Approximately 600-700 bp of the clone could be read from each primer.

EXAMPLE 5 Location in situ of the SPL mRNA.

Flower buds were fixed with FAA for 20 minutes at 4 ° C, they were dehydrated with ethanol and made transparent with xylene. The tissues were embedded in paraplastic and 10 μm thick sections were made. Sections were deparaffinized with xylene and processed for in situ hybridization. To obtain sense RNA probe, the plasmid containing SPL cDNA was linearized with Kpn I and transcribed with T3 RNA polymerase in the presence of DIG-UTP. For antisense RNA probe, the plasmid was cut with BamHl and transcribed in the presence of DIG-UTP with T7 RNA polymerase. The lengths of the probes were reduced by alkaline treatment to a fragment having a length of approximately 150 bp. Hybridization was performed according to a standard protocol. See Jackson, D., 1991, In situ Hybridization in Plants, in Plant Pathology: A Practical Approach, Oxford University Press.

EXAMPLE 6 Determination that the SPL protein is a nuclear protein It has been determined that the SPL protein is a nuclear protein. A translation fusion of the SPL protein to the GUS reporter gene (Jefferson, R.A., Nature 342 (6251): 837-8 (Dec. 1989)) was used for this purpose. The method that was used to determine nuclear localization has been previously described for other proteins (for example Pepper et al, Cell 78 (1): 109-116 (1994)). Two primers, SPL-Xba-S: 5'CTAGTCTAGTCTAGAAGATCATCA3 '(SEQ ID NO: 16) and SPL-BamH1-T: 5'CGGATCCAAGCTTCAAGGACAAATCAATGGT 3' (SEQ ID NO: 17), which introduced restriction enzyme sites immediately upstream of the SPL start codon and the high SPL codon, respectively, were used to amplify the complete SPL coding sequence from the cDNA. This amplified fragment was cloned in front of the GUS gene in vector pB1221 (Clontech), giving rise to clone pB1221-SPL, which encodes an SPL-GUS fusion. The gene fusion in pB1221-SPL is driven by the promoter and will result in the synthesis in plant cells of a fusion protein consisting of the SPL protein in the N-terminus and the GUS protein in the complete C-terminus. Plasmid DNA pB1221-SPL was introduced into onion epidermal cells using the BioRad PDS-1000 / He particle bombardment system. The samples were kept overnight at room temperature and stained with X-Gluc, a histochemical stain for GUS activity (Jefferson, R.A., Nature 14: 342 (6251): 837-8 (Dec. 1989)). It was discovered that the SPL-GUS fusion protein is located exclusively in the nucleus, whereas in the same experiment a control GUS protein without fusion was localized to the cytoplasm. This experiment demonstrates that SPL is a nuclear protein, which is consistent with its proposed function as a regulatory protein that is required for the development of sporozoites.

EXAMPLE 7 Promoter of the SPL gene A DNA fragment of 2690 nucleotides upstream of the start codon of the SPL gene was fused to a GUS gene without promoter in a binary T-DNA vector designated pZIPIII (Hajdukiewicz, P., et al, Plant, Mol. Biol. : 989-994 (1994) for plant transformation The SPL-GUS promoter co-construct was introduced into Landsberg plants by vacuum infiltration and transformed plants were selected by standard methods, (eg, Bechtold, N., and Pelletier, G., Methods Mol. Biol. 82: 259-266 (1998).) A histochemical staining procedure was used to monitor the expression of the GUS reporter gene (Jefferson, RA, Nature 342 (6251): 837-8 (Dec. 1989).) The transgenic plants showed expression of the GUS reporter gene in the megaesporocytes and microsporocytes.The pattern of GUS expression that was observed was similar to the expression pattern of the SPL gene, as determined by in situ localization of SPL RNA ( see example 5 above). experiment showed that the 2690 base pairs of DNA upstream of the start codon of SPL contain the SPL promoter region, and that this DNA sequence was sufficient to confer the SPL gene expression specificity (ie, the expression in Ectocytes) to a heterologous transgene such as the GUS gene. Although the invention has been described in detail with reference to certain preferred embodiments thereof, it will be understood that the modifications and variations are within the spirit and scope of those described and claimed.

Claims (53)

NOVELTY OF THE INVENTION CLAIMS

1. - An isolated nucleic acid or its complement comprising nucleic acid encoding a protein according to SEQ ID NO: 4.

2. An isolated nucleic acid or its complement according to claim 1, further characterized in that said nucleic acid comprises a nucleic acid as set forth in SEQ ID NO: 1.

3. An isolated nucleic acid or its complement according to claim 2, further characterized in that said nucleic acid comprises a nucleic acid as set forth in nucleotides 81-1024 of SEQ ID NO: 1.

