MXPA00009241A - Compositions and methods for early pregnancy diagnosis - Google Patents

Abstract

Pregnancy-associated glycoproteins (PAGs) are structurally related to the pepsins, thought to be restricted to the hoofed (ungulate) mammals and characterized by being expressed specifically in the outer epithelial cell layer (chorion/trophectoderm) of the placenta. By cloning expressed genes from ovine and bovine placental cDNA libraries, the inventors estimate that cattle, sheep, and most probably all ruminant Artiodactyla, possess possibly 100 or more PAG genes, many of which are placentally expressed. The PAGs are highly diverse in sequence, with regions of hypervariability confined largely to surface-exposed loops. Selected PAG that are products of the invasive binucleate cells, expressed highly in early pregnancy at the time of trophoblast invasion and expressed weakly, if at all, in late gestation are useful in the early diagnosis of pregnancy. In a preferred embodiment, the invention relates to immunoassays for detecting these PAGs.

Description

COMPOSITIONS AND METHODS FOR EARLY EARLY DIAGNOSIS BACKGROUND OF THE INVENTION I. FIELD OF THE INVENTION The present invention relates in general to the fields of veterinary medicine, biology and the diagnosis of reproduction. More specifically, the present invention relates to the use of analytical methods to detect early stages of pregnancy.

II. RELATED TECHNIQUE The diagnosis of pregnancy is an important component in the stable management of reproduction, particularly in the dairy industry (Oltenacu et al., 1990), in which a large proportion of artificial inseminations fail (Streenan and Diskin, 1986) . For a long time, a reliable and simple pregnancy test for cattle has been sought. Various procedures are available, including the progesterone assay in milk (Oltenacu et al., Markusfeld et al., 1990), estrone sulfate analysis (Holdsworth et al., 1982, Warnick et al., 1995), rectal palpation ( Hatzidakis et al., 1993), ultrasound (Beal et al., 1992; Cameron and Malmo, 1993) and blood tests with specific antigens of pregnancy. Among them, the progesterone test in milk is the most cost effective for the producer (Oltenacu et al., 1990, Markusfeld et al., 1990). Followed by the procedure of rectal palpation, performed on day 50 (Oltenacu et al., 1990). While all procedures are potentially useful, all have failed for expectations in terms of their practical use, in the field. For example, measurements of progesterone in milk or serum around days 18-22 give unacceptably high rates of false positives (Oltenacu et al., 1990, Markusfeld et al., 1990). Rectal palpation can be used to detect pregnancy as early as day 35, but this procedure can lead to 5-10% or more of embryo mortality (Oltenacu et al., 1990, Hatzidakis et al., 1993). Rectal palpation on day 50 causes less damage to embryos, but has a marginal economic value due to the advanced pregnancy (Oltenacu et al., 1990). Ultrasonography has an advantage over rectal palpation in terms of accuracy, particularly before day 45 (Beal et al., 1992, Cameron and Malmo, 1993), but the instrument is expensive, its use requires considerable training and There is a limited risk to the animal. A related procedure, Doppler sonography, is more accurate than rectal palpation (Cameron and Malmo, 1993), but again requires well-trained personnel. The presence of estrone sulfate in urine or serum provides another test but is only useful after day 100 as the concentrations increase (Holdsworth et al., 1982, Warnick et al., 1995).

The discovery of pregnancy-specific protein B (PSP-B) (Butler et al., 1982) provided a new approach in the diagnosis of pregnancy since it could be detected in the blood of pregnant cows around the fourth week of pregnancy. pregnancy (Sasser et al., 1986; Humblot et al., 1988). Two other groups have developed immunoassays that are based on an identical or immunologically similar antigen (Zoli et al., 1992a, Mialon et al., 1993, Mialon et al., 1994). In the first case, the antigen (Mr ~ 67 kDa) was called pregnancy-associated glycoprotein in bovine (boPAG, now boPAG-1) (Zoli et al., 1992a); in the second case, it was called pregnancy protein 60 (PSP60) (Mialon et al., 1993, Mialon et al., 1994). The immunoassay for PSP-B / boPAG1 / PSP60 has two advantages. First, it allows pregnancy to be detected at a relatively early stage. Second, the interpretation of the assays does not require knowledge of the exact date of service, since the immunoreactive boPAG-1 molecules are always present in the maternal serum of pregnant cows around day 28 and the concentrations increase as the virus progresses. pregnancy (Sasser et al., 1986; Mialon et al., 1993; Mialon et al., 1994). However, two important disadvantages of this procedure persist. First, the positive diagnosis in the fourth week of pregnancy continues to be somewhat uncertain because the antigen concentrations in the blood are low and somewhat variable. Second, the concentrations of boPAGI increase markedly towards the end (Sasser et al., 1986, Zoli et al., 1992a, Mialon et al., 1993) and, due to the long half-life of the molecule (Kiracofe et al., 1993), the antigen can still be detected 80-100 days after calving (Zoli et al., 1992a, Mialon et al., 1993, Mialon et al., 1994, Kiracofe et al., 1993), compromising diagnosis of pregnancy in cows raised within the early post-calving period. Therefore, the test can only be carried out in dairy cows on the 30th day if an artificial insemination ("Al") was performed on or after the 70th post-parturition date. A pregnancy test is needed that can be carried out early in pregnancy and that will reliably provide a definitive indication of whether or not it is necessary to carry out a new breeding or selection of animals. In general, the Al is satisfactory in less than 50% of cases and the producer must rely on the obvious signs of return estrus (which are easily overlooked) or delay rearing to confirm the pregnancy failure by one of the methods described above. Such delays are extremely costly and constitute a significant loss for the industry. On the North Island of New Zealand alone, more than two million cows are reared in a period of six weeks. Accurate knowledge of the state of pregnancy of these animals will be an invaluable aid for said and other dairy industries throughout the world. It is evident that in this field the need persists for a precise, sensitive and convenient pregnancy test in cattle that can be carried out towards the end of the third week after insemination.

BRIEF DESCRIPTION OF THE INVENTION Therefore, one of the objectives of the present invention is to provide a sensitive and accurate test for early pregnancy. With the use of PAGs selected as biochemical markers, the present invention provides an early pregnancy test in which PAG antigen: a) is abundantly reduced at an early stage and, preferably, does not rekindle, pregnancy b) is a product of the binucleated cell and absent or not present in significant quantities after calving and c) has a minimal cross-reaction with late PAG products that can remain in the maternal serum during the post-calving interval. The early immunoassay will be particularly useful in the dairy industry, where animals are usually confined for at least part of the day and where intensive management is practiced. It is also likely that a modified test will be of value in the captive breeding programs of other animals, for example, between ruminants, okapi or giraffe and possibly also for other non-ruminant species. Therefore, in a particular preferred embodiment, a method is provided for detecting pregnancy in a bovine animal comprising obtaining a sample from the animal; and the detection of at least one of the antigens associated with pregnancy (PAG), where the PAG is present at the beginning of the pregnancy and absent at approximately two months of post-parturition, whereby the presence of the PAG indicates that the animal is pregnant. Insemination is usually, but not invariably, carried out about two months after calving in dairy cattle, until satisfactory conception results are achieved. The detection method can be applied within 15 days after insemination and conveniently between 20 and 25 days after insemination. Given these facts, the window of time for the disappearance of a useful PAG is approximately two months after the calving, although an earlier disappearance is also advantageous. However, PAGs that remain up to about 65, about 70, about 75, about 80, about 85, about 90, about 95 or about 100 days after parturition are also useful. However, the exact day for this determination may vary depending on individual circumstances, given the descriptions in this document, and the skilled artisan will understand the meaning of evaluating the absence of PAG during this period and may determine that day. For example, if the insemination takes place at a later date than 60 days post-parturition, PAGs with a later disappearance profile may be useful. Therefore, it is considered that the PAG of the present invention is detectable at an early stage of pregnancy but it is not detectable at two months postpartum. In addition, it should be understood that the PAG indicative of an early pregnancy may be absent in late stages of pregnancy or present in markedly lower amounts than those found in the early stages of pregnancy (for example, between day 15 and day 30). of pregnancy). In particularly preferred embodiments, the PAG can be selected from the group consisting of PAG2, PAG4, PAG5, PAG6, PAG7, and PAG9. In more preferred embodiments, the PAG can be, independently BoPAG2, BoPAG4, BoPAG5, B0PAG6, BoPAG7, BoPAG9, boPAG7v; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 20 or boPAG 21. In particular aspects of the present invention, the sample may be saliva, serum, blood, milk or urine. Methods of collecting samples are well known to those skilled in the art, for example, blood can be collected by syringe from a vein of the tail or other blood vessel, milk is extracted from the udder. Saliva and urine are also collected by well-known techniques. In defined embodiments, it is contemplated that the detection comprises an immunological detection. In preferred embodiments, the immunological detection comprises the detection of BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG7v; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21 with polyclonal antiserum. In alternative embodiments, the immunological detection comprises detection of BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAGT, boPAG7v; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21 with a monoclonal antibody preparation. Immunological detection methods are well known to those skilled in the art; in a particular preferred embodiment, the immunological detection may comprise an ELISA assay, in other alternative embodiments, the immunological detection comprises Western blots. In certain aspects of the present invention, the method for detecting pregnancy may further comprise detection of a second PAG in the sample. The second PAG can be selected from the group consisting of BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG7v; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 2. Alternatively, the second PAG can be any other glycoprotein associated with the pregnancy used in the detection of pregnancy, for example, PAG1. In the same way, the present invention contemplates a pregnancy detection method that also comprises the detection of a third PAG in the sample. In those modalities that use ELISA as an immunological technique, it is contemplated that the ELISA can be a sandwich ELISA comprising the binding of a PAG to a first antibody preparation fixed to a substrate and a second antibody preparation labeled with an enzyme. The sandwich ELISA is well known to those skilled in the art. In particularly preferred embodiments, the enzyme may be alkaline phosphatase or horseradish peroxidase. In other embodiments, the first antibody preparation can be a monoclonal antibody preparation.

