MXPA00009315A - Inflammatory mediator antagonists - Google Patents

Abstract

The present invention relates to the use of an antagonist of OSM such as an antibody or small molecule in the manufacture of a medicament for the treatment or prophylaxis of an inflammatory arthropathy or inflammatory disorder, and the use of OSM in screening for such antagonists.

Description

Inflammatory Mediator Antagonists Background of the Invention The present invention relates to the use of an OSM antagonist in the manufacture of a medicament for the treatment or prophylaxis of an inflammatory arthropathy or inflammatory disorder and methods of screening for these antagonists.

Background of the Invention Rheumatoid arthritis (RA) is a chronic inflammatory disease affecting the joint joints, characterized by synovial hyperplasia and extensive cellular infiltration of mononuclear cells and polyfunctional leukocytes (PMN). A complex, and probably the interaction between the resident and the infiltration of cell types is likely to cause the chronic secretion of metalloproteinases (MMPs), causing the destruction of articular cartilage, ligaments and subchondral bone (Firestein GS Current Opinion in Rheumatology. 4: 348-54, 1992). Among the numerous pro-inflammatory cytokines involved REF .: 122928 in triggering the pathology of RA in the conjuncture, TNFa has shown that plays a pivotal role, with anti-TNFa therapies that show clear benefit (Elliott MJ et al., Lancet 344 (8930): 1150- 10, 1994). TNFa mediates several pathological effects including the induction of MMPs (Dayer JM et al, Journal of Experimental Medicine, 162 (6): 2163-8, 1985), the regulation of other pro-inflammatory cytokines (Haworth C. et al. European Journal of Immunology 21 (10): 2575-9, 1991- and Dinarello CA. et al.Journal of Experimental Medicine 163 (6): 1433-50, 1986) and increased PMN adhesion and migration of transendothelial cells (Smart SJ.Casale TB American Journal of Physiology .266: L238-45, 1994). However, TNFα is seen as an initiator of the pro-inflammatory cytokine cascade, relatively little is known about its positive regulation (Feldmann M. Annual Review of Immunology 14: 397-440, 1996).

Oncostatin M (OSM) (Rose Tm, Bruce AG, PNAS USA 88 (19): 8641-5, 1991) is a 28 kDa glycoprotein corresponding to the family of cytokines comprising IL-6, IL-11, factor Leukemia inhibitor (LIF), cililiar neurotrophic factor (CNTF) and cardiot rofin 1 (CT-1) (Taga T. Kishimoto, T. Annual Review of Immunology, 15: 797-819, 1997). All members share a common signaling chain, gpl30, as part of a complex family of hetero- and homodimeric receptors (Grotzinger J. et al., [Article] Proteins, 27 (1): 96-109, 1997). OSM shares a common heterodimeric receptor with LIF, (LIFr: gpl30, type I) and also has its own unique receptor comprising the OSMrβ chain and gp 130 (type II) (Mosley B. et al. [Article] Journal of Biological Chemistry 27 (51): 32635-32643, 1996). OSM has been well known for its effects on cell growth and division (Horn D. et al. [Journal Article] Growth Factors 2 (2-3): 157-65, 1990).

Recently, OSM has shown that it has potent, pro-inflammatory properties in mice in vivo (Modur V. et al., J. Clin. Invest. 100: 158-168, 1997) and demonstrate the potent synergy with IL-1 for promote joint degradation in model systems, ex vivo (Cawston T. Biochemical &Biophysical Research Communications 215 (1): 377-85, 1995).

OSM induces a prolonged increase in P-selectin (and E-selectin) in endothelial cells (Yao L. et al, Journal of Experimental Medicine, 184 (1): 81-92, 1996), stimulates plasminogen primer activity of the urokinase type in fibroblasts (Hamilton J. et al Biochemical &Biophysical Research Communications 180 (2): 652-9, 1991) and is a potent inducer of IL-6 endothelial cells (Brown Tj. et al Journal of Immunology 147 (7): 2175-80, 1991 Oct. 1). OSM has recently been measured in RA but not OA in the synovial fluid (Hui W. et al, Annals of the Rheumatic Diseases, 56 (3): 184-187, 1997) and synovium, the production of this has been localized by macrophages (1997, Okamoto H et al., Arthritis and Rheumatism 40 (6): 1096-1105) and Cawston et al (1998, Arthritis and Rheumatism, 41 (10) 1760-1771). To date other experiments in this field have been speculatively based on the similarity of the members of the IL-6 subfamily (carroll G. et al., Inflamm. Res. 47 (1998) 1-7).

The present inventors have discovered that OSM has the ability to induce TNFα secretion in macrophages. Contrary to recent data suggesting that OSM regulates the production of the metalloproteinase-1 inhibitor in tissue (TIMP-1) (Nemoto et al 1996, A &R 39 (4), 560-566), with complexes and inactivates MMP-1 and therefore the decrease in collagen release is expected, the inventors discovered that OSM induces TNFa secretion, suggested by them. OSM can now play a role in the mediation of the destruction. of the cartilage. Based on this finding, the present inventors have shown that therapeutic administration of an anti-OSM neutralizing antibody without inhibition of the members of the IL-6 family can only alleviate collagen-induced arthritis in a model mouse. The synergy of OSM with TNFa promotes the release of cartilage collagen has subsequently been shown by T. Cawston et al (1998, Arthritis and Rheumatism, 41 (10) 1760-1771).

Brief Description of the Invention According to the present invention, therefore, the use of an OSM antagonist in the manufacture of a medicament for the treatment or prophylaxis of an inflammatory arthropathy or inflammatory disorder is provided. A particular use of an OSM antagonist in the manufacture of a medicament to prevent or reduce the release of cartilage collagen. The invention further provides a method for the treatment or prophylaxis of an inflammatory arthropathy or inflammatory disorder comprising administering an effective amount of an OSM antagonist to a patient suffering from a disorder.

The antagonist may function to block the OSM from interacting with the OSP receptor gpl30, or the other receptors, the OSMrβ or LIFr chain, or by blocking the formation of heterodimers of these proteins, and to prevent binding and signaling of OSM by of this reduce the synthesis of pro-inflammatory cytokines and / or MMPs. The antagonist according to the invention can therefore be a ligand for the OSM or one or more of the OSM receptors (gpl30, OSMrβ or LIFr) or an agent capable of interfering with these interactions in a manner that affects the biological activity of OSM. Hereinafter, the reference to an OSM antagonist can be taken as meaning of an antagonist for the same OSM or for one of its receptors.

The present invention also demonstrates that in the synovial vascular endothelium of rheumatoid arthritis, P and E-selectin co-localize gp-130, the signaling element of OSM receptors of type I and II. Without wishing to be bound by theory, this indicates that OSM, produced by macrophages, can stimulate the vascular endothelium of RA to facilitate the recruitment of leukocytes through the regulation of P and E-selectin. The discovery that ligation of L-selectin with specific antibody or fucoidan (L-selectin agonist) activates human mononuclear cells to secrete OSM may be slightly significant in terms of the amplification of the inflammatory response, by providing a local source additional OSM to activate TNFa and P and E-selectin.

The amino acid residues that are important for the interaction of OSM with the gpl30 have been identified. From the published OSM amino acid sequences (Malik et al., 1989, Mol. Cell. Biol., 9 (7), 2847-53, the entry of the M27288 DNA sequence into the EMBL database, the entry of the protein sequence P13725 is Swissprot) these- are -G120, Q16 and Q20; N124 can also represent a part (see SEQ ID 12 and later). The first 25 residues are a peptide signal, and the mature protein corresponds to the sequence AAIGS (SEQ ID 13). The sequence is numbered from the first amino acid of the mature protein as shown.

SEQ ID 12 1 5 15 25 35 MGVLLTORTL LSLVLALLFP SMASMAAIGS CSKEYRVLLG QLQKQTDLMQ DTSRLLDPYI 45 55 65 75 85 95 RIQGLOVPKL REHCRERPGA FPSEETLP.GL GRRGFLQTLN ATLGCVLKR ADLEQRLPKA 105 115 125 135 145 155 QDLSRSGLNI EDLEXLQMAR PNILGLRNNI YCMAQLLDNS DTAEPTKAGR GASQPPTPTP? 65 175 185 125 205 215 ASDAFQRKLE GCRF HGYHR FMHSVGRVFS KWG? SPNRSR RHSPHQ? LRK GVRRTRP < ? R '225 227 GKRLMT-RGQL PR The invention therefore further provides an antagonist or agent capable of interacting with one or more of the specific residues and / or the binding sites help to define OSM to alter the biological activity of OSM.

Inflammatory arthropathies that can be treated in accordance with this invention include rheumatoid arthritis, psoriatic arthritis, juvenile arthritis, inflammatory osteoarthritis and / or reactive arthritis. Inflammatory disorders that can be treated include, among others, Crohns disease, ulcerative colitis, gastritis such as gastritis resulting from infection with H. pylori, asthma, obstructive pulmonary disease, Alzheimer's disease, multiple sclerosis and psoriasis.

The potential antagonists of OSM include small organic molecules, ions that interact specifically with OSM for example a substrate possibly a natural substrate, a cell membrane component, a receptor of a natural ligand, a fragment of this or a peptide or other protein molecules, particularly preferred are a mutant form of OSM non-signaling which will block the OSM binding with the OSM receptor, but also modified OSM molecules. These antagonists can be in the form of DNA encoding the protein or peptide and can be delivered for the in vivo expression of the antagonist. The antagonists may be vaccines comprising the molecular proteins or peptides or DNA, designated to produce an antagonistic effect towards the OSM by means of the induction of the in vivo antibody responses labeled with the native OSM. These antagonists may include antibodies, reagents derived from antibodies or chimeric molecules. Included in the definition of antagonist is a structural mimicry. or functional of any molecule described above. Also contemplated are nucleic acid molecules such as DNA or RNA aptamers.

Preferred antagonists include organic molecules. These compounds can be of any class of compounds but will be selected on the basis of their ability to affect the biological activity of OSM however one of the mechanisms described above and will be physiologically acceptable for example non-toxic or demonstrating an acceptable level of toxicity or other side effects. One class of compounds that can provide useful antagonists are ribonucleosides such as N- (lH-pyrazolo [3,4-d] pyrmidin-4-yl) -benzamide); Davoll and Kerrige, J. Chem. Soc., 2589, 1961).

