MXPA00009974A - ANTISENSE OLIGONUCLEOTIDES FOR THE INHIBITION OF INTEGRIN&agr;v - Google Patents

Abstract

The present invention relates to an antisense oligonucleotide or a derivative thereof which has a sequence that corresponds to a part of a nucleic acid which encodes an integrin&agr;v subunit and which has the ability to induce apoptosis, the preparation and the use thereof.

Description

O ANTICIPATED IGONUCLEOTIDO LA. INHIBITION OF THE EXPRESSION OF THE SÜBUNIDAD av DE INTEGRINA The present invention relates to an antisense oligonucleotide or a derivative thereof having a sequence corresponding to a part of a nucleic acid encoding an av integrin subunit and having the ability to induce apoptosis, the preparation and the use of these.

The integrin avp3 is the best known vitronectin receptor, however, it is highly undecided recognizing RGD in a wide array of adhesive proteins, such as fibronectin, fibrinogen, osteopontin, von Willebrand factor, thrombospondin and collagen [Hynes, Cell 69 ( 1992) 11-12; Horton, Int J. Biochem. Cell Biol. 29 (1997) 721-725].

Despite its undecided behavior, the avß3 integrin is not widely expressed. It is left highly in osteoclasts, where it is the dominant integnna. Osteoclasts play an important role in bone resorption that causes osteoporosis. The integrin avß3 mediates the adhesion of osteoclasts of bone proteins such as osteopontin or sialoprotein bone, thus stimulating bone resorption. [Chorev, Biochemistry 37 (1995) 367-375]. Inhibition of bone resorption in a rat osteoporosis model has been reported for the systemic administration of a monoclonal antibody [Crippes, Endicronology 137 (1996) 918-924.] Or by the RGD containing equistatin snake venom protein [Fisher, Endicronology 132 (1993) 1411-1413] as a proof of concept. This makes the avß3 integrin a promising target for the treatment or prevention of osteoporosis.

The avß3 integrin is expressed in a minimal amount on inactive or resting blood vessels, but is significantly activated during angiogenesis in vivo [Brooks, Eur, J. Cancer, Part A 32a (1996) 2423-2429; Brooks, DNSP 10 (1997) 456-461]. Angiogenesis plays a role in a number of pathological conditions, such as eye diseases, chronic inflammation, psoriasis, wound healing and cancer. It has been shown that a subsequent blockade of the integrin function avßs by peptide antibody or antagonist effectively prevents the formation of blood vessels in different models in vivo. [Stroembland, Chem. Biol. 3 (1996) 881-885]. The prevention of integrin ovß3 binding to its ligands selectively causes apoptosis in vessel proliferation S-S ^ -afi ^ yá ^ ¡^^^^^^ ¿^^^^^^^ # É ^^^ Angiogenic [Brooks, Cell 79 (1994) 1157-1164; Ruoslahti, Kidney Int. 51 (1997) 1413-1417, [Meredith, Trends Cell Biol. 7 (1997) 146-150]. It appears that the avß3 integrin has a unique function during angiogenesis, namely to avoid specific survival signals to facilitate vascular cell proliferation. This function makes the integrin avß3 an interesting target for the treatment of tumors and the other diseases mentioned in the above. Restenosis is an additional pathological condition that can potentially be prevented by targeting avß3 integrin. Smooth muscle cells (SMC) are another site of avβ3 integrin expression [Hoshiga, Circ. Res. 77 (1995) 1129-1135] and balloon catheter injury induces the expression of osteopontin mRNA and avß3 integrin [Panda, Proc. Nati Acad. Sci. USA 94 (1997) 9308-9313]. It appears that the avß3 integrin favors the survival and migration of SMCs [Leavesley, J. Cell. Biol .. 121 (1993) 163-170], [Clyman, Exp. Cell Res. 200 (1992) 272-284]. Blocking its activity by peptide agonists reduces in neointimal thickening [Matsuno, Circulation 90 (1994) 2203-2206; Choi, J. Vasc.Surg. 19 (1994) 125-134; Yue, they would melt. Clin. Cardiol. 28 (1997) 69-83].

The mAb LM609 against integrin avß3 has been used in vivo and in vitro for the inhibition of angiogenesis in a variety of disease models, such as in a human breast cancer / SCID mouse model [Books, J.CIin. Invest. 96 (1995) 1815-1822], in rabbit cornea [Friedlander, Science 270 (1995) 1500-1502], tumor-induced angiogenesis in chicken chorioallantoic membrane [Brooks, Cell 79 (1994) 1157-1164]. In summary, mAb LM609 leads to disruption of angiogenesis by inducing apoptosis of angiogenic blood vessels, while no effect is observed in pre-existing vessels. This not only prevents the growth of tumors in vivo, but also induces extensive regression in most cases [Brooks, Cell 79 81994) 1157-1164].

The mAb c7E3 (ReoPro; Centocor / Lilly) that inhibits integrins vß3 and < ißbß3 recently demonstrated in complete phase III trials effective reduction in occlusive events subsequent to angioplasty. As well as late events associated with restenosis [Topol, Am. J. Cardiol. 75 (1995) 27B-33B]. 17E6, an antibody against the integrin avß3 subunit, reacting with avß3 integrins, < xvßs, < * vß ?, strongly inhibited the development of tumors in tumor models in nude mice [Mitjans, J.Cell. Sci. 108 (1995) 2825-2838].

The cyclic peptide [cyclo-RGDfV] which binds selectively to integrin avß3 (IC50 = 4 nM) (the lower case letters denote amino acids D) [Pfaff, J. Biol. Chem. 269 (1994) 20233-20238; Wermuth, J. Am. Chem. Soc. 119 (1997) 1328-1225] have also been used with good results by Brooks et al., [Brooks, Cell 79 (1994) 1157-1164] to inhibit tumor-induced angiogenesis in chick chorioallantoic membrane.

Another possibility of inhibition of the integrin avß3 function is the use of antisense oligonucleotides [E. Ulhmann and A. Peyman, Chemical Reviews 90, 543 (1990); S. Agrawal, TIBTEH 1996, 376]. The synthesis of the avß3 integrin subunit in melanoma cells was suppressed by an all-phosphorothioate antisense oligonucleotide of the integrin avß3 subunit, 18-mer [Nip, J.Cin. Invest. 95 (1995) 2096-2103]. Inhibition of the mouse integrin av subunit using a mouse specific 21-mer antisense oligonucleotide [Martin, P.T. & Sanes, JR (1997) Development 124, 3909-3917] and a mouse specific 43-mer antisense oligonucleotide [Wada, J., Ku ar, A., Liu, Z., Ruoslahti, E., Reichardt, L. , Marvaldi, J., & Kanwar, Y.S. (1996) J. Cell. Biol .. 132, 1161-76] has also been described. No induction of apoptosis was observed in the treatment with any of the three Oligonucleotides described. In all three cases, the antisense oligonucleotides were used as all phosphorothioates. Nip et al. They described an antisense oligonucleotide AS-3 that targets nucleotides 41-58 of the av subunit of the human vitronectin receptor (HSVTNR = human vβ3 integrin, AC M14648). This region comprises the translation start site of HSVNTR.

The abstract "integrin vß3 prevents apoptosis in metastatic bone cancer cells from bone (Townsed et al., Described at the ASBMR meeting in 1998) summarizes the effects" of the av integrin antisense oligonucleotide, but without describing a sequence and particular structure of the oligonucleotide.

The general concept of the invention is to provide an Oligonucleotide or a derivative thereof which: a) has a sequence corresponding to a part of a nucleic acid encoding a integrin ctv subunit (= integrin otv) and b) has the ability to induce apoptosis.

The present invention offers an oligonucleotide antisense or a derivative thereof, which: a) has a sequence corresponding to a separate nucleic acid encoding av integrin, b) induces apoptosis in a cell that contains mRNA for av integrin, when it is put in contact with this cell.

The antisense oligonucleotide or a derivative thereof modulates the expression of at least one protein involved in a signal transduction pathway that induces apoptosis when contacted with a cell.

The antisense oligonucleotide, or a derivative thereof, induces, for example, increase in p21 expression, reduction in the expression of bcl-2 and / or when placed in a cell induces an inhibition of cell adhesion, by example, when placed in contact with an osteoclast cell, the antisense oligonucleotide or a derivative thereof induces inhibition of bone resorption; and / or induces p53 translocation from the cytosol to the nucleus of this cell.

In addition, the present invention provides a antisense oligonucleotide or a derivative thereof, which: a) has a sequence corresponding to a part of a nucleic acid encoding an av integrin, and b) that when contacted with a cell it inhibits the addition of this cell to the particular substrates.

The antisense oligonucleotide, or a derivative thereof, can inhibit the adhesion of a cell to a substrate containing at least one protein belonging to the group of extracellular matrix proteins, serum proteins, bone sections, vitronectin, fibrinogen and / or or fibronectin.

The present invention also relates to a process for the preparation of an oligonucleotide or a derivative thereof, wherein the suitably protected monomers are condensed on a solid support.

In another aspect, the invention relates to an agent for selectively removing cells that express av integrin. In another aspect, the invention relates to an anti-adhesive agent for selectively removing the adhesion of cells expressing av integrin. In addition, the invention .. ¿aa = Adfcfc .. comprises a method for inhibiting the expression of integrin av, wherein an antisense oligonucleotide, or a derivative thereof, with one of the sequences SEQ ID NO. 4 to SEC ID NO. 8 or SEQ ID NO: 12 is made and hybrid to av integrin mRNA The invention furthermore relates to a method for inhibiting the adhesion of a cell to a specific substrate, wherein an antisense oligonucleotide or a derivative thereof, which has a sequence corresponding to a part of a nucleic acid encoding av-integrin. it is made and contacted with this cell, whereby the antisense oligonucleotide or derivative of this hybrid to av integrin mRNA and by this means inhibits the expression of integrin v to a certain degree.

The invention further relates to a method for removing av av-integrin expressing cells, wherein an antisense oligonucleotide or a derivative thereof is prepared with a sequence corresponding to a part of a nucleic acid encoding av and carried to the cells, whereby the hybrid antisense oligonucleotide to av integrin mRNA and by this means inhibits av integrin expression to a certain extent.

In addition, the invention comprises the method for modulating the expression or activity of a protein that is involved in at least one of the signal transduction pathways for inducing apoptosis, wherein an antisense oligonucleotide or a derivative thereof is prepared, which has a sequence corresponding to a part of a nucleic acid encoding av integrin and contacted with a cell, whereby the antisense oligonucleotide or derivative of this hybrid to av integrin mRNA and thereby inhibits the expression of av to some degree.

The invention also relates to a pharmaceutical composition comprising at least one of the oligonucleotides or a derivative thereof described above and, if appropriate, one or more physiologically acceptable excipients and additives and / or auxiliaries.

In another aspect, the invention relates to a diagnostic reagent and / or a test kit and further to a method for identifying cells, which expresses or over-expresses av integrin, wherein an oligonucleotide or a derivative thereof is synthesized and it is contacted with a cell or a probe of a cell, and for determining whether the antisense oligonucleotide or the derivative thereof has hybridized to av integrin mRNA.

This test kit or diagnostic reagent may be convenient to identify cells that express or overexpress av integrin; the test kit or diagnostic reagent comprises: a) an oligonucleotide or a derivative thereof, having a sequence corresponding to a part of a nucleic acid encoding av integrin, and B) a reagent for detecting whether the oligonucleotide or derivative thereof has hybridized to integrin mRNA.

The part of the nucleic acid to which the oligonucleotide corresponds (hereinafter "ON") has a length of 5 to 100 nucleotides or more, preferably from 8 to 26 nucleotides, more preferably from 10 to 20 nucleotides in length. Thus, an oligonucleotide of the invention has a length of 5 to 100 nucleotides or more, preferably from 8 to 26, more preferably in a length of 10 to 20. nucleotides. In the special embodiments of the invention, the oligonucleotide has a length of 18, 26, 14 or 12 nucleotides.

The oligonucleotide has a sequence corresponding to a part of a nucleic acid encoding a subunit of integrin av. "corresponds" means that the order of the bases of the oligonucleotide allows the oligonucleotide to hybridize to this part of the nucleic acid to which the sequence of the oligonucleotide corresponds. With respect to the nucleic acid, the order of the nucleobases within the sequence of the oligonucleotide could be the same ("sense oligonucleotide") or the opposite ("antisense oligonucleotide").

In addition, the oligonucleotide could have one or more uncoupling in comparison to the nucleic acid sequence.

The oligonucleotide could hybridize to double-stranded and single-stranded mRNA, DNA or cDNA, respectively. The oligonucleotide could be an antisense oligonucleotide, an oligonucleotide forming a triple helix, a ribosome or an aptamer.

In a preferred embodiment of the invention, the oligonucleotide is an antisense oligonucleotide.

The nucleic acid sequence encoding the av integrin subunit could be any sequence encoding the 125 kDa fragment or the 25 kDa fragment of the integrin subunit to "or a part of it. The nucleic acid could be a cDNA, mRNA or a gene or a part of it. The source of the nucleic acid sequence could be any animal, preferably a mammalian animal, more preferably a human. In a preferred embodiment of the invention, the nucleotide sequence is deduced from or corresponds to a part of the cDNA of the human av integrin subunit, respectively.

The cDNA sequence of the human av integrin subunit is available from gene databases, such as, for example, EMBL or NCBI. The integrin av subunit sequences can, for example, be obtained with accession numbers M14648, J02826 and M18365. A portion of the cDNA of the human av mtegrin subunit is available from Suzuki et al., (1986) Proc. Nati Acad. Sci. USA 83, p. 8616. In a preferred embodiment of the invention, the oligonucleotide corresponds to a part of SEQ ID NO. 1 (Table 1).

Within SEQ ID NO 1 there are two preferred regions: (a) core region 1 (SEQ ID NO 2): nucleotides 37-60 and core region 2 (SEQ ID NO 3): nucleotides 122-147 of the HSVTNR gene shown in SEQ ID NO 1 (the core regions are underlined). In a modality Preferred of the invention, the oligonucleotide corresponds to SEQ ID NO 2 or SEQ ID NO 3, or a part thereof. The oligonucleotide directed against one of the core regions has, for example, a length of 8 to 26 nucleotides, preferably 10 to 20 nucleotides, in a special embodiment of the invention, the oligonucleotide has a length of 18 nucleotides or less. SEQ ID NO.2: 5'- CGGC GAT6GCTTTT CCGCCGCGGC -3 'SEQ ID NO.3: 5'- GTGCCGCGC CTTCAACCTAGACGTGG -3 Examples for the sequences for an oligonucleotide are: SEQ ID NO.4: 3'- GAAGCCGCTACCGAAAAGGC -5 'SEQ ID NO.5: 3'- CGCGTGAAGCCGCTACCG -5' SEQ ID NO.6: 3'- GCTACCGAAAAGGCGGCG -5 'SEQ ID NO.7: 3'- GCTGCCGAGAGAGCAACG -5' SEQ ID NO.8: 3'- GCGGAAGTTGGATCTGC -5"SEQ ID NO.12: 3'- GCGGAAGTTGGACCTGC -5 'In a special embodiment of the invention, the oligonucleotide has the sequence SEQ ID NO 6 or a part thereof, or the sequence of the oligonucleotide is deduced from it (by example, it has one or more uncoupling.) In another special embodiment of the invention, the oligonucleotide comprises the sequences SEQ ID NO 6.

