MXPA00011140A - Compounds from moraxella catarrhalis - Google Patents

Abstract

The invention provides BASB020 polypeptides and polynucleotides encoding BASB020 polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are diagnostic, prophylactic and therapeutic uses.

Description

MORAXELLA CATARRHALIS COMPOUNDS FIELD OF THE INVENTION This invention relates to polynucleotides ("hereinafter referred to as BASB020 polynucleotide (s)"), polypeptides encoded thereby (hereinafter referred to as "BASB020 or BASB020 polypeptide (s)"), recombinant materials and methods for their In another aspect, the invention relates to methods for using said polypeptides and polynucleotides, including vaccines against bacterial infections In a further aspect, the invention relates to diagnostic assays for detecting infections of certain pathogens.

BACKGROUND OF THE INVENTION Moraxella catarrhalis (also known as Branhamella catarrhalis) is a Gram negative bacterium frequently isolated from the human upper respiratory tract. It is responsible for several pathologies, the main one of these being otitis media in babies and children, and pneumonia in older people. It is also responsible for sinusitis, nosocomial infections and less frequently invasive diseases. Otitis media is an important childhood illness due to both the number of cases and its potential sequelae. More than 3.5 million cases are registered each year in the United States, and it is estimated that 80% of children have experienced at least one episode of otitis before reaching the age of 3 years (Klein, JO (1994) Clin Inf.Dis 19: 823). If left untreated or chronic, this disease can lead to hearing losses that may be temporary (in the case of fluid accumulation in the middle ear) or permanent (if the auditory nerve is damaged). In babies, such hearing losses may be responsible for delayed speech learning. Mainly three bacterial species have been isolated from the middle ear of children with otitis media: Streptococcus pneumoniae, Haemophilus influenzae (NTHi) that can not be typified, and M. catarrhalis. Cases are present in 60 to 90%. A review of recent studies shows that S. pneumoniae and NTHi represent approximately 30%, and M. catarrhalis approximately 15% of cases of otitis media (Murphy, TF (1996) Microbiol Rev. 60: 267). Other bacteria can be isolated from the middle ear 'H. Influenzae type B, S. pyogenes, etc.), but at a much lower frequency (2% of cases or less). Epidemiological data indicate that, for pathogens found in the middle ear, colonization of the upper respiratory tract is an absolute prerequisite for the development of otitis; however, others are also required to lead to the disease (Dickinson, DP et al. (1988) J. Infect. Dis. 158: 205, Faden, HL et al. (1991) Ann.Otorhinol. Laryngol. 100: 612) . These are important to activate the migration of bacteria to the middle ear through the eustachian tubes, followed by the initiation of an inflammatory process. These factors are unknown until now. It has been postulated that a transient anomaly of the immune system after a viral infection, for example, can cause an inability to control the colonization of the expiratory tractor (Faden, HL et al. (1994) J. Infecí Disa 169: 1312). An alternative explanation is that the exposure to environmental factors allows a more important colonization of some children, who subsequently become susceptible to the development of otitis media due to the sustained presence of pathogens in the middle ear (Murphy, TF (1996) Microbiol. 60: 267). The immune response to M. catarrhalis is poorly characterized. The analysis of strains sequentially isolated from the nasopharynx of babies from 0 to 2 years of age indicates that they obtain and eliminate new strains. This indicates that an effective immune response against this bacterium is assembled by the colonized children (Faden, HL et al. (1994) J. Infecí Dis. 169: 1312). In many tested adults, bactericidal antibodies have been identified (Chapman, AJ et al. (1985) J. Infect. Dis. 151: 878). The strains of M. catarrhalis present variations in their capacity to resist the bactericidal activity in the serum; in general, the isolates of sick individuals are more resistant than those who are simply colonized (Hol, C. et al. (1993) Lancet 341: 1281, Jordan, KL, et al. (1990) Am. J. Med. 88 (sup 5A) -28S). The resistance in the serum, therefore, can be considered as a virulent factor of the bacleria. An opsonization activity has been observed in the sera of children recovering from mid-oitis. The antigens activated by these different immune responses in humans have not yet been identified, with the exception of OMP B1, an 84 kDa protein, whose expression is regulated by iron, and which is recognized by the sera of patients with pneumonia ( Sethi, S. and others (1995) Infecí.Immun. 63: 1516), and of UspA1 and UspA2 (Chen D. and oíros (1999), Infecí, lmmun.67: 1310). Some other membrane proteins present on the surface of M. catarrhalis have been characterized using biochemical methods, or for their potential involvement in the induction of a protective immunity (for review see Murphy, TF (1996) Microbiol Rev. 60: 267) . In a model of mouse pneumonia, the presence of antibodies evoked against some of them (UspA, CopB) favors a more rapid elimination of the lung infection. Another peptide (OMP CD) is highly conserved among strains of M. catarrhalis, and presents homologies with a porcine of Pseudomonas aeruginosa, which has been shown to be effective against this bacterium in animal models. The frequency of infections with Moraxella catarrhalis has increased dramatically in recent decades. This has been prompted by the emergence of multiple strains of antibiotic resistance and an increasing population of people with weak immune systems. It is no longer uncommon to isolate Moraxella catarrhalis strains that are resistant to some or all of the blasting antibodies. This phenomenon has created a medical need that has not been met and demanded for new antimicrobial agents, vaccines, drug classification methods, and diagnostic tests for this organism.

COMPENDIUM OF THE INVENTION The present invention relates to BASB020, in particular BASB020 polypeptides and BASB020 polynucleotides, recombinant materials and methods for their production. In another aspect, the invention relates to methods for using said polypeptides and polynucleotides, including the prevention and irradiation of microbial diseases, among others. In a further aspect, the invention relates to diagnostic assays for detecting diseases associated with microbial diseases and conditions associated with said infections, such as assays for detecting the expression or activity of BASB020 polynucleotides or polypeptides. Various changes and modifications within the spirit and scope of the invention described will be readily apparent to those skilled in the art after reading the following descriptions and reading the other parts of the present disclosure.

DESCRIPTION OF THE INVENTION The invention relates to polypeptides and polynucleotides BASB020 as described with more delalle more ahead. In parícular terms, the invention relates to polypeptides and polynucleotides of BASB020 of Moraxella catarrhalis, which is related by the amino acid sequence homology to the hemolysin protein TlyC of Serpulina hyodysenteriae. The invention especially relates to BASB020 having the nucleotide and amino acid sequences set forth in SEQ ID NO: 1, 3, 5 or and SEQ ID NO: 2, 4, 6 or 8, respectively. It is understood that the sequences set forth in the sequence sequence lysia as "DNA" represented an illustration of one embodiment of the invention, since those skilled in the art will recognize that such sequences may be useful in polynucleotides in general, including ribopolynucleotides.

Polypeptides In one aspect of the invention, polypeptides of Moraxella catarrhalis referred to herein as "BASB020" and "BASB020 polypeptides", as well as their biological, diagnostic, prophylactic, clinical or therapeutically useful variants thereof, and compositions comprising them.

The present invention further provides: (a) an isolated polypeptide comprising an amino acid sequence having at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, most preferably at least 97-99% or an exact identity, to that of SEQ ID NO: 2, 4, 6 or 8; (b) a polypeptide encoded by an isolated polynucleotide comprising a polynucleotide sequence having at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, still most preferably at least 97% identity -99% or identity exacerbates SEQ ID NO: 1, 3, 5 or 7, over the entire length of SEQ ID NO: 1, 3, 5 or 7, respectively; or (c) a polypeptide encoded by an isolated polynucleotide comprising a polynucleotide sequence encoded by a polypeptide having at least 85% identity, preferably at least 90% identity, most preferably at least 95% identity , and preferably at least 97-99% or exact identity to the amino acid sequence of SEQ ID NO: 2, 4, 6 or 8. The BASB020 polypeptides provided in SEQ ID NO: 2, 4, 6 or 8 are the BASB020 polypeptides of the strains of Moraxella catarrhalis, MC2931 (ATCC 43617), MC912, MC2913 and MC2969. The invention also provides an immunogenic fragment of a BASB020 polypeptide, ie, a contiguous portion of a BASB020 polypeptide having the same immunogenic activity or substantially the same immunogenic activity as the polypeptide, comprising the amino acid sequence of SEQ ID NO: 2 , 4, 6 or 8; that is, fragmentation (if necessary when coupled to a porler) is able to evoke an immune response, which recognizes the powerful BASB020. Said immunogenic fragment may include, for example, BASEB020 polypeptide lacking an N-terminal leader sequence, and / or a transmembrane domain and / or a C-terminal anchor domain. In a preferred aspect, the immunogenic fragment of BASB020 according to the invention comprises substantially all of the extracellular domain of a polypeptide, which has at least 85% identity, preferably at least 90% identity, preferably at least 95% identity. Identity%, most preferably at least 97-99 identity, to that of SEQ ID NO: 2, 4, 6 or 8 over the entire length of SEQ ID NO: 2. A fragment is a polypeptide having an amino acid sequence that is completely the same as part but not the entire amino acid sequence of any polypeptide of the invention. As with the BASB020 polypeptides the fragments may be "free-standing" or "spherical" comprised within a larger polypeptide of which they form a part or region, most preferably as a single continuous region in a single larger polypeptide. Preferred fragments include, for example, truncated polypeptides having a portion of an amino acid sequence of SEQ ID NO: 2, 4, 6 or 8 variants thereof, such as a coninuous series of residues that include an amino acid sequence - and / or carboxyl-terminal. Also preferred are degradation forms of the polypeptides of the invention produced by or in a host cell. Others preferred are fragments characterized by structural or functional attributes, such as fragments comprising alpha helix and alpha helix forming regions, beta sheet and beta sheet forming regions, spinning and spinning regions, helical and helical forming regions, hydrophilic regions, hydrophobic regions, antipathetic regions, amphlaic bela regions, flexible regions, surface forming regions, sub-region binding region, and regions with high antigenic index. Other preferred fragments include an isolated polypeptide comprising an amino acid sequence of at least 15, 20, 30, 40, 50 or 100 continuous amino acids of the amino acid sequence of SEQ ID NO: 2, 4, 6 or 8, or a an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 amino acids coniinuered or deleted from the amino acid sequence of SEQ ID NO: 2, 4, 6 or 8. The fragments of the polypeptides of the invention can be employed to produce the corresponding full length polypeptide through peptide synthesis; therefore, these fragments can be used as intermediates to produce the full-length polypeptides of the invention. Particularly preferred are those variants in which several 5-10, 1-5, 1-3, 1-2, or one amino acid are substiluted, eliminated, or aggregated in any combination. The polypeptides, or immunogenic fragments, of the invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is generally advantageous to include an additional amino acid sequence containing secretion or leader sequences, pro-sequences, purification-assisting sequences such as multiple residues of histidine, or an additional sequence for stability during recombinant production. In addition, the addition of the exogenous polypeptide or lipid tail or polynucleotide sequences to increase the immunogenic potential of the final molecule is also considered. In one aspect, the invention relates to genetically engineered soluble fusion proteins comprising a polypeptide of the present invention, or a fragment thereof, and several portions of the constant regions of heavy or light chains of immunoglobulins of several subclasses ( IgG, IgM, IgA, IgE). Preferred as an immunoglobulin is the constant part of the heavy chain of human IgG, particularly IgG 1, wherein the fusion occurs in the hinge region. In a particular embodiment, the Fc part can be removed simply through the incorporation of a cleavage sequence, which can be separated with the coagulation factor Xa. Furthermore, this invention relates to processes for the preparation of these fusion proleins through genetic engineering, and to their use for drug classification, diagnosis and therapy. A further aspect of the invention also relates to polynucleotides encoding said fusion proteins. Examples of fusion protein technology can be found in International patent applications Nos. WO94 / 29458 and WO94 / 22914. The proteins can be chemically conjugated, or expressed as recombinant fusion proteins allowing increased levels to be produced in an expression system as compared to a non-fused protein. The fusion pairing can help to provide T-helper epitopes (immunological fusion pattern), preferably T-helper epitopes recognized by humans, or that help the expression of the protein (expression enhancer) at higher levels than the native recombinant protein. . Preferably, the fusion pattern will be both an immune fusion pattern and an expression enhancing pattern. Fusion patterns include the protein D of Haemophiius influenzae and the non-structural protein of influenza virus, NS1 (hemagglutinin). Another fusion pattern is the protein known as LytA. Preferably, the C-terminal portion of the molecule is used. LytA is derived from Streptococcus pneumoniae which synthesizes an N-acelyl-L-alanine amidase LytA, (encoded by the LytA gene. {Gene, 43 (1986) p 265-272.}.) An autolysin that specifically degrades certain bonds in the base structure of peptidoglycan. The C-terminal domain of the LytA protein is responsible for affinity to choline or to some choline analogues such as DEAE. This property has been exploited for the development of E. coli C-LytA expression plasmids useful for the expression of fusion proteins. The purification of hybrid proteins containing the C-LytA fragment at its amino terminus has been described. { Biofechnology: 10, (1992) p. 795-798} . It is possible to use the repeat portion of the LytA molecule found at the C-terminal end starting at residue 178, eg, residues 188-305. The present invention also includes variants of the aforementioned polypeptides, ie polypeptides that vary from the reporter by conservative amino acid substitutions, whereby one residue is replaced by another with similar characteristics. The typical aspect of these substiíuciones is between Ala, Val, Leu and lie; between Ser and Thr; between the acid residues Asp and Glu; between Asn and Gln; and between the basic waste Lys and Arg; or the aromatic residues Phe and Tyr. The polypeptides of the present invention can be prepared in any suitable form. Such polypeptides include isolated natural polypeptides; recombinantly produced polypeptides, synthetically produced polypeptides, or polypepides produced through a combination of these methods. The means for preparing said polypeptides are also well understood in the art. It is highly preferred that a polypeptide of the invention is derived from Moraxella catarrhalis, however, it is preferred that it is obtained from other organisms of the same laxonomic genus. A polypeptide of the invention can also be obtained from, for example, organisms of the same family or taxonomic order.