Other preferred antagonists include antibodies, fragments thereof or artificial constructs comprising antibodies or fragments thereof or artificial constructs designed to duplicate the binding of antibodies or fragments thereof. These constructions are discussed by (Dougall et al in Tibtech 12, 372-379) (1994).

Also included in the definition of antibody are recombinant antibodies such as recombinant human antibodies, which can be used. The antibodies can be altered eg these can be "chimeric" antibodies comprising the domains of the variable of a donor antibody and the constant domain of a human antibody (as described in the patent O86 / 01533) or these can be antibodies " Humanized "where only the CDRs are derived from a different species than the structure. of the variable domains of the antibodies (as set forth in EP-A-0239400). The regions that determine complementarity (CDRs) can be derived from a monoclonal rodent or primate antibody. The structure of the variable domains, and the constant domain, of the altered antibody are usually derived from the human antibody. A humanized antibody should not raise as much as the immune response when administered to a human compared to the immune response mounted by a human against the totally foreign antibody such as one derived from a rodent.

Preferred antagonists include whole antibodies, F (abf) 2 fragments, Fab fragments, Fv fragments, ScFv fragments, other fragments, CDR peptides and mimetics. These can be obtained / prepared by people with experience in the art. For example, enzyme digestion can be used to obtain the F (ab ') 2 and Fab fragments (by attaching an IgG molecule with pepsin or papain division respectively). Reference should be made to the "antibodies" in the following description to include all the possibilities mentioned above.

As will be appreciated by a person skilled in the art, where the specific protein or peptide antagonists are disclosed, derivatives of these antagonists can be used. The term "derivative" includes variants of the described antagonists, which have one or more amino acid substitutions, deletions or insertions relative to the antagonists, although they still have the bonding activity described. Preferably these derivatives have substantial amino acid sequences identical with the specific antagonists.

The degree of identity of the amino acid sequence can be calculated using a program such as "best fit" (Smith and Waterman, Advances in Aplied Mathematics, 482-489 (1981)) to find the best segment of similarity between any of the two sequences . Alignment is based on maximizing the record achieved using a matrix of amino acid similarities, as described by Schwartz and Dayhof (1979) Atlas of Protein Sequence and Structure, Dayhof, M.O., Ed pp 353-358.

Preferably the degree of identity of the sequence is at least 50% and more preferably it is at least 75%. Sequence identities are more preferred at least 90% or at least 95%. However, it will be appreciated by one skilled in the art that high degrees of sequence identity are not necessarily required since several amino acids can often be substituted by other amino acids having similar properties without substantially altering or adversely affecting certain properties of a protein. Sometimes referred to as "conservative" amino acid changes. Thus the amino acids glycine, valine, leucine, or isoleucine can often be substituted by another include: phenylalanine, tyrosine, and tryptophan (amino acids that have aromatics in the side chains); lysine, arginine and histidine (amino acids that have bases in the side chains); asparate and glutamate (amino acids that have acids in the side chains); asparagine and glutamine (amino acids that have amides in the side chains) and cysteine and methionine (amino acids that have sulfur in the side chains). Thus the term "derivative" may also include a variant of the amino acid sequence comprising one or more such as "conservative" changes relating to the sequence.

The present invention also includes fragments of the antagonists of the present invention or derivatives thereof which still have the desired binding activity. Preferred fragments are at least ten amino acids long, but these may be longer, (for example, with a length of up to 50 or up to 100 amino acids).

In addition, preferred OSM antagonists for use in the invention are oligonucleotide ligands. The systematic evolution of the ligands by exponential enrichment (SELEX) is a protocol in which immense libraries of single-stranded oligonucleotides are screened for the desired activity against a protein or other target molecule (Tuerk &Gold 1990 Science 249, 505-510, Green et al, 1991 Meths, Enzy ol., 2 75-86; Gold et al., 1995 Annu., Rev. Biochem., 64, 763-797; Uphof et al., 1996 Curr. Opin. Struct. Biol. 6, 281 -288). The product of this screening is a simple oligonucleotide sequence terminated in an aptamer with the desired activity, usually high binding affinity, with the target protein. The SELEX procedure is usually started with an RNA or DNA library consisting of some fortuitous oligonucleotide sequences 101-1015. In the completely randomized oligonucleotide library, each molecule will exhibit a unique tertiary structure that will be totally dependent on the nucleotide sequence of this molecule. Thus when screening against a target protein the binding affinity of the oligonucleotide for this protein will be determined by the fit between the shape of the oligonucleotide and epitopes in the target protein. As a consequence of starting from a library of immense diversity, it is usual to be able to identify sub-nM affinity parameters with the target protein with selectivity of the target protein with other proteins with homology of the entire structure (Tuerk &Gold 1990 supra, Green et al., 1991 supra, Uphof et al., 1996 supra). Using the SELEX methodology, the aptamers of RNA or DNA for 100 proteins and small molecules including dopamine (Mannironi et al., 1997 Biochemistry 36, 9726-9734), substance P (Nieuwlandt et al, 1995 biochemistry 34, 5651-5659), human neutrophil elastase (Bless et al., 1997 Current biol. 7, 877-880), Growth Factor Derivative of Platelets (PDGF) (Green et al, 1996 Biochemistry 35, 14413-14424), Vascular Endothelial Growth Factor (VEGF) (Green et al, 1995 Chem Biol. 2, 683-695), thrombin (Bock et al., 1992 Nature 355, 564-66) and L-selectin (0 'Connell et al., 1996 PNAS USA 93, 5883-5887).

Several aptamers have been shown to have biological activity, usually receptor antagonism or enzyme inhibitor, both in vi tro and in vi vi. For example RNA aptamers with high affinity and inhibitory activity for human neutrophil elastase (hNE) are generated by mixed SELEX (Bless et al., 1997 supra). Following the modification of SELEX to increase stability, the aptamer was tested in a rat model of lung inflammation (Bless et al., 1997 supra). In a second example, a DNA aptamer with 49 nucleotides long was generated for human L-selectin with an nM affinity of the protein (O 'Conell et al., 1996 supra). The aptamer selectively exhibited 600-double of L-selectin with E-selectin and 10,000-fold selectively for P-selectin. Intravenous injection of an inhibited aptamer formulation that signals human radiolabelled PBMC in the lymph nodes, but not in other organs, in a dose dependent manner (Hicke et al., 1996 J. Clin. Invest. 98.2688- 2692). In a third example, high affinity RNA parameters have been increased against human VEGF to investigate the role of VEGF in angiogenesis (Jellinek et al., 1994).

Biohemistry 33, 10450-10456; Green et al. , nineteen ninety five; Ruckman et al. , 1998. J. Biol. Chem. 273,20556-20567; Willis et al. , 1998 Bioconj. Chem. 9,573-582). A liposome formulation of the VEGF aptamer inhibits the proliferation of endothelial cells induced by VEGF in vitro and the increase of vesicular permeability and angiogenesis in vivo (Willis et al., 1998 supra). Therefore, an OSM oligonucleotide ligand or an OSM receptor (OSMR, LIFR, gpl30) is provided for the use of the invention.

To produce an aptamer for use in the invention as described above, OSM or a receptor must first be linked to the plates for screening. Alternative rounds of selection and amplification (eg, SELEX procedure) can then be developed according to Fitzwater and Polansky (Meths in Enzymol, 267-275-301) to generate RNA or DNA aptamers for human OSM. Typically these parameters are modified RNA aptamers while the RNA provides the greatest structural diversity and therefore the possibility of generating high affinity molecules. Following the generation of a high affinity aptamer, post-SELEX optimization protocols can be developed to increase the stability of the aptamer, to truncate the aptamer to a central sequence (typically the aptamers are lOOmer or shorter) that is more receptive with the synthesis of the solid phase by means of this is reduced the cost of the synthesis, and the development of the formulations for in vivo use.

In the first of these procedures the aptamer can be truncated to reduce the length of the molecule to a central sequence required for the activity. The short central sequence, often between 20 and 40 nucleotides long, will be cheaper and faster to synthesize and may have biocapacity to increase. The information regarding the composition of the central sequence can be obtained from the comparison of sequence homology. However, truncation experiments that usually involve synthesis generate the shortest aptamers sequentially up to a minimum sequence required for the activity. This usually removes the fixed sequences but there are numerous examples where the nucleotides within the fixed sequences have contributed to the affinity of the aptamer (Fitzwater and Polansky, 1996 supra).; Ruckman J. et al. , (1998) J. Biol. Chem. 273, 20556-20567, Green et al. , 1995 supra). Therefore the invention can provide aptamers that are truncated or extended versions of the selected aptamer or one that demonstrates greater than 70% sequence homology with the selected aptamer.

Following truncation, several base modification experiments can be developed to improve the stability of the aptamer for protection against ribonuclease cleavage. During SELEX it is not possible to include purified 2 'purine bases in the T7 polymerase used for transcription, and this modification will not be tolerated. Therefore, to increase the stability of the post-SELEX aptamer, it is usual to replace the purine bases within the aptamer with the 2'-modified purines. This modification is usually through the use of 2'-0-methyl purines although other modified purines can be used including 2 '-aminopurines or 2' -fluoropurines (Ruckman et al., 1998 supra; Green et al., 1995 supra). This has to be done sequentially so this modification, post-SELEX, can result in loss of affinity (Green et al., 1995 supra).

Following truncation and stabilization it is possible to generate very large quantities of a modified aptamer completely short that can be synthesized by chemical synthesis on a solid scale. Different molecules can be added to the 5 'end of an aptamer to facilitate the use of the aptamer or to formulate an aptamer for in vivo delivery. This includes a separate radical to help the formation of images (Hnatowich DJ (1996) QJ Nucí, Med. 40, 202-8), fluorescin to help molecular detection (Germán et al., 1998 Anal.Chem. 70, 4540-5.), A lipid group to help to insertion into a liposome (Willis et al., 1998 supra), or conjugation with a small molecule drug or peptide (Charlton J, et al., (1997b) Biochemistry 36, 3018-3026). Generally, the addition of a molecule to the 5 'end of an aptamer does not cause loss of affinity or specificity.