In another preferred embodiment of the invention, the nucleic acid is the cDNA of the mouse av integrin subunit. He cDNA is described, for example, in Wada et al., (1996) J. Cell Biol. 132, p. 1165. An example of an oligonucleotide sequence is SEQ ID NO 9.

SEC ID NO 9: 3 '-GCTACCGACGAGGGCCCG-5' The invention also relates to the oligonucleotide derivatives, for example their salts, in particular their physiologically tolerated salts. Salts and physiologically tolerated salts are described in Remingtons Pharmaceuticals Science (1985) Mack publishing Company, Easton, PA (page 1418). Derivatives also refer to modified oligonucleotides having one or more modifications (e.g. at positions of a particular nucleoside and / or particular internucleoside bridges, oligonucleotide analogs (e.g., Nucleic Acid Polyamide (PNA), monoester nucleic acid phosphoric acid (PHONA = PMENAS), oligonucleotide chimeras (for example, consisting of a DNA part and a PNA part or consisting of a DNA part and a PHONA part).

The object of the invention are oligonucleotides, in particular antisense oligonucleotides directed against the mRNA of the human av integrin subunit (HSVTNR mRNA) which are modified to make them resistant against nucleases provided that these oligonucleotides are not uniformly modified with internucleotide phosphorothioate bridges (all phosphorothioates) and that they induce apoptosis of the correspondingly treated cells. An oligonucleotide can, for example, be completely composed of the "natural nucleotides" (comprising the "naturanucleoside bases"), deoxyadenosine phosphate, deoxyguanosine phosphate, deoxycytidine phosphate, uridine phosphate and thymidine phosphate. In other embodiments of the invention, an oligonucleotide may, where appropriate, contain one or more modifications, for example chemical modifications. An oligonucleotide may have several identical and / or different modifications. The modified oligonucleotide by coordination comprises analogous oligonucleotides and oligonucleotides chimeras. Therefore, the present invention also relates to an oligonucleotide having one or more chemical modifications to improve its properties. Preferably the oligonucleotide is partially modified. In another embodiment of the invention, the oligonucleotide is completely modified, with the proviso that if all the phosphodiester bridges are replaced by phosphothioate bridges, this is not the only modification (the oligonucleotide also contains another type of modification). Examples of chemical modifications are known to the experts and are described, for example, in Uhlmann and A. Peyman, Chemical Reviews 90 (1990) 543 and "Protocols for Oligonucleotides and Analogs" Synthesis and Property & Synthesis and Analytical Techniques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993 and S. T. Crooke, F. Bennet, Ann. Rev. Pharmacol. Toxicol 36 (1996) 107-129.

The invention relates to an oligonucleotide comprising one or more modifications, and wherein each modification is independently selected from: a) the replacement of a phosphoric diester bridge located at the 2 'and / or 5' end of a nucleoside by a modified phosphodiester bridge, b) the replacement of a phosphoric diester bridge located at the 3 'and / or 5' end of a nucleoside by a phosphodiester bridge, c) the replacement of one sugar phosphate molecule from the phosphate sugar backbone by another unit , d) replacement of a β-D-2 '-deoxyribose with a modified sugar radical, e) replacement of a natural nucleoside base by a modified nucleoside base, f) conjugation of the oligonucleotide to a molecule that influences the properties of the oligonucleotide, and g) the introduction of a 3 '-3' and / or 5 '-5' inversion in the 3 'and / or 5' end of the oligonucleotide. More detailed examples for the chemical modification of an oligonucleotide are: a) the replacement of one or more phosphate diesters by modified phosphodiester bridges, for example with phosphorothioate, phosphorodithioate, NR R -phosphoramidite, boranophosphate, phosphate- (C1-C21) -O-alkyl ester, phosphate- [(Cß-C12) aryl- ((C1-C21) -O-alkyl] ester , (C? -C8) alkyl phosphonate and / or (C6-C12) -aryl phosphonate, where R1 and R 'are, independently of each other, hydrogen, Ci-Cis alkyl, C6-C20 aryl »C6 aryl -C 14 -C 8 alkyl, preferably hydrogen, C 1 -C 8 alkyl and / or methoxyethyl, preferably hydrogen, in particular C 1 -C 4 alkyl and / or methoxyethyl, or R and R form, together with the atom of nitrogen that carries them, a heterocyclic ring of 5 to 6 members that can also contain another heteroatom of the group of O, S and N; b) the replacement of one or more 3'- and / or 5'-phosphoric diester bridges (phosphodiester bridges) with "defosfo" bridges (described, for example, in Uhlman, E. and Peyman, A. in "Methdos in Molecular Biology ", vol.20," Protocols for Oligonucleotides and Analogs ", S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, 355ff), for example, with formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethylhydraz, dimethylene sulfone and / or silyl groups; c) the replacement of one or more sugar phosphate units of the phosphate sugar backbone by another unit, for example with a suitable unit for building a "morpholino derivative" oligomer (described, for example, in EP Stirchak et al., Nucleic Acids Res. 17 (1989) 6129) and / or a polyamide nucleic acid ("PNA") (described, for example in PE Nielsen et al., Bioconj Chem. 5 (1994) 3), for example, 2-aminoethylglycine nucleic acid and / or monoester of phosphoric acid (phosphono-nucleic acid nucleic acid, "PHONA") (described, for example, in Peyman et al., Angew. Chem. Int. Ed. Engl. 35 (1996), 2632-2638 and in EP 0 738 898 A2); d) the replacement of one or more units β-D-2 '-deoxyribose with a modified sugar radical, for example with β-D-ribose, aD-2' -deoxyribose, L-2 '-deoxyribose, 2'-F -2'-deoxyribose, 2'-O-alkyl (of C? -C6) -ribose, 2'-O-alkenyl (C2-C6> -ribose, 2 '- [O-alkyl (of C? -C6 ) -O-alkyl (from C? -C6)] -ribose, 2'-NH2-2 '-deoxyribose,? -D-xylofuranose, a-arabinofuranose, 2,4-dideoxy-? -D-erythro-hexo- pyranose, and carbocyclic sugar analogs (described, for example, in Froehier, J. Am. Chem. Soc. 114 (1992) 8320) and / or open chain (described. for example, in Vandendriessche et al. Tetrahedron 49 (199) 7223) and / or bicyclo sugar analogues (described, for example, in M. Tarkov et al., Helv. Chim. Acta 76 (1993) 481): e) modifying or replacing one or more natural nucleoside bases with modified nucleoside bases, for example with 5- (hydroxymethyl) uracil, 5-aminouracil, pseudoouracil, dihydrouracil, 5-alkyl (Ci-Cß) -uracil, 5- alkenyl (from C2-C6) uracil, 5-alkynyl (from C2-C6) -uracil, 5-alkyl (from C1-C6) cytosine, 5-alkenyl (from C2-C6) cytosine, 5-alkynyl (from C2- C6) cytosine, 5-fluorouracil, 5-fluorocytosine, 5-chlorouracil, 5-chlorocytosine, 5-bromouracil, 5-bromocytosine or substituted 7-deaza-7 purines. f) the conjugation of the oligonucleotide with one or more molecules that influence (favorably) the properties (for example cell penetration, stability of the nuclease, affinity for the chosen nucleic acid, for example, the chosen sequence HSVTNR and / or better pharmacokinetics) of the oligonucleotide (for example, the properties of an antisense oligonucleotide and / or of a triple helix oligonucleotide); such molecules can attack the sequence of the chosen nucleic acid, while binding and / or cross-linking, when the oligonucleotide modified hybrid with this chosen sequence; the examples are conjugated with polylysine, with intercalation agents such as pyrene, acridine, phenazine or phenanthridine, with fluorescein compounds such as fluorescein, with crosslinking agents such as psoralen or azidoproflame, with lipophilic molecules such as alkyl (C12-C20), with lipids as , 2-dihexadecyl-rac-glycerol, with steroids such as cholesterol or testosterone, with vitamins such as vitamin E, with poly- or oligoethylene glycol, with diesters alkyl (of C12-C18) phosphate and / or with 0-CH2-CH (OH ) -O-C12-C18 alkyl; these molecules can be conjugated at the 5 'end and / or the 3' end and / or within the sequence, for example, to a (modified) nucleoside base; a special mode of chemical modification refers to the conjugation of oligonucleotide a) with lipophilic molecules, for example alkyl (C12-C20), b) with steroids such as cholesterol and / or testosterone, c) with poly- and / or oligoethylene glycol, d) with vitamin E, e) with intercalation agents such as pyrene, f) with alkyl (of C1-C18) phosphate diesters and / or g) with 0-CH2-CH (OH) -O-alkyl (C12-) C18); the processes for preparing an oligonucleotide conjugate are known to those skilled in the art and are described, for example, in Uhlmann, E. & Peyamn, A. Chem. Rev. 90 (1990) 543 and / or M. Manoharan in "Antisense Research and Applications", Crooke and Lebleu, Eds. CRC Press, Boca Ratón, 1993, chapter 17, p. 303ff, and EP-A 0 552 766: g) in another special embodiment of the invention, the oligonucleotide may have 3 '-3' and / or 5 '-5' inversions at the 3 'end and / or the 5' end; This type of chemical modification is known to the experts and is described, for example, in M. Koga et al. J. Org. Chem. 56 (1991) 3757.

In a special embodiment of the invention, the oligonucleotide corresponds to a part of the nucleic acid sequence near the translation start site (SEQ ID NO: 1, nucleotides 1 to 60) (Tables 1 and 2) which is known to In many cases, it is an efficient region for the antisense oligonucleotides. A number of oligonucleotides having a sequence corresponding to a part of SEQ ID NO: 1 and which were further modified were synthesized and characterized. Surprisingly, it was found that an antisense oligonucleotide against nucleotides 50-67 of HSVTNR (the numbers refer to SEQ ID NO: 1, Tables 1 and 2) which are known as ON 5543 is more effective for inhibition of HSVTNR expression than other oligonucleotides that are directed against (or correspond to respectively) nucleotides 44-63 (ON 5541), 41-58 (AS-3 of Nip et al.) and 39-56 (ON 5542). The sequence of ON 5543 corresponds to the nucleotides 50-67, ON 5541 corresponds to nucleotides 44-63, AS-3 (Nip et al.) Corresponds to nucleotides 41-48 and ON 5542 corresponds to nucleotides 39-56. The oligonucleotides ON 5543, ON 5541, ON 5542 and AS-3 (Nip et al.) Are modified. The oligonucleotide AS-3 is a whole phosphothioate, all phosphodiester bridges are replaced by phosphothioate bridges. Within the other oligonucleotides only particular positions are modified: the location of the modification within the sequences is shown (the type of modification: replacement of the phosphodiester bridges by thiophosphate bridges): SEQ ID NO 4: (ON 5541) 3'-G * A * AGC * C * GC * TAC * C * GAAAAG * G * C-5 ' SEQ ID NO: 5: (ON 5542) antisense 3'-C * G * C * GT * GAAG * C * CGC * TA * C * C * G-5 ' SEQ ID NO: 6: (ON 5543) antisense 3'-G * C * T * AC * CGAAAAGG * CGG * C * G-5 ' * is a phosphorothioate residue. The invention also relates to oligonucleotides having modifications in the same positions, but another type of modification.

Other oligonucleotides are used as control oligonucleotides to determine the sequence specificity of the above oligonucleotides. For example, the oligonucleotides of SEQ ID NO: 10, 11 and 7 are those used (control oligonucleotides): SEQ ID NO: 10: ON 5043 (inverted control of ON 5543) 5 '-G * C * T * AC * CGAAAAGG * CGG * C * G-3' SEQ ID NO: 11: ON 5544 (direction of ON 5543) 5 '-C * G * AGTC * TT * TT * CCGCC * G * C-3' SEQ ID NO: 7: ON 5045 (decoupling from ON 5543) 3 '-G * C * T * GC * CGAGAGAG * CAA * C * G-5' * is a phosphorothioate residue, the uncoupling in the sequence SEQ ID NO: 7 is underlined. The inhibition observed with the antisense oligonucleotides is specific for the chosen protein (the chosen protein is the av integrin subunit) or the chosen sequence (a nucleic acid encoding the av integrin subunit) respectively, in view of the fact that only the concentrations were reduced. of av protein, while other protein concentrations remain unchanged, as a reference, for example, it is possible to determine concentrations of the b3 protein and actin; these remained unchanged. Thus, these oligonucleotides specifically inhibit the expression of the av integrin subunit. In addition, shortened versions of ON 5 5543 may also block or inhibit respectively the expression of the av subunit of the human vitronectin receptor. In addition, partially phosphorylated oligonucleotide ON 5543 showed greater specificity than the all-phosphorothioates used in the previous studies (Nip et al., Martin et al, Wada et al.). A second region in the HSVTNR RNA [sic] was identified within the coding region, the nucleotides against which the effective antisense oligonucleotides could be identified. For example, ON 5959 5 covering nucleotides 128-145 (corresponding to nucleotides 128-145) could effectively inhibit the synthesis of av integrin protein. This region shows high homology of the sequence between different species, such as humans, chickens and mice. A comparison of the human, chicken and mouse sequences and the respective antisense oligonucleotide (s) (sequences) are shown below: Humana 128 5 '-CGCCTTCAACCTAGACG-3' 145 Gallus [sic] 5'-CGCCTTCAACCTGGACG-3 ' Mouse 5'-CGCCTTCAACCTGGACG-3 ' The corresponding antisense sequence: SEQ ID NO: 12: 3 '-GCGGAAGTTGGACCTGC-5' SEQ ID NO: 12: ON 5473 ("consensus-1" antisense) 3'-G * C * G G AA G * T * T G G A C * C * T G * C-5 ' SEQ ID NO: 13: ON 5474 (inverted control) 5 '-G * C * G G A G * T * T G G A C * C * T G * C-3' SEQ ID NO: 14: ON 5475 (sense) 5 '-C * G C * CT * T * C A A C * C * T G G A * C * G-3' SEQ ID NO: 8: ON 5959 ("consensus-2" antisense) 3 '-G * C * G G A A G * T ^ T G G A T * C * T G * C-5' underlined: 5-propynyl pyrimidine, * phosphothioate bridges The "consensus-1" oligonucleotide has a decoupling against human, but is perfect against mouse and chicken. The "consensus-2" oligonucleotide is perfect against human, but has a decoupling g-t against mouse and chicken.

