MXPA00010613A - Recombinant virus expressing foreign dna encoding feline cd80, feline ctla-4 or feline cd86 and uses thereof - Google Patents

Abstract

The present invention involves a recombinant virus which comprises at least one foreign nucleic acid inserted within a non-essential region of the viral genome of a virus, wherein each such foreign nucleic acid encodes a protein. The protein which is encoded is selected from the groups consisting of a feline CD28 protein or an immunogenic portion thereof, a feline CD80 protein or an immunogenic portion thereof, a feline CD86 protein or an immunogenic portion thereof, or a feline CTLA-4 protein or an immunogenic portion thereof. The protein is capable of being expressed when the recombinant virus is introduced into an appropriate host. The present invention also involves arecombinant virus further comprising a foreign nucleic acid encoding an immunogen derived from a pathogen. The present invention also comprises recombinant viruses which are capable of enhancing an immune response in a feline. The present invention also comprises recombinant viruses which are capable of suppressing an immune response in a feline.

Description

RECOMBINANT VIRUS THAT EXPRESSES STRANGE DNA THAT CODIFIES FOR FELINE CD80, FELINE CTLA-4 OR FELINE CD86 AND USES OF IT INTERFERON-? AND THEIR USES This application claims the priority of the United States Application Serial No. 09 / 071,711, filed on May 1, 1998, the contents thereof being incorporated in this manner as reference in this application. Throughout this application, the various publications referenced appear in parentheses. Complete citations of these publications can be found at the end of the specification that immediately precedes the section of the sequence listing. The disclosures of these publications are hereby incorporated in their entirety as a reference within this application to more fully describe the state of the art to which this invention pertains.

BACKGROUND OF THE INVENTION It is believed that the stimulation of the activation and proliferation of T cells in response to host disease depends on two interactions: the recognition of the T cell receptor (TCR) by immunogenic peptides in the host. MHC class I molecule context and the secondary interaction of accessory ligands, such as CD80 and CD86, with their co-receptors, CD-28 and / or CTLA-4 in T cells. The successful interaction of these two routes leads to the activation and proliferation of both CD4 + and CD8 + T cells and the increase in the production of Th1 and Th2 immunoregulatory cytokines. In the absence of adequate co-stimulation of T cells, an anergic state can develop, by which T cells can not proliferate and secrete cytokines. Over the years, two molecules have emerged as key regulators of the responses of T cells, CD28 and its ligands, CD80 and CD86. CD28 is the co-stimulatory primary recipient of T cells and after interaction with CD80 and CD86, increases T cell proliferation and cytokine synthesis, which prevents the death of T cells. CTLA-4 (also called CD152), a homologue of CD-28, also plays an important role in co-stimulation. Although, it is not fully understood, it seems to inhibit co-stimulatory responses of T cells. Interaction and reciprocal action between CD28, CTLA-4 and its CD80 and CD86 ligands in co-stimulatory processes are important for the global induction and suppression of immune responses in host disease. (Linsley et al, 1991a, 1993a).

There are currently no successful vaccines for the prevention of feline immunodeficiency disease and the disease of feline infectious peritonitis in cats. Vaccines against feline leukemia virus are currently available, but their level of efficacy remains questionable and, in some cases, may cause the disease. It has been shown that experimental vaccines against feline infectious peritonitis do not protect or cause early death, by means of antibody-mediated reinforcement. Therefore, there is a need in the art for agents and compositions that provide protection against these and other diseases, where a vaccine does not yet exist or which increases the efficacy of existing and commonly used vaccines. In addition, there is a need in the art for vaccines and agents that induce a cell-mediated response in the absence of antibodies that reinforce the disease. And, finally, vaccination of cat puppies is difficult, due to the inability to overcome maternal antibodies in puppies. Safe and effective agents are needed to help overcome these barriers. In the present invention, by manipulating the expression of feline CD28, feline CTLA-4 and its co-stimulatory molecules, feline CD80 and feline CD86 ligands, it is possible to regulate T cell responses, by increasing, suppression or re-direction, to reinforce the desired immune response to a particular feline pathogen or a feline disease condition. In particular, these co-stimulatory molecules are useful for vaccination against infectious diseases, in the treatment of infectious diseases and in the treatment of neoplastic, degenerative, autoimmune and immunodeficiency conditions in felines. The present invention overcomes the lack of efficacy and effectiveness of the above described feline vaccines, which are currently available.

SUMMARY OF THE INVENTION The present invention involves a recombinant virus comprising at least one foreign nucleic acid, inserted into a non-essential region of the viral genome of a virus, wherein each foreign nucleic acid encodes a protein. The protein that is encoded is selected from the groups consisting of a feline CD28 protein or an immunogenic portion thereof, a feline CD80 protein or an immunogenic portion thereof, a feline CD86 protein or an immunogenic portion thereof or a feline CTLA-4 protein or an immunogenic portion thereof. The portion has the ability to be expressed when the recombinant virus is introduced into an appropriate host. The present invention also involves a recombinant virus which additionally comprises a foreign nucleic acid encoding an immunogen derived from a pathogen. The present invention also comprises recombinant viruses that have the ability to enhance the immune response in a feline. The present invention also comprises recombinant viruses that have the ability to suppress the immune response in a feline.

BRIEF DESCRIPTION OF THE FIGURES Figure IA; The DNA and the amino acid sequence of feline CD80 (B7-1) (TAMU). (SEQ ID NO: 1 and 2). Figure IB; Graph of the hydrophobicity of the amino acid sequence of feline CD80 (B7-1) (TAMU). Figure 2A; The DNA and the amino acid sequence of the feline CD80 (b7-l) (SYNTRO). (SEQ ID NO: 3 and 4). Figure 2B; Graph of the hydrophobicity of the amino acid sequence of feline CD80 (B7-1) (SYNTRO). Figure 3A: DNA and amino acid sequence of feline CD86 (B7-2). (SEQ ID NO: 5) Figure 3B: Graph of the hydrophobicity of the amino acid sequence of feline CD86 (B7-2) Figure 4A: DNA and amino acid sequence of feline CD28 (SEQ ID NO: 7 and 8) Figure 4B: Graph of the hydrophobicity of the amino acid sequence of feline CD28 Figure 5A: DNA and amino acid sequence of feline CTLA-4 (CD152) (SEQ ID NO: 9 and 10). Figure 5B: Graph of the hydrophobicity of the amino acid sequence of feline CTLA-4 (CD152).

DETAILED DESCRIPTION OF THE INVENTION The present invention involves a recombinant virus comprising at least one foreign nucleic acid, inserted into a non-essential region of the viral genome of a virus, wherein each foreign nucleic acid: (a) encodes a protein selected from the groups consisting of a feline CD28 protein or an immunogenic portion thereof; a feline CD80 protein or an immunogenic portion thereof; a feline CD86 protein or an immunogenic portion thereof; or a protein Feline CTLA-4 or an immunogenic portion thereof and (b) has the ability to be expressed when the recombinant virus is introduced into an appropriate host. In one embodiment of the invention described above, the recombinant virus comprises at least two foreign nucleic acids, each inserted into a non-essential region of the viral genome. In another embodiment of the invention, the recombinant virus comprises at least three foreign nucleic acids inserted each into a non-essential region of the viral genome. In another embodiment of the invention, the recombinant virus comprises four foreign nucleic acids, each inserted into a non-essential region of the viral genome. In another embodiment, the recombinant virus includes, but is not limited to, a raccoon pox virus, a pig pox virus or a feline herpes virus. In a further embodiment of the invention identified above, the recombinant virus comprises more than one foreign nucleic acid and each of the foreign nucleic acids is inserted into the same non-essential region. In another embodiment, any of the recombinant viruses comprises more than one foreign nucleic acid, where all these foreign nucleic acids are not inserted in the same non-essential region.

In a separate embodiment, any of the recombinant viruses comprises more than one foreign nucleic acid, wherein all of these foreign nucleic acids are not inserted into the same non-essential region. In a separate embodiment, any of the recombinant viruses comprises a foreign nucleic acid encoding an immunogen derived from a pathogen. In a further embodiment of the invention, the recombinant virus encodes a feline pathogen, a rabies virus pathogen, a Chlamydia pathogen, a pathogen of Toxoplasmosis gondii, a pathogen of Dirofilaria immitis, a flea pathogen or a bacterial pathogen. In another embodiment of the invention, the recombinant virus codes for the feline immunodeficiency virus (FIV for its acronym in English, although hereinafter also FIV), the feline leukemia virus (FeLV), the infectious peritonitis virus. feline (FIP) feline panleukopenia virus, feline calicivirus, feline reovirus type 3, feline rotavirus, feline coronavirus, feline syncytial virus, feline sarcoma virus, feline herpes virus, feline virus Feline Borna disease or a parasite of felines. In a further embodiment of the invention, the recombinant virus comprises at least one foreign nucleic acid, comprising a promoter for expressing the foreign nucleic acid. In another embodiment, the recombinant virus expresses at least one foreign nucleic acid, under the control of a promoter endogenous to the virus. In one embodiment of the invention, the recombinant virus further comprises a foreign nucleic acid encoding a detectable label. In a further embodiment of the invention, the detectable marker is beta galactosidase from E. coli. The invention further provides a recombinant virus encoding immunogens of a FIV gag protease, a FIV envelope protein, a FeLV gag protease or a FeLV envelope protein. The invention provides a recombinant virus that additionally comprises a nucleic acid encoding the genome of feline immunodeficiency virus or a portion thereof. The invention provides a recombinant virus further comprising a nucleic acid encoding the genome of the feline leukemia virus or a portion thereof. The invention provides a recombinant virus further comprising a nucleic acid encoding feline IL12, GMCSF, p35 or p40. The invention further provides a vaccine comprising an effective immunizing amount of this recombinant virus and a suitable vehicle. The invention provides a recombinant feline herpes virus that contains a non-essential region in the glycoprotein G gene of feline herpes virus. The invention provides a recombinant feline herpes virus of claim 12 designated as S-FHV-031 (Accession No. ATCC VR-2604). This virus was deposited on May 1, 1998 at the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20108-0971, USA, in accordance with the provisions of the Budapest Treaty for the International Recognition of Deposits Microorganisms for the Purpose of Patent Procedures. The invention provides a recombinant swinepox virus with a non-essential region in the largest Hind III to Bgl II sub-fragment of the M Hind III fragment of the swinepox virus. The invention further provides a feline recombinant swinepox virus of claim 14 designated as S-SPV-246 (Accession No. ATCC VR-2603). This virus was deposited on May 1, 1998 in the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20108, USA, in accordance with the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for Purposes of Patent Procedures. In an embodiment of the invention described above, the recombinant virus, the portion of the protein CD28, CD80 or CD86 of the soluble portion of the protein. In another embodiment of the invention, the recombinant virus comprises foreign nucleic acid encoding the feline CTLA-4 protein. The above-described invention of a vaccine comprising an effective immunizing amount of a recombinant virus and a suitable vehicle. In one embodiment of the invention, a vaccine contains an effective immunizing amount of the recombinant virus of between approximately lxlO5 pfu / ml and approximately lx108 cfu / ml. In another embodiment, the invention provides a vaccine further comprising a mixture of the recombinant virus and an effective immunizing amount of a second immunogen. The invention provides a method for enhancing the immune response in a feline, which comprises administering to the feline an effective immunizing amount of any of the previously identified recombinant viruses. The invention further provides a method for immunizing a feline by administering to the feline an effective immunizing amount of any of the previously identified recombinant viruses.

The invention provides the method for suppressing an immune response in a feline by administering to the feline any effective suppressant amount of a recombinant virus containing a soluble CD28, CD80 or CD86. The invention provides a method for suppressing an immune response in a feline by administering to the feline any effective suppressant amount of a recombinant virus containing feline CTLA-4 protein. The invention provides for the administration of the above-described recombinant virus by the intravenous, subcutaneous, intramuscular, transmuscular, topical, oral or intraperitoneal routes. In one embodiment, the invention provides a method for suppressing the immune response in a feline when the feline is the recipient of a transplanted organ or tissue or if it is suffering from an immune response. In a further embodiment, the invention provides a method for suppressing an immune response in a feline, comprising administering to the feline an antisense nucleic acid that has the ability to hybridize and inhibit the translation of: (a) a transcript of feline CD28 mRNA , (b) a feline CD80 transcript or (c) a feline CD86 mRNA transcript of the antisense nucleic acid that is present in an amount effective to inhibit translation and thereby suppress the immune response in the feline. In one embodiment, the invention described above provides a method for reducing or abrogating a tumor in a feline, comprising administering to the feline tumor a recombinant virus containing a nucleic acid encoding a feline CD80 protein, a feline CD86 protein or a combination thereof in an effective amount to reduce or abrogate the tumor. In one embodiment, the invention provides a method for reducing or abrogating a tumor in a feline, wherein the recombinant virus further comprises and has the ability to express an antigen associated with the feline tumor and the administration is carried out systemically. The present invention provides isolated and purified DNA encoding feline CD80 ligand (B7-1) or feline ligand CD86 (B7-2) or feline CD28 receptor or feline CTLA-4 (CD152) receptor, as well as such as cloning and expression vectors comprising CD80 or CD86 or CD28 or CTLA-4 or RNA, totally or partially, and cells transformed with vectors encoding CD80 or vectors encoding CD86 or vectors encoding CD28 or vectors that code for CTLA-4. The feline species from which CD80 or CD86 or CD28 or CTLA-4 were selected are from the group comprising, without limitation, domestic cats, lions, cougars, lynxes and cheetahs. The invention provides isolated and purified feline CD80 (B7-1) cDNA of approximately 941 nucleotides. The invention also provides isolated and purified feline CD80 polypeptide of approximately 292 amino acids, whose native membrane-bound or mature form has a molecular mass of about 33.485 kDa, an isoelectric point of about 9.1 and a net charge at pH 7.0 of 10. The coexpression of CD80 with the co-stimulatory molecule CD28 and a tumor antigen or an antigen of a pathogenic organism, has the ability to activate or increase the activation of T lymphocytes, inducing the production of the immuno-stimulatory cytokine and regulating growth of other cell types. The coexpression of Cd80, with the co-stimulatory molecule CTLA-4, has the ability to regulate the activation of T lymphocytes. The invention provides isolated and purified feline CD86 (B7-2) cDNA of approximately 1176 nucleotides. The invention also provides isolated and purified feline CD86 polypeptide of about 320 amino acids, whose native membrane-bound or mature form having a molecular mass of about 36.394 kDa, an isoelectric point of about 9.19 and a net charge at pH 7.0 of 11.27. The co-expression of CD86, with co-stimulatory molecules CD28 and a tumor antigen or an antigen of a pathogenic organism, has the ability to activate or increase the activation of T lymphocytes, inducing the production of immuno-stimulatory cytokines and regulating the growth of other types of cells The co-expression of CD86, with the costimulatory molecule CTLA-4, has the ability to regulate the activation of T lymphocytes. Feline CD80 or CD86, according to the present invention, are obtained from native sources or recombinants. The feline CD80 or CD86, in accordance with the present invention, comprises the native and membrane bound form or a secreted form lacking the transmembrane domain. The invention provides isolated and purified feline CD28 cDNA of about 689 nucleotides. The invention provides isolated and purified feline CD28 polypeptide of approximately 221 amino acids, whose native membrane-bound or mature form has a molecular mass of about 25,319 kDa, an isoelectric point of about 9.17 and a net charge at pH 7.0 of 9.58. The invention provides isolated and purified feline CTLA-4 cDNA of about 749 nucleotides. The invention also provides purified and isolated feline CTLA-4 polypeptides of approximately 223 amino acids, whose native membrane-bound or mature form has a molecular mass of approximately 24,381 kDa, an isoelectric point of approximately 6.34 and a net charge at pH 7.0 -0.99. The invention provides a recombinant swinepox virus expressing foreign DNA, the foreign DNA encoding cDNA and feline CD80, feline CD86, feline CD28 and feline CTLA-4 polypeptides. The invention provides a recombinant raccoon pox virus expressing foreign DNA, the foreign DNA encoding feline CD80 and cDNA polypeptides, feline CD86, feline CD28 and feline CTLA-4. The invention provides a recombinant feline herpes virus expressing foreign DNA, the foreign DNA encoding cDNA and feline CD80, feline CD86, feline CD28 and feline CTLA-4 polypeptides. In another aspect, the invention provides a method for enhancing an immune response in a feline to an immunogen, which is achieved by administering the immunogen before, after or virtually simultaneously with feline CD80 or feline CD86 with or without CD28. feline or feline CTLA-4 in a vector of the recombinant virus of pox of the pig, in a vector of the recombinant virus of raccoon pox or in a vector of the recombinant virus of feline herpes, in an amount effective to reinforce the immune response. In another aspect, the invention provides a method for suppressing an immune response in a feline to an immunogen, which is achieved by administering the immunogen before, after or practically simultaneously with feline CD80 or feline CD86 with or without feline CD28. or feline CTLA-4 or with antisense RNA or DNA, in whole or in part, coding for feline CD80 or feline CD86 or feline CD28 or feline CTLA-4, in a vector of the recombinant virus of swinepox, in a vector of the virus recombinant of raccoon pox or in a recombinant feline herpes virus vector, in an amount effective to suppress the immune response. In another aspect, the invention provides a vaccine for inducing an immune response in felids to an immunogen, comprising the immunogen and an effective amount of feline CD80 in a recombinant virus vector of pigs pox, in a recombinant virus vector. of raccoon pox or in a recombinant feline herpes virus vector, for reinforcement in the immune response. The immunogen is derived from, for example, feline pathogens, such as feline immunodeficiency virus, feline leukemia virus, feline parvovirus, feline coronavirus., the feline leptovirus and the like. In another aspect, the invention provides a vaccine for inducing an immune response in felids to an immunogen, which is achieved by administering a recombinant swinepox virus vector, a recombinant raccoon pox virus vector or a vector of recombinant feline herpes virus, which express DNA or RNA of an immunogen and DNA or RNA of accessory molecules CD80, CD86, feline CD28, in any combination, which code for protein or protein fragment in an effective amount to modulate the immune response. The feline CD80 protein has an amino acid sequence that is 59% and 46% identical to the human and mouse proteins, respectively. The feline CD86 protein has an amino acid sequence that is 68% and 64% identical to the human and rabbit proteins, respectively. The feline CD28 protein has an amino acid sequence that is 82% and 74% identical to the human and mouse proteins, respectively. The feline CTLA-4 proteins have an amino acid sequence that is 88% and 78% identical to the human and mouse proteins, respectively. The human or mouse CD80 or CD86 proteins can not functionally replace feline CD80 or CD86 proteins. Therefore, feline CD80, feline CD86, feline CD28 and feline CTLA-4 are the novel reagents required for the regulation of feline immunity. The present invention encompasses the accessory regulatory molecules of T cells, CD80 (B7-1) or CD86 (B7-2) or CD28 or CTLA-4 (CD152) of feline species. The invention provides isolated and purified nucleic acids encoding, in whole or in part, feline CD80 or feline CD86 or feline CD28 or feline CTLA-4, as well as for the CD80, CD86, CD28 or CTLA-4 polypeptides, purified from either from native or recombinant sources. The feline CD80, CD86, CD28 or CTLA-4 produced in accordance with the present invention are used to enhance the efficiency of feline vaccines against tumors and pathogenic organisms and as therapeutic agents for the treatment of viral and bacterial diseases in cats. The feline CD80, CD86, CD28 or CTLA-4, produced in accordance with the present invention, were also used to alleviate diseases due to overactive, overactive or misdirected immune responses.

Nucleic acids, vectors, transformed The sequences of the cDNA coding for feline CD80 (SEQ ID NO: 1, 3), feline CD86 (SEQ ID NO: 5), feline CD28 (SEQ ID NO: 7) or feline CTLA-4 ( SEQ ID NO: 9) are shown in Figures 1 to 5 and the predicted amino acid sequences of feline CD80 (SEQ ID NO: 2, 4), feline CD86 (SEQ ID NO: 6), feline CD28 (SEQ ID NO: 8) or feline CTLA-4 (SEQ ID NO: 10) are shown in Figures 1 to 5. The designation of these feline polypeptides as CD80, CD86, CD28 or CTLA-4 is based on the partial homology of the sequence of amino acids with the human, mouse or rabbit homolog of these polypeptides and the ability of the CD80 or CD86 polypeptides to bind to the feline CD28 receptor (see below) or to CTLA-4 and to activate or stimulate or regulate activation of the T lymphocytes. In addition, without wanting to be bound by theory, it is predicted that feline CD80 or feline CD86 polypeptides also exhibit a or more of the following bioactivities: activation of natural killer cells or NK (natural killer), stimulation of B cell maturation, activation of MHC-restricted cytotoxic T cells, proliferation of mast cells, interaction with cytokine receptors and the induction of immunoregulatory cytokines. Due to the degeneracy of the genetic code (ie, multiple codons that encode certain amino acids), other DNA sequences than those shown in Figures 1 to 5 can also encode the amino acid sequences CD80, CD86, CD28 or Feline CTLA-4 shown in Figures 1 to 5. These other DNAs include those that contain "sequence-conservative" variations in which a change in one or more nucleotides of a given codon does not result in alteration of the amino acid encoded in that position. In addition, a particular amino acid residue in a polypeptide can frequently be changed without altering the globble conformation and function of the native polypeptide. These "function-conserving" variants include, but are not limited to, the replacement of an amino acid with one that has similar physicochemical properties, such as, for example, acid, basic, hydrophobic, hydrophilic, aromatic, and the like (eg, replacement). of lysine by arginine, aspartate by glutamate or glycine by alanine). In addition, the amino acid sequences are added or deleted without destroying the bioactivity of the molecule. For example, additional amino acid sequences are added at either the terminal amino or carboxy termini to serve as purification tags, such as histidine tags (ie, to allow purification in a single step of the protein, then from which, they are removed chemically or enzymatically).

Alternatively, the additional sequences confer an additional cell-surface binding site or otherwise alter the specificity of the target cell of the feline CD80, CD86, CD28 or CTLA-4, as with the addition of an antigen binding site. for antibodies. The feline CD80 or feline CD86 or feline CD28 or feline CTLA-4 cDNA within the scope of the present invention are those of Figures 1 to 5, sequence-conserving DNA variants, DNA sequences encoding variants of Function-preserving polypeptides and combinations thereof. The invention encompasses feline CD80, CD86, CD28 or CTLA-4 fragments that exhibit a degree of useful bioactivity, either alone or in combination with other sequences or components. As explained below, within the ordinary skill in the art it is perfectly possible to predictively manipulate the sequence of CD80, CD86, CD28 or CTLA-4 and establish whether a particular variant of CD80, CD86, CD28 or CTLA-4 cats possess a stability and bioactivity appropriate for a particular application or variations that affect the binding activities of these molecules that result in an increase in effectiveness. The feline CD80 and CD86 will each bind to the CD28 co-receptor or the CTLA-4 co-receptor. This can be achieved by expressing and purifying the CD80 polypeptide variant, CD86, CD28 or CTLA-4 in a recombinant system and evaluate their stimulating activity of T cells and / or the growth promoting activity in a cell culture and in animals, followed by the test in the application. The bioactivity of the CD80 variant is tested by functional binding to the CD28 or CTLA-4 receptors. The bioactivity of the CD86 variant is tested by functional binding to the CD28 or CTLA-4 receptors. In a similar way, the bioactivity of the CD28 variant or the CTLA-4 variant is tested. The present invention also encompasses DNA (and polypeptides) of feline CD80, CD86, CD28 or CTLA-4 derived from other feline species, including, but not limited to, domestic cats, lions, tigers, cheetahs, lynx and the like. The feline CD80, CD86, CD28 or CTLA-4 homolog of the sequence shown in Figures 1 to 5 is easily identified by screening the cDNA or from genomic libraries to identify clones that are hydrized with probes comprising all or part of the sequence of Figures 1 to 5. Alternatively, expression libraries are screened using antibodies that recognize feline CD80, CD86, CD28 or CTLA-4. Without wishing to be bound by theory, it is anticipated that the CD80 or CD86 genes from other feline species will share at least approximately 70% homology with feline CD80, CD86, CD28 or CTLA-4 genes. Also within the scope of the invention are DNAs encoding the CD80, CD86, CD28, or CTLA-4 homologue, defined as DNA encoding polypeptides that share at least about 25% amino acid identity with CD80, Feline CD86, CD28 or CTLA-4. In general, manipulations of the nucleic acid, according to the present invention, use methods that are well known in the art, such as those disclosed in, for example, Molecular Cloninq, A Laboratorv Manual (2nd Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor), or Current Protocols in Molecular Bioloqy (Eds. Aufubel, Brent, Kingston, More, Feidman, Smith and Stuhl, Greene Publ. Assoc., Iley-Interscience, NY, NY, 1992). The present invention encompasses sense and antisense cDNA and RNA sequences. The invention also encompasses feline CD80, CD86, CD28 or CTLA-4 genomic DNA sequences and flanking sequences that include, but are not limited to, regulatory sequences. Nucleic acid sequences encoding feline CD80, CD86, CD28 or CTLA-4 polypeptides are also associated with heterologous sequences, including promoters, enhancers, response elements, signal sequences, polyadenylation sequences, introns, regions, '- and 3'- that do not code and the similar. Transcriptional regulatory elements that are operably linked to the cDNA sequences of CD80, CD86, CD28, or CTLA-4, include, without limitation, those that have the ability to direct the expression of genes derived from prokaryotic cells, from eukaryotic cells, from prokaryotic cell virus, eukaryotic cell virus and any combination thereof. Those skilled in the art are aware of other useful heterologous regulatory sequences. The nucleic acids of the present invention are modified by methods known to those skilled in the art to alter their stability, solubility, binding affinity and specificity. For example, the sequences are methylated selectively. The nucleic acid sequences of the present invention are also modified with a tag capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like. The present invention also provides vectors that include nucleic acids encoding CD80, CD86, CD28 or CTLA-4 polypeptides in whole or in part. These vectors include, for example, plasmid vectors for expression in a variety of eukaryotic and prokaryotic hosts. Preferably, the vectors also include a promoter operably linked to the coding portion of the feline CD80, CD86, CD28 or CTLA-4 polypeptide. The encoded feline CD80, CD86, CD28 or CTLA-4 polypeptides are expressed using any suitable vectors and host cells as explained herein or are known in some manner by those skilled in the art. The present invention also provides vectors that include, totally or partially, nucleic acids encoding CD80, CD86, CD28 or feline CTLA-4 polypeptides. These vectors include, for example, live viral vectors for expression in a variety of eukaryotic hosts or for the expression of DNA or RNA vaccines. In one embodiment, the live viral vector is attenuated. In another embodiment, the live viral vector is attenuated by a gene deletion. In another embodiment, the viral vector is inactivated by chemical or heat treatment. The living viral vector is selected from the group consisting, but not limited to, herpes virus, variola virus, adenovirus, adeno-associated virus, retrovirus, baculovirus, alphavirus, rhabdovirus, picornavirus. The live viral vector is selected from the group consisting, inter alia, of feline herpes virus, canine herpes virus, poultry herpes virus, bovine herpes virus, equine herpes virus, pseudorabies virus, smallpox virus. of the pig, bird pox virus, poultrypox virus, raccoon pox virus, canarypox virus, vaccine virus, Malony's murine leukemia virus, Sindbis virus and Semliki virus Forest. The live viral vector is a recombinant viral vector expressing a foreign DNA that is cDNA of CD80, CD86, CD28 or feline CTLA-4, totally or partially. The foreign DNA is also a cDNA of an antigen of a pathogenic organism. The recombinant viral vector is constructed by recombinant homologous or cosmid reconstruction methods, known to those skilled in the art. Preferably, the vectors also include a promoter linked in operable form to the coding portion of the CD80, CD86, CD28 or feline CTLA-4 polypeptide. The promoter is selected from the group comprising, inter alia, gE promoter of feline herpes virus, late / early synthetic promoter of variola virus, human cytomegalovirus immediate early promoter, gX promoter of pseudorabies virus. The promotion of gene expression also includes the expression of the cDNA of CD80, CD86, CD28 or CTLA-4 of an element of the internal ribosomal entry site (IRES or its acronym in English), contained in a cassette (vector pCITE, Novagen , Madison, Wl). Cell lines for the development of viral vectors include, but are not limited to, Crandell feline kidney cells (CRFK), chicken embryo fibroblasts, embryonic pig kidney cells (ESK-4), porcine kidney cells (PK). ). The CD80, CD86, CD28 or feline CTLA-4 encoded polypeptides are expressed using any suitable vector and host cells as explained herein or otherwise known to those skilled in the art. In a preferred embodiment, the genes encoding CD80 and CD28, CD80 and CTLA-4, CD86 and CD28 or CD86 and CTLA-4, in combination with the genes of an immunogen derived from a feline pathogen, are incorporated into a single vector recombinant virus and then formulated in a live vaccine. Feline CD80, CD86, CD28 or CTLA-4 genes, alone or in combination with feline genes derived from feline pathogens are incorporated into the recombinant virus, so that the expression of these genes is controlled by an appropriate promoter. In another embodiment, genes encoding feline CD80, CD86, CD28 or CTLA-4, alone or in combination, are incorporated into a recombinant viral vector and co-administered in a vaccine with a second recombinant viral vector encoding genes. of immunogens derived from feline pathogens. These two modalities provide the desired immune responses in the same cell or in cells in close proximity to achieve the increase, the suppression or redirection of the desired immune response. The immunogen is selected from the group comprising, but is not limited to, feline pathogens, such as feline immunodeficiency virus, feline leukemia virus, feline infectious peritonitis virus, feline panleukopenia virus (parvovirus), feline calicivirus, feline reovirus type 3, feline rotavirus, feline coronavirus (infectious peritonitis virus), rabies virus, feline syncytial virus, feline sarcoma virus, feline herpes virus (rhinotracheitis virus), disease virus of Feline Borna, Chlamydia, Toxoplasmosis gondii, feline parasites, Dirofilaria immitis, fleas, bacterial pathogens and the like. Viral vectors or live vectors frequently include one or more replication systems for cloning or expression, one or more markers for selection in the host, such as, for example, resistance to antibiotics or calorimetric markers, such as β-galactosidase (lacZ) or β-glucuronidase (uidA) or fluorescent labels, such as the green fluorescent protein and one or more expression cassettes.

The inserted coding sequences are synthesized, isolated from natural sources, prepared as hybrids or the like. The ligation of the coding sequences to the transcriptional regulatory sequences is achieved by methods known to those skilled in the art. Suitable host cells were transformed / transfected / infected by any suitable method, including electroporation, CaCl2-mediated DNA uptake or liposome, fungal infection, microinjection, microprojectile or the like. Vectors suitable for use in the practice of the present invention include, without limitation, YEp352, pcDNAI (Invitrogen, Carlsbad, CA), pRc / CMV (Invitrogen) and pSFVl (GIBCO / BRL, Gaithersburg, MD). A preferred vector for use in the invention is pSFV1. Suitable host cells include E. Col i. yeast, COS cells, PC12 cells, CHO cells, GH4C1 cells, BHK-21 cells and amphibian melanophores cells. BHK-21 cells are a preferred host cell line for use in the practice of the present invention. Suitable vectors for building genetic vaccines or naked DNA include, but are not limited to, pTarget (Promega, Madison, Wi), pSI (Promege, Madison, Wl) and pcDNA (Invitrogen, Carlsbad, CA).

The nucleic acids encoding feline CD80, CD86, CD28 or CTLA-4 polypeptides were also introduced into the cells by recombination events. For example, this sequence is microinjected into a cell, effecting homologous recombination at the site of an endogenous gene encoding the polypeptide, an analog or a pseudogene thereof or a sequence with a significant identity to a gene coding for CD80 polypeptide, Feline CD86, CD28 or CTLA-4. Other methods based on recombination are also used, such as non-homologous recombinations and the suppression of the endogenous gene by homologous recombination, especially in pluripotent cells. The present invention provides a method for improving the immune response in a feline to an immunogen, which is achieved by administration of the immunogen before, after or virtually simultaneously with feline CD80 or feline CD86 with or without feline CD28 or CTLA- 4 feline in an effective amount to strengthen the immune response. The present invention provides a method for enhancing an immune response in a feline to an immunogen, which is achieved by administering an expression vector containing an immunogen derived from a feline pathogen and accessory molecules feline CD80 or feline CD86 with or without feline CD28 or feline CTLA-4 in an effective amount to enhance the immune response. The present invention provides a method for redirecting an immune response in a feline to an immunogen, which is achieved by administering an expression vector containing an immunogen derived from a feline pathogen and accessory molecules CD80 feline or feline CD86 with or without Feline CD28 or feline CTLA-4 in an effective amount to enhance the immune response. The present invention provides a method for suppressing an immune response in a feline to an immunogen, which is achieved by administering the immunogen before, after or virtually simultaneously with feline CD80 or feline CD86 with or without feline CD28 or Feline CTLA-4 or with antisense DNA or RNA encoding feline CD80 or feline CD86 or feline CD28 or feline CTLA-4, in an amount effective to suppress the immune response. The present invention provides a vaccine for inducing an immune response in a felid to one or more immunogens, comprising the immunogen and the effective amount of feline CD80 or feline CD86 with or without feline CD28 or feline CTLA-4 for reinforcement of the feline CD85 or feline CD86 or feline CTLA-4 immune response for suppression of the immune response. In another embodiment, the invention provides a vaccine comprising an expression vector containing genes for immunogens for feline pathogens and genes for CD80, CD86 with or without feline CD28 or feline CTLA-4 for augmentation or suppression of the immune response.

CD80 polypeptides. Feline CD86, CD28 or CTLA-4 Feline CD80 gene (of which in Figures 1 and 2 shows the DNA and amino acid sequence) codes for a polypeptide of approximately 292 amino acids. The feline CD86 gene (of which Figure 3 shows the DNA and amino acid sequence) codes for a polypeptide of about 320 amino acids. The feline CD28 gene (of which Figure 4 shows the DNA and the amino acid sequence) codes for a polypeptide of approximately 221 amino acids. The feline CTLA-4 gene (of which in Figure 5 the DNA and the amino acid sequence is shown) encodes a polypeptide of approximately 223 amino acids. The purification of feline CD80, CD86, CD28 or CTLA-4 from natural or recombinant sources is achieved by methods well known in the art, including, but not limited to, ion exchange chromatography, reverse phase chromatography on C4 columns. , gel filtration, isoelectric focusing, affinity chromatography and the like. In a preferred embodiment, large quantities of feline CD80, CD86, CD28 or CTLA-4 bioactive are obtained by construction of a recombinant DNA sequence comprising the coding region of feline CD80, CD86, CD28 or CTLA-4. fused in a frame before a sequence coding for C-terminal histidine residues in the pSFVl replicon (GIBCO / BRL). The mRNA encoded by this plasmid is synthesized using techniques well known to those skilled in the art and introduced into BHK-21 cells by electroporation. Cells synthesize and secrete feline CD80, CD86, CD28 or feline CTLA-4 glycosylated mature polypeptides containing 6 C-terminal histidines. The feline CD80, CD86, CD28 or CTLA-4 modified polypeptides were purified from the cell supernatant by affinity chromatography using a histidine binding resin (His-bind, Novagen, Madison, Wl). CD80 cat feline or feline CD86 polypeptides isolated from any source were modified by methods known in the art. For example, feline CD80, CD86, CD28 or CTLA-4 were phosphorylated or dephosphorylated, glycosylated or deglycosylated and the like. Modifications that alter the solubility, stability and binding specificity and affinity of feline CD80, CD86, CD28 or CTLA-4 are especially useful.

Guimeric molecules of CD80. Feline CD86, CD28 or CTLA-4 The present invention encompasses the production of chimeric molecules prepared from feline CD80, CD86, CD28 and feline CTLA-4 fragments in any combination. For example, by introducing the binding site of CTLA-4 in place of the CD-28 binding site, to increase the binding affinity of CD28 while maintaining reinforcement of the immune response. In one embodiment, the binding sites of CD80 or CD86 in CTLA-4 and CD28 were exchanged such that a binding region in CD28 was replaced by a binding region of CTLA-4. The effect of the chimeric CD28 molecule with a CTLA-4 binding region is to increase the affinity of CD28 for CD80 or CD86 and increase the magnitude of the increase in the immune response. In an alternative embodiment, the chimeric molecules of CD80 and CD28 or of CD86 and CD28 or fragments thereof, bound to the membrane and improved the immunoreforming capabilities of those molecules. In an alternative embodiment, the chimeric molecules of CD80 and CTLA-4 or of CD86 and CTLA-4 or, fragments thereof, bound to the membrane and improved the immunosuppressive capabilities of these molecules. In an alternative embodiment, the chimeric molecules of CD80 and CTLA-4 or of CD86 and CTLA-4 or, fragments thereof, bound to the membrane and redirected the immune response to obtain the desired effect. In an alternative embodiment, feline CD80, CD86, CD28 or CTLA-4 is a fusion protein with another polypeptide. The polypeptide includes, but is not limited to, an immunoglobulin, an antigen, a tumor antigen, a cell surface receptor or a cell surface ligand.

Antibody CD80, CD86, CD28 or CTLA-4 Antibodies The present invention encompasses antibodies that are specific for feline CD80, CD86, CD28 or CTLA-4 polypeptides, identified as described above. The antibodies are polyclonal or monoclonal and discriminate against feline CD80, CD86, CD28 or CTLA-4 of the different species, identify functional domains and the like. These antibodies were conveniently prepared using the methods and compositions disclosed in Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, 1988, as well as with immunological and hybridoma technologies, known to those skilled in the art. When natural or synthetic peptides derived from CD80, CD86, CD28 or feline CTLA-4 were used to induce a specific immune response of feline CD80, CD86, CD28 or CTLA-4, the peptides were conveniently coupled to a suitable vehicle, such as KLH and were administered in a suitable adjuvant, such as Freund's. Preferably, the selected peptides are coupled to a vehicle with a lysine core practically in accordance with the methods of Tan (1988) Proc. Na ti. Acad. Sci. USA, 85.: 5409-5413. The resulting antibodies, especially the internal image anti-idiotypic antibodies, were also prepared using the known methods. In one embodiment, purified feline CD80, CD86, CD28 or CTLA-4 were used to immunize mice, after which the spleen was removed and the splenocytes were used to form cell hybrids with myeloma cells to obtain cell clones. that secrete antibodies, in accordance with techniques that are standard in the field. The resulting monoclonal antibodies secreted by these cells were screened using assays in vi tro of the following activities: binding to feline CD80, CD86, CD28 or CTLA-4, inhibition of binding activity with CD80, CD86, CD28 receptor or CTLA-4 and inhibition of the stimulatory activity of the T cells of CD80, CD86, CD28 or CTLA-4.

Antibelino CD80, CD86 antifelino, CD28 antifelino or CTLA-4 antifelino antibodies were used to identify and quantify feline CD80, CD86, CD28 or CTLA-4, using immunoassays such as ELISA, RIA and the like. Antibelin CD80, CD86 antifelino, CD28 antifelino or CTLA-4 antifelino antibodies were also used to immunoassay feline CD80 or feline CD86 or feline CD28 or feline CTLA-4 extracts. In addition, these antibodies can be used to identify, isolate and purify feline CD80, CD86, CD28 or CTLA-4 from different sources and carry out subcellular and histochemical localization studies.