To improve the half-life in vivo, the aptamers have been modified through the addition of polyethylene glycol (PEG) molecules or through incorporation into liposomes. In both cases these modifications can cause a significant increase in the half-life in vivo. (Willis et al., 1998 supra).

In addition, aptamers with liposome formulations have been formulated with 20K and 40K PEGs to increase serum stability in vi vo. A DNA aptamer has been generated against L-selectin. To increase the stability in vi the PEG 20K ester was coupled with the aptamer through the N-terminal amine radical. It was shown that the PEG-conjugated aptamer blocks the L-selectin-dependent lymphocyte that changes in vi in mouse SCID (Hicke et al., 1996 supra). Therefore, a conjugate of an aptamer and a carrier molecule, for example PEG, is provided for use in this invention. In this embodiment, the aptamer and the vehicle will be linked, for example, through the N-terminal amine radical. Further provided is a formulation or composition for use in the invention comprising an aptamer and a delivery molecule for example a liposome. In this mode they may not be linked between the aptamer and the vehicle, the aptamer may simply be encapsulated, dispersed or distributed throughout the vehicle.

The aptamers isolated in this study can also be modified for use as diagnostic molecules to detect the presence of human OSM in serum, tissue or other ex vivo samples, or for the detection of human OSM throughout the body under study. for the formation of images in vi vo (Charlton J, et al., (1997) Chemistry and Biology 4, 809-816; Hnatowich, 1996 supra). Fluoroscein or other fluorescence detection groups can be added at the 5 'end of the aptamer molecule to aid in the detection of fluorescence for applications such as FACS (Sort Fluorescence Activated Cells) (Davis KA et al., ( 1996) Nuc Acids Res. 24, 702-6, Charlton et al., 1997 supra), ELONA assay (Enzyme Linked Oligonucleotide Assay) (Drolet DW, et a l. , (1996) Nature Biotech. 14, 1021-1025) and other diagnostic applications. The advent of peptides that perform chelation technetium-99m (Tc99m) separate, such as MAG3 (Fritzberg AR et al., J. Nuci Med. 1986: 27, 111-6) has greatly facilitated the use of a wide range of molecules (Kubo A. et al., (1998) Kaku Igaku 35, 909-28) and macromolecules (Taillefer R. et al., (1995) Eur. J. Nucí, Med. 22, 453-64), for the Imaging the presence of the white protein in vi vo (macromolecules (Palíla VR et al., (1999) Nucí, Med. 40, 352-60) .The images are visualized with the help of a? -camera and achieved in a variety of species from mouse to man.The recent modification of Tc99m chelators has allowed more efficient and stable labeling of molecules under medium conditions (Hnatowich DJ 1998 Nucí, Med 39, 56-64). the radiolabelling of single-stranded oligonucleotides has already been developed, the fate of these labeled unmodified oligonucleotides in vivo has been inve preliminarily stipulated (Hnatowich, 1996 supra).

Of course it will be appreciated that any antagonist based on peptide, protein or nucleic acid for use in this invention will preferably be in a purified form for example matter associated with a molecule in its natural state or as a result of being manufactured, notably the purity it is greater, 70% pure but more preferably greater than 80% or 90% pure.

The antagonists of the present invention may be used alone or in combination with immunosuppressive agents such as steroids (prednisone etc.) cyclophosphamide, cyclosporin A or an analogous purine (eg, methotrexate, 6-mercaptopurine, or the like), or antibodies such as an anti-i-lymphocyte antibody or more preferably with a tolerance, anti-autoimmune or anti-inflammatory inducing agent such as the CD4 + cell inhibitory agent for example, an anti-CD4 antibody (preferably a blocking or non-blocking antibody). depleted), and anti-CD8 antibody, an anti-CD23 antibody, a TNF antagonist for example, an anti-TNF antibody or TNF inhibitor for example, soluble TNF receptor or agent, such as NSAIDs or other cytokine inhibitors.

Suitable doses of an antagonist of the present invention will vary, depending on factors such as the disease or disorder to be treated, the route of administration and the age and weight of the individual to be treated and the nature of the antagonist. Without being associated with any particular dose, it is believed that for example for parenteral administration, a daily dose from 0.01 to 20 mg / kg of an antibody (or other large molecule) of the present invention (usually present as part of a pharmaceutical composition as indicated above) may be suitable for treating a typical adult. The most suitable dose may be 0.1 to 5 mg / kg, such as 0.1 to 2 mg / kg. A suitable unit dose will be 1-400 mg. Suitable doses of small organic molecules would be similar and suitable doses of oligonucleotide ligands would be for example 0.1-10 mg / kg.

The invention further provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and, as an active ingredient, an antagonist according to the invention and optionally other therapeutic agents as described above. The antagonists, and the pharmaceutical compositions of these of the invention are particularly useful for parenteral administration, for example, subcutaneously, intramuscularly or intravenously but depending on the nature of the antagonist other routes such as oral, inhalation, intranasal, may be more appropriate. topical, or intra articular.

Compositions of parenteral administration commonly comprise a solution of an antagonist or a cocktail of these dissolved in an acceptable carrier, preferably an aqueous carrier. A variety of aqueous vehicles can be used, for example, water, buffered water, 0.4% saline, 0.3% glycine and the like. These solutions are sterile and generally free of particulate matter. These compositions can be sterilized by conventional, well-known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required at the approximate physiological conditions such as pH adjustment and buffering agents, toxicity adjusting agents and the like, for example sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The concentration of the antibody or other antagonist in these formulations can vary widely, for example from less than about 0.5%, usually or at least about 1% up to as much as 15 to 20% by weight and will be selected primarily based on fluid volumes, the viscosities, etc., according to the particular mode of administration selected.

Thus, a typical pharmaceutical composition of intramuscular injection could be made until it contains 1 ml of sterile, buffered water, and 50 mg of antagonist. A typical composition for intravenous infusion could be made up to contain 250 ml of the sterile Ringer's solution, and 150 mg of antibody or other antagonist according to the invention. Current methods for preparing parenterally prepared compositions will be known or apparent to those of ordinary skill in the art and are described in greater detail, for example, Remington Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pennsylvania (1980). ). Suitable formulations of nucleic acid antagonist are discussed above.

Antagonists of the protein of this invention such as antibodies that can be lyophilized for storage and reconstitute a suitable vehicle prior to use. This technique has been shown to be effective with conventional immunoglobulins. Any suitable lyophilization and reconstitution techniques can be employed. It will be appreciated by persons skilled in the art that lyophilization and reconstitution can cause the variation of degrees of antibody activity loss (eg, conventional immunoglobulins, IgM antibodies tend to have greater activity loss than IgG antibodies) and that they use levels that they may have to adjust to compensate Simple or multiple administrations of compensations can be performed with levels and patterns of dose selected by the physician's treatment. In any case, the pharmaceutical formulations must provide an amount of the antibody or other antagonist of this invention sufficient to effectively treat the patient.

The present invention includes within the scope an assay for determining whether or not a particular agent that binds to the OSM may be useful in the treatment of an inflammatory disease. The invention therefore comprises an assay for the identification of OSM antagonists comprising combining OSM with the test agent and determining whether or not the agent is capable of blocking the interaction between OSM and the OSM receptor or affecting full differential labeling of the biological activity of OSM of the marker molecule.

To select an antagonist for the use of the invention as described above OSM, the key to bind OSM residues as described above present as a vehicle or in a manner wherein the binding sites are defined ("OSM link radical") , or a first OSM receiver must be obtained. The human OSM encoding the cDNA can be generated synthetically, based on the EMBL sequence (expansion number M27288), cloned into the appropriate expression vehicle and used to transform an appropriate host such as the E. coli OSM protein. in Human is then purified from the culture medium and linked to the screening plates.

OSM, an OSM binding moiety and / or OSM receptor can be used to evaluate the binding of substrates of small molecules and ligands, for example, in cells, cell-free preparations, chemical libraries and mixtures of natural product. The invention therefore provides an assay for the identification of an OSM antagonist comprising contacting OSM with a test agent and measuring the binding. These substrates and ligands may be substrates and natural ligands may be structural or mimetic functional. These molecules are included in the definition of OSM antagonists. The screening method can involve high processing at a given time. For example, to screen the antagonists, a synthetic reaction mixture, cellular compartment, such as membrane, cell envelope, or cell wall, or a preparation of any of these, can be prepared from a cell expressing the OSM receptor. The preparation is then incubated with labeled OSM in the absence or presence of the candidate molecule. The ability of the candidate molecule to bind to the OSM receptor is reflected by the decreased binding of the labeled OSM. Molecules that link freely, for example, without including the functional effects of OSM are probably better antagonists. This assay can be returned and the labeled OSM receiver can be used with non-labeled OSM. Another subsequent screening with an ELISA format can be used to identify OSM antagonists where the ability of a candidate molecule is measured to prevent binding of a conjugated OSM receptor such as the gpl30-Fc fusion protein with the OSM immobilized on the plate, in this assay the gp-130-Fc bond is detected by the labeled anti-Fc antibody and the colorimetric assay.

The functional effects of potential antagonists can be measured, for example, by determining the activity of a reporter system following the interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of OSM or the molecules that They get the same effects in OSM. Reporter systems that may be useful in this regard include but are not limited to substrate colorimetric labeling converted to product, a reporter gene that is responsible for changing the functional activity of the OSM receptor, and binding assays known in the art.

Brief Description of the Figures. Figure: ELISA shows the ex vivo secretion of Oncostatin M by means of synovial biopsy cultures.

Figure Ib: Spontaneous ex vivo secretion of Oncostatin M by inflamed but not non-inflamed synovial cultures. Figure 2: The effect of rhOSM on the production of TNF alpha by THP-1 cells differentiated with PMA. Figure 3a and 3b The synergistic effect of OSM with TNFa to promote the release of ex vivo collagen. Figure 4a The measured secretion of anti-i-L-OSM selection antibody. Figure 4b OSM secretion induced by Fucoidan. Figure 5a-d Photomicrography demonstrates staining of vascular endothelial RA using gp-130 P and E selection antibodies. Figure 6 The OSM of the messenger RNA in conjunction with the control & ClI-arthritic mouse. Figure 7 Mouse arthritic DBA-1 treated with goat anti-OSM antibody or goat IgG control. 7a = clinical records. 7b - thickness of the leg.