In a particular embodiment of the invention, an oligonucleotide is prepared only by replacing some of the phosphodiester bridges with phosphorothioate bridges. In particular, the invention comprises oligonucleotides that are only modified to a minimal degree. The principle of minimally modified oligonucleotides is described in A. Peyman, E. Uhlmann, Biol. Chem. Hoppe-Seyler, 377 (1996) 67-70 and EP 0 653 439. In this case, 1.5, more preferably, 1-3 terminal nucleotide units at the 5 'end and / or at the 3' end are protected, for example, the intonucleoside [sic] phosphodiester bridges located at the 3 'and / or 5' end of the corresponding nucleosides are example replaced by internucleoside phosphorothioate bridges. In addition, at least one internal pyrimidine nucleoside is modified. Preferably, the internucleoside 3 'and / or 5' bridge (s) of an internal pyrimidine nucleoside is modified / replaced, for example by phosphorothioate bridges. The minimally modified oligonucleotides have particularly advantageous properties; for example, they exhibit a particularly high degree of nuclease stability in association with the least modification. They also have a significantly reduced propensity for non-antisense effects that are frequently associated with the use of all phosphorothioate oligonucleotides (Stein anal. (1994) Antisense Res. Dev. 4, 67). Partially modified oligonucleotides also show a higher binding affinity than all-phosphorothioates. In a special embodiment of the invention, at the 3 'and / or 5' end of the oligonucleotide the 1.5 nucleotides are modified. In another special embodiment of the invention, at least one non-terminal pyrimidine nucleoside and / or a phosphodiester bridge located at the 3 'and / or 5' end of this pyrimidine nucleoside is modified. Special embodiments of the invention include a minimally modified oligonucleotide. For example, a minimally modified oligonucleotide may have the following phosphorothioate standards: ? EQ ID NO: 6: 5 '-G * C * GGC * GGAAAAGC * CA * T * C * C-3' SEQ ID NO: 8: 5 '-C * GT * C * TAGGT * T * GAAGG * C * G-3 '("*" defines the phosphorothioate bridge) These minimally modified oligonucleotides can, for example, also include other types of modifications, for example, of the nucleoside bases, for example being substituted by 5-propynylpyrimidines, as well: SEQ ID NO: 8: 5 '-C * GT * C * TAGGT * T * GAAGG * C * G-3' (C: 5-propynylcytosine, T: 5-propynyluracil; "*" bridge phosphorothioate) Another preferred embodiment is constituted by chimeric oligonucleotides composed of DNA and 2'-0-methyl-RNA, for example: SEQ ID NO: 6: 5 '-G * C * GGC * GGAAAAGC * CA * TA * C * G-3' SEQ ID NO: 8: 5 '-C * GT * C * TAGGT * T * GAAGG * C * G-3 ("*" defines phosphorothioate bridges, 2'-O-methyl-ribonucleosides modified with 2'-O-methyl are underlined) Another preferred embodiment is constituted by chimeric oligonucleotides composed of DNA and PNA, for example: SEQ ID NO: 6: 5 '-G * C * GGC * Ggaaaagccatcg-3' SEQ ID NO: 8: 5 '-C * GT * C * TAggttgaaggcg-3' ("*" defines phosphorothioate bridges, the sequence of the PNA portion is indicated by lowercase letters) SEQ ID NO: 6: 5 '-G * C * GGC * Ggaaaagccatcq-3' SEQ ID NO: 8: 5 '-C * GT * C * TAggttgaaggcg-3' ("*" defines phosphorothioate bridges, the sequence of the PNA part is indicated by the lowercase letters, the nucleosides -aüiZt modified with 2'-O-methyl (the 2'-0-methylribonucleoside unit) are underlined) Another preferred embodiment is constituted by antisense oligonucleotides having hexadecyl (C16) residues at the 3 'or 5' end, for example: SEQ ID NO: 6: 5 '-C16-G * C * GGC * GGAAAAGC * CA * T * C * G-3' The oligonucleotides of the invention have a characteristic functional activity: they effectively inhibit the synthesis of the av protein (= av integrin subunit); this can be demonstrated, for example, when the amount of protein is determined relative to the probes with control oligodeoxynucleotides (the ONs). In addition, the treatment of the osteoclasts with the oligonucleotides of the invention induces a dose-dependent, substrate-specific reduction of osteoclast adhesion and inhibits bone resorption with a low IC 50 (2 x 10 μM). The oligonucleotides of the invention cause morphological changes consistent with the retraction of the cells, and induce apoptosis in the treated cells as observed by DNA staining with bis-benzimide, and is confirmed by decorating the DNA fragmented at an early stage by the TUNNEL. Surprisingly, the oligonucleotides of the invention stimulate the expression of the complex inhibitor ,,. . ,. ,. . . . . . AF1 / CIP1. . .. cyclin / cyclin-dependent kinase p21, and inhibit that of the cell survival gene, bcl-2. On the contrary, the expression of the gene that favors death bax cells remain unchanged. This leads to a reduction of the bcl-2 / bax ratio of which is known to underlie the intracellular signal for apoptosis. The oligonucleotides of the invention were also active in different cancer cell lines. So that, oligonucleotide ON 5543 inhibits the cell attachment of breast carcinoma MDA-MB231 cells while the sense and control oligonucleotides with corresponding decoupling had no effect. Adhesion of the cells was blocked in a dose-dependent manner to 10 nM to 1 μM of the antisense oligonucleotide concentrations. Surprisingly, the induction of apoptosis was also observed for cancer cells treated with the oligonucleotides of the invention making them useful for tumor treatments. 20 The surprisingly different downstream signaling mechanisms are carried out with the treatment with antisense oligonucleotides specific to the av integrin subunit: the mechanism that is carried out to induce apoptosis depends on the type of cell (functional activity of cell type-specific ONs) .

Therefore, the present invention relates to an oligonucleotide that is characterized by a specific and unexpected function (functional activity): when the oligonucleotide is contacted with a cell, it modulates the expression of at least one protein that is involved in apoptosis In a first aspect, the invention relates to an oligonucleotide that induces an increase in the expression of p21, in particular in the expression of p21 WAFl / CIPl. In a second embodiment, the invention relates to an oligonucleotide that induces a reduction in the expression of bcl-2. In a third embodiment, the invention relates to an oligonucleotide, which did not affect the expression of bax. In another embodiment of the invention, the oligonucleotide induces a reduction in the expression of bcl-2, but has no effect on the expression of bax. In this embodiment of the invention, the oligonucleotide causes a reduction of the bcl-2 / bax ratio, the oligonucleotide causes an intracellular signal for apoptosis.

The oligonucleotide is characterized by other specific functions: in another embodiment of the invention the oligonucleotide induces an inhibition of cell adhesion, preferably this effect is dose dependent. In a preferred embodiment, the oligonucleotide inhibits anchor-dependent growth. In another embodiment of the invention, the oligonucleotide induces an inhibition of bone resorption; preferably, this effect is dose dependent. The invention also relates to the process for the preparation of an oligonucleotide according to the invention. The process for the preparation comprises the chemical synthesis of the oligonucleotide. Preferably, chemical synthesis is a normal method used for the synthesis of oligonucleotides, for example, the phosphoramidite method described in example 1. The invention furthermore relates to methods of using the oligonucleotide as an antisense oligonucleotide, such as an oligonucleotide. triple helix former, as an adaptamer or as ribosim. Furthermore, the invention relates to methods wherein the oligonucleotide is used to inhibit the expression of the av integrin subunit, to modulate the expression of at least one protein that is involved in apoptosis, to induce apoptosis in a cell, to inhibit the adhesion of cells and to inhibit bone resorption, to inhibit angiogenesis and vascularization, for example, by inducing apoptosis of angiogenic blood vessels [sic], in particular if this vascularization is associated with tumor growth and tumor metastasis. Therefore, the invention relates to methods of using oligonucleotides for the treatment of tumors and for the prevention of metastasis.

- " The invention furthermore relates to a method of inhibiting the expression of the av integrin subunit and / or modulating the expression of a protein that is involved in apoptosis and / or to induce apoptosis and / or inhibit cell adhesion. and / or inhibiting bone resorption, wherein an oligonucleotide of the invention is contacted with a cell. The invention also relates to the use of the oligonucleotides to modulate and also to inhibit all or part of the expression of the av protein and / or mutants thereof, for example, to totally or partially inhibit the translation. Therefore, the invention relates to a method, wherein the oligonucleotide is contacted with a cell, and a method for introducing the oligonucleotide into a cell. The invention further relates to a method for hybridizing the oligonucleotide with a chosen nucleic acid and to a method for inhibiting the expression of the selected nucleic acid of integrin av. The invention further relates to the use of oligonucleotides as pharmaceutical compounds and the use of oligonucleotides to prepare pharmaceutical compounds. In particular, oligonucleotides can be used in pharmaceutical compounds that are used for the prevention and / or treatment of diseases that are associated with expression or over expression (increased expression) of the integrin subunit av. The invention also relates to methods for the preparation of a pharmaceutical composition, comprising the mixing of an oligonucleotide according to the invention with physiologically acceptable excipients and, if appropriate, suitable additives and / or auxiliaries. The invention further relates to the use of the oligonucleotides, or of the pharmaceutical compounds containing these oligonucleotides, to treat diseases in which the causative factor is the av integrin subunit or its over expression, or which is involved. The invention further relates to the use of oligonucleotides or a pharmaceutical composition prepared therefrom for the treatment and / or prophylaxis of osteoporosis, for the treatment and / or prophylaxis of cardiovascular diseases such as restenosis, and for the treatment of cancer, for example, to inhibit tumor growth and tumor metastasis. In particular, the invention relates to the use of the oligonucleotides or a pharmaceutical composition thereof to treat cancer or to prevent tumor metastasis or restenosis, or to prepare pharmaceutical compounds that can be used to treat cancer or to prevent tumor metastasis or restenosis. . The invention further relates to methods of use for treating cancer or preventing tumor metastasis or restenosis in combination with known therapeutic methods, for example, with methods currently used for the treatment of cancer or for the prevention of tumor metastasis or restenosis. Preference is given to the combination with radiation treatment and the known chemotherapeutic agents, such as cisplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen. The invention furthermore relates to pharmaceutical preparations comprising oligonucleotides and / or their physiologically tolerated salts in addition to the excipients and / or auxiliary substances which have no objection to pharmaceutical use. The oligonucleotides and / or their physiologically tolerated salts can be administered to animals, preferably mammals, and in particular humans, as pharmaceutical compounds by themselves, in mixtures with each other or in the form of pharmaceutical preparations that allow topical, percutaneous use, parenteral or enteric and containing as an active constituent, an effective dose of at least one oligonucleotide in addition to customary pharmaceutically acceptable excipients and excipients. The preparations typically contain from about 0.1 to 90% by weight of the therapeutically active compound. To treat restenosis, there is preference for topical use, for example in the form of administration using a catheter. In the case of cancer, preference is given to the intravenous route and oral administration, while in the case of osteoporosis preference is given to oral administration. The pharmaceutical products are prepared in a manner known per se (for example, Remingtons Pharmaceutical Sciences, Mack Publ. Co., Easton, PA), using pharmaceutically inert inorganic and / or organic excipients. Lactose, corn starch and / or derivatives thereof, talc, stearic acid and / or its salts, etc., can, for example, be used to prepare pills, tablets, coated tablets and hard gelatin capsules. Examples of excipients for soft gelatin capsules and / or suppositories are fats, waxes, semisolid and liquid polyols, natural and / or hardened oils, etc. Examples of suitable excipients for preparing solutions and / or syrups are water, sucrose, invert sugar, glucose, polyols, and the like. The excipients for preparing solutions for injection are water, alcohols, glycerol, polyols, vegetable oils, etc. Suitable excipients for microcapsules, implants are combined polymers of glycolic acid and lactic acid. In addition, the liposome formulations that are known to the experts (N. Weiner, Drug Develop Ind Pharm 15 (1989) 1523; "Liposome Dermatics, Springer Verlag 1992), for example, HVJ liposomes (Hayashi, Gene Therapy 3 (1996) 878) are convenient Dermal administration can also be effected, for example, using iontophoretic methods and / or by electroporation. , lipofectins and other carrier systems can be used, for example those that are used in gene therapy Systems that can be used to introduce the oligonucleotides in a highly efficient form in eukaryotic cells or in the nuclei of eukaryotic cells are particularly convenient. In addition to the active ingredients and excipients, a pharmaceutical preparation may also contain additives, such as fillers, extenders, disintegrants, binders, lubricants, wetting agents, stabilizing agents, emulsifiers, preservatives, sweeteners, colorants, flavors and flavoring agents, thickeners, diluents or buffer substances and, in addition, s, solvents and / or solubilizing agents and / or agents to obtain a slow release effect, and also salts for changing the osmotic pressure, coating agents and / or antioxidants. These may also contain two or more different oligonucleotides and / or their physiologically tolerated salts and, in addition to at least one oligonucleotide, one or more different therapeutically active ingredients. The dose can vary within wide limits and must be adjusted for the individual circumstances in each case. The invention relates to a pharmaceutical composition comprising at least one oligonucleotide according to the invention that can be used for the treatment of diseases that are associated with abnormal cell proliferation, migration of cells, differentiation of cells, angiogenesis, neurite outgrowth retinal, bone resorption, phagocytosis, immune response, signal transduction and metastasis of neoplastic cells. This pharmaceutical composition can be used for the treatment and prevention of cancer and metastasis of cancer, the treatment and prevention of osteoporosis, the treatment of eye diseases, chronic inflammation, psoriasis, restenosis and the support of wound healing. A more detailed description of the particular aspects of the invention: The adhesion of cells to the substrate has been recognized as a crucial event requiring the expression of specific receptors capable of recognizing and binding to the components of extracellular matrices, the so-called "molecules" of adhesion to the cells "(1). Integrin receptors represent the most important cell surface protein by which cells bind to extracellular matrices. The permutations of integrin subunits a and ß serve as receptors for multiple adhesive proteins, their interaction with extracellular matrices being responsible for the correct growth, survival and cell function (2) (3). Osteoclasts are multinucleated cells that reabsorb bone, commonly they are in contact with the mineralized bone matrix with gaps [sic] that are the result of their resorption activity (4). Bone resorption requires that the osteoclasts bind to the bone surface and adhere firmly to it to form the obturating membrane, a specialized adhesion area that contributes significantly to the maintenance of the controlled composition of the resorption lacuna medium (5) . In this sealed extracellular space, proteolytic enzymes and hydrogen ions degrade the organic and inorganic components of bone (6). Due to the importance of the organization of the obturating membrane for the function of the osteoclasts, the conditions that interfere with the adhesion properties of the cells modulate the resorption activity (7). The vitronectin receptor (integrin av ß3) is present in the selected cell types, including osteoclasts where it is highly expressed and plays a role related to the resorption activity (8). He The receptor consists of the av subunit of ~ 150 kDa, and the β3 subunit of ~ 95 to 115 kDa (9). In addition to vitronectin, avp3, it recognizes the motif of the adhesive sequence Arg-Gly-Asp (RGD) present in the bone matrix proteins Osteopontin and bone cialoprotein. (10,11). As for many a subunits a, the av chain has a major function in the determination of ligand specificity (10, 12). In addition, the ß3 chain can form heterodimers with at least four other B subunits (ßi, ßs, ßß, and ßß) and has been shown to have several highly conserved regions between species 812). Taken together, this information suggests that the av integrin subunit may represent an important choice for the regulation of specific functions associated with the adhesive capacity of cells.