Other aspects of the present invention contemplate an antibody composition that reacts immunogeologically with BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG 7v; boPAGTv; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21. In particularly preferred embodiments, an antibody composition that reacts immunologically with BoPAG2 is contemplated. Other embodiments provide an antibody composition that reacts immunologically with BoPAG4. Other additional modalities provide an antibody composition that reacts immunologically with BoPAGd. Still other embodiments contemplate an antibody composition that reacts immunologically with B0PAG6. Other embodiments contemplate an antibody composition that reacts immunologically with BoPAG7. Still other modalities contemplate an antibody composition that reacts immunologically with BoPAGT. It is considered that the antibody composition can be a monoclonal antibody composition or a polyclonal antibody composition. The present invention further provides a hybridoma cell that secretes a monoclonal antibody that reacts immunologically with BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG7v; boPAG9v; boPAGI d; boPAG16; boPAG17; boPAG18; boPAG19; boPAG20 or boPAG21. A method for making a monoclonal antibody for BoPAG4, BoPAGd, BoPAGd, BoPAG7, boPAG 7v; boPAG9v; boPAGId; boPAG16; boPAG, 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21 comprising the steps of immunizing an animal with a BoPAG preparation; obtain antibody-secreting cells from the immunized aminal; immortalize the antibody-secreting cells; and identifying an immobilized cell that secretes antibodies that immunologically bind with the immunizing BoPAG. Another aspect of the present invention provides a method for identifying a pregnancy associated glycoprotein (PAG) which is an early indicator of pregnancy in an euterio animal, comprising the steps of obtaining a cDNA library prepared from the placenta of the animal. between day 1 and day 30 of pregnancy, and hybridize the library under conditions of high stringency with a nucleic acid probe derived from PAG; whereby the hybridization of the probe makes it possible to identify the PAG. The present invention also provides a method for identifying a pregnancy associated glycoprotein (PAG) which is an early indicator of pregnancy in an euterio animal comprising the steps of: obtaining an RNA preparation from the placenta of the animal between days 15 and 30 of the pregnancy; and carrying out an RT-PCR ™ with the preparation using primers derived from PAG; whereby the amplification allows to identify the PAG. In particularly preferred embodiments, the PAG detected in cattle (Bos taurus) may be one or more of the following PAGs that are known to be produced at an early stage of pregnancy, namely: BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG7v; boPAG9v; boPAG15; boPAG16; boPAG17; boPAG18; boPAG19; boPAG20 or boPAG21. More specifically, bovine PAGs that can be detected comprise the sequence of one or more of the following amino acid sequences: SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID N °: 30 and SEQ ID N °: 32; SEQ ID N °: 40; SEQ ID N °: 42; SEQ ID N °: 44; SEQ ID N °: 46; SEQ ID N °: 48; SEQ ID N °: 50; SEQ ID N °: 52; SEQ ID N °: 54; SEQ ID NO: 56. When applied to other species, the present invention will allow the detection of other PAGs produced at the time when the trophoblast (pre-placenta) begins to attach or to implant in the uterine wall of the mother. The "early" PAGs of these species may present a cross-immunological reaction with the PAGs that are useful in the early detection of pregnancy in cattle. The present invention contemplates an isolated and purified BoPAG2 polypeptide. In a preferred embodiment, the BoPAG2 polypeptide comprises the sequence of SEQ ID No.:25. In addition, the invention contemplates an isolated and purified BoPAG4 polypeptide. In particularly preferred embodiments, the BoPAG4 polypeptide comprises the sequence of SEQ ID NO: 27. Another embodiment contemplates an isolated and purified BoPAGd polypeptide. A particularly preferred BoPAGd polypeptide comprises the sequence of SEQ ID NO: 29. Still another embodiment provides an isolated and purified BaPAG6 polypeptide. In preferred embodiments, the B0PAG6 polypeptide comprises the sequence of SEQ ID No.:29. Another embodiment contemplates an isolated and purified BoPAG7 polypeptide. An especially preferred BoPAG7 polypeptide comprises the sequence of SEQ ID NO: 30. The present invention further contemplates an isolated and purified BoPAG9 polypeptide. In preferred embodiments, the BoPAG9 polypeptide comprises the sequence of SEQ ID No.:32. The present invention further contemplates an isolated and purified BoPAG7v polypeptide. In preferred embodiments, the BoPAG7v polypeptide comprises the sequence of SEQ ID NO: 40. The present invention further contemplates an isolated and purified BoPAG9v polypeptide. In preferred embodiments, the BoPAG9v polypeptide comprises the sequence of SEQ ID NO: 42. The present invention further contemplates an isolated and purified BoPAG15 polypeptide. In preferred embodiments, the BoPAG15 polypeptide comprises the sequence of SEQ ID NO: 44. The present invention further contemplates an isolated and purified BoPAG 16 polypeptide. In preferred embodiments, the BoPAG 16 polypeptide comprises the sequence of SEQ ID NO: 46. The present invention further contemplates an isolated and purified BoPAG17 polypeptide. In preferred embodiments, the BoPAG17 polypeptide comprises the sequence of SEQ ID NO: 48. The present invention further contemplates an isolated and purified BoPAG polypeptide. In preferred embodiments, the BoPAG polypeptide 18 comprises the sequence of SEQ ID NO: dO. The present invention further contemplates an isolated and purified BoPAG 19 polypeptide. In preferred embodiments, the BoPAG19 polypeptide comprises the sequence of SEQ ID NO: 62. The present invention further contemplates an isolated and purified BoPAG20 polypeptide. In preferred embodiments, the BoPAG20 polypeptide comprises the sequence of SEQ ID NO: 64. The present invention further contemplates an isolated and purified BoPAG21 polypeptide. In preferred embodiments, the BoPAG21 polypeptide comprises the sequence of SEQ ID NO: 56. Alternative embodiments of the present invention define an isolated and purified nucleic acid encoding BoPAG2. In particularly preferred embodiments, the nucleic acid encoding BoPAG2 comprises the sequence of SEQ ID NO: 2. In other preferred embodiments, the nucleic acid that modifies BoPAG2 encodes a BoPAG2 polypeptide comprising the sequence of SEQ ID No.:2d . Another embodiment provides an isolated and purified nucleic acid encoding BoPAG4. In preferred embodiments, the nucleic acid encoding BoPAG4 comprises the sequence of SEQ ID NO: 4. In other equally preferred embodiments, the nucleic acid encoding BoPAG4 encodes a BoPAG4 polypeptide comprising the sequence of SEQ ID No.:27. In yet another embodiment, an isolated and purified nucleic acid encoding BoPAGd is contemplated. In preferred embodiments, the nucleic acid encoding BoPAG comprises the sequence of SEQ ID NO: d. In other preferred embodiments, the nucleic acid encoding BoPAGd encodes a BoPAGd polypeptide comprising the sequence of SEQ ID NO: 28. In yet another aspect of the present invention there is provided an isolated and purified nucleic acid encoding B0PAG6. In particular preferred aspects, the nucleic acid encoding BoPAGd comprises the sequence of SEQ ID N °: 6. In particularly preferred embodiments, the nucleic acid encodes a B0PAG6 polypeptide comprising the sequence of SEQ ID No.:29. invention also contemplates an isolated and purified d nucleic acid encoding BoPAG7. In preferred modalities, the nucleic acid comprises the sequence of SEQ ID NO: 7. In other preferred embodiments the nucleic acid encodes a BoPAG7 polypeptide comprising the sequence of SEQ ID NO: 30. Still another embodiment contemplates an isolated and purified acid that 0 encodes BoPAG9. In particular embodiments, the nucleic acid encoding BoPAG9 comprises the sequence of SEQ ID No. 9. In other particularly preferred embodiments, the nucleic acid encoding BoPAG9 encodes a BoPAG9 polypeptide comprising the sequence of SEQ ID No.:32. Yet another embodiment contemplates an isolated and purified nucleic acid encoding BoPAG7v. In particular embodiments, the nucleic acid encoding BoPAG7v comprises the sequence of SEQ ID NO: 39. In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a BoPAG7v polypeptide comprising the sequence of SEQ ID No.:40. Yet another embodiment contemplates an isolated and purified nucleic acid encoding BoPAG9v. In particular embodiments, the nucleic acid encoding BoPAG9v comprises the sequence of SEQ ID NO: 41. In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a BoPAG9v polypeptide comprising the sequence of SEQ ID NO: 42. Yet another embodiment contemplates an isolated and purified acid encoding BoPAGI d. In particular embodiments the nucleic acid encoding BoPAG15 comprises the sequence of SEQ ID NO: 43. In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a boPAGI d polypeptide comprising the sequence of the SEQ ID NO: 44. Yet another embodiment contemplates an isolated and purified nucleic acid encoding B0PAGI 6. In particular embodiments, the nucleic acid encoding B0PAGI 6 comprises the sequence of SEQ ID N °: 4d.

In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a B0PAGI 6 polypeptide comprising the sequence of SEQ ID NO: 46. Yet another embodiment contemplates an isolated and purified nucleic acid encoding boPAG17. In particular embodiments, the nucleic acid encoding BoPAG17 comprises the sequence of SEQ ID NO: 47.

In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a BoPAG17 polypeptide comprising the sequence of SEQ ID No.:48. Yet another embodiment contemplates an isolated and purified nucleic acid encoding BoPAG 18. In particular embodiments the nucleic acid encoding B0PAGI8 comprises the sequence of SEQ ID No.:49.

In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a B0PAGI8 polypeptide comprising the sequence of SEQ ID NO: 60. Still another embodiment contemplates an isolated and purified nucleic acid encoding BoPAG19. In particular embodiments, the nucleic acid encoding BoPAG19 comprises the sequence of SEQ ID NO: 5. In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a BoPAG19 polypeptide comprising the sequence of SEQ ID No.:52. another embodiment contemplates an isolated and purified nucleic acid encoding BoPAG20. In embodiments the nucleic acid encoding BoPAG20 comprises the sequence of SEQ ID No.:63. In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a BoPAG20 polypeptide comprising the sequence of SEQ ID No.:64. another embodiment contemplates an isolated and purified nucleic acid encoding BoPAG21. In particular embodiments, the nucleic acid encoding BoPAG21 comprises the sequence of SEQ ID NO: dd. In other particularly preferred embodiments, the nucleic acid encoding BoPAG7v encodes a BoPAG21 polypeptide comprising the sequence of SEQ ID NO: 66. Oligonucleotides comprising at least 1 d consecutive base pairs of any sequence are also contemplated herein. which encodes PAG, or a complement to it, described in this document. Particularly contemplated is an oligonucleotide comprising at least 16 consecutive bases approximately of the sequence of SEQ ID NO: 9, or the complement thereof. In other embodiments, the oligonucleotide is about 20 bases in length. An oligonucleotide comprising at least 16 consecutive bases approximately of the sequence of SEQ ID NO: 7, or the complement thereof is also contemplated. Other embodiments contemplate an oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 6, or the complement thereof. Still other embodiments provide an oligonucleotide comprising at least 16 consecutive bases approximately of the sequence of SEQ ID NO: d, or the complement thereof. In yet another embodiment, an oligonucleotide comprising at least 1 d consecutive bases approximately of the sequence of SEQ ID N °: 4, or the complement thereof is contemplated. Still another embodiment contemplates an oligonucleotide comprising at least about 1 d consecutive bases of the sequence of SEQ ID NO: 2, or the complement thereof. Still another embodiment contemplates an oligonucleotide comprising at least 1d consecutive bases approximately of the sequence of SEQ ID NO: 39 or the complement thereof. Yet another embodiment contemplates an oligonucleotide comprising at least 16 consecutive bases approximately of the sequence of SEQ ID NO: 41, or the complement thereof. Yet another embodiment contemplates an oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 43, or the complement of it. Yet another embodiment contemplates an oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 4d or the complement thereof. Yet another embodiment contemplates an oligonucleotide comprising at least 16 consecutive bases approximately of the sequence of SEQ ID NO: 47, or the complement thereof. Yet another embodiment contemplates an oligonucleotide comprising at least about 1 d consecutive bases of the sequence of SEQ ID No.:49, or the complement thereof. Yet another embodiment contemplates an oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 51, or the complement thereof. Yet another embodiment contemplates an oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No.:63, or the complement thereof. Yet another embodiment contemplates an oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 5d, or the complement thereof. Of course it should be understood that oligonucleotides of greater lengths are also contemplated, including oligonucleotides of 17,18,19,20,21, 22,23,24,26,30,36,40,46,60 or more consecutive base pairs. of length. The present invention also provides a [jiiego] kit comprising a first preparation of monoclonal antibodies that immunologically binds BoPAG2, BoPAG4, BoPAG5, B0PAG6, BoPAG7, BoPAG9, boPAG7v; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21; and as a suitable container means thereto, it is contemplated that in particular embodiments, the kit may further comprise a second preparation of monoclonal antibodies that immunologically binds to the same boPAG as the first monoclonal antibody, but where the first and second monoclonal antibodies they join different epitopes; and as a means a suitable container for it. In particular preferred aspects, the first antibody preparation is bound to a support. It is contemplated that the support can be any support that is routinely used in immunological techniques. In particularly preferred embodiments, the support can independently be a polystyrene plate, a test tube or a rod. In particular embodiments, the second antibody preparation comprises a detectable label. The detectable label can be, independently, a fluorescent label, a chemiluminescent label or an enzyme. In a particular defined modality, the enzyme is alkaline phosphatase or horseradish peroxidase. In other preferred embodiments, the kit may also comprise a substrate for the enzyme. In other embodiments, the kit may further comprise a buffer or a diluent; and as a means a suitable container for it.

In another embodiment, a kit is provided that includes a first antibody composition that binds immunologically to BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG7v; boPAGTv; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21; and as a medium a suitable container for the same as well as a second antibody composition that immunologically binds to the same boPAG as the first antibody composition, but the compositions of the first and second antibodies bind to different epitopes; and in this defined kit a suitable container for it is included as a medium. More specifically, this aspect of the invention encompasses a second antibody composition that includes a detectable label. Other components of the kit, including reservoirs for reagents, instructions and the like are well known to those skilled in the art and their use in the kits described herein is also contemplated. In other embodiments, a method is provided for detecting pregnancy in a non-bovine eutheric animal, comprising obtaining a sample from the animal, and detecting at least one of the antigens associated with the pregnancy (PAG) in the sample. , where the PAG is present in early stages of pregnancy, whereby the presence of the PAG indicates that the animal is pregnant. The PAG may be absent after a post-parturition period. As used herein, the term "absent" means that it is not present according to a given detection method. In other modalities the PAG may decrease after paticion. As used in this document, "decrease" means that it falls to levels that are not detectable or barely detectable according to a given protocol. In a particular preferred embodiment, the PAG can be selected from the group consisting of PAG2, PAG4, PAGd, PAG6, PAG7 and PAG9. In various modalities, the animal in which the pregnancy is determined, can include all the artidactyls, including the family Suidae (pigs and related species) and Camellidae (camels). It is contemplated that the animal may belong to the sub-order Ruminants. In more defined modalities, they are Ruminants that belong to the Bovidae family. In more particular modalities, the animal is a goat or a sheep. In other modalities, the animal may belong to the order Perisodactyla. In preferred embodiments, the animal may be a horse or a rhinoceros. In alternative preferred embodiments, the animal belongs to the Carnivorous order. More particularly, the animal can be a species of canines or felines. Even more particularly, the animal can be a dog or a cat. In other modalities, the animal can be a human being or a panda. Other objects, features and advantages of the present invention will be apparent from the following detailed description. It should be understood, however, that the specific detailed description, insofar as they are indicators of the preferred embodiments of the invention, are only offered for illustrative purposes, since various changes and modifications that are within the spirit and scope of the invention will be evident. for those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE FIGURES The following figures form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood with reference to one or more of these figures, in combination with the detailed description of the specific embodiments indicated in this document. Figure 1 are aligned amino acid sequences of different boPAGs each structure was deduced from the corresponding cDNA sequences. The probable signal sequence is underlined and a known cleavage site of the propeptide sequence (ISG RG / DS) is shown for some PAGs (vertical arrow). Many additional sequences are known, some of cDNAs that do not contain the complete ORF, others differ in less than 5% in the nucleotide sequence of those that are shown. The numbering at the end of the rows is by amino acid residue starting with the Meti. The numbers in parentheses show the equivalent pepsin residue. The tables indicate the sequences conserved around the catalytic residues of aspartic acid (Asp32 and Asp 215). GenBank access codes for boPAGI up to boPAG12 are M73961, L06 151, L06 153 and AF020506 through AF 0206 14, respectively. Figure 2 are aligned sequences of different GG amino acids ovPAGs see the legend of fig. 1 for the details. The GenBank access codes for ovPAGI to ovPAG9 are M73961, U30261 and U94789 to U94795, respectively. Figure 3 is a summary of the cloning data for boPAG expressed in bovine placenta from days 19 and 25 early boPAG clones were identified by three independent procedures. The numbers indicate the isolated amount of clones of identical sequence in each procedure. First, a bovine cDNA library from day 25 was examined by homologous hybridization (Hibrid) with a probe composed of ov, bo and poPAGI and 2, as well as eqPAG cDNA. Sixteen clones were completely purified and sequenced with full-length cDNA. An immunological (immuno) analysis of the library was then performed with anti-boPAGI antiserum and 19 clones were purified and partially sequenced. A reverse transcription was performed with placental RNA from a Holstein cow on day 19, which was then amplified by PCR ™ (RT-PCR ™). The PCR ™ products were subcloned and partially sequenced. It can be noted that most of the early boPAG was identified by homologous hybridization. Figure 4 are paired members of the amino acid and nucleotide sequences of bovine PAG. The data show the percentage of nucleotide identity (shading) and the percentage of sequence identity of translated (non-shaded) amino acid sequences. Figure 5 is a phylogram based on amino acid sequences showing the ratio of all the known cloned PAGs with common proteases of mammalian aspartic acid. The tree was constructed with the Distances and GrowTree programs of Wisconsin GCG. The lengths of the branches are proportional to the degree of amino acid diversity between pairs of proteins. Symbols of the PEPA_pig protein databank, porcine pepsinogen A; PEPF_rabbit, pepsinogen F of rabbits. Figure 6 is Southern genomic DNA transfer of selected species of ruminant and non-ruminant ungulates and a member of the Carnivora family (Panda) was digested with EcoRl DNA and probe tests were performed using the boPAGI probe. The DNA size markers are on the left. Some DNA samples, for example, from Suffolk sheep and Mulé deer were analyzed twice.