Applications Feline ligand CD80 (B7-1), feline ligand CD86 (B7-2), feline CD28 receptor or feline CTLA-4 (CD152) receptor produced in accordance with the present invention can be used in beneficial form as a vaccine to avoid infectious disease or to promote development in feline homologous or heterologous species. For example, the co-expression of CD80 or CD86 with co-stimulatory molecules CD28 or CTLA-4, in any combination, and an antigen or tumor antigens from a pathogenic organism. The co-expression of feline CD80 or CD86 with a feline CTLA-4 receptor has the ability to inhibit the activation of T lymphocytes and suppress the immune response. A specific example would be to co-express CD80 or CD86, with immunogens derived from FIV, FeLV or FIP in a viral vector or in a DNA expression vector, which, when administered as a vaccine, would activate, increase or regulate proliferation of CD4 + and CD8 + T lymphocytes and would induce immunoregulatory cytokines, such as IL-2, IFN-g, IL-12, TNFa, IL-6 and the like. Another specific example would be to express CD80, CD86, CD28 or CTLA-4 in a viral vector or in a DNA expression vector, which, when administered as a therapeutic agent, would regulate or re-direct the immune response. The increase in immunity by means of the interaction of feline CD80 or CD86 with CD28 or CTLA-4 or the inhibition of the immune response by means of the interaction of feline CD80 or CD86 with CTLA-4, takes advantage of the advantage of the natural process of regulation instead of adding strange substances that could have multiple effects, even harmful to health in a global or long term. The CD80, CD86, CD28 or CTLA-4 molecules are administered with other recombinant molecules, such as those encoding antigens that are desirable for the induction of immunity. The CD80, CD86, CD28 and / or feline CTLA-4 gene is inserted into an expression vector and is infected or transfected in a target cell and expresses the gene product within the target cell, so that it is anchored in the membrane of plasma of the target cell or of the cell presenting the antigen or secreted on the outside of the target cell or of the antigen presenting cell. An expression vector, such as a plasmid, Semliki Forest virus, a smallpox virus or a herpes virus, transfers the gene to the antigen presenting cell. The CD80, CD86, CD28 and / or feline CTLA-4 gene or fragments of the genes in any combination are inserted into a DNA or RNA expression vector and injected into a felid and express the gene product in the felid as a "naked" DNA / RNA or as a genetic vaccine. The co-expression of the immunogen and the CD80, CD86, CD28 and / or CTLA-4 within a white cell or a feline, contributes to the activation, to the increase in the activation or to the regulation of the T lymphocytes, of the lymphocytes B and other cells. Alternatively, the expressed protein could be administered after expression in a prokaryotic or eukaryotic system, such as a plasmid, a Semliki Forest virus, a smallpox virus or a herpes virus or other viral or bacterial vector. The CD80, CD86, CD28 or feline CTLA-4 proteins normally function anchored in the cell membrane as accessory molecules to the plasma membrane although they can occur in other forms, particularly without membrane anchors. In one embodiment, feline CD80 and feline CD86 are soluble, lack a transmembrane domain or a hydrophobic region and interact with co-stimulatory molecules CD28 or CTLA-4, either in membrane bound form or in soluble form. In an alternative embodiment, feline CD80 or feline CD86 are membrane bound and co-stimulatory molecules CD28 or CTLA-4 are in soluble form, lack transmembrane domain or hydrophobic region. Soluble CD28 or CTLA-4, preferably in dimeric form, are useful for treating the disease related to T-cell mediated immunosuppression in cats. Soluble CD28 or CTLA-4 prevent rejection of transplanted tissue and can be used to treat autoimmune disease. Specifically, soluble CD28 or CTLA-4 are useful to prevent grafting against host disease in a bone marrow transplant. Soluble CD28 or CTLA-4 prevent binding of a cell containing CD80 or feline CD86 bound to the membrane. In another embodiment, the feline CTLA-4 is fused with an immunoglobulin (Ig). The CTLA-4 fusion is useful for suppressing an immune response or for treating an autoimmune disease. Autoimmune disease includes, but is not limited to, arthritis, psoriasis, rejection of an organ transplant, graft disease against the host. In one embodiment, the CD80 and / or proteins Feline CD86 expressed either in bound or soluble form would be used for treatment in the reduction or abrogation of feline tumors. Especially, feline CD80 and / or CD86 proteins would be expressed from a viral vector or from naked DNA by means of direct tumor injection or would be administered systemically in combination with or without co-vectorized feline tumor-associated antigens. Sequence-conserving and conservative variants of the DNA function and feline CD80, CD86, CD28 or CTLA-4 polypeptides or a feline CD80, CD86, CD28 or CTLA-4 bioactive fragment or subfragment are fused in the frame with another sequence, such as a cytokine, interleukin, interferon, colony stimulating factor, antigen of a pathogenic microorganism, antibody or purification sequence, such as a his-tag or an indicator gene, such as lacZ from E. coli, E. coli or a green fluorescent protein.

Vaccines The present invention encompasses methods and a composition for increasing the efficacy of an immune response in feline species. In this embodiment, feline CD80, CD86, CD28 or CTLA-4 are used in conjunction with an immunogen for which an immune response is desired. For example, in feline vaccines containing pathogen immunogens, such as feline immunodeficiency virus and feline leukemia virus and other pathogens, such as feline parvovirus, feline leptovirus and feline coronavirus, it is desirable to include the feline CD80, CD86, CD28 or CTLA-4 vaccine to regulate the magnitude and quality of the immune response. To this end, feline CD80, CD86, CD28 or CTLA-4 purified from native or recombinant sources, as described above, are included in the vaccine formulation at a concentration ranging from about 0.01 to 100.0 mg per vaccine per cat. Alternatively, a recombinant vector expressing feline CD80, CD86, CD28 and / or CTLA-4 and an immunogen from a feline pathogen are included in the vaccine formulation at a concentration ranging from 0.01 to 100.0 mg per vaccine per cat, preferably in a vaccine formulation in a concentration ranging from about 0.25 mg / kg / day to about 25 mg / kg / day. Feline CD80, CD86, CD28 or CTLA-4 is administered together with a live (ie, replicating) viral vaccine or a non-replicating vaccine. Non-limiting examples of replicating vaccines are those that comprise native or recombinant viruses or bacteria, such as the modified feline herpes virus or the modified raccoon pox virus. Non-limiting examples of live viral vaccines with limited or no replication in a feline host, except expression of foreign DNA (such as CD80, CD86, CD28 or feline CTLA-4 or an immunogen of a feline pathogen) in a host cell , are the modified poultrypox virus, the modified pigpox virus or the Semliki Forest virus. Non-limiting examples of non-replicating vaccines are those which are comprised of killed or inactivated viruses or other microorganisms or crude or purified antigens, derived from native, recombinant or synthetic sources, such as, for example, feline leukemia virus vaccines. Commercial sources of feline vaccines are known to those skilled in the art (Compendium of Veterinary Pharmaceuticals, 1997) and are used in combination with the present invention for a more effective vaccine. A vaccine for inducing and regulating an immune response in a feline before an immunogen is comprised of an immunogen and an effective amount of feline CD80 or feline CD86 with or without feline CD28 or feline CTLA-4 for the increase in immune response or feline CD80 or feline CD86 with CTLA-4 for suppression of the immune response. The immunogen is selected from the group consisting, enunciatively, of feline pathogens, such as feline immunodeficiency virus, feline leukemia virus, feline infectious peritonitis virus, feline panleukopenia virus (parvo), feline calicivirus, feline reovirus type 3, feline rotavirus, feline coronavirus (infectious peritonitis), rabies virus, feline syncytial virus, feline sarcoma virus, feline herpes virus (rhinotracheitis virus), feline Borna disease virus, Chlamydia, Toxoplasmosis gondii, feline parasites , Dirofilaria immitis, fleas, bacterial pathogens and the like. Growth regulation or regulation of the activation of a cell type, such as a T lymphocyte, indicates that the regulatory response either stimulates or suppresses cell growth. The regulation of an immune response in a felid indicates that the immune response is either stimulated or suppressed to treat the disease or the infectious agent in the felid. In a preferred embodiment, the genes coding for CD80 and CD28, CD80 and CTLA-4, CD86 and CD28 or CD86 and feline CTLA-4, in combination with genes from an immunogen from feline pathogen, are incorporated into a single vector recombinant virus and then formulated in a live vaccine. Feline CD80, CD86, CD28 or CTLA-4 genes, alone or in combination with feline immunogenic genes are incorporated into the recombinant virus, so that the expression of these genes is controlled by an appropriate promoter. The administration of the vaccine results in the expression of CD80 or CD86 bioactive ligands of feline and in CD28 or CTLA-4 receptors and in the expression of feline immunogens, in the same cell, thus providing primary and secondary co-stimulatory signals that are necessary to reinforce the desired immune response. This modality provides an early and localized immune response to the feline immunogen and a feline disease vaccine with improved efficacy. In another embodiment, the genes encoding feline CD80, CD86, CD28 or CTLA-4, alone or in combination, are incorporated into a recombinant viral vector and co-administered in a vaccine with a second recombinant viral vector, which encodes for genes of feline immunogens, thereby providing the desired responses in the same cell or in cells in close proximity, to achieve the desired increase in immune response and a feline disease vaccine with improved efficacy. The following are examples of recombinant viral vectors for use in the expression of feline CD80, CD86, CD28 and CTLA-4 and for use in a vaccine to produce an improved protective immune response upon inoculation of a pathogenic microorganism: 1. The expression of CD80, CD86, CD28 and feline CTLA-4 alone or in any combination thereof, in whole or in part, in a recombinant swinepox virus (inserted in a non-essential insertion site). For non-replicating vaccination purposes, used alone or in combination with another vaccine or therapeutic agent (recombinant, live or killed) for use in felids but not limited to them. 2. The expression of feline CD80, CD86, CD28 and CTLA-4, alone or in any combination thereof, partially or totally, in a recombinant feline herpes virus (inserted in the gE site of the FHV or any insertion site Not essensial) . For replicating vaccination purposes, used alone or in combination with a vaccine or therapeutic agent (recombinant, live or killed) for use in felids but not limited to them. 3. The expression of feline CD80, CD86, CD28 and CTLA-4, alone or in any combination thereof, in whole or in part, in a recombinant raccoon pox virus (inserted in a non-essential insertion site). For purposes of replicating vaccination, used alone or in combination with another vaccine or therapeutic agent (recombinant, live or killed) for use in felids but not limited to them. 4. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in any combination, in whole or in part, in a recombinant swinepox virus containing gag-protease and / or FIV envelope. 5. Expression of feline CD80, CD86, CD28 and CTLA-4, alone or in any combination, in whole or in part, in a recombinant feline herpes virus, which contains gag-protease and / or IFV envelope genes. 6. Expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, in whole or in part, in a recombinant raccoon pox virus containing gag-protease and / or FIV envelope genes. 7. The expression of CD80, CD86, CD28 and Feline CTLA-4 alone or in any combination, in a recombinant smallpox virus containing genes for the gag-protease and / or envelope of FeLV. 8. The expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, in whole or in part, in a recombinant feline herpes virus containing genes for the gag-protease and / or envelope of FeLV. 9. The expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, in whole or in part, in a recombinant raccoon pox virus containing genes for the gag-protease and / or envelope of FeLV. 10. Expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, in whole or in part, in a recombinant swinepox virus containing genes for gag-protease and / or envelope of FeLV and. gag-protease and / or VIF envelope or any combination thereof. 11. The expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, in whole or in part, in a recombinant feline herpes virus containing gag-protease and / or envelope genes of FeLV y_ gag-protease and / or VIF envelope or any combination thereof. 12. Expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, wholly or partially, in a recombinant raccoon pox virus containing gag-protease and / or envelope genes of FeLV and gag protease and / or VIF shell or any combination thereof. 13. The expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, wholly or partially, in pig pox virus or raccoon pox virus or any other expression system including, but not limited to, , E. col i, Semliki forest virus and baculovirus, in order to generate unpurified or purified polypeptide. Uses include, but are not limited to, the generation of polyclonal or monoclonal antibodies and the generation of reagents for the development of the functional test. 14. The expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination in an attenuated viral vector of FIV or FeLV. In one embodiment, the viral vector of FIV or FeLV is attenuated by gene deletion. 15. Expression of feline CD80, CD86, CD28 and CTLA-4 alone or in any combination, in whole or in part, in an expression vector containing genes for feline immunogens for the purpose of administration as a genetic vaccine or vaccine of naked DNA. Vectors include, but are not limited to: pTarget (Promega, Madison, Wl), pcDNA (Invitrogen, Carlsbad, CA). (Donnelly JJ, et al., 1997, Hassett and Whitton, 1996.) 16. Genes or gene fragments of CD80, CD86, CD28 and CTLA-4, alone or in any combination, in whole or in part, can be inserted or transfected into the chromosomes of a feline or another mammal. The integration of these genes or fragments of these genes can be achieved with a retroviral vector and can be used as a form of gene therapy. The present invention provides methods and compositions for improving the disease resistance of feline species for medical and / or commercial purposes. In this modality, feline CD80, CD86, CD28 or CTLA-4, expressed alone or in any combination, in whole or in part and in combinations with or without genes encoding feline immunogens, are administered to felids using any appropriate mode of administration. For the promotion of development or disease resistance, feline CD80, CD86, CD28 or CTLA-4, expressed alone or in any combination, are administered in a formulation with a concentration ranging in amounts from about 0.01 to 100.0 mg per vaccine per cat, preferably in a formulation at a concentration ranging from about 0.25 mg / kg / day to about 25 mg / kg / day. For the promotion of development or resistance to disease, a recombinant viral vector expressing feline CD80, CD86, CD28 or CTLA-4 is administered, alone or in any combination, in a formulation with a concentration ranging in amount from about 0.01 to 100.0 mg per vaccine per cat, preferably in a formulation with a concentration ranging from about 0.25 mg / kg / day to about 25 mg / kg / day. It will be understood that the required amount of feline CD80, CD86, CD28 or CTLA-4 can be determined by routine experimentation well known in the art, such as, for example, establishing a matrix of dosages and frequencies and comparing a group of units or subjects experimental in each point of the matrix. In accordance with the present invention, feline CD80, CD86, CD28 or CTLA-4, native or recombinant, is formulated with a physiologically acceptable carrier, such as, for example, phosphate buffered saline or deionized water. The formulation may also contain excipients, which include lubricants, plasticizers, absorption enhancers, bactericides and the like, which are well known in the art. The feline CD80, CD86, CD28 or CTLA-4 polypeptide of the invention is administered by any effective means, including, but not limited to, the intravenous, subcutaneous, intramuscular, transmuscular, topical or oral routes. For subcutaneous administration, the dosage form consists of, for example, feline CD80, CD86, CD28 or CTLA-4 in sterile physiological saline. For oral or respiratory administration, feline CD80, CD86, CD28 or CTLA-4, with or without excipients, is microencapsulated or macroencapsulated in, for example, liposomes and microspheres. Dermal patches (or other prolonged-release dosage forms) are also used.

MATERIALS AND METHODS PREPARATION OF MATERIAL SAMPLES OF VIRUS OF THE VIRUS OF MAPACHE. For the preparation of the raccoonpox virus material samples and the raccoonpox virus genomic DNA, the raccoonpox virus isolate (RPV) ATCC VR-838 was used. Another available RPV isolate is V71-I-85A, from the Centers for Disease Control (CDC), Atlanta, GA. Raccoon pox virus (RPV) virus samples were prepared by infecting VERO cells, CRFK cells or MDCK cells with a multiplicity of infection of 0.01 PFU / cell in Dulbecco's Modified Eagle's medium containing 2 mM glutamine, 100 units / ml of penicillin, 100 units / ml of streptomycin (these components were obtained from Sigma or from an equivalent provider and will be referred to hereinafter as the negative medium DMEM). Prior to infection, the cell monolayers were washed once with negative DMEM medium to remove traces of fetal bovine serum. To the RPV contained in the initial inoculum (0.5 ml per 10 cm plate, 10 ml per flask T225 cm) then it was allowed to absorb on the cell monolayer for two hours, redistributing every half hour. After this period, the original inoculum was brought to the recommended volume with the addition of complete DMEM medium (the DMEM negative medium plus 5% fetal bovine serum). Plates were incubated at 37 ° C in 5% C02 until the cytopathic effect was terminated. The medium and cells were harvested and frozen in a conical tube with a 50 ml screw cap at -70 ° C. After thawing at 37 ° C, aliquots were taken from the virus material and placed in 1.0 ml vials and re-frozen at -70 ° C. The titers were normally about 106 PFU / ml.

PREPARATION OF MATERIAL SAMPLES OF PORK SMELL VIRUS. Samples of swinepox virus (SPV) were prepared by infecting pig kidney embryonic cells (EMSK), ESK-4 cells, PK-15 cells or Vero cells with a multiplicity of infection of 0.01. UFP in a 1: 1 mixture of Iscove Modified Dulbecco's Medium (IMDM) and RPMI 1640 medium containing 2 mM glutamine, 100 units / ml of penicillin, 100 units / ml of streptomycin (these components were obtained from Sigma or from a equivalent supplier and, henceforth, will be referred to as a negative EMSK medium). Prior to infection, the cell monolayers were washed once with EMSK negative medium to remove traces of fetal bovine serum. The SPV contained in the initial inoculum (0.5 ml per 10 cm dish, 10 ml per flask T175 cm) was then allowed to be absorbed on the cell monolayer for two hours, redistributing every half hour. After this period, the original inoculum was brought to the recommended volume with the addition of complete EMSK medium (EMSK negative medium plus 5% fetal bovine serum). Plates were incubated at 37 ° C in 5% C02 until the cytopathic effect was terminated. The medium and cells were harvested and frozen in a conical tube with a 50 ml screw cap at -70 ° C. After thawing at 37 ° C, aliquots were taken from the virus material and placed in 1.0 ml vials and re-frozen at -70 ° C. The titers were normally about 106 PFU / ml.

PREPARATION OF RPV OR SPV DNA. For isolation of raccoon pox virus virus or pig pox virus, a confluent monolayer of VERO cells (for RPV) or EMSK cells (for SPV) was infected in a T225 cm2 flask with a multiplicity of 0.1 with raccoon pox virus (ATCC VR-838) was incubated for 3 to 5 days until all cells showed 100% cytopathic effect. The infected cells were then harvested by scraping the cells and depositing them in the medium and subsequently centrifuged at 3000 rpm for 5 minutes in a clinical centrifuge. The medium was decanted and the cell pellet was gently resuspended in 1.0 ml of Phosphate Buffered Saline (PBS: 1.5g of Na2HP04, 0.2g of KH2P04, 0.8g of NaCl and 0.2g of KCl per liter of H20) (by T175) and subjected to two successive freeze-thaw cycles (-70 ° C to 37 ° C). In the last thawing, the cells (on ice) were sonicated twice for 30 seconds each with 45 seconds of cooling time between them. The cell debris was then removed by centrifugation (Sorvall super-speed centrifuge RC-5B) at 3000 rpm for 5 minutes in an HB4 rotor at 4 ° C. The virions from the RPV, present in the supernatant, were then agglomerated into pellets by centrifugation at 15,000 rpm for 20 minutes at 4 ° C in a SS34 rotor (Sorvall) and resuspended in 10 mM Tris (pH 7.5). This fraction was then stratified in a gradient of 36% sucrose (w / v in 10 mM Tris, pH 7.5) and centrifuged (Beckman L8-70M ultracentrifuge) at 18,000 rpm for 60 minutes in a SW41 rotor (Beckman) at 4 ° C. The virion pellet was resuspended in 1.0 ml of 10 mM Tris, pH 7.5, and subjected to sonication on ice for 30 seconds. This fraction was stratified in a continuous gradient of sucrose from 20% to 50% and centrifuged at 16,000 rpm for 60 minutes in a SW41 rotor at 4 ° C. The virion band of the RPV located approximately three quarters down the gradient was harvested, diluted with 20% sucrose and pelleted in granules by centrifugation at 18,000 rpm for 60 minutes in a SW41 rotor at 4 ° C. Then the resulting bead was washed once with 10 mM Tris, pH 7.5, to remove traces of sucrose and, finally, resuspended in 10 mM Tris, pH 7.5. The RPV DNA was then extracted from purified virions by lysis (4 hours at 60 ° C) induced by the addition of EDTA, SDS and proteinase K to final concentrations of 20 mM, 0.5% and 0.5 mg / ml, respectively. After digestion, three extractions were made with phenol: chloroform (1: 1) and the sample was precipitated by the addition of two volumes of absolute ethanol and incubation at -20 ° C for 30 minutes. The sample was then centrifuged in an Eppendorf minicentrifuge for 5 minutes at full speed. The supernatant was decanted and the granule was air dried and rehydrated in 0.01 M Tris, pH 7.5, 1 mM EDTA at 4 ° C.

PREPARATION OF FHV VIRUS MATERIAL SAMPLES. The S-FHV-000 was obtained from the ATCC (ATCC No. 636) and the S-FHV-001 was obtained from NVSL (SGE strain of the NVSL Inoculation Virus, Lot KS). Samples of FHV virus material were prepared by infecting Crandell feline kidney cells (CRFK) with a multiplicity of infection of 1.0 PFU in Dulbecco's Modified Eagle's Medium (DMEM) containing 2 mM glutamine, 100 units / ml penicillin. , 100 units / ml of streptomycin (these components were obtained from Irvine Scientific or from an equivalent supplier and, henceforth, will be referred to as complete DME medium) plus 5% fetal bovine serum. After the cytopathic effect was finished, the medium and cells were harvested, aliquots were taken and frozen at -70 ° C. Titers were from approximately 1 x 107 to 1 x 108 PFU / ml.

PREPARATION OF THE DNA OF THE VIRUS OF HERPES. A confluent monolayer of CRFK cells in a 25 cm2 flask or a 60 mm petri dish was infected with 100 ml of the virus sample. After incubating overnight or when the cells showed 100% cytopathic effect, the cells were scraped and placed in the medium. The cells and medium were centrifuged at 3000 rpm for 5 minutes in a clinical centrifuge. The medium was decanted and the cell pellet was gently resuspended in 0.5 ml of solution containing 0.5% NONIDET P-40 (octylphenol condensed ethylene oxide containing an average of 9 moles of ethylene oxide per molecule) (NP-). 40, purchased from Sigma Chemical Co., St. Louis, MO.). The sample was incubated at room temperature for 10 minutes. Ten ml of an RNase A stock solution (Sigma Chemical Co., St. Louis, MO.) Was added (the material was 10 mg / ml, boiled for 10 minutes to inactivate the DNase). The sample was centrifuged in granule nuclei. The DNA granule was removed with a Pasteur pipette or with a wooden wand and discarded. The supernatant fluid was decanted into a 1.5 ml Eppendorf tube containing 25 ml of 20% sodium dodecyl sulfate (Sigma) and 25 ml of K-proteinase (10 mg / ml, Boehringer Mannheim Biochemicals, Indianapolis, IN). The sample was mixed and incubated at 37 ° C for 30 to 60 minutes. An equal volume of phenol saturated with water was added and the sample blended briefly. The sample was centrifuged in an Eppendorf minicentrifuge for 5 minutes at full speed. The upper aqueous phase was withdrawn into a new Eppendorf tube and two volumes of absolute ethanol were added and the tube was set at -20 ° C for 30 minutes to precipitate the nucleic acid. The sample was centrifuged in an Eppendorf minicentrifuge for 5 minutes. The supernatant was decanted and the granule was air dried and rehydrated in ~ 16 ml of H20. For the preparation of larger amounts of DNA, the procedure was started to scale with rolling bottles or 175 cm2 flasks of CRFK cells. The DNA was stored in 0.01 M Tris, pH 7.5, 1 mM EDTA at 4 ° C.

TRANSFECTION OF DNA FOR THE GENERATION OF RECOMBINANT VIRUS. The method is based on the calcium phosphate procedure of Graham and Van der eb [25] with the modifications that follow. Virus and / or plasmid DNA was diluted to 298 ml in 0.01 M Tris, pH 7.5, lMM EDTA. Forty ml of 2M CaCl 2 was added followed by an equal volume of buffered saline solution of 2X HEPES (lOg of N-2-hydroxyethyl piperazine-N'-2-ethanesulfonic acid (HEPES), 16g of NaCl, 0.74g of KCl, 0.25. g of Na2HP04-2H20, 2g of dextrose per liter of H20 and buffered with NaOH at a pH of 7.4). The mixture was then incubated on ice for 10 minutes and then added dropwise to a 80% confluent monolayer of CRFK cells growing in a 50 mm petri dish in 5 ml of medium (DME plus fetal bovine serum at 5%). %). The cells were incubated 4 hours at 37 ° C in a humidified incubator containing 5% C02. The medium was aspirated onto the plates and the cells were treated with 20% glycerol in 1XPBS (1.15g Na2HP04, 0.2g of KH2P04, 0.8g of NaCl, 0.2g of Kcl per liter of H20) for one minute. Cells were washed three times with 5 ml of 1XPBS and fed with 5 ml of medium (DME plus 5% fetal bovine serum). The cells were incubated at 37 ° C in the same way as the previous one for 3 to 7 days until the cytopathic effect of the virus was 50 to 100%. The virus was harvested as described above for the preparation of the virus samples. This material will be referred to as a transfection material and subsequently screened for the recombinant virus by the SCREENING FOR RECOMBINANT VIRUSES OF HERPES EXPRESSING ENZYMATIC MARKERS GENES.

PREPARATION OF LISTS OF INFECTED CELLS. For the preparation of the cell lysate, a serum-free medium was used. A confluent monolayer of cells (VERO, CRFK or MDCK) in a 25 cm2 flask or in a 60 mm petri dish was infected with 10 μl of the virus sample. After the cytopathic effect was over, the medium and cells were harvested and the cells were agglomerated in pellets at 3000 rpm for 5 minutes in a clinical centrifuge. The cell pellet was resuspended in 250 μl of disruption buffer (2% sodium dodecyl sulfate, 2% β-mercaptoethanol). The samples were sonicated for 30 seconds on ice and stored at -20 ° C.

WESTERN TRANSFER PROCEDURE. The lysate samples and protein standards were run on a polyacrylamide gel, according to the Laemnli procedure. After gel electrophoresis, the proteins were transferred and processed in accordance with Sambrook et al. (1989). The primary antibody was diluted 1: 100 with 5% dehydrated milk without fat in sodium tris-chloride and sodium azide (TSA: 6.61g of Tris-HCl, 0.97g of Tris-base, 9.0g of NaCl and 2.Og of Sodium Azide per liter of H20). The secondary antibody was conjugated with alkaline phosphatase and diluted 1: 1000 with TSA.

TECHNIQUES OF MOLECULAR BIOLOGY. Techniques for handling bacteria and DNA, including procedures such as restriction endonuclease digestion, gel electrophoresis, DNA extraction from gels, ligation, phosphorylation with kinase, phosphatase treatment, development of bacterial cultures, Transformation of bacteria with DNA and other methods of molecular biology are described by Sambrook et al. (1989) and Current Protocols in Molecular Biology (1992). Except where indicated, they were used with a smaller variation.

SEQUENCING OF DNA DNA sequencing was performed by dideoxy sequencing reactions with fluorescent labeling using the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit with Amplitaq DNA polymerase, FS (Perkin-Elmer, per manufacturer's instructions) and electrophoresed in a DNA sequencer. Perkin-Elmer automated DNA / Applied Biosystems, Model 373A in accordance with the manufacturer's instructions. Reactions were made using both the dGTP mixtures and the dITP mixtures to clarify the compression areas. Alternatively, the compressed areas were resolved on formamide gels. The templates were subclones of double-stranded plasmid or M13 single-stranded subclones and the primers were prepared either for the vector just outside the insert to be sequenced or for the previously obtained sequence. The obtained sequence was assembled and compared using the DNAStar software.

CLONING WITH THE REACTION IN CHAIN BY THE POLYMERASE. The polymerase chain reaction (PCR) was used to introduce convenient restriction sites for the manipulation of several DNAs. The procedures used are described by Innis, et al. (1990). In general, the amplified fragments were smaller than 500 base pairs and the critical regions of the amplified fragments were confirmed by DNA sequencing. The primers used in each case are detailed in the descriptions of the construction of the vectors by homology, below.

RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION OF RECOMBINANT RPV, SPV or FHV. This method depends on the homologous recombination between the DNA of the raccoon pox virus and the plasmid homology vector DNA that occurs in tissue culture cells that contain both the raccoon pox virus DNA and the vector of homology of the transfected plasmid. For homologous recombination to occur, monolayers of cells (CRFK, MDCK or VERO) were infected with S-RPV-000 (ATCC VR-838) or with S-SPV-001 or with S-FHV-001 with a multiplicity of infection of 0.01 PFU / cell to introduce the replicating RPV in the cells (ie, DNA synthesis). The plasmid homology vector DNA was then transfected into these cells, in accordance with the INFECTION-TRANSFECTION PROCEDURE. The construction of the homology vectors used in this procedure are described below.

INFECTION-TRANSFECTION PROCEDURE. Plates of 6 cm of cells (CRFK, MDCK or VERO) approximately 80% confluent, were infected with S-RPV-000 or with S-SPV-001 or with S-FHV-001 with a multiplicity of infection of 0.01 PFU / cell in DMEM negative medium and incubated at 37 ° C in a humidified 5% C02 environment for 2 to 3 hours. The transfection procedure used is essentially recommended for the Lipfectin ™ Reagent (BRL). Briefly, for each 6 cm plate, 15 μg of plasmid DNA was diluted to 100 μl with H20. Separately, 50 micrograms of Lipofectin Reagent was diluted to 100 μl with H20. The 100 μl of the diluted Lipofectin Reagent was then added dropwise to the diluted plasmid DNA, contained in a 5 ml polystyrene tube with pressure cap and mixed gently. The mixture was then incubated for 15 to 20 minutes at room temperature. During this time, the virus inoculum was removed from the 6 cm plates and the monolayers of cells were washed once with negative DMEM medium: Then 3 ml of the negative DMEM medium was added to the mixture of plasmid DNA / lipofectin and the content was extracted with pipette in the cell monolayer. The cells were incubated overnight (approximately 16 hours) at 37 ° C in a humidified 5% CO 2 environment. The next day, the 3 ml of the negative DMEM medium was removed and replaced with 5 ml of the complete DMEM medium. The cells were incubated at 37 ° C in 5% C02 for 3 to 5 days until the cytopathic effect of the virus was 80 to 100%. The virus was harvested as described above for the preparation of viral materials. This material is referred to as a transfection material and subsequently screened for the recombinant virus by the BLUOGAL SCREENING FOR THE RECOMBINANT VIRUS OF MAPACHE VIRUS.

SCREENING FOR RECOMBINANT RPV OR SPV OR FHV EXPRESSING β-galactosidase (BLUOGAL VALUATIONS AND CPRG) or β-glucuronidase (VALUATION X-GLUC). When the β-galactosidase (lacZ) marker gene from E. coli was incorporated into a recombinant virus, the plates containing the recombinants were visualized by one of two simple methods. In the first method, the chemical compound Bluogal ™ (Life Sciences Technology, Bethesda, MD) was incorporated (200 μg / ml) into the upper agarose layer during plaque titration and plates expressing active β-galactosidase turned blue. The blue plates were then seeded on fresh cells (MDCK, CRFK or VERO) and purified by additional isolation of the blue plate. In the second method, CPRG (Boehringer Mannheim) (400 μg / ml) was incorporated into the upper agarose layer during plaque titration and plates expressing active β-galactosidase turned red. The red plates were then harvested on fresh cells (MDCK, CRFK or VERO) and purified by additional isolation of the red plate. In both cases, the viruses were usually purified with three to four rounds of plaque purification. When the β-glucuronidase marker (uidA) gene from E. coli was incorporated into a recombinant virus, the plates containing the recombinants were visualized using the chromogenic substrate, X-beta-D-gluUA CHX (X-GLUC; -bromo-4-chloro-3-indoxyl-beta-D-glucuronic acid, cyclohexylammonium salt, Biotynth AG, Switzerland) during the plate titration, in the upper agarose layer were incorporated (200 μg / ml) and the plates that Express active ß-glucuronidase turned blue. The blue plates were then seeded in fresh cells (MDCK, CRFK or VERO) and purified by additional isolation of the blue plate.

SCREENING FOR THE EXPRESSION OF THE STRANGE GENE IN RECOMBINANT RPV, USING BLACK PLATE EVALUATIONS. To analyze the expression of the foreign antigens expressed by recombinant raccoon pox virus, the cell monolayers (MDCK, CRFK or VERO) were infected with RPV or recombinant SPV or FHV., they were coated with an agarose nutrient medium and incubated for 3 to 5 days at 37 ° C for the development of the plaque to occur. The upper agarose layer was then removed from the box, the cells were fixed with 100% methanol for 10 minutes at room temperature and the cells were air-dried. The fixation of the cells results in the detection of cytoplasmic antigen, as well as in the detection of surface antigen, while the expression of the specific surface antigen can be detected using unfixed cells. The primary antibody was then diluted to the appropriate dilution with blotto IX (dehydrated milk without 5% fat in Tris-sodium chloride and sodium azide (TSA: 6.61g Tris-HCl, 0.97G Tris-base, 9. Og of NaCl and 2. Og of Sodium Azide per liter of H20) and incubated in the cell monolayer for 2 hours at room temperature The unbound antibody was then removed by washing the cells three times with TS buffer at room temperature. The secondary antibody, an alkaline-phosphatase conjugate, was diluted 1: 1000 with blotto IX and incubated with the cells for 2 hours at room temperature.The unbound secondary antibody was removed by washing the cells three times with TS buffer (6.61g). of Tris-HCl, 0.97 g of Tris-base, 9. Og of NaCl per liter of H0) at room temperature The cells were then incubated for 15 to 30 minutes at room temperature with freshly prepared substrate solution (100 mM Tris HCl , pH 9.5, 100 mM NaCl, 5 mM MgCl 2, 0.3 m g / ml of Tetrazolium Blue Nitro and 0.15 mg / ml of 5-bromo-4-chloro-3 -indoyl phosphatase). The plates express the black spot of the correct antigen. To stop the color development reaction, a fixing solution was used (20 mM Tris-HCl, pH 2.9 and 1 mM EDTA).

SCREENING FOR THE EXPRESSION OF CD80 (B7-1) and CD36 (B7-2) FELINES IN SPV, RPV or FHV RECOMBINANT, USING BLACK PLATE EVALUATIONS. To analyze the expression of co-stimulatory CD80 or CD86 molecules, expressed by recombinant viruses of pig pox, raccoon pox or feline herpes in monolayers of cells (MDCK, CRFK, VERO or ESK-4) were infected with RPV recombinant viruses or SPV or FHV expressing CD80 or CD86, superimposed on the nutrient agarose medium and incubated for 3 to 5 days at 37 ° C for the development of the plate to occur: The upper agarose layer was then removed from the box, the cells or were fixed with 100% methanol for 10 minutes at room temperature and the cells were air dried or left unfixed, or left unfixed and treated immediately with PBS IX. Fixation of the cells results in a cytoplasmic antigen detection as well as in a surface antigen detection, while the expression of the specific surface antigen can be detected using unfixed cells. Then a huCTLA-4 / Fc chimera (R & Systems, Minn. MN, cat. # 325-CT) was brought to the appropriate dilution with Blotto IX (5% fat-free dehydrated milk in Tris-sodium chloride (TS : 6.61g of Tris-HCl, 0.97g of Tris-base, 9.Og of NaCl per liter of H20) and incubated in the cell monolayer for 2 hours at room temperature.The unbound chimera was removed by washing the cells three times with TS buffer at room temperature Detection antibody, a monoclonal anti-huIgG1 fc alkaline phosphatase conjugate (Zymed, cat 05-3322) was diluted to the appropriate concentration with Blotto IX and incubated with the cells for 2 hours at room temperature. The unbound detection antibody was then removed by washing the cells three times with TS buffer (6.61g Tris-HCl, 0.97g Tris-base, 9.Og NaCl per liter H20) at room temperature. cells were then incubated for 15 to 30 minutes at room temperature with freshly prepared substrate solution prada (10 mM Tris HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl 2, 0.3 mg / ml Nitro Blue Tetrazolium and 0.15 mg / ml 5-bromo-4-chloro-3 -indoyl phosphatase). The plates express the black spot of CD80 or CD86. To stop the color development reaction, a fixing solution was used (20 mM Tris-HCl pH 2.9 and EDTA ImM).

SCREENING FOR BIOACTIVITY OF INTERFERON GAMMA FELINO, EXPRESSED FROM SPV, RPV or FHV, USING VSV PLATE REDUCTION. The CRFKS or an appropriate feline cell line in 96-well plates was treated with the supernatants of cells infected with recombinant viruses expressing feline IFNgamma and incubated for 6 to 12 hours at 37 ° C. The VSV virus (100-1000 particles / well) was then added to the appropriate wells and incubated for 24 hours or until the cell-only control wells were completely lysed. The cavities were washed 3 times with PBS IX and the monolayers were fixed with 100% methanol and air dried. A solution of 0.05% violet crystal was added to all the cavities, for 10 minutes at room temperature, then air-dried. The presence of purple staining was marked in the cavities. A healthy and intact monolayer of cells absorbed the crystal violet dye. Supernatants with IFN-gamma activity will protect CRFKs against VSV-induced cell lysis and will stain purple.

PROCEDURE FOR THE PURIFICATION OF VIRAL GLUCOPROTEINS TO BE USED AS A DIAGNOSIS. The viral glycoproteins were purified using antibody affinity columns. To produce the monoclonal antibodies, BALB / c female mice of 8 to 10 weeks of age were vaccinated seven times intraperitoneally at intervals of two to four weeks with 107 PFU of raccoon pox virus recombinants. Three weeks after the last vaccination, the mice were injected intraperitoneally with 40 mg of the corresponding viral glycoprotein. The spleens were removed three days after the last dose of antigen. Splenocytes were fused with mouse NS1 / Ag4 plasmacytoma cells by the modified procedure of Oi and Herzenberg. Splenocytes and plasmacytoma cells were agglomerated in granules by centrifugation at 300 x g for 10 minutes. One ml of 50% polyethylene glycol solution was added to the cell pellet. (molecular weight 1300-1600) stirring for one minute. The modified Eagle's Dulbecco's medium (5ml) was added to the cells in three minutes. The cells were agglomerated in pellets by centrifugation at 300 x g for 10 minutes and resuspended in medium with 10% fetal bovine serum and containing 100 mM hypoxanthine 0.4 mM aminopterin and 16 mM thymidine (HAT). Cells (100 ml) were added to the cavities from eight to ten 96-well tissue culture plates containing 100 ml of normal spleen feeder layer cells and incubated at 37 ° C. The cells were fed fresh HAT medium every three or four days. Hybridoma culture supernatants were tested by ELISA TEST in 96-well microtiter plates coated with 100 mg of viral glycoprotein. The supernatants of the reactive hybridomas were further analyzed by black plate titration and Western blotting. The selected hybridomas were cloned twice by limiting dilution. Acetic fluid was produced by intraperitoneal injection of 5 x 10 6 hybridoma cells in BALB / c mice treated with pristane. Cell lysates of the raccoon pox virus recombinants were obtained as described in PREPARATION OF INFECTED CELL LISTS. Cell lysates containing glycoprotein (100 ml) were passed through a 2-ml agarose affinity resin in which 20 mg of glycoprotein monoclonal antibody was immobilized, in accordance with the manufacturer's instructions (AFC Medium, New Brunswick Scientific, Edison, NJ). The column was washed with 100 ml of 0.1% Nonidet P-40 in phosphate buffered saline (PBS) to remove the bound material in non-specific form. The ligated glycoprotein was eluted with 100 mM carbonate buffer, pH 10.6 (40). The purity of the pre- and post-eluted fractions was monitored by reactivity with the monoclonal antibodies of the RPV in an ELISA system.

TRY ELISA. To determine the immune status of the animal after vaccination and inoculation, a standard enzyme linked immunosorbent assay (ELISA) protocol was used. A solution of glycoprotein antigen (100 ml to ng / ml in PBS) was allowed to be absorbed in the microtitre box cavities for 18 hours at 40 ° C. The coated wells were rinsed once with PBS. The cavities were blocked by adding 250 ml of PBS containing 1% BSA (Sigma) and incubated for 1 hour at 37 ° C. The blocked cavities were rinsed once with PBS containing 0.02% Tween 20. To the wells were added 50 ml of test serum (previously diluted 1: 2 in PBS containing 1% BSA) and incubated for 1 hour at 37 ° C. The antiserum was removed and the wells were washed 3 times with PBS containing 0.02% Tween 20. To visualize the cavities containing the antibody against the specific antigen, 50 ml of a solution containing horseradish peroxidase-coupled antibobin IgG (diluted 1: 500 in PBS containing 1% BSA, Kirkegaard and Perry Laboratories, Inc. was added. ) the solution was incubated for 1 hour at 37 ° C, then it was removed and the wells were washed three times with PBS containing 0.02% Tween 20. To each well was added 100 ml of substrate solution (ATBS, Kirkegaard and Perry Laboratories, Inc.) and the color was allowed to develop for 15 minutes. The reaction was terminated by the addition of 0.1M oxalic acid. The color was read at an absorbance of 410nm in an automatic plate reader.