Strategies that target the inhibition of av-mediated adhesion of cells can greatly facilitate therapeutic approaches for osteopenic syndromes, as well as provide insights into the mechanisms underlying the deterioration of osteoplast activity in osteopetrosis. . Antisense oligodeoxynucleotides (ON) offer opportunities for specific inhibition of the gene expression sequence (13-20).

Phosphodiester rapidly degrade in serum and within cells, with half-lives of less than 2 hours (14,15,21,22). However, the chemical modification of phosphodiester bonds that occur in nature, such as the replacement of a non-bridge-forming oxygen with sulfur, increases its intracellular stability against nucleases (23,24). It has been shown (25) that partial phosphorothiazon equally effective in reducing the amount of the chosen protein and has the additional advantage of decreasing non-sequence related side effects occasionally associated with phosphorothioated molecules, (19). In this study, ON antisense partially phosphorothioated av were used and evidence was obtained that this reagent impairs osteoclast adhesion and bone resorption. In addition, this is the first time that treatment with av antisense ON induces apoptosis of rabbit osteoclasts in vi tro, and that this apoptotic process is accompanied by altered expression of the genes p21"afi / c? P? and bcl_2.

The anchoring of integrin-mediated cells regulates different cellular functions (1-3), and the avß3 receptor is known to play an important role in the control of osteoclast activity (38,39). Surprisingly he has found that the specific inhibition of integrin av expression by an antisense reagent, which reduces osteoclast adhesion and bone resorption in vitro, induces programmed cell death by mechanisms that include regulation of the V21 genes "ail / ,: ípl and bcl- 2, but not the bax.

For a long time it has been shown that the deterioration of adhesion represents an important mechanism to inhibit bone resorption. In this study it was shown that such inhibition is obtained when the synthesis of the av integrin subunit is potentially reduced by an antisense mechanism while the levels of the b3 integrin subunit remain unchanged. This effect is based on the specificity of the Watson-Crick bases between the antisense ON and the target mRNA (14, 19, 22, 24, 40), which offers the potential to block the expression of specific genes within of the cells. This has been reported in numerous tissue culture experiments and in some recent in vivo studies (41). Although the mechanism of action of antisense NOs is generally difficult to prove (14,16,42,43), reasonable evidence was obtained in this study that supports a specific antisense effect. First, the observed inhibition is sequence specific in that only the antisense av is effective, whereas the ON control, direction, inverted and decoupled were not active. Secondly, the inhibition observed is specific to the chosen protein, since only the levels of the av protein were reduced, while b3 and actin remained without change.

The av antisense On used in this study encompassed the AUG start site, was located between bases 220 and 237 of the human sequence and complemented the rabbit gene. This reagent was found with a high potency, at least a part determined by an effect of local concentration by absorption to the substrate, which was higher than for the antisense OAs AS3 and AS4 reported to inhibit the adhesion of melanoma cells in vitro (37) Antisense DNA methods have been used to control various functions of osteoclasts (32, 44-47). NOs against the 16 kD and 60 kD subunits of V-ATPase have been shown to inhibit bone resorption and polarization of rat osteoclasts at high doses (approximately 30 mM) (44, 45), demonstrated microscopically. by disruption of the annular structure of F-Actin that is usually observed in osteoclasts in resorption (2,48). The ant antisense on av 5543 showed no obvious effects on the annular structures of the F-atina (no sample), but obviously induce programmed cell death, an event that has been demonstrated by rapidly breaking cells (49,50). Adhesion to the substrate has long been considered as crucial for the survival of cells growing adherent to an extracellular matrix (3). Growth dependent on the anchor has been demonstrated in a variety of cell types to modulate the function and expression of en (51,52). The transition from anchor-dependent growth to anchor-independent growth is a peculiar character of the neoplastic transformation, normal cells being dependent on the interaction with the substrate by physiological behavior. Apoptosis is a highly conserved active cellular mechanism characterized by shrinkage of cells, chromatin condensation and nuclear fragmentation (49). All these events have been observed in our cells treated with the antisense av, suggesting that the alteration of the interaction with the substrate can control the size of the osteoclast population m vitro.

Programmed cell death is regulated by different genes that control the balance of cell proliferation and cell death (49,50). A cell suffers apoptosis as a result of information received by the microenvironment and interpreted by the intracellular machinery. The mechanisms mediated by the receptor on the cell surface that control apoptosis usually act through signal transduction systems involving the activation of second messengers that regulate the transcription of specific genes (49,50). For example, the p2? WAF1 / CIP1 gene codes for a protein that inhibits the cyclin / cyclin dependent kinase, CDK (53). The binding of avb3 during angiogenesis has been demonstrated to suppress the expression of p2"afl / cl 1 and to stimulate the survival of cells (54) .In our study we found that the inhibition of the synthesis of av integrins by the antisense On 5543 stimulated the expression of p2? WAE'1 CIE ': L in a combined population enriched in osteoclasts and osteoclast precursors.This gene was clearly detectable in untreated osteoclasts, as expected for post-mitotic cells, as well as in a small number (9%) of mononuclear cells, although its immunodetection in osteoclasts was improved and, at the same time, the number of mononuclear cells expressing the gene increased in cultures treated with ON, control in relation to antisense-treated The inhibition of cyclin-CDK complex by p2lwafl c? pl interferes with critical phosphorylation events for the transition of the cell cycle (53). It has recently been suggested that this cell cycle inhibitor is involved in the suspension of growth associated with terminal differentiation (55). In addition, the potential functions of this gene in events that cause efficient preparation of DNA damage or apoptosis (56, 57) have been only hypotheses. The expression of the p2lSF1 protein CIP1 [sic] has been found suppressed in endothelial cells during avb3-mediated adhesion in vivo and in vitro (52), and stimulated in response to the disruption of the interaction of fibroblasts to the extracellular matrix ( 58). These data indicate a direct potential link between the integrin-dependent anchor and the regulation of p2iwa £ 1 clP1 to favor cell survival.

Among the numerous genes that have been implicated in the control of cell survival, the bcl-2 gene, which encodes two spliced variants, Bcl-2a and Bcl-2b, is known to be a negative regulator of cell death (49, fifty). Bcl-2 prolongs the survival of non-cyclic cells, and prevents death by apoptosis of the cyclic cells (49,50). In contrast, the Bax gene encodes a protein that has a function as opposed to bcl-2 acting as a promoter of death. Bcl-2 is known to enhance cell survival based on its capacity to timerize with Bax (49.50); therefore, the high bcl-2 / bax ratio favors cell survival, while a low bcl-2 / bax ratio induces apoptosis. This study clearly demonstrates that programmed osteoclast death induced by av-dependent anchor impairment is associated with a drastic reduction in bcl-2 expression rather than with changes in bax concentrations. These events lead to a clear reduction in the bcl-2 / bax ratio that also induces apoptosis in osteoclasts and their putative precursors. In this context, it is interesting to note that Strómblar et al. (54) recently demonstrated that the denial binding of endothelial cells on a surface coated with bovine serum alumina affected the expression of both genes, inducing a decrease in bcl-2 and an increase in bax relative to the cells bound to the immobilized anti-avß3 antibody. These findings indicate that the inhibition of av-integrin-dependent anchorage in different cell models can induce different effects on the expression of the bcl-2 and bax gene products that lead to a reduction of the bcl-2 / bax ratio.

In conclusion, this study provides evidence of a ON antisense targeting the mRNA of the integrin av subunit of osteoclasts that inhibits satisfactory adhesion and bone resorption with high specificity and potency, and that av-dependent anchoring is mandatory for the survival of osteoclasts and their putative precursors. A clear link between the inhibition of av-mediated adhesion and the regulation of p21"a £ 1 c? Pl [sic] and the relationship of bcl-2 / bax has been shown to represent the underlying pathway that favors apoptosis in the lineage of rabbit osteoclasts The development of this approach opens a path for alternative treatments for bone diseases.

The most common malignancies frequently involve the skeleton, for example, advanced breast carcinomas (59). In the United Kingdom, breast cancer affects 7% to 10% of women and globally accounts for one fifth of malignancies in women, and at least half of these patients will die of metastatic disease (60). Bone metastasis is apparently associated with most of the primary tumors, although there are some malignancies that are predisposed to disperse into the skeleton. In particular, prostate cancer and breast cancer almost always metastasize to bone (59,60). Therefore, the elucidation of the cellular mechanisms involved can help in the development of new effective treatments that could prevent practically incurable and catastrophic disease.

Dispersion of the cancer requires the uncoupling of the cells from a primary tumor site and migration to and attachment to a secondary location for their establishment. Many workers have shown that various adhesion molecules to cells play a role in metastasis and that integrins are especially involved in tumorigenic dispersion (61).

Integrins are not only involved in cell-cell and SM-cell interactions (SM = extracellular matrix) but also in signaling to the cell, and are thus involved in the detection of the cellular micro-environment, performing important functions in the cells. cellular activities such as migration, differentiation, survival and (re) modeling of tissue in normal and pathological states (64,65).

In the case of breast cancer cell lines there is considerable evidence of altered levels of integrin in the tumorigenic situation compared to the native, parental background. Av integrins, and especially vitronectin (avß3), are highly expressed and could have a prominent function in metastasis of mammary carcinoma to bone (66). Different lines of breast carcinoma cells are available for the study of the effect of different anti-adhesive treatments, such as monoclonal antibodies and peptides, and these include the series of MDA-MB cell lines. In a study by Meyer et al., (66) where they assessed the expression of av integrins in 8 different breast cancer cell lines, they found that the traditional avß3 vitronectin receptor was only expressed in MDA-MB231 cells, whereas avßs it is expressed by all breast cancer cells and vß2 is expressed in the majority. The av subunit could be a key target for anticancer treatments. Since the vitronectin receptor has been shown to be important in tumor progression and expression of the invasive phenotype (66,67) as demonstrated in melanoma cell types (68,69). Therefore, there is considerable interest in trying to modify the expression profiles of the integrin in breast cancer with consequent effects on the growth and dispersion of the primary tumor.

The therapeutic potential of antisense ONs when designed to suppress the cellular function of the av integrin subunit in breast cancer cells was demonstrated. A comprehensive analysis of the cell line's physiology MDA-MB231 (human mammary carcinoma cell lines) challenged with low doses of the antisense ONs specific for the av integrin subunit showed sufficient inhibition of cell adhesion to ECM (extracellular matrix). These anti-adhesive effects are due to decreases in the level of total av protein and give rise to the activation of programmed cell death.

ON 5543 induces an increased rate of apoptosis. It is known that the inhibition of anchorage to the substrate activates the intracellular signals for apoptosis, and that the av receptors play an important role in the prevention of this event (74-77). Apoptosis is an active process that requires transcription events before nuclear fragmentation and packaging of DNA in "apoptotic bodies" (78). There are several cellular "switches" that activate cell death, one of which is the p53 protein, a gene product that detects DNA damage and suspends the Go cell cycle transition. Gi through activation of inhibitor p2iW? F1 / CIP1 from? cyclin-cyclin-dependent kinase complex (75,769). Other signals for apoptosis are represented by reciprocal changes of the Bcl-2 and Bax gene products. When the Bcl-2 / Bax ratio is reduced, the pro-apoptotic performance of the Bax product is favored. In the study with MDA-BM231 cells, the The expression of these genes was unchanged by ON 5543. However, the p53 protein was translocated from the cytoplasm to the nucleus, an event that occurs as a consequence of the interruption of av-mediated adhesion in other cellular models (75). The p53 expressed by the MDA-MB231 cell line is a mutant form (79), and its signaling pathway is not completely understood.

The integrin av receptors have been shown to be important for the physiology of osteoclasts and the spread of breast cancer to bone (68, 69). Other media have already been used for the disruption of osteoclast adhesion to the substrate. Neutralizing avß3 antibodies include equistatine disintegrin from snake venom and RGD peptides (71, 72). Other workers have recently demonstrated the advantage of using a small non-peptide mimetic molecule (SC-68448) to antagonize vß3 integrin (80). In comparison with the RGD peptides, ON 5543 is highly specific for av and, in the variation with antibodies and non-peptide mimetics, blocks all av receptors, regardless of the associated β subunit. In addition to the avß3 receptor, osteoclasts and breast cancer cells also express avß receptors. and the avßs (88, 71, 72). Therefore, ON 4443 directed to the av gene (mRNA, respectively) offers the advantage of blocking a mechanism shared by both types of cells involved in metastatic lesions, with high efficiency and specificity for all av receptors.

Despite the appreciable similarity of the effect on adhesion, the mechanism underlying the apoptotic events activated by ON 5543 in osteoclasts and MDA-MB231 cells seems to differ in some specific aspects. The osteoclasts showed an increase in p21 WAF1 / CIP1 expression and a reduction in the Bcl-2 / Bax ratio (77), while none of these genes were modified in MDA-MB231 cells. This indicates that intracellular signals for apoptosis regulated by the av gene is heterogeneous may be cell type specific.

ON 5543 also induces apoptosis with a mechanism probably involving p53 (but no changes observed in the expression of p53, but a translocation of p53 was observed from the citaol [sic] to the nucleus), but independent of the inhibitor complex kinase dependent on , .. ,. " WAFI / CIPI. . , cyclin-cyclin p21, cell survival factor Bcl-2 and proapoptotic factor Bax. The effectiveness of ON 5543 in the interruption of ECM contact of tumor cells and osteoclasts suggests that this compound It can block metastatic bone diseases.