DETAILED DESCRIPTION OF THE PREFERRED MODALITIES I. The present invention Despite the availability of various tests to detect pregnancy, there remains a need to provide improved assays for early and accurate pregnancy detection, especially in cattle reared within two or three months after birth. birth or less. In the context of the present invention, the preferred species is bovine. The present invention makes it possible to identify various polypeptides expressed by the placenta, known as pregnancy-associated glycoproteins (PAG), which can be used to make an early and accurate diagnosis of pregnancy in cattle and other animals. Other embodiments include the development of reagents from these polypeptides, and their corresponding genes, for use in assays intended to detect pregnancy. Extrapolation to other closely related and unrelated species extends the application of these methods. For use according to the present invention, the selected PAGs are those that: a) are abundantly produced in the early stage of pregnancy and preferably not in late stages, b) are a product of a binucleated cell and that are absent or not present in significant quantities after calving, and c) present a minimal cross-reaction with late PAG products that may persist in the maternal serum during the post-calving interval. In addition, the PAG should be detectable in serum at sufficient concentrations for simple and rapid detection. Finally, PAGs must have the capacity for the reproducible production of polyclonal and monoclonal antibodies in the appropriate host species. The rest of the description explains various characteristics of the invention and its implementation.

II. Glycoproteins associated with pregnancy The placenta is the distinctive structure of eutherian mammals. Although it is not the mammal organ most conserved from an anatomical point of view, however, it is undoubtedly the most diverse (Haig, 1993). Placentation ranges from the invasive hemocorionic type, as in humans, where the surface of the trophoblast is in direct contact with maternal blood, to the epitheliocorionic type (for example, in pigs), where the uterine epithelium is not eroded (Amoroso , 1962). The placenta not only has a highly variable structure, but also produces polypeptide hormones that vary between species (Haig, 1993, Roberts et al, 1996). For example, no group of mammals other than the higher primates possess a chorionic gonadotrophin homologous to hCG for the luteal support in the early stages of pregnancy and until now only ruminant ungulates are known for their production of type I interferon as antiluteolítica hormone (Roberts et al, 1996). Placentation in ruminants, such as cattle and sheep, is superficial, relatively noninvasive, and known as cotyledonary sinepileliocoriónico (Wooding, 1992). The term 'sinepiteliocoriónico' describes the fetomaternal syncytium formed by the fusion of the binucleated cells of the trophoblast and the uterine epithelial cells, whereas 'cotyledonary' describes the main structure of the placenta and specifically the crests of the trofoblast villi (cotyledons) that they insinuate themselves towards the crypts of the maternal caruncles. These regions of fetal cotyledons and interdigitated and partially fused maternal caruncles constitute the placentas and are the main sites for the exchange of gases and nutrients in the placenta. The binucleated cells, which make up about 20% of the superficial epithelial cells (trophoectoderm) migrate and fuse with the maternal uterine epithelial cells and pour their secreted products directly into the maternal system. Among these products are the placental lactogens (Wooding, 1981) and the glycoproteins associated with pregnancy (Zoli et al, 1992a). The glycoproteins associated with cattle pregnancy (boPAG), also known by several different names, including pregnancy-specific protein B (Butler et al, 1982), were discovered when trying to develop pregnancy tests for cattle (Sasser et al. , 1986; Zoli et al, 1991; Zoli et al, 1992a). Rabbits were injected with placental cotyledons extracts and untargeted antibodies against placental antigens were separated by adsorption with tissue extracts from nonpregnant animals. The resulting antisera provided the basis for a precise pregnancy test for cattle and sheep as early as one month after insemination. Xie et al, (1991) used an antiserum directed against purified boPAG from cattle and sheep to search late-placental tissue cDNA libraries. The full-length cDNAs shared 86% identity of nucleotide sequences with each other and an unexpected 60% identity with the pepsinogens. The boPAGs had mutations in and around their active sites that would make them inactive as proteinases (Xie et al, 1991, Guruprased et al, 1996). The similarities with pepsin A (-50% amino acid identity) and chemosin (-45%) in the primary structure have allowed the construction of atomic models of (ov) PAG1 of d ovinos and boPAGI (Guruprasad et al, 1996). Both molecules possess the typical bilobed structure of all known eukaryotic aspartic proteinases and possess a cleft, between the two lobes, capable of accommodating peptides of up to 7 amino acids in length. The models strongly suggested that both ovPAGI and boPAGI can bind to the 0 pepsin inhibitor, pepstatin, a prediction that has been proven. Even in the initial studies (Butler et al, 1982, Zoli et al, 1991, Xie et al, 1991, Xie et al, 1994, Xie et al, 1996), it became clear that boPAGs were heterogeneous in terms of charge and molecular weight, and as more isoforms have been purified they have become evident, differing in their ad terminal amino sequences (Atkinson et al, 1993, Xie et al, 1997a). Other searches in libraries have allowed the identification of additional transcripts in ruminants (Xie et al, 1994, Xie et al, 199d, Xie et al, 1997b) and the existence of PAG in non-ruminant species, such as pigs (Szafranska et al, 1996). and horses (Guruprasad et al, 1996). 0 Despite its apparent lack of proteolytic activity, all PAG whose amino terminal sequences have been determined are processed in a manner typical of other aspartic proteases, such as pepsin (Davies, 1990). For example, a propeptide of most PAGs, which constitutes the first 38 amino acids of the secreted form and which is usually folded in the region of the active site, has been harvested from the secreted forms of PAG. Therefore, the calculated molecular weight of mature, non-glycosylated PAG, ie, without the signal propeptide sequence, would be -36,000 daltons and circulating serum antigen would not have this segment either. The observed molecular weight of the secreted PAG, however, is much larger, ranging from 45,000 daltons to 90,000 daltons (Xie et al, 1991, Sasser et al, 1989, Xie et al, 1996), probably due to extensive glycosylation (Holdsworth et al, 1982). There are probably multiple boPAG genes in the bovine genome that contribute to the three-phase alterations of PAG concentrations in maternal serum.

A. BoPAG 1 Bovine PAG1 (bo) was initially identified as a single placenary antigen generating antiserum to total bovine placenta extracts (Zoli et al, 1991). It is a product of the binucleated cells of the trophoblast (Xie et al, 1991, Zoli et al, 1992b) that constitute the invasive component of the placenta (Wooding, 1992, Guillomot, 1995). In 1991, cDNA was identified for both boPAGI and ovine PAG1 (ovPAGI) (Xie et al, 1991). Unexpectedly, PAG1 belongs to the gene family of aspartic proteinase (AP), a grouping that includes pepsin, chemosin, renin and cathepsins D and E (Guruprased et al, 1996). Unlike other members of the AP family, both ovPAGI and boPAGI appear to be enzymatically inactive, since the catalytic domain in the active site region is mutated (Xie et al, 1991; Guruprasad et al, 1996). The BoPAGI gene contains 9 exons and 8 introns (Xie et al, 1996), an organization identical to that of other mammalian aspartic genes. Southern genomic transfer with a probe spanning exon 7 and exon 8, which represent the most conserved region of PAG relative to other APs, indicated that many PAG genes probably existed. In addition, when tests were carried out with probes in bovine genomic libraries with the boPAGI cDNA, 0.06% of positive phage plaques were identified, which suggests that there may be 100 or more PAG genes in the bovine genome (Xie et al, 1995 ). This approach has recently been confirmed with several different approaches (Xie et al, 1997b). The levels of boPAGI, or related molecules, that cross-react with a boPAG-1 antiserum are very low around day 21 to day 27 (Wamick et al, 1996, Beal et al, 1992, Cameron and Malmo, 1993; et al, 1982), are maintained at a higher but still low concentration, until around day 100 of pregnancy and then rise rapidly to -100 ng / ml. After the concentrations remain relatively constant until the last four months of pregnancy where they constitute peaks of 1 pg / ml of serum or more, just before calving. Another explanation of the three-phase profile of boPAGI immunoreactivity is that the expression of boPAGI is very low in early stages of pregnancy, increases considerably towards the middle of gestation and presents peaks before calving (Sasser et al, 1986; Zoli et al. al, 1992a, Patel et al, 1995). As an alternative, the presence of immuno-active antigens in very early stages of pregnancy may be due to the production of other boPAGs. The increase in the second quarter may reflect the production of yet another different class of boPAG or possibly the beginning of a low expression of PAG1. The exponential increase in boPAG just before calving could represent a sudden increase in the synthesis of one or more molecules related to boPAGI or a greater "escape" through a more permeable utero-placental junction. Immunochemistry and in situ hybridization analyzes have shown that boPAGI and ovPAGI, and the most related molecules (since antiserum and probes can not be expected to be monospecific), are located in binucleated cells (Xie et al, 1991; Zoli et al, 1992b). In contrast, the antigenically distinctive boPAGI is predominantly expressed in the mononuclear cells of the trophoectoderm (Xie et al, 1994). In ruminants, binucleated cells constitute the invasive components of the trophoblast and do not appear until around day 13 in sheep and day 17 in cattle (Wooding, 1992). Then they will increase their amount quickly. Around day 21 in cattle constitute up to 20% of the cells in the trophoectoderm and a high percentage actively fuses with the epithelial cells of the maternal uterus (Wooding, 1992, King et al, 1980, Guillomot, 1996). Granules of binucleated cells, containing PAG1 (Zoli et al, 1992b), are discharged from the fusion cell into the maternal stroma and its capillary network. Therefore, the products of binucleated cells have easy access to maternal circulation.

B. New species of ovPAG and boPAG In accordance with the present invention, the cDNA of a series of new boPAGs has been identified and cloned (Figure 1). A similar large family, (ov) PAG of sheep, has been identified from sheep placenta (Xie et al, 1991, Xie et al, 1997a, Xie et al, 1997b, Fig. 2). Some of the boPAGs are useful in the early detection of pregnancy in cattle. These molecules are homologous to, but different from, boPAGI (Xie et al, 1991, Fig. 1, Fig. 3). The inventors now estimate that there are at least 100 genes related to PAG in cattle, and the inventors have already fully cloned or partially sequenced at least 20 different cDNAs (including 10 complete cDNAs of early pregnancy). Apparently, the PAG constitute a polymorphic group (Xie et al, 1994, Xie et al, 1996, Xie et al, 1997a, Xie et al, 1997b), whose members show variable degrees of cross-immunoreactivity or do not present any cross-reaction with the antiserum that was developed. Some of the cloned PAGs are only expressed in the binucleated cells of the placenta (see example 3). It is known that these cells fulfill an endocrine function (Wooding, 1992). For example, they produce placental steroids and lactogens.