STRATEGY FOR THE CONSTRUCTION OF SYNTHETIC VIRAL VIRAL PROMOTERS. For the recombinant vectors of pig pox, synthetic pox promoters offer several advantages including the ability to control the resistance and the expression time of the foreign gene. Three LP1, EP1 and LP2 promoter cassettes were designed, based on promoters that have been defined in the vaccine virus. It was designed that each cassette contained the DNA sequences defined in the vaccine, flanked by restriction sites that could be used to combine the cassettes in any order or combination.

Initiating methionines were also designed inside each cassette, so that fusions could be made in the frame either at the EcoRI or BamHl sites. Also, at address 31 of the fusion site in the table, a set of translational stop codons was designed in all three reading frames and an early transcriptional termination signal. The DNA encoding each cassette was synthesized in accordance with standard techniques and cloned into the appropriate homology vectors.

Isolation of an initial fragment of CD80 The mRNA was extracted from peripheral blood mononuclear cells (PBMC) stimulated for 16 hours with Con A using the RNA extraction reagent RNAzoIB (Biotexc, Houston, TX). Initially, the cDNA was derived from this RNA by a reverse transcriptase (RT) reaction using dT oligo as the 3 'primer. Briefly, RNA and dT oligo were heated at 75 ° C for 3 minutes to eliminate the secondary structure. RT, DNTP, buffer and distilled water were then added and the mixture was incubated for 1 hour at 42 ° C. After this incubation, the sample was heated at 95 ° C for 5 minutes to inactivate RT. Degenerate primers derived from consensus regions within the published human and murine CD80 sequences (GeneBank, Gaithersburg, MA) were then used for the initial amplification of a fragment of 344 nucleotides (ntd.) Coding for a central region within of the gene constant domain: 5 'primer B7-2 GGC CCG AGT A (CT) A AGA ACC GGA C (SEQ ID NO 56) 3 'primer B7-3 CAG (AT) TT CAG GAT C (CT) T GGG AAA (CT) TG (SEQ ID NO 57) To amplify the product, a polymerase chain reaction protocol was used (PCR) hot start using Taq polymerase. The reaction mixture, which lacks the Taq enzyme, was initially heated at 95 ° C for 5 minutes in a warm start or start step, to avoid the formation of primer dimers. The enzyme was added before the beginning of the temperature cycle. The PCR reaction was then heated at 95 ° C for 30 seconds to melt the double stranded DNA. The reaction was then cooled to 42 ° C for 30 seconds to facilitate reassociation of the degenerate primers. To facilitate the binding of primers that were not 100% homologous, a low annealing temperature was used. The reaction was then heated at 72 ° C for 45 seconds, the optimum temperature for the Taq polymerase to extend to the primer and copy the opposite DNA strand. The temperature cycle was repeated 30 times. After the 30 cycles, a final extension step of 72 ° C was used for 7 minutes to facilitate the extension of any unfinished products. After visualization on 1% agarose gel, the product was ligated overnight at 16 ° C in the Ta cloning vector (Invitrogen, San Diego, CA) for sequencing. Two ml of the ligation reaction was used to transform the competent InvaF 'cells. The transformed bacteria were striated on LB plates (50 mg / ml ampicillin) coated with 40 ml of a 50 mg / ml solution of x-gal. The next day, the white colonies were selected and inoculated into 5 ml of the LB medium containing 100 mg / ml of ampicillin and grown overnight at 37 ° C with shaking at 225 rpm. Minipreparations were carried out in cultures overnight to determine the clones that possessed the plasmid with the correct insert. The plasmid was extracted from the cultures using a standard alkaline lysis procedure, wherein the DNA will be further purified by extraction with phenol: chloroform (Maniatis et al., 1982). The DNA was precipitated in 2 volumes of ethanol and then digested with EcoRI. The digestions were visualized on a 1% agarose gel to determine the colonies with the plasmid containing the appropriate insert. The plasmid was then purified from positive clones and sequenced using either sequencing of the dideoxy terminator radiolabelled with S35 based on Sequenase (USB, Cleveland, OH) or by sequencing the fluorescent dye terminator cycle (Perkin Elmer, Norwalk CT). From the cDNA sequence, the specific 3 'and 5' primers were constructed for use in the rapid 5"amplification of cDNA end reactions (RACE) and for the derivation of the 3 'sequence in conjunction with the degenerate primers of the 3 'untranslated region (UTR).

Isolation of the CD80 region 51 To derive the 5 'sequence of the gene, the cDNA amplification protocol was used.

Marathon (Clonetech, Palo Alto, CA). The mRNA produced from PBMC stimulated for 12 hours with A and concurrently 4 hours with LPS. He MRNA was extracted using the ULTRASPEC RNA extraction reagent (Biotexc, Houston, TX). The cDNA was produced with a dT oligo anchor primer with nucleotides degenerated at the 5 'end to facilitate binding of the primer to the 51 most end of the poly A tail. The cDNA was then transcribed as previously described. The specific binders were ligated to the cDNA with T4 DNA ligase. In the cDNA, PCR was carried out by contact with an internal 3 'primer specific for the previously amplified region: B7-284: TTA TAG TAG GGA CAG GGA AG (SEQ ID NO 58) B7-190: AGG CTT TGG AAA ACC TCC AG (SEQ ID NO 59) and an anchor primer complementary to the linked linker sequence. The parameters of the PCR reaction by contact using the KlenTaq polymerase mixture (Clontech, Palo Alto, CA) were: 95 ° C for 5 minutes, 1 cycle; 95 ° C for 30 seconds, 72 ° C for 30 seconds and 68 ° C for 45 seconds, 5 cycles; 95 ° C for 30 seconds, 65 ° C for 30 seconds and 68 ° C for 45 seconds 5 cycles; 95 ° C for 30 seconds, 60 ° C for 30 seconds and 68 ° C for 45 seconds, 25 cycles. 1 ml of this reaction was diluted in 50 ml of water and 5 ml of this dilution were then diluted in a nested PCR reaction (95 ° C for 5 minutes 1 cycle, 95 ° C for 30 seconds 65 ° C for 30 seconds and 68 seconds). ° C for 45 seconds, 30 cycles with KlenTaq polymerase mix) with the specific anchor binder primer and a 3 'primer specific for the gene located 5' of the initial primer (Figure 6).

B7-20: TTG TTA TCG GTG ACG TCA GTG (SEQ ID NO 60) B7-135: CAA TAA CAT CAC CGA AGT CAG G (SEQ ID NO 61) 20 ml of each reaction were visualized on 1.5% agarose gel and of the gel the appropriate fragment was cut. The cDNA was extracted and purified from the agarose by centrifuging a thin gel cut through a gel nebulizer and a 0.22 mm micropure filter (Amicon, Beverly, MA). The purified DNA was then sequenced directly using the dye terminator cycle sequencing (Perkin Elmer, Norwalk, CN).

Isolation of the 3 'region of CD80 The 3' region of the gene was derived by choosing 5 gene-specific primers from the 344 ntd fragment. and the previously sequenced 5 'region: B7-S220 GTC ATG TCT GGC AAA GTA CA G (SEQ ID NO 62) B7-50 CAC TGA CGT CAC CGA TAA CCA C (SEQ ID NO 63) B7-140 CTG ACT TCG GTG ATG TTA TTG G (SEQ ID NO 64) ) B7-550: GCC ATC AAC ACÁ ACÁ GTT TCC (SEQ ID NO 65) B7-620: TAT GAC AAA CA CCA TAG CTT C (SEQ ID NO 66) The degenerate 3 'primers were then chosen from consensus regions of the 3' UTR of the CD80 of human and murine. B7-1281 G (A / G) A AGA (A / T) TG CCT CAT GA (G / T) CC (SEQ ID NO 67) B7-1260 CA (C / T) (A / G) AT CCA ACÁ TAG GG (SEQ ID NO 68) The cDNA was produced from RNA extracted with ULTRASPEC (Biotexc, Houston, TX) from PBMC stimulated with Con A and LPS as previously described. The annealed dT oligo was used as the initial 3 'primer for transcription of RNA into cDNA. PCR reactions based on Taq polymerase were carried out with this cDNA, using the specific 5 'primers and the degenerated primers (95 ° C for 5 minutes, one cycle, 95 ° C for 30 seconds, 42 ° C for 30 seconds and 72 ° C). C for 45 seconds, 30 cycles, 72 ° C for 7 minutes). Two rounds of nested reactions were required before a single fragment of the correct size was produced. This product was cut from 1.5% agarose gel, purified as previously described and sequenced with dye terminator cycle sequencing (Perkin Elmer, Norwalk, CN). From the sequence data of the 5 'and 3' regions, primers were constructed that would amplify a region coding for the entire open reading frame of the feline CD80 gene: B7 START: ATG GGT CAC GCA GCA AAG TGG (SEQ ID NO 69) B7-960: CCT AGT AGA GAA GAG CTA AAG AGG C (SEQ ID NO 70) The previously produced PBMC cDNA and known to contain DNA was used. code for the gene This PCR reaction (95 ° C for 5 minutes 1 cycle, 95 ° C for 30 seconds, 42 ° C for 30 seconds and 72 ° C for 45 seconds, 30 cycles, 72 ° C for 7 minutes) used KlenTaq DNA polymerase, a enzyme cocktail that retains some of the activity of 5 'exonuclease in the hope of reducing random errors frequently associated with Taq polymerase. The reaction amplified a fragment of 960 base pairs (bp), which was cloned into the TA cloning vector (Invitrogen, San Diego, CA) and sequenced as previously described. The final sequence of the gene included cDNA from two separate animals. Each pair of bases of the gene was independently verified in at least 3 separate sequences, derived from individual PCR reactions, to reduce the possibility of errors derived from errors induced by PCR.

Isolation of an initial CD28 fragment The mRNA was extracted from HK5 peripheral blood lymphocytes stimulated for 16 hours with Con A using the RNAzoIB RNA extraction reagent (Biotexc, Houston, TX). Initially the cDNA was derived from this RNA by a reaction with reverse transcriptase (RT) using dT oligo as the 3 'primer. Briefly, RNA and dT oligo were heated at 75 ° C for 3 minutes to eliminate the secondary structure. Then RT, dNTP, buffer and distilled water were added and the mixture was incubated for 1 hour at 42 ° C. After this incubation, the sample was heated at 95 ° C for 5 minutes to inactivate RT. Then for the initial amplification of a 673 ntd fragment coding for most of the open reading frame, the degenerate primers derived from the consensus regions found within the published human, murine and rabbit CD28 nucleic acid sequences were then used ( GeneBank, Bethesda, MD). CD28-113: CAÁ CCT TAG CTG CAÁ GTA CAC (SEQ ID NO 71) CD28-768: GGC TTC TGG ATA GGG ATA GG (SEQ ID NO 72) To amplify the product a warm start PCR protocol using Taq polymerase was used (95 ° C for 5 minutes, 1 cycle, 95 ° C for 30 seconds, 48 ° C for 30 seconds and 72 ° C for 45 seconds, 30 cycles: 72 ° C for 7 minutes, 1 cycle) the fragment was then visualized on a 1% agarose gel and ligated into a TA cloning vector (Invitrogen, San Diego, CA) and sequenced as previously described. From this cDNA sequence, the specific 3 'primers were derived and synthesized for use in 5' RACE reactions. CD28190: CGG AGG TAG AAT TGC ACT GTC C (SEQ ID NO 73) CD28 239: ATT TTG CAG AAG TAA ATA TCC (SEQ ID NO 74) Isolation of the 5 'region of CD28 To obtain the remainder of the 5' sequence of the feline CD28 molecule, a modified 5 'GIBCO RACE protocol (Gibco BRL, Gaithersburg, MD) was used. The RNA was extracted from PBMC stimulated 16 hours with Con A. For the synthesis of the first strand of the cDNA, a specific primer of the 3 'gene was used. The RNA and the primer were heated at 75 ° C for 5 minutes before the addition of the other RT reagents. After denaturation, the mixture was cooled to 4 ° C and a reaction buffer, magnesium chloride, dNTP, DTT and RT SuperScript (Gibco BRL, Gaithersburg, MD) were added. The RT mixture was incubated at 42 ° C for 30 minutes and then heated at 70 ° C for 15 minutes to denature the RT. Then a Rnasa cocktail was added and the reaction was incubated at 55 ° C for 10 minutes to remove the residual RNA and avoid the incorrect extension of the terminal transferase (TdT). The cDNA was then purified on a GlassMax spin column (Gibco BRL, Gaithersburg, MD) to remove unincorporated dNTP and primer. The tail was then extended with TdT to the cDNA purified and eluted from the column. The TdT was used to add a tail of 20-30 nucleotides dC to the cDNA. The enzyme was added to a mixture of purified cDNA, magnesium chloride, reaction buffer and dCTP after denaturation of the cDNA at 95 ° C for 3 minutes. The reaction was incubated at 37 ° C for 10 minutes and the enzyme was then inactivated by heat at 70 ° C for an additional 10 minutes. Prolonged cDNA was amplified in a warm start PCR reaction based on Taq polymerase (95 ° C for 5 minutes; 95 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 45 seconds, 35 cycles; 72 ° C for 7 minutes). Primers of this reaction included a 3 'primer located 5' of the cDNA synthesis primer and an anchor primer specific for the dC binder and composed mainly of dG with a few di. One ml of this reaction was diluted in 50 ml of water and 5 ml of this dilution were then used in a nested PCR reaction (95 ° C for 5 minutes, 1 cycle, 95 ° C for 30 seconds, 55 ° C for 30 seconds and 72 ° C for 45 seconds, 30 cycles with KlenTaq polymerase mixture) with the anchor primer dG / dl 51 and an additional 3 'primer specific for the gene in the 5' direction. Thirty ml of the nested reaction was then visualized on 1.5% agarose gel and the appropriate fragment was extracted from the gel (Figure 19). The cDNA was purified as previously described with the Amicon gel nebulizer and the micropure filter (Amicon, Beverly, MA). The purified cDNA sample was subjected to sequencing through sequencing of the dye terminator cycle (Perkin Elmer, Norwalk, CN). From the completed fragments, a consensus sequence was derived. From the sequence, a first pair was synthesized that encompassed the entire open reading frame of the feline CD28 gene: feCD28 5 ': CGC GGA TCC ACC GGT AGC ACA ATG ATC CTC AGG (SEQ ID NO 75) feCD28 31: CGC GGA TCC TCT GGA TAG GGG TCC ATG TCA G (SEQ ID NO 76) Using these primers, a molecule of CDNA including the entire coding region was amplified from EK6 stimulated with Con A and cDNA derived from PBMC ED3. This PBMC cDNA was previously produced and had already been shown to contain RNA that codes for the gene. This PCR reaction (95 ° C for 5 minutes 1 cycle, 95 ° C for 30 seconds, 42 ° C for 30 seconds and 72 ° C for 45 seconds, 30 cycles, 72 ° C for 7 minutes) using KlenTaq DNA polymerase in the hope of reducing Random errors frequently associated with Taq polymerase produced a 754 bp fragment that was cloned into a TA cloning vector and sequenced as previously described. As with the CD80 molecule, each nucleotide site was confirmed by at least three independently derived sequences VECTOR OF HOMOLOGY 902-49.46. Plasmid 902-49.46 was constructed in order to insert foreign DNA into the RPV. It incorporates a ß-galactosidase (lacZ) marker gene from E. coli, flanked by RPV DNA. In the 5 'direction of the foreign gene there is a fragment of approximately 906 base pairs of the RPV DNA. In the 3"direction of the foreign genes there is a fragment of approximately 895 base pairs of the RPV DNA When the plasmid is used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION of RECOMBINANT RPV, a virus containing DNA encoding will result for the foreign genes Observe that the ß-galactosidase marker gene (lacZ) is under the control of a late promoter (LP1) and a second foreign DNA was inserted into an EcoRI or BamHI site and the second foreign DNA is under the control. Late / early promoter control (LP2EP2) This was constructed using standard recombinant DNA techniques (Sambrook et al) by joining the restriction fragments of the following sources with the synthetic DNA sequences The plasmid vector was derived from a fragment of HindIII restriction of approximately 2999 base pairs of pSP64 (Promega) .Fragment 1 is a HindIII restriction subfragment to approximate Xbal 906 base pairs of the HindIII restriction U fragment of the RPV (Knight et al.). Fragment 2 is a BamH1 to PvuII restriction fragment of approximately 3010 base pairs of plasmid pJF751 (Ferrari et al.). Fragment 3 is a subfragment Xbal to HindIII of approximately 895 base pairs of the U HindIII fragment of the RPV. The Xbal sites in fragments 1 and 3 became unique Notl sites using Notl linkers.

VECTOR OF HOMOLOGY 904-63. B7 The homology vector 904-63. B7 was used to insert foreign DNA into the SPV. It incorporates a ß-galactosidase (lacZ) marker gene from E. col i and gag / feline immunodeficiency virus protease (IVF) and the envelope genes flanked by SPV DNA. When this homology vector was used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR RECOMBINANT SPV GENERATION, a virus containing DNA encoding the foreign genes results. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pox promoter (LP1) and the IVF gag / protease and the envelope genes are under the control of late / early synthetic pox promoters (LP2EP2) separated but identical. The IVF gag / protease and the envelope promoter cassettes / FIV gene are oriented in opposite directions, so that the transcription of the gag / protease and the envelope genes run towards each other to avoid the possibility of recombination homologous between identical promoters. The homology vector was constructed using standard recombinant DNA techniques (Sambrook et al.), Binding restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a HindIII to BamH1 restriction fragment of approximately 2972 base pairs of pSP64 (Promega). Fragment 1 is a BglII to Accl restriction subfragment of approximately 1484 base pairs of the M HindIII fragment of the SPV (23). Fragment 2 is an EcoRI to BglII fragment of approximately 2580 base pairs of the FIV envelope gene synthesized by reverse transcription (RT) and the polymerase chain reaction (PCR) (15)., 42), using the cDNA of the FPR strain PPR. The 5 'primer (5' -GCCCGGATCCTATGGCAGAAGGGTTTGGCAGC-3 '10 / 93.21) (SEQ ID NO. 77) is synthesized from the 5' end of the FIV envelope gene and introduces a BamH1 site at the 5 'end of the gene. The primer in the 3 'direction (5'-CCGTGGATCCGGCACTCCATCATTCCTCCTC -3'; 10 / 93.20) (SEQ ID NO 78) is synthesized from the 3 'end of the envelope gene of the IVF, and introduces a BamHI site at the 3' end of the gene and was used for reverse transcription and chain reaction by the polymerase . The PCR product was digested with BamHl to produce a fragment with a length of 2580 base pairs corresponding to the envelope gene of the FIV. Fragment 3 is an EcoRI to BglII fragment of approximately 1839 base pairs of the FIV gag / protease gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42), using the cDNA of the PPR strain of the FIV. The 5 'primer (51-GCGTGAATTCGGGGAATGGACAGGGGCGAGAT-3'; 11 / 94.9) (SEQ ID NO 79) is synthesized from the 5 'end of the IVF gag / protease gene and introduces an EcoRI site at the 5' end of the gene. Primer 31 (51-GAGCCAGATCTGCTCTTTTTACTTTCCC -3 '; 11 / 94.10) (SEQ ID NO 80) was synthesized from the 3' end of the IVF gag / protease gene, introduced a BglII site at the 3 'end of the gene and used for reverse transcription and chain reaction by polymerase. The PCR product was digested with EcoRI and BglII to produce a fragment with an approximate length of 1839 base pairs corresponding to the gag / protease gene of FIV. Fragment 4 is a BamH1 to PvuII restriction fragment of approximately 3010 base pairs of plasmid pJF751 (Ferrari et al.). Fragment 5 is a Accl to HindIII restriction subfragment of approximately 2149 base pairs of the HindIII restriction M fragment of the SPV. The Accl site in the SPV homology vector became a unique Notl site using synthetic binders.

VECTOR OF HOMOLOGY 917-60.B9. The plasmid 917-60. B9 was constructed in order to insert foreign DNA into the SPV. It incorporates a β-galactosidase (lacZ) marker gene from E. coli and the IFN- gene? feline (Onions et al., (1996); Argyle et al., (1995) flanked by SPV DNA.) In the 5 'direction of the foreign genes there is a fragment of approximately 1484 base pairs of SPV DNA. There is a fragment of approximately 2149 base pairs of SPV DNA when the plasmid is used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION of RECOMBINANT SPV, resulting in a virus containing DNA encoding foreign genes. that the β-galactosidase marker gene (lacZ) is under the control of the OlL promoter of pig pox and the feline CD28 gene is under the control of a synthetic late / early pox promoter (LP2EP2), which can be constructed using DNA techniques standard recombinant (Sambrook et al.) joining restriction fragments from the following sources.The plasmid vector was derived from a JíindIII restriction fragment to Bam Hl of approximately 2972 base pairs of pSP64 (Promega). Fragment 1 is a BglII to Accl restriction subfragment of approximately 1484 base pairs of the HindIII restriction M fragment of SPV. Fragment 2 is an EcoRI to BamHl restriction fragment synthesized by reverse transcription and polymerase chain reaction (PCR) using RNA from feline spleen cells stimulated with ConA as a template. To synthesize IFN-? feline, the primer (5'- TCGAGAATTCGATGAATTACACAAGTTTTATTTTCG - 3 '; 1 / 97.4) (SEQ ID NO 81) was synthesized from the 5 'end of the IFN-? of feline, was introduced into an EcoRI site at the 5 'end of the gene. The primer (51-TCGAGGATCCTTATTTCGATGCTCTACGGCCTC -3 '; 1 / 97.3) (SEQ ID NO 82) was used for reverse transcription and PCR and was synthesized from the 3' end of the IFN-α gene. of feline, was introduced into the BamHI site at the 3 'end of the gene. The PCR product was digested with EcoRI and BamHI to produce a fragment with a length of approximately 504 base pairs corresponding to the IFN-α gene. feline. Fragment 3 is a BamHI to Pvul I restriction fragment of about 3010 base pairs of plasmid pJF751 (Ferrari et al.). Fragment 4 is an Accl to HindIII subfragment of approximately 2149 base pairs of the M HindlII fragment of the SPV.

Accl sites in fragments 1 and 4 became unique Notl sites using Notl linkers.

VECTOR OF HOMOLOGY 926-76.D7. The homology vector 926-76. D7 was constructed in order to suppress a portion of the gE coding region of the feline herpes virus and to insert an AD? strange. It incorporates a feline CD80 gene flanked by AD? of the FHV. The feline CD80 gene was under the control of the gE promoter of FHV. This was built from the sources of AD? indicated using AD techniques? standard recombinant (Sambrook et al.). The plasmid vector was derived from a restriction endonuclease fragment Asp718I to Asp718I of approximately 2958 base pairs of a pSP18 / 19. Fragment 1 is an Asp718I to Smal subfragment of approximately 1415 base pairs of Fragment B Exit FHV. Fragment 2 is an EcoRI to BamHI fragment of approximately 879 base pairs of the feline CD80 gene synthesized by CLONING WITH THE CHAIN REACTION BY THE POLYMERASE. The template for the PCR reaction was RNA from feline spleen cells stimulated with ConA. The 5 'primer (5' -TCGAGAATTCGGGTCACGCAGCAAAGTGG-3 ': 1 / 97.43) (SEQ ID NO 52) is synthesized from the 5' end of the feline CD80 gene and introduces an EcoRI site. The 3 'primer (5'-GCTAGGATCCAATCTATGTAGACAGGTGAGAT-3'; 1 / 97.6) (SEQ ID NO 53) is synthesized from the 3 'end of the feline CD80 gene, introduces a BamHI site at the 3' end of the gene and used for reverse transcription and chain reaction by polymerase. The 3 'fragment is a Salf to Asp718I subfragment of approximately 2205 base pairs of the E BcoRI fragment of FHV.

VECTOR OF HOMOLOGY 930 -23.Al. The plasmid 930-23. Al was built in order to insert foreign DNA into the SPV. It incorporates a β-galactosidase (lacZ) marker gene from E. col i and the feline CD80 gene flanked by SPV DNA. In the 5 'direction of the foreign genes, there is a fragment of approximately 1484 base pairs of SPV DNA. In the 31st direction of the foreign genes there is a fragment of approximately 2149 base pairs of SPV DNA. When the plasmid is used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR RECOMBINANT SPV GENERATION, a virus containing DNA encoding foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pox promoter (LP1) and the feline CD80 gene is under the control of a synthetic late / early pox promoter (LP2EP2). This can be constructed using standard recombinant DNA techniques (Sambrook et al.) By joining restriction fragments from the following sources. The plasmid vector was derived from a HindIII restriction fragment to Ba H1 of approximately 2972 base pairs of pSP64 (Promega). Fragment 1 is a BglII to Accl restriction subfragment of approximately 1484 base pairs of the HindIII restriction M fragment of SPV. Fragment 2 is an EcoRI to BamHl restriction fragment synthesized by reverse transcription and polymerase chain reaction (PCR) using RNA from feline spleen cells stimulated with ConA as a template. To synthesize feline CD80, the primer (5'-TCGAGAATTCGGGTCACGCAGCAAAGTGG -3 '; 1 / 97.43) (SEQ ID NO 52) was synthesized from the 51 end of the feline CD80 gene, introducing an EcoRI site at the 5' end of the gene. The primer (5'-GCTAGGATCCAATCTATGTAGACAGGTGAGAT -3 '; 1 / 97.6) (SEQ ID NO 53) was used for reverse transcription and PCR and was synthesized from the 3' end of the feline CD80 gene, introduced a BamHl site at the end 3 'of the gene. The PCR product was digested with EcoRI and BamHI to produce a fragment with a length of approximately 879 base pairs corresponding to the feline CD80 gene. Fragment 3 is a BamH1 to PvuII restriction fragment of approximately 3010 base pairs of plasmid pJF751 (Ferrari et al.). Fragment 4 is an Accl to HindIII subfragment of approximately 2149 base pairs of the M ffindIII fragment of SPV. Accl sites in fragments 1 and 4 became unique Notl sites using Notl linkers.

VECTOR OF HOMOLOGY 930-26.Al. Plasmid 930-26. Al was built in order to insert AD? strange in the SPV. It incorporates a β-galactosidase (lacZ) marker gene from E. col i and the feline CD28 gene flanked by AD? of the SPV. In the 5 'direction of the foreign genes there is a fragment of approximately 1484 base pairs of AD? of the SPV. In the 3 'direction of the foreign genes is a fragment of approximately 2149 base pairs of AD? of the SPV. When the plasmid was used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR RECOMBINANT SPV GENERATION, a virus containing DNA encoding the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pox promoter (LP1) and the feline CD28 gene is under the control of a synthetic late / early pox promoter (LP2EP2). It can be constructed using standard recombinant DNA techniques (Sambrook et al.) By joining restriction fragments from the following sources. The plasmid vector was derived from a HindIII restriction fragment to Ba H1 of approximately 2972 base pairs of pSP64 (Promega). Fragment 1 is a BglII to Accl restriction subfragment of approximately 1484 base pairs of the HindIII restriction M fragment of SPV. Fragment 2 is an EcoRI to BamHl restriction fragment synthesized by reverse transcription and polymerase chain reaction (PCR) using RNA from feline spleen cells stimulated with ConA as a template. To synthesize feline CD28, the primer (5'-GATGAATTCCATGATCCTCAGGCTGGGCTTCT -3 *; 7 / 97.1) (SEQ ID NO 54) was synthesized from the 5 'end of the feline CD28 gene, introduced an EcoRI site at the 5' end of the gene. The primer (5'-GATCAGATCTCAGGAACGGTATGCCGCAA-3 '; 7 / 97.2) (SEQ ID NO 55) was used for reverse transcription and PCR and was synthesized from the 3' end of the feline CD28 gene, introduced a BamHl site at the end 3 'of the gene. The PCR product was digested with EcoRI and BamHI to produce a fragment with a length of approximately 666 base pairs corresponding to the feline CD28 gene. Fragment 3 is a BamH1 to PvuII restriction fragment of approximately 3010 base pairs of plasmid pJF751 (Ferrari et al.). Fragment 4 is an Accl to HindIII subfragment of approximately 2149 base pairs of the M. HindlII fragment of SPV. Accl sites in fragments 1 and 4 became unique Notl sites using Notl linkers.

VECTOR OF HOMOLOGY 931-21. Al. The homology vector 931-21. Al was used to insert AD? strange in the SPV. It incorporates a β-glucuronidase (uidA) marker gene from E. coli and the feline CD80 gene flanked by AD? of the SPV. When this homology vector was used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR RECOMBINANT SPV GENERATION, a virus containing DNA encoding the foreign genes results. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic early smallpox (EP2) promoter and the feline CD80 gene is under the control of a separate and unique synthetic late / early pox promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (Sambrook et al.) Joining restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector. The plasmid vector was derived from a Dral restriction fragment of approximately 2700 base pairs of PNEB193 (New England Biolabs). Fragment 1 is a Dral to EcoRI restriction subfragment of approximately 881 base pairs of the HindIII fragment of SPV. Fragment 2 is an EcoRI to BamHl fragment of approximately 879 base pairs of the feline CD80 gene synthesized by CLONING WITH CHAIN REACTION BY THE POLYMERASE. The template for the PCR reaction was RNA from feline spleen cells stimulated with ConA. The 5 'primer (5' -TCGAGAATTCGGGTCACGCAGCAAAGTGG-3 '; 1 / 97.43) (SEQ ID NO 52) is synthesized from the 5' end of the feline CD80 gene and introduces an EcoRI site. The 3 'primer (51-GCTAGGATCCAATCTATGTAGACAGGTGAGAT-3': 1 / 97.6) (SEQ ID NO 53) is synthesized from the 3 'end of the feline CD80 gene, introduces a BamHI site at the 3' end of the gene and was used for the reverse transcription and the chain reaction by the polymerase. Fragment 3 is an EcoRI to Smal restriction fragment of approximately 1823 base pairs of plasmid pRAJ260 (Clonetech). Fragment 4 is an EcoRI to Dral restriction subfragment of approximately 994 base pairs of the HindIII restriction fragment of SPV. The EcoRI site in the SPV homology vector was converted to a unique Notl site using synthetic binders.

VECTOR OF HOMOLOGY 931-22. Al. Plasmid 931-22. Al was built in order to insert foreign DNA into the RPV. It incorporates a feline CD80 gene flanked by RPV DNA. In the 5 'direction of the foreign gene there is a fragment of approximately 906 base pairs of RPV DNA.

In the 3 'direction of the foreign genes there is a fragment of approximately 895 base pairs of RPV DNA. When the plasmid is used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR RECOMBINANT RPV GENERATION, a virus containing DNA encoding foreign genes will result. Note that the feline CD80 gene is under the control of a late / early promoter (LP2EP2). It was constructed using standard recombinant DNA techniques (Sambrook et al.) By joining restriction fragments from the following sources with the synthetic DNA sequences. The plasmid vector was derived from a HindIII restriction fragment of approximately 2999 base pairs of pSP64 (Promega). Fragment 1 is a HindIII to Xbal restriction subfragment of approximately 906 base pairs of the HindIII restriction U fragment of RPV (Knight et al.). Fragment 2 is an EcoRI to BamHl fragment of approximately 879 base pairs of the feline CD80 gene synthesized by CLONING WITH CHAIN REACTION BY THE POLYMERASE. The template for the PCR reaction was RNA from feline spleen cells stimulated with ConA. The 5 'primer (51-TCGAGAATTCGGGTCACGCAGCAAAGTGG-3'; 1 / 97.43) (SEQ ID NO 52) is synthesized from the 5 'end of the feline CD80 gene and introduces an EcoRI site. The 3 'primer (5'-GCTAGGATCCAATCTATGTAGACAGGTGAGAT-3': 1 / 97.6) (SEQ ID NO 53) is synthesized from the 3 'end of the feline CD80 gene, introduces a BamHl site at the 3 'end of the gene and is used for reverse transcription and chain reaction by the polymerase. Fragment 3 is a Xbal to HindIII subfragment of approximately 895 base pairs of the V HindIII U fragment. The Xbal sites in fragments 1 and 3 became unique Notl sites using Notl linkers. The synthetic DNA between fragments 2 and 3 contains the LP2EP2 promoter and an EcoRI site and a BamHI site for the insertion of the foreign DNA.

VECTOR OF HOMOLOGY 931-32.A5. Plasmid 931-32. A5 was constructed in order to insert foreign DNA into the RPV. It incorporates a feline CD80 gene and a β-galactosidase marker gene (lacZ) of E. col i flanked by RPV DNA. In the 5 'direction of the foreign genes there is a fragment of approximately 906 base pairs of the RPV DNA. In the 3 'direction of the foreign genes there is a fragment of approximately 895 base pairs of RPV DNA. When the plasmid was used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR RECOMBINANT RPV GENERATION, a virus containing DNA encoding foreign genes will result. It was constructed using standard recombinant DNA techniques (Sambrook et al.) By joining restriction fragments from the following sources with the synthetic DNA sequences. The plasmid vector was derived from a HindIII restriction fragment of approximately 2999 base pairs of pSP64 (Promega). Fragment 1 is a HindIII to Xbal restriction subfragment of approximately 906 base pairs of the HindIII restriction U fragment of RPV (Knight et al.). Fragment 2 is an EcoRI to BamHl fragment of approximately 879 base pairs of the feline CD80 gene synthesized by CLONING WITH CHAIN REACTION BY THE POLYMERASE. The template for the PCR reaction was RNA from feline spleen cells stimulated with ConA. The 5 'primer (51-TCGAGAATTCGGGTCACGCAGCAAAGTGG-3'; 1 / 97.43) (SEQ ID NO 52) is synthesized from the 5 'end of the feline CD80 gene and introduces an EcoRI site. The 3 'primer (5 * -GCTAGGATCCAATCTATGTAGACAGGTGAGAT-3'; 1 / 97.6) (SEQ ID NO 53) is synthesized from the 3 'end of the feline CD80 gene, introduces a BamHI site at the 3' end of the gene and is used for reverse transcription and chain reaction by polymerase. Fragment 3 is a BamHI to PvuII restriction fragment of approximately 3010 base pairs of plasmid pJF751 (Ferrari et al.). Fragment 4 is a Xbal to HindIII subfragment of approximately 895 base pairs of the V HindIII U fragment. The Xbal sites in fragments 1 and 4 were converted to unique Notl sites using Notl linkers.

VECTOR OF HOMOLOGY 931-55. B12: The homology vector 931-55. B12 was used to insert foreign DNA into the SPV. It incorporates a ß-glucuronidase (uidA) marker gene from E. coli and the IFN-? of feline (Onions, et al. (1996); Argyle et al., (1995)) flanked by SPV DNA. When this homology vector was used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR RECOMBINANT SPV GENERATION, a virus containing DNA encoding the foreign genes results. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic early smallpox (EP2) promoter and the IFN-? of feline is under the control of a separate and unique synthetic late / early smallpox (LP2EP2) promoter. The homology vector was constructed using standard recombinant DNA techniques (Sambrook et al.), Binding restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a 2700 bp Dral restriction fragment of PNEB193 (New England Biolabs). Fragment 1 is a Dral to EcoRI restriction subfragment of approximately 881 base pairs of the HindIII fragment of SPV. Fragment 2 is an EcoRI to BamHl restriction fragment synthesized by reverse transcription and polymerase chain reaction (PCR) using RNA from feline spleen cells stimulated with ConA as a template. To synthesize feline IFN-α, the primer (5 * TCGAGAATTCGATGAATTACACAAGTTTTATTTTCG-3 '; 1 / 97.4) (SEQ ID NO 81) was synthesized from the 5' end of the IFN-α gene. of feline, introduced an EcoRI site at the 5 'end of the gene. The primer (51 TCGAGGATCCTTATTTCGATGCTCTACGGCCTC - 3 '; 1 / 97.3) (SEQ ID 82) was used for reverse transcription and PCR and was synthesized from the 3 'end of the feline IFN-g gene, introduced a BamH1 site at the 3' end of the gene. The PCR product was digested with EcoRI and BamHI to produce a fragment with a length of approximately 504 base pairs corresponding to the IFN-α gene. of cats. Fragment 34 is an EcoRI to Smal restriction fragment of approximately 1823 base pairs of plasmid pRAJ260 (Clonetech). Fragment 4 is an EcoRI to Dral restriction subfragment of approximately 994 base pairs of the HindIII restriction fragment of SPV. The EcoRI site in the homology vector of the SPV became a unique site using synthetic binders.

VECTOR OF HOMOLOGY 846-88.B17. The plasmid 846.88.bl7 was constructed in order to suppress the entire gE coding region of the feline herpes virus and to insert a foreign DNA. It incorporates a β-galactosidase (lacZ) marker gene from E. coli inserted into the suppressed gE site of FHV flanked by HV DNA. The plasmid 846-88. B17 contains a deletion of 1638 base pairs of the gE gene from the Smal site in fragment B I left the FHV at the SalI site in the E EcoRI fragment of the FHV. The Smal site in fragment B I left the FHV and the SalI site in the E EcoRI fragment of the FHV define the end points of the deletion of the gE gene. In the 5 'direction of the foreign gene there is a subfragment Asp718 to SamI of approximately 1415 base pairs of B Salí del FHV containing the complete coding sequence of the gl gene (370 amino acids), in the 3' direction of the foreign gene there is a subfragment Salí to Asp 718 from approximately 2205 base pair pairs of the E EcoRI fragment of the FHV containing a single terminal short repeat sequence. When the plasmid is used in accordance with the RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION OF RECOMBINANT RPV, SPV OR FHV, a virus containing DNA encoding the foreign gene will result. Note that the lac Z gene of E. coli is under the control of the gE promoter of the constitutive FHV. It was constructed using standard recombinant DNA technique (Sambrook et al.).

VECTOR OF HOMOLOGY 921-65.B5. The homology vector 921-656. B5 was constructed to suppress the SPV gene 15 (approximately 237 bp) and to insert foreign DNA into the SPV. It incorporates a β-galactosidase marker gene (LacZ) of E. coli and to the gag / protease genes of feline leukemia virus (FelLV) and envelope, flanked by SPV DNA. When this HOMOLOGY OF CONFORMITY WITH THE HOMOLOGA RECOMBINATION PROCEDURE was used for the generation of recombinant RPV, SPV or FHV, a virus containing DNA encoding the foreign genes results. It was constructed using standard recombinant DNA techniques (Sambrook et al.). Note that the β-galactosidase (LacZ) marker gene is under the control of the constitutive late pox promoter (I5L) and the FeLV gag / protease and FeLV envelope genes are under the control of different synthetic early smallpox promoters, EP2 and EP1, respectively. The SPV sequence flanking the foreign gene insertions were derived from a 3.2 kb N HinglII genomic fragment. The 5 'sequence of the foreign genes is a 903 bp fragment containing part of the SPV 14L gene and the 3' sequence is a 966 bp fragment containing part of the SPV 16L gene. The open reading frames of the E. coli lacZ gene, the FeLV envelope and the FeLV gag / protease all run in the same orientation with respect to the SPV 16L and SPV 14L genes.

VECTOR OF HOMOLOGY 942-03.C6. The plasmid 942-03. C6 was constructed in order to suppress a portion of the gE coding region of the feline herpes virus and to insert three foreign genes into the site with gE suppression. It incorporates a feline CD80 gene (~ 879 bp) and the FIV gag / protease gene (-1800 bp) and an FIV envelope gene (-2600 bp) flanked by FHV DNA. The feline CD80 gene was under the control of the gE promoter of FHV; the gag / protease gene of FIV is under the control of the gX promoter of the pseudorarabia and the envelope gene of the FIV is under the control of the immediate early gene of the cytomegalovirus. In the 5 'direction of the foreign genes there is a Asp718 to Smal subfragment of approximately 1415 base pairs of the SalI fragment of the FHV. In the 3 'direction of the foreign genes, there is a Salf to Asp718 subfragment of approximately 2205 base pairs of the E EcoRI fragment of the FHV containing a single terminal short repeat sequence. When the plasmid is used in accordance with the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECOMBINANT RPV, SPV OR FHV, a virus containing DNA encoding the foreign gene will result. The plasmid of homology 942-03. C6 was constructed using standard recombinant DNA techniques (Sambrook et al.).