Polynucleotides It is an object of the invention to provide polynucleotides that encode BASB020 peptides, particularly polynucleotides that encode the polypeptide designated herein as BASB020. In a particularly preferred embodiment of the invention, ei The polynucleotide comprises a region encoding polypeptides BASB020 comprising a sequence set forth in SEQ ID NO: 1, 3, 5 or 7, which includes a full-length gene, or a variant thereof. The BASB020 polynucleotides provided in SEQ ID NO: 1, 3, 5 or 20 7 are the BASB020 polynucleotides of Moraxella catarrhalis strains MC2931 (ATCC 43617), MC2912, MC2913 and MC2969. As a further aspect of the invention, isolated nucleic acid molecules encoding and / or expressing BASB020 polypeptides and polynucleotides, particularly polypeptides, are provided. • 25 and BASB020 polynucleotides from Moraxella catarrhalis, including, for example, unprocessed RNAs, ribozyme RNAs, mRNAs, cDNAs, genomic DNAs, B- and Z-DNAs. Further embodiments of the invention include polynucleolides and biological, diagnostic, prophylactic, clinically or therapeutically useful polypeptides, and their variants, and compositions comprising the same. Another aspect of the invention relates to isolated polynucleotides, including at least one extended length gene encoding a BASB020 polypeptide having a deduced amino acid sequence of SEQ ID NO: 2, 4, 6 or 8, and polynucleotides. are related to them and their variants. In another preferred embodiment of the invention, there is a BASB020 polypeptide of Moraxella catarrhalis comprising or consisting of an amino acid sequence of SEQ ID NO: 2, 4, 6 or 8, or a variant thereof. Using the information provided herein, such as a polynucleotide sequence set forth in SEQ ID NO: 1, 3, 5 or 7, a polynucleotide of the invention encoding the BASB020 polypeptide can be obtained using standard cloning and classification methods, • such as those for cloning and sequencing DNA fragments chromosomes from bacteria using cells of Moraxella catarrhalis Catlin as a starting material, followed by obtaining a clone of longilud complela. For example, to obtain a polynucleotide sequence of the invention, as a polynucleotide sequence given in SEQ ID NO: 1, 3, 5 or 7, typically a collection of chromosomal DNA clones of Moraxella catarrhalis Callin in E. coli or some other suitable host is applied a probe with a radiolabelled oligonucleotide, preferably one of 17-mer or greater, derived from a partial sequence. Clones carrying DNA identical to that of the probe can then be distinguished using severe hybridization conditions. Through the sequencing of the individual clones thus identified by hybridization with designed sequencing primers of the original polypeptide or polynucleotide sequence, it is then possible to extend the polynucleotide sequence in both directions to determine a full-length sequence. Conveniently, said sequencing is performed, for example, by using denatured double stranded structure DNA prepared from a plasmid clone. Suitable techniques are described by Maniatis, T., Fritsch, E. F., and Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd. Ed .; Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York (1989). (See in particular classification by hybridization 1.90 and DNA templates denatured double chain structure of sequencing 13.70). Direct genomic DNA sequencing can also be performed to obtain a full-length gene sequence. Illustrative of the invention, each polynucleotide set forth in SEQ ID NO: 1, 3, 5 or 7 was discovered in a DNA library derived from Moraxella catarrhalis. In addition, each DNA sequence set forth in SEQ ID NO: 1, 2, 5 or 7 contains an open reading frame that encodes a proiein that approximates the number of amino acid residues described in SEQ ID NO: 2, 4, 6 or 8 with a deduced molecular weight that can be calculated using molecular weight values of amino acid residue well known to those skilled in the art. The polynucleotide of SEQ ID NO: 1, entails the start codon at nucleotide number 1 and the stop codon starting at number 841 of the nucleotide of SEQ ID NO: 1, encodes the polypeptide of SEQ ID NO: 2. The polynucleotide of SEQ ID NO: 3, entails the start codon in nucleoid number 1 and the stop codon starting at number 841 of the nucleotide of SEQ ID NO: 3, encodes the polypeptide of SEQ ID NO: 4. The polypeptide of SEQ ID NO: 5, enwraps the start codon at nucleoid number 1 and the deink codon beginning at nucleotide number 841 of SEQ ID NO: 5, encodes the polypeptide of SEQ ID NO: 6. The polynucleotide of SEQ ID NO: 7, eny the start codon at nucleoid number 1 and the stop codon starting at number 841 of the nucleotide of SEQ ID NO: 7, encodes the polypeptide of SEQ ID NO: 8. In a further aspect, the present invention provides an isolated polynucleotide comprising or consisting of: (a) a polynucleotide sequence having at least 85% identity, preferably at least 90% identity, preferably at least 95% of identity, still very preferably at least 97-99% or exact identity SEQ ID NO: 1, 3, 5 or 7, over the entire length of SEQ ID NO: 1, 3, 5 or 7, respectively; or (b) a polynucleotide sequence that encodes a polypeptide having at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, most preferably at least 97-99% or 100% or exact, to the amino acid sequence of SEQ ID NO: 2, 4, 6 or 8, over the entire length of SEQ ID NO: 2, 4, 6 or 8, respectively. A polynucleotide encoding a polypeptide of the present invention, including homologs and orthologs from species other than Moraxella catarrhalis, can be obtained through a process comprising the steps of classifying an appropriate collection under severe hybridization conditions (e.g. temperature on the scale of 45-65 ° C and an SDS concentration of 0.0-1%) with a labeled or detectable probe consisting of or comprising the sequence of SEQ ID NO: 1, 3, 5 or 7, or a fragment of the same; and isolating a full-length gene and / or genomic clones containing said polynucleotide sequences. The invention provides an identical polynucleotide sequence, over its entire length, to a coding sequence (open reading frame) in SEQ ID NO: 1, 3, 4 or 7. The present invention also provides a coding sequence for a mature polypeptide or a fragment thereof, itself as well as a coding sequence for a polypeptide or mature fragment in the reading frame with another coding sequence, such as a sequence encoding a leader or secretion sequence, a pre sequence, or pro, or prepro-protein. The polynucleotide of the invention may also contain at least one non-coding sequence, including, for example, but not limited to at least one non-coding 5 'and 3' sequence, such as the transcribed but translated sequences, RNAization (such as rho-dependent and rho-independent termination signals), ribosome binding sites, Kozak sequences, mRNA stabilizing sequences, introns, and polyadenylation signals. The polynucleotide sequence may also comprise a coding sequence that encodes additional amino acids. For example, a marker sequence that facilitates purification of the fused polypeptide can be encoded. In certain embodiments of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described by Gentz et al., Proc. Nati Acad. Sci., USA 86: 821-824 (1989), an HA peptide tag (Wilson et al., Cell 37: 767 (1984), both may be useful for purifying the polypeptide sequence fused thereto. invention also include, but are not limited to, polynucleotides that describe a structural gene and its naturally associated sequences that control gene expression.The nucleotide sequence encoding the BASB020 peptide of SEQ ID NO: 2, 4, 6 or 8 may be identical to the peptide coding sequence contained in nucleotides 1 to 840 of SEQ ID NO: 1, 3, 5 or 7, respectively, Alternatively, it may be a sequence, which as a result of the (generation) redundancy of the genic code, also encodes the polypeptide of SEQ ID NO: 2, 4, 6, or 8. The term "polynucleotide encoding a polypeptide", as used herein, encompasses polynucleotides that include a sequence encoding a polypeptide of the invention n, particularly a bacterial polypeptide and more particularly a Moraxella catarrhalis polypeptide, BASB020, having an amino acid sequence set forth in SEQ ID NO: 2, 4, 6 or 8. The term also encompasses polynucleotides that include an individual continuous region or discontinuous regions encoding the polypeptide (eg, polynucleotides interrupted by the integrated phage, an integrated insertion sequence, an integrated vector sequence, an integrated transposon sequence, or due to RNA editing or genomic DNA rearrangement) together with additional regions, which may also contain coding and / or non-coding sequences. The invention further relates to variants of the polynucleotides described herein that encode variants of a polypeptide having a deduced amino acid sequence of SEQ ID NO: 4, 6 or 8. Fragments of polynucleotides of the invention may be used, for example, for synthesizing full length polynucleotides of the invention.

Other particularly preferred embodiments are polynucleotides encoding BASB020 variani, having the amino acid sequence of BASB020 polypeptide of SEQ ID NO: 2, 4, 6 or 8, where several, some, 5 to 10, 1 to 5, from 1 to 3, 2, 1 or no amino acid residue is subsumed, modified, deleted and / or added, in any combination. Especially preferred among these are the silent substitutions, additions and deletions, which do not alter the properties and activities of the BASB020 polypeptide. Other preferred embodiments of the invention are polynucleotides that are at least 85% identical over their entire length to a polynucleotide encoding the BASB020 polypeptide by forming an amino acid sequence disclosed in SEQ ID NO: 2, 4, 6 or 8, and polynucleotides that are complementary to said polynucleotides. Alfernafivamenle, highly preferred are polynucleotides that comprise a region that is at least 90% identical over its length to the polynucleotide encoding the BASB020 polypeptide and complementary polynucleotides thereto. In this regard, polynucleotides at least 95% identical over their entire length are particularly preferred to them. In addition, those with at least 97% are highly preferred among those with at least 95%, and among those those with 98% and at least 99% are preferred and preferred, with at least 99% being very preferred. . Preferred embodiments are polynucleolides that encode polypeptides that substantially retain the same biological function or activity as the mature polypeptide encoded by a DNA SEQ ID NO: 1, 3, 5 or 7. According to some preferred embodiments of this invention, polynucleotides are provided which hybridize, particularly under severe conditions, to BASB020 polynucleotide sequences, such as those SEC polynucleolides ID NO: 1, 3, 5 or 7. The invention further relates to polynucleotides that hybridize to the polynucleotide sequences provided herein. In this regard, the invention spatially refers to polynucleotides that hybridize under severe conditions to the polynucleotides described herein. As used herein, the terms "severe conditions" and "severe hybridization conditions" represent hybridization that occurs only if there is at least 95% and preferably at least 97% identity between the sequences. specific for severe hybridization conditions is incubation overnight at 42 ° C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6) , 5x Denhardl's solution, 10% dextran sulfate, and 20 micrograms / ml of separate salmon sperm DNA, followed by washing the hybridization soporie in 0.1 x SSC at approximately 65 [deg.] C. Hybridization and washing conditions they are well known and illus- trated in Sambrook et al., Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring Harbor, NY, 1989), particularly Chapter 11. It can also be used to hybridize solution with sequencing. polynucleide beads provided by the invention. The invention also provides a polynucleotide consisting of or comprising a polynucleotide sequence obtained by classifying an appropriate classification with a complement gene for a polynucleotide sequence set forth in SEQ ID NO: 1, 3, 5 or 7 under severe hybridization conditions with a probe. having the sequence of said polynucleotide sequence set forth in SEQ ID NO: 1, 3, 5 or 7, or a fragment thereof; and isolating said polynucleide sequence. Useful fragments for obtaining said polynucleotide include, for example, probes and primers fully as described herein elsewhere. As discussed herein with respect to polynucleotide assays of the invention, for example, the polynucleotides of the invention can be used as a hybridization probe for RNA, CDNA and genomic DNA to isolate full length cDNAs and genomic clones encoding BASB020 and to isolate cDNA and genomic clones from other genes having high identity, particularly high sequence identity, to the BASB020 gene. Said probes will generally comprise at least 15 nucleotide residues or base pairs. Preferably, said probes will have at least 30 nucleotide residues or base pairs and can have at least 50 nucleotide residues or base pairs. Particularly preferred probes will have at least 20 nucleotide residues or base pairs and will have less than 30 nucleotide residues or base pairs. A coding region of a BASB020 gene can be - ^ isolated by classifying a DNA sequence provided in SEQ ID NO: 1, 3, 5 or 7 to synthesize an oligonucleotide probe. A labeled oligonucleotide having a sequence complementary to that of a gene of the invention is then used to classify a collection of cDNA, genomic DNA or mRNA to determine which members of the library hybridize the probe. There are several methods available and well known to those skilled in the art for obtaining full-length DNAs, or extended-strand DNAs, for example, those based on the rapid amplification method of cDNA ends (RACE), (see, for example, Forman et al., PNAS USA 85: 8998-9002).

Recent modifications of the technique, illustrated by the Marathon ™ technology (Clontech Laboratories Inc.) for example, have significantly simplified the search for longer cDNAs. In Marathon ™ technology, cDNAs from mRNA extracted from a selected tissue and an "adapter" sequence have been prepared tied on each end. Nucleic acid amplification (PCR) was then performed to amplify the 5 '"missing" end of the DNA using a combination of oligonucleotide primers specific to the gene and specific in the adapter. The PCR reaction is then repeated using primers (nested), that is, primers designed to rapidly heat and cool within the amplified product (typically a specific adapter initiator that quickly quenches and cools to the 3 'end in the adapter sequence and a gene-specific primer that rapidly warms and cools to the 5' end in the sequence of selected gene). The products of this reaction can then be analyzed through DNA sequencing and a length-of-complement DNA constructed either by linking the product directly to the exislenfe DNA to give a complete sequence, or by performing a separate full-length PCR using the new DNA information. sequence for the 5 'primer design. The polynucleotides and polypeptides of the invention may be employed, for example, as search reagents and as screening agents for discovering disorders and agonists for diseases, particularly diseases of humans, as discussed in the present in relation to polynucleotide assays. Polynucleolides of the invention which are oligonucleolides derived from a sequence of SEQ ID NO: 1-8, can be used in the processes of the present invention as described, but preferably for PCR, to determine whether the polynucleolides idenlified herein in total or in part they are or not transcribed in bacteria in infected tissues. It is recognized that these sequences will also be used in the diagnosis of the infection stage and type of infection that the pathogen has obfenido. The invention also provides polynucleotides that encode a polypeptide that is the mature prolein plus additional amino-or carboxyl-terminal amino acids, or amino acids within the mature polypeptide (when the mature form has more than one polypeptide chain, for example). Such sequences can play an important role in the processing of a protein from a precursor to a mature form, can allow the transport of protein, can lengthen or reduce the half-life of the protein or can facilitate the manipulation of a protein for the trial or production, among other things. As is generally the case in vivo, additional amino acids can be processed from the protein matures through cellular enzymes. • A polynucleotide complementary to it is provided for each and all polynucleotides of the invention. It is preferred that these complementary polynucleotides are completely complementary to each polynucleotide with which they are complementary. A precursor protein having a mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide. When prosequences are removed, • inactive precursors are usually activated. Some or all prosequences can be removed before activation. In general, said precursors are termed proproteins. In addition to standard A, G, C, T / U representations for nucleotides, the term "N" can also be used to discovering certain polynucleotides of the invention. "N" means that any of the four nucleotides of DNA or RNA may appear at said designated position in the DNA or RNA sequence, except if it is preferred that N is not a nucleic acid than when taken in combination with adjacent nucleotide positions. , when read in a correct reading frame, may have the effect of generating a premature termination codon in said reading frame. In summary, a polynucleotide of the invention can encode a mature protein, a mature protein plus a leader sequence (which can be termed a preprotein), a precursor of a mature protein having one or more prosequences that are not the leader sequences of a preprotein, or a preprotein, which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which are generally removed during the processing steps that produce immature active forms of the polypeptide. In accordance with the aspect of the invention, there is provided the use of a polynucleotide of the invention for therapeutic or prophylactic purposes, in particular genetic immunization. The use of a polynucleotide of the invention in genetic immunization will preferably employ a suitable delivery method such as direct injection of plasmid DNA into muscles (Wolf et al., Hum Mol. Genel (1992) 1: 363, Manthorpe et al. Hum. Gene Ther. (1983) 4: 419, DNA delivery in complex with specific protein carriers (Wu et al., J. Biol. Chem. (1989) 264: 16985), co-precipitation of DNA with calcium phosphate (Benvenisfry &Reshef, PNAS USA, (1986) 83: 9551), encapsulation of DNA in various forms of liposomes (kaneda and oíros, Science (1989) 243: 375), paríicle bombardmeni (Tang y oíros, Nalure (1992) 356: 152, Eisenbraun and others, DNA Cell Biol (1993) 12: 791), and infection in vivo using cloned retroviral vectores (Seeger et al., PNAS USA (1984) 81: 5849).

Vectors Host Cells. Expression Systems The invention also relates to vectors comprising a polynucleotide or polynucleotides of the invention, host cells that are genetically engineered with vectors of the invention and the production of polypeptides of the invention through recombinant techniques. Cell-free translation systems can also be employed to produce said proteins using RNAs derived from the DNA constructs of the invention. The recombinant peptides of the present invention can be prepared through processes well known to those skilled in the art from genetically engineered host cells comprising expression systems. Accordingly, in a further aspect, the present invention relates to expression systems comprising a polynucleotide or polynucleotides of the present invention, to host cells that are genetically engineered with said expression systems, and to the production of polypeptides of the invention. invention through recombinant techniques. For the recombinant production of the polypeptides of the invention, the host cells may be genetically engineered to incorporate expression systems or portions thereof or polynucleotides of the invention. The introduction of a polynucleotide to the host cell can be effected by methods described in many standard laboratory manuals, such as Davis, and others, BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook, and others, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd. Ed. Cold Spring Harbor Laboraíory Press, Cold Spring, N. Y. (1989), such as calcium phosphate transfection, DEAE-dexire-mediated transfection, transvession, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scraping charge, ballistic introduction and infection. Representative examples of appropriate hosts include bacterial cells, such as Streptococcus, Staphylococcus, Enterococcus, E. coli, Streptomyces, Cyanobacteria, Bacillus subtilis, Neisseria meningitidis and Moraxella catarrhalis cells.; fungal cells, such as yeast cells, Kluveromyces, Saccharomyces, a basidiomycete, Candida albicans and Aspergillus, insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS. HeLa, C127, 3T3, BHK, 293, CV-1 and Bowes melanoma cells; and plant cells such as gymnosperm or angiosperm cells.

A wide variety of expression systems can be used to produce the polypeptides of the invention. Such vectors include, among others, vectors derived from viruses, • chromosomal, episomal, for example, vectors derived from bacterial plasmids, from bacferiophage, from transposons, from yeast episomes, from insert elements, from yeast chromosomal elements, from viral viruses such as baculoviruses, papopavirus, isolates such as Sv40, vaccinia virus, adenovirus, poultry pustulation virus, virus of pseudorabia, piconavirus, relrovirus, and alphaviruses, and vectors derived from their combinations, such as those derived from bacteriophage plasmid genere elements, such as cosmids and phagemics. Expression system constructs can confer regions of confrol that regulate as well as promote expression. In general, any A system or vector suitable for maintaining, propagating or expressing polynucleotides and / or expressing a polypeptide in a host can be used for expression in this regard. The appropriate DNA sequence can be inserted into the expression system through • of any variety of well-known techniques and of ruin, as, for example, those esfablecidas in Sambrook and oíros, MOLECULAR CLONING. A LABORATORY MANUAL, (supra). In recombinant expression systems in eukaryotes, for the secretion of a protein translated into the lumen of the endoplasmic reticulum, in the periplasmic space or in the environment After extraceluating, appropriate secretory signals can be incorporated into the expressed polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals. The polypeptides of the present invention can be recovered and purified from recombinant cell cultures at through well-known methods including precipitation of sodium sulfate or ethanol, extraction of acid, chromium chromatography of anion or calcium ion, chromophography of phosphocellulose, chromophography of hydrophobic extraction, affinity chromatography, hydroxylapay chromatography and lectin chromoiography. Most preferably, it uses IMAC metal ion affinity chromatography for purification). Well-known techniques for refolding proteins can be used to generate active conformation when the polypeptide is denatured during long-term syn- thesis, isolation and / or purification. 15 The expression system may also be a bio-recombinant microorgamism, such as a virus or a bacterium. The gene of interest can be inserted into the genome of a live recombinant virus or bacterium. Inoculation and infection in vivo with this live vector will lead to the in vivo expression of the antigen and the induction of immune responses. The viruses and bacteria used for this purpose are, for example: poxivirus (eg vaccine, poultry pustulation, canary pustulation), aviaviruses (Sindbis virus, Semliki Forest virus, Venezuelan equine encephalitis virus), Adenoviruses, adenoasoc virus. ado, picornavirus (poliovirus, rhinovirus), herpes virus (varicella zoster virus, etc.), Listeria, Salmonella, Shigella, Neisseria, BCG. These viruses and bacteria can be virulent or attenuated in various ways in order to have live vaccines. Said live vaccines are also part of the invention.