However, the functions of the family members of the PACs are unknown, although they enter the maternal circulation. An important aspect of the present invention is that the PAGs are not expressed uniformly throughout the pregnancy (see example 4). Some are in the early stage of pregnancy, while others are expressed in more advanced stages. For example, PAGs that are most strongly expressed in invasive binucleated cells at the time of implantation are not dominant in late pregnancy. Conversely, boPAGI (PSP-B) (Xie et al, 1991, Butler et al, 1982, Sasser et al, 1986) is primarily a product of the binucleate cells of late placenta and the antiserum generated against it is not can recognize the dominant PAG produced by binucleated cells in early pregnancy. Therefore, the test developed by the other groups and based on boPAG1 / PSP-B / PSP60 (Butler et al, 1982, Sasser et al, 1986, Zoli et al, 1992a, Mialon et al, 1993, Kiracofe et al, 1994 ) only has a marginal utility in early pregnancy because the antigen is produced in extremely small amounts, if at all, at that time. The expression pattern of boPAGI also helps to explain the concentration profile of the measured antigen in serum, At term, the levels may exceed d pg / ml, on the day 40, when the placental development in terms of size almost it has been completed, the concentrations are around 10 ng / ml, that is, 600 times less.

Some of the new boPAGs described in this invention (boPAG 4, 5, 6, 7 and 9), which possess the sequences of SEQ ID NO: 27 SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 32, are present on day 25 of pregnancy. These PAGs are expressed in the invasive binucleated cells that release their secretory granules in the capillary bed of the maternal uterus (see example 3). Among these five, boPAG4 seems to cross-react with the late pregnancy PAG, boPAGI, which has formed the basis of previous pregnancy tests (see example 1). By virtue of their early expression, these PAG can be detected by conventional immunological techniques in the physiological fluids of heifers or cows (especially in serum, urine and milk) in order to detect the presence of one or more fetuses in the uterus before of the 30th day of pregnancy. In this way, the presence of these antigens provides an early diagnostic test for pregnancy in cattle. Similar observations have been made about the diversity of PAGs, the location of the different PAGs in mononuclear and binucleated cells and the probable variable times of PAG expression in sheep (Xie et al., 1991; Xie et al., 1997a Xie et al., 1997b). Due to the large number of genes observed in other species (Figure 6) these observations can probably also be applied to other Artiodactyla.

C. Structural, functional and evolutionary aspects of PAGs PAGs belong to the gene family of aspartic proteinases (Xie et al., 1991; Xie et al., 1994; Xie et al., 1995), although the inventors do not consider that they are necessarily active as proteolytic enzymes. The cDNAs of these antigens (called pregnancy associated glycoproteins or PAG) were cloned from the early placenta and expressed in various systems in order to produce recombinant products. Active aspartic proteinases, which include various pepsins, chemosins, cathepsins E and D and renin, are grouped in the central branches of the tree. These include eqPAGI, which is paired with rabbit F-pepsinogen. EqPAGI is an active proteinase after the excision of the propeptide (Green et al., 1998) and therefore it may be the homologue in pepsin F horse. Unfortunately, very little is known about pepsinogen F; it was cloned from the stomach of neonatal rabbits (Kageyama et al., 1990), but its pattern of general expression in the fetus has not been studied to date, nor has pepsinogen F been described in any other species. BoPAGI and 2 occupy an intermediate position between enzymatically functional aspartic proteinases and PAGs of cattle and sheep. In this last group, boPAGd, boPAGIO and ovPAGd are the three most distant gene products, possibly the oldest identified up to now. The most related to them are ovPAG2 and boPAG2, 11 and 12. As determined by in situ hybridization analysis, their genes are expressed both in the mononuclear cells as well as in the larger invasive binucleate strains of the outer trophorectum layer. of the placenta. The rest of the PAG genes, ovPAGI, 3, 4, 6, 7, 8, and 9 and boPAG 1, 3, 4, 5, 6, 7, and 9, with a divergence smaller than the previous group, present an expression strictly specific for binucleated cells. Since binucleated cells are a typical feature of the trophoectoderm of the synepitheliocorionic placentas of pecoran ruminants (suborder: Ruminants) (Wooding, 1992), it is tempting to speculate about a relatively recent divergence of genes related to PAG1. If the entire family of PAG genes arose through a series of relatively recent duplications during the diversification of the two-toed ungulates (Artiodactyla), it could be assumed that the expected lengths of the branches leading to a PAG were relatively short. Instead, many are long, far exceeding the distance between cathepsin E from humans, rabbits and rats (Figure 8), whose divergence spans more than 100 million years of evolutionary time. There seem to be two possible explanations. One is that the recent theory about the origin is incorrect and that the duplication of the PAG took place early in the diversification of mammals. The second is that the genes doubled later but accumulated mutations at a very high rate. Early diversification seems unlikely in view of the fact that large numbers of members of the gene family of aspartic proteinases have not been described in rodents or humans despite considerable efforts to clone them (Birch and Loh, 1991). . The data of the inventors for the horse (Perisodactyla) and the cat (Carnivora) indicate that there is only a limited (and possibly a single) amount of PAG genes expressed in each species. Therefore, the inventors support the concept of a late and rapid diversification of the PAG within the Artiodactyla. In this sense, the relationship between ovPAG2 and boPAG 1 1 (94% at the amino acid level) suggests that they are functional homologs. These genes are the closest relationship of all the PAGs shown in FIG. 8, despite the separation of species that occurred around 18 million years ago (Miyamoto et al., 1993). The analysis (Nei, 1987; Li, 1993) of nucleotide substitutions within identical (silent) mutations regions by identical site (Ks) with respect to non-identical mutations (substitution) by non-identical site (Ka) in comparison paired between all PAGs it has an average of 1.18 ± 0.27 (mean ± SD). A more detailed examination indicates that within the highly conserved regions the ratio of Ks to Ka is high, while it is low in the regions that encode hypervariable loops. For example, the ratio of Ks to Ka has an average of 3.07 ± 1.08 for the 29 highly conserved codons that encode the buried carboxyl end of the molecules. On the contrary, the value for the preceding 21 codons, which are hypervariable and which encode the two loops (291-296 and 281-287) shown in FIG. 5B, is 0.53 ± 0.18. Therefore, mutations that alter amino acids have accumulated more rapidly than silent mutations. Mutations that lead to changes in amino acids are much more likely to be harmful and therefore to be eliminated, but not identical changes. For this reason the Ks / Ka relations are, in general, greater than 2.0 (Ohta, 1992). The PAGs seem to be exceptional in this sense, since the data suggest that their great variability has occurred as a result of a positive selection. Other related aspartic proteases, such as ovine and bovine chemosins, which are enzymes whose coding regions are 96% identical in sequence (Moir et al., 1982; Pungercar et al., 1990) despite 18 million years of separation (Miyamoto et al., 1993), exhibit a ratio of Ks to Ka of 2.47, a value greater than double with respect to the average PAG pair. The only PAG pair that has a value comparable to that of chemosins is that of the proteins ovPAG2 and boPAG11 (with a ratio of 2.92) whose relationship has been discussed previously (Figure 8) and which can be functional homologs. Equine PAG and rabbit pepsinogen F, both active enzymes, provide a value of 2.61. probably these genes have also acquired a function that is less tolerant to changes in surface loop regions than PAGs in general. In a more general context, the evolution of multigene families has been the subject of varying recent reviews (Ohta, 1996, Hughes, 1994, Fryxell, 1996). They all agree that most of the duplicated genes are likely to be lost quickly or that they accumulate as pseudogenes, as a result of a Darwinian "purification" selection, unless they acquire a new function. With this argument it must be assumed that individual PAGs are not only functional molecules, but each one fulfills a different function. Hughes (1994) has suggested that we must first acquire a weak bifunctionality before duplication of genes and that, once duplicated, the genes are separated by a burst of amino acid substitutions that allow a specific function to fix and improve. It is likely that these mutations are acquired by a combination of non-identical point mutations and by gene conversion events that are likely to occur easily between structurally similar genes that are closely related (Ohta, 1996). Genetic drift and natural selection ensure the retention of those mutations that are not harmful. At this time it is not possible to estimate the types of mutational changes that contributed to the greater diversity of PAG. Fryxell (1996) has suggested that the retention of a duplicate gene generally requires the presence of a family of pre-existing or similarly evolving complementary molecules with which the products of the duplicated genes can interact. Among the best-known families of rapidly evolving genes are the immunoglobulins, the T cell receptors and the MHC antigens, the cytochrome p450 system and the olfactory receptors. In each of these cases, diversification is linked to a more accurate ability to bind to particular ligands. For PAGs, it is tempting to assume that their function is related to their ability to bind to peptides, although a function comprising some structural feature other than the slit, such as the prbpeptide or carbohydrate, can not be ruled out. Although the regions around the two catalytic aspartyl residues are generally conserved in all aspartic proteinases (Davis, 1990; Takahashi et al., 1996), substitutions elsewhere can strongly influence the peptides that achieve access to the catalytic center, clearly evident when comparing the excessively narrow specificity of renin with that of pepsin A. Reorganization of the site of combination of an antibody against a hapten of nitrophenyl phosphate as it evolved from its germline precursor, led to an affinity for the ligand 30,000 times greater and only comprised a bundle of amino acids, many of which were in one location on the surface of which they were in direct contact with the ligand (Wedemayer et al., 1997). The small additive changes in the packing of the loops provided a combination site capable of enclosing the hapten much more efficiently. Presumably, similar events could modify the peptide binding gap of the PAGs and provide molecules with a considerable range of specificities.

D. Variants of the PAGs It is contemplated that according to the present invention, variants of the PAGs can be used for various uses. These changes may improve stability or function, for example, antigenicity or immunoreactivity. It may be convenient to create fusion proteins or variants by substitution, insertion or deletion from the identified PAGs. The deletion variants lack one or more of the residues of the native protein. Insertional mutants typically comprise the addition of material at a non-terminal point in the polypeptide. This may include the insertion of an immunoreactive epitope or simply a single residue. The terminal additions are fusion proteins. Substitution variants typically contain the exchange of one amino acid for another at one or more sites within the protein and can be designed to modulate one or more of the properties of the polypeptide, such as stability against proteolytic cleavage, without loss of other functions or properties. Substitutions of this type can be called "conservative", that is, an amino acid is substituted by another of similar shape and charge. Conservative substitutions are well known in the art and include, for example, changes of alanine by serine, arginine by lysine; asparagine by glutamine or histidine; aspartate for glutamate; glycine by proline; histidine by asparagine or glutamine; isoleucine by leucine or valine; leucine by valine or isoleucine; lysine by arginine; methionine by leucine or isoleucine; phenylalanine by tyrosine, leucine or methionine; serine by threonine; threonine by serine; tryptophan by tyrosine; tyrosine by tryptophan or phenylalanine; and valine by isoleucine or leucine. The following is a discussion based on the amino acid changes of a protein in order to create an equivalent molecule or even an improved, second-generation molecule. For example, certain amino acids may be substituted by other amino acids in the structure of the protein without an appreciable loss of the ability of interactive binding with structures such as, for example, antigen-binding regions of the antibodies or binding sites on the molecules of substrate. Since it is the interactive ability and the nature of a protein that define the biological functional activity of said protein, certain amino acid substitutions can be made in the sequence of a protein, and its underlying DNA coding sequence, and still obtain a protein with similar properties. Therefore, the inventors contemplate that various changes can be made in the DNA sequences of the genes without appreciable loss of their usefulness or biological activity, as will be described below. Table 1 shows the codons that encode the particular amino acids. Another embodiment for the preparation of polypeptides according to the invention is the use of peptidomimetics. Mimetics are molecules that contain peptides that mimic the elements of the secondary structure of the protein. See, for example, Johnson et al., Peptide Turn Mimetics "in BIOTECHNOLOGY AND PHARMACY, Pezzuto et al., Eds., Chapman and Hall, New York (1993) .The rational rationale for the use of peptidomimetics is that the peptide structure of The proteins exist primarily to orient the amino acid side chains in such a way that molecular interactions, such as those between antibodies and antigens, are facilitated.A peptidomimetic is expected to allow molecular interactions similar to that of the natural molecule. principles can be used, together with the principles indicated above, to manipulate second generation molecules that have many of the natural properties of PAGs, but with altered and even improved characteristics.

E. Purification of proteins It is convenient to purify the various PAGs identified by the inventors or variants thereof. Protein purification techniques are well known to those skilled in the art. These techniques comprise, at one level, the crude fractionation of the cellular environment into polypeptide and non-polypeptide fractions. Once the polypeptides are separated from the other proteins, the polypeptide of interest can be further purified using chromatographic and electrophoretic techniques in order to achieve partial or complete purification (or purification to homogeneity). Particularly suitable analytical methods for the preparation of a pure peptide are ion exchange chromatography, exclusion chromatography; electrophoresis on polyacrylamide gel; isoelectric focus. A particularly efficient method for purifying peptides is protein liquid chromatography or even HPLC. Some aspects of the present invention relate to the purification, and in particular embodiments, the substantial purification, of an encoded protein or an encoded peptide. The term "purified protein or peptide" as used herein, refers to a composition, which can be isolated from other components, wherein the protein or peptide is purified to any degree relative to the state in which it can be obtained. naturally. Therefore, a purified protein or peptide also refers to a protein or a peptide, free of the medium in which it can appear naturally. In general, the term "purified" refers to a composition of proteins or peptides that has been fractionated in order to eliminate the other components, and where the composition substantially retains its expressed biological activity. When the term "substantially purified" is used, this designation will refer to a composition in which the protein or peptide constitutes the main component of the composition, such as constituting about 50%, about 60%, about 70%, About 80%, about 90%, about 95% or more of the proteins in the composition. There are various methods for quantifying the degree of purification of the protein or peptide that will be known to those skilled in the art in the light of the present disclosure. These include, for example, the determination of the specific activity of a fraction by SDS / PAGE analysis. A preferred method for evaluating the purity of a fraction is to calculate the specific activity of the fraction, in order to compare it to the specific activity of the initial extract and thus calculate the degree of purity, evaluated in this document by means of a "quantity of Purified times "(ie, 2 times, 5 times, 10 times, 50 times, 100 times, 1000 times, etc.). The actual units used to represent the amount of activity will, of course, depend on the particular assay technique chosen for the purification and whether the protein or the expressed peptide exhibits a detectable activity. Those skilled in the art are aware of the various techniques that are suitable for use in protein purification. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation or acid pH of contaminating proteins, followed by centrifugation; chromatography steps such as, ion exchange, gel filtration, reversed phase, hydroxy I to patita and affinity chromatography; isoelectric focus; gel electrophoresis; and combinations of these and other techniques. As is generally known in the art, it is considered that order can be changed to carry out the various steps of purification or that certain steps can be omitted and still result in a suitable method for the preparation of a protein or a peptide substantially purified.