Examples: Abbreviations: BSA: Bovine serum albumin DMEM: Dubelco Modified Minimum Essential Medium ECL: enriched chemiluminescence FBS: Fetal Bovine Serum ON: Oligodeoxynucleotides PBS: Phosphate-buffered saline TRAP: Tartrate-resistant acid phosphatase TUNNEL: end notch labeling dUTP-biotin mediated by TdT.

Methods Reagents The cell culture medium, reagents and sera were from Hyclone (Róntegenstraat, Netherlands) or Gibco Lifesciences (Inchinnan, UK). Culture plates and sterile glass material was from Falcon Becton-Dickinson (Lincoln Park, NJ) and from Costar Co. (Cambridge, MA). The equipment for the detection of apoptosis / DNA fragmentation (TUNNEL) was from Chemicon (Tamecula, CA). The chemicals, of the purest grade, were from Sigma Chemical Co.

(St. Louis, MO). Monoclonal antibody 23C6, human avß3 (16) and monoclonal antibody 13C2, av, were produced in our laboratory. The human av monoclonal antibody (clone # 139) and the human polyclonal ß3 antibody (clone # 1264) (27) were obtained from the Department of Dermatology, State University of New York at Stony Brook, New York. The anti-p21wñF1 / CIP1 (Ab-5) and p53 (0P09) antibodies were from Oncogene Research Calbiochem (Cambridge, MA). Anti-Bcl-2 (sc 492), anti-Bax (se 493), anti-actin (sc 1616) and secondary antibodies were from Santa Cruz Biotechnology Inc. (Heidelberg, Germany). The ECL team was from Amersham International foot (Little Chalfont, U. K.). The compound 1, 25-dihydrox? Vitamin D3 was obtained from Roche S. P. A. (Milan, Italy).

RT-PCR: Total RNA was prepared from spleen and rabbit bone marrow, tissues with high av expression. The two flanking initiators, av? and aV3, amplified a predicted band of 198 bp (see Figure 1). The aV2 primers? internal and 3 'aV3 amplify a 133 bp band, although this product would not include the ATG home site. Therefore, nested PCR using the product av? + aV3 as a template, using the av and aV2 primers, was used to amplify an 82 bp band that should include the sequence of the start site. This was T: A subcloned in pCR2.1 and sequenced automatically in the forward and reverse directions.

Cells: Freshly isolated osteoclasts were obtained from New Zealand white newborn rabbits (4-7 days) as described by Chambers et al. (30) and Caselli et al. (31) The cells were allowed to bind to the substrates for 45-90 minutes, then incubated in DMEM supplemented with 10% FBS, 100 IU / ml penicillin, 100 μg / ml streptomycin, in an atmosphere saturated with 95% water air and 5% CO2. The rabbit osteoclasts were also differentiated in vitro from the bone marrow. The bone marrow was washed from long bones and cultured as already described. After 24 hours, the non-adherent cells were removed by aspiration and with repeated washes, and the total fraction of the adherent cells was incubated with 10 nM of 1,25-dihydroxy vitamin D3 for 10 days. At the end of the incubation, the contaminating stromal cells were eliminated by moderate trypsinization and the osteoclast phenotype was evaluated by positive staining for TRAP activity, retraction in response to 100 nM salmon calcitonin, formation of a resorption gap.

The mouse osteoclasts were generated in vitro and characterized as described by Tanaka et al. (32) The human mammary carcinoma cell line MDA-MB231 was purchased from the ICRF mammary cell culture laboratory and the ETCC. Cells were cultured in Dubelco Modified Minimum Essential Medium (DMEM) with Earle salts containing 10% fetal bovine serum (FCS), 100 U / ml [sic] penicillin, 0.2 mg / ml streptomycin, 0.2% glycine at 37 ° C in 5% CO2, 95% air in a humidified atmosphere.

Treatment of MDA-MB231 cells with ONs The ONs were diluted in DMEM in reference solutions and stored in aliquots at -20 ° C until use. The treatment of MDA-MB231 cells was performed in the presence of the lipofectamine uptake enhancer (5 μg / ml). lipofectamine was mixed with adequate dilutions of the ONs and incubated for 30 minutes before administration to the cells.

Substrates: Osteoclasts were plated in glass, bone or dentin. DMEM with a 10% FBS content was used as a standard adhesion substrate during cell culture on artificial substrates. Otherwise, covers Glass gliders were previously coated with adhesive proteins and the cells were then incubated in DMEM with low serum content (1%). To coat the substrate, 20% FBS or 10 μg / ml fibrinogen, fibronectin, vitronectin and fibrillar collagen were used as sources of adhesive substrates. The wells were coated with proteins and incubated three hours or overnight at 4 ° C. The solutions were then replaced with 60% methanol, and the wells were further incubated for one hour at 4 ° C. Methanol was removed by aspiration, and the wells were incubated with 100 μl of a buffer containing 50 mM Tris-HCl (pH 7.8), 110 mM NaCl, 5 mM CaCl 2, 1% BSA and 0.1 mM phenyl methyl sulfonyl fluoride during 30 minutes at room temperature. Finally, the wells were washed three times with DMEM supplemented with 0.2% BSA and immediately used for the experiment.

Treatment with the ONs: The ONs were dissolved in water and diluted in DMEM as reference solutions and stored in aliquots at -20 ° C until use. The treatment of the osteoclasts was performed by incubating the cells with adequate concentrations of the NO for different times.

Analysis of the marked FITC-ON: «Afefc ^ úsS The ONs marked with FITC were synthesized to monitor their uptake in the cells and adsorbance [sic] to the substrates. Cells were incubated for 24 hours with 1 μM FITC-ON, fixed and observed by confocal fluorescence microscopy (Leica Tcs-NT System). For adsorption to glass or dentine, concentrations in the range of FITC-ON (0.2-20 μM) were incubated together for up to 24 hours.

Apoptosis: Cell morphology was evaluated by phase contrast microscopy. Bisbenzimide was used, which binds specifically to the adenine-thymidine regions of DNA for nuclear staining. Cells were fixed in Carnoy's fixative (methanol-glacial acetic acid 3: 1), incubated for 30 minutes in 0.5 μg / ml bisbenzimide, rinsed (2x in distilled water), mounted in glycerol-PBS 1: 1 and observed by traditional epifluorescneic microscopy.

To evaluate fragmented DNA, the TUNNEL method (34) was used according to the manufacturer's instructions. Briefly, the cells were fixed in 4% buffered paraformaldehyde, washed (two minutes, 4x in distilled water) and incubated in TdT buffer for 5-10 minutes at room temperature. Then the buffer was removed and the cells were incubated in buffer solution that contained Tdt and Biotin-dUPT for 60 minutes at 37 ° C. The cells were then washed in TdT buffer for 15 minutes at room temperature, washed (2 min, 4x in distilled water), blocked in blocking reagent and incubated with FITC conjugated with avidin for 30 minutes at 37 ° C. Cells were washed in PBS (5 min, 3x), stained with 0.5 μg / ml propidium iodide, washed in PBS (3 min), mounted and observed by traditional epifluorescence microscopy.

Statistics: The data are the average + SD of at least three independent experiments. The statistical analysis was performed by means of one-way analysis of variance (ANOVA) followed by the Student's t test or the Mann-hitney test. A value of p < 0.05 was considered statistically significant.

Example 1: Synthesis of oligodeoxynucleotides The sequences of the ON av and the sequence of the rabbit AUG start site Some of the sequences of the ONs used in this study are shown in Table 3. The partially phosphorylated antisense ONs targeted to the av-subunit of the human vitronectin receptor were chosen based on the BLAST alignment program (35). Alignment of known species variants for the av subunit revealed high homologies around the translation start site (Figure IA). In view of the use of rabbit osteoclasts in the following studies, the initial sequence of rabbit translation was determined by RT-PCR. Three pairs of degenerate primers were designed, which when used in combination manifested the rabbit sequence (Figure IB and C). Figure ID represents the start sequence of the rabbit translation, including the antisense sequence ON 5543. The sequences are highly homologous (98.9%) with only one base at discrepancy at position 83 where the rabbit av contained a base of thymidine compared to a cytosine in the human sequence (36). The ONs were synthesized using an Applied Biosystems 394 DNA synthesizer (Perkin Elmer Applied Biosystems, Inc. Foster City, USA) and the chemistry of normal phosphoramidite. After coupling, the phosphorothioate linkages were introduced by sulfurization using the Beaucage reagent (28) followed by cap formation with acetic anhydride and N-methylimidazole. After the dissociation of the solid support and the final deprotection by treatment with concentrated ammonia, the ONs were purified by electrophoresis in polyacrylamide gel. The ONs modified with propynyl pyrimidine C-5 were prepared as described previously 829). All the ONs were analyzed by negative ion electrospray mass spectroscopy (Fisons Bio-Q), which in all cases confirmed the calculated mass. The C16-modified oligonucleotides were synthesized using hexadecyloxy (cyanoethoxy) N, N-diisopropyl aminophosphane as the phosphorylating reagent in the last step of the synthesis of the oligonucleotides instead of a standard amidite. The analysis of the oligonucleotides was carried out as follows: a) Analytical gel electrophoresis in 20% acrylamide, 8M urea, 45 μM tris-borate buffer, pH 7.0 and / or) HPLC analysis: Waters GenPak FAXcolumn, CH3CN gradient (400 ml) ), H20 (1.61), NaH2P04 (3.1 g), NaCl (11.7 g), pH 6.8 (0.1 M an NaCl) then CH3CN (400 ml), H20 (1.61), NaH2P04 (3.1 g), NaCl (175.3 g) , pH 6.8 (1.5 M an NaCl [sic] and / or c) capillary electrophoresis using Beckmann eCAP® capillaries, U100P gel column, length 65 cm, ID 100 mm, 15 cm window from one end, tris buffer 140 μM, borate 360 mM, urea 7 M and / od) mass spectroscopy with electrospray of negative ions that in all cases confirmed the values ate.- of the expected mass.

The following oligonucleotides against HSVTNR mRNA (human) were prepared: ON 5541 (antisense) 3'-G * A * AGC * C * GCTAC * C * GAAAAG * G * C- S 'ON 5542 (antisense) 3'-C * G * C * GT * GAAG * C * CGC * TA * C * C * G- 5 'ON 5543 antisense S'-G'CT'ACCGAAAAGG-CGG-C'G - 5' ON 5043 (inverted contr. Of ON 5543) 5, -G * C * T * AC * CGAAAAGG * CGG * C * G-3 'ON 5044 (sense of ON 5543) ^ - ^ • ATGGCTrTrccGCC-G'c-y ON 5045 (mismatch of ON 5543) 3'-G * C * T * GC * CGAGAGAG * CAA * C * G-5 'ON 5959 antisense 5'- C * GT * C * TAGG TT * G AA GG * C * G -3' ON 5972 inverted Control 5'- G * C "GGAAG * T * TGGAT * C * TG * C -3 'ON 5970 sense 5'-C * GC * CTCAAC * CT AGA * C * G -3' ON 5971 mismatch 5'- C * G TCT GAGT "T * GAGAG * C * G - 3" ON 5431 antisense 3'- G * C * TAC * CGAAAAGG'CGG * C'G-C16 -5 'ON 5432 inverted repeat 5'- G * C * TAC * CGAAAAGG * CGG * C * G-C16-ON 5504 antisense 3'- G * CT * AC * CGAAAAGG * CGG * C * G -5 'ON 5503 inverted repeat 5'- G * C * T * AC * CGAAAAGG * CGG * C * G -3' ON 5506 antisense 3 ' - G * C * T * AC * CGAAAAGG * CGG * C * G-C16 -5 'ON 5505 inverted repeat 5'-G * CT * AC * CGAAAAGG * CGG * C * G -C16- 3' ON 5959 antisense 3 'G * C * G GAA GTT GGA T * C * TG * C 5' antisense = antisense inverted repeat = inverted repetition mismatch = uncoupled inverted control = inverted control sense = sense For comparative studies in animals, a mouse-specific antisense oligonucleotide was synthesized: ON 5468 mouse antisentium av 3 'G * C * TAC * CGAC * GAGGGC * C * C * G 5 '* is a phosphorothioate residue, and C is propinyl-dC, T is propinyl-dU Example 2: Uptake of ON antisense ON 5543 and reduction of av protein. The uptake studies were first performed to examine whether the ON 5543 antisense of av bound to FITC was taken in the osteoclasts. Ex vivo rabbit osteoclasts, plated on glass (Figure 2) or dentin (not shown), internalized the fluorescent ON, with the highest levels observed in numerous intracellular vacuoles (Figure 2); the nuclei generally showed low uptake. To examine whether antisense ON reduces the synthesis of av integrin, large amounts of rabbit osteoclasts were generated in vitro from the fraction of adherent bone marrow cells cultured for 10 days in the presence of 1,25-dihydroxy vitamin D3. nM. The TRAP-positive multinucleated osteoclasts fully active in bone resorption and shrinkage in the 10-fold salmon calcitonin response appeared on the sixth day of culture and progressively increased over time. The cultures were then cleared of contaminating stromal cells by moderate trypsinization, and those populations that contained > 80% of cells of the osteoclast lineage (mature osteoclasts and putative positive mononuclear precursors for TRAP) were treated with ON 5543 for 48 hours. at *. / atf ..; 5th. ' Example 3: Immunoassay Cellular extracts from 90% of confluent cultures were prepared with TBS buffer (10 mM Tris-HCl, pH 7.4 and 0.9% NaCl) containing 0.5% Triton X-100 and protease inhibitors. The Used ones were kept at 4 ° C during the procedure. The lysates were centrifuged for 10 minutes at 11,000 g to eliminate nuclei and cellular waste, were precipitated with TCA and then solubilized in Laemmii buffer. 30 μg of the cellular protein was subjected to SDS-PAGE (8% acrylamide gel for av, β3 and actin and 12% for p21 [sic], bcl-2 and bax), and the proteins were transferred to nitrocellulose filters .

The filters were then incubated with the primary antibody at 4 ° C overnight, washed and incubated with the secondary antibody conjugated with horseradish peroxidase at room temperature for 90 minutes, washed and detected by ECL. Immunoassay (Figure 3A) showed that 1 μM of ON 5543 antisense reduced the level of av protein compared to untreated cultures and cultures treated with control ONs. In contrast, no significant change in the expression of the β3 integrin subunit or actin was observed. Similar results were obtained using mouse osteoclasts generated in vitro as already described by Tanaka et al. (32) and treated with antisense av and mouse-specific control do not show data).