Diagnostic tests. Forecast. Serotyping and Mutation This invention also relates to the use of BASB020 polynucleotides and polypeptides of the invention to be used as diagnostic reagents. The detection of polynucleolides and / or BASB020 polypeptides in a eukaryote, particularly a mammal, and in particular a human being, will provide a diagnostic method for the diagnosis of a disease, stage of the disease or response of an infectious organism to drugs. Eukaryotes, particularly mammals, and especially humans, particularly those infected or suspected of being infected with an organism comprising the BASB020 gene or protein, they can be detected at the nucleic acid or amino acid level through a variety of well-known techniques, as well as through methods provided herein. The polypeptides and polynucleotides for prognosis, diagnosis or other analyzes can be obtained from a body material of the putatively infected and / or infected individual. The polynucleotides of any of these sources, particularly DNA or RNA, can be directly used for deletion can be amplified enzymatically using PCR or any other amplification technique before analysis. RNA, in particular mRNA, cDNA and genomic DNA can also be used in the same forms. Using the amplification, the characterization of the species and strain of infectious organism or resident present in an individual can be done, through an analysis of the genotype of a polynucleotide selected from the organism. Deletions and insertions can be detected through a change in the size of the amplified product compared to a genotype of a reference sequence selected from a selected organism, preferably a different species of the same genus or a different strain from the same species. Spot mutations can be identified by hybridizing amplified DNA to labeled BASB020 polynucleotide sequences. It is possible to distinguish perfectly or significantly coincident sequences from imperfect or more significantly mismatched duplexes through DNase or RNase digestion, for DNA or RNA respectively, or by detecting differences in melting temperatures or renaturation kinetics. Polynucleotide sequence differences can also be detected through alterations in the electrophoretic mobility of polynucleotide fragments in gels as compared to a reference sequence. This can be done with or without denaturing agents. Polynucleotide differences can also be detected through DNA or RNA sequencing. See, for example, Myers et al., Science, 230: 1242 (1985). Sequence changes at specific locations can also be revealed through nuclease protection assays, such as RNase, VI and S1 protection assay or a chemical cleavage method. See, for example, Coílon y oíros, Proc. Nall. Acad. Sci. USA, 85: 4397-4401 (1985). In another embodiment, an array of oligonucleotide probes comprising the nucleotide sequence BASB020 or its fragments can be constructed to conduct an efficient classification of, for example, genetic mutations, serotype, taxonomic classification or identification. The methods of disposition technology are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, gene linkage, and genetic variability (see, for example, Science, 274: 610 (1996)). In this manner, in other respects, the invention relates to a diagnostic kit comprising: (a) a polynucleotide of the present invention, preferably the nucleotide sequence SEQ ID NO: 1, 3, 5 or 7, or a fragment of it; (b) a nucleotide sequence complementary to that of (to); (c) a polypeptide of the present invention, preferably the polypeptide of SEQ ID NO: 2, 4, 6 or 8 or a fragment thereof; or (d) an antibody to a polypeptide of the present invention, preferably to the polypeptide of SEQ ID NO: 2, 4, 6 or 8. It will be appreciated that in any equipment, (a), (b), (c) or ( d) may comprise a substantial component. Said equipment will be of use for the diagnosis of a disease or susceptibility to disease, among others. This invention also relates to the use of polynucleotides of the present invention as diagnostic reagents. Detection of a mutated form of a polynucleotide of the invention, preferably SEQ ID NO: 1, 3, 5 or 7, which is associated with a disease or pathogenicity, will provide a diagnostic tool that can be added to, or defined, a diagnosis of a disease, a prognosis of the course of a disease, a determination of the stage of a disease, or a susceptibility to a disease, which results from under-expression, over-expression or altered expression of polynucleotide. Organisms, particularly infectious organisms, that carry mutations in said polynucleotide can be detected at the polynucleotide level through a variety of techniques, such as those described herein. The cells of an organism carrying mutations or polymorphisms (allelic variations) in a polynucleotide and / or polypeptide of the invention can also be detected at the level of the polynucleotide or polypeptide through a variety of techniques, to enable serotyping, for example. For example, RT-PCR can be used to detect mutations in RNA. It is particularly preferred to use RT-PCR in conjunction with automatic detection systems, such as, for example, GeneScan. You can also use RNA, cDNA or genomic DNA for the same • purpose, PCR. As an example, PCR primers complementary to a polynucleotide encoding the BASB020 polypeptide can be used to identify and analyze mutations. The invention further provides primers with 1, 2, 3 or 4 nucleotides removed from the 5 'and / or 3' end. These initiators can be used, inter alia, to amplify the BASB020 DNA and / or RNA isolated from a sample derived from an individual, such as a body material. The primers can be used to amplify a polynucleotide isolated from an infected individual, so that the polynucleotide can then be subjected to various techniques to produce the polynucleotide sequence. In this manner, mutations in the polynucleotide sequence can be detected and used to diagnose and / or predict the infection or its stage or course, for the serotype and / or • classify the infectious agent. The invention further provides a process for diagnosis, disease, preferably bacterial infections, most preferably infections caused by Moraxella catarrhalis, which comprises determining from a sample derived from an individual, such as a body material, an increased level of expression of the polynucleotide with a sequence of SEQ ID NO: 1, 3, 5 or 7. The high or reduced expression of a BASB020 polynucleotide can be measured using any of the methods well known in the art for the quantification of polynucleotides, such as , for example, amplification, PCR, RT-PCR, RNase protection, Northern staining, spectrometry and other hybridization methods. In addition, a diagnostic assay according to the invention for expressing on expression of BASB020 polypeptide compared to normal control tissue samples can be used to detect the presence of an invention, for example. The assay techniques that can be used to determine the levels of a BASB020 polypeptide in a sample derived from a host, such as a body material, are well known to those skilled in the art. These test methods include radio immunoassays, competitive binding assays, Western staining analysis, antibody sandwich assays, anficibody detection and ELISA assays. The polynucleolides of the invention can be used as components of polynucleotide arrays, preferably arrays or high density gratings. These high density arrays are particularly useful for diagnostic and prognostic purposes. For example, a group of dots each comprising a different gene, and further comprising a polynucleotide or polynucleotides of the invention, can be used to apply a probe, such as using hybridization or amplification of nucleic acid, using probes obtained or derived from a body sample, to determine the presence of a particular polynucleotide sequence or sequence related to an individual. Such presence may indicate the presence of a pathogen, particularly Moraxella catarrhalis, and may be useful for the diagnosis and / or prognosis of a disease or course of a disease. A grid comprising a number of variants of the polynucleotide sequence of SEQ ID NO: 1, 3, 5 or 7 is preferred. A number of variani of a polynucleotide sequence encoding the polypeptide sequence of SEQ ID NO: 2, 4, 6 or 8 is also preferred.

Antibodies The polypeptides and polynucleotides of the invention or their variants, or cells expressing them, can be used as immunogens to produce immunospecific antibodies to said polypeptides or polynucleotides, respectively. In certain preferred embodiments of the invention, antibodies are provided against BASB020 polypeptides or polynucleotides. Antibodies raised against the polypeptides or polynucleotides of the invention can be obtained by administering the polypeptides and / or polynucleotides of the invention, or epitope-bearing fragments of either or both, analogs of either or both, or cells expressing either or both. , to an animal preferably one that is not a human being, using ruina propulolos. For the preparation of monoclonal antibodies, any technique known in the art that provides antibodies produced by continuous cell line cultures can be used. Examples include various techniques, such as those by Kohier, G. and Milsiein, C, Nalure 256: 495-497 (1975); Kozbor and Oíros, immunology Today 4:72 (1983); Cole and hear you, p. 77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985). Techniques for the production of individual chain antibodies (US Pat. No. 4,946,778) can be adapted to produce single chain antibodies to polypeptides or polynucleotides of this invention. Also, transgenic, or other organism or animal mice, such as other mammals, can be used to express humanized antibodies immunospecific to the polypeptides or polynucleotides of the invention. Alternatively, phage display technology can be used to select antibody genes with binding activity towards a polypeptide of the invention from either the repertoires of genes and amplified by PCR of lymphocytes from humans classified as having anti-BASB020 or from collections naíurales (McCafferíy y oíros, (1990), Nature 348, 552-554; Marks et al., (1992) Biotechnology 10, 779-783). The affinity of these antibodies can also be improved, for example, through the improved chain intermixing (Claxon and Oros, (1991) Nature 352: 628). The antibodies described above can be used to isolate or identify clones expressing the polypeptides or polynucleotides of the invention to purify the polypeptides or polynucleotides, for example, through affinity chromatography. In this way, among others, antibodies may be used to confine the BASB020 polypeptide or BASB020 polynucleotide to treat infections, particularly Baclerian infections. Polypeptide variants include antigenic, epitopic or immunologically equivalent variants that form a particular aspect of this invention. Preferably, the antibody or its variant is modified to make it less immunogenic in the individual. For example, if the individual is a human being, the anilibody most preferably must be "humanized", wherein the region or regions of complementarity determination of the hybridoma-derived antibody has been transplanded to a human monoclonal antibody, for example, as described by Jones et al. (1986), Nature 321, 522-525 or Tempest et al., (1991) Biotechnology 9, 266-273.

Antagonists and Agonists - Assays and Molecules Polypeptides and polynucleotides of the invention can also be used to determine the binding of small ligand molecule substrates in, for example, cells, cell-free preparations, chemical libraries and mixtures of natural product. These subscripts and ligands can be subsymeres and natural ligands or they can be functional or functional mimics. See, for example, Coligan et al., Current Protocols in Immunology 1 (2): Chapter 5 (1991). 5 Classification methods can simply measure the binding of a candidate compound to the polypeptide or polynucleotide, or cells or membranes carrying the polypeptide or polynucleotide, or a fusion protein of the polypeptide through a tag directly or indirectly associated with the candidate compound .

Alternatively, the classification method may involve • competition with a marked competitions. In addition, these classification methods can test whether the candidate compound results in a signal generated by the activation or inhibition of the polypeptide or polynucleotide, using detection systems.

Suitable for the cells comprising the polypeptide or polynucleotide. Inhibitors of the activation are generally analyzed in the presence of a known agonist and the effecium is observed in the acyivation by the agonism through the presence of the • candidate compound. Polypeptides can be used Constitutively active and / or polypeptides and constivatively expressed polynucleotides for classifying methods for agonists or reverse inhibitors, in the absence of an agonist or inhibitor, testing whether the candidate compound results in the inhibition of activation of the polypeptide or polynucleotide, whatever the case. In addition, the classification methods can simply comprise the steps of mixing a candidate compound with a solution confining a polypeptide or polynucleide of the present invention, to form a mixture, measuring the activity of the BASB020 polypeptide and / or polynucleotide in the mixture, and comparing the activity of the BASB020 polypeptide and / or polynucleotide of the mixture with a standard. Fusion proteins, such as those made from the Fc portion and the BASB020 polypeptide, as described above, can also be used for high throughput screening assays to identify antagonists of the polypeptide of the present invention, as well as filigenetic polypeptides. and / or functionally related (see, D. Bennetl et al., J. Mol. Recognition, 8: 52-58 (1995); and K. Johanson et al., J. Biol. Chem. 270/16): 9459-9471 (nineteen ninety five)). Polynucleotides, polypeptides and antibodies that bind to and / or interact with a polypeptide of the present invention can also be configured to configure classification methods to detect the effect of aggregated compounds on the production of mRNA and / or polypeptide in cells. For example, an ELISA assay can be constructed to measure the associated levels of cells or secreted from the polypeptide using monoclonal and polyclonal antibodies through standard methods known in the art. This can be used to discover agents that can inhibit or enhance the production of the polypeptide (also referred to as an antagonist or agonist, respectively) of properly manipulated cells or tissues.

The invention also provides a method for classifying compounds to identify those that improve (agonists) or block (antagonisms) the action of BASB020 polypeptides or polynucleotides, particularly those that are baclerioeslalic and / or baceric. The method for classifying can involve techniques of production. For example, to classify agonists or antagonists, a synthetic reaction mixture, a cellular component, such as a membrane, a cell cover or cell wall or a preparation of any of these, comprising the BASB020 polypeptide and a labeled ligand substrate of said polypeptide it is incubated in the absence or presence of a candidate molecule that can be a BASB020 agonist or antagonist. The ability of the candidate molecule to agonize or antanogize the BASB020 polypeptide is reflected in the reduced binding of the labeled ligand or reduced production of the product from the substrate. Molecules that bind freely, that is, without inducing the effects of the BASB020 polypeptide, are very likely to be good antagonists. Molecules that bind well and, as the case may be, raise the production speed of the production to parlir of the substrate, increase the signal translation, or increase the activity of the chemical channel, are agonists. The detection of the regime or level of, as the case may be, production of the product from the substrate, signal transduction, or chemical channel activity can be improved using a reporting system. Reporting systems that may be useful in this regard include, but are not limited to, colorimetric, labeled substrate converted to a product, a reporter gene that is sensitive to changes in the activity of polynucleotide or BASB020 polypeptide, and junctions known in the art. Another example of an assay for BASB020 agonists is a competitive assay that combines BASB020 and a potential agonist with BASB020 binding molecules, recombinant BASB020 binding molecules, and subsalts or nalural ligands, or subsalicylate or ligand mimics, under conditions appropriate for an assay of compefilive inhibition. BASB020 can be labeled, such as through radioactivity or a co-calorimetric compound, so that the number of BASB020 molecules bound to a binding molecule or converted to the product can be accurately determined to determine the effectiveness of the po- ideic agonist. Poissonic agonisies include, but are not limited to, small organic molecules, peptides, polypeptides, and antibodies that bind to a polypeptide and / or polynucleotide of the invention and thus inhibit or exfine its activity or expression. Potential antagonists may also be small organic molecules, a peptide, a polypeptide, such as a proinin or related substance which binds the same cells to a binding molecule, such as a binding molecule, without inducing activities induced by BASB020, avoiding thus the action or expression of BASB020 polypeptides and / or polynucieotides excluding BASB020 polypeptides and / or polynucleotides from the binding.

Potential antagonists include a small molecule that binds to and occupies the polypeptide binding site, thus preventing binding to cell binding molecules, so that normal biological activity is avoided. Examples of small molecules include, but are not limited to, small organic molecules, peptides or peptide-like molecules. Other potential antagonists include amino acid molecules (see, Okano, J. Neurochem 56: 560 (1991); OLIGODEXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raion, FL (1988), for a description of these molecules). Preferred polemial anlagonists include related compounds and variances of BASB020. In a further aspect, the present invention relates to genetically engineered soluble fusion proteins, comprising a polypeptide of the present invention, or a fragment thereof, and various portions of the heavy or light chain constant regions of immunoglobulin several subclasses (IgG, IgM, IgA, IgE). The preferred one as an immunoglobulin is the constant part of the heavy chain of human IgG, particularly IgG1, wherein the fusion occurs in the hinge region. In a particular embodiment, the Fc part can be removed simply by incorporating a cleavage sequence, which can be separated with the coagulation factor Xa. Furthermore, this invention relates to processes for the preparation of these fusion proteins through genetic engineering, and to the use thereof for drug classification, diagnosis and therapy. A further aspect of the invention also relates to polynucleotides encoding said fusion proteins. Examples of the fusion protein technology can be found in the international patent applications Nos. WO94 / 2958 and WO94 / 22914. Each of the polynucleotide sequences provided herein can be used in the discovery and development of antibacterial compounds. The encoded protein, after expression, can be used as a target for the classification of antibacterial drugs. In addition, polynucleotide sequences encoding the amino terminal regions of the encoded protein or Shine-Delgarno or other translation that facilitates the sequences of the respective mRNA can also be used to construct anti-sense sequences to control the expression of the coding sequence. inferes. The invention also provides the use of the polypeptide, polynucleotide, agonist or antagonist of the invention to interfere with the initial physical interaction between a pathogen or pathogens and a eukaryotic, preferably a mammal, host responsible for the sequelae of infection. In particular, the molecules of the invention can be used: to prevent the adhesion of bacteria, in particular gram positive and / or gram negative bacteria, to eukaryotic extracellular matrix proteins, preferably of mammalian, or in hosted devices or in matrix proteins extracellular in wounds; for blocking bacterial adhesion between eukaryotic extracellular matrix proteins, preferably mammalian and bacterial BASB020 proteins that mediate tissue damage and / or block the normal progression of pathogenesis in infections initiated differently through the implantation of hosted devices or through of surgical techniques. According to another aspect of the invention there are BASB020 agonists and antagonists, preferably bacteriostatic or bactericidal agonists and antagonists. The antagonists and agonists of the invention can be used, for example to prevent, inhibit and / or trap diseases.

In a further aspect, the present invention relates to mimotopes of the polypeptide of the invention. A mimotope is a sequence of pepid, sufficiently similar to the naive peplido (sequentially or structurally), which is capable of being recognized by antibodies that recognize the native peptide; or is capable of developing antibodies that recognize the native peptide when coupled to a suitable carrier. Peptide mimotopes can be designed for a particular purpose through the addition, removal or substitution of selected amino acids. In this manner, the peptides can be modified for the purposes of facilitating conjugation to a proinin promoter. For example, it may be desirable for some chemical conjugation methods to include a terminal cysteine. In addition, it may be desirable for peptides conjugated to a protein carrier that include a hydrophobic terminus away from the conjugated term of the peptide, such that the free unconjugated end of the peptide remains associated with the surface of the carrier protein. In this way the peptide is presented in a conformation that most likely resembles that of the peptide found in coníexlo of the whole naliva molecule. For example, the peptides can be alleled to have an N-terminal cisine and a C-terminal hydrophobic amidated tail or tail. Alternatively, the addition or substifution of a D-stereoisomer form of one or more of the amino acids can be performed to create a beneficial derivative, for example, to improve the stability of the peptide. Alternatively, mimotopes of the peptide can be idenified using antibodies which are themselves capable of binding to the polypeptides of the present invention using standard techniques such as phage display technology (EP 0 552 267 B1). It is technical, it generates a large number of peptide sequences that resemble the structure of native peptides and, therefore, are capable of binding to anti-naive peptide antibodies, but not necessarily by themselves they can share sequence homology. imporíanie with naive polypeptide.