Examples Examples Cloning of the cDNAs for CTLA-4, CD28, C86 (B7-2), CD80 (B7-D-SPAH and CD80 (B7-1) -TAMU felines: The cDNA for CTLA-4, CD28, C86 ( B7-2) and CD80 (B7-1) felines were cloned amplifying, first by RT-PCR (reverse transcriptase polymerase chain reaction), a region between two sequences that were retained long enough to degenerate to the primers that interacted with the feline mRNA. The source of the mRNA were the peripheral blood mononuclear cells (PBMC) or splenocytes stimulated for at least 16 hours with Con A. This PCR product was sequenced. The sequence was used to make primers by PCR RACE (rapid amplification of cDNA ends). End 51 was amplified by first making cDNA with a 3 'primer complementary to the freshly conserved sequenced region. An oligonucleotide was ligated to the 3 'end of the cDNA (complement with the 5' end of mRNA). This sequence served as the binding site for the 5 'primer that was compatible with the 3' PCR primer that corresponded to another region in the newly sequenced region. The degenerate primers were used in multiple rounds of nested reactions to obtain the 3 'end. This 5 'primer for PCR was designed to react with a sequence in the newly sequenced region. The products were sequenced either directly or cloned into a Ta cloning vector and sequenced from the plasmid. The completely open reading frame was cloned by amplifying it in its entirety by PCR with primers constructed from the known sequences. The ORFs were cloned and sequenced three times. The ORF of B7-1 was subcloned into a pSI plasmid with an SV40 promoter and with the SFV plasmid. The pSI was used to establish the functional interaction of B7-1 with feline CD28. The DNA primers used for the RT / PCR of the cDNA for feline CD80 (B7-1) were: 5 'primer: 5' -CGCGGATCCGCACCATGGGTCACGCAGCAAAGTGGAAAAC-3 '; (SEQ ID NO 11) 3 'Primer: 5' -CCTAGTAGAGAAGAGCTAAAGAGGC-3 •; (SEQ ID NO 12) (Refer to the above, the list of primers for cDNA for feline CD80). The DNA primers used for the RT / PCR of the cDNA for feline CD28 were: 'Primer: 5' -CGCGGATCCACCGGTAGCACAATGATCCTCAGG-3 '; (SEQ ID NO.13) 3 'Primer: 5' -CGCGGATCCTCTGGATAGGGGTCCATGTCAG-3 '; (SEQ ID NO.14) (Refer to the above, the list of primers for cDNA for feline CD28). The DNA primers used for the RT / PCR of the cDNA for feline CTLA-4 were: 1. Degenerate primers for the first PCR product (672 bp): Deg 5 'P: 5 * -ATGGCTT (C) GCCTTGGATTT (C) CAGC ( A) GG-3 '; (SEQ ID NO: 15) Deg 3 'P: 5' -TCAATTG (A) ATG (A) GGAATAAAATAAGGCTG-3 '; (SEQ ID No. 16) 'end of CTLA-4 (455 bp): Gene-specific primers nested (NGSP) and gene-specific (GSP) degenerate: First round PCR: Deg 5' P: 5 '-TGTTGGGTTTC (T) G (A) CTCTG (A) CTT (C) CCTG-3 '; (SEQ ID NO: 17) 3 'GSP: 5 * -GCATAGTAGGGTGGTGGGTACATG-3'; (SEQ ID No. 18) PCR nested by the PCR product of the first round: Deg 51 P: 5 '-TGTTGGGTTTC (T) G (A) CTCTG (A) CTT (C) CCTG-3'; (SEQ ID NO: 19) 3 'NGSP: 5' -ACATGAGCTCCACCTTGCAG-3 '; (SEQ ID NO 20) End 31 of CTLA-4: Adapter Primer 1 (API, Clonetech Lab, Inc., Palo Alto, CA); Nested adapter primer (AP2, Clonetech Lab), gene specific primer (GSP) and gene specific primer (NGSP): 3 'RACE PCR: API: 5' -CCATCCTAATACGACTCACTATAGGGC-3 '; (SEQ ID NO: 21) GSP 5 ': 5' -GTGAATATGGGTCTTCAGGCAATG-3 '; (SEQ ID NO.22) PCR RACE nested 3 'with PCR product RACE 3': AP2: 5 '-ACTCACTATAGGGCTCGAGCGGC-3'; (SEQ ID NO: 23) NGSP 5 ': 5' -GAAATCCGAGTGACTGTGCTGAG-3 '; (SEQ ID NO.24) Four . Primers for the entire CTLA-4 gene Primer CTLA-4 Fel 5 ': 5 • -AACCTGAACACTGCTCCCATAAAG- 3'; (SEQ ID NO: 25) CTLA-4 3 '5' primer-GCCTCAGCTCTTAGAAATTGGACAG-3 (SEQ ID NO.26) The DNA primers used for CD86 RT / PCR for feline CD86 (B7-2) were: 1. Degenerate primers for the first PCR product (423 bp): Deg 5 'P: 5' -TAGTATTTTGGCAGGACCAGG-3"; (SEQ ID No. 27) Deg 3 'P: 5' -CTGTGACATTATCTTGAGATTTC-3 '; (SEQ ID NO: 28) 2. Degenerate primers for the second PCR product (574 bp): Deg 5 'P: 5' -GA (G) CA (T) GCACT (A) ATGGGACTGAG-3 '; (SEQ ID No. 29) Deg 3 'P: 5' -CTGTGACATTATCTTGAGATTTC- 3 '; (SEQ ID NO 30) 3. 5 'end of CD86.AP1, AP2 (Clontech Lab), Gene-specific primers (GSP) 3', degenerate and nested gene specific (NGSP) 3 ': RACE RACE 5': API: 5 '-CCATCCTAATACGACTCACTATAGGGC-3'; (SEQ ID No. 31) GSP 3 ': 5' -TGGGTAACCTTCTATAGATGAGCAGGTC-3 '(SEQ ID No. 32) 'RACE PCR nested with the 5' RACE PCR product: AP2: 5 '-ACTCACTATAGGGCTCGAGCGGC-3 »; (SEQ ID NO: 33) NGSP 3 ': 5 • -CAGGTTGACTGAAGTTAGCAAGCAC-3'; (SEQ ID NO 34) 4. End 3 «of B7-2: 1AP1, AP2, GSP 5 'and NGSP 5': PCR RACE 3 ': API: 5' -CCATCCTAATACGACTCACTATAGGGC-3 '; (SEQ ID NO: 35) GSP 5: 5 • -GGACAAGGGCACATATCACTGTTTC-3 '; (SEQ ID NO 36) PCR RACE 3 'nested with the PCR product of RACE 3': AP2: 5 '-ACTCACTATAGGGCTCGAGCGGC-3'; (SEQ ID NO.37) NGS P 5 ': 5' - CAGTGCTTGCTAACTTCAGTCAACC-3 '(SEQ ID NO 38) The entire CD86 gene: Primer 572 feline B72 (1): 5 '-CGGGAATGTCACTGAGCTTATAG-3'; (SEQ ID No. 39) Feline primer B72 (1176) 3 ': 5' -GATC TGGG (_? GGTTAGC? GGGG-3 '; (SEQ ID NO.

Example IB Cloning of CD80 (B7-1) -Syntro / SPAH; Plasmid 917-19-8 / 16 Cazo spleen cells were extracted and cultured with Concanavalin A for 5 hours. The cells were granulated, washed with PBS and used to isolate the total RNA (Qiagen RNeasy Total RNA System). Total RNA was treated with DNase I (Boehringer Mannheim) to remove DNA contamination of the RNA preparations. The messenger RNA was then extracted from these preparations using Oligotex beds from Qiagen (Santa Clara, CA) and rapid columns. Copy DNA was generated from RNA, in the presence of random hexamers, dNTP, siRNA, reverse transcriptase (Promega) and reverse transcriptase buffer (Promega) and incubated at 42 ° C for 30 minutes. The PCR was then used to generate a full-length, double-stranded open reading frame (ORF) clone of the feline B7-1 using the 5 / 97.50 sense primer (5 '-ATGGGTCACGCAGCAAAGTG-3'); (SEQ ID NO: 41) and the antisense primer 5 / 97.51 (5'-CTATGTAGACAGGTGAGATC-3 '); (SEQ ID NO: 42), dNTPs, B7-1 cDNA (the chain), MgSO4, Vent polymerase (BRL) and Vent polymerase buffer (BRL). The PCR conditions were the following: 1 cycle of 94 °, 15 seconds; 35 cycles of 94 ° for 30 seconds, 48 ° for 2 minutes, 72 ° for 2 minutes; 1 cycle of 72 ° for 10 minutes. PCR reactions were run in a 1% low melting agarose gene and DNA fragments corresponding to the expected size of the B7-1 ORF were isolated, gel purified (Qiagen1 s Gel Purification Kit, Santa Clara, CA) and cloned in pCR-BLUNT plasmid vector using Invitrogen's team reagents Zero Blunt PCR Cloning Kit (San Diego, CA). The DNA extracted from kanamycin-resistant bacterial colonies was pre-taminated by the presence of a single Nhel Site (contained in feline CD80 (B7-1) - TAMU). Inserts that were in this size range of 800 to 900 bp and containing an Nhel site were sequenced using protocols and automated sequencing equipment with ABI fluorescence (Perkin-Elmer-Cetus, Applied Biosystems, Inc.). The plasmid vector and B7-1, gene-specific primers derived from the previously cloned B7-1 gene which were used to generate pCR-Blunt DNA sequence primers are: 1 / 97.36 (5 '-CAGGAAACAGCTATGAC-3'); (SEQ ID NO: 43) and 1 / 97.37 (5 '-AATACGACTCACTATAGG-3'); (SEQ ID NO.44). The gene-specific primers B7-1: 12 / 96.22 (51-AACACCATTTCATCATCCTTT-3 '); (SEQ ID NO: 45), 1 / 97.33 (5 '-ATACAAGTGTATTTGCCATTGTC-3'); (SEQ ID NO: 46), 12 / 96.20 (5 '-AGCTCTGACCAATAACATCA-3'); (SEQ ID NO: 47), 12 / 96.21 (5 '-ATTAGAAATCCAGTTCACTGCT-3'); (SEQ ID NO: 48), 1 / 97.32 (5 'TCATGTCTGGCAAAGTACAAG-3); (SEQ ID NO: 49), 11 / 96.32 (5'-ATTCACTGACGTCACCGA-3 '); (SEQ ID NO: 50), 11 / 96.31 (5 '-AAGGCTGTGGCTCTGA-3'); (SEQ ID NO 51). It was determined that two clones contain full length CD80 sequence corresponding to the original CD80 sequence with the exception of 2 DNA point mutations. One of these point mutations did not affect the amino acid sequence. The second mutation resulted in an amino acid change from a Leucine to an Isoleucine. The resulting feline CD80 clone was designated 917-19-8 / 16. (CD80-Syntro / SPAH).

Example 2 S-SPV-229 S-SPV-229 is a swinepox virus that expresses at least two foreign genes. The gene for β-galactosidase from E. coli (lacZ) and the gene for feline CD80 were inserted into the Accl SPV site within the larger Bglll subfragment to the HindIII of the genomic fragment SPV HindIII M (a single restriction site Notl has replaced a single Accl restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the feline CD80 gene is under the control of the late / early promoter (LP2EP2). The S-SPV-229 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 930-23. Al (see "Materials and methods") and virus S-SPV-001 in the HOMOLOGA RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection material was screened by SCREENING FOR RECOMBINANT SPV THAT EXPRESSES β-galactosidase (BLUOGAL VALUATIONS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-229. This virus was evaluated for β-galactosidase expression, purity and insert stability by multiple passages monitored by blue plate titration and black plate titration, as described in "Materials and methods". After the first three rounds of purification, all the plates observed were blue, indicating that the virus was pure, stable and expressing β-galactosidase. (U.S. Patent 5,382,425 is incorporated herein by reference). S-SPV-229 was assessed for the expression of β-galactosidase-specific antigens using the BLACK PLATE SIZE FOR EXPRESSION OF STRANGE GENE IN RECOMBINANT SPV. It was shown that a monoclonal antibody for β-galactosidase reacts specifically with S-SPV-229 plates and not with negative control plates S-SPV-001. All the S-SPV-229 plates observed reacted with the monoclonal antibody for β-galactosidase indicating that the virus was stably expressing the β-galactosidase foreign gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines. The S-SPV-229 was evaluated for expression of feline CD80 specific antigens using the SCREENING FOR EXPRESSION OF CD86 (B7-2) and CD80 (B7-1) FELINE IN FHV, RPV or RECOMBINANT SPV USING BLACK PLATE ASSESSMENTS. It is shown that a human CTLA-4 / Fc chimeric antibody reacts specifically with S-SPV-229 plates (expressing feline CD80) and not with S-SPV-001 negative control plates. It is shown that all the S-SPV-229 plates observed react with the chimeric antibody CTLA-4 / Fc, which indicates that the virus is stably expressing the feline CD80 foreign gene. To confirm the expression of the feline CD80 gene product, the cells are infected with S-SPV-229 and samples of infected cell lysates were subjected to polyacrylamide gel electrophoresis. The gel was labeled and analyzed using the WESTERN TRANSFER PROCEDURE. S-SPV-229 is useful as vaccines against feline diseases. S-SPV-229 improves the efficacy of vaccines against FIV, FeLV, FIP or other feline diseases when used alone or in combination with FIV, FeLV, FIP or other feline vaccines. S-SPV-229 is also useful for the expression of CD80 polypeptide. The cell lysate of infected cells S-SPV-229 is injected into mice or rabbits to develop the monospecific, polyclonal antibodies to feline CD80.

Example 3 S-SPV-230 S-SPV-230 is a swinepox virus that expresses at least two foreign genes. The gene for β-galactosidase from E. coli (lacZ) and the gene for feline CD80 were inserted into the Accl SPV site within the larger Bglll subfragment to the HindIII of the genomic fragment SPV HindIII M (a single restriction site Notl has replaced a single Accl restriction site). The lacZ gene is under control of the synthetic late promoter (LP1) and the feline CD80 gene is under the control of the late / early promoter (LP2EP2). The S-SPV-230 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 930-26. Al (see "Materials and methods") and virus S-SPV-001 in the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECOMBINANT SPV. The transfection material was screened by SCREENING FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL EVALUATIONS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-230. This virus was assessed for the expression of β-galactosidase, purity and insert stability by multiple passages monitored by the blue plate titration, as described in "Materials and methods". After the first three rounds of purification, all the plates observed were blue, indicating that the virus was pure, stable and expressing the foreign gene. The S-SPV-230 was evaluated for the expression of feline CD28 specific antigens using the BLACK PLATE SCREENING FOR EXPRESSION OF STRANGE GENE IN RECOMBINANT SPV. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines. To confirm the expression of the feline CD80 gene product, the cells are infected with S-SPV-230 and samples of infected cell lysates were subjected to polyacrylamide gel electrophoresis. The gel was labeled and analyzed using the WESTERN TRANSFER PROCEDURE. The S-SPV-230 is useful as a vaccine against feline diseases. S-SPV-230 improves the effectiveness of vaccines against FIV, FeLV, FIP or other feline diseases when used alone or in combination with FIV, FeLV, FIP or other feline vaccines. S-SPV-230 is also useful for the expression of CD80 polypeptide. The cell lysate of infected cells S-SPV-230 is injected into mice or rabbits to increase the monospecific, polyclonal antibodies to feline CD80.

Example 4 S-SPV-225 S-SPV-225 is a swinepox virus that expresses at least two foreign genes. The gene for β-galactosidase from E. coli (lacZ) and the gene for inteferon-? feline (feline IFN-?) were inserted into the Accl SPV site within the larger Bglll subfragment to the HindIII of the SPV Hind IIIM genomic fragment (a single restriction site Notl has replaced a single Accl restriction site). The lacZ gene is under the control of the OlL promoter of pig pox and the IFN-α gene. Feline is under the control of the synthetic late / early promoter (LP2EP2). The S-SPV-225 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 917-60. B9 (see "Materials and methods") and virus S-SPV-001 in the RECOMBINATION HOMOLOGOUS PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection material was screened by SCREENING FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL ASSESSMENT AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-225. This virus was evaluated for β-galactosidase expression, purity and insert stability by multiple passages monitored by blue plate titration, as described in "Materials and methods". After the first three rounds of purification, all the plates observed were blue, indicating that the virus was pure, stable and expressing β-galactosidase. S-SPV-225 was assessed for the expression of specific IFN-γ antigens. felines using the BLACK PLATE SCREENING FOR EXPRESSION OF STRANGE GENE IN RECOMBINANT SPV. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines. To confirm the expression of the gene product IFN-? feline, the cells are infected with S-SPV-225 and samples of infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. The gel was labeled and analyzed using the WESTERN TRANSFER PROCEDURE. S-SPV-225 was assessed for the expression of IFN-? feline bioactive using the BIOACTIVITY SCREENING FELINE INTERFERON RANGE EXPRESSED FROM SPV, RPV or FHV RECOMBINANT USING VSV PLATE REDUCTION. S-SPV-225 is useful as a vaccine against feline diseases. S-SPV-225 improves the effectiveness of vaccines against FIV, FeLV, FIP or other feline diseases when used alone or in combination with FIV, FeLV, FIP or other feline vaccines.

Example 5 S-SPV-220: S-SPV-200 is a swinepox virus expressing three foreign genes. The genes for feline immunodeficiency virus (FIV) gag / protease and envelope of FIV (full length) and the gene for beta-galactosidase of E. coli (lacZ) were inserted into a single Not I restriction site (Not I bonds inserted into a single Accl restriction site in the OlL ORF of the SPV Hind IIIM fragment). The FIV envelope and gag / protease genes are under the control of the synthetic but separate synthetic late / early promoter (LP2EP2). The lacZ gene is under the control of the synthetic late promoter (LP1).

The S-SPV-200 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 904-63. B7 and S-SPV-001 virus in the HOMOLOGA RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection material was screened by SCREENING FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL EVALUATIONS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-157. This virus was assessed for β-galactosidase expression by means of blue plate titration, as described in "Materials and methods". The analysis of purity and stability of insert after 5 passages was made via the detection of gag VIF and ß-galactosidase in black plate titration and the detection of VIF gag and envelope in western blot evaluation. S-SPV-200 is a recombinant swinepox virus that expresses the FIV protease / gag proteins and FIV envelope and is useful as a vaccine in felids against FIV infection. S-SPV-200 is also useful for the expression of FIV envelope proteins and gag / protease.

EXAMPLE 6 S-SPV-233: S-SPV-233 is a pigpox virus that expresses five foreign genes: gagVIF, envVIF, Felino CD80, E.coli lacZ and E.coli uidA. The full-length feline CD80 gene and the E. coli β-glucuronidase gene (uidA) were inserted into a single Not I restriction site (the Not I linkers inserted into a single EcoRI restriction site within a region of approximately 3.2 kb (SEQ ID NO) of the SPV HindIII K fragment of 6.7 kb). Genes for feline immunodeficiency virus (FIV) gag / protease, and FIV envelope (full-length) and the gene for β-glucuronidase (lacZ) of E. coli were inserted into a single restriction site Not I ( Not I linkers inserted into a single Accl restriction site in the OlL ORF of the SPV Hind III M fragment). The CD80 gene is under the control of the late / early synthetic promoter (LP2EP2) and the uidA gene is under the control of a single, separate early synthetic promoter (EP2). The FIV envelope and gag / protease genes are under the control of the separate but identical synthetic late / early promoter (LP2EP2). The lacZ gene is under the control of the synthetic late promoter (LP1). (International PCT Application WO 96/22363, incorporated herein by reference). S-SPV-233 was derived from S-SPV-200 (contains VIF gag genes, VIF envelope and E.coli lacZ). This was achieved using the homology vector 931-21. Al and S-SPV-200 virus in the HOMOLOGA RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection material was screened by SCREENING FOR RECOMBINANT SPV EXPRESSING β-glucuronidase (X-gLUC and SCREENING FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of the blue / green purification will be the recombinant virus designated S-SPV-233. S-SPV-233 is evaluated for the expression of FIV gag antigens, FIV envelope, and specific feline CD80 using BLACK PLATE SCREENING FOR EXPRESSION OF STRANGE GENE IN RECOMBINANT SPV. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines. S-SPV-233 is evaluated for the expression of feline CD80 specific antigens using SCREENING FOR THE EXPRESSION OF CD80 (B7-1) and CD86 (B7-2) FELINES IN SPV, RPV or VHF USING BLACK PLATE ASSESSMENTS. It is shown that a human CTL-4 / Fc chimeric antibody reacts specifically with S-SPV-233 plates (expressing feline CD80) and not with negative control plates S-SPV-001. It is shown that all S-SPV-233 plates observed react with the chimeric antibody CTLA-4 / Fc that indicates that the virus is stably expressing the feline CD80 foreign gene. To confirm the expression of the gag gene product from VIF gag, FIV envelope, and feline CD80, cells were infected with S-SPV-233 and samples from the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. The gel is transferred and analyzed using the WESTERN TRANSFER PROCEDURE. S-SPV-233 is a recombinant swinepox virus that expresses FIV protease / gag proteins and FIV envelope and is useful as a vaccine for felids against FIV infection. S-SPV-233 is also useful for the expression of FIV envelope proteins and gag / protease.

Example 7 S-SPV-235: S-SPV-235 is a swinepox virus expressing five foreign genes: FIV gag, FIV envelope, IFN-γ. of feline, lacZ of E.coli and uidA of E.coli. The IFN-? Gene of full-length feline and the gene for ß-glucuronidase from E. coli (uidA) were inserted into a single restriction site Not I (Not I linkers inserted into a single EcoRI restriction site within a region of approximately 3.2 kb (SEQ ID NO) of the HindIII K SPV fragment of 6.7 kb). Genes for feline immunodeficiency virus (FIV) gag / protease, and of VIF envelope (full-length) and the gene for β-galactosidase (lacZ) of E.coli were inserted into a single Not I restriction site (Not I linkers inserted at a single Accl restriction site in the ORF OlL fragment Hind III M SPV). The IFN-? Gene it is under the control of the late / early synthetic promoter (LP2EP2) and the uidA gene is under the control of a single, separate early synthetic promoter (EP2). The FIV envelope and gag / protease genes are under the control of the separate but identical synthetic late / early promoter (LP2EP2). The lacZ gene is under the control of the synthetic late promoter (LP1). S-SPV-235 was derived from S-SPV-200 (contains VIF gag genes, VIF envelope and E. coli lacZ). This was achieved using the homology vector 931-55. B12 and S-SPV-200 virus in the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECOMBINANT SPV. The transfection material was screened by SCREENING FOR RECOMBINANT SPV EXPRESSING β-glucuronidase (X-GLUC and SCREENING FOR RECOMBINANT HERPES VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of the blue / green purification is the recombinant virus designated S-SPV-235. S-SPV-235 is evaluated for the expression of VIF gag antigens, VIF envelope, and IFN-α Species of felines using the BLACK PLATE SCREENING FOR EXPRESSION OF STRANGE GENE IN RECOMBINANT SPV. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines. The S-SPV-225 is valued for the expression of IFN-? feline bioactive using the BIOACTIVITY SCREENING FELINE GAMMA INTERFEREX EXPRESSED SPV, RPV or VHF USING UVS PLATE REDUCTION. To confirm the expression of the VIF gag gene product, VIF envelope, and IFN-? of feline, cells were infected with S-SPV-235 and samples of the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. The gel is transferred and analyzed using the WESTERN TRANSFER PROCEDURE. S-SPV-235 is a recombinant swinepox virus that expresses the FIV protease / gag proteins and FIV envelope and is useful as a vaccine for felids against FIV infection. S-SPV-235 is also useful for the expression of the gag / protease and envelope proteins of FIV.

Example 8 S-SPV-224: S-SPV-224 is a swinepox virus expressing three foreign genes. The genes for feline leukemia gag / protease virus (FeLV) and envelope FeLV (full length) and the gene for E.coli (lacZ) were inserted into a 15L SPV deletion site derived from a partial HindIII N genomic fragment SPV of 1869 bp. The gag / protease gene of FeLV is under the control of the synthetic early smallpox (EP2) promoter. The envelope gene of FeLV is under the control of the synthetic early smallpox promoter (EP1). The lacz gene is under the control of the constitutive late promoter SPV 15L. S-SPV-224 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 921-65. B5 and virus S-SPV-001 in the RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION OF RPV, SPV or RECOMBINANT FVH. The transfection material was screened by SCREENING FOR SPV or SPV FHV RECOMBINANT expressing β-galactosidase (X-GLUCO VALORATIONS). The final result of the red plaque purification was the recombinant virus designated S-SPV-224. This virus was acid for β-galactosidase expression by blue plate acids, as described in "Materials and methods". S-SPV-224 is evaluated for the expression of gag / protease proteins of FeLV, envelope of FeLV and β-galactosidase using SCREENING FOR EXPRESSION OF STRANGE GENE IN RPV, SPV OR FHV RECOMBINED USING BLACK PLATE ASSESSMENTS. The assays described here that were carried out on ESK-4 cells would be a suitable substrate for the production of vaccines for recombinant SPV. August 14, 1998. To confirm the expression of the FeLV gene gag / protease and FeLV envelope products, the cells are infected with S-SPV-224 and the samples of the infected cell lysates are subjected to gel electrophoresis. of SDS polyacrylamide. The gel is transferred and analyzed using the WESTERN TRANSFER PROCEDURE. S-SPV-224 is a recombinant swinepox virus that expresses the gag / protease proteins of FeLV and the envelope of FeLV and is useful as a vaccine for felids against infectious FeLV. S-SPV-224 is also useful for the expression of the gag / protease and envelope proteins of FIV.

EXAMPLE 9 S-SPV-246: S-SPV-246 is a swinepox virus that expresses five foreign genes: FeLV gag / protease, FeLV envolvnete, feline CD80, E.coli lacZ, and uidA E.coli. The full-length feline CD80 gene and the gene for β-galactosidase E. coli (uidA) were inserted into a unique Not I restriction site (the Not I linkers inserted into a single EcoRI restriction site within a region of approximately 3.2 kb of the HindIII k SPV fragment of 6.7 kb). The CD80 gene is under the control of the synthetic late / early promoter (LP2EP2) and the uidA gene is under the control of the EP2 synthetic early smallpox promoter. The gag / protease genes of FeLV, FeLV envelope (full-length) and β-galactosidase (lacZ) genes of E. coli were inserted into an I5L deletion site derived from a partial N 1869 genomic fragment HindIII. The gag / protease gene of FeLV is under the control of the early synthetic smallpox promoter, EP2. The envelope gene of FeLV is under the control of the early smallpox synthetic promoter, EP1. The lacZ gene is under the control of the late smallpox constitutive promoter, 15L. (The International PCT Application WO 96/22263 is incorporated herein by reference). The S-SPV was derived from S-SPV-224 (contains the gag / protease gene of FeLV, Envelope of FeLV and lacZ of E.coli in the fragment HindIII N partial of 1869 kb of deletion 15L). This was achieved using the homology vector 931-21. Al and the S-SPV-224 virus in the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECRUITING VPN, SPV OR FHV. The transfection material was screened by SCREENING FOR RPV OR SPV OR RECOMBINANT FHV EXPRESSING β-galactosidase (BLUOGAL VALUATIONS AND CPRG) OR β-galactosidase (VALUATION X-GLUC). The final result of the blue / green purification will be the recombinant virus designated S-SPV-246. The S-SPV-246 is evaluated for the expression of FeLV envelope proteins and gag / FeLV protease using the SCREENING FOR EXPRESSION OF STRANGE GENE IN RPV, SPV OR RECOMBINANT FHV USING BLACK PLATE ASSESSMENTS. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines. S-SPV-246 is titrated for specific feline CD80 expression using SCREENING FOR EXPRESSION CD80 (B7-1) AND CD86 (B7-2) IN SPV, RPV OR FHV USING BLACK PLATE ASSESSMENTS. It is shown that a human CTL-4 / Fc chimeric antibody reacts specifically with S-SPV-246 plates (which express feline CD80) and not with negative S-SPV-001 control plates. It is shown that all the S-SPV-246 plates observed react with the chimeric antibody CTLA-4 / Fc human, indicating that the virus is stably expressing the feline CD80 stranger gene. To confirm the expression of the gag / protease gene product of FeLV, FeLV envelope and feline CD80, cells were infected with S-SPV-235 and samples of the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. . The gel is transferred and analyzed using the WESTERN TRANSFER PROCEDURE. S-SPV-246 is a recombinant swinepox virus that expresses the gag / protease proteins of FeLV and the envelope of FeLV and is useful as a vaccine for felids against FeLV infections. S-SPV-246 is also useful for the expression of the gag / protease and envelope proteins of FeLV.

EXAMPLE 10 Additional examples of recombinant swinepox viruses, which are useful as a vaccine against feline immunodeficiency virus (FIV), feline leukemia virus (FeLV) or feline infectious peritonitis (FIP) are: A recombinant smallpox virus of Pig expresses five strange genes. The VIF envelope gene is under the control of the EPI early synthetic pox promoter; the VIF gag / protease gene is under the control of the EP2 synthetic early smallpox promoter; the E.coli lacZ gene is under the control of the I5L pig pox promoter; the feline CD80 gene is under the control of the late / early synthetic pox promoter LP2EP2; the idA gene of E. coli is under the control of EP2 synthetic early pox promoter. The envelope gene of FIV, the gag / protease genes of FIV and lacZ of E. coli are located in a different and different non-essential SPV insertion site from the E. coli uidA and feline CD80 gene insertions. A recombinant swinepox virus expresses five foreign genes. The VIF envelope gene is under the control of the EPI early synthetic pox promoter; the VIF gag / protease gene is under the control of the EP2 synthetic early smallpox promoter; the lacZ gene of E. coli is under the control of the I5L promoter of pig pox; the feline CD86 gene is under the control of the late / early synthetic pox promoter LP2EP2; the idA gene of E. coli is under the control of EP2 synthetic early pox promoter. The VIF envelope gene, the VIF gag / protease and E.coli lacZ genes are located in a different and different non-essential SPV insertion site from the insertion of E.coli uidA and feline CD86. A recombinant swinepox virus expresses five foreign genes. The feline CD86 gene is under the control of the late / early synthetic pox promoter LP2EP2; the E. coli uidA gene is under the control of EP2 synthetic early pox promoter. This virus has been used alone or in combination with other proteins or recombinant vaccines. Additional examples of recombinant swinepox viruses that are useful for the production of vaccines against FeLV disease would be the same as those described above, with the exception of the replacement of the VIF gene with the comparable FeLV-specific genes. Additional examples of recombinant swinepox viruses which are useful for the production of proteins to be used as a vaccine for the production and purification of polyclonal antibody are: A recombinant swinepox virus expresses a foreign gene. The feline CD80 gene lacking transmembrane domain is under the control of the late / early smallpox synthetic promoter, LP2EP2. Alternatively, the feline CD80 gene lacking the transmembrane domain has a histidine tag fusion at the carboxyl terminus, to allow purification on an affinity column with nickel. A recombinant virus of pig pox expresses a foreign gene. The feline CD28 gene lacking transmembrane domain is under the control of the late / early smallpox synthetic promoter, LP2EP2. Alternatively, the feline CD28 gene lacking the transmembrane domain has a histidine tag fusion at the carboxyl terminus, to allow purification on an affinity column with nickel. A recombinant virus of pig pox expresses a foreign gene. The feline CD86 gene lacking the transmembrane domain is under the control of the late / early smallpox synthetic promoter, LP2EP2. Alternatively, the feline CD86 gene lacking the transmembrane domain has a histidine tag fusion at the carboxyl terminus, to allow purification on an affinity column with nickel. Additional examples of recombinant swinepox viruses using both CD80 and CD86 and which are useful for the development of vaccines for FIV and FeLV diseases in felids are: A recombinant swinepox virus expresses five foreign genes. The CD86 gene and feline CD80 gene are expressed in a bicistronic cassette under the control of the synthetic late / early smallpox promoter, LP1EP2, which drives the transcription of CD80 and CD86 and which includes an IRES EMCV element between the two reading frames open; the uidA gene of E.coli is under the control of the early synthetic promoter, EP2. The VIF gag / protease gene is under the control of the pig pox promoter, OlL; the LacZ gene of E.coli is under the control of the late synthetic smallpox promoter, LP1. The CD80 / CD86 genes and the E. coli uidA are contained in a different and non-essential SPV insertion site of the insertions of the E.coli lacZ gene and FIV gag / protease.

A recombinant swinepox virus expresses five foreign genes. The feline CD86 gene and the CD-80 genes are expressed in a bicistronic cassette under the control of the late / early smallpox synthetic promoter, LP1, which drives the transcription of CD80 and CD86 and which includes an IRES EMCV element between the two frames of open reading; the lacZ gene of E. coli is under the control of the late synthetic promoter, LP1. The VIF envelope gene is under the control of the early smallpox synthetic promoter, EP1. The uidA gene of E. coli is under the control of the late synthetic smallpox promoter, LP1. The CD80 / CD86 and the uidA gene of E. coli are contained in a different and distinct SPV insertion site, non-essential of the gag / protease VIF and lacZ insertions of E. coli. A recombinant swinepox virus expresses six foreign genes. The feline CD86 gene and the CD80 gene expressed in a bicistronic cassette under the control of the late synthetic smallpox promoter, LP1, which drives the transcription of CD80 and CD86 and which includes an IRES EMCV element between the two open reading frames; the uidA gene of E.coli is under the control of the early synthetic promoter, EP2. The VIF gag / protease gene is under the control of the early small pox promoter, EP2; the VIF envelope gene is under the control of the early smallpox synthetic promoter, EP1; the LacZ gene of E. coli is under the control of the constitutive promoter of smallpox 15L. The CD80 / CD86 genes and the E. coli uidA are inserted at a site other than the insertion of the VIF envelope gene insert, VIF gag / protease and E.coli LacZ. Additional poxpox viruses for use as FeLV vaccines for felids would be constructed as described above, replacing the VIF genes with comparable FeLV gene constructs.

EXAMPLE 11 Additional examples of recombinant raccoon pox virus, which are useful as a vaccine against feline diseases, such as, for example, feline immunodeficiency virus (FIV), feline leukemia virus (FeLV) or feline infectious peritonitis (FIP) ) are: A recombinant raccoon pox virus expresses two foreign genes. The feline CD86 is under the control of the late / early synthetic pox promoter LP2EP2; the lacZ gene of E. coli is under the control of the late synthetic smallpox promoter Ll. Additional examples of recombinant raccoonpox virus which are useful for the production of proteins for use as a vaccine or for the production and purification of polyclonal antibodies. A recombinant raccoon pox virus expresses a foreign gene. The feline CD80 gene lacking the transmembrane domain is under the control of the late / early smallpox synthetic promoter LP2EP2. Alternatively, the feline CD80 gene lacking the transmembrane domain has a histidine tag fusion at the carboxyl terminus to allow purification on an affinity column with nickel. A recombinant raccoon pox virus expresses a foreign gene. The feline CD28 gene lacking the transmembrane domain is under the control of the late / early smallpox synthetic promoter LP2EP2. Alternatively, the feline CD28 gene lacking the transmembrane domain has a histidine tag fusion at the carboxyl terminus to allow purification on a nickel affinity column. A recombinant raccoon pox virus expresses a foreign gene. The feline CD86 gene lacking the transmembrane domain is under the control of the late / early smallpox synthetic promoter LP2EP2. Alternatively, the feline CD86 gene lacking the transmembrane domain has a histidine tag fusion at the carboxyl terminus to allow purification on a nickel affinity column. A recombinant raccoon pox virus expresses four foreign genes. The CD86 gene and feline CD-80 gene expressed in a bicistronic cassette under the control of the late / early smallpox synthetic promoter, LP2EP2, which drive the transcription of CD80 and CD86 and which include an IRES EMCV element between the two frames of open reading that drive the translation of the 2nd. gene in 3 'direction, CD80; the VIF gag gene is under the control of the pig pox promoter, OlL; the uidA gene of E.coli is under the control of the early synthetic promoter of smallpox E2. A recombinant raccoon pox virus expresses four foreign genes. The CD86 gene and the feline CD-80 gene expressed in a bicistronic cassette under the control of the late / early synthetic promoter of smallpox LP2EP2, which drive the transcription of CD80 and CD86 and which include an IRES EMCV element between the two open reading frames that drive the translation of the 2nd. gene in the 3 'direction, CD80; the VIF envelope gene is under the control of the early smallpox synthetic promoter, El; the uidA gene of E.coli is under the control of the early synthetic promoter of smallpox E2. A recombinant raccoon pox virus expresses five foreign genes. The CD86 gene and the feline CD-80 gene expressed in a bicistronic cassette under the control of the synthetic late / early smallpox promoter, LP2EP2, that drive the transcription of CD80 and CD86 and that include an IRES EMCV element between the two reading frames open that drive the translation of the 2nd. gene in the 3 'direction, CD80; the VIF gag gene is under the control of the pig pox promoter, OlL; the VIF envelope gene is under the control of the early smallpox synthetic promoter, El; the E. coli uidA gene is under the control of the early smallpox synthetic promoter, E2. Additional examples of recombinant raccoon pox viruses that are useful as a vaccine against feline disease, such as, for example, feline immunodeficiency virus (FIV), feline leukemia virus (FeLV) or feline infectious peritonitis (FIP) are : A recombinant raccoon pox virus expresses two foreign genes. The feline CD86 is under the control of the late / early synthetic pox promoter LP2EP2; The lacZ gene of E.coli is under the control of the late synthetic smallpox promoter LP1. Additional examples of recombinant raccoonpox virus using both CD80 and CD86 and which are useful for the development of vaccines for FIV and FeLV diseases in felids are: A recombinant raccoon pox virus expresses four foreign genes. The CD86 gene and the feline CD-80 gene expressed in a bicistronic cassette under the control of the late synthetic pox promoter LP1, which drive the transcription of CD80 and CD86 and which include an IRES EMVC element between the two open reading frames. The VIF gag / protease gene is under the control of the late / early smallpox synthetic promoter, LP2EP2; the uidA gene of E. coli is under the control of the early smallpox synthetic promoter, EP2. The genes CD80 / CD86, gag / protease of FIV and uidA are all inserted into a single non-essential RPV site. A recombinant raccoon pox virus expresses four foreign genes. The CD86 gene and the feline CD-80 gene expressed in a bicistronic cassette under the control of the late / early synthetic promoter of pox LP2, which drives the transcription of CD80 and CD86 and which includes an IRES EMVC element between the two open reading frames; the lacZ gene of E.coli is under the control of an early synthetic smallpox promoter, El; the E. coli uidA gene is under the control of the early smallpox synthetic promoter, E2. The CD80 / CD86, FIV envelope and uidA genes are all inserted into a single non-essential RPV site. A recombinant raccoon pox virus expresses six foreign genes. The CD86 genes and the feline CD-80 genes expressed in a bicistronic cassette under the control of the late synthetic promoter of LP1 pox, which drive the transcription of CD80 and CD86 and which include an IRES EMVC element between the two open reading frames; The E.coli lacZ gene is under the control of the late synthetic smallpox promoter. The VIF gag / protease gene is under the control of the early synthetic promoter, EP2; the VIF envelope gene is under the control of the early smallpox synthetic promoter, EP2; the VIF envelope gene is under the control of the early smallpox synthetic promoter, EPI; the uidA E. coli gene is under the control of the lacZ genes of E.coli that are inserted at a site other than the insertion of the VIF envelope gene, the VIF gag / protease and the insertion of the uidA gene of E. coli. coli. Additional recombinant raccoon poxviruses for use as a FeLV vaccine for felids would be constructed as described above, replacing the FIV genes with the comparable FeLV genes.