4. An isolated nucleic acid or its complement that encodes a protein that participates in the formation of myocytes in a plant, further characterized in that said nucleic acid comprises DNA that occurs naturally, or DNA degenerated to said DNA that occurs naturally, of a plant that hybridizes to the DNA of (a) SEQ ID NO: 2 or SEQ ID NO: 3, or portions thereof, or (b) SEQ ID NO: 1, or portions thereof, under moderately rigorous, in which the naturally occurring DNA has at least 70% identity to the DNA of (a) or (b), and in which said naturally occurring DNA encodes said protein.

5. - An isolated nucleic acid or its complement according to claim 4 having at least 70% identity with (a) nucleotides 81-1024 of SEQ ID NO: 1, or a portion thereof, or (b) variations from (a) that encode the same amino acid sequence as it is encoded by (a), but use different codons for some of the amino acids.

6. An isolated nucleic acid that encodes a protein involved in the formation of myocytes in a plant, further characterized in that said protein comprises: (a) the same amino acid sequence as set forth in SEQ ID NO: 4, or (b) an amino acid sequence having at least 80% homology to the amino acid sequence as set forth in SEQ ID NO: 4 and which is involved in myocyte formation in a plant.

7. An isolated nucleic acid according to any of claims 1 to 6, further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes in a plant.

8. An isolated nucleic acid according to claim 7, further characterized in that said nucleic acid has been mutated by insertion of one or more genetic elements.

9. An isolated nucleic acid according to claim 8, further characterized in that said genetic elements comprise a sequence Ds. -Jtj ^ d? H.

10. A protein that is required for the formation of myocytes in a plant, further characterized in that said protein comprises: (a) the same amino acid sequences as set forth in SEQ ID NO: 4, or (b) an amino acid sequence that it has at least 80% homology with the amino acid sequence as set forth in SEQ ID NO: 4 and that is involved in myocyte formation in a plant.

11. An antibody that recognizes and binds to a protein according to claim 10.

12. A fusion protein comprising any of the amino acid sequences according to claim 10.

13. A plant transformed with a isolated nucleic acid sequence or its complement comprising nucleic acid encoding a protein according to SEQ ID NO: 4.

14. A plant transformed with an isolated nucleic acid sequence or its complement according to claim 13, further characterized in that said nucleic acid sequence comprises a nucleic acid as set forth in SEQ ID NO: 1.

15. A plant transformed with an isolated nucleic acid sequence or its complement according to claim 14, further characterized in that said nucleic acid sequence comprises a nucleic acid sequence as set forth in nucleotides 81-1024 of SEQ ID NO: 1.

16. - A plant according to claim 13, 14 or 15 further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes in said plant.

17. A plant seed transformed with an isolated nucleic acid sequence or its complement comprising nucleic acid encoding a protein according to SEQ ID NO: 4.

18.- A plant seed transformed with a nucleic acid sequence isolated or its complement in accordance with the claim 17, further characterized in that said nucleic acid sequence comprises a nucleic acid as set forth in SEQ ID NO: 1.

19. A plant seed transformed with an isolated nucleic acid sequence or its complement in accordance with the claim 18, further characterized in that said nucleic acid sequence comprises a nucleic acid sequence as set forth in nucleotides 81-1024 of SEQ ID NO: 1.

20. A plant seed according to claim 17, 18 or 19 further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes in a plant.

21. A plant cell transformed with an isolated nucleic acid sequence or its complement comprising nucleic acid encoding a protein according to SEQ ID NO: 4.

22.- A plant cell transformed with a nucleic acid sequence isolated or its complement according to claim 21, further characterized in that said nucleic acid sequence comprises a nucleic acid as set forth in SEQ ID NO: 1.

23. A plant cell transformed with an isolated or isolated nucleic acid sequence. its complement according to claim 22, further characterized in that said nucleic acid sequence comprises a nucleic acid sequence as set forth in nucleotides 81-1024 of SEQ ID NO: 1.

24.- A plant cell in accordance with claim 21, 22 or 23 further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes in a plant.

25. A method for producing a transgenic plant that is capable of producing fruits substantially free of seeds or flowers substantially free of pollen, comprising the step of transforming a plant with a nucleic acid or its complement comprising nucleic acid encoding a protein in accordance with with SEQ ID NO: 4.

26. A method for producing a transgenic plant that is capable of producing fruits substantially free of seeds or flowers substantially free of pollen, comprising the step of transforming a plant with a nucleic acid sequence or its complement according to claim 25, characterized in addition because said nucleic acid sequence comprises a nucleic acid sequence as set forth in SEQ ID NO: 1. && amp;

27. - A method for producing a transgenic plant that is capable of producing fruits substantially free of seeds or flowers substantially free of pollen, comprising the step of transforming a plant with a nucleic acid sequence or its complement according to claim 26, further characterized in that said nucleic acid sequence comprises a nucleic acid sequence as set forth in nucleotides 81-1024 of SEQ ID NO: 1.

28. A method according to claim 25, 26 or 27 further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes in said plant, therefore returning to said plant capable of producing said fruits without seeds or flowers without pollen.

29. A method according to claim 28, further characterized in that said nucleic acid is a nucleic acid according to claim 27.

30.- A method according to claim 28, further characterized in that said nucleic acid has been mutated by inserting one or more genetic elements.