Vaccines Another aspect of the invention relates to a method for inducing an immune response in an individual, particularly a mammal, preferably humans, which comprises inoculating the subject with the BASB020 polynucleotide and / or polypeptide, or a fragment or variant of the same, suitable for producing the antibody and / or a T cell immune response to protect said individual from infection, particularly bacterial infection and more particularly infection by Moraxella catarrhalis. Median methods are also provided which said immunological response reduces bacterial replication. In yet another aspect, the invention relates to a method for inducing an immune response in an individual, which comprises supplying to said individual a nucleic acid, sequence or ribosome neighbor to direct expression of the polynucleolide and / or BASB020 polypeptide, or a fragment or variant thereof, for expressing the BASB020 polynucleotide and / or polypeptide, or a fragment or variant thereof, for the purpose of inducing an immune response, such as, to produce the antibody and / or an immune response of T cell, including, for example, cytokine production T cells or T cells of cytotoxic cells, to protect said individual, preferably a human being, from a disease, whether that disease is already established within the individual or not. An example to administer the gene is to accelerate it towards the desired cells as a cover on particles or something else. Said nucleic acid vector may comprise DNA, RNA, a ribosome, a modified nucleic acid, a DNA / RNA hybrid, a DNA-protein complex or an RNA-protein complex. A further aspect of the invention relates to an immunological composition that when introduced to an individual, preferably a human being, capable of inducing an immune response therein, induces an immune response in said individual to a polynucleotide and / or BASB020 polypeptide thereof, wherein the composition comprises a recombinant BASB020 polynucleotide and / or polypeptide encoded therefrom and / or comprises DNA and / or RNA that encodes and expresses an antigen of the polynucleotide, BASB020 polypeptide encoded thereon, or other polypeptide the invention. The immune response can be used therapeutically or prophylactically and can take the form of antibody immunity and / or cellular immunity, such as cellular immunity arising from CTL or CD4 + T cells. A BASB020 polypeptide or a fragment thereof can be fused with a co-protein or chemical moiety, which may or may not produce antibodies, but is capable of stabilizing the first protein and producing a fused or modified protein, which will have antigenic and / or immunogenic properties, and preferably protective properties. In this way, the fused recombinant protein, preferably further comprises an antigenic co-protein, such as Haemophilus influenzae lipoprotein D, glutathione-S-transferase (GST) or beta-galactosidase, or any other relatively large co-protein that solubilizes the protein and facilitates the production and purification of it. In addition, coproifein may act as an adjuvant in the sense of providing a generalized stimulation of the immune system of the organism receiving the protein. The co-protein can be bound either to the amino or carboxy terminus of the first protein. Through this invention are provided compositions, particularly vaccine compositions, and methods comprising the polypeptides and / or polynucleotides of the invention and immunostimulatory DNA sequences, such as those described by Sato, et al., Science 273: 352 (1996). . Also, this invention provides methods that use the described polynucleotide or its parlicular fragments, which have been shown to encode non-variable regions of Baclerian cell surface proleins., in polynucleotide constructs used in such experiments of genetic immunization in animal models of infection with Moraxella catarrhalis. These experiments will be particularly useful to identify protein epitopes capable of provoking a prophylactic or therapeutic immune response. It is believed that this aspect will allow the subsequent preparation of monoclonal antibodies of particular value, derived from the requisite organ of the animal that successfully resists or eliminates the infection, for the development of prophylactic agents or therapeutic treatments of Baclerian infection, particularly infection by Moraxella catarrhalis, in mammals, particularly human beings. The invention also includes a vaccine formulation comprising an immunogenic recombinant polypeptide and / or polynucleotide of the invention together with a suitable carrier, such as a pharmaceutically acceptable carrier. Since the polypeptides and polynucleolides can be separated in the slogan, each is preferably administered parenterally, including, for example, administration which is subcutaneous, intramuscular, intravenous or intradermal. Formulations suitable for parenteral administration include sterile aqueous and non-aqueous injection solutions, which may contain antioxidants, pH regulators, bacteriostatic compounds and solutes which render the formulation isotonic with the body fluid, preferably the blood, of the individual.; and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents. The formulations can be presented in single dose or multiple dose containers, for example, sealed vials and flasks and can be stored in a freeze dried condition that requires only the addition of the sterile liquid vehicle immediately before use. The vaccine formulation of the invention may also include auxiliary systems to improve the immunogenicity of the formulation. Preferably, the auxiliary system preferentially evokes a response type TH1. An immune response can be broadly distinguished into two extreme categories, being a humoral or cell-mediated immune responses (ideally characterized by mechanism of antibody effectors and protective cells, respectively).

These response categories have been called TH-1 type responses (cell-medd response) and TH2-type immune responses (humoral response). The extreme TH1 immune responses can be characterized by the generation of cytotoxic T lymphocytes restricted in aplotype, antigen-specific, and natural killer cell responses. In TH1 type responses of roots these are usually characterized by the generation of antibodies of the IgG2a subtype, while in humans they correspond to IgG1 type antibodies. The TH2-type immune responses are characterized by the generation of a broad scale of immunoglobulin isotypes including in IgG1, IgA, and IgM mice.

It can be considered that the driving force behind the development of these two types of immune responses are cytokines. High levels of TH1-type cytosines tend to favor the induction of cell-medd immune responses for the given antigen, while high levels of TH2-type cytosines tend to favor the induction of humoral immune responses to the antigen. The distinction between immune responses of type TH1 and TH2 is not absolute. In reality, an individual will suppress an immune response that is described as predominantly TH1 or predominantly TH2. However, it is generally convenient to consider the families of cells in terms of those described in murine CD4 + ve T cell clones by Mosmann and Coffman (Mosmann, TR and Coffman, RL (1989) TH1 and TH2 cells : different patterns of lymphokine secretion lead to different functional properties, Annual Review of Immunology, 7, p145-173.p Traditionally, the responses of type TH1 are assocd with the production of the cytosines INF-? and IL-2 through T lymphocytes. Other coughs usually directly assocd with the induction of TH1-type immune responses are not produced by T cells, such as IL-12. In contrast, the TH2 lipo responses are assocd with the secretion of II-4, IL-5, IL-6 and IL-13. 10 Vaccine auxiliaries are known to be particularly common # Suitable for the elimination of lipo cytosine responses either TH1 or TH2. Traditionally, the best indicators of the TH1: TH2 balance of the immune response after vaccination or infection include direct measurement of production of TH1 or TH2 cytokines by T lymphocytes in vitro after restimulation with antigen, and / or the measurement of the ratio of IgG1: IgG2a of the antigen-specific antibody responses. In this way, an auxiliary of type TH1 is one that preferentially stimulates populations of isolated T cells for produce high levels of TH1-type cytosine when re-stimulated with antigen in vitro, and promote the development of both CD8 + cytoioxic T lymphocytes and the response of specific immunoglobulin-anigen assocd with the TH1-type isolipid. The auxiliaries that are capable of preferential stimulation of the TH1 cell response are described in International Patent Application No. WO 94/00153 and WO 95/17209. Lipid A of 3-Des-O-asylated monophosphoryl (3D-MPL) is one of these auxiliaries. It is known from GB 2220211 (Ribi). Chemically, it is a mixture of 3-De-O-acylated monophosphoryl A lipid with 4.5 or 6 isolated chains and is manufactured by Ribi Immunochem., Montana. A preferred form of the 3-Des-O-asylated monophosphoryl lipid A is described in the European Pafenie application 0 689454 B1 (SmiihKIine Beecham Biologicals SA). Preferably, the 3D-MPL particles are suffciently small to be sterile filtered through a 0.22 micron membrane (European Patent No. 0 689 454). 3D-MPL will be present in the range of 10μg-100μg, preferably 25-50μg per dose, where the antigen will typically be present on a scale of 2-50μg per dose. Another preferred auxiliary comprises QS21, a non-toxic fraction purified by Hplc derived from Quillaja bark Saponaria Molina. Optionally, this can be mixed with 3-Des-O-asylated monophosphoryl lipid A (3D-MPL), optionally June with a vehicle. The production method of QS21 is described in the Patent of E.U.A. No. 5,057,540. Previously, non-reactogenic auxiliary formulations containing QS21 have been described (WO 96/33739). Said formulations comprising QS21 and choleslerol have been shown to be successful TH1 stimulatory aids when formulated together with an antigen. Other auxiliaries that are preferential stimulants of the • TH1 cell response include oligonucleotides immunomodulators, for example, non-methylated CpG sequences as described in WO 96/025555. The TH1 stimulant auxiliary difference combinations, such as those mentioned above, are also contemplated to provide an auxiliary that is a stimulant. preferential of the TH1 cell response. For example, QS21 can be formulated June with 3D-MPL. The ratio of QS21: 3D-MPL will typically be in the order of 1:10 to 10: 1; preferably from 1: 5 to 5: 1 and substantially from 1: 1. The preferred scale for optimal synergy is 2.5: 1 to 1: 1 3D-MPL: QS21. Preferably, a vehicle is also present in the vaccine composition according to the invention. The vehicle can be an oil-in-water emulsion, or an aluminum salt, such as aluminum phosphate or aluminum hydroxide. • A preferred oil-in-water emulsion comprises an oil Metabolizable, such as squalene, alpha tocopherol and Tween 80. In a particularly preferred aspect, the anligens in the vaccine composition according to the invention are combined with QS21 and 3D-MPL in said emulsion. In addition, the oil-in-water emulsion can confer span 85 and / or lecithin and / or tricaprylin. Typically, for administration to humans, QS21 and 3D-MPL will be present in a vaccine in the range of 1μg-200μg, ie, 10-100μg, preferably 10μg-50μg per dose. Typically, the oil-in-water emulsion will comprise 2 to 10% squalene, 2 to 10% alpha tocopherol and 0.3 to 3% Tween 80. Preferably the squalene: alpha tocopherol ratio is equal to or less than 1 and which provides a more stable emulsion. Span 85 can also be present at a level of 1%. In some cases, it may be advantageous if the vaccines of the present invention can also contain a stabilizer. Non-toxic water-in-oil emulsions preferably contain a non-toxic oil, for example, squalane or squalene, an emulsifier, for example, Tween 80 in an aqueous vehicle. The aqueous vehicle can be, for example, saline regulated in its pH with phosphate. A particularly powerful auxiliary formulation that implies QS21.3D-MPL and tocopherol in an oil-in-water emulsion is described in WO 95/17210. The present invention also provides a polyvalenle vaccine composition comprising a vaccine formulation of the invention in combination with other antigens, in particular antigens useful for treating cancer, autoimmune diseases and related conditions. Said polyvalent vaccine composition may include an induction helper of TH-1 as described above. Although the invention has been described with reference to certain BASB020 polypeptides and polynucleotides, it should be understood that it covers fragments of naturally occurring polypeptides and polynucleotides, and similar polypeptides and polynucleotides with additions, deletions or substitutions that do not substantially affect the immunogenic properties of the polypeptides or recombinant polynucleotides.

Compositions, Types and Administration In a further aspect of the invention, there are provided compositions comprising a BASB020 polynucleotide and / or a BASB020 polypeptide for administration to a cell or a multicellular organism. The invention also relates to compositions comprising a polynucleotide and / or a polypeptide, described here, or its agonists or antagonists. The polypeptides and polynucleotides of the invention may be employed in combination with a non-sterile or sterile vehicle or vehicles for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to an individual. Said compositions comprise, for example, a media additive or a therapeutically effective amount of a polypeptide and / or polynucleotide of the invention and a pharmaceutically acceptable carrier or excipient. Such vehicles may include, but are not limited to, saline, pH regulated saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation must be adapted to the mode of administration. The conjugate invention of the peptide, so that the free unconjugated end of the peptide remains associated with the surface of the carrier protein. In this manner, the peptide is presented in a conformation that most likely resembles that of the peptide found in the context of the entire native molecule. For example, the peptides can be altered to have an N-terminal cysteine and a C-terminal hydrophobic amidated tail or tail. Alternatively, the addition or substitution of a D-stereoisomer form of one or more of the amino acids can be performed to create a beneficial derivative, for example, to improve the stability of the peptide. Alternatively, mimotopes of the peptide can be identified using antibodies that are capable by themselves of binding to the polypeptides of the present invention using techniques such as phage display technology (EP 0 552 267 B1). This technique generates a large number of peptide sequences that resemble the structure of the native peptides and, therefore, are capable of binding to anti-naive peptide antibodies, but not necessarily by themselves can share sequence homology imporlanle with the nalive polypeptide.

Vaccines The other aspect of the invention relates to a method for inducing an immune response in an individual, particularly a mammal, preferably humans, which comprises 48 inoculating the subject with the polynucleotide and / or BASB020 polypeptide, or a fragment or variant thereof, suitable for producing the antibody and / or a T cell immune response to protect • said individual of infection, particularly Baclerian infection and 5 more particularly infection by Moraxella catarrhalis. Methods are also provided by which said immunological response reduces bacterial replication. In still another aspect, the invention relates to a method for inducing a nanobiological response in an individual, which comprises supplying said individual a nucleic acid vector, sequence or ribosome for • direct expression of the BASB020 polynucleotide and / or polypeptide, or a fragment or variant thereof, to express the BASB020 polynucleotide and / or polypeptide, or a fragment or variant thereof in vivo for the purpose of inducing an immune response, such as , for produce the antibody and / or a T cell immune response, including, for example, cytokine production T cells or T cells of cytotoxic cells, to protect said individual, preferably a human being, from a disease, if that disease It is already established within the individual or not. A The example to administer the gene is by accelerating it towards the desired cells as a cover on particles or something else. Said nucleic acid vector may comprise DNA, RNA, a ribosome, a modified nucleic acid, a DNA / RNA hybrid, a DNA-protein complex or an RNA-protein complex. Another aspect of the invention relates to an immunological composition 49 that when introduced to an individual, preferably a human being, capable of inducing an immune response therein, induces an immune response in said individual to a polynucleide and / or BASB020 polypeptide encoded therein, wherein the composition comprises a recombinant BASB020 polynucleotide and / or polypeptide encoded therefrom and / or comprises DNA and / or RNA encoding and expressing an antigen of the polynucleotide, BASB020 polypeptide encoded therein, or other polypeptide of the invention. The immune response can be used therapeutically or prophylactically and can take the form of antibody immunity and / or cellular immunity, as cellular immunity arising from CTL or CD4 + T cells. A BASB020 polypeptide or a fragment thereof can be fused with a co-protein or chemical moiety, which may or may not produce antibodies, but is capable of stabilizing the first protein and producing a fused or modified protein, which will have antigenic and / or immunogenic properties, and preferably protective properties. In this way, the fused recombinant protein preferably also comprises an antigenic co-protein, such as lipoprolein D from Haemophilus influenzae, giutationa-S-transferase (GST) or beta-galactosidase, or any other relatively large co-protein that solubilizes the protein and facilitates the production and purification of it. In addition, the co-protein can act as an adjuvant in the sense of providing a generalized stimulation of the immune system of the organism receiving the protein. The co-protein can be linked either to the amino or carboxy terminus of the first protein. Compositions, particularly vaccine compositions, and methods comprising the polypeptides and / or polynucleotides of the invention and immunostimulatory DNA sequences, such as those described by Sato, et al., Science 273: 352 (1996) are provided by this invention. . Also, this invention provides methods that use the described polynucleotide or its particular fragments, which have been shown to encode non-variable regions of bacterial cell surface proteins., in polynucleotide constructs used in said genetic immunization experiments in animal models of infection with Moraxella catarrhalis. Said experiments will be partially useful to idenify prolein epitopes capable of provoking a prophylactic or lepraeuic immune response. It is believed that this aspect will allow the subsequent preparation of monoclonal antibodies of paraficular value, derived from the requisite organ of the animal that successfully resists or eliminates the infection, for the development of prophylactic agendas or ipaeulic fralarienals of Baclerian infection, parlicuiarly infection by Moraxella catarrhalis, in mammals, particularly human beings. The invention also includes a vaccine formulation comprising an immunogenic recombinant polypeptide and / or polynucleotide of the invention together with a suitable carrier, such as a pharmaceutically acceptable carrier. Since the polypeptides and polynucleotides can be separated in the stomach, each is preferably administered parenterally, including, for example, administration which is subcutaneous, intramuscular, intravenous or intradermal. Formulations suitable for parenteral administration include sterile aqueous and non-aqueous injection solutions, which may contain antioxidants, pH regulators, bacteriostatic compounds and solutes which render the formulation isotonic. with the body fluid, preferably the blood, of the individual; Y • Aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents. The formulations can be presented in single-dose or multi-dose containers, for example, sealed vials and flasks and can be stored in a freeze dried condition that requires only the addition of the liquid sterile vehicle immediately before use. The vaccine formulation of the invention may also include • auxiliary systems to improve the immunogenicity of the formulation. Preferably, the auxiliary system preferentially evokes a response type TH1. An immune response can be broadly disliked in two exiguous categories, being a humoral or immune responses mediated by cell (traditionally characterized by mechanism). antibody and protective cell effectors, respectively). 52 These response categories have been called TH-1 type responses (cell-mediated response) and TH2-type immune responses (humoral response). The extreme TH1 type immune responses can be characterized by the generation of cytotoxic T lymphocytes restricted in aplotype, specific antigen, and nalural annihilator cell responses. In TH1 type responses of mice these are usually characterized by the generation of IgG2a subtype antibodies, while in humans it is correspond to antibodies of type lgG1. The immune responses of • Type TH2 are characterized by the generation of a wide scale of immunoglobulin isotypes including in rationing IgG 1, IgA, and IgM. It can be considered that the driving force behind the development of these two types of immune responses are cytokines.