EXAMPLE 12 S-FHV-020 S-FHV-020 is a recombinant feline herpes virus that has a deletion of the entire gE gene of FHV (1638 base pairs) an insertion of the lacZ gene of E. coli is a gE site of deletion. The lacZ gene of E.coli is under the transcriptional control of the constitutive FHV gE promoter. S-FHV-020 was derived from S-FHV-001 (strain NVSL). This was achieved using the homology vector 486-88. B17 and the S-FHV-001 virus in the RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION RPV, SPV 0 FHV RECOMBINANT. The transfection material was screened by means of the SCREENING FOR RPV OR SPV OR RECOMBINANT FHV EXPRESSING β-galactosidase (BLUOGAL VALUATIONS and CPRG) OR β-galactosidase (VALUATION X-GLUC). The final result of blue plate purification was the recombinant virus designated S-FJV-020. The analysis of purity and stability inserted after 5 passages was made via detection of β-galactosidase in the SCREENING FOR THE EXPRESSION OF STRANGE GENE IN RPV, SPV OR FHV USING BLACK PLATE ASSESSMENTS.

EXAMPLE 13 S-FHV-031 S-FHV-031 is a recombinant feline herpes virus that has a deletion of the entire gE gene of FHV of 1638 base pairs and an insertion of three foreign genes at the gE deletion site. The CD80 gene is under the transcriptional control of the constitutive FHV gE promoter and is oriented in the same direction as the deletion gE gene. The VIF gag / protease gene is under the control of the gX promoter of the pseudorabies and the envelope gene of FIV is under the control of the cytomegalovirus immediate early promoter. Envelope and gag / protease genes are oriented in the same direction with respect to each other, but opposite in orientation towards the CD80 gene. S-FHV-031 was derived from S-FHV-020 (contains the Lac Z gene from E. coli behind the gE promoter). This was achieved using the homology vector 942-03. C6 (see "Materials and methods") and virus S-FHV-020 in the RECOMBINATION HOMOLOGA RPV, SPV or FHV. The transfection material was screened by means of the SCREENING FOR RPV OR SPV OR RECOMBINANT FHV EXPRESSING β-galactosidase in BLUOGAL VALUATIONS AND CPRG) or β-glucuronidase (VALUATION X-GLUC). The recombinant plaques are selected and purified by white plate selection. This virus is characterized by restriction endonuclease mapping and the SOUTHERN TRANSFER DNA procedure. This analysis confirms the insertion of the FIV envelope, FIV gag / protease and feline CD80 genes and deletion of the FIV gE gene of 1638 base pairs. (The International PCT Application WO 96/13575 is incorporated herein by reference). S-FHV-031 in the present example is assessed by expression of FIV envelope-specific antigens, FIV gag / protease and feline CD80 using the WESTERN TRANSFER PROCEDURE. The assays described here were performed on CRKF cells, which indicate that CRFK cells would be a suitable substrate for the production of recombinant FHV vaccines. The lysate from cells infected with recombinant feline herpes virus exhibited band in the expected size of feline CD80 protein, FIV gag / protease and FIV envelope. S-FHV-031 in the present example is assessed by expression of specific feline CD80 antigens using SCREENING FOR EXPRESSION OF CD86 (B7-2) and CD80 (b7-l) FELINE IN SPV, RPV OR RECHBINING FHV USING ASSESSMENTS OF BLACK PLATE. A human CTL-4 / Fc chimeric antibody is shown to react specifically with recombinant feline herpes virus (which expresses feline CD80) plates and not with negative SFHV-001 control plates. All the observed plaques of recombinant feline herpes virus are shown to react with the human chimeric antibody CTLA-4 / Fc which indicate that the virus is stably expressing the feline CD80 foreign gene. S-FHV-031 is a recombinant feline herpes virus that expresses feline FIV envelope, VIF and CD80 envelope, gag / protease proteins and is useful as a vaccine for felids against FIV infection Example 14 A feline recombinant herpes virus has a deletion of the gE gene and an insertion of at least one foreign gene at the gE deletion site. The foreign gene is the feline CD86 gene and is under the transcriptional control of the gE promoter of FHV. The feline recombinant herpes virus CD86 is useful as a vaccine against feline diseases. The feline recombinant herpes virus improves the efficacy of vaccines against FIV, FeLV, FIP or other feline diseases, when used alone or in combination with FIV, FeLV, FIP or other feline vaccines.

EXAMPLE 15 Additional examples of feline recombinant herpes virus useful as a vaccine against feline immunodeficiency virus (FIV), feline leukemia virus (FeLV) or feline infectious peritonitis (FIP) are: A feline recombinant herpes virus expresses three genes strangers. In the gE deletion sites of the FHV. The envelope gene of FeLV is under the control of the gX promoter of pseudorabies; the VIF gag gene is under the control of the cytomegalovirus immediate early promoter; the feline CD80 gene is under the control of the gE promoter of the feline herpes virus. A feline recombinant herpes virus expresses three foreign genes at the gE deletion site of FHV. The envelope gene of FeLV is under the control of the gX promoter of pseudorabies; the VIF gag gene is under the control of the cytomegalovirus immediate early promoter; the feline CD86 gene is under the control of the gE promoter of the feline herpes virus. A feline recombinant herpes virus expresses three foreign genes. In the deletion site gE of the FHV. The envelope gene of FeLV is under the control of the gX promoter of pseudorabies; the gag gene of FeLV is under the control of the cytomegalovirus immediate early promoter; the feline CD86 gene is under the control of the gE promoter of feline herpes virus. A feline recombinant herpes virus expresses five foreign genes. The CD86 gene and the feline CD80 gene are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES element of EMCV between the two open reading frames; the E. coli uidA gene is under the control of the infectious laryngotracheitis virus gl promoter. CD80, CD86 and the uidA gene of E. coli are inserted into the only long region of the FHV genome at a particular site to be non-essential. The gag / protease gene of FIV is under the control of the immediate early promoter of cytomegalovirus and the lacZ gene of E.coli under the control of the gX promoter of pseudorabies are inserted into the gE site of FHV deletion. A feline recombinant herpes virus expresses five foreign genes. The cd86 gene and the feline CD80 gene are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86. The translation of the second open reading frame of the CD80 in the 3 'direction is under the control of an EMCV IRES element. The uidA gene of E.coli is under the control of the infectious laryngotracheitis virus gl promoter. The CD80, CD86 and uidA genes of E.coli are inserted into the only long region of the FHV genome at a particular site to be non-essential. The envelope gene of FIV under the control of the immediate early promoter of cytomegalovirus and the lacZ gene of E. coli under the control of the gX promoter of pseudorabies are inserted into the gE site of FHV deletion. A feline recombinant herpes virus expresses six foreign genes. The CD86 gene and the feline CD80 gene are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES element of EMCV between the two open reading frames. The uidA gene of E.coli is under the control of the infectious laryngotracheitis virus gl promoter. The CD80, CD86 and uidA genes of E. coli are inserted into the single long reagent of the FHV genome at a non-essential site. The envelope gene of FIV under the control of the cytomegalovirus immediate early promoter; the gag / protease gene of FIV under the gX promoter of the pseudorabies virus and the lacZ gene of E.coli under the control of the gH promoter of the FHV are inserted into the gE site of FHV deletion. A feline recombinant herpes virus expresses five foreign genes. The feline CD86 gene and the CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES element of EMCV between the two open reading frames; the E. coli uidA gene is under the control of the infectious laryngotracheitis virus gl promoter. The CD80, CD86 and uidA genes of E.coli are inserted into the only long region of the FHV genome at a non-essential site. The gag / protease gene of FeLV under the control of the cytomegalovirus immediate early promoter and the E. coli lacZ gene under the control of the pseudorabies gX promoter are inserted into the deletion gE site of FHV. A feline recombinant herpes virus expresses five foreign genes. The feline CD86 gene and the feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86. The translation of the 2nd. CD80 open reading frame in the 3 'direction is under the control of an EMCV IRES element. The uidA gene of E.coli is under the control of the gl promoter of the infectious laryngotracheitis virus. The CD80, CD86 and uidA genes of E.coli are inserted into the only long region of the FHV genome at a non-essential site. The envelope gene of FeLV under the control of the cytomegalovirus immediate early promoter and the E. coli lacZ gene under the control of the pseudorabies gX promoter are inserted into the deletion site of the FHV gE. A feline recombinant herpes virus expresses six foreign genes. The feline CD86 gene and the feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES element of EMCV between the two open frames. The uidA gene of E.coli is under the control of the gl promoter of the infectious laryngotracheitis virus. The CD80, CD86 and uidA genes of E.coli inserted into the only long region of the FHV genome at a non-essential site. The envelope gene of FeLV under the control of the cytomegalovirus immediate early promoter; the gag / protease gene of FeLV under the gX promoter of pseudorabies virus and the lacZ gene of E.coli under the control of the gE promoter of FHV are inserted into the gE site of FHV deletion.

EXAMPLES 17 A feline recombinant herpes virus has a deletion of the gE gene and an insertion of at least one foreign gene in the deletion gE site. The foreign gene is the feline CD80 gene and is under the transcriptional control of the gH promoter of FHV. The recombinant feline hypervirus is derived from S-FHV-001 (strain NVSL). This is achieved using the homology vector .926-76. D7 (see "Materials and methods") and the virus S-FHV-001 in the RECOMBINANT PROCEDURE HOMOLOGOUS FOR GENERATION OF RECOMBINANT HERP VIRUS. The transfection material is screened by the SCREENING FOR RECOMBINANT HERPES VIRUS EXPRESSING ENZYMATIC MARKERS GENES. This virus is characterized by the mapping of the restriction endonuclease and the TRANSFER SOUTHERN DNA procedure. This analysis confirms the insertion of the feline CD80 gene and the deletion of the gE gene of the FHV of 1638 base pairs.

(The PCT international application WO 96/13575 is incorporated herein by reference). The recombinant feline herpes virus in the present example is assessed by the expression of the feline CD80 specific antigen using the BLACK PLATE SCREEN FOR EXPRESSION OF THE STRANGE GENE IN RECOMBINANT FHV. The assays described here were carried out on CRFK cells, indicating the CRFK cells that would be a suitable substrate for the production of vaccines for recombinant RPV. The feline recombinant herpes virus in the present example was assessed by the expression of the feline CD80 specific antigen using the SCREENING FOR EXPRESSION OF CD80 (B7-1) and CD86 (B7-2) FELINE IN SPV, RPV OR FHV RECOMBINANT USING BLACK PLATE ASSESSMENTS. A human CTL-4 / Fc chimeric antibody that reacts specifically with feline recombinant herpesvirus (expressing feline CD80) and not S-FHV-001 negative control plates is shown. All observed plaques of feline recombinant herpes virus were shown to react with the human CTLA-4 / Fc chimeric antibody which indicates that the virus is stably expressing the feline CD80 foreign gene. To confirm the expression of the feline CD80 gene product, the cells were infected with the recombinant feline herpes virus of the present example and the samples of the infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was transferred and analyzed using the WESTERN TRANSFER PROCEDURE. The lysate of cells infected with feline recombinant herpes virus exhibited a band in the expected size of feline CD80 protein.

Example 18 A feline recombinant herpes virus has a deletion of the gE gene and an insertion of at least one foreign gene in the deletion gE site. The foreign gene is the feline CD86 gene and is under the transcriptional control of the gE promoter of FHV. The recombinant feline hypervirus expressing feline CD86 is useful as a vaccine against feline diseases. The feline recombinant herpes virus improves the efficacy of vaccines against FIV, FeLV, FIP or other feline diseases when used alone or in combination with FIV, FeLV, FIP or other feline vaccines.

Examples 19 Additional examples of feline recombinant herpes virus useful as feline immunodeficiency virus (FIV) vaccine, feline leukemia virus (FeLV) or feline infectious peritonitis (FIP) are: A feline recombinant herpes virus expresses three strange genes. The envelope gene of FIV is under the control of the gX promoter of pseudorabies; the VIF gag gene is under the control of the cytomegalovirus immediate early promoter; the feline CD80 gene is under the control of the gE promoter of the feline herpes virus. A feline recombinant herpes virus expresses three foreign genes. The envelope gene of FeLV is under the control of the gX pseudorabies promoter; the gag gene of FeLV is under the control of the cytomegalovirus immediate early promoter; the feline CD80 gene is under the control of the gE promoter of the feline herpes virus. A feline recombinant herpes virus expresses three foreign genes. The envelope gene of FIV is under the control of the gX promoter of pseudorabies; the VIF gag gene is under the control of the cytomegalovirus immediate early promoter; the feline CD86 gene is under the control of the gE promoter of the feline herpes virus. A feline recombinant herpes virus expresses three foreign genes. The envelope gene of FeLV is under the control of the gX pseudorabies promoter; the gag gene of FeLV is under the control of the cytomegalovirus immediate early promoter; the feline CD86 gene is under the control of the gE promoter of the feline herpes virus. A feline recombinant herpes virus expresses five foreign genes. The CD86 gene and feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES EMCV element between the two open reading frames that drive the translation of the 2nd. gene in the 3 'direction, CD80; the uidA gene of E. coli is under the control of the gl promoter of the infectious laryngotracheitis virus; the VIF gag gene is under the control of the cytomegalovirus immediate early promoter; the lacZ gene of E. coli is under the control of the gX promoter of the pseudorabies. The five foreign genes are contained in two different insertion sites of the feline herpes virus. A feline recombinant herpes virus expresses five foreign genes. The CD86 gene and feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86. The Translation of the 2nd. open reading frame of the CD80 in the 3 'direction is under the control of an IRES EMCV element; the uidA gene of E. coli is under the control of the gl promoter of the infectious laryngotracheitis virus; the envelope gene of FIV is under the control of the cytomegalovirus immediate early promoter; the lacZ gene of E. coli is under the control of the gX promoter of the pseudorabies. A feline recombinant herpes virus expresses six foreign genes. The CD86 gene and feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES EMCV element between the two open reading frames that drive the translation of the 2nd. gene in the 3 'direction, CD80; the uidA gene of E. coli is under the control of the gl promoter of the infectious laryngotracheitis virus; the VIF gag gene is under the control of the cytomegalovirus immediate early promoter; the VIF envelope gene is under the control of the cytomegalovirus immediate early promoter; the lacZ gene of E. coli is under the control of the gX promoter of the pseudorabies. A feline recombinant herpes virus expresses five foreign genes. The Cd86 gene and feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES EMCV element between the two open reading frames that drive the translation of the 2nd. gene in the 3 'direction, CD80; the uidA gene of E. coli is under the control of the gl promoter of the infectious laryngotracheitis virus; the gag gene of FeLV is under the control of the cytomegalovirus immediate early promoter; the lacZ gene of E. coli is under the control of the gX promoter of the pseudorabies. The five foreign genes are contained in two different insertion sites of the feline herpes virus. A feline recombinant herpes virus expresses five foreign genes. The CD86 gene and feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86. The translation of the 2nd. CD80 open reading frame in the 3 'direction is under the control of an IRES EMCV element; the uidA gene of E.coli is under the control of the gl promoter of the infectious laryngotracheitis virus; the envelope gene of FeLV is under the control of the cytomegalovirus immediate early promoter; the lacZ gene of E. coli is under the control of the gX promoter of the pseudorabies. A feline recombinant herpes virus expresses six foreign genes. The CD86 gene and feline CD80 genes are expressed in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter, which drives the transcription of CD80 and CD86 and which includes an IRES EMCV element between the two open reading frames that drive the translation of the 2nd. gene in 3 'direction, CD80; the uidA gene of E. coli is under the control of the gl promoter of the infectious laryngotracheitis virus; the gag gene of FeLV is under the control of the cytomegalovirus immediate early promoter; the envelope gene of FeLV is under the control of the immediate early promoter of cytomegalovitus; the lacZ gene of E. coli is under the control of the gX promoter of the pseudorabies.

Example 20 Characterization of the CD80 (B7-1) -TAMU, CD86 (B7-2), CD28, CTLA-4 and CD80 (B7-1) polypeptides and cDNAs -Syntro / SPAH: The Feline CD80 (B7-1) cDNA , isolated and purified, of approximately 941 nucleotides codes for an open reading frame of feline CD80 polypeptides of approximately 292 amino acids, the bound native membrane or the mature form of which has a molecular mass of approximately 33,485 kDa, an isoelectric point of approximately 9.1, a net charge at a pH of 7.0 of 10.24. The protein transmembrane domain is from about 241 to 271 amino acids. Feline CD80-TAMU and Feline CD80-Syntro / SPAH are isolated cDNAs and polypeptides independently from two different sources, and the DNA and amino acid sequence differ slightly. The source of the CD80-TAMU mRNA was the feline peripheral blood mononuclear cells stimulated with ConA, and the source of the CD80-Syntro / SPAH RNA was the feline spleen cells, stimulated with ConA. The difference in cDNA sequence between CD80-TAMU and CD80-Syntro / SPAH is T a C at nucleotide 351 and C to A at nucleotide 670. In the amino acid sequence, the change at nucleotide 351 is silent, and the change in nucleotide 670 results in a conservative change of neutral amino acids, leucine to isoleucine, at residue 224 of the amino acid. The isolated and purified feline CD86 (B7-2) cDNA of approximately 1176 nucleotides codes for an open reading frame of feline CD86 polypeptides of about 320 amino acids, the bound native membrane or the mature form of which has a molecular mass of about 36.394 kDa, an isoelectric point of about 9.19, a net charge at a pH of 7.0 of 11.27. The isolated and purified feline CD28 cDNA of approximately 689 nucleotides codes for an open reading frame of feline CD28 polypeptides of approximately 221 amino acids, the bound native membrane or the mature form of which has a molecular mass of approximately 25,319 kDa, an isoelectric point of about 9.17, a net charge at a pH of 7.0 of 9.58. The isolated and purified feline CTLA-4 cDNA of approximately 749 nucleotides codes for an open reading frame of feline CTLA-4 polypeptide of approximately 223 amino acids, the bound native membrane or the mature form of which has a molecular mass of approximately 24.381 kDa, an isoelectric point of approximately 6.34, a net charge at a pH of 7.0 of -0.99. The coexpression of CD80, with costimulatory molecules CD28 or CTLA-4 and an antigen or a tumor antigen of a pathogenic organism, has the ability to activate or reinforce the activation of the T lymphocyte, more specifically of the The-1 lymphocytes and to promote the growth of other cell types. The coexpression of CD80, with the costimulatory molecule CTLA-4 has the ability to suppress the activation of T lymphocytes, more specifically of The-1 lymphocytes. The co-expression of CD86, with costimulatory molecules CD28 or CTLA-4 and a tumor antigen or an antigen of a pathogenic organism, has the ability to activate or reinforce the activation of T lymphocytes, more specifically of The-1 lymphocytes and promote the growth of other cell types. The coexpression of CD86, with the costimulatory molecule CTLA-4, has the ability to suppress the activation of T lymphocytes, more specifically of The-1 lymphocytes.

Example 21 Use of CD80 (B7-1), CD86 (B7-2), CD28 and feline CTLA-4 in vaccines. The following experiments were carried out to evaluate the immune boosting activities of feline CD80, CD86, CD28 and CTLA-4 in feline vaccines. Feline CD80, CD86, CD28 and CTLA-4 are inserted into recombinant viral vectors (derived from herpes virus, swinepox virus or raccoon pox virus) useful for the expression of recombinant proteins in felids (see PCT International Applications WO 96/22363 or WO 96/13575). The recombinant viral vectors that express all the immune booster molecules or, which, alternatively, express combinations by pairs of CD80 and CD28 or of CD80 and CTLA-4 or of CD86 and CD28 or of CD86 and CTL-4, are administered orally or intramuscularly to cats at 8 weeks of age in a dosage range of 0.1 to 10.0 mg per kg of body weight, or a dosage of about 104 to 109 plaque forming units (pfu) or, preferably, at a dosage of about 10 pfu. A subunit vaccine for FIV or FeLV or a viral vector vaccine for FIV or FeLV (see above) is administered at a minimum dose of protection, simultaneously with the vaccine, in the immune booster vector, CD80, CD86, CD28 and feline CTLA-4. Three to four weeks later, the cats were given a second dose of the vaccine. The cats were inoculated with a virulent strain of FIV (PPR or Petaluma) or a Rickard strain of FeLV (administered with methylprednisolone to suppress immunity in cats) at the USDA standard inoculation dosage level and were observed regularly for 12 weeks for the development of viremia. A group of cats vaccinated for up to 12 months was observed with respect to the development of tumors caused by FeLV. The incidence of disease in cats is compared to controls that do not receive a vaccine or with VIF or FeLV vaccine without immune reinforcing molecules. The results of the inoculation experiment are that the cats that did not receive the vaccine and that were then inoculated with FeLV or FIV, more than 60% develop persistent viremia; the cats vaccinated with the VIF or FeLV subunit vaccine and that were then inoculated, 75% are protected against viraemia; the cats that received FeLV or FIV subunit vaccine and a combination of the immune booster vaccine, in feline CD80, CD86, CD28 and CTLA-4 vector, and that were then inoculated, 100% are protected against viraemia. The additional beneficial aspects of adding the CD80, CD86, CD28 and CTLA-4 vaccine in feline vector is 100% protected against viremia and / or tumor formation; the duration of immunity (more than 1 year); early start of immunity or primary vaccination of a single dose instead of 2 doses currently required by all manufacturers. Cats vaccinated with viral FIV or FeLV vaccines in vector are protected from inoculation at a significantly higher level than cats vaccinated with a FeLV or FIV subunit vaccine. The cats that receive the FeLV or FIV vaccine in viral vector and a combination of the CD80, CD86, CD28 and feline CTLA-4 vector vaccine, immune booster and then inoculated, are 100% protected from viremia. Cats vaccinated with the FeLV or FIV vaccine in a viral vector and a combination of the feline CD80, CD86, CD28, and CTLA-4 vaccine, in immune booster vector, receive the additional beneficial aspects described above. In an alternative procedure, cats at 8 weeks of age, are injected intramuscularly, with 100 μg of plasmid containing cDNA for feline CD80, CD86, CD28 and CTLA-4 molecules, in a mixture with a plasmid containing cDNA for envelope and gag of VIF or envelope and gag of FeLV or, alternatively, they are injected intramuscularly with 100 μg of plasmid containing cDNA expressing combinations by pairs of CD80 and CD28 or CD80 and CTLA-4 or CD86 and CD28 or CD86 and CTLA-4 paired with CD28 or CTLA-4, in a mixture with a plasmid containing cDNA for envelope and VIF gag or envelope and gag of FeLV. Control cats do not receive CD80, CD86, CD28 and CTLA-4. Cats are inoculated with virulent FeLV or FIV and observed for signs of disease, as described above. the results of the inoculation experiment are that the cats receiving the cDNA vector containing feline CD80, CD86, CD28 and CTL-4 vector containing FIV genes and FeLV genes show 100% protection against the disease, compared to cats that only received cDNA vector that contains FIV genes or FeLV genes and that show 75% protection against the disease. In an alternative procedure, cats, at 8 weeks of age, are injected intramuscularly, with 0.1 to 100 mg of purified protein for feline CD80, CD86, CD28 and CTLA-4 molecules or, alternatively, pairwise combinations of CD80 or CD86 paired with CD28 or CTLA-4 proteins, of the recombinant cDNA vectors described above, and injected intramuscularly with 0.1 to 100 mg of a subunit vaccine containing envelope and gag of FIV or envelope and gag of FeLV . Control cats do not receive CD80, CD86, CD28 and CTLA-4. Cats are inoculated with a strain of FIV or a virulent FeLV strain and observed regularly for the development of disease. The results of the inoculation experiment are that cats receiving the purified protein for feline CD80, CD86, CD28 and CTLA-4 and a subunit vaccine containing FIV or FeLV show significantly reduced incidence of disease, compared to cats that they receive only a subunit vaccine containing FIV or FeLV proteins.

Example 22 Use of feline CD80, CD86, CD28 and CTLA-4 as a prophylactic vaccine for protection against disease. Feline CD80, CD86, CD28 and CTLA-4 in a recombinant pig pox viral vector, recombinant raccoon pox or feline recombinant herpes, when administered as described in Example 17, but without the administration of antigens in viral vectors or subunits, coming from pathogenic organisms, are useful to stimulate immunity and a The-1 response that encourages a protective immune response when inoculated with a viral, parasitic or bacterial pathogen. In an alternative procedure, feline CD80 or CD86, in combination with feline CTLA-4 in viral vectors when administered as described in Example 3, are useful for suppressing an immune response and protecting against autoimmune disease in cats.

Example 23 Use of feline CD80, CD86, CD28 and CTLA-4 to inhibit and destroy tumor cell growth. The tumor cells of a cat were transfected with a viral vector of recombinant pig pox, recombinant raccoon pox or feline recombinant herpes, which expresses feline CD80 or CD86 in combination with CD28 or CTLA-4. The transfected tumor cells are re-administered to the cat, and the presence of CD80, CD86, CD28 and CTLA-4 on the surface of the tumor cell elicits a broad immunological response for the transfected and non-transfected tumor cells resulting in the killing of localized and metastatic tumor cells. In an alternative procedure, vectors expressing feline CD80 or CD86 in combination with CD28 or CTLA-4 are injected directly into a tumor in a cat that results in a broad immunological response to tumor cells resulting in the killing of tumor cells. localized and metastatic.

Example 24 Use of feline CD80, CD86, CD28 and CTLA-4 as a therapeutic agent to treat diseases in cats. Feline CD80, CD86, CD28 and CTLA-4 in a recombinant pig pox viral vector, recombinant raccoon pox or feline recombinant herpes, when administered as described in Example 17, but without the administration of antigens In viral vectors or subunits, coming from pathogenic organisms, they are useful in the stimulation of immunity to eliminate or reduce the level of pathology of the disease.

Experimental Support Data: SPV 246 Safety and Efficacy of an SPV vaccine in recombinant viral vector, sue contains gag and envelope of FeLV and feline CD80. The construction of a SPV virus, recombinant SPV 246 (in the body of the original presented copy) was described in the foregoing. SPV 246 contains five foreign genes that include genes encoding gag and envelope of FeLV and feline CD80 as well as two marker genes, β-glucuronidase and β-galactosidase. The expression of gag and envelope of FeLV and CD80 in cells infected with SPV 246 was confirmed by WESTERN TRANSFER analysis. The bands representing the gag and envelope proteins of FeLV were detected with a goat polyclonal antibody against FeLV P27 (Biodesign, ME) and a monoclonal antibody against gp70 of FeLV (Biodesign, ME), respectively. It appeared that the gag and envelope proteins of FeLV are posttranslationally processed in a manner similar to native viral proteins. Purity, expression and stability analyzes were performed by means of BLACK PLATE titration using the antibodies described above. The SPV 246 was stably passed at least 5 times. 100% of the plates generated from the cells infected with SPV 246 were positive for ß-galactosidase, ß-glucuronidase, envelope and gag of FeLV. The expression of feline CD80 was confirmed in WESTERN TRANSFER analysis using a polyclonal, anti-human CD80 antibody. Multiple bands ranging in size from 30 kda to 60 kda specific for feline CD80 were detected. These bands represent alternate and multiple glycosylation patterns of CD80 expressed and modified in the context of SPV and ESK-4 cells. The virus SPV 246 and control, SPV 003, as well as other candidates for FHV recombinant vaccine and FeVV SPV were tested for their ability to protect cats against persistent infection with FeLV. Briefly, old cats of 8 weeks of age, group of 10 cats, were vaccinated subcutaneously with 1 ml of SPV 246, control virus or other recombinant viruses (doses ranging from 7x105ufp / cat to 1x107 pfu / cat. vaccinated 3 times, at intervals of 3 weeks After the vaccinations, the cats were inoculated by the oro-nasal route with the standard Rickard inoculation strain of FeLV (106-2 TCID50 / ml / cat), after pretreatment with acetate of methylprednisolone (Depo-Medrol) Cat serum was analyzed for persistent viraemia on a weekly basis for 15 weeks post inoculation.Capes were considered to be persistently viremic after testing positive for the presence of FeLV p27 for 3 weeks Consecutive Results: Cats vaccinated with SPV 246 were partially protected against FeLV viremia in a FeLV inoculation study. The value of avoidable fraction (FP) predicted for cats treated with SPV 246 was 50% (Table 1).

Table 1: Number and percentage of cats with persistent viremia at 15 weeks post-inoculation. The predictable fraction (FP) predicted for each group was calculated.

EXAMPLES OF ADDITIONAL RECOMBINANT VIRUSES CONTAINING CD80 and CD86. SPV 280 SPV 280 is a recombinant swinepox virus that expresses six foreign genes. A homology vector designated 992-23.6 was constructed in the following manner: the feline CD86 gene and the CD80 gene were expressed in a bicistronic DNA cassette under the control of the synthetic late pox promoter, LP1, which drives transcription of CD80 and CD86 and including an IRES EMVC element between the two open reading frames; the ß-glucuronidase gene of E.coli is under the control of the synthetic early promoter, EP2. SPV 280 was derived from SPV 258, which contains the genes for gag and envelope of FeLV and β-galactosidase. SPV 258 was previously designed to contain the gag / protease genes of FeLV and the envelope gene of FeLV (gp70) truncated under the control of synthetic early / late pox promoters, LP2EP2; the E. coli β-galactosidase gene is under the control of the constitutive I5L pox promoter and inserted into the partial HindIII N fragment of 1869 bp with deletion. The CD80 / CD86 and β-glucuronidase genes of E. coli were cloned into the homology vector, 992-23.6 into a distinct HindIII K fragment and non-essential partial SPV. SPV 280 was derived from SPV 258. This was achieved using the homology vector 992-23.6 and the virus S-SPV-258 in the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION OF RECOMBINANT RPV, SPV or FHV. The transfection material was screened by RECOMBINANT SPV SCREENING EXPRESSING β-galactosidase (BLUOGAL EVALUATIONS and CPRG) or β-glucuronidase (VALUATION X-GLUC). The final result of the multiple turns of purification by blue / green plate was the recombinant virus SPV 280. The SPV 280 was evaluated for gag expression of FeLV, envelope of FeLV and the marker genes, β-galactosidase and β-glucuronidase by Analysis of BLACK PLATE. It was determined that 100% of the plates generated from ESK-4 cells infected with purified SPV 280 are expressing FeLV gag and FeLV envelope, using a goat polyclonal antibody for FeLV gag (Biodesign, ME) and a mouse monoclonal antibody for FeLV envelope, gp70 (Biodesign, ME). Expression of feline CD80 and CD86 was confirmed in WESTERN TRANSFER analysis using goat polyclonal anti-human CD80 and CD86 antibodies (R &D Systems, MN), respectively. Multiple bands ranging in size from 30kda to 60kda specific for feline CD80 were detected, and multiple bands varying from 40kda to 70kda were detected for feline CD86. These bands represent multiple and alternating glycosylation patterns of CD80 and CD86 expressed in the context of SPV in ESK-4 cells.

SPV 281 SPV 281 is a recombinant swinepox virus that expresses six foreign genes. A homology vector designated 992-23.6 was constructed in the manner described for SPV 280. SPV 281 was derived from SPV 228, which contains the genes for FIV envelope and gag protease and E.coli β-galactosidase. The VIF gag / protease gene is under the control of an early smallpox synthetic promoter, EP2; the VIF envelope gene is under the control of an early smallpox synthetic promoter, EP1; the ß-galactosidase gene of E.coli is under the control of the constitutive pox promoter I5L. The VIF, envelope and ß-galactosidase gag / protease from E.coli were inserted into the partial Hind III N fragment of 1869 bp with SPV deletion. The CD80 / CD86 and β-glucuronidase genes were inserted into the distinct Hind III K partial fragment and non-essential SPV. SPV 281 was derived from SPV 228. This was achieved using the homology vector 992-23.6 and the S-SPV-228 virus in the RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION OF RPV, SPV OR FHV RECOMBINANTS. The transfection material was screened by means of the SCREENING METHOD FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL VALUATIONS and CPRG) or β-glucuronidase (VALUATION X-GLUC). The final result of the multiple turns of purification by blue / green plate was the recombinant virus SPV 281. The SPV 281 was assessed for the expression of gag of FIV, envelope of FIV and the marker genes, β-galactosidase and β-glucuronidase by Analysis of BLACK PLATE. It was determined that 100% of the plates of ESK-4 cells infected with purified SPV 281 are expressing VIF gag and envelope of FIV, β-galactosidase and β-glucuronidase, using mouse monoclonal antibodies for VIF gag (p27) and VIF envelope (gp 100) (Custom Monoclonals, CA; BioDesign International, ME, respectively), a mouse monoclonal antibody to β-galactosidase and a rabbit polyclonal antibody to β-glucuronidase (Biodesign, ME and Molecular Probes, OR, respectively). Expression of feline CD80 and CD86 was confirmed in WESTERN TRANSFER analysis using polyclonal anti-human CD80 and CD86 antibodies (R &D Systems, MN). Multiple bands ranging in size from 30kda to 60kda specific for feline CD80 were detected, and multiple bands varying from 40kda to 70kda were detected for feline CD86. These bands represent multiple and alternating glycosylation patterns of CD80 and CD86 expressed in the context of SPV in ESK-4 cells. The expression gag and envelope of FIV was also confirmed by WESTERN TRANSFER analysis using the antibodies described above. The VIF gag and envelope seemed to be processed in P24 and gp 100, respectively.

FHV 043 FHV 043 is a feline recombinant herpes virus, which expresses five foreign genes. A homology vector designated 987-57 was constructed. In the following manner: the feline CD86 and CD80 genes were cloned in a bicistronic cassette under the control of the cytomegalovirus immediate early promoter (CMV IE), which drives the transcription of CD80 and CD86. The translation of the 2nd. CD80 open reading frame in the 3 'direction was under the control of the IRES EMCV element. The E.coli β-glucuronidase gene is under the control of the infectious laryngotracheitis virus gl promoter. The E.coli CD80, CD86 and β-glucuronidase genes were inserted into the single long region of FHV at a unique EcoRI site derived from a fragment H I Partial FHV salt. The insertion was between the gL and adjacent transcriptional activator genes. FHV 043 was derived from FHV 017, which contains the envelope genes of FIV and β-galactosidase from E.coli. The VIF envelope gene is under the control of the IE CMV promoter; and the β-galactosidase gene is under the control of the gX promoter element of pseudorabies. The envelope of VIF and β-galactosidase from E. coli were inserted into the gE US deletion site of FHV. FHV 043 was derived from FHV 017. This was achieved using the homology vector 987-57. Al and the virus FHV 017 in the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECOMBINANT RPV, SPV OR FHV. The transfection material was screened by means of the SCREENING METHODS FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL VALUATIONS and CPRG) or β-glucuronidase (VALUATION X-GLUC). The final result of the multiple turns of purification by blue / green plate was the recombinant virus FHV 043. The FHV 043 was evaluated for the expression of marker genes, β-galactosidase and β-glucuronidase by BLACK PLATE Analysis. It was determined that 100% of the plates of CRFK cells infected with purified plate FHV 043 are expressing β-galactosidase and β-glucuronidase, using a mouse monoclonal antibody for β-galactosidase (Biodesign, ME) and a rabbit polyclonal antibody for β-glucuronidase (Molecular Probes, OR). It was determined that this virus is stable after at least 5 passages.

Expression of feline CD80 and CD86 was confirmed in WESTERN TRANSFER analysis using polyclonal anti-human CD80 and CD86 antibodies (R &D Systems, MN). Multiple bands ranging in size from 30kda to 60kda specific for feline CD80 were detected, and multiple bands varying from 40kda to 70kda were detected for feline CD86. The expression of VIF envelope (gpl30) was confirmed in WESTERN TRANSFER analysis using a convalescent cat serum from a cat infected with FIV.

VECTOR OF HOMOLOGY 1015-18.8A (LP1-CD86 / IRES-CD80): The homology vector 1015-18.8A was used to create recombinant RPV viruses expressing CD8 and CD86: A plasmid containing the smallpox LP1 promoter, the IRES EMCV element and a Poly A transcriptional exterminator of smallpox was reconstructed. The feline CD80 gene was amplified by PCR with primers 1 / 97.6 (5'-GCTAGGATCCAATCTATGTAGACAGGTGAGAT-3 ') and 3 / 98.4 (5 '-TCGAGGATCCGGGTCACGCAGCAAAGTGG-3'), containing both BamHl cloning sites. CD80 was cloned behind the LPl promoter. The feline CD86 gene was amplified by PCR with primers 1 / 98.18 (5 '-TCGACAATTGGATGGGCATTTGTGACAG-3') with a site Cloning Mfel and 8 / 97.31 (51- GTGGATCCAGGATCCGGAGCGG-3 ') blunt end.

CD86 was cloned behind the IRES EMCV element. The cassette was then digested with NotI and cloned into the HindIII N vector of RPV containing the β-galactosidase gene of E.coli under the control of the late synthetic promoter, I5L. The final homology vector 1015-18.8A was used to create viruses containing VIF or FeLV and CD80 and CD86 genes, according to THE HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION OF RECOMBINANT RPV.

S-RPV-045; S-RPV-045 is a recombinant raccoon pox virus, which expresses three foreign genes. S-RPV-045 was derived from the RPV-000 raccoon pox virus (ATCC VR-838). This was achieved using the homology vector 1015-18.8A and the parental virus S-RPV-000 in the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION OF RECOMBINANT RPV. The transfection material was screened for the recombinant by the SCREENING FOR RECOMBINANT RPV EXPRESSING β-galactosidase (BLU-GAL EVALUATIONS and SCREENING FOR RECOMBINANT RPV EXPRESSING ENZYMATIC MARKERS GENES). The virus was purified by plaque and passed 5 times. RPV-045 was assessed for the expression of β-galactosidase by black plate analysis. It was determined that 100% of the plates generated from VERO cells infected with purified RPV-045 are expressing β-galactosidase, using a rabbit polyclonal antibody (ICN, OH). Western analysis using the WESTERN TRANSFER PROCEDURE confirmed the expression of CD80 and CD86 using goat polyclonal anti-human CD80 and CD86 antibodies (R & D Systems, MN), respectively. Multiple bands varying in size were detected, from 30 to 60 kda specific for feline CD80, and multiple bands varying from 40 to 70 kda specific for feline CD86 were detected. These bands represent alternate and multiple glycosylation patterns of CD80 and CD86 expressed in the context of RPV in VERO cells.

S-RPV-046: RPV-046 is a raccoon pox virus, which expresses five foreign genes. The RPV-046 was derived from the RPV-036 of the raccoon pox virus. This was achieved using the homology vector 1015-18.8A and the parental virus RPV-036 in the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION OF RECOMBINANT RPV. The transfection material was screened for the recombinant by the SCREENING FOR RECOMBINANT RPV EXPRESSING β-galactosidase (BLU-GAL EVALUATIONS and SCREENING FOR RECOMBINANT RPV EXPRESSING ENZYMATIC MARKERS GENES). The virus was purified by plaque and passed 5 times. The final result of the multiple turns of purification by blue / green plate was the recombinant FHV 046 virus. RPV 046 contains the VIF gag gene under the control of the synthetic early / late pox promoter, LP2EP2, and the β-glucuronidase gene under the control of the early virus synthetic promoter, EP2. These genes are contained in the distinct and non-essential HindIII U site of the partial RPV. The CD80 and CD86 genes and the β-galactosidase are contained in the single and distinct site, non-essential HindIII N partial RPV. RPV-046 was assessed for the expression of β-galactosidase and β-glucuronidase by black plate analysis. It was determined that 100% of the plates generated from Vero cells infected with purified RPV-045 are expressing β-galactosidase and β-glucuronidase. Western analysis using the WESTERN TRANSFER PROCEDURE confirmed the expression of CD80 and CD86 using goat polyclonal anti-human CD80 and CD86 antibodies (R & D Systems, MN), respectively. Multiple bands varying in size were detected, from 30 to 60 kda specific for feline CD80, and multiple bands varying from 40 to 70 kda specific for feline CD86 were detected. These bands represent alternate and multiple glycosylation patterns of CD80 and CD86 expressed in the context of RPV in VERO cells. The expression VIF gag / protease was also confirmed by WESTERN TRANSFER analysis using mouse monoclonal antibodies to VIF gag (p27) (Custom Monoclonals, CA).