There are no general requirements that the protein or peptide is always provided in its most purified state. Moreover, it is contemplated that less purified products will be useful in some modalities. The partial purification can be carried out using a combination of fewer purification steps or using different forms of the same general purification scheme. For example, it is considered that the use of cation exchange column chromatography with HPLC equipment will generally result in more purification times than the same technique using a low pressure chromatography system. Methods that have a lower degree of relative purification may have advantages in the total recovery of the protein product or in the maintenance of the activity of an expressed protein. It is a known fact that the migration of a polypeptide can vary, sometimes significantly, with different SDS / PAGE conditions and according to the degree of glycosylation (Capaldi et al., 1977). Therefore, it should be taken into account that under different electrophoresis conditions, the apparent molecular weights of the purified or partially purified expression products can vary. High pressure liquid chromatography (HPLC) is characterized by a very fast separation with an extraordinary resolution of peaks. This is achieved thanks to the use of very fine particles and high pressure to maintain a fast flow rate. The separation can be achieved in a few minutes or at the most one hour. Moreover, only a very small volume of sample is needed because the particles are so small and so packed that the volume of the free space constitutes a very small fraction of the volume of the bed. In addition, it is not necessary that the concentration of the sample is very large because the bands are so narrow that very little dilution of the sample occurs. Gel chromatography or molecular sieve chromatography is a special type of partition chromatography that is based on molecular size. The theory behind gel chromatography is that the column, which is prepared with tiny particles of an inert substance containing small pores, separates the larger molecules from the smaller molecules as they pass through or around the pores, depending on its size. As long as the material that makes up the particles does not absorb the molecules, the only factor that determines the flow velocity is size. Therefore, the molecules are eluted from the column in decreasing size, as long as the shape is relatively constant. The chromatography on gel is insurmountable for the separation of molecules of different size because the separation is independent of all other factors, such as pH, ionic strength, temperature, etc. There is virtually no absorption, there is less zone dispersion and the volume of elution is related to molecular weight. Affinity chromatography is a chromatographic process that is based on the specific affinity between the substance to isolate a molecule with which it can bind specifically. This is an interaction of the receptor-ligand type. The material of the column is synthesized by covalent coupling of one of the binding members to an insoluble matrix. The material of the column can then specifically absorb the substance of the solution. Elution takes place by changing the conditions for those in which no union occurs (alteration of pH, ionic strength, temperature, etc.). A particular type of affinity chromatography that is useful in the purification of carbohydrate-containing compounds is chromatography with lectin affinity. Lectins are a class of substances that bind to a variety of polysaccharides and glycoproteins. The lectins are usually coupled to the agarose with cyanogen bromide. Conconavalin A coupled to Sepharose was the first material of this class to be used and widely used in the isolation of polysaccharides and glycoproteins. Other lectins that have been used are lentil lectin, wheat germ agglutinin, which has been useful in the purification of N-acetyl glucosaminyl residues, and Helix pomatia lectin. The lectins themselves are purified using affinity chromatography with carbohydrate ligands. Lactose has been used to purify peanut and castorine lectins; Maltose has been useful in the extraction of lectins from lentils and nanjea; N-acetyl-D-galactosamine is used to purify soybean lectins; N-acetyl glucosaminyl binds to wheat germ lectins; D-galactosamine has been used to obtain clam and L-glucose binds to lotus lectins. The matrix must be of a substance that by itself does not adsorb molecules to any significant degree and that has a wide range of chemical, physical and thermal stability. The ligand must be coupled in such a way that it does not affect its binding properties. The ligand must also provide a relatively strong bond. And it should be possible to elute the substance without destroying the sample or the ligand. One of the most common forms of affinity chromatography is immunoaffinity chromatography. The generation of antibodies that are suitable for use in accordance with the present invention is described below.

F. Synthetic peptides The present invention also describes portions of peptides related to PAG for use in various embodiments of the present invention. Due to their relatively small size, the peptides of the invention can also be synthesized in solution on a solid support according to conventional techniques. There are several commercially available automatic synthesizers and can be used according to known protocols. See, for example, Stewart and Young, (1984); Tam et al., (1983); Merrifield, (1986); and Barany and Merrifield (1979), whose contents are incorporated in this document as a reference. Short peptide sequences, or overlapping peptide libraries, usually from about 6 to 35 to 60 amino acids, which correspond to the selected regions described herein, can be easily synthesized and then examined in assays designed to identify reactive peptides. . Alternatively, recombinant DNA technology can be employed, where a nucleotide sequence encoding a peptide of the invention is inserted into an expression vector, transformed or transfected into an appropriate host cell and cultured under conditions suitable for expression.

G. Antigen Compositions The present invention provides the use of PAG or peptides as antigens for the generation of monoclonal polyclonal antiserum for use in pregnancy detection. It is anticipated that some variant of a PAG, or portions thereof, will be coupled, joined, ligated, conjugated or chemically linked with one or more agents through linkers, polylinkers or derivatized amino acids. This can be done in such a way that a bispecific or multivalent vaccine composition is produced. It is further envisioned that the methods used in the preparation of these compositions will be familiar to those skilled in the art and should be suitable for administration to animals, ie, acceptable for pharmaceutical use. Preferred agents are vehicles such as limpet hemocyanin (KLH) or glutathione-S-transferase.

In order to formulate the PAGs for an immunization, it will generally be convenient to employ appropriate salts and buffers so that the polypeptides become stable. The aqueous compositions of the present invention comprise an effective amount of the PAG antigen for the host animal, dissolved or dispersed in an aqueous vehicle or medium acceptable for pharmaceutical use. Said compositions can be called nodules. The phrase "acceptable for pharmaceutical or pharmacological use" refers to molecular entities and compositions that do not produce adverse reactions, allergic or otherwise when not administered to an animal or a human being. As used herein, an "acceptable carrier for pharmaceutical use" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, agents that delay absorption and isotonic and the like. The use of said media and agents with pharmaceutically active substances is well known in the art. Unless any of the conventional media or agents are incompatible with the vectors or cells of the present invention, their use in the therapeutic compositions is contemplated. Complementary active ingredients can also be incorporated into the compositions. The compositions of the present invention may include the conventional pharmaceutical preparations. The administration of these compositions according to the present invention will be through any common route, as long as the target tissue can be reached through said route. These include oral, nasal, buccal, rectal, vaginal or topical administration. Alternatively, administration can be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Said compositions are usually administered as the compositions acceptable for pharmaceutical use, described above. PAGs can also be administered parenterally or intraperitoneally. Solutions of the active compounds such as the free base or as the salts acceptable for pharmacological use can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under normal conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. Pharmaceutical forms suitable for use as injectables include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that it facilitates application with syringes. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a dispersion medium or solvent containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol and the like), suitable mixtures thereof and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as a lectin, by maintaining the necessary particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be achieved by the use in the compositions of agents that delay absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the required amount of the PAGs in the appropriate solvent with the various additional ingredients listed above, as needed, followed by sterilization with filtration. In general, the dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle containing the dispersion medium and the other required ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are the techniques of vacuum drying and freeze drying, which allow obtaining powder of the active ingredient, plus any additional desired ingredient from a previously sterilized solution of the same.

The compositions of the present invention may be formulated in a neutral or saline form. Salts acceptable for pharmaceutical use include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acid, or organic acids such as acid acetic, oxalic, tartaric, mendélico and similar. Salts formed with free carboxyl groups can also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxide, and organic bases such as isopropylamine, trimethiamine, histidine, procaine and the like. For parenteral administration in an aqueous solution, for example, the solution should be adequately regulated if necessary and first the liquid diluent should be rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous media that can be used is known to those skilled in the art in the light of the present disclosure, for example, a dosage could be dissolved in 1 ml of isotonic NaCl solution and then can be completed up to 1000 ml of 0 fluid for hypodermoclysis or injected into the intended infusion site, (see for example, "Remigton's Phramaceutical Sciences" 15th Edition, pages 1036-1038 and 1570-1680). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for the administration will determine, in any case, the appropriate dose for the individual subject. Moreover, the preparations must comply with the standards of sterility, pyrogenicity, general safety and purity.

III. Nucleic acids A. Sequences encoding PAG The present invention provides, in another embodiment, genes encoding the various PAG polypeptides. Specifically, those that encode PAG2, PAG4, PAG5, PAG6, PAG7 and PAG9 are foreseen. Those nucleic acid sequences that encode the proteins possessing the sequences of SEQ ID No.:25, SEQ ID No.:27; SEQ ID N °: 28; SEQ ID N °: 29; SEQ ID N °: 30; and SEQ ID NO: 32 are encompassed by the present invention, as well as those polynucleotides that are described in SEQ ID NO: 2; SEQ ID N °: 4; SEQ ID N °: 5; SEQ ID N °: 6; SEQ ID N °: 7; and SEQ ID N °: 9. The present invention is not limited in its scope to these genes, however, since the person skilled in the art will be able, using these nucleic acids, to easily identify the related PAGs in several different species. Furthermore, it should be clear that the present invention is not limited to the specific nucleic acids described herein. As will be indicated below, a given "PAG gene" can contain a large variety of different bases and still produce the corresponding polypeptide that can not be functionally distinguished (i.e., antigenically, immunologically) and, in some cases structurally, from the genes described in this document. Similarly, any reference to a nucleic acid should be construed as also encompassing the host cell that contains d said nucleic acid and which, in some cases, has the ability to express the product of said nucleic acid. In addition to therapeutic considerations, the cells expressing the nucleic acids of the present invention may be useful in the context of a search for agents that induce, repress, inhibit, augment, interfere with, block, nullify, or stimulate or improve the detection capacity of the PAGs. The nucleic acids according to the present invention can encode a complete PAG gene, a PAG domain containing an important epitope or any other fragment of the PAG sequences described herein. Nucleic acid can be derived from genomic DNA, that is, it can be cloned directly from the genome of a particular organism. In preferred embodiments, however, the nucleic acid will comprise complementary DNA (cDNA). At a minimum, these and other nucleic acids of the present invention can be used as molecular weight standards in, for example, gel electrophoresis. 0 The term "cDNA" refers to a DNA prepared using messenger RNA (mRNA) as a template. The advantage of using a cDNA, compared to a genomic DNA or a polymerized DNA from a tempering of genomic, unprocessed or partially processed RNA, is that the cDNA contains primarily the coding sequences of the corresponding protein. There may be times when the use of complete or partial genomics is preferred. It is also contemplated that a given PAG of a species may be represented by natural variants that present slightly different nucleic acid sequences but which nonetheless code for the same protein (see Table 1). As used in this application, the term "nucleic acid encoding PAG" refers to a nucleic acid molecule that has been isolated from total nucleic acids. In preferred embodiments, the invention relates to a nucleic acid sequence essentially as shown in, for example, SEQ ID NO: 26; SEQ ID N °: 27; SEQ ID N °: 28; SEQ ID N °: 29; SEQ ID N °: 30; or SEQ ID N °: 32. The term "as shown in, for example, SEQ ID No.:25; SEQ ID No.:27; SEQ ID No.:28; SEQ ID No.:29; SEQ ID No.:30; or SEQ ID No.:32"means that the nucleic acid sequence corresponds substantially to a portion of SEQ ID No.:25; SEQ ID N °: 27; SEQ ID N °: 28; SEQ ID N °: 29; SEQ ID N °: 30; or SEQ ID NO: 32 respectively, the term "functionally equivalent codon", as used herein, refers to codons that encode the same amino acids, such as the six codons for arginine or serine (Table 1), and it also refers to codons that encode biologically equivalent amino acids, as described in the following pages: TABLE 1 Amino Acids Codons Alanine Wing A GCA GCC GCG GCU Cysteine Cys C UGC UGU Acid Asp D GAC GAU aspartic Acid Glu E GAA GAG Glutamic Phenylalanine Phe F UUCUUU Glycine Gly G GGC GGG GGU Histidine His H CAC CAU Isoleucine He I AUA AUC AUU Lysine Lys K AAA AAG Leucina Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG Aspargin Asn N AACAAU Proline Pro P CCA CCC CCG CCU Glutamine Gln Q CAÁ CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serina Ser S AGC AGU UCA UCC UCG UCU Treonine Thr T ACA ACC ACG ACU Valine Val V GUAGUCGUGGUU Tryptophan Trp W UGG Tyrosine Tyr and UAC UAU Taking into account the degeneracy of the genetic code, the sequences that have at least 50% approximately, usually at least about 60%, more usually about 70%, more commonly about 80%, preferably at least about 90% and most preferably about 95% of nucleotides that are identical to the nucleotides of FIG. 1, will be sequences "like those shown in Fig. 1". The sequences that are essentially the same as those shown in FIG. 1, can also be functionally defined as sequences that are capable of hybridizing with a segment of nucleic acids containing the complement of FIG. 1 under standard conditions. Naturally, the present invention also encompasses DNA segments that are complementary, or essentially complementary, to the sequence shown in FIG. 1. Nucleic acid sequences that are "complementary" are those that have the ability to pair at their bases according to the standard Watson-Crick complementarity rules. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, evaluated by the same nucleotide comparison as was just described, or that are defined as capable of hybridizing to the nucleic acid segment of SEQ ID No. 2; SEQ ID N ° 4; SEQ ID N °: 6; SEQ ID N °: 7; or SEQ ID N °: 9 under relatively stringent conditions, such as those described with this document. Said sequences may encode the complete PAGs encompassed in this document or functional or non-functional fragments thereof.