Alloys levels of TH1-type cilosins tend to favor the induction of cell-mediated immune responses for the given antigen, whereas all levels of cytosines of TH2 type tend to favor the induction of humoral immune responses. • for the animal. 20 The dissolution of TH1 and TH2 type immune responses is not absolute. In reality, an individual will suppress an immune response that is described as predominantly TH1 or predominantly TH2. However, it is usually convenient to consider cytosine families in terms of those described in murine CD4 + ve T cell clones by Mosmann and Coffman 53 (Mosmann, TR and Coffman, RL (1989) TH1 and TH2 cells: different patterns of lymphokine secretion lead differenl funcfional properties, Annual Review of Immunology, 7 , p145-173 Traditionally, TH1-type responses are associated with the production of cytokines INF- and IL-2 through T-lymphocytes, other cytokines usually directly associated with the induction of TH1-type immune responses. They are produced by T cells, such as IL-12, In contrast, TH2-type responses are associated with the secretion of II-4, IL-5, IL-6 and IL-13. Particularly suitable for the stimulation of kinase responses of either TH1 or TH2 type Traditionally, the best TH1: TH2 balance indicators of the immune response after a vaccination or infection includes direct measurement of TH1 cytosine production or TH2 by T lymphocytes in vitro after restimulation with antigen, and / or measuring the ratio of IgG1: IgG2a of the antigen-specific antibody responses.

Thus, a TH1 lipo auxiliary is one that preferentially stimulates isolated T cell populations to produce high levels of TH1-type cytosine when re-stimulated with in vitro antigen, and promotes the development of both CD8 + cytotoxic T lymphocytes and specific antigen immunoglobulin response associated with the TH1 type isotype. Assistants that are capable of preferential stimulation of the TH1 cell response are described in International Patent Application No. WO 94/00153 and WO 95/17209. Lipid A of 3-Des-O-asylated monophosphoryl (3D-MPL) is one of these auxiliaries. It is known from GB 2220211 (Ribi). Chemically, is a mixture of 3-De-O-acylated monophosphoryl A lipid with 4.5 or 6 isolated chains and is manufactured by Ribi Immunoc em., Montana. A preferred form of the 3-Des-O-asylated monophosphoryl lipid A is described in European Patent Application 0 689454 B1 (SmithKine Beecham Biologicals SA). Preferably, the 3D-MPL particles are small enough to be filtered in sterile form through a 0.22 micron membrane (European Patent No. 0 689 454). The 3D-MPL will be present in the range of 10μg-100μg, preferably 25-50μg per dose, where the antigen will typically be present on a scale of 2-50μg per dose. Another preferred aid comprises QS21, a non-toxic fraction purified by Hplc derived from Quillaja bark Saponaria Molina. Optionally, this can be mixed with 3-Des-O-asylated monophosphoryl lipid A (3D-MPL), optionally together with a carrier. The production method of QS21 is described in the U.S. Patent. No. 5,057,540. Previously, non-reactogenic auxiliary formulations containing QS21 have been described (WO 96/33739). Said formulations comprising QS21 and cholesterol have been shown to be auxiliary TH1 stimulants are successful when formulated together with an antigen. Other adjuvants that are preferential stimulants of the TH1 cell response include oligonucleotides immunomodulators, for example, non-methylated CpG sequences as described in WO 96/025555. Combinations of different TH1 stimulating aids, such as those mentioned above, are also contemplated to provide an auxiliary that is a stimulant. preferential of the TH1 cell response. For example, QS21 can • be formulated together with 3D-MPL. The ratio of QS21: 3D-MPL will typically be in the order of 1:10 to 10: 1; preferably from 1: 5 to 5: 1 and substantially from 1: 1. The preferred scale for optimal synergy is 2.5: 1 to 1: 1 3D-MPL: QS21. Preferably, a vehicle is also present in the vaccine composition according to the invention. The vehicle can be an oil-in-water emulsion, or an aluminum salt, such as aluminum phosphide or aluminum hydroxide. • A preferred oil-in-water emulsion comprises an oil Metabolizable, such as squalene, alpha tocopherol and Tween 80. In a particularly preferred aspect, the antigens in the vaccine composition according to the invention are combined with QS21 and 3D-MPL in said emulsion. In addition, the emulsion of acetyl in water may contain span 85 and / or lecithin and / or tricaprylin. Typically, for administration to humans, QS21 and 3D-56 MPL will be given in a vaccine in the range of 1μg-200μg, such as 10-100μg, preferably l6μg-50μg per dose. Typically, the oil-in-water emulsion will comprise 2 to 10% squalene, 2 to 10% alpha tocopherol and 0.3 to 3% Tween 80. Preferably the squalene: alpha tocopherol ratio is equal to or less than 1 and which provides a more stable emulsion. Span 85 can also be present at a level of 1%. In some cases, it may be advantageous if the vaccines of the present invention can also contain a stabilizer. The non-toxic oil-in-water emulsions preferably contain a non-toxic aceyl, for example, squalane or squalene, an emulsifier, for example, Tween 80 in an aqueous vehicle. The aqueous vehicle can be, for example, saline regulated in its pH with phosphate. A particularly powerful auxiliary formulation that involves QS21.3D-MPL and tocopherol in an oil-in-water emulsion is described in WO 95/17210. The present invention also provides a polyvalent vaccine composition comprising a vaccine formulation of the invention in combination with other antigens, in particular antigens useful for treating cancer, autoimmune diseases and related conditions. Said polyvalent vaccine composition may include a TH-1 induction aid as described above. Although the invention has been described with reference to certain BASB020 polypeptides and polynucleotides, it should be understood that it covers fragments of naturally occurring polypeptides and polynucleotides, and similar polypeptides and polynucleotides with additions, deletions or subsfifutions that do not substantially affect the immunogenic properties of the recombinant polypeptides or polynucleotides.

Compositions, kits and administration In a further aspect of the invention, compositions comprising a BASB020 polynucleotide and / or a BASB020 polypeptide for administration to a cell or a multicellular organism are provided. The invention also relates to compositions comprising a polynucleotide and / or a polypeptide, described here, or its agonists or antagonists. The polypeptides and polynucleotides of the invention can be used in combination with a non-sterile or sterile vehicle or vehicles to be used with cells, tissues or organisms, as a suitable pharmaceutical carrier for administration to an individual. Said compositions comprise, for example, a media additive or an ephemeral effective amount of a polypeptide and / or polynucleotide of the invention and a pharmaceutically acceptable carrier or excipient. Such vehicles may include, but are not limited to, saline, pH regulated saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation must be adapted to the mode of administration. The invention 58 further relates to packages and diagnostic and pharmaceutical equipment comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention. Polypeptides, polynucleotides and other compounds of the invention can be employed alone or in conjunction with other compounds, such as therapeutic compounds. The lepraeulic compositions can be administered in an effective, convenient manner including, for example, administration via topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes, among others. In therapy or as a prophylactic, the active agent can be administered to an individual as an injectable composition, for example, as a sterile aqueous dispersion, preferably isotonic. In a further aspect, the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of a polypeptide and / or polynucleotide, such as the soluble form of a polypeptide and / or polynucleolide of the present invention, agonist or antagonist peptide or molecule compound small, in combination with a pharmaceutically acceptable carrier or excipient. Such vehicles include, but are not limited to, saline, pH regulated saline, dextrose, water, glycerol, ethanol, and combinations thereof. The invention further relates to pharmaceutical packages and equipment comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention. Polypeptides, polynucleotides and other compounds of the present invention alone or June with other compounds, such as therapeutic compounds. The composition will be adapted to the administration route, for example, through a systemic route or an oral route. Preferred forms of systemic administration include, injection, typically through intravenous injection. Other routes of injection, such as subcutaneous, intramuscular or intraperitoneal, can be used. Alternative means for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acids or other detergenfes. In addition, if a polypeptide or other compounds of the present invention can be formulated in an enteric or encapsulated formulation, oral administration may also be possible. The administration of these compounds can also be • Topical and / or localized, in the form of balsams, pastes, gels, lotions, powders and the like. To be administered to mammals, and particularly to humans, it is expected that the daily dose level of the active agent will be from 0.01 mg / kg to 10 mg / kg, typically around 1 mg / kg. The doctor will in any case delermine the actual dose that will be the most suitable for an individual and will vary with the age, weight and response of the individual individual. The above doses are illustrative of the average case. Of course, there may be individual cases where higher or lower dose scales are warranted, and these are within the scope of this invention. The preferred dose scale depends on the choice of the peptide, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending physician. However, the appropriate doses are on the scale of 0.1-100μg / kg of the subject. A vaccine composition is conveniently in injectable form. Conventional auxiliaries can be used to improve the immune response. A suitable unit dose for vaccination is 0.5-5 micrograms / kg of the antigen, and said dose is preferably administered 1-3 times and with an interval of 1-3 weeks. With the indicated dose scale, no adverse toxicological effect will be observed with the compounds of the invention that could prevent their administration to suitable individuals. However, it is expected that wide variations in the dose required in view of the variety of compounds available and the different efficiencies of various administration routes. For example, oral administration may be expected to require higher doses than administration to injections of iniravenous. Variations in these dose levels can be adjusted using standard empirical routines for optimization, as is well known in the art. 61 Databases of Sequences. Sequences in a Tangible Medium and Algorithms The polynucleotide and polypeptide sequences form a valuable information resource with which their bi-and three-dimensional structures are determined as well as identify additional sequences of similar homology. These aspects are facilitated by storing the sequence in a computer readable medium and then using the data stored in a known macromolecular structure program or to search a sequence database by using well-known search tools, such as the GCG program package. The present invention also provides methods for the analysis of sequences or strips of character, particularly genetic sequences or encoded protein sequences. Preferred methods of sequence analysis include, for example, sequence homology analysis methods, such as identity and similarity analysis, DNA, RNA and protein structure analysis, sequence assembly, cladistic analysis, sequence motif analysis , determination of open reading frame, called nucleic acid base, codon usage analysis, nucleic acid base classification and peak analysis of sequencing chromatogram. A computer-based method is provided to perform homology identification. This method comprises the steps of: providing a first polynucleotide sequence comprising the sequence of a polynucleotide of the invention in a computer-readable medium.; and comparing said polynucleotide sequence with at least one second polynucleotide or polypeptide sequence to identify the homology. A computer-based method for performing homology identification is also provided, said method comprising the steps of: providing a first polypeptide sequence comprising the sequence of a polypeptide of the invention in a computer-readable medium; and comparing the first polypeptide sequence with at least one second polynucleotide or polypeptide sequence to identify the homology. All publications and references, including, but not limited to, patents and patent applications, as set forth in this specification are incorporated herein by reference in their language, as if each publication or individual reference was specific and individually indicated as incorporated by reference herein as eslabiece íoíalmeníe. Any patent application to which this application claims priority, is also incorporated herein by reference in its entirety in the manner described above for publications and references. DEFINITIONS "Identity", as is known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be, can be delerminated 63 while retaining the sequence. In the "identity" technique it also means the degree of sequence relationship between polypeptide or polynucleotide sequences, as the case may be, as determined by the coincidence between the sequences of said sequences. "Identity" can be easily calculated through known methods, including, but not limited to those described in (Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informaíics and Genome Projecls , Smiíh, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G ., Academic Press, 1987, and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988) The methods for determining identity are designed to give the greatest match between the sequences tested.Moreover, the methods for disclosing identity are encoded in publicly available computer programs. of computer to determine the identity between The sequences include, but were not limited to, the GAP program in the CGC program package (Devereux, J., and others, Nucleic Acids Research 12 (1): 387 (1984)), BLASTP, BLASTN (Altschul, S.F. and others, J. Molec. Bioi. 215: 403-410 (1990), and FASTA (Pearson and Lipman Proc. Nati. Acad. Sci. USA 85; 2444-2448 (1988).) The BLAST family of programs is publicly available from 64 NCBIs and other sources (BLAST Manual , Altschul, S., and others, NCBI NLM NIH Belhesda, MD 20894; Allschul, S., and oíros, J. Mol. Biol. 215: 403-410 (1990). The well-known algorithm of Smiíh Walerman can also be used to determine identity. Parameters for polypeptide sequence comparison include the following: Algorifm: Needleman and Wunsch, J. Mol Biol. 48: 443-453 (1970) Comparison Matrix: BLOSSUM62 by Henikoff and Henikoff, Proc.

Nati Acad. Sci. USA. 89: 10915-10919 (1992). Hollow Penalty: 8 Gap Length Penalty: 2 A useful program with parametric spheres is publicly available as the "gap" program of Genefics Compuer Group, Madison Wl. The parameters listed above are the default parameters for peptide comparisons (without any penalty for ex- treme gaps). The parameters for the polynucleotide comparison include the following: Algorithm: Needleman and Wunsch, J. Mol Biol. 48: 443-453 (1970) Comparison Matrix: coincident aspects = +10, non-co-occurring = 0 Gap Penalty: 50 Gap Length Penalty: 3 Available as: the gap program of Geneíics Computer Group, Madison Wl. These are the default parameters for 65 nucleic acid comparisons. A preferred meaning for "identity" for polynucleotides, and polypeptides, as the case may be, is provided in (1) and (2) below. (1) Polynucleolide embodiments further include an isolated polynucleotide comprising a polynucleolide sequence having at least 50, 60, 70, 80, 85, 90, 95, 97 or 100% identity to the reference sequence SEQ ID NO. NO: 1, wherein said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO: 1, or may include up to a whole number of nucleotide alterations as compared to the reference sequence, wherein said alterations are selected of the group consisting of at least one deletion, nucleotide substitution, including transition and transversion, or insertion, and wherein said alterations may occur at the 5 'or 3'-termini positions of the reference nucleolide sequence or any other those terminal positions, interspersed either individually between the nucleotides in the reference sequence or in one or more continuous groups within the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides in SEQ ID NO: 1 by the integer that defines the percent identity divided by 100 and then subtracting that prodult from the total number of nucleotides in SEQ ID NO: 1 or: comparison in pairs of identities is summarized in Table 3, showing that the four BASB020 protein sequences are all similar at identity level equal to or greater than 99%.

Table 1: Characteristics of the strains of Moraxella catarrhalis used in this study Table 2: Identities in pairs of BASB020 polynucleotide sequences (in%) Table 3: Identities in pairs of BASB020 polypeptide sequences (in%) Example 3: Construction of plasmid to express recombinant BASB020. A: Cloning of BASB020. The Bam Hl and Sali restriction sites engineered in previous amplification primers ([SEQ ID NO: 11)] and inverse ([SEQ ID NO: 12]), respectively, allowed directional cloning of the PCR production of 504 bp in the commercially available E. coli expression pyramid, pQE30 (QiaGen, resistant to ampicillin), so that a mature BASB020 protein can be expressed as a fusion protein containing an affinity chromatography (His) tag in the serum? No. The PCR product BASB020 was purified from the amplification reaction using spin columns made of silica gel (QiaGen) according to the manufacturer's instructions. To produce the required BamHl and Salí terms necessary for cloning, the purified PCR product was sequentially digested to be supplemented with BamHl and Salí reslinding enzymes as recommended by the manufacturer (Life Technologies). After the first restriction digestion, the PCR product was purified through spin column as was done earlier to remove salts and eluted in sterile water before the second enzyme digested. The fragment of digested DNA was again purified using spin columns based on silica gel before ligation with the plasmid pQE30.