Figure * 8 Histological data comparing the infiltration in the joint and cartilage damage in arthritis by collagen in mice. 8a & b: The control mouse exhibited extensive infiltration of the conjuncture by PMNs and mononuclear cells (8a) and the destruction of articular cartilage surface, characterized by the wide infiltration of neutrophil (8b). 8c & d: The representative joints of an animal treated with anti-OSM with normal / medium arthritis, shows markedly a reduced level of cellular infiltrate with intact articular cartilage. Figure 9 The HepG2 B6 sPAP and MTS assay for N- (1H-pyrazolo [3,4-d] pyrimidin-4-yl) -benzamide showing a concentration dependent inhibition of sPAP release induced by OSM.

Figure 10 The TNFa sPAP and MTS assay for N- (1H-pyrazolo [3,4-d] pyrimidin-4-yl) -benzamide shows limited inhibition of TNFa-induced sPAP release from A549 cells. Figure 11 The inhibition of the antibody from the production of sPAP in the HepG2 B6 assay. M2-M4 denotes mouse serum for four mouse individuals; OM5-6.1, OM5-6.10, Om6-10.111 denote experimentally the supernatant hybridoma supplied. Figure 12 The competition of wild-type and mutant-OSM-GST fusion with wild-type OSM with plaque binding to bind gp-130-Fc in an Elisa. Figure 13 The O.D. of three OSM-GSTs mutants show the low activity of the conduction production sPAP in HepG2 cells.

The present invention will now be described by way of example only with reference to the accompanying drawings; where: Detailed description of the invention Example 1: Detection of OSM in ex-vivo synovial tissue cultures Experiment 1: Fresh excised synovial tissue from diagnosed patients who have rheumatoid arthritis, osteoarthritis or bunions were mechanically dissected using sterile hypodermic needles to produce fragments of approximately 1 mm3. They were placed in 200μl wells with a flat bottom in a 96-well tissue culture plate (Costar) where RPMI 1640 (Sigma) supplemented with 10% AB + heat-inactivated male serum was added (North London Blood Tranfusion Center) , 10 mM hepes, 1% sodium pyruvate, 1% non-essential amino acids (all of Sigma), 4 mM L-glutamine (Hyclone), 100 U / ml penicillin + 100 μg / ml streptomycin (Hyclone) (complete human medium, CHM) and incubated at 37 ° C.

The 100 ul / well samples of the culture supernatant were collected on days 0, 2, 5 and 9 by cooling to 20 ° C and then the OSM was tested by ELISA. The data (Quantikine R &D Systems) were shown in Fig. La. The secreted OSM was detected in the synovial samples supplied with RA, but not from the synovium supplied from the control or arthritic or OA patients. The levels of OSM in tissue cultures with RA were maximum about 5 days of incubation, reaching a concentration of approximately 1400 pg / ml and remained greater than 800 pg / ml on day 9.

Experiment 2: The synovial tissue was washed in PBS and the fatty tissue was removed. Sterile scissors were used to cut the tissue into small fragments (1-4mm). This tissue was washed with PBS before use. The tissue was weighed and placed directly on the 2"4 or 48 well plate (Costar), 100 mg / well.The tissue was cultured at 37 ° C and 5% C02 in 1.5 ml of Dulbecco's modified Eagle's medium. (Sigma) are 10% supplement of human AB + heat inactive serum (Sigma), 2mM L-glutamine (Life Technologies), 200 U / ml of penicillin and 200 μg / ml of streptomycin (Life Technologies), 480 U / ml ml of nystain (Sigma), 50 μg / ml of gentamicin (Life Technologies) and 10 mM of Hepes (Sigma), sterile filter.The supernatants were removed on day 3 and the OSM was tested in an ELISA using antibodies in pairs (R &D Systems).

Synovial tissue cultures from the knee biopsy of patients with RA or OSM spontaneously secreted from inflamed OA. Following the 3-day incubation period, the mean level of OSM in the supernatant of the RA cultures was 246 pg / ml (range 30 to 982, n = 12) and the OA cultures were 473 pg / ml ( range 44 to 2001, n = 14). The OSM was secreted by inflammation but without still synovial tissue (Figure lb).

Example 2a: Division of THF-1 cells THP-1 cells from the human pro-monocyte line (ECACC) were spent two weeks in RPMI, adding the 10% supplement with heat-inactivated FCS, 10 mM hepes , 1% non-essential amino acids (all from Sigma), 4 mM L-glutamine (Hyclone) (complete medium, CM) and then PMA (Sigma) to cells washed with lug / ml and incubated at 37 ° C for 30 minutes. The x 3 cells were washed in pre-warm PBS, resuspended in CM and plated on flat bottom plates with 1.5 x 10 5 cells / ml in 96 wells (Costar). The plates were incubated for 48 hours at 37 ° C, 5% C02, then washed with PBS, the medium was replaced, and incubated for another 24 hours. The cells were washed x1 in PBS before use.

Example 2b: Preparation of blood monocytes stimulated with IFN-ga a Human leukocyte layers (North London Blood Transfusion Center) was diluted 1: 3 with PBS, the layer was formed by Linfoprep (Nycomed UK) and centrifuged at 600 xg for 30 minutes at room temperature. PBMC collected, counted, were washed three times in PBS and resuspended in 80 ml of RPMI 1640/10% FCS at 5 x 106 cells / ml. 20 ml were placed in each of the four 175 cm2 flasks and incubated overnight at 37 ° C to allow the adherence of the monocytes. The non-adhered cells are discharged and the adhered cells are removed after incubation with ice-cooled versne at 4 ° C for 15 minutes. The cells were washed twice in PBS, resuspended in RPMI 1640 + 10% heat inactive human serum (Sigma) with 6.9 x 10 5 / ml and 250 ul of cell suspension placed in each well of the plate with 96 wells with flat bottom (Costar). Half of the plate was added 100 IU / ml IFN? (genzyme), the other half left as control. Plates were incubated overnight at 37 ° C, 5% C02 prior to the assay.

Example 2c: Stimulation of TNFa release: Oncostatin M of recombinant, lyophilized human (rhOSM) was purchased from R & amp; amp; amp;; D Systems diluted with 10 μg / ml in sterile PBS + 0.1% BSA (Sigma) and aliquots were stored at -20 ° C until use. RhOSM, CM derived from E. coli were added to wells in triplicate of macrophages, monocytes or Thp-1 cells, prepared as above and incubated for 7 hours at 37 ° C, 5% C02. The supernatants were harvested and cooled to -20 ° C until the TNFα protein was tested by ELISA. In assays designated for co-assay of TNFa mRNA, the cells were incubated as above for 4 hours, washed once in PBS and used in extraction RNA buffer (ARNzole).

The RNA was detected as follows. The total RNA was prepared according to the manufacturer's instructions and stored at -80 ° C in water treated with DEPC. For RT-PCR, approximately lug of RNA was reverse transcribed using the oligo dT coating (first-strand cDNA synthesis kit, Pharmacia Biotech) and the Resulting cDNAs were subjected to 30 cycles of PCR using the following shells for TNFa (Clontech amplimers): forward GAGTGACAAGCCTGTAGCCCATGTTGTAGCA, (SEQ ID 1) reverse - GCAATGATCCCAAAGTAGACCTGCCCAGAC (SEQ ID 2). The amplified product (444bp) was separated by agarose gel electrophoresis (2%) and visualized by staining ethidium bromide.

Example 2d: OSM induces the production of TNFa in human cells of the monocyte lineage. The human pro-monocyte Thp-1 line was induced to differentiate using PMA, washed thoroughly, and incubated with human recombinant SOM as described. described above. The culture supernatants were removed at 8 hours and assayed for TNFa production by TNF specific ELISA Quantikine, R &D Systems) according to the manufacturers' instructions. The OSM induced a dose-related release of TNFα, which can previously be measured at 1 ng / ml OSM and maximized at 200-500 ng / ml, usually reaching secreted levels greater than 2500 pg / ml TNFα. A representative experiment is shown in Fig. 2. The expression of the TNFa message, measured by RT-PCR as described above, was greatly increased in the THP-1 cells incubated for 4 hours with 100 ng / ml of OSM, with relationship to unstimulated control cells (Fig. 2).

Importantly, the induction of TNFa is not because it contaminates the endotoxin with the pre-boiling of OSM the TNFa secretion is completely removed by the intense heat (data not shown). Also, the removal of OSM by immunoprecipitation using the abolished activity of the specific antibody (data not shown). These discoveries were extended to include human mocitos, pre-activated with interferon-? and human blood macrophages, differentiated in culture for 7 days. Both cell types, when co-incubated for 8 hr. With OSM, TNFa was secreted, as measured by ELISA. The average TNFα secretion of monocytes was 1447 pg / ml (range 137-4709 pg / ml, n = 4 donors) and 542 pg / ml by macrophages (range 62-1428 pg / ml, n = 3 donors).

Example 3a: Cartilage degradation test The cartilage of the bovine nasal wall was maintained at 4 ° C overnight after slaughter. Discs of 2 mm diameter were cut from a 2 mm slice and washed twice in HBSS. Three disks per well of a 24-well plate (Costar) were incubated at 37 ° C, 5% C02 for 24 hours in a volume of 600 μl of DMEM (Sigma) containing 25 mM of HEPES supplemented with 2mM of glutamine, 100 μg / ml streptomycin, 100 U / ml penicillin and 2.5 μg / ml amphotericin B (medium cartilage degradation, CDM). The cartilage was grown in quadrupled walls in either: 600 μl of CDM alone, 2, 10 or 50 ng / ml of human recombinant TNFα alone, 10 ng / ml rhOSM alone (R & D Systems) or TNFa + OSM and incubated for 7 days at 37 ° C, 5% C02. The supernatants were collected and placed with a fresh medium containing the identical test reagents on day 1. The experiment was continued for another 7 days and on day 14 all the medium was removed and the remaining cartilage was digested with 4.5 mg / ml of papain (Sigma) in 0.1 M phosphate buffer pH 6.5, containing 5 mM EDTA and 5 mM cysteine hydrochloride, incubating at 65 ° C for 16 hr, to determine the remaining hydroxyproline content of the fragments of the cartilage. The cumulative level of proline-OH released in the middle of day 14 was measured and expressed as the percentage of total release as discussed below.