B. Fragments encoding PAG Alternatively, the hybridizing segments can be shorter oligonucleotides. Sequences of 17 bases in length should only appear once in the human genome and, therefore, will be sufficient to specify a single target sequence. While it is simpler to elaborate and increase the in vivo accessibility of the shorter oligomers, there are numerous other factors involved in the specificity of the hybridization. Both the binding affinity and the sequence specificity of an oligonucleotide with respect to its complementary target increase with a greater length. It is contemplated that examples of oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55 may be used. , 60, 65, 70, 75, 80, 85, 90, 95, 100 or more base pairs, although the use of others is also contemplated. The longer polynucleotides are also contemplated. Said oligonucleotides will be useful, for example, as a probe in Southern and Northern blots and as primers in the amplification reactions. These reagents are particularly useful in identifying structurally related PAGs.

Suitable hybridization conditions are well known to those skilled in the art. In some applications, for example, amino acid substitution by site-directed mutagenesis, it is considered that lower stringency conditions are necessary. Under these conditions, hybridization can take place even when the sequences of the probe and the target chain are not perfectly complementary, but they present mismatches in one or more positions. The conditions can become less astringent by increasing the salt concentration and decreasing the temperature. For example, a condition of medium astringency is obtained with NaCl 0.1 at approximately 0.25 M, at a temperature of 37 ° C to 55 ° C approximately, while a condition of low astringency can be obtained with salts at 0.15 M to approximately 0.9 M, at temperatures that vary in a range of 20 ° C to 5d ° C approximately. Accordingly, it is possible to easily manipulate the hybridization conditions and therefore it will generally be the method of choice depending on the desired results. In other embodiments, hybridization can be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl 2, 10 mM dithiothreitol, at temperatures between about 20 ° C and about 37 ° C. Other hybridization conditions used may include 10 mM Tris-HCl (pH 8.3), 50 mM KCl, approximately 1.5 μM MgCl 2, at temperatures ranging from about 40 ° C to 72 ° C. Formamide and SDS can also be used to alter the hybridization conditions.

As indicated above, one of the methods employing probes and recorders of the present invention is the search for genes related to the PAG comprised by the present invention or, more particularly, to PAG homologs from other species. The existence of the variety of homologies strongly suggests that other homologs will be discovered in different species. Normally, the target DNA will be a genomic or cDNA library, although the searches can include the analysis of RNA molecules: Variation in the astringency of the hybridization and the region of the probe, allow to discover different degrees of homology. Another way to use the probes and primers of the present invention is in site-directed or site-specific mutagenesis. Site-specific mutagenesis in a technique useful in the preparation of individual peptides or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA. The technique also provides the ability to prepare and test sequence variants, incorporating one or more of the aforementioned considerations, by introducing one or more changes in the nucleotide sequence of the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences that encode the DNA sequence with the desired mutation, as well as a sufficient amount of adjacent nucleotides, to provide a sequence sequence size and complexity sequence enough to form a stable pair on both sides of the suppression union that is going through. Typically, a primer of about 17 to 25 nucleotides in length, with alteration of about 5 to about 10 residues on either side of the junction of the sequence being altered, is preferred.

C. Vectors for cloning, gene transfer and expression In some embodiments, expression vectors can be used to produce PAGs that can then be purified and used, for example, to generate antisera or monoclonal antibodies with which additional studies are conducted. The expression requires the provision of appropriate signals in the vectors and that includes various regulatory elements, such as enhancers / promoters from viral and mammalian sources that direct the expression of the genes of interest in the host cells. The elements designed to optimize the stability and capacity to be translated from the messenger RNA in host cells are also defined. The conditions are also provided for the use of a number of selection markers with dominant drugs in order to establish permanent, stable cell clones that express the products, as well as an element that binds the expression of drug selection markers with the expression of the polypeptide. Throughout this application, the term "expression construct" includes any type of genetic construct comprising a nucleic acid encoding a gene product, in which a part or all of the nucleic acid encoding the sequence has the ability to be transcribed. The transcript can be translated into a protein, but it is not necessary for this to happen. In certain embodiments, expression includes both the transcription of a gene and the translation of the mRNA into a gene product. In other embodiments, the expression includes only the transcription of the nucleic acid encoding a gene of interest. In preferred embodiments, the nucleic acid encoding a gene product is under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or of the synthetic machinery introduced, necessary to initiate the specific transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the correct location and orientation relative to the nucleic acid to control the start of the RNA polymerase and the expression of the gene. Typically, the promoter is selected to achieve high levels of expression, such as the lac inducible promoter for use in E. coli, alcohol oxidase for yeast, CMV IE for various systems in mammals or the polyhedron promoter for Baculovirus. Other elements include polyadenylation signals, origins of replication, internal ribosome entry sites (I RES) and selection markers (eg, neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol).

The transfer of expression constructs into the cells is also contemplated in the present invention. Methods include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe at al., 1990) DEAE-dextran / Gopal, 1985), electroporation (Tur-Kaspa et al., 1986; Potter et al, 1984), direct microinjection (Harland and Weintraub, 1985), liposomes loaded with DNA (Nicolau and Sene, 1982, Fraley et al., 1976) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al., 1987), bombardment of genes using high-speed microprojectiles (Yang et al., 1990) and transfection measured by receptors (Wu and Wu, 1987, Wu and Wu, 1988). In some embodiments of the invention, the expression construct comprises a virus or a manipulated construct derived from a viral genome. The ability of certain viruses to enter cells through an endocytosis measured by receptors, to integrate into the genome of the host cell and to express viral genes stably and effitly has made them attractive candidates for gene transfer strangers in mammalian cells (Ridgeway, 1988; Nicolás and Rubenstein, 1988; BaichwaI and Sugden, 1986; Temin, 1996). The first viruses used as gene vectors were viruses to DNA, including papovaviruses (simian virus, bovine papillomavirus and polyoma) (Ridgeway, 1988; BaichwaI and Sugden, 1986) and adenoviruses (Ridgeway, 1988; BaichwaI and Sugden. , 1986). Retroviruses are a group of single-stranded RNA viruses characterized by their ability to convert their RNA into double-stranded DNA in infected cells through a process of reverse transcription (Coffin, 1990). The resulting DNA is stably integrated into cellular chromosomes as a provirus and direct the synthesis of viral proteins, making them attractive candidates for cell transformation. Other viral vectors may be employed as expression constructs in the present invention. Virus-derived vectors such as vaccinia virus (Ridgeway, 1988, BaichwaI and Sugden, 1986, Hermonat and Muzycska, 1984) and herpes viruses can be employed. They offer diverse attractive characteristics for diverse cells of mammals (Friedmann, 1989, Ridgeway, 1988, BaichwaI and Sugden, 1986, Coupar et al., 1988, Horwich et al., 1990). In another embodiment of the invention, the expression construct (and the PAGs) can be trapped in a liposome. Liposomes are vesicular structures characterized by a membrane of phospholipid bilayers and an aqueous internal medium. Multilamellar liposomes have multiple lipid layers separated by an aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo an automatic rearrangement before the formation of closed structures and trap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991).

IV. Generation of antibodies that react with PAGs In another aspect, the present invention completes an antibody that is immunoreactive with the PAG molecule of the present invention, or with any portion thereof. The antibody can be a polyclonal or monoclonal antibody composition, constituting both preferred embodiments of the present invention. The means for preparing and characterizing antibodies are well known in the art (see, for example, Harlow and Lane, 1988). Briefly, a polyclonal antibody is prepared by immunizing an animal with an immunogen comprising a peptide or a polypeptide of the present invention and collecting antisera from the immunized animal. A wide variety of animal spe can be used for the production of the antiserum. Typically, the animal used for the production of antisera in a non-human animal, including rabbits, mice, rats, hamsters, pigs or horses. Due to the relatively large blood volume of rabbits, said animal is the preferred choice for the production of polyclonal antibodies. Antibodies, both polyclonal and monoclonal, specific for the isoforms of the antigens can be prepared using conventional immunization techniques, generally known to those skilled in the art. The composition containing the antigenic epitopes of the compounds of the present invention can be used to immunize one or more experimental animals, such as a rabbit or a mouse, which will then produce the specific antibodies against the compounds of the present invention. The polyclonal antiserum can be obtained, once the time for the generation of antibodies has elapsed, simply by bleeding the animal and preparing the serum samples from whole blood. It is proposed that the monoclonal antibodies of the present invention will be useful in standard immunochemical methods, such as ELISA and Western blot methods and in immunohistochemical methods such as tissue staining, as well as in other methods that can employ specific antibodies for the antigenic epitopes related to PAG. In addition, it is proposed that monoclonal antibodies specific to the particular PAG of different species can be used in other useful applications. In general, both polyclonal and monoclonal antibodies against PAG can be used in various modalities. For example, they can be used in antibody cloning protocols to obtain cDNA or genes encoding other PAG polypeptides. They can also be used in inhibition studies to analyze the effects of PAG-related peptides on cells or animals. Anti-PAG antibodies will also be useful in immunolocalization studies to analyze the distribution of PAG polypeptides during various cellular events, for example, to determine the specific distribution of cells or cells of PAG polypeptides during different points in the cell cycle. A particular application of said antibodies is in the purification of native or recombinant PAG, for example, using an affinity column for the antibody. The operation of all such immunological techniques is known to those skilled in the art in the light of the present disclosure. The means for preparing and characterizing antibodies are well known in the art (see, for example, Harlow and Lane, 1988).; whose content is incorporated in this document as a reference). Other specific examples of preparation of monoclonal antibodies are described in the examples, below. As is known in the art, a given composition may vary in its immunogenicity. Therefore, it is often necessary to boost the host immune system, which can be achieved by coupling the immunogenic peptide or polypeptide to a vehicle. Examples of preferred vehicles are limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins, such as ovalbumin, mouse or rabbit serum albumin, can also be used as a carrier. Means for conjugating the polypeptide to a carrier protein. Means for conjugating the polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bi-biazotized benzidine. As is also known in the art, the immunogenicity of a particular immunogenic composition can be improved by the use of non-specific stimulators of the immune response, known as adjuvants. Examples of preferred adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed tuberculosis Mycobacterium), incomplete Freund's adjuvants and aluminum hydroxide adjuvant. The amount of immunogenic composition used in the production of polyclonal antibodies varies according to the nature of the immunogen as well as the animal used for immunization. Various routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal route). The production of polyclonal antibodies can be monitored by taking blood samples from the immunized animal at different intervals after immunization. A second boost of reinforcement may also be administered. The reinforcement and titling process is repeated until an adequate degree is obtained. When the desired level of immunogenicity is achieved, the immunized animal is bled and the serum is isolated and stored and / or the animal can be used to generate mAbs. The mAbs can be easily prepared by the use of well-known techniques, such as those described in the US patent. No. 4,196,265, the content of which is incorporated herein by reference. Typically, this technique comprises immunizing a suitable animal with a selected immunogenic composition, for example, a purified or partially purified PAG. The immunizing composition is administered in an effective manner to stimulate the antibody producing cells. Rodents, such as mice and rats, are the preferred animals, however, the use of rabbit, sheep or toad cells is also possible. The use of rats represents some advantages (Goding, 1986), but mice are preferred, BALB / c mice being the most preferred since they are the most used and generally allow a higher percentage of stable fusions to be obtained. After immunization, somatic cells with potential to produce antibodies, specifically B lymphocytes (B cells), are selected for use in the mAB generation protocol. These cells can be obtained from biopsies of spleen, tonsils or lymph nodes, or from a peripheral blood sample. Spleen cells and peripheral blood cells are preferred, the former because they constitute a rich source of antibody-producing cells that are in the dividing plasmablast phase and the latter because peripheral blood is very easy to obtain. Often, a panel of animals will be immunized and the spleen of the animal with the highest antibody titer will be removed and then the spleen lymphocytes are obtained by homogenizing the spleen with a syringe. Typically, the spleen of an immunized mouse contains approximately 5 x 10 7 to 2 x 10 8 lymphocytes. The B antibody-producing lymphocytes of the immunized animal are then fused with cells of an immortal cell, in general, one of the same species as that of the animal that was immunized. The lines of myeloma cells suitable for use in hybridoma-producing fusion processes are preferably non-antibody producing, which have a high fusion efficiency and enzymatic deficiencies that render them incapable of growing in certain selective media that only provide the conditions for the growth of the desired fused cells (hybridomas). Any of a number of myeloma cells known to those skilled in the art can be used (Goding, 1986; Campbell, 1984). For example, when the immunized animal is a mouse, P3-X63 / Ag8, P3-X63-Ag8.653, NS1 / 1.Ag 4 1, Sp210-Ag14, FO, NSO / U, MPC-1 may be used. , MPC11-X45-GTC 1.7 and S194 / 5XX0 Bul; for rats, R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210 can be used; and U-266, GM1500-GRG2. LICR-LON-HMy2 and UC729-6 are all useful in relation to cell fusions. Methods for generating hybrids of lymphoma cells of spleen or lymph node producing antibodies usually comprise the mixture of somatic cells with myeloma cells in a ratio of 2: 1, although the ratio can vary from about 20: 1 to 1: 1, respectively, in the presence of one or more agents (chemical or electrical) that promote the fusion of cell membranes. Fusion methods employing Sendai virus (Kohier and Milstein, 1975; 1976) and those employing polyethylene glycol (PEG), such as PEG 37% (v / v), by Geffer et al., (1977) have been described. . The use of electrically induced fusion methods is also appropriate (Goding, 1986).