B: Production of the Expression Vector. To prepare the expression plasmid pQE30 for ligation, it was similarly digested to complete lanto with BamHl as SalI and then treated with bovine intestinal phosphatase (CIP, approximately 0.02 units / pmoles from the 5 'end, Life Technologies) as directed by the manufacturer to avoid self-ligating. A molar excess of approximately 5 times the fragment digested for the prepared vecter was used to program the ligation reaction. A standard ligation reaction of approximately 20 μl (approximately 16 ° C, approximately 16 hours), using methods well known in the art, was performed using T4 DNA ligase (approximately 2.0 units / reaction, Life Technologies). A ligation aliquot (approximately 5 μl) was used to transform the electro-competent M15 (pREP4) cells according to methods well known in the art. After a growth period of approximately 2-3 hours at 37 ° C in approximately 1.0 ml of the LB broth, the transformed cells were plated on LB agar plates containing kanamycin (50 μg / ml) and ampicillin (100 μg / ml). ml). both antibiotics were included in the selection means to ensure that all transformed cells carried both the plasmid pREP4 (KnR) carrying the laclq gene necessary for the repression of expression for expression that can be induced by IPTG of proteins in pQE30, and the plasmid pQE30-BASB020 (ApR). The plates were incubated overnight at 37 ° C for about 16 hours. Individual colonies of KnR / ApR were collected with sterile sticks and used to "patch" fresh LR KnR / ApR plates as an inoculum as well as a culinary broth of approximately 1.0 ml of LB KnR / ApR. Both patched plates and the broth culinate were incubated overnight at 37 ° C either in a standard incubator (plates) or in a shaking water bath. An analysis of whole cell based PCR was used to verify which transformants are contained in the BASB020 DNA insert. Here, the broth culture of approximately 1.0 ml of LB Kn / Ap overnight was transferred to a 1.5 ml polypropylene tube and the cells were collected through sterilization in a Beckmann microcentrifuge (approximately 3 minutes, at ambient temperature). , approximately 12,000 X g). The cell pellet was suspended in approximately 200 μl of sterile water and an aliquot of approximately 10 μl was used to program a final volume PCR reaction of approximately 50 μl containing both the anterior and inverse amplification primers of BASB020. The final concentrations of the PCR reaction components were essentially the same as those specified in Example 2, except that approximately 5.0 units of Taq polymerase were used. The denaturation step at initial 95 ° C was increased to 3 minutes to ensure thermal separation of the bacterial cells and release of the plasmid DNA. A model 9700 ABI thermal cycler and a three step, 32 cycle thermal amplification profile were used, ie 95 ° C, 45 sec.; 55-58 ° C, 45 sec, 72 ° C, 1 min., To amplify the PCR fragment of MC-P6 from the samples of the lysate transformant. After the thermal amplification, an aliquot of approximately 20 μl of the reaction was analyzed through agarose gel electrophoresis (0.8% agarose in pH-regulator of fris-acetate-EDTA (TAE))). The DNA fragments were visualized by UV illumination after gel eleclroforesis and stained with ethidium bromide. A DNA-standard DNA standard (1 Kb ladder, Life Technologies) was electrophoresed in parallel with the test samples and used to clarify the size of the PCR products.

• The transformants that produced the expected 504 bp PCR product were identified as strains containing a BASB020 expression construct. Then, the strains containing the expression plasmid were analyzed for the expression capable of induction of the recombinant BASB020. 10 C: Expression Analysis of Positive PCR Transformants. For each positive PCR transformant idenified above, approximately 5.0 ml of the LB broth confusing kanamycin (50 μg / ml) and ampicillin (100 μg / ml) were inoculated with cells of the patch plate and developed overnight at 37 ° C with agitation (approximately 250 rpm). An aliquot of the night seed culture (approximately 1.0 ml) was inoculated into a 125 ml Erlenmeyer flask containing approximately 100 ml. • 25 ml of Kn / Ap LB broth and developed at 37 ° C with shaking (approximately 250 rpm) until the turbidity of the culíivo reached O.D.600 of approximately 0.5, that is to say, a phase of average reg? Sfro (usually around 1.5-2.0 hours). At that time, approximately half of the culíivo (approximately 12.5 ml) was transferred to a second 125 ml flask and the expression of the recombinant BASB020 protein induced by the addition of IPTG (1.0 M supply medium prepared in sterile water, Sigma) to a final concentration of 1.0 mM. incubation of both IPTG-induced and non-induced cultures continued for approximately 4 hours at 37 ° C with shaking. The samples (approximately 1.0 ml) from the induced cultures as non-induced were removed after the induction period and the cells were collected by centrifugation in a microcentrifuge at room temperature for approximately 3 minutes. The individual cell pellets were suspended in approximately 50 μl of sterile water, then mixed with an equal volume of 2X Laemelli sample pH regulator SDS-PAGE containing 2-mercapioemphenol, and placed in a boiling water bath for approximately 3 minutes. minutes to denature the protein. Equal volumes (approximately 15μl) of the cell-mediated Iisatos with IPTG were loaded as uninduced crude onto 12% tris / glycine polyacrylamide gel in duplicate (Mini gels, Novex, thickness of 1 mm). The induced and non-induced lisal samples were eleciroforeated conjunctly with pre-stained molecular weight markers (see, Blue, Novex) under conventional conditions using a standard operating pH regulator SDS / Tris / Glycine (BioRad). After electrophoresis, a gel was stained with commassie bright blue, R250 (BioRad) and then decolorized to visualize the induction proteins via novel IPTG of BASB020. The second was electrotrown on a PVDF membrane (0.45 micron pore size, Novex) for approximately 2 hours at 4 ° C using a BioRad Mini-Protean II staining apparatus and a Towbin methanol transfer pH regulator (20% ). The membrane block and antibody incubations were performed according to methods well known in the art. A monoclonal ampi-RGS (His) 3 antibody, followed by a second rabbit anti-mouse antibody conjugated to HRP (QiaGen) was used to confirm the expression and identity of the BASB020 recombinant prolein. The visualization of the anti-His antibody reactive pattern was achieved using either an insoluble substratum of ABT or by using Hyperfilm with the chemiluminescence system of Amersham ECL.

D: Sequence confirmation. To further verify that the prolein of recombinant BASB020 capable of induction by IPTG being expressed, is in the correct open reading frame and not an adulterated molecule arising from a cloning artifact (i.e., a frame shift), the sequence of Cloned DNA was determined. The DNA sequence for the BASB020 gene of M-catarrhalis was obtained from a chain structure using asymmetric PCR assay sequencing methodologies, conventional (ABI Prism Dye-Term? nalor Cycle Sequencing, Perkin-Elmer). Sequencing reactions were programmed with undigested expression plasmid DNA (approximately 0.5 μg / rxn) as a template and appropriate sequencing primers specific to the pQE30 vector and ORF-specific (approximately 3.5 pmol / rxn). In addition to the template and the sequencing primer, each sequencing reaction (approximately 20 μl) included all four different dNTPs (eg A, G, C, and T) and the four nucleotide ddNTPs (eg, ddA, ddG, ddC, and ddT), corresponding, with each eminator being conjugated to one of the four fluorescent dyes, Joe, Tam, Rox, or Fam. The individual chain structure sequencing elongation outputs were terminated at random positions along the the template through the incorporation of the ddNTP terminators marked with dye. The termination products labeled with fluorescent dyes were purified using microcentrifuge size exclusion chromatography columns (Princelon Genetics), dried under vacuum, suspended in the template resuspension regulator (Perkin-Elmer) for capillary eleclroforesis or deionized formamide. for PAGE, they were denatured at 95 ° C for approximately 5 min., and analyzed by capillary elecirophoresis of resolution (ABi 310 Aufomaled DNA Sequenator, Perkin-Elmer) or high resolution PAGE (ABI 377 Automated DNA Sequenator), according to recommended by the manufacturer. The DNA sequence data produced from individual reactions were collected and the relative fluorescent peak intensities analyzed automatically in a PowerMAC computer using the ABI Sequence analysis software (Perkin-Elmer). The DNA sequences individually analyzed were manually edited for accuracy before being extracted to a single-strand chain consensus sequence using the AutoAssembler software (Perkin-Elmer). Sequencing determined that the expression plasmid contained the correct sequence in the correct open reading frame.

Example 4: Production of recombinant BASB020. Bacterial strain A recombinant expression strain of E. coli M15 (pREP4) containing a plasmid (pQE30) encoding BASB020 of M. catarrhalis was used to produce cell mass for the purification of recombinant protein. The expression strain was cultured on LB agar plates containing 50 μg / ml kanamycin ("Kn") and 100 μg / ml ampicillin ("Ap") to ensure both the pREP4 laclq control plasmid and the expression were obtained. of construction pQE30-BASB020. For cryopreservation at -80 ° C, the strain was propagated in the LB broth containing the same concentration of antibiotics, then mixed with an equal volume of LB broth containing 30% glycerol (w / v).

Medium The fermentation medium used for the production of the recombinant protein consisted of the 2X YT broth (Difco) containing 50 μg / ml of Kn and 100 μg / ml of Ap. Antifoam was added to the medium for the fermenter at 0.25 ml / L ( Antifoam 204, Sigma) .. to induce the expression of the recombinant protein BASB020, was added to the fermenter 1 mM, final of IPTG (ß-D-thiogalactopyranoside isopropyl).

Fermentation A 500-ml Erlenmeyer seed flask, containing 50 ml of work volume, was inoculated with 0.3 ml of the rapidly thawed frozen culture, or several columns of a selective agar plate culture, and incubated for approximately 12 hours. at 37 ± 1 ° C on a stirring plate at 150 rpm (Innova 2100, New Brunswick Scientific). This seed was then used to inoculate a 5-liter working volume fermenter containing the 2X YT broth and both Kn and Ap antibiotics. The fermenter (Bioflo 3000, New Brunswick Scientific) was operated at 37 ± 1 ° C, air spray of 0.2 - 0.4 VVM, 250 rpm in Rushton impellers. The pH was not controlled either in the seed cell of the flask or in the fermenter. During fermentation, the pH varied from 6.5 to 7.3 in the fermenter. IPTG (1.0 M of supply material, prepared in sterile water) was added to the fermenter when the culture reached the mean growth rate (approximately 0.7 O. D.600 units). Cells were induced for 2-4 hours, then harvested by centrifugation using either a 28RS Heraeus supernatant centrifuge (Sepatech) or RC5C (Sorvall instrumenis.) The cells were stored at -20 ° C and processed.

Purification. Chemicals and materials Imidazole, guanidine hydrochloride, Tris (hydroxymethyl), and EDTA (ethylenediaminetetraacetic acid) of or better biotechnology grade were all obtained from Ameresco Chemical, Solon, Ohio. Triton X-100 (t-Octifenoxypolyethoxy-ethane), sodium phosphate, monobasic and Urea were reactive or better if obtained from Sigma Chemical Company, Yes. Louis, Missouri. Glacial acrylic acid and hydrochloric acid were obtained from Mallincrodt Baker Inc., Phillipsburg, New Jersey. Methanol was obfuscated from Fisher Scientific, Fairlawn, New Jersey. PefablocOSC (4- (2-aminoethyl) benzenesulfonyl fluoride). The prolease complelas inhibitor, and PMSF (phenylmeryl sulfonylfluoride) ciprofluid tables were obfuscated from Roche Diagnostics Corporation, Indianapolis, Indiana. Bestafine, pepsiein A, and protease inhibitor E-64 were obtained from Calbiochem. LaJolla, California Saline regulated at its pH with Dulbecco phosphate (1x PBS) was obtained from Qualily Bioiogical, Inc., Gaiíhersburg, Maryland. Saline regulated at its pH with Dulbecco's phosphate (10x PBS) was obtained from BioWhittaker, Walkersville, Maryland. The penta-His antibody, the urea BSA was obtained from QiaGen, Valencia, California. AffiniPure goat anti-mouse IgG conjugated with peroxidase was obtained from Jackson Immuno Research, West Grove, Penn. The individual AEC solution was obtained from Zymed, South San Francisco, California. All other chemicals were reactive or better. Ni-NTA super flux resin was obtained from QiaGen Inc., Valencia, California. The pre-mixed Tris-Glycine at 4-20% and 10-20% polyacrylamide gels, all operated in pH regulators and solutions. The SeeBlue pre-stained standards transference membranes of multiple color standards MuItiMark and PVDF were obtained from Novex, San Diego, California. SDS-PAGE silver strain kits were obtained from Daiichi Pure Chemicals Company Limited, Tokyo, Japan. The Coomassie staining solution was obtained from Bio-Rad Laborafories, Hercules, California. Acrodisc® 0.2 μm syringe fillr were obtained from Pall Gelman Sciences, Ann Arbor, Michigan. Disposable 25 mm GD / X syringe fillr were obtained from Whatman Inc., Clifton, New Jersey. The 8,000 MWCO dialysis tubing was obtained from BioDesign Inc. Od. New York, Carmal New York. The BCA protein assay reagents and viper skin dialysis tube 3,500 MWCO were obtained from Pierce Chemical Co., Rockford, Illinois.

Extraction Protocol The cell paste was thawed at room temperature for 30 to 60 minutes. 5 to 6 grams of the material were loaded into a 50 ml centrifuge tube. To this, 5 ml / gram of guanidine hydrochloride (Gu-HCl) was added as a pH regulator (6M guanidine hydrochloride, 100Mm phosphate of Sodium, monobasic, 10 Mm of Tris and 0.05% of Trilon X-100, pH 8.0). the cell pass was resuspended using a pro-scientific homogenizer PRO300D, at a power of YA for 15 minutes. The extraction mixture was then placed at room temperature with moderate agitation for 60 to 90 minutes. After 60 to 90 minutes, the extraction mixture was centrifuged at 15,800 x g for 15 minutes (Sorvall RC5C centrifuge 11,500 rpm). The supernatant (S1) was decanted and saved for further purification. The pellet (P1) was saved for analysis.

Union of BASB020 to Niguel Resin-NTA AI S1, 3 to 4 ml of the Ni-NTA resin was added. This was then placed at ambient temperature with moderate agitation for one hour. After one hour, the S1 / NÍ-NTA was packed into a column of XK16 Pharmacia. The column was then washed with 1 M Gu-HCl pH buffer (1 M guanidine hydrochloride, 100 mM sodium phosphate, monobasic, 10 mM Tris and 0.05% Triton X-100, pH 8.0). This was then followed by a wash with a pH regulator of phosphide (100 mM sodium phosphate, monobasic, 10 mM Tris and 0.05% Triton X-100 pH 6.3). The protein was then eluted from the column with a pH buffer of 250 mM imidazole (250 mM imidazole, 100 mM sodium phosphate, monobasic, 10 mM Tris and 0.05% Triton X-100, pH 5.9).

Final Formulation The BASB020 was formulated through conifer-free dialysis, three 0.1% changes in Triton X-100 and 1x PBS, pH 7.4, to remove residual Gu-HCl and imidazole. The purified protein was characterized and used to produce antibodies as described below.

SDS-PAGE Biochemical Characterizations and Western Dye Analysis The purified recombinant protein was resolved in 4-20% polyacrylamide gels and electrophoretically transferred to 100 V PVDF membranes for 1 hour as previously described (Thebaine and Oros 1979, Proc. Nail, Acad Sci. USA 76: 4350-4354). The PVDF membranes were then pre-treated with 25 ml of saline regulated at its pH with Dulbecco's phosphate containing dry milk without 5% fat. All subsequent incubations were performed using this pre-cooling pH regulator. The PVDF membranes were incubated with 25 ml of a 1: 500 dilution of preimmune serum or rabbit immune serum of rabbit for 1 hour at room temperature. The PVDF membranes were then washed 2 times with wash buffer (20 mM Tris pH buffer, pH 7.5 containing 150 mM sodium chloride and 0.05% Tween-20. PVDF membranes were incubated with 25 ml. of a 1: 5000 dilution of peroxidase-labeled goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA), for 30 minutes at ambient temperature.The PVDF membranes were then washed 4 times with wash buffer and they were developed with 3-amino-9- 5 ethylcarbazole and urea peroxide as supplied by Zymed (San Francisco, CA) for 10 minutes each, and the results of an SDS-PAGE analysis (Figure 4) show an approximate protein. 32-35 kDa purified to more than 90% and that is reactive to an anti-RGS (His) antibody through of Western stains (Figure 5) of the SDS-PAGE. • Protein Sequencing The amino-terminal amino acid sequencing of the purified protein was performed to confirm the production of the recombinase protein sequence by using well-defined chemical protocols in a Hewlett-Packard G1000A sequencer model 1090 LC sequencer and sequencer model 241 F Hewlett-Packard with a 1100 LC model.

Example 5: Production of Antisera to Recombinant BASB020 [0104] Polyvalent antisera directed against the BASB020 protein were generated by vaccinating two rabbits with the purified recombinant BASB020 protein. Each animal was given a total of three immunizations intramuscularly (? .m.) Of approximately 20 μg of the BASB020 protein per injection (starting with complete Freund's assistant and followed with incomplete Freund's assistant) at intervals of approximately 21 days. The animals were bled before the first immunization ("pre-bled") • on days 35 and 57. 5 Anti-BASB020 protein thiulations were measured through an ELISA assay using the purified recombinant BASB020 protein (0.5 μg / well). The titration is defined as the highest dilution equal to or greater than 0.1 as calculated with the following equation: OD average of two test samples of antiserum - the OD average of two pH regulator test samples. The • titrations after three immunizations were between 3,000 and 8,000. The antisera were used as the first antibody to idenify the proiein in a Wesierian line as described in the Example 4 below. Western exposure showed the presence of the anti-BASB020 antibody in the sera of immunized animals.