S-RPV-047; RPV-047 is a raccoon pox virus, which expresses five foreign genes. The homology vector 1015-18.8A was constructed as described above and contains the cassette LP1-CD86 / IRES-CD80 and the β-galactosidase gene of E.coli under the control of the synthetic late promoter (I5L) in the HindIII N fragment The RPV-047 was derived from the RPV-044 that contains the genes for FIV envelope and the β-glucuronidase of E. col i (ß-glucuronidase) in the HindIII U fragment of RPV. The envelope gene of FIV is under the control of the synthetic early promoter (EP1). The β-glucuronidase gene is under the control of the synthetic late promoter (LP1). RPV-047 was derived from the raccoon RPV-044 smallpox virus. This was achieved using the homology vector 1015-18.8A and the parental virus RPV-044 in the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION OF RECOMBINANT RPV. The transfection material was screened for the recombinant by the SCREENING FOR RECOMBINANT RPV EXPRESSING β-galactosidase (BLU-GAL EVALUATIONS and SCREENING FOR RECOMBINANT RPV EXPRESSING ENZYMATIC MARKERS GENES). The virus was purified by plaque and passed 5 times. The final result of the multiple turns of purification by blue / green plate was the recombinant FHV 047 virus. RPV-047 was assessed for the expression of β-galactosidase by black plate analysis. It was determined that 100% of the plates generated from Vero cells infected with purified RPV-047 are expressing β-galactosidase, using a rabbit polyclonal antibody (ICN, OH). The Western analysis that uses the WESTERN TRANSFER PROCEDURE confirmed the expression of CD80 and CD86 using goat polyclonal anti-human CD80 and CD86 antibodies (R & D Systems, MN), respectively. Multiple bands varying in size were detected, from 30 to 60 kda specific for feline CD80, and multiple bands varying from 40 to 70 kda specific for feline CD86 were detected. These bands represent alternate and multiple glycosylation patterns of CD80 and CD86 expressed in the context of RPV in VERO cells. The envelope expression of FIV was also confirmed by WESTERN TRANSFER analysis using mouse monoclonal antibodies to FIV envelope (gplOO) (BioDesign International, ME).

S-RPV-048; RPV-048 is a raccoon pox virus, which expresses five foreign genes. The homology vector 1015-18.8A was constructed as described above and contains the cassette LP1-CD86 / IRES-CD80 and the β-galactosidase gene of E.coli under the control of the synthetic late promoter (I5L) in the HindIII N fragment The RPV-048 was derived from the RPV-038 that contains the genes for gag / protease of FeLV and β-glucuronidase of E. coli in the HindIII U fragment of RPV. The gag / protease gene of FeLV is under the control of synthetic early / late promoters (LP2EP2). The β-glucuronidase gene is under the control of the synthetic late promoter (LP1). RPV-048 was derived from the raccoon RPV-038 recombinant pox virus. This was achieved using the homology vector 1015-18.8A and the parental virus RPV-038 in the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECOMBINANT RPV. The transfection material was screened for the recombinant by the SCREENING FOR RECOMBINANT RPV EXPRESSING β-galactosidase (BLU-GAL EVALUATIONS and SCREENING FOR RECOMBINANT RPV EXPRESSING ENZYMATIC MARKERS GENES). The virus was purified by plaque and passed 5 times. The final result of the multiple turns of purification by blue / green plate was the recombinant virus FHV 048. The RPV-048 was assessed for the expression of β-galactosidase by black plate analysis. It was determined that 100% of the plates generated from Vero cells infected with purified RPV-048 are expressing β-galactosidase, using a rabbit polyclonal antibody (ICN, OH). Western analysis using the WESTERN TRANSFER PROCEDURE confirmed the expression of CD80 and CD86 using goat polyclonal anti-human CD80 and CD86 antibodies (R & D Systems, MN), respectively. Multiple bands varying in size were detected, from 30 to 60 kda specific for feline CD80, and multiple bands varying from 40 to 70 kda specific for feline CD86 were detected. These bands represent alternate and multiple glycosylation patterns of CD80 and CD86 expressed in the context of RPV in VERO cells. The expression gag / protease of FeLV was also confirmed by analysis of WESTERN TRANSFER using rabbit polyclonal antibodies for FeLV gag (p27) (BioDesign International, ME).

S-RPV-052 The RPV-052 is a raccoon pox virus, which expresses six foreign genes. The homology vector 1015-18.8A was constructed as described above and contains the cassette LP1-CD86 / IRES-CD80 and the β-galactosidase gene of E.coli under the control of the synthetic late promoter (I5L) in the HindIII N fragment The RPV-052 was derived from the RPV-030 that contains the genes for gag / protease of FeLV, envelope of FeLV and β-glucuronidase of E. coli (ß-glucuronidase) in the HindIII U fragment of RPV. The gag / protease gene of FeLV is under the control of the synthetic early promoter (EP2). The envelope gene of FeLV is under the control of the synthetic early promoter (EP1). The β-glucuronidase gene is under the control of the synthetic late promoter (LP1). RPV-052 was derived from the raccoon pox virus RPV-030. This was achieved using the homology vector 1015-18.8A and the parental virus RPV-030 in the RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION OF RECOMBINANT RPV. The transfection material was screened for the recombinant virus by SCREENING FOR RECOMBINANT RPV EXPRESSING β-galactosidase (BLU-GAL EVALUATIONS and SCREENING FOR RECOMBINANT RPV EXPRESSING ENZYMATIC MARKERS GENES). The virus was purified by plaque and passed 5 times. The final result of the multiple turns of purification by blue / green plate was the recombinant virus FHV 052. The RPV-052 was evaluated for the expression of β-galactosidase, β-glucuronidase, gag of FeLV and envelope of FeLV by the Analysis of black plate. Western analysis using the WESTERN TRANSFER PROCEDURE confirmed the expression of CD80 and CD86 using goat polyclonal anti-human CD80 and CD86 antibodies (R &D Systems, MN), respectively. FeLV gag / protease expression and FeLV envelope were also confirmed by WESTERN TRANSFER analysis using rabbit polyclonal antibodies for the FeLV gag (p27) (BioDesign International, ME) and mouse monoclonal anti-FeLV envelope (gplOO ) (BioDesign, ME).

S-RPV-053: RPV-053 is a raccoon pox virus, which expresses six foreign genes. The homology vector 1015-18.8A was constructed as described above and contains the cassette LP1-CD86 / IRES-CD80 and the β-galactosidase gene of E.coli under the control of the synthetic late promoter (I5L) in the HindIII N fragment The RPV-053 was derived from RPV-034 which contains the genes for FIV gag / protease, FIV envelope and E-glucuronidase. coli in the HindIII U fragment of RPV. The gag / protease gene of VIF is under the control of the synthetic early promoter (EP2). The VIF envelope gene is under the control of the synthetic early promoter (EP1). The β-glucuronidase gene is under the control of the synthetic late promoter (LP1). RPV-053 was derived from the raccoon pox virus RPV-034. This was achieved using the homology vector 1015-18.8A and the parental virus RPV-034 in the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECOMBINANT RPV. The transfection material was screened for the recombinant by the SCREENING FOR RECOMBINANT RPV EXPRESSING β-galactosidase (BLU-GAL EVALUATIONS and SCREENING FOR RECOMBINANT RPV EXPRESSING ENZYMATIC MARKERS GENES). The virus was purified by plaque and passed 5 times. The final result of the multiple turns of purification by blue / green plate was the recombinant virus FHV 053.

S-SPV-275: S-SPV-275 is a recombinant virus of pig pox, which expresses five foreign genes. A homology vector designated 992-23.6 was constructed as follows: the feline CD86 and CD80 genes were expressed in a cassette of bicistronic DNA under the control of the synthetic late pox promoter, LP1, which drives the transcription of both CD86 and CD80 , and included an IRES EMCV element between the two open reading frames. The E.coli β-glucuronidase gene is under the control of the synthetic early smallpox promoter, EP2. The parental virus used was S-SPV 046, which contains the VIF gag / protease gene promoted by the synthetic late / early pox promoter, LP2EP2 and the β-galactosidase gene is under the control of the constitutive pox promoter, OlL. The ß-galactosidase and gag / protease genes were inserted into the partial HindIII M fragment of SPV, while the ß-glucuronidase and CD86 / CD80 genes are inserted into the partial Hind III K fragment of SPV. S-SPV 275 was derived from S-SPV 046. This was achieved using the homology vector 992-23.6 and S-SPV 046 in the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATION OF RECOMBINANT RPV. The transfection material was screened by SCREENING FOR RECOMBINANT SPV EXPRESSING β-glucuronidase (VALUATION X-GLUC). The final result of the multiple turns of purification by green / blue plates was the recombinant virus SPV 275. The S-SPV 275 was evaluated for the expression of gag of FIV and the marker gene, β-glucuronidase by BLACK PLATE Evaluation. It was determined that 100% of the plates generated in ESK-4 cells infected with purified S-SPV 275 are expressing FIV gag, using a mouse monoclonal antibody for VIF gag (Custom Monoclonals, CA), and is stable after 5 passages Gag expression of FIV, CD86 and CD80 was confirmed in the WESTERN TRANSFER analysis, using the monoclonal mouse antibody for FIV gag and the goat polyclonal anti-human CD86 and CD80 antibodies (R & amp; amp; amp;; D Systems; MN) for CD86 and CD80 from Felino. Two distinct bands were detected in the 50kDa and 27kDa specific for VIF gag. Multiple bands ranging from 40kDa to 70kDa specific for Felino CD86, and thus, bands ranging from 30kDa to 60kDa specific for Felino CD80 were detected.

S-FHV 040; S-FHV 040 is a recombinant feline herpes virus, which expresses five foreign genes. A homology vector designated 957-87. Al was constructed in the following manner: the feline CD86 and CD80 genes were expressed in a cassette of bicistronic DNA under the control of the cytomegalovirus immediate early promoter (CMV IE), which drives the transcription of CD80 and CD86, and included an element IRES EMCV between the two open reading frames. The ß-glucuronidase gene of E. coli is under the control of the virus promoter of infectious laryngotracheitis gl. The ß-glucuronidase and CD80, CD86 genes were inserted into the single long region of FHV at a unique EcoRi site derived from a partial IH fragment of FHV salt, between the adjacent transcriptional activator genes and gL. The parental virus used was S-FHV 019 which contains the gag gene of FeLV promoted CMV IE and the β-galactosidase gene of E. coli which is under the gX promoter of pseudorabies; both genes are located at the gE deletion site of single short FHV (US). S-FHV 040 was derived from S-FHV 019. This was achieved using the homology vector 987-57. Al and virus S-FHV 019 in the RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION OF RECOMBINANT FHV. The transfection material was screened by SCREENING FOR RECOMBINANT FHV EXPRESSING β-glucuronidase (VALUATION X-GLUC). The final result of the multiple turns of purification by green / blue plates was the recombinant virus S-FHV 040. The S-FHV 040 was assessed for the gag expression of FeLV and the marker genes β-glucuronidase and β-galactosidase by Titration of BLACK PLATE. It was determined that 100% of the plates generated in CRFK cells are expressing β-glucuronidase and β-galactosidase. FeLV gag expression was also confirmed by NEGRA PLACA Assay using goat polyclonal antibody for gp27 from FeLV (BioDesigns; ME). This virus appears to be stable after five passages. The expression of gag of FIV, CD80 and CD86 was confirmed in the WESTERN TRANSFER analysis. Goat polyclonal anti-human CD80 and CD86 antibodies (R & D Systems; MN) were used for feline CD80 and CD86. Multiple bands ranging from 30kDa to 60kDa specific for feline CD80 were detected, and bands ranging from 40kDa to 70kDa specific for feline CD86 were also detected. The expression of FeLV was confirmed using a goat polyclonal antibody for gp27 from FeLV (BioDesigns, ME).

S-FHV 042: S-FHV 042 is a recombinant feline herpes virus, which expresses five foreign genes. A homology vector designated 957-87. Al was constructed in the following manner: the feline CD86 and CD80 genes were expressed in a cassette of bicistronic DNA under the control of the cytomegalovirus immediate early promoter (CMV IE), which drives the transcription of CD80 and CD86, and included an element IRES EMCV between the two open reading frames. The ß-glucuronidase gene of E. coli is under the control of the virus promoter of infectious laryngotracheitis gl. The ß-glucuronidase and CD80, CD86 genes were inserted into the single long region of FHV at a unique EcoRi site derived from a partial IH fragment of FHV salt, between the adjacent transcriptional activator genes and gL. The parental virus used was S-FHV 018 containing the envelope of FeLV promoted from IE CMV and the β-galactosidase gene from E. coli under the pseudorabies gX promoter; both genes are located at the gE, short, single (US) deletion site of FHV. S-FHV 042 was derived from S-FHV 018. This was achieved using the homology vector 987-57. Al and virus S-FHV 018 in the RECOMBINATION PROCEDURE HOMOLOGA FOR THE GENERATION OF RECOMBINANT FHV. The transfection material was screened by SCREENING FOR RECOMBINANT FHV EXPRESSING β-glucuronidase (ASSESSMENT) X-GLUC). The final result of the multiple turns of purification by green / blue plates was the recombinant virus S-FHV 042. The S-FHV 042 was assessed for the expression of the envelope of FeLV and the marker genes β-glucuronidase and β-galactosidase by Titration of BLACK PLATE. It was determined that 100% of the plates generated in CRFK cells are expressing β-glucuronidase and β-galactosidase. The expression of the FeLV envelope was confirmed by BLACK PLACA Evaluation using the mouse monoclonal antibody for gp70 of FeLV (BioDesigns; ME) . This virus was stable after five passages. Envelope expression of FeLV, CD80 and CD86 was confirmed in the WESTERN TRANSFER analysis. Goat polyclonal anti-human CD80 and CD86 antibodies (R & D Systems; MN) were used for feline CD80 and CD86. Multiple bands ranging from 30kDa to 60kDa specific for feline CD80 were detected, and bands ranging from 40kDa to 70kDa specific for feline CD86 were also detected. An envelope band of FeLV of lOOkDa was detected using the mouse monoclonal antibody for gp70 (BioDesigns; ME).

S-FHV 044: S-FHV 044 is a recombinant feline herpes virus, which expresses five foreign genes. A homology vector designated 957-87. Al was constructed in the following manner: the feline CD80 and CD86 genes were expressed in a cassette of bicistronic DNA under the control of the cytomegalovirus immediate early promoter (CMV IE), which drives the transcription of CD80 and CD86, and included an element IRES EMCV between the two open reading frames. The ß-glucuronidase gene is under the control of the infectious laryngotracheitis gl virus promoter. The ß-glucuronidase and CD80, CD86 genes were inserted into the single long region of FHV at a unique EcoRi site derived from a partial IH fragment of FHV salt, between the adjacent transcriptional activator genes and gL. The parental virus used was S-FHV 016 which contains the FIV gag / protease promoted by IE CMV (with a deletion of nine amino acids at the five prime end of the protease gene), and the β-galactosidase gene from E. coli that it is under the gX promoter of pseudorabies; both genes are located at the gE, short, single (US) deletion site of FHV. S-FHV 044 was derived from S-FHV 016. This was achieved using the homology vector 987-57. Al and S-FHV 016 virus in the HOMOLOGA RECOMBINATION PROCEDURE FOR THE GENERATION OF RECOMBINANT FHV. The transfection material was screened by SCREENING FOR RECOMBINANT FHV EXPRESSING β-glucuronidase (VALUATION X-GLUC). The final result of the multiple turns of purification by green / blue plates was the recombinant virus S-FHV 044. The S-FHV 044 was assessed for the expression of gag of FIV and the marker genes β-glucuronidase and β-galactosidase by Titration of BLACK PLATE. It was determined that 100% of the plates generated in CRFK cells are expressing both marker genes using mouse monoclonal antibodies (BioDesign, ME). VIF gag expression was also confirmed by BLACK PLACA Assay using the mouse monoclonal antibody for VIF gag (Custom Monoclonals, CA). This virus was stable after five passages. The gag expression of FeLV, CD80 and CD86 was confirmed in the WESTERN TRANSFER analysis. Goat polyclonal anti-human CD80 and CD86 antibodies (R & D Systems; MN) were used for feline CD80 and CD86. Multiple bands ranging from 30kDa to 60kDa specific for feline CD80 were detected, and bands ranging from 40kDa to 70kDa specific for feline CD86 were also detected. Two distinct bands of 50kDa and 27kDa specific for VIF gag were detected using the monoclonal FIV gag antibody.

Table 2: Recombinant SPV viruses containing the genes encoding CD80 and / or CD86 or CD28 Table 3: Recombinant RPV viruses containing the genes encoding CD80 and / or CD86 and CD28. Table 4: Recombinant FHV viruses containing the genes encoding CD80 and / or CD86 and CD28.

ADDITIONAL EXAMPLES INVOLVING CD80 and CD86, etc. OF FELINE CO-VECTORIZATION, WITH PARTIAL GENOMICS OR TOTAL LENGTH OF VIF or FELV.

Note: Recombinant viral vectors containing CD80, CD86, CTLA-4 or CD28 in a recombinant virus with the complete or partial genome complement of FIV and / or VID and with or without p35 and p40 of feline IL-12. These recombinant viruses have potential as vaccines against FIV and FeLV diseases in felids. 1. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant swinepox virus containing the total or partial FIV genome. 2. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a feline herpes virus recombinant virus that contains the total or partial FIV genome. 3. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant raccoon pox virus containing the total or partial FIV genome. 4. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant virus of pig pox containing the genome of total or partial FeLV. 5. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant virus of feline herpes virus containing the total or partial FeLV genome. 6. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant raccoon pox virus containing the total or partial FeLV genome. 7. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant pox virus containing the total or partial FIV genome and the genes for IL12, GM-CSF, p35 and p40 of feline. 8. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in combination, in a recombinant feline herpesvirus virus containing the total or partial FIV genome and the genes for IL12, GM-CSF, p35 and feline p40. 9. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant raccoon pox virus containing the total or partial FIV genome and the genes for feline IL12, GM-CSF, p35 and p40 . 10. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in a combination, in a recombinant swinepox virus containing the total or partial FeLV genome and the genes for IL12, GM-CSF, p35 and p40 of feline. 8. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in combination, in a recombinant virus of feline herpes virus containing the total or partial FeLV genome and the genes for IL12, GM-CSF, p35 and feline p40. 9. Expression of feline CD80, CD86, CD28 and CTLA4, alone or in combination, in a recombinant raccoon pox virus containing the total or partial FeLV genome and the genes for IL12, GM-CSF, p35 and p40 of feline.

Table 5: Recombinant viruses containing the FIV (? LTR) genome and the genes encoding feline CD80 and / or CD86 EXAMPLES VECTOR OF HOMOLOGY 1007-70.A2 (SPV N / CMV- VIFgenoma? LTR / I5L-lacZ). The homology vector 1007-70.A2 was used to insert foreign DNA into the HindIII N insertion site of the SPV. It incorporates a β-galactosidase marker gene from E. coli and the full-length FIV genome (8.5kb) without the long terminal repeat (LTR) flanking elements. This cassette is flanked by SPV DNA homologous to a non-essential site within the H.III N fragment of SPV. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing DNA encoding foreign genes was obtained. Note that the ß-galactosidase marker gene is under the control of a constitutive pox promoter, I5L, and the FIV (? LTR) genome is under the control of the cytomegalovirus immediate early promoter (CMV IE). The homology vector was constructed using standard recombinant DNA techniques (Sambrook, et al.). The VIF genome (? LTR) was synthesized by CLONING WITH THE CHAIN REACTION BY POLYMERASE). The template for the PCR reaction was the proviral DNA from a plasmid containing the full-length FIV PPR virus. The primer to the 5 'end (5'-ACGCGTCGACCAGCTAACAAGGTAGGAGAGACTCT-3'; 11/23 / 98BW.3) is synthesized from the 5 'end of the FIV genome towards the 5' end of the Gag coding region and introduces a Sal I site only. The primer towards the 3 'end (51- TCGAGTCGACTTGTGACAGTTCTTAGTCCATAAGC-3 *; 11/11 / 98BW.1) is synthesized from the 3' end of the FIV genome, towards the 3 'end of the 2nd. Exon Rev and introduces a unique Sal I site. The final homology vector, 1007.70.A2, was used to create a recombinant virus containing the FIV genome (without LTR) and feline CD80 and CD86 or containing the FIV (LTR minus) and feline CD80 and CD86 genomes and the IL genes. -12 felines, p35 and p40 according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING SPV, RPV and RECOMBINANT FHV.

VECTOR OF HOMOLOGY 1005-95.1 (RPV U / CMV-VIFgenoma? LTR / I5L-LacZ).

The plasmid 1005-95.1 was constructed in order to insert the foreign DNA into the RPV. It incorporates the LTR of the FIV genome and the E. coli β-glucuronidase gene flanked by RPV DNA. Towards the 5 'end of the foreign gene is a fragment of approximately 906 base pairs of the RPV DNA. Towards the 3 'end of the foreign genes is a fragment of approximately 895 base pairs of the RPV DNA. When the plasmid is used according to the RECOMBINANT RECOMBINANT GENERA RECOMBINATION PROCEDURE, a virus containing DNA that codes for foreign genes will be obtained. Note that the LTR of the FIV genome is under the control of the cytomegalovirus immediate early promoter and the E. coli β-glucuronidase gene is under the control of a synthetic early pox promoter, EP2. The homology vector was constructed using standard recombinant DNA techniques (Sambrook, et al.), by binding restriction fragments from the following sources with the synthetic DNA sequences. The plasmid vector was derived from a HindIII restriction fragment of approximately 2999 base pairs of pSP64 (Promega). Fragment 1 is a restriction subfragment of HindIII to Xbal of approximately 906 base pairs of the restriction fragment U, HindIII of RPV (Knight, et al.). Fragment 2 is a Sali fragment of approximately 8.5kb of the FIV genome without the LTR elements and was synthesized by the CLONING WITH CHLORINE REACTION BY POLYMERASE. The template for the PCR reaction was the proviral DNA from a plasmid containing the full-length FIV PPR virus. The 5 'end primer (5'- ACGCGTCGACCAGCTAACAAGGTAGGAGAGACTCT-3'; 11/23 / 98BW.3) synthesized from the 5 'end of the FIV genome towards the 51st end of the Gag coding region and introduces a unique Sal I site. The primer to the 3 'end (5'-TCGAGTCGACTTGTGACAGTTCTTAGTCCATAAGC-3 *; 11/11 / 98BW.1) is synthesized from the 3' end of the FIV genome towards the 3 'end of the 2nd. exon Rev and introduces a Sal I site. Fragment 3 is a fragment of 2. Okb approximately containing the β-glucuronidase gene of E. coli. Fragment 4 is a subfragment of Xbal to HindIII of approximately 895 base pairs of the U-fragment of HindIII RPV. The final homology vector 1005.95.1 was used to create recombinant viruses containing the FIV (? LTR) genome and the feline CD80 and CD86 genes or to create recombinant viruses containing the FIV (? LTR) genome and the CD80 genes and feline CD86 and feline IL-12 genes, p35 and p40 according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, RPV and FHV.

VECTOR OF HOMOLOGY 1016-74.A6 (FHV? GE / CMV-VIFgenoma-? LTR / gX-lacZ). The homology vector 1016-74.A6 was constructed for the purpose of suppressing a portion of the gE coding region from the feline herpes virus and inserting a foreign DNA. It incorporates the FIV genome (LTR minus) and the E. coli β-galactosidase gene flanked by VHF DNA. The LTR of the FIV genome is under the control of the Cytomegalovirus IE promoter and the β-galactosidase gene is under the control of the gX promoter of the pseudorabies virus. It was constructed from the indicated DNA sources using standard type recombinant DNA techniques (Sambrook, et al.). The plasmid vector is derived from a restriction endonuclease fragment Asp718I to Asp718I of approximately 2958 base pairs of a fragment of a pSP18 / 19. Fragment I is a Asp718I to Smal subfragment of approximately 1415 base pairs of the SalI B fragment of FHV. Fragment 2 is a Sali fragment of approximately 8.5kg of the FIV genome, without the LTR elements and was synthesized by cloning with polymerase chain reaction. The template for the PCR reaction was proviral DNA from a plasmid containing the full-length FIV PPR virus. The primer to the 5 'end (5' -ACGCGTCGACCAGCTAACAAGGTAGGAGAGACTCT-3 '; 11/23 / 98BW.3) was synthesized from the 5' end of the FIV genome towards the 5 'end of the Gag coding region and introduced a Sal I site only. The primer to the 3 'end (5' -TCGAGTCGACTTGTGACAGTTCTTAGTCCATAAGC-3 '; 11/11 / 98BW.l) is synthesized from the 3' end of the IVF genome towards the 3 'end of the 2nd. Exon Rev and introduces a unique Sali site. Fragment 3 is a fragment of the β-galactosidase gene of about 3.5kb. Fragment 4 is a Subfragment SalI to Asp718I of approximately 2205 base pairs of the EcoRI E fragment of FHV. The final homology vector, 1016-74.A6 was used to create recombinant viruses containing the FIV (? LTR) genome and the feline CD80 and CD86 genes or to create recombinant viruses containing the FIV (? LTR) genome and the feline CD80 and CD86 genes and the feline IL-12 genes, p35 and p40 according to the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, RPV and FHV.

SPV 288 SPV 288 is a recombinant swinepox virus that expresses the total complement of the ORF contained in the FIV genome and 4 additional extraneous genes. SPV 288 was derived from SPV 282. SPV 282 contains the feline CD86 gene and the CD80 gene expressed in a cassette of bicistronic DNA under the control of the synthetic LPV pox late promoter, which initiates the transcription of CD80 and CD86 and includes a EMCV IRES element between the two open reading frames; and the ß-glucuronidase gene from E.coli under the control of the synthetic early promoter, EP2, in the genomic fragment H.III K of SPV. The homology vector 992-23.6 was used to construct SPV 282 using the HOMOLOGA RECOMBINATION PROCEDURE FOR GENERATING RPV, SPV or RECOMBINANT FHV. The CD80 and CD86 and β-glucuronidase genes from E. coli are inserted into a distinctive and non-essential partial HV III III HV fragment. The CMV-FIV genome and the β-galactosidase genes are inserted within the Hind III N partial fragment of SPV, distinctive and non-essential. SPV 288 was derived from SPV 282. This was achieved using the homology vector 1007-70.A2 (See above) and SPV 282 virus in the PROCEDURE OF RECOMBINATION HOMOLOGA TO GENERATE RPV, SPV OR FHV RECOMBINANT. The transfection material was screened by SCREENING FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL EVALUATIONS and CPRG) or β-glucuronidase (EVALUATION X-GLUC). The final result of the multiple repeats of the purification of blue / green plaque was the recombinant virus SPV 288. SPV 288 was evaluated to determine the expression of FeLVgag, envelope of FeLV from the FIV genome and of the marker genes, β-galactosidase and β-glucuronidase by means of BLACK PLATE analysis. 100% of the plates generated from ESK-4 cells infected with purified SPV 280 was determined by expressing FeLVgag and FeLV envelope, using a goat polyclonal antibody for FeLVgag (Biodesign, ME) and a mouse monoclonal antibody for the FeLV envelope, gp70 (Biodesign, ME). The expression of the feline CD80 and CD86 genes was confirmed in the WESTERN TRANSFER analysis using the goat polyclonal anti-human CD80 and CD86 antibodies (R &D Systems, MN), respectively. Several bands were detected that varied in size from 30kda to 60kda, specific for the feline CD80 gene and several bands that varied between 40kda and 70kda specific for feline CD86. These bands represent alternating and multiple glycosylation patterns of the CD80 and CD86 genes that are expressed in the context of SPV in ESK-4 cells. The expression of the proteins encoded in the FIV genome was confirmed in the WESTERN TRANSFER analysis using cat serum from cats infected with FIV.

FHV 054 FHV 054 is a recombinant feline herpes virus that expresses the full complement of the ORF contained in the FIV genome and 2 additional extraneous genes. A homology vector designated 1016-75. Bl was constructed for the purpose of inserting the FIV (? LTR) genome and the? -galactosidase into the single long partial Sal H fragment of FHV. The insertion is between the gL gene and the adjacent transcriptional activator gene. The FIV genome is under the control of the CMV IE promoter and the E. coli β-galactosidase gene is under the control of the gX promoter element of pseudorabies. FHV 054 was derived from FHV 030, which contains the feline CD80 gene in the suppressed gE site of FHV. This was achieved using the homology vector 1016-75. Bl and the FHV 030 virus in the HOMOLOGA RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT RPV, SPV OR FHV. The transfection materials were screened by SCREENING FOR RECOMBINANT FHV EXPRESSING β-galactosidase (BLUOGAL EVALUATIONS and CPRG) or β-glucuronidase (EVALUATION X-GLUC). The final result of several repetitions of blue / green plate purification was the recombinant virus FHV 054. FHV 054 was evaluated for its expression of β-galactosidase by BLACK PLATE analysis. 100% of the plates of the CRFK cells infected with FHV 054 purified in plate, was determined by expressing β-galactosidase, using a mouse monoclonal antibody (Biodesign, ME). This virus was determined to be stable after at least 5 subcultures. Feline CD80 gene expression, FIV gag and FIV envelope were confirmed in WESTERN TRANSFER analysis using polyclonal anti-human CD80 antibodies (R & D Systems, MN), mouse monoclonal anti-FIV gag antibodies (Custom Monoclonals, CA) and monoclonal mouse FIV anti-convolutional antibodies (Biodesign). The expression of the total complement of the VIF genes encoded in the genome was confirmed in the WESTERN TRANSFER analysis using convalescent cat serum from a cat infected with FIV.

FHV 055 FHV 055 is a recombinant feline herpes virus that expresses the full complement of the ORF contained in the FIV genome and 3 additional extraneous genes. A homology vector designated 1016-75. Bl was constructed in order to insert the FIV (? LTR) genome and the β-galactosidase into the long, single, partial FHV Sal H fragment. The insertion is made between the gL gene of FHV and the adjacent transcriptional activating gene. The FIV genome is under the control of the CMV IE promoter and the E. coli β-galactosidase gene is under the control of the gX promoter element of pseudorabies. FHV 055 was derived from FHV 041, which contains the CD86 gene and the feline ß-glucuronidase gene in the suppressed gE site of FHV. The feline CD86 is under the control of the gH promoter of FHV and the β-glucuronidase gene is under the control of the gX promoter of the pseudorabies virus. This was achieved using the homology vector 1016-75. Bl and the FHV 041 virus in the HOMOLOGA RECOMBINATION PROCEDURE TO GENERATE RPV, SPV OR RECOMBINANT FHV. The transfection materials were screened by SCREENING FOR RECOMBINANT FHV EXPRESSING β-galactosidase (BLUOGAL EVALUATIONS and CPRG) or β-glucuronidase (EVALUATION X-GLUC). The final result of several repetitions of the purification of blue / green plate was the recombinant virus FHV 055. FHV 055 was evaluated for the expression of β-galactosidase and β-glucuronidase by means of BLACK PLATE analysis. 100% of the plates of the CRFK cells infected by FHV 055 purified in plate, was determined expressing β-galactosidase and β-glucuronidase, using a mouse monoclonal antibody (Biodesign, ME) and a rabbit polyclonal antibody (Molecular Probes, OR ), respectively. This virus was determined as stable in 5 subcultures. Expression of feline CD86 gene, FIV gag and FIV envelope was confirmed by WESTERN TRANSFER analysis using CD86 anti-human polyclonal antibodies (R & amp; amp; amp;; D Systems, MN), mouse monoclonal FIV anti-gag antibodies (Custom Monoclonals, CA) and mouse monoclonal FIV anti-envelope antibodies (Biodesign). The expression of the total complement of the FIV genes encoded in the genome was confirmed by WESTERN TRANSFER analysis using convalescent cat serum from a cat infected with FIV.

RPV 055 RPV 055 is a recombinant raccoon pox virus that expresses the total complement of the ORF contained in the FIV genome and 4 additional extraneous genes. RPV 055 was derived from RPV 0445, which contains the feline CD86 gene and the CD80 gene expressed in a cassette of bicistronic DNA under the control of the late synthetic smallpox promoter, LP1, which initiates the transcription of the CD80 and CD86 genes and includes to an IRES element of EMCV between two open reading frames and the ß-glucuronidase gene of E.coli under the control of the synthetic early promoter, EP2 in the partial genomic fragment H.III N of RPV. The homology vector 1005-95.1 was used to construct RPV 055 using the RECOMBINATION PROCEDURE HOMOLOGA FOR GENERATING RPV, SPV OR RECOMBINANT FHV. The CD80 and CD86 genes and β-galactosidase genes from E. coli were inserted into a distinctive and non-essential partial Hind III fragment of RPV. The CMV-FIV genome and the β-glucuronidase genes were inserted into the partial HindIII U fragment of RPV, distintito and non-essential.

RPV 055 was derived from RPV 045. This was achieved using the homology vector 1005-95.1 and the RPV 045 virus in the RECOMBINATION PROCEDURE HOMOLOGA TO GENERATE RPV, SPV OR RECOMBINANT FHV. The transfection material was sieved by the SCREENING FOR RECOMBINANT SPV THAT EXPRESSES β-galactosidase (BLUOGAL EVALUATIONS and CPRG) or ß-glucuronidase (EVALUATION X-GLUC). The final result of several repetitions of the purification in blue / green plate was the recombinant virus RPV 055. RPV 055 was evaluated in its expression of FeLVgag, envelope FeLV from the genome of FIV and of the marker genes, β-galactosidase and β -glucuronidase by BLACK PLATE analysis. 100% of the plates generated from infected VERO cells with purified RPV 055, were determined to express FeLVgag and FeLV envelope, using a goat pliclonal antibody for FeLVgag (Biodesign, ME) and a mouse monoclonal antibody for the envelope FeLV, gp70 (Biodesign, ME) Expression of feline CD80 and CD86 was confirmed by WESTERN TRANSFER analysis using polyclonal goat anti-CD80 and CD86 antibodies (R &D Systems, MN), respectively. Several bands ranging in size from 30kda to 60kda, specific for the feline CD80 gene were detected and other bands ranging from 40kda to 70kda specific for the feline CD86 gene were detected. These bands represent multiple and alternating glycosylation patterns of the CD80 and CD86 genes expressed in the context of RPV in VERO cells. The expression of the proteins encoded in the FIV genome was confirmed by WESTERN transfer analysis using cat sera from cats infected with FIV.