Example 4: Measurement of cell adhesion The osteoclasts were plated on round coverslips of 13 mm in diameter or slices of bovine bone of 4 x 4 mm or dentine discs (diameter 6 mm) of elephant ivory, and incubated in the presence of the ON during different times. At the end of the incubation, the non-adherent cells were removed by extensive washes in PBS (3x), and the bound cells were fixed in 3% paraformaldehyde in PBS for 15 minutes at room temperature, rinsed in PBS (3x), stained for TRAP enzyme and observed by phase contrast microscopy. Adhesion was evaluated by counting the number of multinucleated osteoclasts positive for TRAP for each coverslip or bone / dentin slice. ON 5543 av antisense inhibited adhesion of rabbit osteoclasts ex vivo to glass and bone or dentin and bone resorption. Titration curves were biphasic and suggest that activity can be observed at concentrations as low as 2 x 10 μM (p <0.05, Figure 4). This high power was also due to a local concentration effect on the substrate support. In fact, the ON 5543 modified with FITC (ON 5543 marked with FITC) was rapidly adsorbed to the dentin matrix, rising to a maximum of 4 hours (Figure 5). Similar results were obtained for the adsorption of ON with decoupling FITC-ON 5543 to dentine and glass (not shown). Similarly, adsorption to glass increased with time and ON concentration (not shown). however, the relative amounts of adsorbed FITC-labeled NO were approximately 30 times lower than those observed with dentin. Figure 6 shows that the three control ONs were ineffective (p = ns) in inhibiting the adhesion of the osteoclasts ex vivo and the resorption in relation to the antisense ON 5543 (p <0.0001). The comparative study showed a higher activity of antisense ON 5543 (20 mM, adhesion 68% and resorption 65% inhibition vs. nothing) in relation to AS3 (20 mM, adhesion 53 and resorption 50% inhibition vs. none) and AS4 (20 mM, adhesion 485 and resorption 50% inhibition vs. none, n = 3-8; p <0.001) av antisense ONs that were shown to inhibit adhesion of melanoma cells in culture (37).

Example 5: Measurement of bone resorption Bone resorption was evaluated according to Prallet et al. (33). The osteoclasts were plated on slices of bone or dentin and incubated in the continuous presence of ONs for 24-48 hours. At the end of the incubation, adherent TRAP positive multinucleated cells were counted under light microscopy. Then eliminated by sonication for two minutes in NaOCl 0.01%. The slices were rinsed twice in distilled water (20 min) and stained for 4 minutes in 1% toluidine blue in 1% sodium borate, and observed by traditional light microscopy with a 20x objective. The number of resorption wells in at least 5 slices of bone or dentin discs for each spot was counted in three visual categories, according to Prallet et al. (33). For each experiment, the average control value (only vehicle) of the well area index was used as a basis to calculate each value as a percentage of the average control value (31). Otherwise, bone resorption was listed as the number of wells per osteoclast, and normalized to control the values of resorption in the presence of only vehicle. The treatment of the osteoclasts generated in vi tro with the ON 5543 antisense, but not with the control, the ONs showed inhibition of adhesion and resorption equivalent to that observed with osteoclasts ex vivo (data not shown). When this fraction was cultivated during the 10 days necessary for differentiation in continuous presence of ON antisense ON 5543, a significant reduction was observed not only in TRAP-positive multinucleated cells, but also in the mononuclear precursors of putative positive osteoclasts for TRAP. Again, all control ONs were ineffective (Figure 7). These results indicate the efficacy of the antisense ON 5443 also in the early stage of osteoclast development and validates the molecular analysis performed in this study using this population of cells.

Example 6: Substrate specificity The substrate specificity of the effect of ON 5543 (abbreviation 5543) on the adhesion of osteoclasts was determined (Figure 8). A concentration-dependent effect, adhesion to serum and vitronectin (Figure 8A and B) that was observed (with 63% inhibition at 20μM, p <0.001). In the case of adhesion to fibrinogen and fibronectin (Figure 8C and B) there were small, but statistically significant (p <0.01) reductions in the number of osteoclasts bound after 24 hours, whereas adhesion to fibrillar collagen was not affected (Figure 8C and B). Figure 8E, p = ns). The effect of ON 5543 antisense on the adhesion of the osteoclasts was compared to that of the monoclonal antibody blocking function 23C6 (to human avß3, but cross-reactive to the rabbit receptor) (Figure 8F). The inhibitory effect of 23C5 was the most prominent in cells plated on serum and vitronectin, with the responses for ON 5543 in parallel with those of 23C6 in all the matrix proteins tested.

Example 7: Determination of apoptosis Cell morphology was evaluated by phase contrast microscopy. Bisbenzimide was used, which binds specifically to the adenine-thymidine regions of DNA for nuclear staining. The cells were fixed in Carnoy's fixative (methanol-glacial acetic acid 3: 1), incubated for 30 minutes in 0.5 μg / ml bisbenzimide, rinsed 2x in distilled water), mounted in glycerol PBS 1: 1 and observed by microscopy. epifluorescence of conventional epifluorescence.

To evaluate fragmented DNA, the tunnel method was used according to the manufacturer's instructions. Briefly, the cells were fixed in paraformaldehyde buffered at 4%, washed (2 min, 4x in distilled water) and incubated in TdT buffer for 5-10 minutes at room temperature. The buffer was then removed and the cells were incubated in buffer containing TdT and biotin dUPT for 60 minutes at 37 ° C. The cells were then washed in TdT buffer for 15 minutes at room temperature.

Washes (2 min, 4x in distilled water) blocked in blocking reagent and incubated with FITC conjugated with avidin for 30 minutes at 37 °. Cells were washed in PBS (5 min, 3x), stained with 0.5 μg / ml propidium chloride, washed in PBS (3 min), mounted and observed by traditional epifluorescence microscopy.

The morphological analysis of the osteoclasts treated with ON antisense ON 5543 showed cellular retraction in relation to the control ON (figure 9A-D) with nuclei frequently showing morphological changes consistent with nuclear damage. Therefore, the DNA was decorated with bisbezamide, a compound that binds specifically to the adenine-timid regions. After 24 hours of challenge by antisense NO, nuclei that appeared altered with apoptotic bodies were evident (Figure 9H). The cultures treated with control (figure 9F and G) showed no alteration, since the nuclei were indistinguishable from those of the untreated control (figure 9E). To confirm apoptosis, TUNNEL staining of DNA fragment was performed, which reveals cell death program at a very early stage. It was found that cells treated with ON 5543 (figure 91) the number of apoptotic nuclei relative to untreated cells or cells treated with ON control (figure 9J).

To examine the intracellular mechanism that induces apoptosis, experiments were designed to investigate genes that were altered to promote cell death with the inhibition of av synthesis. Immunofluorescent detection of the p2i protein "afl cl 1 showed an increase in expression in the fraction of mononuclear cells and osteoclasts treated with the antisense av ON 5543, but not with the control ON (figure 10).

In addition, the immunoassay showed that the ON 5543 av antisense induces a potent reduction of Bcl-2, whereas the control ONs were ineffective. In all test conditions, Bax's expression remained unchanged (figure HA). The densitometric analysis showed a reduction of approximately 50% of the bcl-2 / bax ratio in the cells treated with 5543 av but not in those treated with ON control (figure 11B).

Example 8: Inhibition of the addition of the cells of mammary carcinoma MDA-MB231 cells and determination of apoptosis. The ON 5543 antisense at a concentration of 1 μM was tested on carcinoma cells basically as already described and was found to inhibit the adhesion of MDA-MB231 cells by approximately 40%, while i & a ^ no adhesion of the cells decreases with the sense control oligonucleotides and with decoupling. The antisense oligonucleotide was added to the MDA-MB231 cells established in wells coated with fibrinogen at concentrations 0.01 to 1 μM. The cells were challenged for 24 hours before staining with crystal violet. TUNNEL staining of fragmented DNA again manifested programmed cell death of cancer cells.

Example 9: Inhibition of cell adhesion of CGT cells 23. ON 5473 antisense at a concentration of 1 μM was tested on carcinoma cells basically as already described and found to inhibit the adhesion of GCT 23 cells by approximately 40% while that the adhesion of the cells did not decrease with the sense and inverted oligonucleotides.

Example 10: Inhibition of adhesion of cells by oligonucleotides of different chemical modification. ON 5959, ON 5431, ON 5504, ON 5506 and ON 5959 were all tested as already described in Examples 3 and 4 and found to inhibit cell adhesion. ON 5506 provided 80% inhibition of cell adhesion ^^^^^^^.

NBA-MB231.

Example 11: Treatment of cells in MDA-MB231 cell with ON. Incubation of MDA-MB231 cells with ON 5543 was performed in the presence of lipofectamine uptake enhancer. The control experiments showed that 5 μg / ml of lipofectamine was more effective and that the treatment of up to 72 hours was without toxic effects (data not shown).

The RT-PCR of the cDNA and the immunoassay of the whole cell fraction confirmed mRNA reduction of av (55%) and protein (65%) in a specific antisense form, as demonstrated by the lack of effect by the sense and 5543 ONs with uncoupling (figure 12) as a reference gene, β-actin was used whose mRNA and protein expression level remained unchanged by the antisense treatment, further confirming antisense specificity.

Example 12: Adhesion to ECM (extracellular matrix) To quantify adhesion to ECM, MDA-MB231 cells suspended in growth medium containing FCS were plated in plastic wells in the presence of ON 5543 antisense av and control ONs where it was assumed that the adhesion substrate originates from whey proteins.

We observed dose-dependent inhibition of cell adhesion in cultures treated with the ON 5543 antisense with the constant (58% decrease) reached at 1 μM (Figure 13). The adhesion inhibition was time dependent. Figure 14 shows the maximum effect (decrease 64) in an incubation time of 72 hours. All control ONs were without effect (Figure 13 and 14).

The question was whether the effect of the ON 5543 antisense was specific to the ECM substrate. The MDA-MB231 cells were plated on plastic coated with vitronectin, fibrinogen, fibronectin and laminin. Adherence to vitronectin, fibronectin fibrinogen was significantly inhibited in the presence of increasing concentrations of ON 5543 (0.1 to 1 μM) (maximum decrease 34%, 59% and 65% for, fibronectin, fibrinogen and vitronectin respectively). In contrast, adhesion to laminin was not affected. The ON 5044 (1 μM) used as control was inactive (Figure 15).

ECM proteins and preparation and reversal on glass objects.

Covers 13 mm glass objects were cleaned by washing with 70% ethanol. The objects covered were coated with 250 2 μl of protein solution (10 μg / ml in sterile PBS) on a tissue culture plate at 4 ° C overnight. The residual protein binding sites were blocked by saturation with 1% BSA in PBS for 1 hour at 37 ° C. The coverslips were then washed 3 times in PBS and once in DMEM. The solutions were then replaced with 60% methanol, and the wells were incubated for 1 hour at 4 ° C. Methanol was removed by aspiration, and the wells were incubated with 100 μl of a buffer containing 50 mM tris-HCl (pH 7.8), 110 mM NaCl, 5 mM CaCl 2, 1% BSA and 0.1 mM phenylmethylsulfonyl fluoride during 30 minutes at room temperature. Finally, the wells were washed three times with DMEM supplemented with 0.2% BSA and immediately used for the experiment.

Adhesion test of the cells The MDA-MB231 cells were plated in 24-well multiple well plates and incubated with the ODN [sic] in the presence of lipofectamine for different times. At the end of the incubation, the wells were rinsed with PBS (3x) to remove the non-adherent cells. Each well was then treated with 20% methanol (10 minutes), and the cells were followed with 0.5% violet crystal in 20 methanol [sic] for 5 minutes before rinsing with distilled water and air drying for 15 minutes. The violet crystal was then solubilized with 100 μl of Na citrate. 0. 1 N in 50% ethanol and transferred to the 96-well microtiter plates and the absorbance, which was linearly proportional to the bound cells, was read spectrophotometrically at 540 nm.

Example 13. Apoptosis of MDA-MB231 cells. The DNA was decorated with bis-benzimide, a reagent that binds to the regions of adenine timida nucleic acid revealing their morphological appearance number of fragmented DNA bodies protruding from the different nuclei treated ON 5543 cells were identified; these fragments were very few or totally absent in the cells treated with On sense and with decoupling control. To confirm apoptosis with a specific method that reveals the fragmentation of the NA at the early stage, I applied TUNNEL staining. TUNNEL nucleic acid staining [sic] was found in most cells treated with ON 5543 antisense (data not shown). In contrast, cultures treated with ON control, sense and with decoupling showed staining in only a small proportion of the cells, possibly revealing the "physiological" rate of programmed cell death in this line of cells in our culture conditions.

It is known that apoptosis is activated by intracellular signals that are specific to the cell type and extremely heterogeneous, therefore the profile of a panel of genes potentially involved in the intracellular signal for apoptosis was investigated. It is known that the MDA-MB231 cell line expresses a mutant form of pro-apoptotic factor p53 (22). The immunoassay revealed p53 in our cultures. However, the expression of the protein was unmodified after treatment with ON 5543 and control ON (Figure 16). Therefore, it was [sic] the cultures treated with ON control, sense and with decoupling, the p53 was distributed in the cytoplasm and in the nuclei of the MDA-MB231 cells. In contrast, in cultures treated with ON 5543, p53 was almost completely translocated nuclei. However, despite this, the profile of a series of genes (Bcl-2, Bax, p21WSF1 CLP1) whose expression can be modified by activated p53, remained unchanged by treatment with ON 5543 (Figure 17).