Ephc Example 6: Immunological characterization Western blot analysis 20 Several strains of M. catarrhalis were developed including ATCC 49143, and ATCC 43617, as well as clinical isolates from various geographic regions, on chocolate agar plates for 48 hours at 35 ° C in 5% CO2. Several colonies were used to inoculate 25 ml of the Muller Hinton broth in a 250 ml flask. '25 The cultures were grown overnight and collected by centrifugation. Then, the cells were solubilized by suspending 30 μg of cells in 150 μl of PAGE sample pH regulator (360 mM Tris buffer, pH 8.8 containing 4% sodium dodecyl sulfate and 20% glycerol), and incubating the suspension at 100 μg. ° C for 5 minutes. Solubilized cells were resolved in 4-20% polyacrylamide gels and the separated proteins were electrophoretically transferred to 100V PVDF membranes for 1 hour as previously described (Thebaine and Oros, 1979, Proc.Nal.Acid.Sci.USA 76: 4350-4354). The PVDF membranes were then treated with 25 ml of saline regualdated at its pH with Dulbecco's phosphate containing dry milk without 5% fat. All subsequent incubations were performed using this pretreatment pH regulator. The PVDF membranes were incubated with 25 ml of a 1: 500 dilution of preimmune serum or rabbit immune serum for 1 hour at room temperature. The PVDF membranes were then washed twice with wash buffer (20 mM Tris pH buffer, pH 7.5 containing 150 mM sodium chloride and 0.05% Tween-20). The PVDF membranes were incubated with 25 ml of a 1: 5000 dilution of peroxidase-labeled goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Wesí Grove, PA) for 30 minutes at ambient temperature. The PVDF membranes were then washed four times with wash buffer and developed with 3-amino-9-elylcarbazole and urea peroxide as supplied by Zymed (San Francisco, CA) for 10 minutes each. A protein of approximately 32-35 kDa (corresponding to the expected molecular weight of BASB020) which is reactive with the antiserum was detected in all the Moraxella strains.

Example 7: Presence of the Antibody for BASB020 in human convalescent serum Western blot analyzes of purified recombinant BASB020 were performed as described in Examples 4 and 6 above, except that a combination of human sera from children infected with M. catarrhalis was used as the first antibody preparation. The results show that the antisera of naturally infected individuals react to the purified recombinase prophecy, as shown in Figure 6.

Example 8: Efficacy of BASB020 vaccine: improvement of elimination of lung M. catarrhalis in mice. The proleary capacity of the recombinant BASB020 proiein was tested in a root model. This mouse model was based on the analysis of the invasion of the lung by parle of M. caíarrhalis followed by a standard intranasal attack for the vaccinated mice. Groups of 6 BALB / c mice (females with an age of 6 weeks) were immunized subcutaneously with 100 μl of the vaccine corresponding to a dose of 10 μg and boosted 2 weeks later. One week after reinforcement, mice were attacked through instillation of 50 μl of bacterial suspension (+/- 10 6 CFU / 50 μl) in the left nasal window under anesthesia (mice were anesthetized with a combination of ketamine and xylazine, 0.24 mg of xylazine ( Rompun) and 0.8 mg of ketamine (Imalgene) / 100 μl). The mice were sacrificed 4 hours after the attack and the lungs were removed aseptically and homogenized individually. The mean number of record 10 CFU / lung was determined by counting the colonies grown on Mueller-Hinton agar plates after placing in the plates 20 μl of 5 serial dilutions of the homogenalo. The average of the average number of CFU / lung registers 10 and standard deviations were calculated for each group. The results were analyzed statistically by applying a form of ANOVA after assuming equality of variation (verified by the Brown and Forsythe test) and normality (verified using the Shapiro-Wilk test). The differences between the groups were analyzed using the Dunnel test, the Tukey test scale test (HSD) and the Student-Newman-Keuls test. In these experimental groups of mice these were immunized either with BASB020 adsorbed on AIPO4 (10μg of BASB020 on 100μg of AIPO4) or with an annihilated whole cell preparation (kwc) of M. catarrhalis strain ATCC 43617 adsorbed on AIPO4 (5 x 108 cells on 100μg of AIPO4) or with 100μg of AIPO4 without antigen. The mice were attacked with 106 CFU of live bacteria M. catarrhalis strain ATCC 43617. The average number of record 10 of CFU / lung and standard deviation 4 hours after the attack were calculated • 5 for each group. The mice immunized by Sham had . 5 (+/- 0.23) of CFU record 10 / lungs 4 hours after the attack. The preparation of kwc induced a significant elimination in the lung as compared to the control group (difference of 10 record of 1.74). The BASB020 vaccine induced a difference in • 0.62 record in elimination in the lung as compared to the control group, which was significantly different from the control. A Western blot using the purified recombinant BASB020 protein and combined sera from mice immunized with the BASB020 protein and collected before the attack showed the presence of the antibody for the protein.

BASB020 (Figure 7). • Example 9: Production of BASB020 peptides. antisera and its reactivity. They produced two short amino acid BASB020 sera having the sequences of CNEEAWSQNRRAELSY (SEQ ID NO: 13) and YTGVAPLVDNDETV (SEQ ID NO: 14), in the laboratory using generally well-known methods. These peptides coupled to KLH were used to produce antibodies in female rabbits in New Zealand free of specific pathogens at 12 weeks of age. The rabbits received 4 injections at approximately 3 week intervals of 200 μg of peptide-KLH in auxiliary • 5 full Freund (first injection) or incomplete (second, third and fourth injections). The animals were bled before the first immunization and one month after the fourth injection. The midpoint titers of anti-peptide were measured through ELISA analysis using free peptides. The medium-point titers of anti-peptide one month after the fourth immunization were greater than 41,000. Western blots of recombinant BASB020 recombined, using anti-peptide antibodies as the first antibody were prepared as described in Examples 4 and 6. The results are presented in Figure 8.

Deposited Materials A deposit containing a strain of Moraxella catarrhalis • Catlin was deposited with American Type Culture Collection (in the present "ATCC") on June 21, 1997 and was assigned the deposit number 43617. The deposit was described as Branhamella catarrhalis (Frosch and Kolle) and is a collection of 1 5-2.9 kb insert dried by freezing the isolated M. catarrhalis oblenid of a transtracheal aspiration of a coal miner with bronchitis chronic. The deposit is described in Antimicrob. Agents Chemoter. 21: 506-508 (1982). The deposit of the Moraxella catarrhalis strain is referred to herein as the "deposited strain" or as the "DNA of the deposited strain". The deposited strain contains a full-length BASB020 gene. A reservoir of the pMC-HI3 vector consisting of DNA Moraxella calarrhalis in pQE30 was deposited with the American Type Culture Collection (ATCC) on February 12, 1999 and assigned the deposit number 207106. The sequence of the polynucleotides contained in the The deposited strain / clone as well as the amino acid sequence of any polypeptide encoded thereby, are controlled in the event with any conflict with any description of the sequences herein. The deposit of the deposited strains has been made under the terms of the Budapest Treaty in the International Recognition of the Deposit of Microorganisms for Purposes of Patenal Procedure. The strains deposited will be irrevocably and without resi fi cation or condition released to the public after the issuance of a patent. The deposited strains are provided as a convenience to those skilled in the art and not as an admission that a deposit is required for training, such as that required in accordance with 35 U. S.C. §112.