LIST OF SEQUENCES 1 1 0 ^ Winsl ow, Babara J. Cochr an, Mark D. < 12C > Recombinant virus expressing foreign DNA encoding feline CD80, feline A-4 CT or feline CD86 and uses thereof 1. .0 > _? 4957-E-PCT < l < 10 > Not yet known < i -11 > 1999-0-1-30 • ..; Ü ^ 09 / 071,711 • -! - ?! - _.39fe-0! .- 0i • 'i 70.' ? aten ln Ver. 2.0 2: o .- i < T.-: > 941 feline • .220 • 22- > CDC 222, 1; .. (876) < 4oo: aty ggt c «? Gca gca aag tgg aaa here cca cta ctg aag ca. ': cca tat 48 Mee Gly His Ala Ala Lys Trp Lys Thr Pro Leu Leu Lys His Pro Tyr 5 10 15 ecc aag cr.c trt ceg ctc ttg atg cta gct agt ctt ttt. tac rr .: tet 9 £ Pro I.ys Leu Phe Pro Leu Leu Met Leu Ala Ser Leu P.? < - Tyr? Ht. Cya 20 25 30 tea ggr. at ctc cag gtg aa aag here gtg gaa gaa gta gca. gta cta 44 Ser Gly Tic lie Gin Val Asr. Lys Thr Val Glu Glu Val Wing Val Leu 3 40 45 tcc tgt gat tac aac att 'tcc acc aaa gaa ctg acg gaa att cga at 192 Ser Cys Asp Tyr Asn lie Thr Lys Glu Leu Thr Glu lie Arg lie 50 55 60 cat tjg caa aag gat gat gaa atg gtg ttg gct gtc atg tet ggc aaa 240 Tyr Trp Gln Lys Asp Asp Glu Met Val Leu Wing Val Met Ser Gly Lys (-5 70 75 80 gta ca gtg tgg ecc aag tac aag aac cgc here ttc act gac gtc acc 288 Val Gln Val Trp Pro Lys Tyr Lys Asn Arg Thr Phe Thr Asp Val Thr 85 90 95 cat aac cac tcc att gtg ate atg gct ctg cgc ctg tea gac aat ggc 336? sp Asn His Ser lie Val lie Met Ala Leu Arg Leu Ser Asp Asn Gly 100 105 110 aaa tac act tgt att att caa aag att gaa aaa ggg tet tac aaa gtg 384 Lys Tyr Thr Cys lio lie Gln Lys He Glu Lys Gly Ser Tyr Lys Val lib 120 125 aaa cac ctg act teg gtg atg tta ttg gtc aga gct gac ttc cct gtc 432 Lys Hxs Leu Thr Ser Val Met Leu Leu Val Arg Ala Asp Phe Pro Val 130 135 140 cct agt ata act gat. ctt gga aat cca tet cat aac ate aaa agg ata 480 Pro Ser lie Thr Asp Leu Gly Asn Pro Ser His Asn He í-ys Arg He 145. 150 155 160 atg tgc tta act tet ggt ttt cca aag cct cac ctc tcc tgg ctg 528 Met Cys Leu Thr Ser Gly Gly Phe Pro Lys Pro Hi = Leu Ser Trp Leu i65 i70 175 qaa aat ga. gaa gaa tta aat gcc ate aac here gtt tec caá gat 576 Glu Asn Glu GJu Glu Leu Asn Ala He Asn Thr Thr Val Ser Gln Asp60 185 190 cct gaa acr. gag ctc tac act att age agt gaa ctg gat ttc aat atg 624 Prc Glu Tnr Glu Leu Tyr Thr He Ser Ser Giu Leu Asp Phe Asn Met 195 200 205 here aac aac cat age ttc ctg tgt ctt gtc aag tat gga aac tta cta 672 Tnr Asn Asn His Ser Phe Leu Cys Leu Val Lys Tyr Gly Asn Leu Leu 210 215 220 gta tea cag ate ttc aac tgg aaa tea gag cca cag cct tet aat 720 Val Ser Gir. lie Pne Asn Trp Gln Ly = Ser Glu Pro Gin Pro Ser Asn 225 230 235 240 aat cag ctc tgg ate att ate ctg age tea gta gta agt ggg att gtt 768 A = n Gln Leu Trp He He lie Leu Ser Ser Val Val Ser Gly He Val 245 250 255 gtg ate act gea ctr. acc tta aga tgc cta gtc cac agc cct gct gca 916 Val He Thr Ala Leu Thr Leu Arg Cys Leu Val His Arg Pro Ala Ala 260 265 270 agg tgg aga caa aga gaa atg ggg aga gcg cgg aaa tgg aaa aga tet 864? rg Trp Arg Glp Arg Glu Met Gly Arg Wing Arg Lys Trp Lys Arg Ser 275 280 285 cac ctg tet here tagattctgc agaaccactg tatgeagage atctggaggt 916 His Leu Ser Thr 290 agectettta gctcttctct actag 941 < 210 > 2 < 211 > 292 < 212 > PRT < 213 > CD80 feline 400 > 2 Met 01y His Ala Ala Lys Trp Lys Thr Pro Leu Leu Lys His Pro Tyr 1 5 10 15 Pro Lys Leu Ppe Pro Leu Leu Met Leu Ala Ser Leu Phe Tyr Phe Cys 20 25 30 • Ser Gly He He Gln Val? Sn Lys Thr Val Glu Glu Vai Wing Val Leu: .5 40 45 Ser Cys At.p Tyr? Sn He: Ser Thr Lys Gl Leu Thr GJLU He? Rg He 50 55 60 Tyr Trp Gln Lys A = p Asp Giu Met Val Leu Ala Val Met Ser Gly Lys 65 70 75 30 Val Gln Val Trp Pro Lys Tyr Lys Asn Arg Thr Phe Thr Asp Val Thr 85 90 95 Asp? Sn -U5 Ser He Vai He Met Ala Leu Arg Leu Ser Asp Asn Gly 100 105 110 Lys Tyr Thr Cys He He Gln Lys lie Glu Lys Gly Ser Tyr Lys Val ll 120 125 Lys Hi? Leu Thr Ser Val Met Leu Leu Val Arg Ala Asp Phe Pro Val 130 135 140 Pro Ser He Thr Asp Leu Gly Asn Pro Ser His Asn He Lvs Ara He 150 155 160 Met Cys Leu Thr Ser Gly Gly Phe Pro Lys Pro His Leu Ser Trp Leu 165 170 175 Giu Asn Glu Glu Glu Leu Asn Wing He Asn Thr Thr Val Ser Gln Asp 180 -85 190 Pro Glu Thr Glu Leu Tyr Thr He Ser Ser Glu Leu Asp Phe Asn Met 195 200 205 Thr Asr. Asn His Ser Phe Leu Cys Leu Val Lys Tyr Gly Asn Leu Leu 210 215 220 Val be Gin He Phe Asn Trp Gln Lys Ser Glu Pro Glr. Pro Ser? Sn 225 230 235 240 Asn Glr. Leu Trp He He He Le Le Ser Ser Val Val Ser Gly He Vai 245 250 255 Val lie Thr Ala Leu Thr Leu Aro Cys Leu Val Kis Arg Pro Ala Wing 260 265 270 Arg Trp Arg Gln Arg Glu Met Gly Arg Ala Arg Lys Tru Lys ? rg Ser 275 280 285 His Leu Ser Thr 290 • - iü 2 211 > 879 '.212 - DNA < 2i3.-CD80 feline • C22C- • '221 > CDS 222 > ! ii .. ¡876) 400 > 2 ato qgt cac gca gca aag tgg aaa ac cca cta ctg aay falls cca tat 48 Met Gly Kis Ala Aia Lys Trp Lys Thr Pro Leu Leu Lys His Pro Tyr 1 5 10 15 ecc __ ctc ctc ctc ctc ttg atg cta gct agt ctt ttt cac ttc tgt 96 Pro Lys Leu Phe Pro Leu Leu Met Leu Wing Ser Leu Phe Tyr Phe Cys 20 25 30 tea ggt ate ate cag gtg aac aag a gcg gaa gaa gta gca gta cta L44 Ser Gly He He Gln Val Asn Lys Thr Val Glu Val Val Val Leu 35 40 45 tcc tgt gat tac aac att tcc acc aaa gaa ctg acg gaa att cga ate 192 St-x Cys Asp Tyr Asn He Ser Thr Lys Glu Leu Thr Giu He Arg He 50 55 60 tat tgg caa aag gat gat gaa atg gtg ttg gct gtc atg tet gge aaa 240 Tyr Trp Gln Lys Asp Asp Glu Met Val Leu Wing Val Met Ser Gly Lys 65 70 75 80 gta ca qtg tgg ecc aag tac aag aac cgc here tc act gcc ac 288 Vai Gln Val Trp Pro Lys Tyr Lys Asn Arg Thr Phe Thr Asp Val Thr 85 90 95 gat aac cac tcc ait gtg ate atg gct ctg cgc ctg tea gac aat ggc 336 Asp Asn H s Be He Val He Met Wing Wing Leu Arg Leu Being Asp Asn Gly 100 105 HO aaa tac act tgt ate att ata g ata aaa ggg tet tac aaa gtg 384 Lys Tyr Thr Cys He He Gln Lys He Gln Lys Gly Ser Tyr Lys Val 115 120 125 aaa cac ctg act gtg atg tta ttg gtc aga gct gac ttc cct gtc 432 Lys His Leu Th: Ser Val Met Leu Leu Val Arg? La Asp Phe Fro Val 130 135 140 cct age ata act gat ctt gga aat cca tet cat aac ate aaa agg ata 480 Pro Ser He Thr Asp Leu Gly Asn Pro Ser His Asn He Lys Arg He 145 150 155 160 atg tgc tta act. tet gga ggt ttt cca aag cct cac ctc tcc tgg ctg 528 Met Cys Leu Thr Ser Gly Gly Phe Pro Lys Pro His Leu Ser Trp Leu 165 170 175 gaa aat gaa gaa gata tta aat gcc ate aac ac ac gtt te ca ga gat 57. Glu Asn Glu olu Glu Leu Asn Wing He Asn Thr Thr Vai Ser Gln Asp 180 185 190 cct gaa act gag ctc tac act att age agt gaa ctg gat ttc atat 624 Pro Glu Thr Glu Leu Tyr Thr He Ser Ser Glu Leu Asp Phe Asn Met 195 200 205 ac aac aac cat age ttc ctg tgt ctt gtc aag tat gga aac tta ata 672 Thr Asn Asn My Being Phe Leu Cys Leu Val Lys Tyr Gly Asn Leu He 210 215 220 gta tea cag ate ttc aac tgg ca aaa tea gag cca cag cct tet aat 720 Val Ser Gln He Phe? Sn Trp Gln Lys Ser Glu Pro Gln Pro Ser Asn 225 230 235 240 aat cag ctc tgg ate att ate ctg age tea gta gta agt ggg att gtt 768 Asn Gln Leu Trp He He He Leu Ser Ser Val Val Ser Gly De Vai 245 250 255 ctg ate act gca ctt acc tta aga tgc cta gtc cac aga cct gct gca 816 Val He Thr Ala Leu Thr Leu Arg Cys Leu Val Kis Arg Pro Ala Ala 260 265 270 agg tgg aga caga aga gaa atg ggg aga gcg cgg aaa tgg aaa aga tet 864 Arg Trp Arg Gln Arg Glu Met Gly Arg Ala Arg Lys Trp Lys Arg Ser 275 280 285 cac e ".g tet here tag 879 Hts Leu Ser Thr 290 210 > 4 < 2H > 292 '' 12 > PRT < -2-3-- Feline CD80 < Cú A Mel Gly h: s Ala Ala Lys Trp Lys Thr Pro Leu Leu Lys til Vi or Tyr 5 10 15 Pro Ly__ Leu Phe Pro Leu Leu Met Leu Ala Ser Leu Phe Tyr Phe Cys 20 25 30 Ser Gly He- He Gin Val? Sn Lys Thr Val Glu Glu Val Val Val Leu 35 40 45 Se r Cys Asp Tyr As He Ser Thr Lys Glu Leu Thr Glu He Arg He 50 55 60 Tyr Trp Glr. Ly- > Asp Glu Met Vai Leu Ala Val Met Ser. Gly Lys 65 70 75 8C Val Gin Val Trp Pro Lys Tyr Lys? Sn? Rg Thr Phe Thr Asp Val Thr 85 90 95 Asp Asn His Ser He Val He Met Ala Leu Arg Leu Ser Asp Asr. Giy 100 105 110 Lys Tyr Thr Cys He He Gln Lys He Gln Lys Gly Ser Tyr Lys Val 115 120 125 Lys His Leu Thr Ser val Met Leu Leu Val Arg Ala Asp Phe Pro val 130 135 140 Pro Ser He Thr Asp Leu Gly Asn Pro Ser His Asn He Lys Arg He 145 150 155 160 Met Cys Leu Thr Ser Gly Gly Phe Pro Lys Pro His Leu Ser Trp Leu 165 170 175 Glu Asn Glu Giu Giu Leu Asn Wing He Asn Thr Thr Val Ser Gln Asp 180 185 190 Pro Olu Thr Glu Leu Tyr Thr He Ser Ser Glu Leu Asp Phe Asn Met 195 200 205 Thr? Sn Asn His Ser Phe Leu Cys Leu Val Lys Tyr Gly Asn Leu He 210 215 220 Val Ser Gln He Phe Asn Trp Gln Lys Ser Glu Pro Gln Pro Ser Asn 225 230 235 240 Asn Gln Leu Trp He He He He Leu Ser Val Val Ser Gly He Val 245 250 255 Val He Thr Ala Leu Thr Leu Arg Cys Leu Val His Arg Pro? The Wing 260 265 270 Arg Trp Arg Gln Arg Giu Met Giy Arg Ala Arg Lys Trp Lys Arg Ser 275 280 265 üis Leu Ser Thr 290 «.2: or > 5 < 211 > 1080 < 212 > DNA < 213 > Feline CD80 < 220 > < 221 > CDS < 2220 > (63) .. (1052) < -400 > 5 gtttctgtgt tcctcgggaa tgtcactgag cttatacatc tggtctctqg gagctgcagt 60 gg atg ggc att tgt gac age act atg gga ctg agt cac act ctc ctt 107 Met Gly He Cys Asp Being Thr Met Gly Leu Being His Thr Leu Leu 1 5 10 15 qtg atg gcc ctc ctc ctc tet ggt gtt tet tcc atg aag agt ca gca Val Met Ala Leu Leu Ser Gly Val Ser Ser Met Lys Ser Gln Wing 20 25 30 tat ttc aac aag aga act gga gaa ctg cca tgc cat ttt here aac tet ca 203 Tyr Phe Asn Lys Thr Gly Glu Leu Pro Cys His Phe Thr Asn Ser Gln 40 45 aac ata age ctg gat gag ctg gta gta ttt tgg cag gac cag gat aag 251 Asn He Ser Leu Asp Glu Leu Val Val Phe Trp Gln Asp Gln Asp Lys I-C 55 60 ctg gtt etg tat gag ata ttc aga ggc aaa gag aac cct aat gtt 299 Leu Val Leu Tyr Glu He Phe Arg Gly Lys Glu Asn Pro Gln Asn Val 65 70 75 cat ctc aaa tat aag ggc cgt here age ttt gac aag gac aac tgg acc 347 His Leu Ly = Tyr Lys Gly Arg Thr Ser Phe Asp Lys Asp? Sn Trp Thr 80 85 90 95 ctg aga ctc falls to gtt cag ate aag gac aag ggc here tat cac tgt 395 Leu? R? Leu Hrs? Sn Val Gln He Lys Asp Lys Gly Thr Tyr His Cys 300 105 110 ttc att cat tat aaa ggg ecc aaa gga cta gtt ecc atg cac ca atg 44: Phe He His Tyr Lys Gly Pro Lys Gly Leu Val Pro Met His Gln Met 115 120 125 agt tet gac cta tea gtg ctt gct aac ttc agt caa cct gaa ata ata 491 Ser Ser Asp Leu Ser Val Leu Ala Asn Phe Ser Gin Pro Glu He Thr 130 135 140 gta act rct aat aga gaa aat tet ggc ate ata aat t'.g acc tgc 539 Vai Thr Ser? sn Arg Thr Glu Asn Ser Gly He He Asr. Leu Thr Cys 145 150 155 tea tet ata ca ggt tac cca gaa cct aag gag atg tat ttt cag cta 587 Ser Ser He Gln Giy Tyr Pro Giu Pro Lys Glu Met Tyr Phe Gin Leu 160 165 170 175 aac act gag aat tea act act aag tat gat act act gtc atg aa aaaa tet 635 Asn Thr Glu Asn Ser Thr Thr Lys Tyr Asp Thr Val Met Lys Lys Ser 180 185 190 caat aat aat aat aat aat a gaa ctg tac aac gtt tet ate age ttg cct ttt 683 Gin Asr. Asn Val Thr Glu Leu Tyr Asn Val Ser He Ser Leu Pro Phe 195 200 205 tea gr.c cct gaa gca cac aat gtg age gtc ttt tgt gcc ctg aaa ctg 731 3tí_ ul Pro Glu Ala His? Sn Val Ser Vai Phe Cy = Leu Lys Leu 210 215 220 gac ctg gag atg ctg ctc tcc cta cct ct ttc aat ata gca caca 779 Giu Thr Leu Glu Met Leu Leu Ser Leu Pro Phe Asn He Asp Ala Gln 230 235 cct aag gat aaa gac cct gaa ca gcc cac ttc ctc tgg att gcg gcr. 827 Pro Lys? Sp Lys Asp Pro Giu Gln Gly His Phe Leu Trp He Wing Wing 24-2 245 250 255 gt-i ctt gta atg ttt gtr gr.t ttt tgt ggg atg gtg tcc ttt aaa here 875 Val Leu Val Met Phe Val Val Phe Cys Gly Met Val Ser Phe Lys Thr 260 265 270 ct? agg aaa agg aag aag aag cag ccr. gcc ecc tet cat gaa tet gaa 923 Leu Arg Lys Arg Lys Lys Gir Lys. Pro Gly Pro Ser His Glu Cy.s Glu 275 280 285 ace etc aaa agg gag aga gag age aaa cag acc aac gaa aga gta 971 Tnr He Lys Arg Glu? Rg Lys Glu Ser Lys Gln Thr Asn Glu? Rg al 290 295 300 ce :.; tac C? gta cct. gag aga tet gat gaa gcc cag tgt gtt aac att 1019?: o Tvr ¡.-. s Val Pro Giu Arg Ser Asp Glu? the Gln Cys Val Asn He 30b 310 315 ttg aag here gec tea ggg gac aaa aat cag tag gaaaatggtg gettggcgtg 1072 eu Lys Thr Wing Ser Gly Asp Lys Asn Gln 320 325 330 ctgacaat 1080 i0 ~ > 6 < il- > 329 < 212 > PRT 2i3 > Feline CD80 < 400 > 6 Met G i and He Cys? Sp Ser Tnr Met Gly Leu Ser His Th r Leu Leu Vai 5 10 i b Met Ala Leu Leu Leu Ser Gly Val Ser Ser Met Lys Ser Gln Ala Tyr 20 25 30 Phe Asn Lys Thr Gly Glu Leu Pro Cys Hxs Phe Thr Asn Ser Gin Asn 35 40 45 He Ser Leu Asp Glu Leu Val Val Phe Trp Gln Asp Gin Asp Lys Leu 50 55 60 Val Leu Tyr Glu He Phe Arg Gly Lys Glu Asn Pro Gin Asr. Val His 65 70 75 80 Leu Lys Tyr Lys Giy? Rg Thr Ser Phe Asp Lys Asp Asr. Trp Thr Leu 85 90 95 Arg Leu Hxs Asn Val Gln He Lys Asp Lys Gly Thr Tyr Hxs Cys Phe 100 105 H0 He Hxs Tyr Lys Gly Pro Lys Giy Leu Val Pro Met His Gln Met Ser 115 120 125 Ser? Sp Leu Ser Vai Leu Wing Asn Phe Ser Gln Pro Glu He Thr Val J30 135 140 Thr Ser Asr. Arg Thr Glu Asn Ser Gly He He Asn Leu Thr Cys Ser 145 150 155 160 Ser He Gln Gly Tyr Pro Glu Pro Lys Glu Met Tyr Phe Gln Leu Asn 165 170 175 Thr Glu Asn Ser Tnr Thr l.ys Tyr Asp Thr Val Met Lys Lys Ser Glr. 180 185 190 Asn Asn Val Thr Glu Leu Tyr Asn Val Ser He Ser Leu Pro Phe Ser 19b 200 205 Val Pro Glu Ala Hxs Asn Val Ser Val Phe Cys Ala Leu Lys Leu Glu 210 215 220 Thr Leu Glu Met Leu Leu Ser Leu Pro Phe Asn He Asp Ala Gln Pro 225 230 235 240 Lys Asp Lys? Sp Pro Glu Gln Gly His Phe Leu Trp He Ala Wing Val 245 250 255 Leu Val Met Phe Val Val Phe Cys Gly Met Val Ser Phe Lys Tht Leu 260 265 270 Arg Lys Arg Lys Lys Lys Gln Pro Gly Pro Ser Hxs Glu Cys Glu Thr 275 280 285 He Lys Arg Glu Arg Lys Giu Ser Lys Gin Thr Asn Glu Arg Val Pro 290 295 300 Tyr His Val Pro Glu Arg Ser Asp Glu Wing Gln Cys Val Asn He Leu 3C5 310 315 320 Lys Thr? The Ser Gly Asp Lys Asn Gln 325 < 210 > 7 < 211 > 688 212.- DNA < 13. > Feline CD28 < 220 > < 221 - > CDS < 222 > (i) .. (663! <U0--7 att ate ctc agg ctg ctt ctg gct ctc aac ttc ttc ecc ate att caa 48 Met He Leu Arg Leu Leu Leu Ala Leu Asn Phe Phe Pro Ser He Gin 1 10 15 gta acs gaa aac aag att ttg gtg aag cag ttg ecc agg ctt gtg gtg 96 al Thr Giu Asn Lys He Leu Val Lys Gln Leu Pro? Rg Leu Val Val 20 25 30 tac aac aat gag gtc aac ctt age tgc aag tac act cac aac ttc ttc 144 Tyi? sr; Asn Glu Val Asn Leu Ser Cys Lys Tyr Thr His Asn Phe Phe 35 40 45 tea aag gag ttc cgg gca tcc ctt tat aag gga gta gat agt gct gtg 192 Ser Lys Glu Phe Arg Ala Ser Leu Tyr Lys Gly Val Asp Ser Ala Val 50 55 60 gaa gtc tgc gtt gtg aat gga aat tac tcc cat cag cct cag ttc tac 240 Glu Val Cys Val Val Asn Gly Asn Tyr Ser His Gin Pro Gln Phe Tyr 65 70 75 80 tea .agt here gga ttc gac tgt gat ggg aaa ttg ggc aat gaa here gtg 288 Being Ser Thr Gly Phe Asp Cys Asp Gly Lys Leu Gly Asn Glu Thr Vai 85 90 95 here ttc tac ctc cga aat ttg ttt gtt aac cag acg gat att tac ttc 336 Thr Phe Tyr Leu Arg Asn Leu Phe Val Asn Gln Thr Asp He Tyr Phe 100 105 no tc aaa att gaa gtc atg tat. cca cct cct tac ata gac aat gag aag 384 Cyr > Lys He Glu Val Met Tyr Pro Pro Tyr He Asp Asn Glu Lys 115 120 125 age aat qgg acc att ate cac gtg aaa gag aaa cat ctt tgt cca gct 432 Ser Asn Gly Thr He He His Val Lys Glu Lys His Leu Cys Pro Wing 130 135 140 cag ctg tet cct gaa tet tcc aag cca ttt tgg gca ctg gtg gtg gtt 480 Gin Leu Ser Pro Glu Ser Ser Lys Pro Phe Trp Ala Leu to Val Val 145 150 155 160 ggt gga ate cta ggt ttc tac age ttg cta gca here gtg gct ctt ggt 528 Gly Gly He Leu Gly Phe Tyr Ser Leu Leu Wing Thr Val Leu Gly 165 170 175 gct tgc tgg atg aag ag ag ag ag ag ate ctt cag agt gac tat 576 Ala Cys Trp Met Lys Thr Lys Arg Ser? Rg He Leu Gln Ser Asp Tyr 180 185 190 atg aac atg acc ecc cgg agg cca ggg ecc ac cg agg cac tac ca 624 Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Arg His Tyr Gln 195 200 205 cct tac gc.r. cca gca c? c gac ttt gcg gca tac cg tcc tgacatggac 673 Pro Tyr Ala Pro? la Arg, \ p Phe Ala? ia Tyr Arg Ser 210 215 220 ccctatccag aagee 688 < 210 > 8 < 211 > 221 < 212 > PRT < 213 > CD28 feline 400 > 8 Met He Leu Arg Leu Leu Leu Al a Leu Asn Phe Phe Pro Be He Gln 1 10 15 Val Thr Glu Asn Lys He Leu Val Lys Gln Leu Pro Arg Leu Va l Val 20 25 30 Tyr Asn Asn Gl u Val Asn Leu Ser Cys Lys Tyr Thr K-. S Asn Phe Phe 35 40 45 be Lys Glu Phe Arg Wing Ser Leu Tyr Lys Gly Val Asp Ser Wing Val 50 55 60 Giu vai Cys Val Val Asn Gly Asn Tyr Ser His Gln Pro Gln Phe Tyr 65 70 75 80 Be Ser Thr Gly Phe Asp Cys Asp Gly Lys Leu Gly Asn Glu Thr Val 85 90 95 Thr Phe Tyr Leu Arg Asn Leu Phe Val Asn Gln Thr Asp He Tyr Phe 100 105 110 Cys Lys He Glu Val Met Tyr Pro Pro Pro Tyr He Asp Asn Giu Lys 115 120 125 Ser? Sn Giy Thr lie ile His Val Lys Glu Lys Hxs Leu Cys Pro Allah 130 135 140 Gln Leu Ser Pro Glu Ser Ser Lys Pro Phe Trp Ala Leu Val Val Val 145 150 155 160 Giy Gly lie Leu Gly Phe Tyr Ser Leu Leu Ala Thr Val Ala Leu Gly 165 170 175 Wing Cys Trp Met Lys Thr Lys Arg be Arg He Leu Gln Ser Asp Tyr 80 185 190 Met rn Met Thr Pro Arg? Rg Pro Gly Pro Thr Arg Arg His Tyr Gl: _ 200 205 Pro Tyr? Ia Pro Wing Arg Asp Phe? Ia Wing Tyr Arg Ser 210 215 220 < 2i0 > 9 < 2 i 1 > 749 < 212 > DNA < 2 ¿3 > Feline CTLA-4 < 220 < 221 > CDS 222 ^ (27) .. (698) < 400? 9 aacctgaaca ctgctcccat aaagcc atg gct tgc ttt gga ttc cgg agg cat 53 Met Ala Cys Phe Giy Phe? Rg? Rg His ggg gct cag ctg gac ctg gct tet agg acc tgg ecc tgc act gct ctg 101 Gly? Ia Gln Leu Asp Leu Ala Ser Arg Thr Trp Pro Cys Thr Ala Leu 15 20 25 ttt tet ctt ctc ttt ate ecc gtc ttc tcc aaa ggg atg cat gtg gcc 149 Phe Ser Leu Leu Phe He Pro Vai Phe Ser Lys Gly Met His Val Wing 30 35 40 cac cct gca gtg gtg ctg gcc age age cga ggt gtc gcc age ttc gtg 197 Hx s Pro Ala Val Val Leu Ala Being Ser Arg Gly Val Ala Ser Phe Val 45 50 55 tgt gaa tat ggg tet tea ggc aat gcc gcc aaa ttc cga gtg act gtg 245 Cys Glu Tyr Gly Ser Gly Asn Ala? Lys Phe Arg Vai Thr Val 60 65 70 ctg agg caa act ggc age caa atg act gaa gtc tgt gct gcg here tac 293 Leu Arg Glr. Thr Gly Ser Cln Met Thr Glu Val Cys Ala Wing Thr Tyr 75 80 85 here gtg gag aat gag ttg gcc ttc cta aat gat tcc acc tgc act ggc 341 Thr Val Glu Asn Glu Leu Wing Phe Leu Asn Asp Ser Thr Cys Thr Gly 90 95 100 105 ate tcc age gga aac aaa gtg aac ctc acc ate ca ggg ttg agg gec 389 Be Ser Giy? Sn Lys Val Asn Leu Thr He Gln Gly Leu Arg Ala 110 115 120 atg gac acg gga ctc tac ate tgc aag gtg gag ctc atg tac cca cca 437 Met Asp Thr Gly Leu Tyr He Cys Lys Val Glu Leu Met Tyr Pro Pro 125 130 135 ecc tac tat gca ggc atg ggc aat gga acc cag att tat gtc ate gat 485 Pro Tyr Tyr Ala Gly Met Gly Asn Giy Thr Gln He Tyr Val He Asp 140 145 15C cct gaa cct tgc cca gat tet gac ttc ctc ctc ctc tgg ccc gca gca gca 533 Pro Glu Pro Cys Pro Asp Ser Asp Phe Leu Leu Trp He Leu Wing 155 160 165 gtc agt tea gga ttg ttt ttt tat age ttc ctt ate here gct gtt tet 581 Val ser Ser Gly Leu Phe Phe Tyr Ser Phe Leu He Thr? la Val Ser 170 • 175 180 185 ttg age aaa atg cta aag aaa aga age cct ctt act here ggg gtc tat 629 Leu Ser Lys Met Leu Lys Lys Arg Ser Pro Leu Thr Thr Gly Vai Tyr 190 195 200 gtg aaa atg ecc cca here gag cca gaa tgt gaa aag caa ttt cag cct 677 Vai Lys .Ket Pro Pro Thr Glu Pro Glu Cys Glu Lys Gln Phe Gln Pro 205 210 215 tat ttt att ecc ate aat tga cacaccgtta tgaagaagga agaacactgt 728 Tyr Phe He Pro He Asn ¿- < .? ecaattteta agagetgagg c T49 < 210 > 10 < 2H > 223 < 212 > PRT < 213 > Feline CTLA-4 < 400 > IC Met Ala Cys Pn-- Giy Phe Arg Arg Hxs Gly Ala Gln Leu? Sp Leu Ala 1 1C 15 Ser? Rq Thr Trp Pro Cys Thr Ala Leu Phe Ser Leu Leu Phe He Pro 20 25 30 val Phe Se Lys Gly Met Hxs Val Ala Hxs Pro Ala Val Val Leu Ala 3 40 45 Ser Ser? Rg Gly Vui? Ia Ser Phe Val Cys Glu Tyr Gly Ser Ser Gl? 50 55 60 Asn Ala? The Ly. ". Pne? Rg Vai Thr Val Leu Arg Gln Thr Gly Ser Gln 65 70 75 80 Met Thr Glu Val Cys Ala Wing Thr Tyr Thr Val Glu Asn Glu Leu Wing 8b 90 95 Phe Leu Asn? Sp Ser Thr Cys Thr Gly He Ser Ser Giy A = n Lys Val 100 105 110 Asn Leu Thr He Gln Giy Leu Arg Ala Met Asp Thr Gly Leu Tyr He 115 120 125 Cys Lys Vai Glu Leu Met Tyr Pro Pro Pro Tyr Tyr Wing Gly Met Gly 130 135 140 Asn Gly Thr Gln He Tyr Val He Asp Pro Glu Pro Cys Pro Asp Ser 145 150 155 160 Asp Phe Leu Leu Trp He Leu Ala Wing Val Ser Ser Gly Leu Phe Phe 165 170 175 Tyr Ser Phe Leu lie Thr Ala Val Ser Leu Ser Lys Met Leu Lys Lys 180 185 190 Arg Ser Pro Leu Thr Thr Gly Val Tyr Val Lys Met Pro Pro Thr Glu 195 200 205 Pro Glu Cye Glu I.y Gln Phe Gln Pro Tyr Phe He Pro He Asn 210 215 220 < 210 > 11 < 2il > 40 < 212 > DNA < 21i > feline CD80 primer < 400 > il cgcqgatccg caccatgggt cacgcagcaa agtggaaaac 4C < 210 > 1 < 21i > 25 < 212 > DNA < 213 > feline CD80 primer < 400 > 12 cctagtagag aagagctaaa gag? C < 210 > 13 < 211 > 33 < 212 > DNA < 212 > feline CD80 primer < 40ü 13 cgcggatcca ccggtagcac aatgatcctc agg 33 < 210 > 14 < 211 > 31 < 2i'2 > DNA < 213 > feline CD80 primer < 00 > 14 cgcggatcct ctggataggg gtccatgtca g 31 < 210 > 15 < 211 > 27 < 212 > DNA < 213 > feline CTLA-4 primer < 400 > 15 atggcttcgc cttggatttc cagcagg 27 < 210 > 16 211 29 < 212 > DNA 213 > feline CTLA-4 primer < 400 > 16 tcaattgaat gaggaataaa ataaggctg 29 i0 > 17 2H > 28 < 212 DNA < 21 > feline CTLA-4 primer - 400 > 17 t.gttgggttt ctgactctgu ttccctg i.210 > IR 2H > 24 < 212 > DNA < 213 > feline CTLA-4 primer -400 > 18 gcntagtagg gtggtgggta catg 24 < 210 > 19 < 211 > 28 < 212 > DNA < 213 > feline CTLA-4 primer < 400 > 19 tgttgggttt ctgactctga cttccctg 28 < 210 > 20 < 211 > 20 212 > DNA < 213 > feline CTLA-4 primer < 400 > 20 acatgagctc caccttgcag 20 < 210 > 21 .21-. > 27 < 212 > DNA < "i 3 feline CTLA-4 primer <400> 21 ccatcctaat.acgactcact ar.agggc 27 < 210 > 22 < 2H 24 < 212 > DNA < 213 > feline CTLA-4 primer < -?or:. > 22 gtgaatatgg gtcttcaggc aatg 24 < 210 > 23 < 2il > 23 212 > DNA 213 > feline CTLA-4 primer < 400 23 actcactata gggetcgagc ggc 23 < 21C > 24 < 211 > 23 < 12 > DNA < 213 > feline CTLA-4 primer < 400 > 24 gaaatccgag tcactgtgct gag 23 210 > 25 < 2il > 24 < 212 > DNA < 213 > feline CTLA-4 primer < 400 > 25 aacctgaaca ctgctcccat aaag 24 < 210 > 26 < 211 25 < I2 > DNA < 213 > feline CTLA-4 primer < "00 > 26 gcctcagctc ttagaaattg gacag 25 < 210 27 < 211 > 21 < 212 > DNA < 213. > feline CD86 primer < 400 > 27 tagtattr.rq qcaggaccaq g < 210 > 23 < 2il > 23 < 212 > DNA < 2i3 > feline CD86 primer ^ 00 > 28 ctgtgaeatt atcttgagat ttc < 210 > 29 < 211 > 22 < 212 > DNA < 213 feline CD86 primer < 40C > 29 gagcatgcac taatgggact gag < 210 > 30 < 211 ~ > 23 < 212 > DNA < 213 > feline CD86 primer < 400 > 30 etgtgacatt atcttgagat ttc < 210 > 31 < 211 > 27 < 212 > DNA < 2i3 > feline CD86 primer < 400 > 31 ceatcctaar acgactcact atagggc 27 < 210 > 32 2ii > 2P 212 > DNA < 213 > feline CD86 primer < 00 > 32 tgggtaacet tgtatagatg agcaggtc < 210 > 23 < 21i > 23 212 > DNA < 2i3 > feline CD86 primer < 400 > 33 actcactata cggctcgagc ggc < 210 > 34 -'2i2 DNA < :: -.: - feline CD86 primer < 400 34 caggttgact gaagttagca agcac < 210 > 35 < 2H > 27 < 212 > DNA < 2i3 > feline CD86 primer < -100 > 25 ccatcctaat acgactcact atagggc < 210 > 36 < 211 > 25 < 212 > DNA < 213 > feline CD86 primer < 400 > 36 g? Acaagggc acatatcact gtttc 25 < 210 > 37.-p 23 < 212 > DNA < 213 > feline CD86 primer < 400 > 37 actcactata gggctcgagc ggc 23 < 210 > 38 < 211 > 25 < 212"> DNA <213> Feline CD86 primer < 400 > 38 cagtgcttgc raacttcagt caacc 25 ^ 210 > 39 < 2H > 23 < 212 > DNA < 213 > feline CD86 primer < 400 > 39 cgggaatgtc actgagctta tag 23 2JC > 40 -'211 23 < 212 > DNA < 212 > feline CD86 primer < 40C > 40 gatctttttc aggttagcag ggg 23 < 210 > 41 < 211 > 20 < 212 > DNA < 213 > feline CD80 primer < 400 > 41 atgggtcacg cagcaaagtg 20 < 210 42 < 21- > 20 < 212 > DNA < 213 > feline CD80 primer 400 > 42 ctatgtagac aggtgagatc 20 < 210 > 43 • - • 211- > 17 < 212 > DNA < 213 > feline CD80 primer < 40C > 43 caggaaaeay ctatgac 17 < 21Q > 44 < 211 18 < 212 > DNA < .'213 > feline CD80 primer < 400 44 aatacgactc actatagg < 210 > 45 < 211 > 21 < 212 > DNA < 213 > feline CD80 primer < 400 > 45 aacaccattt catcatcctt t 21 < 210 > 46 < 21i > 23 < 212 > DNA 213.- feline CD80 primer < 400 > 46 atacaagtgt atttgccatt gtc 23 < 400 > 41 atgggtcacg cagcaaagtg 20 < 210 > 42 < 211 20 < 212 > DNA < 2i3 > feline CD80 primer < 400 > 42 ctatgtagac aggtgagatc 20 < 210 > 43 < 211 17 < 212 > DNA 213 > feline CD80 primer < 40C > 43 caggaaacag ctatgac 17 < 2 i 0 > 44 211 18 < 212 > DNA < 213 > feline CD80 primer < 400 > 44 aatacgactc artatagg 18 < 210 > 45 < 2H > 21 < 212 > DNA < 213 > feline CD80 primer < 400 > 45 aacaccattt catcatcctt t < 210 > 46 < 211 > 23 < 212 > DNA < 213 > feline CD80 primer < 400 > 46 atacaagtgt atttgccatt gtc 3 < 211 29 < 212 > DNA < 213 > feline CD80 primer < 400 > 52 tcgagaattc gggtcacgca gcaaagtgg 29 < 210 > 53 < 2 H > 32 < 212 > DNA < 213 feline CD80 primer < 400 > 53 qctaggatcc aatctatgta gacaggtgag at < 210 > 54 < 2H > 32 < 212 > DNA < 2i2 > feline CD80 primer < 40C > 54 gatgaattcr. a tgatcctca ggctgggcrt ct 32 < 21C > 55 < 211 > 29 < 212 > DNA < 213 feline CD80 primer < 400 55 gatcagatct cacgaacggt atgecgcaa 29 < 210 > 56 < 2il > 22 < 212 > DNA < 212 > B7-2 primer < 40C > 56 ggcccgagta aaqaaccgg ac < 210 > 57 < 211 > 24 < 212 DNA < 213 > B7-3 primer < 400 > 57 cagwttcagg atcytgggaa aytg 24 < 21 > 58 < 211 > 20 < 212 > DNA < 2i3 > B7-284 primer < 400 > 58 ttatactagg gacagggaag 20 < 210 > 59 < 2H > 20 < 212 > DNA 213 > B7-190 primer < 400 > 59 aggetttgga aaacctccag 20 < 2? 0 > 60 21i > 21 < 212 > DNA < 213 B7-20 primer < 40ü > 60 ttgttatcgg tgacgtcagt g 21 < 210 > 61 < -2H 22 212 > DNA < 213 > Primer B7-135 < 400 > 61 caataacatc dccgaagcca gg 22 ^ 21Ü- > 62 < 11 > 22 < 212 DNA < 213 > primer B7-s220 < 400 > 62 gtcatgtctg gcaaagtaca ag 22 210 > 63 211 > 22 < 212 > DNA ^ 213 > B7-50 << 400 > 63 cactgacgtc accgataacc ac 210 > 64 < 211 > 22 < 212 > DNA 213 > B7-140 primer < 400 > 64 22 ctgacttcgg tgatgttatt gg < 210 > 65 < 211 > 21 12 DNA < 213-- Primer B7-550 < 40C > 65 21 gccatcaaca caacagtttc c 210 > 66 • '211 > 22 212- > DNA < 213 > B7-620 primer < 400 > 66 22 tdtqacaaac aaccatagct te < 210 > 67 < 2H > 20 < 212 > DNA < r213 > primer B7-1281 < 400 > 67 20 graaga tgc ctcatgakcc < 210 > 66 < 21i > 1 . < 212 > DNA < 213 > primer B7-1260 < 400 > 68 cayratccaa cataggg 17 < 210 69 < 211 > 21 < 212 > DNA < 212 > initial primer B7 < 400 > 69 atgggtcacg cagcaaagtg g 21 < 210 > 70 < 211 > 25 < 212 > DNA < 2i2 > Primer B7-960 < 400 > 70 cctagtagag aagagctaaa gaggc 25 < 210 > 71 < 211 > 21 < 212 > DNA < 213 > CD28-113 < 400 > 71 caaccttagc tgcaa? here < 210 > 72 < 211 > 20 < 212 > DNA < 213 > CD28-768 primer < 400 > 72 ggcttctgga tagggatagg 20 < 210 73 < 2H > 22 < 212 > DNA < 213 primer CD28-190 < 400 > 73 cggaggtaga attgcactgt ce 22 < 210 > 74 211 > 21 < 212 > DNA < 212 > CD28-239 primer < 400 > 74 attttgcaga agtaaatatc c 21 < 210 > 75 < 211 > 33 < 212 > DNA < 213 > feCD28 primer < 0ü > 75 cgcggatcca ccggtagcac aatgatcctc agg 33 210 > 76 < 21i 31 < 212 > DNA 213 ^ primer feCD28 < 400 76 cgcggatcct ctggatagcc ctccatgtca g 31 < 210-77 < 2 H > 31 212 > DNA < 213. FIV 5 'PPR primer < 400 > 77 gcccggatcc tatggcagaa gggtttgcag c 31 < 210 > 78 < 211 > 31 < 212 > DNA < 2 i3 > FIV 3 'PPR starter < 400 > 78 ccgtggatcc ggcactccat cattcctcct c 31 < 210 > 79 < 21i > 32 < 212 > DNA < 2'3 > FIV 5 'PPR primer < 400 > 79 gcgtgaattc ggggaatgga caggggcgag at 32 < 210 > 80 < 211 > 28 < 212 > DNA < 213 FIV 3 'PPR starter < 400 > 80 gagccagatc tgctcttttt actttccc 28 < 210 > 81 < 211 > 36 < 212 > DNA < 2i3 > IFN primer < 400 > 81 tcgagaattc gatgaattac acaagtttta ttttcg 36 < 210 > 82 < 211 > 33 < 212 > DNA < 213 > IFN primer < 400 > 82 tcgaggatcc ttatttcgat gctctacggc ctc 23 REFERENCES 1. Argyle, et al., DNA Seq. 5, 169-171 (1995). 2. Azuma, M., et al., J. Immunolosy 149, 1115-1123 (1992). 3. Azuma, M., et al., Nature 366, 76-79 (1993). 4. Chambers, et al., Current Opinion in Itntnunoloc.v 9, 396-404. (1997) . Chen, et al.,. Impmnoloqy 148, 2617-2621 (1992). 6. Chen, et al., Cell 71. 1093-1102 (1992). 7. Donnelly JJ, et al., Annu Rev I munol 1997; 15: 617-648 8. Freeman, et al., J. Im unolocry 143 2714-2722 (1989). 9. Freeman, et al., J. Exp. Med. 174, 625-631 (1991). 1 C. Gimmi, et al., Proc. Nati Acad. Sci. USA 88, 6575-6579 (1991). 11. Hathcock, et al., J. of Exp. Med. 180, 631-640 (1994) 12. Hassett and Whitton, Trends Microbiol 1996; 4: 307-312.) 13. Linsley, et al., Proc. Nati Acad. Sci. USA 87, 5031-5035 (1990). 14. Jenkins, et al., J. Imitmnoloav 147, 2461-2466 (1991).

Onions et al., PCT Int. Application WO 96/03435, Q-One Biotech, February 8, 1996.

Riley, et al., J. Ipnunoloav 158. 5545-5553 (1997).

Tsuji, et al., Eur J Immunoloqy 27 (3), 782-787 (1997).

PCT International Application WO 92/00092, Bristol Myers Squibb.

PCT International Application WO 92/15671, Cytomed, Inc. 17 September 1992.

PCT International Application WO 93/00431, Bristol Myers Squibb, 7 January 1993.

Akeson, A.L. and Woods, C.W. (1993). A fluorometric assay for the quaptitation of cell adherence to endothelial cells. J. Immunol. Meth. 163, 181-185.

Allison, J.P., and Lanier L. (1987). The structure, serology, and function of the T-cell antigen receptor. Annu. Rev. Immunol. 5, 503-540.

Allison, J.P. (1994). CD28-B7 interactior. in T-cell activation, Current Opinion Immunol. 6, 414-419.

Anderson, P., Mori oto, C, Breitmeyer, J.B., Schloss an, S.F. (1988). Regulatory interactions between members of the immunoglobulin superfamily. I munol Still 9, 199-203.

Antonia, S.J., Muñoz, -Antonia, T., Soldevila, G., Miller, J., Flavell, R.A. (nineteen ninety five). B7-1 expression by a non-antigen presenting cell-derived tumor. Dog. Res .. 55, 2253-2256.

Arima, T., Rehman, A., Hickey, W., Flye, M. (1996).