REFERENCES 1. Ruoslahti, E. and B. Obrin. 1996. Exp Cell Res. 227: 1-11. 2. Hu pi? Rie3, M.J. 1996. Curr. Opin. Cell Biol. 8: 632-640. 3. Meredith, J.E. Jr. and Schwartz, M.A 1997. Trends Cell Biol. 7: 146-150. 4. Suda, T., et al. 997. J. Bone Mm Res. 12869-879. 5. Váánanep, HX and M.A. Hortop. 1995. J. Cell Sd. 108: 2729-1732. 6. Váanapen, H.K. 1996 Osteodas! function: Biology and Mechárosme. In Principies of Bone Biology J P. Bilezikian, L G Raisz and G.A. Rodan editors, Academic Press, Condom. 103-13. 7. Ross, F.P., et al. 1993. J. Biol. Chem. 2689901-9907. to Davies. J., et al. 1989. J. Cell Bol. 109: 1817-1326. 9. Nßs iH, S., et al. 1993. J. Biol. Chem.268.16737-16745. 10. H? Mphries, M.J. 1990. J. Ce So. 97.585-592. 11. Yamada, K.M. 1991. J Biol. Chem. 266.12809-12812. 12. Bossy. B. and LF. Reichardt. 1990. ßiochemistry 29: 10191-10198. 13 Ho, P.T.C., and D.R. Parkinson. 1997. Semin. On8l. 24: 187-202. 14. Sharma, H.W. and R. Narayanan. 1995 Sfeassay 17: 1005-1063 15. Zon, G. 1995. Tox. LettS. 8283: 419-424. 16. Wagner, R.W. 1995. Nal. Med. 1: 1116-1118. 17 Stein, C A and Cheng, Y.C. 1993. Saence 261: 1004-1012. 18. Shakin, S.H. and SA Uebhaher. 1986. J. Biol. Chem. 261: 16018-16025 19. Uhlmann, E. and A Peyman. 1990. Chem. Rev.90: 543-584. 20. Schlingensiepen, R., ßt al 1997. Antisense - from technology to therapy (manual and textbook) Biaokwell Science Ex Lihris Vol.6. 21. DßBn, N.M., et al. 1994. J. Biol. Chem. 269: 16416-16424. 22. Bennett. C.F. Cell Adhesion Molecules MeeSng. NHLI, London. ' IBC UK copferencß-. 23. Rojanasakul, Y. 1996. Ádv Drug Delivery Rev. 18: 115-131. 24. Calbretta, B., et at. 1993 Cancar Treat. Rev 19: 69-179 Peyman A. and E. Uhlmann. 1996. Biof. Chem 377: 67-70. Horton, M.A., et ai. 985. Cancer Res 45: 5663-5669. Freed, E., et al. 1989. EMBO J. 8: 2955-2965. lyer, R P, et al. 1990. J. Am. Chem. Soc. 112: 1253-1254. Ojwapd, J.O., et al. 1997. Biachemistry 36: 6033-6045. Chambers, T. J., et al. 1984. J. Cel! Sd. 66: 383-389. Caselli, G.F., et al. 1997. J. Bone Min. Res. 12: 972-9B1. Tanatea, S "ßt al. 1996. Neture 383: 528-531. Prallet, R., P. ßt al. 1992. J. Bone Min. Res. 7: 405-414. Gavrieli, Y., et al. 1992. J. Cell Biol. 119493-501. Altschul, S.F., et a !. 1990. J. Mol. Biol. 215: 403-410. Suzuki, S .. et al. 1986. Proc. Natí. Acad. Sci. USA 83 861 -8618. Nip J., et al. 1995. J. Clin. Invest. 95: 2095-2103. Horton, M A 1997 Int. J. Biochem. Cell ßo /. 29: 721-725. Rodan, S.B. and Rodßn, G A 1997. J. Endocrine !. 154: S47-S56. Fianagan, W.M., 1996. Nature Biotech. 14: 1139-1145. Wagner, R.W. 1994. Nature, 372: 333-335. Khaled, Z., et ak, 1989 Nuc. Acid Res. 24: 737-645. Stein, C.A. 1995. Nature Med. 1: 1119-1121. Laitala, T. and H.K. Vananen 1994. J. Clin. Invest 93: 2311-2318. Laitala-Lßinonen, et al. 1996. Mo !. Biol. Cell 7: 129-142. Udaga a, N .. et al. 1996. Bone, 18: 511-516. Inui, T .. O. et al. 1997. J. Biol. Chem.272: 8109-8112. Lakkaka i, P.T., et al. 1991. J. Celt Bio !. 115: 1179-1186. Hale A. J., et al. 1996. Eur. J. Biochem. 236: 1-26. White, E. 1996. Genes Devetop. 10: 1-15 Brooks, P.O. et a !. 1994. Sdence 264: 569-571. Brooks, P.C., ßt al. 1994. Cell 79: 1 57-1164 Harper. i W.,? t al. 1993. Cell 75: 805-816. Strdmblad, S., et al. 1996. J. Clin. Invest. 98: 426-433. Deng. C, et al. 1995. Cell 82: 675-684.

McDonald, E.R. et at. 1996. Cancer Res. 56.2250-2255. Boudreau, N_, et al 1996. Proc. Nati Acad. Sci USA. 93: 3509-3513. Wu, R.-C and Schontal, A.H. 1997. J. Biol Chem. 271: 29091-29098. Mundy G.R. Horm. MetaW Res, 29: 120-127, 197, Harvey. H A. Cancer, 80: 646-1651, 997. Clezardin, P. Ceil Mol Life Sci 54 541-548, 1998. Hynés, R.O. Ceil 48: 549-554, 1987. Green, L.J., et al. Int. J. Biochem. Cell Biol., SS: 179-184, 1998. Hynes, R.O. Cell, 69: 1-25, 1992 Meredit, J.E., et al. Endocrine Rev. 17: 207-220, 996. Meyer. T, et ai. Br.J. Cancer 77: 530-536. 1998. Marshall, J.F., et al Cancer Bicrt. 7: 129-138, 1996. Marshall, J.F., et al. tnt J. Cancer, 49: 924-931. 1991. Gehisen, KR., Et al. Clin. Exp. Metastasis, 10: 111-120, 1992. Fattman, C.L, et al. Cancer Lett. 130: 103-113, 1998. Horton, M.A. Int. J. ßioe em. Cell Biol. 29: 721-725, 1997. Duopg, L.T., Rodan, G.A Front. Biosci. 3: D757-D768, 1998. Stein, C.A. Antisense Nucleic Acid Drug. dev. 7201-209, 1997. Brooks, P C, et al. Cell, 79: 157-1164, 994. Stre blad, S., et al. J. Clin. Invest. 98: 426-433, 1996. Brooks, PC, et al. J. Clin. Invest.96: 1815-1822, 1995. illanova. I., et al. J. Bone Min. Res., S? Bmitted. Hale A. J., et al. Eur. J. Biochem. 236: 1-26. 1996. evkau, B., et al. Mol. Cell, 1: 553-563. 1998. Carrón, C.P., et al. Cancer Res. 58: 1930-1935, 1998. Horton, M. Int. J. Exp. Pathol. 71: 741-759, 1990.

LEGENDS OF THE FIGURES Figure 1. The av sites and sequences of ON 5543 ("5543") and the rabbit av start site sequence. (A) The sequence of the human av nucleotide site is shown with ON 5543 av included below the sequence. All the information of the sequences is shown in its 5 'to 3' direction with the positions of the sequences marked as shown in the EMBL database. The black arrow shows the Oligonucleotide initiator site used in the cloning by RT-PCR of the start site of the rabbit abon av translation. (B) The control of the PCR control showing the products when the av primers are used. (c) Rabbit av initiation site RT-PCR from a combination of total baseline and bone marrow RN, compared to a control, positive human av cDNA. Each sample was reamplified using nested primers (hence the double products in each line). (D) The rabbit start sequence is shown with ON 5543 av sequences and double underscore. A base that is different between the rabbit and av human cDNA with a T substituting a C at position 83 (due to the degeneracy of the primer with a Y in this position).

Figure 2. Uptake of 5543 av-FITC in rabbit osteoclasts. The rabbit osteoclasts isolated ex vivo were established in glass coated with serum and incubated with antisense ON 5543 av labeled with FITC at 1 μM for 24 hours. (A) top view of a multinucleated osteoclasts showing distribution of the antisense 5543-FITC NO for granular structures within the cytoplasm; Note that the nuclei are negative. (B) side view of an osteoclast taken through the section plane indicated by the arrow (A), showing granular distribution of the antisense and absence in nuclei (glass on which the osteoclast is adherent is shown by the dotted line) . Similar results were seen with osteoclasts in dentin (not shown). Amplification X 2000.

Figure 3. Av antisense AV reduce the expression of av protein. The fraction of the adherent cells of rabbit bone marrow were cultured for 10 days with 1,25-dihydroxy vitamin D3 10 nM [sic] p differentiate a large number of osteoclasts positive for TRAP. The cultures were then treated with 1 nM antisense av and control for 24 hours, lysates, subjected to SDS-PAGE (30 μg of the regular protein) of immunoassays with antibodies recognizing the integrin av and β3 subunits, and actin. The primary antibodies were diluted 1: 250. The secondary antibodies were diluted 1: 5000. The level of the previous av protein of gel was quantified by densitrometric analysis, normalized against actin and expressed in arbitrary units as percent with respect to the control.

Figure 4. The antisense av 5543 inhibits the adhesion and resorption of the osteoclasts. ON av was added to the osteoclasts of rabbits established on glass coated with serum (A) or pieces of dentin (B) in increasing concentrations (5 x 10"13 to 100 μM) .The cells were challenged for 24 hours, before TRAP and / or well staining, n = 8; ± SEM O adhesion to glass coated with serum, • adhesion to dentin pieces, G resorption,? Nothing; *, p <0.05; ** p < 0.01; * ** p < 0.001; **** p < 0.0005.

Figure 5. The binding of anti-sense ON av 5543 to dentin. (A) On antisense av bound to FITC bound to dentin in Increasing concentrations were assessed with time lasting 30 minutes up to 24 hours. (B) Presents the residual fluorescence within the medium at the beginning (0 hours) and the end point (24 hours). n = 6; ± S.E.M. arbitrary fluorescence units plotted against time U nothing, D 0.2 μM, • 2 μM, OR 20 μM.

Figure 6. Comparison of av 5543 antisense ONs and control over the function of rabbit osteoclasts. The studies were carried out using the antisense AV and three controls of relevant specificity. The antisense, disjoint, inverted and sense NOs were incubated with osteoclasts ex vivo (0.2 to 20 μM) for 24 hours. (A) adhesion to glass coated with serum (% glass adhesion vs. ON concentration [μM]). (B) adhesion to dentin discs. (C) resorption. • antisense, or decoupling, inverted U, D sense,? nothing, n = 3; ± S.E.M. p < 0.001 (% adhesion to bone vs. ON concentration [μM]). (C) percent resorption vs. Oligonucleotide concentration [μM].

Figure 7. Effect of antisense ON av 5543 on osteoclasts differentiated in vitro.

The fraction of the adherent cells of the rabbit bone marrow was cultured for 10 days with 10 mM of 1, 25-dihydroxy vitamin D3 and 1 mM of the Indicated ONs. At the end of the incubation, the cells were stained for the TRAP enzyme and the number of mononuclear cells (MNC) positavas p TRAP (A) and multinucleated (B) (PNC) were counted and expressed as a percent rate against untreated cultures . A sense ON, antisense. ON sense, sense; ON uncoupling, decoupling, n = 3; ± SEM, *** p < loX Figure 8. Dose-response effects of the av-5543 antisense ON in ex vivo rabbit osteoclasts adhered to different proteins of the extracellular matrix. Parallel studies were performed with the sense control ON (in this case shown in the concentration 20 μM only). The cultures were treated for 24 hours after the binding on the glass coated with indicated substrate protein. (A) FBS; fetal bovine serum (B), Vn, vitronectin. (C) Fb, fibrinogen, (D) Fn, fibronectin, (E) fibrillar collagen. (F) the table shows the comparison between the effect of neutralizing antibody avß3 23C6 and ON 5543 av. In parentheses the percent variation vs. Nothing. A / s ON antisense (from the left O μM, 0.2 μM, 20 μM). S, ON direction (20 μM). n = 3; ± SEM *, p < 0.05; ** p < 0.001; ***, p < 0.001.

Figure 9. Effect of ant onense 5543 av on the morphology of osteoclasts and apoptosis. The ex vivo rabbit osteoclasts were incubated with the ONs in place for 24 hours. (A-D) Phase contrast micrographs. The arrow indicates a retracted osteoclast. Amplification X 1400. (E-H) Nuclear staining with bisbenzimide. The arrow indicates apoptotic bodies. Amplification X-1400. (I-L) TUNNEL staining of fragmented DNA. X700 amplification. A, E, I: control (c). B, F, J: ON direction (s). C, G, K: ON with decoupling (m). D, H, L: ON antisense (a / s).

Figure 10. The antisense ON 5543 av stimulates the immunoreactivity p2? WAF1 CIP1. The untreated ex vivo rabbit osteoclasts (A) and the osteoclasts incubated for 48 hours with 1 mM of (B) the ON (B) sense, (C) decoupling (D, E) antisense were fixed by immunofluorescent staining with an antibody recognizing the p21 ™ F1 CIP1 protein. The arrows indicate the osteoclasts positive for p2lWAF1 OIP1. X100 amplification. (F) the The number of immunoreactive mononuclear cells P21w present in at least 5 random microscopic fields (20X objective) were counted in control and antisense treated cultures (a 'sense), sense and decoupling (ism), and the percentage of total positive cells was calculated. N = 3 ± SEM *** p < 0.0001.

Figure 11. Expression of the bcl-2 and bax genes The cells of the osteoclast lineage were obtained as described in figure 3 and treated with 1 mM of the antisense av and conrol NO for 48 hours. The cells were then used and subjected to analysis of the bcl-2 and bax protein levels by western blot analysis as described in the methods. Protein levels of bcl-2 and bax were then quantified by densitometry with normalization against actin expression. The bars represent the relative ratio mediated by densitometric analysis and not the absolute molar ratio. C: control, s: ON sense, ON with decoupling, a / s: ON antisense.

Figure 12. Analysis of av integrin expression in MDA-MB231 cells. Monolayers MDA-MB231 cell 90% confluent were treated for 72 hours with ON 5543 1 μM. (A) RT-PCR 0.1 μg of RNA was reverse transcribed and the reactions of the PCR were run with the pairs of primers av and β-actin. The semi-quantitative assays β-actin. For the semiquantitative tests, densitometric analysis was performed and each value was converted as present of the av / β-actin ratio of the cells treated with ON 5543 against the control cells. The experiment was repeated 3 times with similar results.

(B) Immunoassay. 15 μg of protein were subjected to SDS-PAGE (7.5%) acrylamide gel under non-reducing condition and transferred to a Hybond nitrocellulose membrane. The filter was incubated with primary antibodies (diluted 1: 200) overnight at 4 ° C, and secondary antibodies conjugated with HRP (diluted 1: 5000) for 1 hour at 37 ° C. Bands were detected by ECL and analyzed by densitrometry, the results are expressed as a percentage of the av / β-actin ratio of the cells treated with ON 5543 against the control. Similar results were observed in 3 independent experiments.