LIST OF SEQUENCES < 110 > SmithKIine Beecham Biologicals S.A. • < 120 > Novel Compounds < 130 > BM45320 < 160 > 14 < 170 > FastSEC for Windows Version 3.0 < 210 > 1 10 < 211 > 843 < 212 > DNA < 213 > Bacleria < 400 > 1 a'cgcgt-.ggt-c tfcag cgtr gfctatccac? E gcacctgaaa ccegagatga tttattaaag 60 atggtteaag actctcgct-a gctcttagßg cctgapacgg tfcgatatgct egaaggggtg 120 c cctctcc cagcaacc-ea agcgcgtgag attatgacac cacgcccgca ggtg - at.g - g xao att-gccageg atgaegatfct acatgaeatt ctatcgg gg tgcttgaaac agagcßctet 240 ogctatcctg t-tttfcgacag ttt-ttt agafcgat gatgctgfcgg tcggga gcfcgatfcaag 300 gactea-tac catacctaaa agccaaa gacggtaaag agcagccgct ct e -.? aat -ggct 3ß0 ga-attgtac gaaagccg gtatactage gagacggcac getcagatac actgctacgc 420 tcaectcaaa aagcccaagt gcatacggcg att-gcggttg atgaatctgg ctcggtccct 480 ggtga GGCG aaatggagga t-ttgctrgag gagattgccg gtgatattgt tgafcgaacat 540 gatgatattg acgaggacag egacatfcaat aacatcattc cacaccctga taaatcaggc € 00 gtctggttgg tgcaagctpc cacact AACC agtgatcgca atgagattfcfc aggcagtcat 560 eagafcgtfcga cctgatgaca taeaargggc ggctfcgg ca 720 egcaagcafct gggctttgtt ßgccaccttc aaggfcgeg t cgtfccaaatc ga.tgaatggc aaattac GGT-CGT gacgtt 7B0 gaggcacgat ttattcatc gtrggagctt gtgctgatac cacagcttga gaatgctgaa B40 Caá 843 < 210 > 2 < 211 > 280 < 21 2 > P RT < 21 3 > Bacteria < 400 > 2 Men Arg Qly Leu? Rg Arg Trp Leu Ser Ti_r nia Pro alu Thr Arg Asp • 1 S 10 15 Asp Leu Lau Lys Leu Val Glp Asp Ser Arg Gln vhe Leu Glu Pro Aap 20 25 30 - Thr Val Aap Met Leu Slu Gly Val Leu Asp Leu Pro Wing Thr Glp Val 35 40 '45 Arg Glu le Met Thr Pro Arg Pro Gln Val Hiß Ala Lie Ala Ser Asp 50 ?? G0 Asp Asp Leu Ser Asp lie Leu Ser Val Val Leu Glu Thr Glu His Ser 65 70 75 BO Arg Tyr Ero Val Phja Asp be Leu Asp Aßp Aap Wing Val Val Gly lie B? J.Q 95 • Leu. Leu lia Lys Asp Leu lie - > ro Ty-r Leu Lyt Ala Lye Ala Aap Gly 100 Ios lio Lys Glu Gln Pro Leu Lya Leu Wing Asp lie Val Arg Lys Pro Leu Tyr 115 120 12S He Ser Glu Thr Wing Arg Ser Aap Thr Leu Leu Arg be Leu Gln Lys 130 135 14Q Ala Gli- Val His Mee Ala He Val Val Asp Glu Phe Gly be Val Ser 145 150 155 lfiO Gly Val Val Ti ---. Met Glu Asp Leu Leu Glu Glu lie Val Gly Asp lie ÍES 170 175 Val A - P Glu Hiß Asp Asp He Aßp Glu Asp Ser Aep lie Asp Asn lie 1T0 1B5 190 He Pro Hia Pro Aap Lya be Gly Val Trp Leu Val Gln Ala Ser Thr 195 200 205 • Leu H Ser Aßp Cys Aan Glu XIe Leu Gly Ser Hi3 Phe Asp Asp Thr 210 215 220 Asp Val Asp Thr Met Gly Gly Leu Val Met sln. Wing Leu Gly Phe Val 225 230 235 240 Ser Hls Leu Gln Gly Wing Val Val Gln He Asp slu Trp Gln He Thr 245 250 255 Val Val Asp Val Glu Ala Arg Phe He His Leu Leu Lelu Val Leu 260 2ET5 270 He Pro Gln Leu Glu Asp Ala Glu 275 2ß0 < 210 > 1 < 211 > 843 < 212 > DNA < 213 > Bacteria < 400 > 3 atgcgtggte ttaggcgtcg gt- "aka? Cc gcacccgaaa etegagatga tttattaaag 60 ctggctcaag act-ctcgcca gtttttagag cctgatacgg ttgatatgcc tgaaggggtg 120 cigcaßccca cttgatctgc agtgcgtgag attatgaeac cacgcecgca ggtgcatgcg 180 att-gceagcg ecgatgattc atctgatact ttafceggtgg cgcttg aae agageatt t tt 240 cgctatestg tttttgaeag-tggatgat gatgctgrtgg ttgggatttt g tgattaag 300 gacct »ac4c cataccta» »agccaiag-t gacggtamag agcagccgct ca» attggct 360 gatathgtac gaaß ftc tt gtatattagc gagacggcac gcccagat-ac acfcgptacgc 420 tcactteaaa aagcccaagt acatitggcg attgttgttg at-gaattfcgg ct-.ggtcpcc 4BO -rertgtggcg caatggagga t-ttgcfc gag gagattgtcg gtgatacege tgatgaacat S40 gatgatattg acgaggacag cgacattaat aacatcatte cacaccctga taaatcaggc 500 gtt ggtfcgg tgcaagcttc cacaerecace agtgattgca atgaga ctt aggcagtcat 660 -.ttgafcgata cagatgttga tacaatgggc ggtttggtca tgcaagcatt gggctttgtt 720 agccaccttc aaggtgcggt tgtccaaatc gatgaatggc aaattaecgt ggttgatgtt 780 3 »33«? Cgat ttatccatct S? Tfcggagctt gtgstgatac c »q-.gcctga gaatgctgaa &40 < 210 > 4 < 211 > 280 < 212 > PRT < 213 > Bacteria < 400 > 4 Met Arg Gly Leu Arg Arg Trp Leu Ser Thr Wing Pro Glu Thr Arg A - rp 5 10 15 Asp Leu Leu Lys Leu Val Glxi Asp Ser Arg Gla Phe Leu Glu Pro Asp 20 25 30 Thr Val Asp Met Leu Glu Gly Val Leu Asp Leu Pro Wing Thr Gln Val 35 40 45 Arg Glu. He Met Thr Pro Arg Pro Gln al Hie Wing He Wing Asp 50 SS 60 Aßp Asp Leu Ser Asp He Leu Ser Val Val Leu Glu Thr Glu His Ser 65 70 75 80 Arg Tyr Pro Val Plie Asp Ser Leu Asp Aßp Aßp Ala Val Val Gly He BS 90 95 Leu Leu He Lya Asp Leu He Pro Tyr Leu Lyes Wing Lys Wing Asp Gly 100 105 Lio Lys Glu Gln Pro Leu Lyc Leu Wing Asp He Val Arg Lya Pro Leu Tyr • 115 120 125 He Ser Olu Thr Ala Arg Ser Asp Thr Leu Leu Arg Ser Leu Gln Lys 130 135 140 Wing Gln val Hiß Met Wing Val Val Asp Glu Phe Gly Val Ser 145 150 155 160 Gly Val Ala Thr Met Glu Asp Leu Leu Glu Glu He Val Gly Asp He 155 170 175 Val Asp Glu Hiß Asp Asp Asp Glu Asp Ser Asp As Asp Asp He 180 185 190 He Pro His Pro Aisp Lys Sar Gly Val Trp Leu Val Gln Ala Ser Thr 195 200 205 • Leu He Ser Asp Cya Asn Glu He Leu Gly Ser His Ph--. Asp Asp Thr 210 215 220 Asp val Asp Thr Met Gly Gly Leu Val Met Glp Wing Leu Gly Phe Val 225 230 235 240 Ser His Leu Gln Gly Wing Val VaX Gln He Aßp Glu Trp Glp He Thr 245 250 255 Val Val Asp Val Glu Wing Arg Phe lie Hia Leu Leu Glu Leu Val Leu 3S0 2E-5 270 He Pro Gln Leu Glu Asn Wing Glu 275 2B0 < 210 > 5 • < 211 > 843 < 212 > DNA < 213 > Bacteria < 400 > 5 atgcgfcggtc ctaggcgttg gctatccacc gcacctgaaa ctcgagatga tctattaaag 60 ctggttcaag actcfcegcc »gtttttagag cetgatacgg ttgatatgct tgaaggggtg 120 cagcaaccca cttgatscgc agtgcgtgag attatgacac cacgcceaca ggtgcatgog 180 attgccagcg atgacgafctt atccgatatt ttatcggtgg tgcttgaaac agagcattct 240 c etatcccg tttttgacag tttggatgat gatgctgtgg ttgggafcctc gctgatcaag 300 gacttaatac ca-ac? Taaa agccaáagct gßégrgtaaag agcagccgoC eaaattgg et 360 gatattgtae gaaageegtt gfcatattagc gagacggcac gctcagatac actgctacgc 420 tcacttcaaa aagccaaagt aeataeggcg att-gttgttg afcgaafctfcgg ctcggtctct 4Q0 agcgtggcga caatggagga fcttgcttgag gagatfcgtcg gcgatattgt tgatgaacafc 540 gatgai-ATTG acgaggaaag cgßsßctaac aacatcatcc cacaccctg-to caaatcagge 600 gtttggctgg tgcaagcttc agfcgattgca cacactcato atgagatttt aggcagfceac 660 tttgatgata cag tg-tga tacaatgggc: ggCttggtca tgeaagcatt gggctttgtt 720 agc afccttc aaggtgcggt tgttcaaßte gatgaacggc aaatcaccgt ggtcgacgtt 780 gaggcacgat Ccattpatcc gfctggagact gtgccgafcae cacagettga gssatgccgaa S40 taa 343 < 210 > 6 < 211 > 280 < 212 > PRT < 213 > Bacteria < 400 > 6 Mee Arg Gly Leu Arg Arg Trp Leu Ser Thr Wing P or Glu Thr Arg Asp 1 5 XO XS Aßp Leu Leu Lys Leu Vine Gln Asp Ser Arg Glti Phe Leu Glu Pro Asp 20 25 30 T? Go to Asp Met Leu Glu Gly Val Leu Asp Leu Pro Wing Thr Gln Val 35 40 45 Arg Slu He Met Thr Pro Pro Arg Pro sln Val His Wing He Wing Ser Asp 50 S5 eo Aa Asp Leu Ser Asp lie Leu Ser val Val Leu Glu Thr Glu His Ser 65 70 75 80 Arg Tyr Pro Val Phe Asp Ser Leu Asp Asp Asp Wing Val Val Gly He 85 90 95 Leu Leu He Lya Aap Leu He Pro Tyr Leu Lye Wing Lye Wing Asp Gly ICO 105 110 L ß Glu Gln Pro Leu Lye Leu Wing Asp He Val Arg Lys Pro Leu Tyr 115 120 12 = He Ser Glu Thr Wing Arg Ser Aßp Thr Leu Leu Arg be Leu Gln Lys 130 135 140 Ala aln Val Hiß Met Ala He val Val Aap Glu Phe Gly Ser Val Ser 145 150 155 160 Gly Val Ala Thr Met Qlu Aßp Leu Leu Glu Glu He Val Gly Aep He 165 170 17S Val Aap Glu His Aßp Aap He Asp Glu Asp Ser Aap Ile Asn Aen He 1BO 1T5 ISO He Pro Hlß Pro Asp Lys be Gly Val Trp Leu Val Gln Ala Ser Thr 3-95 20D 205 Leu lie Be Asp Cyß Aan Glu He Leu Gly Ser Bis Phe Asp Asp Thr 210 215 220 Asp Val Asp Thr Mee Gly Gly Leu Val Hßt Gln Ala Leu Gly Phe Val 325 230 235 24D Ser His Leu Glia Gly Ala Val Val Gln He Aep Glu Trp Gln He Thr 245 250 255 Val Val Aap al Glu Ala Arg Phe He His Leu Leu Glu Leu Val Leu 26? 265 270 He ro Gl-a. Lau Glu Asp Ala Glu 375 280 < 210 > 7 < 211 > 843 < 212 > DNA < 213 > Bacteria < 400 > 7 atgcgcggte ttaggcgtfcg gtfcacccacc gcacctgaaa cCcgagatga tttattaaag 60 cfcggttaaag actcfccgcpa gtctttagag cetgatacgg ttgatatgefc tgaaggggcg 120 cctgatetgc cagcaa-cca agtgcgtgag afcfcatgacac cacgcccaca ggtgeatgeg IAO attgccagcg atgatgattc gtctgatatc ttatcggtgg tgcttgaaac agagcaccct 240 agatatccrtgr tttttgacag ttt-ggatgat gatgctgtgg Ctgggafct tg tgat ag 300 cafcacccaaa gaettaaca ag caaaget gacggcßaag agcagccgct caaattggct 360 garattgtac gaaagccgfct gcaCaCtagc gagacggcac gctcagacac taege 420 actg ecaettcaaa aagcccaagt gcacatggcg attgtcgttg atgaattegg stcggtctat 4T0 ggegt caacggagga t tt 540 gcttgag gagattgtcg gegatategt tgatgaacat gatgatatcg to gaggacag cgacattaat aacatsattc caaaccctga taaatcaggc eao gcttga-fc gg tgcaagcctc cacacccacc agtgattgca atgagatttt -. ggcagtcat 660 cagacgtcga crtgatgata taaaatgggc ggcccggcca cgcaagcatt aggscttgtt 720 agccatctcc aaggtgcggt tgttcaaatc gatgaafcggc aaattac g gttttgatgtt 780 gagcfeacgafc tcactcatct gtfcggagctc gcgctgatac cacagcttga gaacgctgaa B40 t aa B43 < 21 0 > 8 < 211 > 280 < 212 > PRT < 213 > Bacteria < 400 > 8 Met Arg Gly Leu Arg Arg Trp Leu Ser Thr Wing Pro Glu T? -r Aig Asp 1 5 10 15 Asp Leu Leu Lys Leu Val Gln Asp Ser A g Gl-a Phe Leu Glu Pro Asp 20 25 30 Thr Val Asp Mßt eu Glu Gly Val Leu Asp Leu Pro Wing Thr Gln Val 35 40 45 Arg Glu He Met Thr Pro Arg Pro Gln Val His Ala He Ala Sar Asp 50 SS 60 Aap Aap Leu Ser Aßp He Leu Ser Val Val Leu Glu Th-r. Glu His Ser ßS 70 7S 80 Arg Tyr Pro Val Phß Asp Ser Leu Asp Aap Asp Wing Val Val Gly He H5 90 95 Leu Leu He Lyß Aßp Leu He Pro Tyr Leu Lys Wing Lys Wing Asp Gly 100 IOS 110 I-ys Glu sln Pro Leu Lye Leu Wing Aüp He Val Arg Lyß Pro Leu Tyr 115 120 125 He Ser Glu Tfar Wing Arg Ser Aßp Thr Leu Leu Arg Ser Leu Gln Lye 130 135 140 Ala Gln Val Hia Met Ala He Val Val Aßp Glu Phe Gly Ser Val Ser 14S 150 155 160 Gly Val Val Thr Met Glu Asp Leu L «u Glu Glu He Val Gly Asp He 165 170 175 Val Asp Glu Hiß Aßp Asp He Asp Glu Aßp Ser Asp He Asn Asa He 180 1T5 190 lie Pro His Pro Asp Lyß Ser Gly Val Trp Leu Val Gln Wing Sex Thr 195 200 205 Leu He Ser Aßp C e Aan Glu He Leu Gly Ser His Phe Asp Asp Thr 210 215 220 Asp Val Asp Thr Met Gly Gly Leu Val Met Gln Wing Leu Gly Phe Val 225 230 235 240 Ser Sis Leu Gln Gly Ala Val Val Gln He Asp Glu Trp sli. He Thr 245 250 255 Val Val Aßp Val Glu Ala Arg Phß He His Leu Leu Glu Leu Val Leu 260 265 270 He Pro Gl-- Leu Glu Aen Ala Glu 275 280 < 210 > 9 < 211 > 19 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Oiigonucieotide < 400 > 9 acttgaataa aaccgagtg 19 < 210 > 10 < 211 > 19 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Oligonucleotide < 400 > 10 gacatcggcc gcaacafcgc 19 < 210 > 11 < 211 > 58 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Oligonucleotide < 400 > 11 aagggeccaa ttacgcagag gggatccacg sgcggtctca ggcgttggct atccaccg sß < 210 > 12 • 5 < 211 > 60 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Oligonucleotide 10 < 400 > 12 ßa ggcccaa Ctacgcagag ggfccgaetta tfcattaagca fctctcaagct gfcggtateag 60 < 210 > 13 < 211 > 16 15 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Peptide < 400 > 13 Cys Asn Glu Glu Wing Trp Ser Gln Aati Arg Arg Ala slu Leu Ser Tyr 20 1 5 10 15 < 210 > 14 < 211 > 14 < 212 > PRT 25 < 213 > Artificial Sequence < 220 > < 223 > Pept? Do < 400 > 14 Tyr Thr Gly Val Wing Pro Leu Val Asp --s-i Aßp slu Thr Val 1 S 10 • SEQUENCE INFORMATION Sequences of Polynucleotide and Polypeptide BASB020 SEQ ID NO: 1 Polynucleotide sequence BASB020 of Moraxella catarrhalis of the strain MC2931 J - rGCGTGGTCTTAGGCG.mMTTATCC-ACC ^ crraG tc3V? C ctcrtcGCc-- -ta "Cr? TGATCTGCC-AGCAACCC-AAGTGCGTGAGATTA ^ KTTGCC-AGCG ? TOATGATTTAT-TGATATTT - ^^ CGCTATCCTGTTrtTGACaGTTTAGü --A ^ GAj rTT3U rA-CC - A ACCTAAA GCaAAGC GACGsTA - * ^ GJkTATTGTACGAAAGCCGTTCTATA.t'TAGCGAGACGGC? ^ TC- £ TTCJ-AAaAGX: CC &AGTGC-AT ^^ GGTGTGG éA¡ CUUW.GGAGGATT GCr GAG < ^^ GA GATATTGACC3afiGAC-AGCGAC-ATT.AATAAC? T ^ GT TGGTTC-K-.TGC-AAGCTTCCAaCrTC? T? GTGATTG ^ TTT --- ATGATAC-AJA? TGTTGATACAATaGGCGsTT ^ AGCCATCTTCAAG «TGCGGTTOTTCAAATCGATGAAT5K-KA ^ GAGGCACCS-ATTTATTCATCTGTTGGAGCT GTGCTGATACCACAGCTTG ^^ ?? SEQ ID NO: 2 BASB020 polynucleotide sequence of Moraxella catarrhalis of strain MC2931 mGLRRWLSTA &RTÍ ^ D: i -----? VQDS IASDDDLSDI --- SVVL - r-7? HSRYPV? T > SI - ^^ D: - 7H-eB --- ^ SE ARSDT - L1R ^ E (DI? .EDSDI3SIltXIK - PD S GVWLVOA-3T --- ISDCN-S ILGS --- FI-DTDVirmGGLVMQAIJCSFV SHLQGAVVQ-p3EWQITVVDVEARFIHXiELVLIPQLi51C -E SE ID NO: 3 BASB020 polynucleotide sequence from Moraxella catarrhalis of strain Mcat 2912 AcrcrcKCc-AGOTTT AaAGecrGBT ^^ JUS ßCG GAÍ.-A TATGACACCACßCCCQC - ^ TTAT ^ < ^ GGT < 3CTTGAA? VCAGAGCATTCTCGCTATCCTGTTTTTGA • T? AGGATT -rrGCTGATTAAGGACTTAATACt ^ TAC ^ CAAATTGGCTGATATTOTACGAAAGCCGTTGTATATTA ^ TC? £ rr CAAA GCCCAAGTACA3ATGGCX - »^^ r --- l - f - r < --C ^ GGATTTGCirtßAGtGAGATTGTC (MTGA ATTGT ^ CGAC TTAA? C-ATCA TCC? CACCCrr ^ T ^ AGT? A GCAATGAGA TT AasCU «3T? TATAATaA ACAGA ^ to autóC3cr GGsctt GttAsca« cr? Tc? Aaa ^ GOTTsATGTTGA ^ CACGATTTATTC-iATCTGTTGGAGCTTGTGC ^^ TAA SEQ ID NO: 4 BASB020 polynucleotide sequence from Moraxella catarrhalis of strain Mcat 2912 MRG3 ^ RRWLSTAP - rT-? A _---- LKLV? 3DSRQ-r ^: t ---? VV ----- -HSRYP FDSI-DJ ^ SI-QB-AQVBMAIVVDEFGSVSsVATMED ^^ -j Q SD-- > rai --- sSHFDDTT-7D MGGl? Q ^ SEQ ID NO: 5 BASB020 polynucleotide sequence from Moraxella catarrhalis of the strain Mcat 2913 ATGaTTGGTCTTAGGCGTTGGTTATCCAC8C- ^ ACTCTCsCCAGTTTTTAGAGCCTGATACGGTTGATATGC TGAAGGGGTGCTTC-ÍATCTGCCA ATSTGa-TtíAG-VrTATGAC-ACCACGCCC-A < ^ GG TTATC-GGTGGTGCT GAAAC ^ sC-AT CTCsC TCC-T ^^ ^^ TTaaaATTTTGCTGATTAAGGACTTAATACC Otf-ATTGGCTGATATTGTACGAAAGCCaTTGTA TCACT AT ^^ 15 ^ --AAAAAGCCa-AGTACATA GGCGATTGTTGTTGATGAATTTGGCrrCGGTCTC ClUTOGAGraA TTGCrTaAGGAGATTG CGGCíSA A G Ts Tsa CGACkTIAATAA AT < --ATC ^ TTCCAC ^ TCCTGA ^ AGTC5ATTGC-AATGAGATTTTAs < 3-A-TrC? TTTTGATG! A ^ TGCAAGC? TTGGGCTTTGTTAGCC? TC - TC2VAGsTGCG ^ G < 3TT-ATGTTGAGGC3_CaATTTATTCATCTsT ^ TAA • SEQ ID NO: 6 BASB020 polynucleotide sequence of Moraxella catarrhalis of Mcat 2913 strain SEQ ID NO: 7 10 BASB020 polynucleotide sequence from Moraxella catarrhalis of strain Mcat 2969 Al ^ CaTGGTCTTñGGCGTTGsTTATCC-ACCGa \ CC-T ^ AC CTCGCC-AQTTTTTAGAGCCTÍ-ATAßGGTTGAtAT ^ A - ¡H? GCGT < ytf-- TTA GACACC-AC ^ CC ^^ TTATCGGTGGTGCTTGAAACAGAa (-? TTCTCGCTAT < --CTG ^ TTTCJíSGATTTTGCraATTAAGGACTTAATACC ^ C-GAiCAT AATAACATCATT; CAC - ACCC-rTGATAAATCAGGCGTTT ^ TCCAAGC ^ TTAGGC-TTTG.p.AGCCATCTTCAAGsTGCGGTTGT ^ GGTTGATGTTGAGG OiCGATTTATTCATCTGTTGGAGCTTGTGCrrc ^ CTGAA TAA SEQ ID NO: 8 15 BASB020 polynucleotide sequence of Moraxella catarrhalis of strain Mcat 2969 AXASDDDLSDILSVVX.ET] - HSRYPV --- > SL ^ --- AD: - K: Y? S? -? ? 5D: ^^ DEHPDIDEDSDI-S-NIIPHPD SGV1 ^ VQAST --- I ^ LGFVSHLQGAWQ IDEWQITWDVEARFIHI-LE V I PQLENAE SEC ID NO: 9 ACT TGA ATA AAA CCG AGT G SEQ ID NO: 10 GAC ATT GGC CGC AAC ATG C SEQ ID NO: 11 AAG GGC CCA ATT ACG CAG AGG GGA TCC ATG CGT GGT CTT AGG CGT TGG TTA TCC ACC G SEQ ID NO: 12 AAG GGC CCA ATT ACG CAG AGG GTC GAC TTA TTA TTC AGC ATT CTC AAG CTG TGG TAT CAG SEC ID NO: 13 CNEEA SQNRRAELSY SEC ID NO: 14 YTGVAP VDNDE V

Claims (26)

1. - An isolated polypeptide useful in a vaccine against infection by Moraxella catarrhalis comprising an amino acid sequence, which has at least 85% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8 over the entire length of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, respectively.

2. An isolated polypeptide according to claim 1, wherein the amino acid sequence has at least 95% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4 , SEQ ID NO: 6, and SEQ ID NO: 8 over the entire length of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, respectively.

3. The polypeptide according to claim 1, comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8.

4. An isolated polypeptide having the amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8.

5. An immunogenic fragment of the polypeptide according to claims 1 to 4, wherein the immunogenic fragment is capable of evoking an immune response (if necessary when coupled to a vehicle), which recognizes the polypeptide of SEQ. NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8.

6. A polypeptide according to any of claims 1 to 5, wherein said polypeptide is part of a larger fusion protein.

7. An isolated polynucleotide encoding a polypeptide according to any of claims 1 to 6.

8. An isolated polynucleotide comprising a nucleotide sequence encoding a polypeptide having at least 85% identity to the sequence of amino acid of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8 over the entire length of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEC ID NO: 8, respectively.

9. An isolated polynucleotide comprising a nucleotide sequence having at least 85% identity to a nucieotide sequence encoding a polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8, over the entire coding region; or a nucleotide sequence complementary to said isolated polynucleotide.

10. An isolated polynucleotide comprising a nucleotide sequence having at least 85% identity with that of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 above all the length of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, respectively, or a complementary nucleotide sequence for said isolated polynucleotide.

11. - The isolated polynucleotide according to any of claims 7 to 10, wherein the identity is at least 95% to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 .

12. An isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8.

13. An isolated polynucleotide comprising the polynucleotide of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7.

14. An isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8, which can be obtained by classifying an appropriate collection under severe hybridization conditions with a probe labeled having the sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or fragments thereof.

15. An expression vector or living microorganism comprising an isolated recombinant polynucleotide according to any of claims 7-14.

16. A host cell comprising the expression vector of claim 15 expressing an isolated polypeptide comprising an amino acid sequence having at least 85% identity to the amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8, or a membrane of the host cell containing the expressed polypeptide.

17. A process for producing a polypeptide according to claims 1 to 6, which comprises culturing a host cell of claim 16 under conditions sufficient for the production of said polypeptide and recovering the polypeptide from the culture medium.

18. A process for expressing a polynucleotide of any of claims 7-14, comprising transforming a host cell with the expression vector comprising at least one of the polynucleotides and culturing said host cell under conditions sufficient for the expression of any of the polynucleotides.

19. A vaccine composition comprising an effective amount of the polypeptide of any of claims 1 to 6 and a pharmaceutically acceptable carrier.

20. A vaccine composition comprising an effective amount of the polypeptide of any of claims 7 to 14 and a pharmaceutically acceptable carrier.

21. The vaccine composition according to any of claims 19 or 20, wherein the composition comprises at least another Moraxella catarrhalis antigen.

22. An immunospecific antibody for the polypeptide or immunological fragment according to any of claims 1 to 6. 23.- A method for diagnosing an infection by Moraxella catarrhafis, which comprises identifying a polypeptide according to any of claims 1- 6, or an antibody that is immunospecific for said polypeptide, present within a biological sample of an animal suspected of having said infection. 24. The use of a composition comprising an immunologically effective amount of a polypeptide with any of claims 1-6, in the preparation of a medicament for use in generating an immune response of an animal. 25. The use of a composition comprising an immunologically effective amount of a polynucleotide according to any of claims 7-14 in the preparation of a medicament for use in generating an immune response of an animal. 26. A therapeutic composition useful for the treatment of humans with the disease caused by Moraxella catarrhalis, comprising at least one antibody directed against the polypeptide of claims 1-6 and a suitable pharmaceutical carrier.