Fusion procedures usually produce viable hybrids at low frequencies, around 1 x 10 ~ 6 to 1 x 10"8. However, this is not a problem, since viable fused hybrids differ from unfused progenitor cells ( in particular the unfused myeloma cells which usually continue to be divided indefinitely) by culture in a selection medium.The selection medium is generally such that it contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture medium. examples of preferred agents are aminopterin, methotrexate and azaserin.Aminopterin and methotrexate block the de novo synthesis of both purines and pyrimidines, while azaserine only blocks the synthesis of purines.When aminopterin or methotrexate is used, the medium is supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT medium) When azaserin is used, the medium is supple entained as hypoxanthine. The preferred selection means is HAT. Only cells capable of functioning with accessory pathways of nucleotides can survive in the HAT medium. The myeloma cells are defective in terms of key enzymes in the accessory pathway, for example, hypoxanthine phosphoribosyl transferase (HPRT), and can not survive in it. B cells can work with this pathway, but they have a limited life in culture and generally move within about two weeks. Therefore, the only cells that can survive in the selection medium are those hybrids formed from myeloma cell and B cells.

This culture provides a population of hybridomas from which specific hybridomas are selected. Typically, the selection of hybridomas is carried out by culturing the cells by dilution of a single as in microtiter plates, followed by evaluation of the individual clonal supernatants (after approximately two to three weeks) of the appropriate reactivity. The assay should be sensitive, simple and rapid, such as, for example, radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays, point immunounion assays and the like. The selected hybridomas are serially diluted and cloned into individual individual antibody producing cell lines, said clones can then be propagated indefinitely to provide mAbs. Cell lines can be used for mAb production in two basic ways. A sample of the hybridoma (often in the peritoneal amount) can be injected into a histocompatible animal of the type that was used to obtain the somatic and myeloma cells for the original fusion. The injected animal develops tumors secreting specific monoclonal antibodies produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites, can then be extracted to provide mAbs at a higher concentration. Individual cell lines can also be cultured in vitro, where mAbs are secreted naturally into the culture medium from which they can be easily extracted at high concentrations. The mAbs produced in either of the two forms can be further purified, if appropriate, using filtration methods, centrifugation and various chromatographic methods, such as HPLC or affinity chromatography.

V. Assays for PAG expression in pregnancy detection According to the present invention, the present inventors have determined that certain PAGs are advantageously expressed in early stages of pregnancy and, therefore, can be used as markers in the detection of pregnancy at an early stage. While the present invention is exemplified for cattle, its extension is contemplated to other species including sheep (eg deer, antelopes and giraffes), horses (Perissodáctila), and all other ungulate ruminants and even other related species more distantly (dogs , cats, humans). In addition, immunoassays can be qualitative or quantitative. In cattle, boPAGs can be used individually or in combination to provide a diagnostic evaluation of pregnancy. In accordance with the present invention these boPAGs comprise BoPAG2, boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21. Other boPAGs and PAGs from other species may be useful, for similar purposes, alone or in combination.

A. Immunological detection of pregnancy The present invention links the use of antibodies in the immunological detection of PAGs. Various useful immunodetection methods such as, for example, Nakamura et al., (1987, incorporated herein by reference) have been described in the scientific literature. Immunoassays, in their simplest and most direct sense, are binding assays. Certain preferred immunoassays are the various types of enzyme-linked immunosorbent assays (ELISAs) and radioimmunoassays (RIAs). Immunohistochemical detection using tissue sections is also particularly useful. However, it can be readily appreciated that detection is not limited to such techniques, and that Western blotting, dot blotting, FACS analysis and the like can also be used in connection with the present invention. In general, immuno-binding methods comprise obtaining a sample suspected of containing a protein, peptide or antibody, and contacting the sample with an antibody or protein or peptide according to the present invention, as the case may be, under effective conditions to allow the formation of immune complexes. According to the present invention, preferred samples are fluids such as for example milk, urine, blood, serum or saliva. Contacting the selected biological sample with the protein, peptide or antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes (primary immunocomplexes), is generally a matter of simply adding the composition to the sample and incubate a mixture for a period of time long enough for the antibodies to form immunocomplexes with PAGs. After this time the antibody-PAG mixture will be washed to remove any kind of non-specific antibody binding, allowing only those antibodies specifically bound within the primary immunological complexes to be detected. In general, the detection of immunocomplex formation is well known in the art and can be achieved by the application of numerous approaches. These methods are generally based on the detection of a label or label, such as any radioactive, fluorescent, biological or enzymatic label or label of standard use in the art. The United States patents concerning the use of said markers comprise 3,817,837; 3,850,762; 9,939,350; 3,996,345; 4,277, 437; 4,275,149 and 4,366,241, each of which is incorporated herein by reference. Of course, additional advantages can be found by the use of a secondary binding ligand such as for example a second antibody or a biotin / avidin ligand binding arrangement as is known in the art. Commonly, primary immunocomplexes can be detected by means of a second binding ligand that has binding affinity for PAG, or for the first specific antibody-PAG. In these cases the second binding ligand may be binding to a detectable label. The second binding ligand is often itself an antibody, which can therefore be termed a "secondary" antibody. The primary immunocomplexes are in contact with the secondary binding ligand, labeled, or antibody, under effective conditions and for a period of time sufficient to allow the formation of secondary immune complexes. Next, the secondary immunocomplexes are generally washed to remove any ligand or labeled secondary antibody, not specifically bound, and then the remaining mark is detected in the secondary immunocomplexes. Later methods comprise the detection of primary immune complexes through a two-step approach. A secondary binding ligand, such as for example an antibody that has binding affinity for the PAG or the anti-PAG antibody, is used to form secondary immunocomplexes, as described above. The secondary binding ligand contains an enzyme capable of processing a substrate to a detectable product, thereby increasing the signal over time. After washing, the secondary immune complexes are brought into contact with the substrate, allowing their detection.

B. ELISA As a part of the practice of the present invention, the principles of an enzyme-linked immunoassay (ELISA) can be used. Engvall and Perlmann (1971) introduced for the first time the ELISA that has become a powerful analytical tool that uses a variety of protocols (Engvall, 1980, Engvall, 1976, Engvall 1977, Gripenberg et al., 1978, Makler et al. , 1981; Sarngadharan et al., 1984). The ELISA allows the passive adsorption of substances in solid supports, such as plastic, to allow easy handling under laboratory conditions. For a comprehensive ELISA treatise, those skilled in the art are referred to as "ELISA"; Theory and Practice "(Crowther, 1995) .The sensitivity of the ELISA methods is dependent on the exchange of the enzyme used and the ease of detection of the enzyme reaction product.An increase in the sensitivity of these systems can be achieved. assay by the use of fluorescent and radioactive enzymatic substrates The immunoassays encompassing the present invention include, but are not limited to, those described in U.S. Patent No. 4,367,110 (non-clonal double antibody sandwich assay) and in the patent. No. 4,452,901 (Western blot) Other assays comprise immunoprecipitation of labeled ligands and immunocytochemistry, both in vitro and in vivo In a preferred embodiment the invention comprises a sandwich ELISA wherein the anti-PAG antibodies are immobilized on a selected surface such as, for example, in a cavity of a polystyrene microtiter plate or in a Next, a test composition suspected of containing PAGs, for example a clinical sample, is placed in contact with the surface. After binding and washing to remove binding junctions of immunocomplexes, not bound specifically, the bound antigen can be detected by a second antibody to the PAG. In another exemplary ELISA, the polypeptides in the sample are immobilized on a surface and then contacted with the anti-PAG antibodies. After binding and washing to remove non-specifically bound immunocomplexes, the bound antibody is detected. When the initial antibodies are bound to a detectable label, the primary immunocomplexes can be detected directly. Alternatively, immunocomplexes can be detected using a second antibody having a binding affinity with the first antibody, the second antibody being attached to a detectable label. Another ELISA in which the PAGs are immobilized involves, for their detection, the use of antibody competition. In this ELISA the labeled antibodies are added to the cavities, binding to the PAG is allowed, and it is detected by means of its marks. The amount of PAG in the sample is determined by mixing the sample with the labeled antibodies, before or during incubation with coated cavities. The presence of PAG in the sample, acts by reducing the amount of antibodies available to join the cavity, and therefore reduces the last signal. Regardless of the format used, ELISAs have certain characteristics in common, such as coating, incubation or binding, washing to eliminate non-specifically bound species, and detection of bound immunocomplexes. In the coating of a dish with either antigen or antibody, the cavities of the dish will generally be incubated with the antigen or antibody solution, either overnight or for a specified period of time. Then the cavities of the dish will be washed to remove incompletely absorbed material. Any remaining remnant surface of the cavities are then "coated" with a non-specific protein that is antigenically neutral relative to the test antiserum. These comprise, bovine serum albumin (BSA), casein and milk powder solutions. The coating allows the blocking of non-specific absorption sites of the immobilizing surface thereby reducing the basal levels caused by nonspecific binding of the antisera to the surface. In ELISAs, it is probably more common to use a secondary or tertiary detection means than a direct procedure. Therefore, after binding of a protein or antibody to the amount, of coating with a non-reactive material to reduce the basal levels, and of washing to remove unbound material, the immobilizing surface is brought into contact with the control of human cancer and / or clinical or biological sample to be tested under effective conditions to allow the formation of immunocomplexes (antigen / antibody). The detection of the immunocomplex then requires a labeled secondary binding ligand or antibody, or a second binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand.

"Under conditions effective to allow the formation of the immunocomplex (antigen / antibody)", it means that the conditions preferably comprise diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG), evaporated or powdered milk, and solution. buffe (PBS / tween). These agents also tend to contribute to the reduction of non-specific baseline levels. The "suitable" conditions also mean that the incubation is at a temperature and for a period of time sufficient to allow efficient binding. Typically the incubation steps are from about 1 or 2 hrs up to 4 hrs, at temperatures preferably of the order of 25 ° C to 27 ° C, or it can be overnight at about 4 ° C or the like. To provide detection methods, the second or third antibody will have an associated marker that allows detection. Preferably, this will be an enzyme that generates color development during incubation with an appropriate chromogenic substrate. Therefore, for example, it may be desirable to contact and incubate the first or second immunocomplex with an antibody conjugated with urease, glucose oxides, alkaline phosphatase, or hydrogen peroxidase, for a period of time and under conditions that promote the development of Subsequent immunocomplex formations (eg, incubation for 2 hrs at room temperature in a solution containing PBS such as Tween-PBS).

After incubation with the labeled antibody and after washing to remove the unbound material, the amount of label is quantified, for example pro incubation with a chromogenic substrate, such as urea and bromocresol purple or 2,2'-azido acid - di - (3-ethyl-benzothiasolin-6-sulphonic) [ABTS) and H2O2, in the case that the enzymatic label is peroxidase. The quantification is then carried out by measuring the degree of color generation, using for example a visible spectrum spectrophotometer. One variant of the ELISA is the enzyme-linked coagulation assay, or ELCA (U.S. Patent No. 4,668,621) which uses the coagulation cascade, combined with the RW-XA enzyme labeling as a universal detection system. The advantage of this system for the present invention is that the coagulation reactions can be carried out at physiological pH in the presence of a wide variety of buffers. It is therefore possible to preserve the integrity of complex analytes.