Example 3b: Hydroxyproline assay The release of hydroxyproline (as a measure of collagen degradation) was tested using a modification of the microtiter plate method in (Bergmann I and Loxeley R. (1963) Anal. Biochem. 35 1961- 1965. Chloramine T (7% w / v) was diluted 1: 4 in citrate acetate buffer (57 g of sodium acetate, 37.5 g of tri-sodium citrate, 5.5 g of citric acid, 385 ml of propan-2 -ol per liter of water) P-dimethoxylaminobenzaldehyde (DAB); 20 g in 30 ml 60% perchloric acid) was diluted- 1: 3 propan-2-ol. The specimens were hydrolysed in 6 M HCl for 20 h at 105 ° C and neutralized hydrolyzate was dried over NaOH under vacuum using a Savant Speed Vac. The residue was dissolved in water and a 40 ul or standard sample (hydroxyproline, 5-30ug / ml) was added to the microtitre plates together with Chloramine-T reagent and then the DAB reagent (150 ul) after 4 minutes. . The plate was heated at 65 ° C for 35 min, cooled and the absorbance was determined at 560 n.

Example 3c: OSM performs synergy with TNFa to increase MMFl and collagen release from samples of cartilage culture, ex vivo. The bovine nasal cartilage was cultured in wells in quadruplicate for 14 days in the presence or absence of OSM or TNFa alone (both from R &D Systems), or in combination, as described above. The culture supernatants were tested for a total collagenase activity on day 7 and for the collagen released on day 14. The data in Fig. 3b show that neither OSM nor TNFa alone, used at 10 ng / ml or 50 ng / ml, respectively, induced significant secretion of MMPl. However, the combination of OSM and TNFa used with these concentrations induced release of MMP1 that could be measured. These discoveries were accompanied by the remarkable synergy between OSM and TNFa to increase the release of cartilage collagen. Fig. 3a shows that OSM alone with 10 ng / ml did not induce collagen release while only the highest concentration of TNFα used (50 ng / ml) had a small, but demonstrable effect (less than 10%). However, the combination of 10 ng (ml of OSM with 50 or 10 ng / ml of TNFa caused a release of collagen greater than 80% and 30%, respectively.

Example 4a: Stimulation of PBMC by means of L-selectin Mononuclear cells were isolated from the human leukocyte layers as described above. 5 x 10 5 cells were implanted in 0.5 ml volumes and incubated for 24 hours at 37 ° C, 5% CO 2 with anti-L-selectin monoclonal antibodies with a weight of M. 60-80 kD Fucoidal (Sigma), LAM1- 3 and TQ1 or a control IgG antibody corresponding to the isotype (all of Coulter). The OSM was tested with supernatants using the specific ELISA assay (Quantikine, R &D Systems), according to the manufacturer's instructions.

Example 4b: ligation of L-selectin induces OSM secretion Mononuclear cells from healthy donors were incubated for 24 hours with anti-human L-selectin antibodies (TQ1 or LAM-1). Or a corresponding control antibody of the isotype and the culture of the supernatants tested by ELISA for OSM. The data in Fig. 4a show dose-dependent OSM induction using both anti-L-selectin antibodies. The control antibody had a minimal effect. The ability of the fucoidan agonist of L-selectin to induce the OSM of the mononuclear cell cultures was investigated. Fig. 4b shows that fucoidan has a stimulating power of OSM secretion, inducing levels similar to those seen in RA and OA synovial biopsy cultures (Example 1, Experiment 2, Fig. Lb).

Example 5a: Immunohistochemistry Fresh samples of human tissue were cooled in liquid hexane cooled with C02 and stored in the vapor phase of liquid N2 until use. Sections of the 7 mm cryostat were cut on glass slides coated with 3-aminopropyltriethoxysilane (APES) (Maddox P. et al, J. Clin, Path 40, 1256-1260, 1987) and fixed for 10 minutes at 4 ° C. in 2% paraformaldehyde. Endogenous peroxidase activity was blocked for 20 minutes in 0.05% H202. Primary unconjugated monoclonal antibodies were obtained from the following sources: CD62P, CLB, The Netherlands, CD62E and gpl30 R &D Systems UK. The primary antibodies were applied at an optimal dilution for 45 minutes at room temperature. The negative control sections were incubated with an anti-BrdU monoclonal antibody (SIGMA) used with protein concentrations equivalent to the test antibodies. A biotinylated secondary antibody, followed by the ABC labeled with peroxidase (Vector Elite) was used to label the primary antibody. Peroxidase was developed with a substrate of DAB (3, 3 'diaminobenzidine) (SIGMA).

Example 5b: The so-distribution of receptor selectins and OSM in the RA synovium Frozen sections of inflamed RA synovial tissue were stained using specific antibodies with gpl30, and P and E selectin as described above. The photomicrograph (a) in Fig. 5 demonstrates that the RA vascular endothelium stained strongly positive for gpl30.

The synovium RA staining for P- and E-selectin expression revealed an identical spot pattern for gpl30, restricted to vascular endothelial cells. (Fig. 5b and c respectively). Note that Figure 5c the infiltrate of the perivascular mononuclear cell is associated with E-selectin staining. The staining of the sections in series using the primary control antibodies was negative in the vascular endothelial cells (Fig. 5 panels c and d).

Example 6a: The anti-OSM antibody treatment of collagen-induced arthritis. The collagen-induced arthritis is induced in male DBA / 1 mice (8-12 weeks of age) by immunization with native bovine type II collagen (CII) as previously described (Plater-zyberk C. Clin. Exp. Immunol. 98: 442-7 1994 and Plater-zyberk C. Natural Medicine 1: 781-5, 1995). On day 16 post-immunization with CII, the mouse was recorded daily for signs of redness and inflammation of the joint. With the first appearance of clinical symptoms, the mouse was examined three times a week and each limb was graded for activity severity using the following visuals: 0 = normal. 0.5 = arthritis in 2 or more fingers, 1 = slight inflammation and eridema of the paw without involvement of the fingers, 1.5 = the same as in 1 with participation of the fingers, 2 = more pronounced inflation with erythema of the paw without the participation of the fingers, 2.5 = the same as in 2 with the participation of the fingers, 3 = severe inflammation with movement damage, 3.5 = the same as the 3 with the participation of the fingers. The thickness of the leg was measured using calibrators (Protest 2T, Kroeplin Langenmesstechnik).

DBA / 1 mice immunized with CII were treated after the clinical onset of the disease with injections of 100 mg of goat anti-mouse OSM antibody (R and D Systems, cat No. AF-495-NA). The progression of the disease was evaluated as described above. On day 14 post-initiation, the mice were sacrificed by cervical dislocation and the paws were collected for histopathological examination.

Example 6b: Histological evaluation of the arthritic mouse joints The legs and knees and dissected claws were skinned. The joints were fixed in 10% formalin buffered for 4 days (knees) or 1 day (claws) and decalcified for 3 days in 25% formic acid, dehydrated and immersed in paraffin wax. The Sagittal sections (5-7 mm) of the joints were defatted and stained with Safranin 0, the fast against green / iron haematoxylin stain (as described in Plater-zybek Nature Medicine above). Sinusitis was blindly graduated from 0 (no infiltration) to 3 (extensive infiltration and synovial hyperplasia). The degree of loss of Safranin 0 that stains intensely indicative of the depletion of proteoglycan cartilage, was recorded with a scale from 0 (completely stained cartilage) to 3 (complete exhaustion and loss of cartilage).

Example 6c: Detection of OSM mRNA in the. tissues of arthritic mouse sonycures by collagen.

The arthritic mice, plus the control animals, were sacrificed and both feet and feet were removed and cooled abruptly in liquid nitrogen followed by storage at -80 ° C. The RNA was prepared by shredding each extremity in ARNzol using an ultraturral mechanical homogenizer. The particulate material was allowed to settle, and the supernatant was then mixed with 1/10 volume of chloroform and rotated to separate the aqueous phase containing RNA. The ARNmate used was precipitated (Biochain Institute Inc. San Leandro California) to remove contaminating proteoglycans. After washing in 75% ethanol, the total RNA was dissolved in water-DEPC and reverse transcribed using the cDNA equipment of a Pharmacia strand and the oligo dT coat. PCR reactions were developed using the following stimulants (Life "Technologies custom primers) derived from the mouse OSM sequence (Yoshimmura A. et al EMBO Journal 15 1055-1063, 1996): GGGTGTCCTACCAAGGAACA (SEQ ID 3), CTGAGACCTTTCAAGAGGAC (SEQ ID 4). After 30 cycles of PCR, the reaction products (379bp) were detected using agarose gel electrophoresis. RT-PCR was used to detect OSM mRNA in the legs of arthritic mice as described above. Fig. 6 shows that OSM-specific CRP levels were increased in the joints taken from animals with clinical disease records that progressively increased. In contrast, the message of small or no OSM is detected in the control animals.

Example 6d: Neutralization of OSM alleviates collagen-induced arthritis To directly test the hypothesis that neutralization can improve the clinical symptoms of arthritis, two 100 μg injections that neutralize the polyclonal antibody with OSM were administered for example, on days 1 and 3 after the first appearance of clinical arthritis in a group of 6 mice. In parallel, a second group of 6 arthritic mice were treated identically, using non-immune goat IgG instead of anti-OSM. The clinical severity of the arthritis of the mice was recorded, and the inflammation of the individual paw was measured during a period of 11 days after the second injection of the antibody. Mice treated with control goat IgG developed progressive arthritis, accompanied by increased inflammation of the paw.

In stark contrast, mice treated with anti-OSM antibody developed a significant decrease in severe arthritis in terms of clinical record and inflammation of the leg (Fig. 7 and b). Also, the number of arthritic parts was significantly reduced in the anti-OSM treatment compared to the control animals treated with IgG, demonstrating that this therapeutic protocol was effective in animals protected with the already established disease and other disease progression. (Data not revealed) . This experiment was repeated identically, using 7 mice per group and very similar comparison data were produced (data not shown).