Inhibition by CTLA-4Ig of experimental allergic encepnaiomyelitis. J. Immunol. 156, 4917-4924.

Arruffo, A. and Seed, B. (1987). Molecular cloning of a CD28 cDNA by a COS cell expression system. Proc. Nat. Acad. Sci. USA 84, 8573-8577.

Asjo, B., Cefai, D., Debre, P., Dudoit, Y., Autran, B. (1993). A novel mode of human immunodeficiency virus type 1 (HIV-1) activation: ligation of CD28 alone induces HIV-1 replicatior. in naturally mfected lymphocytes. J. Virol. 67, 4395-4398.

Azuma, M., Cayabyab, M., Buck, M., Phillips, J.K., Lanier, L.L. (1992). Involve ent of CD28 in MHC unrestricted cytotoxicity mediated by a human killer leukaemic cell line. . Immunol. 149, 1115-1123.

Azuma, M., Yssel, H., Phillips, J.H., Spits, H., Lanier, L.L., (1993b) Functional expression of B7 / BB1 on activated T-lymphocytes. J. Exp. Med. 177, 845-850.

Azuma, M., Cayabyab, M., Phillips, J.H., Lanier, L.L. (1993c). Requirements for CD28-dependent T cell-ediated cytotoxicity. J. Immunol. 150, 2091-2101.

Bajorath, J., Stenkamp, R., Aruffo, A. (1993). Knowledge based protein modeling: concepts and examples. Prot. Sci. 2,1798-1810.

Baj orath, J., Peach, R., Linsley, P. S. (1994). Immunoglobulin fold characteristics of B7-1 (CD80) and B7 -2 (CD86). Prot. Sci. 3, 2148-2150.

Balazano, C, Buonavista, N., Rouvier, E. , Golstem, P. (1992) CTLA-4 and CD28 similar proteins, neighboring genes. Int. J. Can, Suppl. 7, 28-32.

Barcy, S., Wettendorf, M., Leo, O., Urbain, J., Kruger, M., Ceuppens, J.L., de Boers, M. (1995). PcR crosslinking on monocytes resuits in impaired T cell stimulatory capacity. In. Immunol. 7, 179-189.

Beale, D. (1985). A comparison of the amino acid sequences of the extracellular domains of the immunoglobulin superfa ily. Possible correlations between conservancy and conformatior .. Like 3iochem Physiol. 80, 181-194.

Bellone, M., lezzi, G., Manfredi, A.A. , Protti, M.P., Dellabona, P., Casorati, G., Rugarli, C. (1994). In vi tro priming of cytotoxic T lytnphocytes against poorly immunogenic epitopes by engineered antigen presenting cells. Eur. . Immun. 24, 2691-2698.

Berke, G. (1993). The functions and mechanisms of action of cytolytic lymphocytes. In "Fundamental Impmnology," (W. Paul), pp. 965-1014. New York: Raven Publ. 3rd ed. 3erke, G. (1994). The binding and lysis of targeT-cells by cytotoxic lymphocytes. Annu. Rev. of Immunol. 12, 735-773.

Boise, L.H., Minn, A.J., Noel, P.J., June, C.H., Accavitti, M., Lindstein, T., Thompson, C.B. (1993). CD28 costi ulation can promote T cell survival by enhancing the expression of Bcl-xL. Immunity 3, 87-89.

Brinch ann, J.E., Doblung, J.H., Heger, B.K., Haaheim, L.L., Sannes, M., Egeland, T. (1994). Expression of costimulatory molecule CD28 on T-cells in human immunodeficiency virus type 1 infection: functional and clinical coorelations. J. Inf Dis. 169, 730-738.

Brown, W.C., Bissey, L-, Logan, K.S., Pedersen, N.C., Elders, J.H. , Collisson, E.W. (1991). Feline immunodeficiency virus infects both CD4 + and CD8 * T-ivmphocytes.-J. of Virol. 62, 3359-3364.

Buck, C.A. (1992). Immunoglobulin Superfamily: structure function and relationship to other receptor molecules. Semin. Cell Biol. 3, 179-188.

Buelens, C, Willems, F., Delvaux, A., Pierard, G., Delville, J.P., Velu, T., Goldman, M. (1995). Interleukin 10 differentially regulates B7-1 (CD80) and 37-2 (CD86) expression on human blood dendritic cells. Eur. J. Immunol. 25, 2668-2675.

Caruso, A., Cantalamessa, A., Licenziati, S., Peroni, L., Prati, E., Martinelli, F., Canaris, AD, Folghera, S., Gorla, R., Balsari, A. (1994 ). Expression of CD28 on CD8 + and CD4 lymphocytes during HIV infection. Sean. J. Immunol. 40, 485-490.

Cerdan, C, Martin, Y., Brailly, H., Courcoul, M., Flavetta, S., Costello, R., Mawas, C., Birg, F., Olive, D. (1991). IL-1 is produced by T lymphocytes activated via the CD2 plus CD28 pathways. J. Immunol. 146, 560-564.

Chen, L., Linsley, P.S., Hellstrom, K.E. (1993). Costimulate ion of T cells for tumor immunity. Immunol. Today 14, 483-486.

Chesnut, R.W. and Gray, H.M. (1986). Antigen presentation by B cells and their significance in T-B interactions. Adv. Immunol. 39, 51-59.

Clark, S.J., Saag M.S., Decker, W.D., Campbell, H.S., Roberson, J.L., Veldka p, P.J. (1991). High titers of cytopathic virus in plasma of patients with synptus of primary HIV-1 infection. N. Ena J. Med. 324, 954-960.

Clayberger, C, Lyu, S.C., DeKruyff, R., Parham, P., Krensky, A.M. (1994). Peptides corresponding to the CDS and CD4 binding domains of HLA molecules block T-lymphocyte immune responses in vitro. J. Immunol. 153, 946-951.

Clevers, H., Alarcon, B., Wileman, T., Terhorst, C. (1988). The T-cell receptor-CD3 complex: A dyna ic protein teach. Annu. Rev. Im unol. 6, 629-662.

Connor, R.I., Mohri, H., Cao, Y., Ho, D.D. (1993). Increased viral burden and cytopathicity correlate temporally with CD4 + T- lymphocyte decline and clinical progression in human immunodeficiency virus type 1-infected individuáis. J Virol. 67, 1772-1777.

Cooper, D.A., Tindall, B., Wilson, E.J., Imreie, A.A., Penny, R. (1988). Characterization of T-lymphocyte responses during primary infection with human immunodeficiency virus. J. Inf. Dis. 157, 889-896.

Damle, N.K., Doyle, L.V., Gross Air, L.S., Ledbetter, J.A. (1988 Differential regulatory signifies the CD28 molecule during the activation of human T lymphocytes, J. Immunol.140, 1753-1761.

Damle, N.K. , Kiussman, K., Leytze, G., Martial, S., Arruffo, A., Ledbetter, J.A., Linsley, P.S. (1994). Costimulation of lymphocytes with integrin ligands ICAM-1 or VCAM-1 induces fuctional expression of CTLA-4 to second receptor for 37. J. Im unol. 152, 2686-2697.

Davis, M.M. and Bjorkman, P.K. (1988). T-cell antigen receptor genes and T-cell recogr.ition. Nature 334, 395-402. from 3oer, M., Kasran, A., Kwekkeboom, J., Walter, H., Vandenberghe, P., Ceuppens, J.L. (1993). Ligation of B7 with CD28 / CTLA-4 on T-cells resuits in CD40 ligand expression, interleukin-4 secretion and efficient help for antibody production by 3 cells. Eur. J. I munol. 23, 3120-3125. deWaal Malefyt, R., Yssel, H., de Vries, J.E. (1993). Direct effects of IL-10 on subsets of human CD4 + T cell clones and resting T cells. Specific inhibition of 11-2 production and proliferation. J. Immunol. 150, 4754-4765.

Dina, L., Linsley, P.S., Huang, L.Y., Germain, R.N. , Shevach, E.M. (1993). IL-10 inhibits macrophage costimulatory activity by selectively inhibiting up regulation of B7 expression. J. Immunol. 151, 1224- 1234.

Driscoll, P.C., Cyster, J., Campbell, I., Williams, A. (1991). Structure of domain 1 of rat T- lymphocyte CD2 antigen. Nature 353, 762-765.

Eliis, J.H., Burden, M., Vinogradov, D., Linge, C, Crowe, J. (1996). Interactions of CD80 and CD86 with CD28 and CTLA-4. J. Immunol. 155, 2700-2709.

Englehard, V.H. (1994). Structure of peptides associated with MHC class I molecules. Curr. OP. Immunol. 6, 13-21.

English, R.V. , Nelson, P., Johnson, C.M. , Nasisse, M., Tompkins, W.A. , Tompkins, M.B. (1994). Development of clinical disease in cats experimentally infected with feline immunodeficiency virus. J. Inf. Dis. 170, 543-552.

Fauci, A.S. and Dale, D.C. (1975). The effect cf hydrocortisone on the kinetics of normal human .1 yrnphocytes. Blood 46, 235-243.

Fauci, A., Macher, A., Longo, D., Lane, H., Rook, A., Masur, H., Gelmann, E. (1984). Aquired immunodeficiency syndrome: epidemiological, clinical, immunological and therapeutic considerations. Ann. Int. Med. 100, 92-106.

FA. Ferrari, et al., Journal of Bacteriology (1985) 161, 556-562.

Fong, T.A. and Mosmann, T.R. (1990). Alloreactive murine CD8 + T cell clones secrete the Thl pattern of cytokines. J Immunol. 144, 1744-1752.

Fouchier, R.A. , Meyaard, L., Brouwer, M., Kovenkamp, E., Schuitemaker, H. (1996). Broader tropis and higher cytopathicity for CD4 + T-cells of asyncytium-inducing compared to a non-syncytiupi-inducing HIV-l isolate as a mechanism for accelerated CD4 + T cell decline in vivo. Virology 219, 87-95. 69. Freedman, A. S., Freeman, G., Horowitz, J.C., Daley, J., Nadler, L.M. (1987). A 3-cell restricted antigen that identifies preactivated B cells. j. I munol. 139, 3260-3267. 7C. Freeman GJ, Borriello, F., Hodes, RJ, Reiser, H., Hathcock, KS, Laszlo, G., McKnight, AJ, Kim, J., Du, L., Lombard, DB, Gray, GS, Nadler, LM, Sharpe, AH (1993). Uncovering a functional alternative CTLA-4 counter B7-1 ip receiver deficient mice. Science 262, 907-909. 71. Gajewski, T. F., Schell, S.R., au, G., Fitch, F. W. (1989). Regulation of T-cell activation: Differences among T-cell subsets. Immunol Rev. 111, 79-110. 72. Ger ain, R.N. (1993). The biochemistry and cell biology of antigen processing and presentation. Ann. Rev. Immunol. 11, 403-450. 73. Haffar, O.K., S ithgall, M.D., Bradshaw, J., Brady, W., Damle, N.K., Linsley, P.S. (1993). Costimulation of T-cell activation and virus production by B7 antigen on activated CD4 * T-cells from human imraunodeficiency virus type 1- infected donors. Imrounoloay 90, 11094-11098. 74. They would do, D.M., Abe, R., Lee, K.P., June, C.H. (nineteen ninety five). Potential roles of the B7 and CD28 receptor families in autoimmunity and immune evasion. Clin. Immunol. Immunopath. 75, 99-111. 75. Hodge, J.W., Abrami, S., Schlom, J., Kantor, J.A. (1994). Induction of antitumor immunity by recombinant vaccinia virus expressing B7-1 or B7-2 costimulatory molecules. Dog. Res. 54, 5552-5555.

Hutchcroft, J.E. and Bierer, B.E. (nineteen ninety six). Signaling through CD28 / CTLA-4 family receptors. J. Immunol. 155, 4071-4074.

M.A. Innis, et al., PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., San Diego (1990).

Jenkins, M.K., Pardoll, D.M., Mizuguchi, J., Quill, H., Schwartz, R.H. (1987). T cell responsiveness in vivo and in vitro: Fine specificity of induction and molecular characterization of the unresponsive state. Immunol. Rev. 95, 113-135.

June, C.H., Ledbetter, J.H., Linsley, P.S., Thompson, C.B. (1990) . Role of the CD28 molecule in T-cell activation. Immunol. Still 11, 211-216.

June, C.H., Bluestone, J.A. , Nadler, L.M., Thompson, C.B. (1994). The B7 and CD28 receptor families. Immunol. Still 12, 321-333.

Knight, J.C., et al., (1992), Virolocrv 190, 423-433.

Kozber, D., Moretta, A., Messner, H.A., Moretta, L., Croce, C.M. (1987). Tp44 molecules involved in antigen-independant T cell activation are expressed on human plasma cells. J. Immunol. 138, 4128-4132.

Kupfer, A. and Singer, S.J. (1989). Cell biology of cytotoxic and helper T-cell functions. Annu. Rev. Immunoi 7, 309-337.

Landay, A.L., Mackewicz, CE., Levy, J.A. (1993). An activated CD8 + T cell phenotype interacts with an anti-HIV activity and assymptomatic clinical status. Clin Immun. Immunopath. 69, 106-116. 85. Lane, P., Burdet, C, Hubele, S., Scheidegger, D., Muller, U., McConnell, F., Kosco-Vilbois, M. (1994). B cell function in mice transgenic for mCTLA4-H gamma 1: lack of germinal centers correlated with poor affinity maturation and class switching despite normal priming of CD4 + T-cells. J Exp Med. 179, 819-830. 86. Lanier, L.L., 0 'Fallón, S., Somoza, C, Phillips, J.H., Linsiey, P.S., Okumura, K., Ito, D., Azuma, M. (1995). CD80 (37) and CD86 (B70) provide similar costimulatory signatures for T cell proliferation, cytokine production, and CTL generation. J. Immunol. 154, 97-105. 87. Larsen, C.P., Ritchie, S.C., Pearson, T.C., Linsley, P.S., Lowry, R.P. (1992). Functional expression of the costimulatory molecule B7 / BB1 in murine dendritic cell populations. J. Exo. Med. 176, 1215-1220. 88. Leahy, D., Axel, R., Hendrickson, W. (1992). Crystal structure of a soluble form of human T cell counter receiver CD8 at 2.8 resolution. Cell 68, 1145-1162. 89. Lechler, R.I., Lombardi, G., Batchelor J.R., Reinsmoen N., Bach, F.H. (1990). The molecular basis of alloreactivity. Annu. Rev. Immunol. 10, 83-88. 90. Lenschow, D.J., Su, G.H.-T., Zuckermann, L.A. , Nabavi, N., Jellis, C.L., Gray, G.S., Miller, J., Bluestone, J.A. (1993). Expression and functional significance of an additional ligand for CTLA-4. Proc. Nat. Acad. Sci. USA. 90, 11054-11058. 91. Lenschow, D.J., Walunas, T.L., Bluestone, J.A. (nineteen ninety six) . CD28 / B7 system of T cell costimulation. Annu. Rev. Immunol. 14 233-258. 92. Leung, H.T. and Linsley, P.S. (1994). The CD28 costimulatory pathway. Therap. Immunol 1, 217-228. 53. Lewis, D.E., Ng Tang, D.S., Adu-Oppong, A., Schober, W., Rodgers, J. (1994). Anergy and apoptosis in CD8 + T-cells from HIV infected persons. J. Immunol. 153, 412-420. 94. Li, Y., McGowan, P., Hellstrom, I., Hellstrom, K.E., Chen, L. (1994). Costimulation of tumor reactive CD4 and CD8 T-lymphocytes by B7 a natural ligand for CD28 can be used to treat mouse melanoma. J. I munol. 153, 421-428. 95. Lindsten, T., Lee, K.P., Harris, E.S., Petryniak, B., Craighead, N., Reynolds, P.J., Lombard, D.B., Freeman, G.J., Nadler, L.M. , Gray, G.S. (1993). Characterization of CTLA-4 structure and expression on human T-cells. J. Immunol. 151, 3489-3499. 96. Linsiey, P.S., Brady, W., Urnes, M., Grosmaire, L.S., Damle, N.K., Ledbetter, J.A. (1991a). Binding of the B-cell activation antigen B7 to CD28 costimulates T-cell proliferation and Interleukin-2 mRNA accumulation. J. Exp. Med. 173, 721-730. 97. Linsley, P.S., Brady, W., Urnes, M., Grosmaire, L.S., Damie, N.K., Ledbetter, J. A. (1991b). CTLA-4 is a second receiver for the B-cell activation antigen B7. J. Exp. Med. 174, 561-569. 98. Linsley, P. S., Wallace, P.M., Johnson, J., Gibson, M.G., Greene, J.L., Ledbetter, J.A., Singh, C., Tepper, M.A. (1992a). 'Im in vivo suppressing by a soluble form of the CTLA-4 T cell activation molecule. Science 257, 792-795. 99. Linsley, P.S., Greene, J.L., Tan, P., Bradshaw, J., Ledbetter, J.A., Anasetti, C., Damle, N.K. (1992b). Co-expression and functional cooperation of CTLA-4 and CD28 on activated T-lymphocytes. J. Exp. Med. 176, 1595-1604.

ICO. Linsley, P. S. and Ledbetter, J. A. (1993a). The role of CD28 receptor during T cell responses to antigen. Ann. Rev. Immunol. 11, 191-212. 1C1. Linsley, P.S., Bradshaw, J., Urnes, M., Grosmaire, L., Thompson, C.B. (1993b). CD28 engagement by B7 / BB-1 induces transient down-regulation of CD28 synthesis and prolonged unresponsiveness to CD28 signaling. J. Immunol. 150, 3161- 3169. 102. Linsley, P.S., Greene, J.L., Brady, W., Bajorath, J., Ledbetter, J.A. , Peach, R. (1994a). Human B7-1 (CD80) and B7-2 (CD86) bind with similar avidities but distinct kinetics to CD28 and CTLA-4 receptors. Im unity 1, 793-801. 103. Lir.sley, P.S., Peach, R., Gladstone, P., Bajorach, J. (1994b). Extending the B7 (CD80) gene family. Prot. Sci. 3, 1341-1343. 104. Linsley, P. S., Ledbetter, J., Peach, R., Bajorath, J. (1995a). CD28 / CTLA-4 receptor structure, binding stoichiometry and aggregation during T cell activation. Res. Immunol. 146, 130-140. 105. Linsley, P.S., Nadler, S.G., Bajorath, J., Peach, R., Leung, H.T. , Rogers, J., 3radshaw, J., Stebbins, M., Leytze, G., Brady, W., Malacko, A.R., Marquardt, H., Sh, S. (1995b). Binding stoichiometry of the cytotoxic T-lytnphocyte-associated molecule-4 (CTLA-4). J. Biol. Chem. 270, 15417-15424. 106. Littman, D.R. (1987). The structure of the CD4 and CD8 genes. Annu. Rev. Immunol. 5, 561-584. 107. Liu, C.C., Welsh, C.M., Young, J. D-S. (nineteen ninety five). Perforin: Structure and function. Immunol. Still 16, 194-201. 108. Liu, Y., Jones, B., Brady, W., Janeway, C.A. , Linsley, P. (1992). Murine CD4 T cell growth: B7 and heat stable antigen both particípate in costimulation. Eur. J. Immunol. 115, 1905-1912. 109. Lombardi, S., Garzelli, C, Pistelio, M., Massi, C, Matteucci, D., Baldinotti, F., Cammarota, G., Da Prato, L., Bandecchi, P., Tozzini, F., 3endinelli , M. (1994). A neutralizing antibody-inducing peptide of the V3 domain of feline immunodeficiency virus envelope glycoprotein does not induce protective immunity. J. Virol. 68, 8374-8379. 110. Lu, Y., Granelli-Piperno, A., Bjorndahl, J.M. , Phillips, C.A., Trevillyan J.M. (1992). CD28-induced T cell activation. Evidence for a protein-yrosine kinase signal transduction pathway. J Immunol. 149, 24-29. 111. Luria, S.E. and Darnell, J.E. (1968). "General Virology." New York: John Willey and Sons, Inc. 112 Lwof f, A. (1957). The concept of virus. J_. Gen. Microbiol. 17, 239-253. 113. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). "Molecular Cloning: A Laboratory Manual." New York: Cold Spring Harbor Press. 114. Martin, P.J., Ledbetter, J.A., Morishita, Y., June, C.H., Beatty, P.J., Hansen, J.A. (1986). A 44 kilosdalton ceil surface homodimer regulates interieukin 2 production by activated human T lymphocytes. J. Immunol. 136, 3282-3287. 115. Matasumura, M., Fremont, D.H., Peterson, P.A., Wilson, I.A. (1992). Emerging principles for the recognition of peptide antigens by MHC class I molecules. Science 257, 927-934. 116. Mescher, M.F. (1992). Surface contact requirements for activation of cytotoxic -lymphocytes. J. immunol. 49, 2402-2405. 117. Minty, A., Chalon, P., Derocq, JM, Dumont, X., Guillemot, JC, Kaghad, M., Labit, C, Leplatois, P., Liauzun, P., Miloux, B., Minty, C , Casellas, P., Loison, G., Lupker, J., Shire, D., Ferrara, P., Caput, D. (1993). Interleukin 13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362, 248-250. 118. Moffett, C.W. and Paden, C.M. (1994). Microglia in the mouse neurohypophysis increase expression of class I major histocompatibility antigens following central nervous system injury. J Neuroimmunol. fifty, 139-51. 119. Mosmann, T. and Coffman, R.L. (1989). TH1 and TH2 celis: Different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Im uni. 7, 145-173. 120. Nabavi, N., Freeman, G.J., Gault, D., Godfrey, G.N. , Nadler, L.M. , Gli cher, L.M. (1992). Signaling through the MHC CII cytoplasmic domain is required for antigen presentation and induces B7 expression. Nature 360, 266-268. 121. Nagata, S. and Golstein, P. (1995). The Fas death factor. Science 267, 1449-1465. 122. Nickoloff, B.J., Mitra, R.S., Lee, K., Turka, L.A., Greem, J., Thompson, C, Shimizu, Y. (1993). Discordant expression of CD28 ligands BB-1 and B7 on keratinocytes in vitro and psoriatic cells in vivo. Am J. Path. 142, 1029-1040. 123. Novotney, C, English, R., Housman, J., Davidson, M., Nasisse, M., Jeng, C.R. (1990). Lymphocyte population changes in cats naturally infected with feline immunodeficiency virus. AIDS 4, 1213-1218. 124. O'Doherty, U., Steinman, R.M. , Peng, M., Cameron, P.U., Gezelter, S., Kopeloff, I., Swiggard, W.J., Pope, M., Bhardwaj, N. (1993). Dendritic cells freshly isolated from human blood express CD4 and mature into typical immunostimulatory dendritic cells after culture in monocyte-conditioned medium. J. Exp. Med. 178, 1067-1076. 125. Ozawa, H., Aiba, S., Nakagawa, S., Taga i, H. (nineteen ninety five) . Interferon gamma and interleukin 10 inhibit antigen presentation by Langerhan's cells for T helper type 1 cells by suppressing .their CD80 (B7-1) expression. Eur. J. Immunol. 26 648-652. 126. Page, C, Thompson, C, Yacoub, M., Rose, M. (1994). Human endothelial stimulation of allogenic T-cells via CTLA-4 independant pathway. Trans. Im unol. 2, 342-347. 127. Peach, R., Bajorath, J .; Brady, W., Leytze, G., Greene, J., Naemura, J., Linsley, P.S. (1994). CDR1 and CDR3-analogous regions in CTLA-4 and CD28 determine the binding to 37-1. J. EXP. Med. 180, 2049-2058. 123. Peach, R., Bajorath, J., Naemura, J., Leytze, G., Greene, J., Aruffo, A., Linsley, P.S. (nineteen ninety five). Both extracellular immunoglobulin-like domains of CD80 contain residues critical for binding T-cell surface receptors CTLA-4 and CD28. J. Biol. Chem. 270, 21181-21187. 129. Pedersen, N.C., Ho, E., Brown, M.L., Yamamoto, J.K. (1987). Isolation of a T lymphotrophic virus from domestic cats with an immunodeficiency like syndrome. Science 235, 790-793. 130. Prasad, K.V., Cai Y.C, Raab, M., Duckworth, E., Cantley, L., Shoelson, S.E., Rudd, CE. (1994). T-cell antigen CD28 interacts with the lipid kinase phosphatidylinositol3 -kinase by a cytoplasmic Tyr (P) -Met-Xaa-Met motif. Proc Nati Acad Sci USA. 91, 2834-2838. 131. Radvanyi, L.G., Shi, Y., Vaziri, H., Sharma, A., Dhala, R-, Mills, G.B., Miller, R.G. (nineteen ninety six). CD28 costimulation inhibits TCR-induced apoptosis during a primary T cell response. J. Immunol. 158, 1788-1798. 132. Ranheim, E.A. and Kipps, T.J. (nineteen ninety five). Tumor necrosis factor-alpha facilitates induction of CD80 (B7-1) on human B cells by activated T-cells: complex regulation by IL-4, IL-10, and CD40L. Cell. Im unol. 161, 226-235. 133. Razi-Wolf, Z., Freeman, G., Galvin, F., Benacerraf, B., Nadler, L., Reiser, H. (1992). Expression and function of the murine B7 antigen and the major costimulatory molecule expressed by peritoneal exúdate cells. Proc. Nat. Acad. Sci. USA. 89, 4210-4214. 134. Rónchese, F., Hausmann, B., Hubele, S., Lane,?. (1994). Mice transgenic for a soluble form of murine CTLA-4 show enhanced expansion of antigen-specific CD4 + T cells and defective antibody production in vivo. J. Exp Med. 179, 809-817. 135. Rotzschke, 0. and Falk, K. (1994). Origin structure and motifs of naturally processed MHC class II ligands. Curr. Op Immunol. 6, 45-51. 136. Russel, J.H. (1983). Internal disintegration model of cytotoxic lymphocyte induced target damage. Immunol. Rev. 72, 97-118. 137. Sambrook, et al., Molecular Cloninq: A Laboratorv Manual, Second Edition, Cold Spring Harboi-Press, Cold Spring Harbor, N.Y. (1989). 138. Current Protocols in Molecular Biology. { Eds. Aufubel, Brent, Kingston, More, Feidman, Smith and Stuhl, Greene Publ. Assoc., Wiley-Interscience, NY, NY, 1992). 139. Saukkonen, J.J., Kornfield, H., Berman, J.S. (1993). Expansion of a CD8 * CD28 + cell population in the blood and lung of HIV-positive patiepts. JAIDS 11, 1194-1199. 140. Schattner, E. and Laurence, J. (1994). HIV induced T-lymphocyte deple ion. Clin. Lab. Med. 14, 221-227. 141. Schmittel, A., Scheibenbogen, C, Keilholz, U. (1995). Lipopolysaccharide effectively up-regulates B7-1 (CD80) expression and costimulatory function of human monocytes. Sean. J. Immunol. 42, 701-704. 142. Schwartz, R.H. (1992). Costimulation of T-lymphocytes: the role of CD28, CTLA-4 and B7 / BB1 go. interleukin-2 production and immunotherapy. Cell 71, 1065-1068. 143. Seder, R.A., Germain, R.N., Linsley,? .S., Paul, W.E. (1994). CD28 mediated co-stimulation of IL-2 production plays a critical role in T cell priming for IL-4 and IFNg production, J. Exp Med. 179, 299-304. 144. Shahinian, A., Pfeffer, K., Lee, K.P., Kundig, T.M., Kishihara, K., Wakeham, A., Kawai, K., Ohashi, P.S., Thompson, CB., Mak, T.B. (1993). Differeptial T cell costimulatory requirements in CD28 deficient mice. Science 261, 609-612. 145. Sher, A., Gazzinelli, R.T., Oswald, I.P., Clerici, M., Kuliberg, M., Pearce, E.J., Berzofsky, J.A. , Mosmann, T.R., James, S.L., Morse, H.C. (1992). Role of T-cell derived cytokines in the down regulation of immune responses inparasitic and retroviral infection. Immunol Rev. 127, 183-204. 146. Siebelink, K.H., Chu, I.H., Rimmelzwaan, G.F., Weijer, K., van Herwijnen, H.R., Knell, P. (1990). Feline Immunodeficiency virus (FIV) infection in the cat as a model for HIV infection in man: FIV induced impairment of immune function. AIDS Res. Hum. Retroviruses 6, 1373-1378. 147. Siebelink, K.H., Tijhaar, E., Huisman, R.C., Huisman, W., deRonde, A., Darby, I.H., Francis, M.J., Rimmelzwaan, G.F., Osterhaus, A.D. (nineteen ninety five). ? nhancement of feline immunodeficiency virus infection after immunization with envelope glycoprotein subunit vaccines. J Virol. 69, 3704-3711. 148. Singer, S.J. (1992). Intracellular communication and cell: cell adhesion. Science 255, 1671-1674. 149. Smithgall, M.D., Wong, J.G., Linsley, P.S., Haffar, O.K. (nineteen ninety five) . Costimulation of CD4 + T-cells via CD28 modulates human immunodeficiency type 1 infection and replica ion in vitro. AIDS Res. Hu. Retro 11, 885-892. 150. Springer, T.A. , Dustin, M.L., Kishimoto, T.K., Marlin, S.D. (1987). The lymphocyte function associated LFA-1, CD2 and LFA-3 molecules: cell adhesion receptors of the immune system. Annu. Rev. Immunol. 5, 223-252. 151. Springer, T.A. (1990). Adhesion receptors of the immune system. Nature 346, 425-434. 152. Stack, R.M., Lenschow, D.J., Gray, G.S., Bluestone, J.A. , Fitch, F.W. (1994). IL-4 treatment of small splenic B cells induces co-stimulatory molecules B7-1 and B7-2. J. Immunol. 152, 5723-5733. 153. Symington, F.W., Brady, W., Linsley, P.S. (1993).

Expression and function of B7 on human epidermal Langerhan's ceils. J. Immunol. 150, 1286-1295. 154. Taylor, M.K. and Cohén, J.J. (1992). Cell mediated cytotoxicity. Curr. Opin. Immunol. 4, 338-343. 155. Thomas, R., Davi, L.S., Lipsky, P.E. (1994). Rheumatoid synovium is enriched in mature antigen presenting dendritic cells. J. Immunol. 152, 2613-2623. 156. Townsend, S.E., and Allison, J.P. (1993). Tumor rejection after direct costimulation of CD8 * T-celis by B7 transfected melanoma cells. Science 259, 368-370. 157. Turka L.A., Ledbetter, J.A., Lee, K., June, CH., Thompson, C.B. (1990) . CD28 is an inducible T cell surface antigen that transduces to proliferative signal in CD3 * mature thymocytes. J. Immunol. 144, 1646-1653. 158. Turka, L.A. , Linsley, P.S., Paine, R., Schieven, G.L., Thompson, CB., Ledbetter, J.A. (1991). Signal transduction via CD4, CD8 and CD28 in mature and im ature thymocytes. J. Immunol. 146, 1428-1436. 159. Unanue, E.R. (1984). Antigen presenting function of the macrophage. Annu. Rev. Immunol. 2, 395-428. 160. van Kooten, C, Rensink, I., Pascual, -Salcedo, D., van Oers, R., Aarden, L. (1991). Monokine production by human T-cells: IL-1 alpha production is limited to memory T-cells. J. Immunol. 146, 2654-2658. 161. van Seventer, G.A. , Shimizu, Y., Shaw, S. (1991). Roles of multiple accessory molecules in T cell activation. Curr. Opin Immunol. 3, 294-303. 162. Wang, R., Murphy, K.M., Loh, D.Y., Weaver, C, Russell, J.H. (1993). Differential activation of an igen-stimulated suicide and cytokine production pathways in CD4 + T-cells is regulated by the antigen-presenting cell. J Im unol. 150, 3832-42. 163. Weiss, A. and Litt an, D.R. (1994). Signal transduction by lymphocyte antigen receptors. Cell 76, 263-274. 164. Williams, A. and Barclay, A. (1988). The immunoglobulin superfamily-domains for cell surface recognition. Ann. Rev. Immunol. 6, 381-405. 165. Windhagen, A., Newcombe, J., Dangond, F., Strand, C, Woodroofe, M.N., Cuzner, M.L., Hafler, D.A. (nineteen ninety five) . Expression of costimulatory molecules B7-1 (CD80), B7-2 (CD86) and interleukin 12 in multiple schlerosis lesions. . Ex. Med. 182, 1985-1996. 166. Yamamoto, J.K., Hansen, H., Ho, W.E., Morishita, T.Y., Okuda, T., Sawa, T.R. (1989). Epidemiological and clinical aspects of feline immunodeficiency virus infection in cats from the continental United States and Canada and possible mode of transmission. J.A.V.M.A. 194, 213-220. 167. Yasukawa, M., Inatsuki, A., Kobayashi, Y. (1989). Differential in vitro activation of CD4 + CD8- and CD8 + CD4- herpes simplex virus-specific human cytotoxic T-cells. J. Im unol. 143, 2051-2057. 168. Yssel, H., Schneider, P.V., Lanier, L.L. (1993). Interleukin 7 specifically induces B7 / BB1 antigen on human cord blood and peripheral blood T-cells and T cell clones. Int. Immunol. 5, 753-759.

. Zanussi, S., Simonelli, C, D'Andrea, M., Caffau, C, Clerici, M., Tirelli, U., DePaoli, P. (1996). CD8 + lymphocyte phenotype and cytokine production in long-term non-progressor and in progressor patients with HIV-1 infection. Clin. Exp. I munol. 105, 220-224.

C. Zhou, T., Weaver, C, Linsley, P. S., Mouptz, J.D. (1994). T-cells of staphylococcal enterotoxin B-tolerized autoimmune MRL-Ipr / lpr mice require costimulation through the 37- CD28 / CTLA-4 pathway for activation and can be reanergized in vivo by stimulation of the T cell receptor in the absence of costimulatory signal. Eur. J. Immunol. 24, 1019-1025.

Claims (36)

1. NOVELTY OF THE INVENTION Having described the present invention, it is considered as a novelty and, therefore, the content of the following CLAIMS is claimed as property: 1. A recombinant virus comprising at least one foreign nucleic acid inserted within a non-essential region of the viral genome of a virus, wherein each foreign nucleic acid (a) codes for a protein selected from the groups consisting of a feline CD28 protein or an immunogenic portion thereof; a feline CD80 protein or an immunogenic portion thereof, a feline CD86 protein or an immunogenic portion thereof, a feline CTLA-4 protein or an immunogenic portion thereof and (b) is capable of being expressed when the recombinant virus is enter a suitable host.
2. 2. The recombinant virus according to claim 1, comprising at least two nucleic acids, each inserted into a non-essential region of the viral genome.
3. 3. The recombinant virus according to claim 2, comprising at least three foreign nucleic acids, each inserted into a non-essential region of the viral genome.
4. 4. The recombinant virus according to claim 3, comprising four foreign nucleic acids, each inserted into a non-essential region of the viral genome.
5. 5. The recombinant virus according to claim 1, wherein the virus is a raccoon pox virus, a swinepox virus or a feline herpes virus.
6. The recombinant virus according to any one of claims 1 to 5, comprising more than one foreign nucleic acid, wherein each foreign nucleic acid is inserted into the same non-essential region.
7. The recombinant virus according to any one of claims 1 to 5, comprising more than one foreign nucleic acid, wherein all foreign nucleic acids are not inserted into the same non-essential region.
8. 8. The recombinant virus according to any of claims 1 to 7, further comprising a foreign nucleic acid encoding an immunogen derived from a pathogen.
9. 9. The recombinant virus according to claim 8, wherein the pathogen is a feline pathogen, a rabies virus, Chlamydia, Taxoplasmosis gondii, Dirofilaria immitis, a flea or a bacterial pathogen.
10. 10. The recombinant virus according to claim 9, wherein the feline pathogen is feline immunodeficiency virus (FIV), feline leukemia virus (FeLV), feline infectious peritonitis virus (FIP), feline panleukopenia virus, feline calicivirus, feline reovirus type 3, feline rotavirus, feline coronavirus, feline syncytial virus, feline sarcoma virus, feline herpes virus, Borna disease feline virus or a feline parasite.
11. 11. The recombinant virus according to any of claims 1 to 7, wherein at least one foreign nucleic acid comprises a promoter for expressing the foreign nucleic acid.
12. 12. The recombinant virus according to any of claims 1 to 7, wherein the expression of at least one foreign nucleic acid is under the control of a promoter endogen for the virus.
13. 13. The recombinant virus according to any of claims 1 to 10, further comprising a foreign nucleic acid encoding a detectable marker.
14. 14. The recombinant virus according to claim 13, wherein the detectable marker is beta galactosidase from E. coli.
15. 15. The recombinant virus according to claim 10, wherein the immunogen of a feline pathogen is gag protease from FIV, an envelope protein from FIV, a gag protease from FeLV or a wrapping protein from FeLV.
16. 16. The recombinant virus according to any of claims 1 to 7, wherein the virus is a feline herpes virus and the non-essential region is a glycoprotein G gene of feline herpes virus.
17. 17. The recombinant feline herpes virus according to claim 12 is designated S-FHV-031 (Accession No. ATCC VR-2604).
18. 18. The recombinant virus according to any of claims 1 to 7, where the virus is a swinepox virus and the non-essential region is the largest subfragment of Hind III to Bgl II of the Hind III M fragment of the swinepox virus.
19. 19. The feline pig pox recombinant virus [sic] of claim 14 is designated S-SPV-246 (Accession No. ATCC VR-2603).
20. 20. The recombinant virus according to any of claims 1 to 7, wherein the portion of the CD28, CD80 or CD86 protein is the soluble portion of the protein.
21. 21. The recombinant virus according to any of claims 1 to 7, wherein the foreign nucleic acid encodes the feline CTLA-4 protein.
22. 22. A vaccine comprising an effective immunizing amount of the recombinant virus of any of claims 1 to 19 and a suitable carrier.
23. 23. The vaccine of claim 22, wherein the effective immunizing amount of the recombinant virus is an amount ranging from about lxlO5 pfu / ml to about 1x10 cfu / ml [sic].
24. The vaccine according to claim 22, further comprising a mixture with the recombinant virus and an effective immunizing amount of a second immunogen.
25. 25. The method for improving an immune response in a feline, comprising administering to the feline an effective immunizing amount of the recombinant virus of any of claims 1 to 19.
26. 26. A method for immunizing a feline, which comprises administering to the feline a effective immunizing amount of the recombinant virus of any of claims 1 to 19.
27. 27. A method for suppressing an immune response in a feline, comprising administering to the feline any effective suppressant amount of the recombinant virus of claim 20 or 21.
28. 28. The The method according to any of claims 24 to 26, wherein the administration comprises intravenous, subcutaneous, intramuscular, transmuscular, topical, oral or intraperitoneal administration.
29. 29. The method according to claim 27, wherein the feline is the recipient of a transplanted tissue or organ or is suffering from an immune response.
30. 30. A method for suppressing an immune response in a feline, comprising administering to the feline an antisense nucleic acid capable of hybridizing to the following and inhibiting the translation of: (a) a transcript of feline CD28 mRNA, (b) a transcript of feline CD80 or (c) a transcript of feline CD86 mRNA, the antisense nucleic acid being present in an amount effective to inhibit translation and thereby suppress the immunological response in the feline.
31. 31. A method for reducing or eliminating a tumor in a feline, which comprises administering to the feline tumor a recombinant virus of claim 1, wherein the nucleic acid encodes a feline CD80 protein, a feline CD86 protein or a combination of the same, in an effective amount to reduce or eliminate the tumor.
32. 32. The method according to claim 31, wherein the recombinant virus further comprises an antigen associated with the feline tumor and is capable of expressing thereto, and the administration is carried out systemically.
33. 33. The recombinant virus of claim 1, further comprising a nucleic acid encoding the feline immunodeficiency virus genome or a portion thereof.
34. 34. The recombinant virus of claim 1, further comprising an acid encoding the feline leukemia virus genome or a portion thereof.
35. 35. The recombinant virus according to claims 33 or 34, further comprising a nucleic acid encoding feline IL12, p35 or p40.
36. 36. A vaccine comprising an effective immunizing amount of the recombinant virus of claim 33 or 34 and a suitable carrier.