Figure 13. Dependence-dependent inhibition of the adhesion of MDA-MD231 cells to the substrate. MDA-MD231 cells cultured in DMEM with ON 5543 at indicated concentrations on the abscissa. The incubation proceeded for 72 hours, then the cultures were fixed, extensively washed to remove float cells and the nuclei were stained with crystal violet. The staining, which was supposed to be proportional to the number of adherent cells, was then solubilized and the intensity of color was measured by spectrophotometry as described in the examples. The data is expressed as a percentage against control. Average ± SEM n = 3, p < 0.003. 1 = ON 5543; 2 = ON 5543; 3 = ON 5044; 4 = = N5545.

Figure 14. Time-dependent inhibition of MDA-MB231 cell adhesion. The MDA-MB231 cells were cultured in DMEM containing 1 μM of ON 5543.1a incubation proceeded for the indicated times on the abscissa, then the cells were fixed and the adhesion was measured as described in figure 13. The data are average + SEM of percent against control, n = 3, p < 0.003. 1 = control; 2 = ON 5543; 3 = ON 5044; 4 = ON 5045.

Figure 15. Effect of the ON5543 antisense av on the adhesion of the MDA-MD231 cells to the ECM substrates (% vs. Control). The MDA-MB231 cells were plated in wells coated with fibronectin (I), fibrinogen (II), vitronectin (II) and laminin (IV) and incubated for 72 hours in DMEM without serum containing 0.2% BSA with 0.001, 0.1 and μM ON 5543 or one μM ON5044. The cells were then fixed and the adhesion was measured as described in Figure 13. The data are expressed as a percentage against the control. Average + SEM. n = 3, p < 0.0001; 1 = control; 2 = ON 5543 (0.01 μM) 3 = ON 5543 (0.1 μM); 4 = ON 5543 (1 μM); 5 = ON 5044 (1 μM).

Figure 16. Analysis of the expression and distribution of p53 Monolayers of confluent 90% MDA-MB231 cells were treated for 72 hours with ON 5543 1 μM. (A) Immunoassay. 40 μg of protein were subjected to SDS-PAGE (15% acrylamide gel) under non-reducing conditions and transferred to Hybond nitrocellulose membrane. Membranes were incubated with primary antibodies (diluted 1: 200) overnight) at 4 ° C and secondary antibodies conjugated with secondary HRP (diluted: 1: 5000) for 1 hour at 37 ° C. The bands were detected by ECL. (B) Immunofluorescence The cells were fixed, immunostained with anti-p53 antibody and observed by traditional epifluorescence microscopy. (a) control without ON; (b) ON 5044; (c) ON5045; (d) ON 5543. 300X amplification. note the cytosolic and nuclear distribution of p53 in (a), (b) and (c), and nuclear staining only in (d).

Figure 17. Immunoassay of genes potentially involved in apoptosis. Monolayers of 90% confluent MDA-MB231 cells were treated for 72 hours with 1 μM ON5543. 80 μg of the protein were subjected to SDS-PAGE (15% acrylamide) under non-reducing conditions and transferred to Hybon nitrocellulose membranes. The filters were then probed with anti-bcl2 antibodies to -bax, -p21, and β-actin (internal control). Membranes were incubated with primary antibodies (dilution: 1: 2000 overnight at 4 ° C, and secondary antibodies conjugated with secondary HRP (1: 5000 dilution for 1 hour at 37 ° C.) Bands were detected by ECL.

LIST OF SEQUENCES ( 1. GENERAL INFORMATION (i) APPLICANT: (A) NAME: Hoechst Marion Roussel Deutscheland GmbH (B) STREET: - (C) CITY: Frankfurt (D) STATE: - (E) COUNTRY: Germany (F) ZIP CODE: 65926 ( G) TELEPHONE: 069-305-7072 (H) TELEFAX: 069-35-7175 (I) TELEX: - (ii) TITLE OF THE INVENTION: OLIGONUCLEOTIDES ANTI-SENTIMENT FOR THE INHIBITION OF THE EXPRESSION OF THE SUB-UNIT INTEGRINA (iii) SEQUENCE NUMBER: 14 (iv): LEGIBLE COMPUTATION FORM: (A) TYPE OF MEDIUM: flexible disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Reléase # 1.0, version # 1.25 (EPO) (2) INFORMATION OF SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 540 base pairs (B) TYPE: nucleic acid (C) HEBRA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..540 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: GGCTACCGCT CCCGGCTTGG CGTCCCGCGC GCACTTCGGC GATGGCTTTT CCGCCGCGGC 60 GACGGCTGCG CCTCGGTCCC CGCGGCCTCC CGCTTCTTCT CTCGGGACTC CTGCTACCTC 120 TßtGCCGCGC CTTCAACCTA GACGTGGACA GTCCTGCCGA GTACTCTGGC CCCGAGGGAA 180 GTTACTTCGG CTTCGCCGTG GATTTCTTCG TGCCCAGCGC GTCTTCCCGG ATGTTTCTTC 2 0 GGCTACCGCT CCCGGCTTGG CGTCCCGCGC GCACTTCGGC GATGGCTTTT CCGCCGCGGC 300 CCGATGGCGA GGGCCGAACC GCAGGGCGCG CGTGMGCCG CTACCGAAAA GGCGGCGCCG 360 (2) INFORMATION OF SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA to mRNA (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..24 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: CGGCGATGGC TTTTCCGCCG CGC 24 (2) INFORMATION OF SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA to mRNA ^^ Üj ^^ j ^ (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..26 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: GTGCCGCGCC TTCAACCTAG ACGTGG 26 (2) INFORMATION OF SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..20 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: CGGAAAAGCC ATCGCCGAAG 20 (2) INFORMATION OF SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..18 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: GCCATCGCCG AAGTGCGC 16 (2) INFORMATION OF SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA- "(genomic) (iv) ANTI-SENSE: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..18 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: GCGGCGGAAA AGCCATCG 18 (2) INFORMATION OF SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..18 s ^ a &aa * ^ '- "- (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: GCAACGAGAG AGCCGTCG 1E (2) INFORMATION OF SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..17 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: CGTCTAGGTT GAAGGCG 17 (2) INFORMATION OF SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (il) TYPE OF MOLECULE: DNA (genomic) (ív) ANTISENTIDO: yes (IX) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..18 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: GCCCGGGAGC AGCCATCG 18 (2) INFORMATION OF SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..18 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10: GCTACCGAAA AGGCGGCG 16 (2) INFORMATION OF SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..18 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11: CGATGGCTTT TCCGCCGC 18 (2) INFORMATION OF SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..17 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12: CGTCCAGGTT GAAGGCG 17 (2) INFORMATION OF SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTI-SENSE: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..17 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13: CGTCCAGGTT GAAGGCG 17 (2) INFORMATION OF SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iv) ANTICIPATION: yes (ix) PECULIARITY: (A) NAME / KEY: exon (B) LOCATION: 1..17 , ~ - -4. ¿Í »" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: GCAGGTCCAA CTTCCGC 17

Claims (31)

1. An antisense oligonucleotide or derivative thereof which: a) has a sequence corresponding to a part of a nucleic acid encoding p av integrin, and b) induces apoptosis in a cell containing av integrin mRNA, when contacted with the cell.

2. The antisense oligonucleotide or a derivative thereof as claimed in claim 1, which, when contacted with a cell modulates the expression of at least one protein that is involved in a signal transduction pathway that induces apoptosis.

3. The antisense oligonucleotide, or a derivative thereof, as claimed in one or more of claims 1 or 2 which induces an increase in the expression of p21.

4. The antisense oligonucleotide, or a derivative thereof, as claimed in one or more of claims 1 or 3 which induces a reduction in the expression of bcl-2.

5. The antisense oligonucleotide, or a derivative thereof, as claimed in one or more of claims 1 or 4 which, when contacted with a cell induces inhibition of cell adhesion.

6. The antisense oligonucleotide, or a derivative thereof, as claimed in one or more of claims 1 or 5 which, when contacted with an osteoclast cell induces an inhibition of bone resorption.

7. The antisense oligonucleotide, or a derivative thereof, as claimed in one or more of claims 1 or 2 which, when contacted with a cell induces p23 translocation from the cytosol to the nucleus of this cell.

8. An antisense oligonucleotide or a derivative thereof, which a) has a sequence corresponding to a part of a nucleic acid encoding an av integrin, and b) which when contacted with a cell inhibits the adhesion of this cell to substrates specific.

9. The antisense oligonucleotide, or derivative thereof, as claimed in claim 8, wherein the substrate comprises at least one protein belonging to the group of proteins of the extracellular matrix.

The antisense oligonucleotide, or derivative thereof, as claimed in one or more of claims 8 and 9, wherein the substrate comprises serum proteins, bone sections, vitronectin, fibrinogen and / or fibronectin.

The antisense oligonucleotide, or derivative thereof, as claimed in one or more of claims 8 and 10, wherein the part of the nucleic acid has a length of 8 to 26 nucleotides.

The antisense oligonucleotide, or derivative thereof, as claimed in one or more of claims 8 and 11, wherein the nucleic acid is human av integrin DNA.

The antisense oligonucleotide, or derivative thereof, as claimed in one or more of claims 8 and 13, wherein part of the nucleic acid comprises the initiation codon of the translation and / or is located within the coding region.

The antisense oligonucleotide or derivative thereof having or comprising one of the sequences SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 ID NO. 7, SEQ ID NO. 8th SEC ID NO. 12 or a part thereof, wherein: SEQ ID NO: 4 is 3 '-GAAGCCGCTACCGAAAAGGC-5 SEQ ID NO: 5 eS 3' -CGCGTGAAGCCGCTACCG-5 SEQ ID NO: 6 eS 3 '-GCTACCGAAAAGGCGGCG-5' SEQ ID NO : 7 eS 3 '-GCTGCCGAGAGAGCAACG-5' SEQ ID NO: 8 eS 3 '-GCGGAAGTTGGATCTGC-5' and SEQ ID NO: 9 eS 3 '-GCGGAAGTTGGACCTGC-5'

15. The antisense oligonucleotide or derivative thereof as claimed in one or more of claims 8 and 14, which has one or more chemical modifications.

16. The antisense oligonucleotide or derivative thereof as claimed in one or more of claims 8 and 15 wherein 1-5 nucleotides at the 3 '/ or 5' end and at least one non-terminal pyrimidine nucleoside and / or a phosphodiester bridge located at the 3 'and / or 5' end of this nucleoside pyrimidine are modified.

17. The antisense oligonucleotide or derivative thereof as claimed in one or more of claims 8 and 16, wherein each modification is independently selected from: a) the replacement of a phosphoric diester bridge located at the 3 'and / or 5' end of a nucleoside by a modified phosphodiester bridge. b) the replacement of a diethodic diester bridge located at the 3 'and / or 5' end of a nucleoside, by a defosfo bridge. C the replacement of a sugar phosphate molecule from the main chain of the sugar phosphate by another molecule. d) replacement of a β-D-2 'deoxyribose with a modified sugar radical. e) replacement of a natural nucleoside base with a modified base. 10 f) the conjugation of the oligonucleotide to a molecule that influences the properties of the oligonucleotide, and g) the introduction of a 3 '-3' and / or 5 '-5' inversion at the 3 'and / or 5' end of the oligonucleotide .

18. A process for the preparation of an oligonucleotide as claimed in one or more of claims 1 to 17, by condensing the suitably protected monomers on a solid support.

19. An agent for selectively removing cells expressing av integrin.

20. An anti-adhesive agent to selectively inhibit the adhesion of cells expressing av integrin. 25 isús? ik '.-

A method for inhibiting av integrin expression, wherein an antisense oligonucleotide or a derivative thereof is prepared, with one of the sequences SEQ ID NO: 4 to SEQ ID NO: 8 or SEQ ID NO: 12 and hybrid to mRNA of integrin av.

A method for inhibiting the adhesion of a cell to a particular substrate, wherein an antisense oligonucleotide or a derivative thereof is prepared, which has a sequence corresponding to a part of a nucleic acid encoding av integrin, and is contact with this cell, wherein the antisense oligonucleotide or derivative thereof hybridizes to av integrin mRNA, and thereby inhibits the expression of av integrin to some degree.

A method for removing av-integrin expressing cells, wherein an antisense oligonucleotide or a derivative thereof is prepared, with a sequence corresponding to a part of a nucleic acid encoding av-integrin, and contacted with the cell, with which the antisense oligonucleotide hybridizes to av integrin mRNA, thereby inhibiting the expression of av integrin to some extent.

24. A method, as claimed in claims 21 to 23, wherein the cell is a tumor cell or an osteoclastic cell.

25. A method for modulating the expression or activity of a protein involved in at least one of the signal transduction pathways for inducing apoptosis, wherein an antisense oligonucleotide or a derivative thereof is made, with a sequence corresponding to a part of a nucleic acid encoding av-integrin, and contacted with a cell, whereby the antisense oligonucleotide or a derivative thereof hybrid to av-integrin mRNA and thereby inhibits the expression of av-mtegrin to a certain extent.

26. The use of the antisense oligonucleotide or a derivative thereof, as claimed in one or more of claims 1 to 17 for the preparation of a pharmaceutical composition for treating diseases associated with the expression of an increased expression of av integrin.

27. A method for preparing a pharmaceutical composition, which is to mix at least one antisense oligonucleotide or a derivative thereof as claimed in a or more of claims 1 to 17, with a physiologically acceptable excipient and, if appropriate, suitable additives and / or auxiliaries.

A pharmaceutical composition containing at least one oligonucleotide as claimed in one or more of claims 1 to 17, and if one or more physiologically acceptable excipients and suitable additives and / or auxiliaries are suitable.

The pharmaceutical composition, as claimed in claim 28 for the treatment and / or prevention of diseases associated with normal cell proliferation. Cell migration, cell differentiation, angiogenesis, retinal neurite excrescence, bone resorption, phagocytosis, immune response, signal transduction and metastasis of neoplastic cells.

The pharmaceutical composition, as claimed in one or more of claims 28 and 29, for the treatment and prevention of cancer and cancer metastasis, the treatment and prevention of osteoporosis, the treatment of eye diseases, chronic inflammation, psoriasis, restenosis and the support for wound healing.

31. A method for identifying cells, which express or over-express av integrin, wherein: (a) an oligonucleotide or a derivative thereof, as claimed in one or more of claims 1 to 17 is synthesized and contacted with a cell or a probe of a cell, and (b) the detection is analyzed [sic] if the antisense oligonucleotide or a derivative thereof has hybridized to av integrin mRNA. A test kit or a diagnostic reagent for identifying cells expressing or expressing av integrin, which contains: a) an oligonucleotide, or a derivative thereof, with a sequence corresponding to a part of a nucleic acid encoding for integrin av, and b) a reagent for detecting whether the oligonucleotide or a derivative thereof has hybridized to av integrin mRNA.