The reduction in clinical severity resulting from treatment with the anti-OSM antibody was confirmed by post-mortem examination of the arthritic legs on day 14 post-onset of the disease. Histological data comparing joint infiltration and cartilage damage on day 14 arthritic mice by collagen with IgG or anti-OSM antibodies are shown in Figure 8. Mice treated with control IgG exhibited extensive infiltration of the conjuncture by the PMN and the cells (Fig. 8a). This was accompanied by the destruction of the surface of the articular cartilage, characterized by a wide neutrophil infiltration (Fig. 8b). In contrast, Fig. 8c and d show representative junctures of an animal treated with anti-OSM, demonstrating a markedly reduced level of cellular infiltrate, with intact articular cartilage. In addition, the joints were blindly recorded due to the histopathological appearance of the cartilage and synovium and reported as normal, moderate or severe. A total of 73 individual joints were evaluated by treatment group; the data were summarized in Table 1. In the animals treated with anti-OSM, 47% of the joints were examined to be normal or exhibited a mean synovitis, compared to only 6% in the IgG control group. Similarly, in the mice treated with anti-OSM, 58% of the joints examined showed little or no damage to the cartilage compared to 21% in the control group treated with IgG. The joints of the two mice treated with anti-OSM with clear signs of redness and inflammation in the joint on day 1 of the treatment subsequently showed complete arthritis relief and showed no infiltration or visible abnormalities with any cartilage or synovium (the data they are not shown).

Table 1: Histological record of the joints of mice treated with anti-OSM or control IgG.

TreatmentCartilage Sinovio Cartilage Sinovius Cartilage synovium Normal / moderate severe medium Anti- 58% 47% 21% 23% 22% 31% OSM IgG 21% 6% 26% 37% 53% 57% Total of joints examined: 73 joints / treatment Example 7: Identification of small antagonists of organic molecules. Small antagonists of OSM organic molecules were identified by inhibition of a biological response of OSM induced from the reporter cell line without originating open cell toxicity. The effect of the compounds on a TNFα response cell line was also tested as a control.

Example 7a: Expression and Purification of OSM from human. A DNA fragment encoding the human OSM (hOSM) with the removed 25 amino acid leader sequence was amplified using the Polymerase Chain Reaction (PCR) of an activated leukocyte cDNA library using the synthetic oligonucleotide primers 5'-GCATAGGATCCGCGGCTATAGGCAGCTGCTCG -3 '(SEQ ID 5) and 5' -ATCGCGAATTCCTACCGGGGCAGCTGTCCCCT-3 ', (SEQ ID 6) designated the EMBL sequence for hOSM (numerical sequence M27288). This PCR product was subcloned into pCR2.1 (Invitrogen) to give pCR2.1hOSM.

A SalI restriction endonuclease cleavage site was created within the Factor Xa site in the bacterial expression vector pGEX-3X (pharmacia) by insertion of CA for TG using the mutagenesis kit performed at the "Rapid Change" site (Stratagene ) to create the sequence shown below (SEQ ID 7); BamHI EcoRI AAA TOG GAT CTG ATC GAA GGT CGA OGG ATC COC GGG AAT TCA TOG K S D L R G N (SEQ ID 14) Factor Xa Following verification of the OSM sequence inserted into "CR2.1hOSM, DNA encoding the mature form of human OSM was PCR amplified from this vector using the forward primer GATACGATCGTCTCATCGAGCGGCTATAGGCAGCTGC-3 (SEQ ID 8) containing an endonuclease site of restriction BsmBl (underlined), and reverse primer 5 '-ATTACATGGAATTCCTATCTCCGGCTCCGGTTCGG-3' (SEQ ID 9) containing an EcoRI site (underlined). This PCR product contains the mature form of human OSM without the leader sequence and without the 31 amino acids of the C-terminus that is removed with the maturation of the protein. Following PCR, the amplified DNA fragment was purified, digested with BsmBI restriction enzymes and subcloned EcoRI into the modified pGEX-3X vector (Pharmacia: containing DNA encoding GST) which is restricted with SalI and EcoRI to generate a plasmid designated pGEX 196. Following sequence verification, plasmid pGEX196 was transformed into BLR-DE3 E. coli (Novagen). Transformed cells were cultured on 2xYT + G media (tripton 16 g / 1, yeast extract 10 g / 1, NaCl 5 g / 1, pH 7.0 with NaOH, 2% glucose) supplemented with lOOug / ml ampycillin.

To prepare the protein in overnight culture of pGEX 196 in BLR-DE3 of E. coli it was diluted 1: 100 and this culture grew at 37 ° C with an A6oonm of 0.8. Expression of the GST-hOSM fusion protein was induced by the addition of IPTG 0. lmM (isopropyl-1-thio-β-D-galactopyranoside) and the culture was maintained for two hours.

GST-hOSM was isolated from the E culture. col i for batch purification. A 3 liter bacterial culture was collected by centrifugation at 3000 r.p.m. and the resulting small pellets which are suspended again in 50 ml of ice-cold PBS (phosphate buffered with brine) containing proteinase inhibitor tablets (Boerhinger). Lysozyme cells and the suspension of cells incubated in the ice were added for 5 minutes. After the lisation was finished the final mixing was finished at 4 ° C for 10 minutes, and then centrifuged at 14,000 g. The supernatant was added to glutathioneagarose (Sigma cat No. G4510) and was terminated at the end of the mixing at 4 ° C for 30 minutes. The suspension was lightly centrifuged, the supernatant was aspirated and the agarose seated twice with ice-cold PBS was washed. The elution buffer (20 mM glutathione, 100 mM tris pH 8.0, 100 mM NaCl, pH 8.0 again) was added and the suspension was incubated on the ice for 5 minutes. The supernatant was collected and fractions were analyzed by sodium dodecylsulfate / polyacrylamide gel electrophoresis (SDS-PAGE), followed by staining with Coomassie bright blue dye, to confirm the integrity of the purified protein.

The optimization experiments of proteolytic separation is established using factor Xa and thrombin, with the thrombin producing the optimal amount of hOSM as demonstrated by the SDS-PAGE analysis of staining with coomassie brilliant blue. The separation of the GST and OSM products was achieved by means of ion exchange chromatography and the OSM product was verified by means of N-terminal sequence and mass spectrometry.

Eg, emplo 7b: HepG2 B6: sPAP assay induced by OSM A He? G2 cell line (ECACC) were stably transferred with six functional STAT3 response elements (REs) above sPAP (secreted placental alkaline phosphatase) cDNA as described below to form HepG2B6. The STAT3 (transcription primer and signal transducer) is an intermediate in the intracellular signaling cascade of the IL-6 cytokine family. Following the dimerization of STAT3 receptors on the cell surface they are phosphorylated and then bound to the REs DNA in the nucleus and downstream of the active DNA, in this construction the DNA is sPAP. Thus the line can be activated to produce sPAP during the whole night of incubation in Oncostatin M.

A STAT responsible for the reporter gene of secreted placental alkaline phosphatase (sPAP) was constructed as follows. Initially a pair of oligonucleotides containing three copies of a palindromic STAT3 response element (Wengeka U. M et al Mol Cell. Biol. 1993 Vol. 13 p276-288 Table 1 on p277 and a 5'Xhol site was cloned into the only site I left the plasmid pBluescript tkSPAP to create pl 1 P3-t k-SPAP • Another six copies of a synthetic oligonucleotide encoding the STAT3 response element was found in the β-Fibrogen promoter (Dalmon et al, Mol. Biol, 1993; 13: 1183-1193 Figure 9 the hßFG sequence includes the distinctive form of Consensus IL6RE and the TTG leader without the GAT tail) when cloned into the Xhol site of pllP3-t k-SPAP to generate pl 1x6 / 1 lP3-t -SPAP Following the sequence to confirm the number of response elements pllx6 / HP3-tk-SPAP was digested with Nrul and Xbal to isolate a DNA fragment containing the 9STAT response elements and the sequence that encodes tk-SPAP, which was subsequently transferred between the Nrul and Xbal of pcADN4 plasmid (Invitrogen) (replacing the CMV promoter) to create a SPAP reporter gene containing the 9 STAT3 response elements, and the NeoR selectable markers to establish the HepG2 cell line.

HepG2 cells (ECACC) were grown in the DMEM medium supplemented with 2 mM L-glutamine, 1% NEAA and 10% calf-fetal serum Hl at 37 ° C in an atmosphere of 5% C02, 92% humidity. For transfer with the STAT-sPAP reporter, the cells were placed in a plate with a confluence of 1% in a 10 cm tissue culture plate and primed with a STAT-sPAP reporter vector using a phosphate transfer kit. of calcium (invitrogen). Then the clonal selection in the presence of 1 mg / ml cell lines of G418 was screened for its ability of IL-6 to cause an increase in the expression of sPAP of the reporter gene STATsPAP.

HepG2B6 cells were placed in 96-well plates with a final concentration of 3 x 10 4 cells per well in 100 μl of medium (DMEM (Sigma), 10% Hl FCS, 1% non-essential amino acids, 2mM Glutamine, 500 μg mi-1 G418, (all from Life Technologies)). The cells were allowed to equilibrate for 48 hours. The putative anti-OSM solid compounds were made with a dilution of the broth with 20 mM in DMSO and serially diluted 1: 3 in DMSO. This was then diluted in the HepG26B assay medium, this is like the previous half but with 1% FCS inactivated with heat, low alkaline phosphatase activity (Life Technologies) replaced by 10% FCS Hl. Compounds were diluted 1: 3 from a high concentration of 200 μM at a final concentration of 0.09 μM in a final concentration of 1% DMSO. (This is 200, 66.67, 22.22, 7.41, 2.47, 0.82, 0.27, 0.09 and 0 μM). The old medium was removed from the wells and replaced with diluted compound that also contained 2 ng ml-1 of OSM (R & D Systems), the cells were incubated for another 20 hours. Each dilution was developed in triplicate. 20 μl of the medium from each well was removed and tested for sPAP activity using pNPP (p-Nitrophenyl phosphate; Sigma) as a substrate. Endogenous alkaline phosphatase was blocked with L-homoarginine. The optical density of the substrate was read at 405-650 nm. The concentration of the compound is plotted against OD as a measure of the measured sPAP and can be analyzed to determine IC 50 values.