31. A method according to claim 30, further characterized in that said genetic elements comprise a sequence Ds.

32. A method for producing fruits substantially free of seeds or flowers substantially free of pollen in a plant, comprising the step of expressing in said plant an isolated nucleic acid sequence or its complement comprising a nucleic acid sequence encoding a protein of according to SEQ ID NO: 4, further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes and thereby produce said seedless fruits or flowers without pollen in said plant.

33. A method for producing fruit substantially free of seeds or flowers substantially free of pollen in a plant, comprising the step of expressing in said plant an isolated nucleic acid sequence or its complement according to claim 32, further characterized in that said sequence of nucleic acid comprises a nucleic acid sequence as set forth in SEQ ID NO: 1, further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes and thereby produce said fruits without seeds or flowers without pollen in said plant.

34. A method for producing fruits substantially free of seeds or flowers substantially free of pollen in a plant, comprising the step of expressing in said plant an isolated nucleic acid sequence or its complement according to claim 33, further characterized in that said sequence of nucleic acid comprises a nucleic acid sequence as set forth in nucleotides 81-1024 of SEQ ID NO: 1, further characterized in that said nucleic acid has been mutated to block, reduce or increase the formation of myocytes and thereby produce said fruits without seeds or flowers without pollen in said plant.

35. A method according to claim 32, 33 or 34, further characterized in that said nucleic acid has been mutated by insertion of one or more genetic elements.

36. A method according to claim 35, further characterized in that said genetic elements comprise a sequence Ds.

37. An isolated nucleic acid or its complement useful as a hybridization probe, further characterized in that said nucleic acid comprises a nucleic acid having a nucleotide sequence as set forth in SEQ ID NO: 2, or SEQ ID NO: 1, or a portion thereof.

38.- A method to produce a plant capable of producing fruits substantially free of seeds or flowers substantially without pollen, comprising the step of mutating endogenous DNA of said plant responsible for the formation of myocytes, further characterized because said myocyte formation is blocked, reduces or increases and said plant becomes capable of producing said fruits without seeds or flowers without pollen.

39.- A method according to claim 38, further characterized in that said endogenous DNA has been mutated by direct mutagenesis.

40. - An isolated nucleic acid or its complement comprising nucleic acid encoding a mutant SPL polypeptide that blocks, reduces or increases the formation of myocytes in a plant.

41. An isolated DNA comprising DNA having at least 8 5 consecutive nucleotides of bases 81-1024 of SEQ ID NO: 1, or a complement thereof.

42. The isolated DNA according to claim 41, further characterized in that said DNA has at least 15 consecutive nucleotides of bases 81-1024 of SEQ ID NO: 1. 10

43. An isolated DNA further characterized in that said isolated DNA consists of 8 or more consecutive nucleotides of a nucleotide sequence 81-1024 of SEQ ID NO: 1, or a complement thereof.

44.- The isolated DNA according to claim 43 further characterized in that said DNA consists of 15 or more nucleotides 15 consecutive of a nucleotide sequence 81-1024 of SEQ ID NO: 1.

45.- An isolated nucleic acid sequence comprising a nucleic acid sequence as set forth in nucleotides -2690 to -1 of SEQ ID NO: 15 or a nucleotide sequence that hybridizes to said sequence and promotes the expression of a coding sequence 20 chained operably to said nucleotide sequence.

46.- A sequence of isolated nucleotides or functional fragments thereof, capable of regulating the expression of a chained gene in an operative manner, said sequence comprises a sequence of nucleotides located within nucleotide positions -2690 to -1 of the nucleotide sequence set forth in SEQ ID NO: 15, or a nucleotide sequence that hybridizes to said sequence and promotes the expression of an operably linked gene.

47.- A fragment of isolated DNA to direct the expression of an endogenous or foreign gene in a cell, said fragment comprises a sequence as set forth in nucleotides -2690 to -1 of SEQ ID NO: 15 operably linked to a codon ATG start of a foreign or endogenous gene.

48. A sequence of isolated nucleotides as set forth in claim 45 or 46, operably linked to a foreign or endogenous functional gene.

49. A method for regulating the expression of a gene that comprises providing a gene of interest operably linked to an SPL gene promoter, transferring said gene operably linked to a cell and expressing said gene under gene expression conditions, characterized further because said SPL gene promoter comprises a nucleotide sequence located within the nucleotide positions -2690 to -1 of the nucleotide sequence set forth in SEQ ID NO: 15 or a sequence of nucleotides that hybridize to said sequence and promote the expression of a chained gene operatively.

50. - The method according to claim 49, further characterized in that said cell is a reproductive cell of a plant.

51.- The method according to claim 50, further characterized in that said reproductive cell is a sporocyte.

52. The method according to claim 50, further characterized in that said gene encodes a ribonuclease, a transposase or a recombinase.

53. A plant comprising cells transformed with a foreign gene operably linked to and under the control of a nucleotide sequence as set forth in claim 45 or 46.