Example 7c: A549 cells: TNFa induced sPAP assay This assay used A549 cells that had been stably transferred with a reporter gene, comprising the cytokine response region of the E-selectin gene coupled with alkaline phosphatase (Ray et al., Biochem. J. 328: 707-715, 1997). This transferred cell line can be driven to produce sPAP by incubation overnight with TNFa.

The A549 cells were plated in 96-well plates with a final concentration of 5 x 10 4 cells per well in 100 μl of the medium. The cells were allowed to equilibrate for 24 hours. The putative anti-OSM solid compounds were made with a dilution of the broth with 20 mM in DMSO and serially diluted 1: 3 in DMSO. This was further diluted in the medium (DMEM 1% FCS deactivated with heat, low alkaline phosphatase activity, 1% non-essential amino acids, 2 mM Glutamine, 500 μgrnl "1 G418, (all from Life Technologies), to give an answer concentration of 0.09-200 μM with a final concentration of 1% DMSO The old medium was removed from the wells and was placed with a diluted compound also 3 ngml * 1 TNFa (R & D Systems), the cells were incubated for other 20 hours Each dilution was developed in triplicate 20 μl of the medium from each well was removed and tested for sPAP activity using pNPP p-Nitrophenyl phosphate (Sigma), as a substrate.The endogenous alkaline phosphatase was blocked with L- homoarginine The optical density of the substrate was read at 405-650 nm.The concentration of the compound is plotted against OD as a measure of the measured sPAP and can be analyzed to determine IC50 values.

Example: 7d: cell viability assay Cell viability was measured as the ability of enzymes dehydrogenase in metabolically active cells to reduce a compound of trimethoxy (3- (4,5-dimethyl-thiazol-2-yl) -5) - (3-carboxymethoxy phenyl) -2- (4-sulfonyl) -2H-tetrazolium, inert salt; MTS with a soluble product fr azan which can be measured directly at 490 nm.

A solution of 2 mg / ml MTS (promising containing 0.046 μg / ml phenazine methosulfate (PMS; Sigma) in PBS Dulbeccos was prepared.) Following the removal of the assay medium from sPAP activity, 20 μl / well MTS / PMS The cells were then incubated for another 45 minutes, then the absorbance was measured at 490 nm, then measured using a 630 nm reference.

Example 7e: N- (lH-pyrazolo [3,4-d] pyrimidin-4-yl) bezamide antagonists (Davoll and Kerridge J. Chem. Soc. 2589, 1961) (GW 340442X) producing a concentration-dependent inhibition of sPAP induced with OSM released with an IC50 of 0.3 μM (figure 9), but was much less potent to inhibit the sPAP induced TNFa (approximate IC50 value of 92 μM) (Figure 10). Therefore this compound has higher 100-fold selectivity of OSM in TNFa.

Example 8a: Generation and testing of anti-human OSM antibodies. The monoclonal antibodies were cultured against human OSM (R + D systems) in mice as follows; strand mice SJL (Jackson Inc. Bar. Harbor, MA) was immunized with the human recombinant OSM (R &D Systems) with a combination of 1 μg of recombinant human OSM antigen emulsified in RIBI adjuvant (RIBI, Hamilton, MT) subcutaneously and 1 μg of antigen in complete Freund's adjuvant intraperitoneally on days 0, 3, 5, and 24 (on day 27, mice are given an intraperitoneally injection of 1 μg of antigen in brine); or 1 μg of antigen emulsified in RIBI adjuvant on days 0, 3, 5, 24 and 53 intraperitoneally (on day 54, the mouse was injected with 1.5 μg of antigen in brine intraperitoneally).

Twenty-four hours after the immunization, mice were sacrificed, and splenocytes harvested and prepared for infusion. The infusion procedure as described in Su J-L et al: Hybridoma 1998; 17 (1): 47-53.). Briefly, the splenocytes and myeloma P3X63Bcl-2-13 (Kilpatrick KE, et al Hybrido to 1997; 16 (4): 387-395) with a ratio of 5: 1 or 1: 1 were fused using polyethylene glycol 1500 (boehringer Mannheim, Germany). The fused cells were resuspended 1 x 10 6 cells / ml with a hybridoma growth medium which is composed of equal volumes of RPMI 1640 (Life Technologies, Inc., Gaithesburg, MD) and EXCELL-610 (JRH Biosciences, Lenexa, KS) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), 1 x Original Hybridoma Cloning Factor (Igen, Gaithersburg, MD), 2mM L-glutamine, and penicillin / streptomycin. The cells were then placed in a plate with 24-well microtitre (Costar, Cambridge, MA) with Iml / well. Twenty-four hours later, 1 ml of 2 x of the HAT selection medium were added to each well; 100 μM hypoxanthine, 0.4 μM aminopterin, 16 μM thymine (life technologies, Inc.) in the hybridoma growth medium. After two weeks of culture at 37 ° C, 5% C02, the supernatants of the hybridoma were screened for the secretion of anti-OSM antibodies by ELISA. Cloning was developed with limiting dilution in the selected hybridomas.

Hybridoma supernatants and diluted serum were incubated in 96-well plates containing bound human OSM. Anti-hOSM antibodies were detected by anti-mouse alkaline phosphatase antibodies. The O.D. duplicates for antibodies giving a positive result is given in Table 2.

Table 2 Three of the supernatants and only one of the mouse sera tested positive in the ELISA. Using the ELISA data, an ordinary measurement of the antibody concentration was determined and the positive antibodies were then titrated against 2 ngml "1 OSM in the sPAP HepG2 B6 assay described in Example 7b. In summary, an antibody was incubated throughout the overnight with the cytokine at 4 ° C before starting the incubation with HepG2 B6 cells The production of sPAP was assayed as described in Example 7b.Inhibition of sPAP production by means of hybridoma supernatants and serum of mice are shown in Figure 11.

Example 9a: Identification of the key link residues for the receiver in OSM. The receptor-binding sites in hOSM were initially identified with related members of the IL-6 family of cytokines. Sites 1 and 3 are considered to be involved in the linkage with the cytokine specific chain of the zreceptor, as in site 2 it is considered that they are involved in the binding of the gpl30 receptor component. Studies of mutations in site 2 in the cytokine leukemia inhibition factor of the family 11-6 (LIF) (Hudson et al (1996) J. Biol. Chem. 271, 11971-11978), interleukin-6 (IL-6) (Paonessa et al (1995) EMBO J. 14, 1942-1951 and Savino et al (1994) EMBO J. 13 1357-1367) suggests that changing residues within site 2 may result in an altered link with gpl30. In order to investigate OSM residues that are important for their interaction with gpl30 it was necessary to identify those residues that would be exposed on the surface of OSM in the region of site 2. Using the information from the NMR experiments (Hoffman et al (1996 J. Biomol, RMN 7 273-282) and 1 published structure of LIF (Robinson et al (1994) Cell 77 1101-16) a model of OSM homology was constructed. The residues that occupy the positions of the surface in this model in the region of site 2 was selected by mutagenesis. The structure of the complex formed between the growth hormone (an OSM homolog) and its receptor has been determined (De Vos et al (1992) Science 255 306). By superimposing the OSM model with growth hormone, other sites of the potential interaction between OSM and gpl30 were identified.

Based on these modeling studies, 27 sites of the mutation in OSM were selected to investigate their interaction with gpl30. See Table 3. At each of these sites an alanine was replaced by the wild type residue. Table 3 Example 9b: Synthesis of mutant OSM-GST fusion molecules For each of the 27 mutations a pair of mutagenic oligonucleotides is designated. There were approximately 33 bases in length and preferably had a G or C residue at either end. Were tuned with the pGEX (pharmacia) derivative expression containing the "wild-type" OSM DNA (see SEQ ID 12) under the control of a lac promoter (/ IPTG that can be induced) (Pharmacia) and the extended use of the polymerase Native Pfu (Stratagene). The original tempered DNA was digested with DpnI (New England Biolabs) and the newly synthesized plasmids (which was not a substrate for DpnI) were transformed into the DH5alpha strand of E. coli (GibcoBBL / Life Technologies). A small group of colonies was collected (typically 4), and the DNA plasmid was isolated and the DNA sequence was determined. A representative mutant clone for each mutation, together with a wild type similarly constructed, was transformed into the BLR strand of E. coli (no DE3: Novagen) for the expression of the recombinant proteins. 0.51 cultures were established and induced with an OD550 of approximately 0.5. After 3 hours of induction the cells were formed into small beads by centrifugation and were used using a combined method of lysozyme and sonication. Since recombinant mutant proteins are expressed as fusions with GST, columns of glut aionsepharose were used to link the fusions. The fusion proteins were then eluted from the columns using free glutathione and then incubated in 10 mm DTT for 4 hours at room temperature to remove the glutathione adduct and stored at -80 ° C.

Example 9c: Effect of point mutations on the ability of OSM-GST to complete with the wild-type OSM that binds gpl30-Fc in an ELISA. The Nunc immunoplates were coated (F6 Maxisorp, Life Technologies) throughout the night (4 ° C) with wild-type OSM according to the Example 7a); 50 μl / well, Iμg / ml in carbonate / bicarbonate buffer pH 9.4) .- The plates were washed (x 6 in PBS 0.05% between 20, using the Skraton Píate washer), dried by liquid elimination and blocked to reduce the non-specific binding (200 μl / well, 1% BSA / PBS). Following 1 h of incubation (room temperature on the shaking platform) the plates were dried by liquid removal and the wild type (weight) or OSM-GST mutant of Example 9b was added. (50 μl / well, 20-0.002 μl / ml, was titrated in 1% BSA / PBS). It was also tested as a positive control polyclonal anti-human OSM antibody (R & D Systems) (20-0.002 μl / ml). A complex of gpl30-Fc (produced immediately 300 ng / ml) and the anti-human IgG alkaline phosphatase conjugate (1: 500, Sigma) in 1% BSA / PBS (50 μl / ml) was added immediately after the agents under the proof. Following a 5 h incubation (room temperature on a shaking platform) the plates were washed (x6) and developed using the ELISA Amplification System (Life Technologies) as the manufacturer's instructions and the ODs were measured at 490 nm. In each plate the total binding was determined by the gpl30-Fc / cojugate and OSM in the presence of 1% BSA / PBS, and non-specific binding by gpl30-Fc / conjugate in the absence of OSM, or conjugated link with OSM in absence of gpl30-Fc.

The DNA encoding the human gpl30 cell domain was amplified by the Polymerase Chain Reaction (PCR) using the synthetic oligonucleotide primers, the forward primer, 5 'CATCGGATCCAAGCTTTACAGTTACTGAGCACAGGACCTCACC BamHI HindIII 5'UTR sequence SEQ ID 10 M L SEQ ID 15) and the reverse primer 5 'CATCCTCGAGTTTCTCCTTGAGCAAACTTTGG SEQ ID 11. Xhol Designated from the sequence of the GenBank database (numerical sequence M57230) for human gpl30. The forward primer contained the restriction endonuclease sites BamHI, and HindIII, and a consensus of the unconverted 5 'sequence followed by the complementary DNA sequence with the start of the gpl30 coding sequence. The reverse primer contained the endonuclease sites with XhoI restriction followed by the complementary DNA sequence at the 3 'end and the extracellular domain of the gpl30 coding sequence. This PCR fragment was purified and sub-cloned into pCR2.1 (Invitrogen) to give pCR2. Igpl30.

The pCR2.1gpl30 plasmid was digested with restriction enzymes BamHI and Xhol and the gpl30 fragment was purified and subcloned into the BamHI and Xhol endonuclease sites in a plasmid containing a DNA sequence encoding an Fc fragment of human IgGl. The plasmid was then digested with the restriction enzyme HindIII, and the resulting gpl30Fc fragment was purified and subcloned into the HindIII site of a baculovirus expression vector, pFastBacl (Life Technologies), to generate a plasmid designated pBACgpFc.

The gpl30Fc fusion protein was expressed in insect cells using the Bac-a-Bac baculovirus expression system (Life Technologies) and then purified from the cell culture supernatant by affinity column chromatography of protein A and verified by stained with brilliant blue coomassie SDS-PAGE and by western blot analysis using commercially available anti-gpl30 and anti-hlgG antibodies.

The mutant and OSM-GST wt were tested to obtain IC50 in 3-6 experiments. The mean OD in the presence of OSM and gp 130-Fc in the absence of the competition ligand (for example, total binding) was 1157 (range 0.825-1.807) and the non-specific binding was less than 0.08. The anti-OSM antibody produced a concentration-dependent inhibition in all the assays (74 ± 1% inhibition at 1 μg / ml). the OSM-GST wt was completed with OSM plate binding to give a concentration-dependent inhibition (Fig. 12), with an IC50 0.139 ± 0.0258 μg / ml determined in the 6 independent experiments. The potency of the OSM-GST mutant to complete the wt OSM plate link is summarized in Table 4. Mutations that resulted in a substantial decrease in the ability to complete wt OSM to bind gpl30 were L13A, Q16A, Q20A, G120A, N123A, and N124A. Of these, Q20A and Q16A were the most fragile: with the highest tested concentration (lOμg / ml) Q20A produced 66 ± 2.3% and Q16A only 15 ± 8% inhibition (Figure 12).

Table 4: Power of OSM-GST wt and mutant in competition with OSM wt with plaque binding to bind gpl30-Fc in the ELISA. IC50 values were determined in 3-6 independent experiments.

Example 9d: Effect of point mutations within OSM in the production of sPAP driven by OSM in a HepG2 B6 ± n v ± tro assay. The test described in Example 7b above was employed. The SOM-GST mutants were diluted to a concentration of 100 ngml-1 using the known concentration of intact OSM mutants generated in Example 9b. A wild type OSM-GST was included for control purposes. Dilutions were made in HepG2 B6 medium with 1% FCS inactive with heat, low activity of alkaline phosphatase. Then the serial dilutions 1: 3 were made. (100; 33.33; 11.11; 3.7; 1.23; 0.4 ng / ml). 3 x 104 HepG2 B6 'were delivered in individual wells of a 96-well plate in 100 μl of medium. The cells were allowed to equilibrate for 48 hours. The medium was then removed and replaced with 100 μl of diluted OSM-GST mutant. The cells were incubated for another 20 hours. Each dilution was developed in triplicate. 20 μl of the medium was removed and tested for sPAP using pNPP as a substrate. The endogenous ALP was blocked with L-homoarginine. The O.D. at 405-650 nm. The experiment was repeated twice.

Most mutants could trigger the release of sPAP in a manner similar to the wild type. Three mutants produced very low levels of sPAP. The EC50 of these mutants was not obtained. The (Figure 13) shows the O.D. of mutants 9 (Q16A), 13 (Q20A) and 20 (G12A), which were less effective in triggering the production of sPAP. The OSM-GST wt is shown for comparison. These data were used to calculate the EC50 values. The current EC50 for each mutant and expressed as a percentage of the wild type are shown in Table 5.

Table 5 Mutant Exp 1 Exp 1 Exp 2 Exp 2 Exp 3 Exp 3 Media 'potenc % EC50% EC50% EC50% i to "nginl" 1 ngml "1 ngml-1 WT 100 24 1 n r¡ 32 100 1S7A 50 12 69 22.2 59.5 MAJOR 2K8A 66 16 38 12.5 52 GREATER 3E9A 98 23.6 27 8.9 62.5 GREATER 4Y10A 134 32.4 256 82 195 MINOR 5R11A 118 28.6 86 27.7 102 EQUAL 6L13A 269 65.7 171 54.9 220 MINOR 7L14A 81 19.4 77 24.9 79 MAJOR 8G15A 87 21 55 17.8 71 MAJOR 9Q16A NC NC NONE 10L17A 301 72.7 174 56 237.5 MINOR 11Q18A 84 20.2 68 21.7 76 MAJOR Mutant Exp 1 Exp 1 Exp 2 Exp 2 Exp 3 Exp 3 Media * potenc ngml-1 ngml-1 ngml-1 12K19A 98 23.6 37 11.9 67.5 GREATER 13Q20A NC NC NONE 14T21A 71 17 33 10.5 52 HIGHER 15D22 152 36.7 50 16 101 EQUAL 16M113A 106 25.6 78 25 92 EQUAL 17P116A 104 25 47 15 75.5 GREATER 18N117A 241 58 132 42.5 186.5 MINOR 19L119A 115 27.8 72 23 93.5 EQUAL 20G120A NC NC NONE 21R121A 135 32.4 43 13.8 124 47.3 101 EQUAL 22N123A 157 37.9 154 49.7 155.5 MINOR 23N124A 125 30.2 113 36.2 119 EQUAL 24Y216A 386 93 32 10.3 106.5 40.8 175 LESS 25Q130A 52 12.5 26 8.2 39 MAJOR 26Q25A 55 13.3 41 13 48 HIGHER 27D26A 81 19.5 79 25.5 80 EQUAL The EC50 values expressed as a percentage of Wild Type EC50 and the current EC50 values are shown < 80% more powerful; 80-120% equal power; > 120% less power than the wild type. NC - uncalculated Examination of this table shows that those mutants that are substantially different from wt in the ELISA are also less potent in the sPAP assay; 6-L13A; 10-L17A; 22-N123A and the fourth, 23-N124A falls just inside the equal power degree by the arbitrary registration system. Thus both types of test show good agreement. Several of the mutants were less "potent" than the wild type when activating sPAP production but there was no variation between the two experiments, except in these mutants (Q16A, Q20A, G12-0A) that did not activate the sPAP of all. The results of the tests indicate that G120A, Q16A and Q20A effect the-OSM link with gpl30. N123A and N124A also appear to have some effects on interactions with gpl30.

Example 10: Role of OSM in gastritis H. pyroli is a gram-negative spiral-shaped bacterium that has been implicated in the cause of gastritis, peptic ulcer disease and gastric cancer. Strains of H. pyroli Cag + have higher incidence with ulcers than strains of H. pyroli Cag- (more pathogenic Cag +, and Cag-) are co-cultivated in-vitro with the gastric epithelial cell line KATO III (ECACC) for To investigate the response of the host with H. pyroli infection by means of differential gene expression analysis. The mRNA was isolated at the time points: 45 min, 3 hours and 24 hours, the radioactive tests derived were hybridized with arrays of high density cDNA gene (contains approximately 136 genes of human including cytokines, cytokine receptors and adhesion molecules). The analysis of the expression profiles of the obtained gene revealed the induction / repression of numerous genes in response to the H. pyroli strains. It was found that Oncostantin M was induced in cells exposed to the highly pathogenic strain of H. pyroli (Cag +) compared to cells exposed weekly to pathogenic H. pyroli (Cag-) or untreated control cells.

It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present invention.

Having described the invention as above, the content of the following is claimed as property.

Claims (10)

Claims

1. The use of an OSM antagonist for the manufacture of a medicament for the treatment of inflammatory arthropathy of an inflammatory disorder.

2. The use according to claim 1 wherein the antagonist is an antagonist for human OSM.

3. The use according to claim 2 wherein the antagonist interacts with one or more of the residues G120, Q16, Q20, N123 or N124 of human OSM.

4. The use according to any of the preceding claims wherein the antagonist is a small inorganic molecule.

5. The use according to any of claims 1-3 wherein the antagonist is an antibody.

6. The use according to claim 5 wherein the antibody is humanized or is chimerized.

7. The use according to any of the preceding claims wherein the medicament is used to prevent or reduce the release of cartilage collagen.

8. The use according to any of the preceding claims for the treatment of rheumatoid arthritis.

9. The use according to any of the preceding claims • wherein the antagonist is et? ~ Combination with an immunosuppressive agent, tolerance inducer, anti-inflammatory.

10. The use according to claim 9 wherein the antagonist is in combination with the cell inhibitory agent CD4 + T, an anti-CD23 antibody or a TNF antagonist.