C. Immunohistochemistry Useful initially in a research context, immunohistochemistry can be useful according to the present invention to identify new PAGs. This involves the modality of tests of tissue blocks embedded in paraffin, both fresh frozen and fixed in formalin, prepared for the study of immunohistochemistry (IHC). For example, each tissue block consists of 50 mg of "pulverized" residual placental tissue. The method for preparing tissue blocks from these particular specimens has been successful in previous IHC studies of various prognostic factors, such as in breast, and is well known to those skilled in the art (Brown et al., 1990; Abbondanzo; et al., 1990; Allred et al., 1990). Briefly, frozen sections can be prepared by rehydrating 60 mg of frozen "pulverized" placental tissue at room temperature in buffer solution (PBS) in small plastic capsules; forming a pellet of the particles by centrifugation; resuspending them in a viscous inclusion medium (OCT); by inverting the capsule and returning to obtain a pellet by centrifugation; freezing instantly in isopentane at 70 ° C; cutting the plastic capsule and removing the frozen tissue cylinder; securing the tissue cylinder in the cryostrictic microtome holder; and cutting 2d - 60 serial sections containing an average of approximately 500 placental cells remarkably intact. The permanent sections can be prepared by a similar method involving the rehydration of 50 mg of sample in a plastic microcentrifuge tube; make a pellet; Resuspend in 10% formalin for a fixation of 4 hrs; wash / make a pellet; resuspend in 2.5% hot agar; make a pellet; cool in ice water to harden the agar; remove the tissue / agar block from the tube; infiltrate and include the block in paraffin; and cut up to 50 serial permanent sections.

D. Kits for immunodetection In subsequent embodiments, the invention provides immunological kits for use in the detection of PAGs in biological samples. Such kits generally comprise one or more PAGs or PAG binding proteins that have immunospecificity for several PAGs and for antibodies. More specifically, the immunodetection kits therefore comprise, in suitable containers, one or more PAGs, antibodies that bind to PAGs and antibodies that bind to other antibodies via Fc portions. In certain embodiments, the PAG or the anti-PAG primary antibody can be provided attached to a solid support, such as a matrix column or cavity of a microtiter plate. Alternatively, the support can be provided with a separate element from the kit. Reagents for immunodetection of the kit may include detectable labels that are associated with, or bound to the antibody provided or to the PAG itself. Detectable labels that are associated with, or adhered to, a second binding ligand are also contemplated. Said detectable labels comprise chemiluminescent or fluorescent molecules (rhodamine, fluorescein, green fluorescent protein, luciferase), radiolabels (3H, 35S, 32P, 14C, 131l) or enzymes (alkaline phosphatase, horseradish peroxidase). The kits may further comprise suitable standards of preset values, including both antibodies and PAGs. These can be used to prepare a standard curve for detection assays.

The kits of this invention, regardless of type, generally comprise packages in which the biological agents can be placed and preferably in suitable aliquots. The components of the kits can be packaged either in an aqueous medium or in the form of lyophilisate. The packaging means of the kits will generally comprise at least one vial, test tube, bottle, bottle or even syringe or other packaging means, in which the antibody or antigen can be placed, and preferably, suitable aliquots. In the case of providing a second or third container or other additional container in which the ligand or component can be placed. Kits of the present invention will typically also contain means for containing the antibody, PAG and any reagent container in closed receptacle for commercial sale. Said packages may comprise containers molded by injection or by blow, in which the desired vials are retained.

VII Method to identify additional PAGs Following the basic teachings of the examples, it will be possible to identify additional PAGs and, even more, to correlate their expression with early and late stages of pregnancy. This is done by obtaining various tissues (for example placenta) as described in the examples, and detecting therein, the presence of various PAG transcripts. One of the best known methods of nucleic acid amplification is the polymerase chain reaction (referred to as PCR ™), which is described in detail in US Pat. do not. 4,683,195; 4,683,202 and 4,800,159, and Innis et al., 1990, each of which is incorporated herein by reference in its entirety. These methods can be applied directly for the identification of PAGs. Briefly, in PCR ™, two primer sequences are prepared that are complementary to regions in opposite complementary strands of the marker sequence. An excess of deoxynucleoside triphosphates is added to the reaction mixture together with DNA polymerase, for example Taq polymerase. If the marker sequence is present in a sample, the primers will bind to the label and the polymerase will cause the primers to extend along the marker sequence by adding nucleosides. By increasing and decreasing the temperature of the reaction mixture, the extended primers will dissociate from the label to form reaction products; the excess of primers will bind to the marker and to the reaction products, and the process is repeated. In the case that the transcript is the nucleic acid sample of interest, a reverse transcriptase (RT) -CRP ™ amplification procedure can be performed in order to convert the transcribed mRNA to DNA and then amplify it for detection or cloning. . Methods for the reverse transcription of RNA to cDNA are well known and described in Sambrook et al., 1989. Alternative methods for reverse transcription use DNA polymerases, RNA-dependent, thermostable. These methods are described in WO 90/07641 filed December 21, 1990. Polymerase chain reaction methodologies are well known in the art. Using PAG-related sequences as primers, either for reverse transcription or for amplification, one can selectively amplify to create a cDNA library and examine the library using the standard probe formats (e.g., Southern blot). The identified clones can then be sequenced. The coding of partial clones for minor transcripts of their entire length can, in turn, be used to isolate the complete sequence of another cDNA or even of genomic libraries.

Vil EXAMPLES The following examples are included to demonstrate preferred embodiments of the invention. Those skilled in the art will appreciate that the techniques disclosed in the examples below represent techniques discovered by the inventor to function well in the practice of the invention, and therefore can be considered to constitute preferred modes for this practice. However, those skilled in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments disclosed and still obtain an equal or similar result without departing from the spirit and scope of the invention.

A. EXAMPLE 1 Cloning of placental tissue boPAGs in early pregnancy Materials and methods Bovine PAG transcripts were cloned from placentas on days 19 and 25. RNA from 6 placentas (Simmental x Hereford) was used from day 25 of pregnancy to build a cDNA library? ZAPII (Clontech, Palo Alto, CA) . The library was examined with a mixed probe of PAG1 and PAG2 bovine, ovine and porcine labeled with 32P and equine PAG cDNA (Xie et al., 1991, Xie et al., 1994, Xie et al., 1995, Szafranska et al. ., nineteen ninety five). Positive clones were isolated and analyzed for the size of the inserts, by PCR ™ and restriction endonuclease digestion. Sixteen clones of the expected length were partially sequenced. The second search identified boPAG transcripts that reacted with an anti-boPAGI antiserum (Zoli et al., 1991; Xie et al., 1991). To increase the isolation frequency of full-length clones, a duplicate filter test was used. The first filter was allowed to react with antiserum to identify the immunopositive clones (Xie et al., 1991), while the second filter was hybridized with a 32P-labeled probe corresponding to 1 and 2 of bogPAGI, ovPAGI and ovPAG2.

The positive clones from both filters were purified and partially sequenced. PAG transcripts of a 19-day trophoblast from a Holstein cow were cloned by reverse transcription (RT) and PCR ™ procedures. The cellular RNA extracted from the trophoblast on day 19 was subjected to reverse transcription with cDNA and then amplified by PCR ™ with a pair of well-preserved primers (boPAGexp3'5 'CCCAAGCTTATGAAGTGGCTTGTGCTCCT3' (SEQ ID NO: 16), and boPAGexp3'5 ' GGGAAGCTTACTTGTCATCGTCGTCCTTGTAGTCGGTACCCACCTGTGCC AGGCCAATCCTGTCATTTC3 '(SEQ ID NO: 17) The RT-PCR ™ products were cloned with TA cloning vectors (Invitrogen, CA, USA) All the new b PAG cDNAs were sequenced in their entirety.

Results The alignment of the amino acid sequences of all available boPAGs is shown in Figure 1. BoPAGI, 2 and 3 have been identified before day 260 of pregnancy, ie close to term (Xie et al., 1991; Xie et al. al., 1994; Xie et al., 1995) and are therefore "late" PAGs. The transcripts for boPAGs 4, 5, 6, 7, 8, 9, 10 and boPAG11 (SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11) were all present in the library on day 2d (Figure 3). BoPAG12 (SEQ ID NO: 12) were present in the Holstein placenta on day 19 (figure 3). Therefore, all of these are "early" PAGs and candidates as early pregnancy antigens. It should be noted that PAG2 (SEQ ID NO: 2), previously detected in late pregnancy (Xie et al., 1994), is also present on day 19 and 25, but that boPAGI (SEQ ID NO: 1) is not expressed on none of these days, as determined by a combination of procedures, including immunological tests. This point is important since the antiserum used by others to detect pregnancy (Sasser et al., 1986; Zoli et al., 1992; Mialon et al., 1993) seemed to recognize boPAGL. It should also be noted that the anti-antiserum boPAGI, yes, recognizes, one of the "early" PAGs namely PAG4. Therefore, it seems that these earlier researchers could detect early pregnancy in cows, because their antisera, one in a fortuitous way, had a cross reaction, albeit weak, with boPAG4. There is a considerable degree of amino acid sequence identity among the 12 boPAGs listed in Figure 1. The most closely related are boPAGI and boPAG3 that share 86% amino acid identity. The least related are boPAG4 and boPAGIO, with only 49% identity. Strikingly boPAGI and boPAG4, which as mentioned above cross-react with the anti-boPAGI antiserum, exhibit only 76% identity at the amino acid level. Presumably there is a common epitome in the two molecules. The hypervariable regions indicated in Figure 1 coincide with the surface loop regions in the model structures (Xie et al., 1997b) and are potential epitopes of distinction. In this sense, boPAGI and boPAG4 share a common loop (LSKDEREGS: 209 - 217; PAG1 numbering) (figure 1), which may explain its immunological cross-reactivities. Other loops can be mimicked as synthetic peptides and used to immunize rabbits or mice in order to obtain specific antibodies against particular PAGs. These data show that boPAGI, the antigen used as the basis for previous pregnancy tests, is a "late" PAG and is not ideal as an early pregnancy antigen. The data also shows that early PAGs are relatively numerous and differ considerably in sequence from one another and from the boPAGI. These differences are more marked in the surface loop regions, which usually have most of the immunoreactive characteristics of the molecule.

B. EXAMPLE 2 Structural relationships between boPAGs Materials and methods The amino acid sequences of various PAGs and pepsin were organized into multiple alignment sequences with a Pile program Up of the Wisconsin GCG package, Version 9.0 (Madison, Wl). A distance matrix (Program Distances) was created and a phylogenetic tree was constructed by means of a "union between related members" procedure (Nei, 1987).

Results The data in figure d correspond to a phylogenetic tree that relates all the bovine PAGs (figure 1) and the ovine PAGs (figure 2) that have been cloned up to the present as cDNA. The methods used to clone these PAG cDNAs are described by Xie et al., 1997b. Also included in figure d, F rat pharynogenins and porcine pepsinogen A, aspartic proethinases structurally more similar to PAGs. It should be noted that bovine and ovine PAGs fall widely within two structurally related groups. One contains boPAG2, - 10, - 1 1, and - 12 together with ovPAG2 and obPAGd. The other comprises boPAGI, 3, 4, 5, 6, 7, and 9. As noted below and by Xie et al., 1997b, the boPAGs of this second group are expressed only in binucleate cells, considering that the invasive component of the trophoblast of the cell type considered to release PAGs into the maternal bloodstream. It should be noted that among the PAGs of the second group are the "early" PAGs. boPAGs4, 5, 6, 7, and 9.

EXAMPLE 3 Certain early PAGs are expressed in the trophoblast of binucleated cells and in the syncytium formed between the trofectoderm and the uterine epithelium.

Materials and methods Riboprobes (cRNA) were prepared using the Riboprobe Preparation System (Promega, Wl E.U.A.). Briefly, two regions of the boPAG cDNA, representing poorly conserved sequences, were used as in situ hybridization of the probe (and ribonuclease protection assay: see next section). The first fragment (536bp) of boPAG2, 4, 8, 9 or 1 1 cDNA that was in the region of exons 6, 7, 8, and 9, was amplified using PCR ™ with a pair of primers (Direct d'CCTCTTTTGCCTTCTACTTGAS '(SEQ ID NO: 18, and Indirect and d'GCGCTCGAGTTACACTGCCCGTGCCAGGC3' (SEQ ID NO: 19) However, another region (407 bp) was chosen for boPAGI, d, 6, and 7 of cDNA, corresponding to 3 hexons, 4 and 5. Again it was amplified by a PCR ™ procedure with two well-preserved primers (Direct B: d TGGGTAACATCATTGGAA3 '(SEQ ID NO: 20, Indirect B: 5'TTTCTGAGCCTGTTTTTGCC5, (SEQ ID NO: 21). ™ were subcloned into TA cloning vectors (Invitrogen, CA, USA) The orientation and sequence of the inserts was determined by sequencing.

The subcloned cDNA fragments were then transcribed in vitro with cRNA in the presence of [35 S] -CTP. [35 S] - Unincorporated CTP was removed from the labeling mixture by centrifugation through a Sephadex G-50 column. The control probes, oriented in the reading frame of the boPAG cRNA were prepared essentially in the manner described above. The probes were used within 3 days. Tissues from day 25 or day 100 were sectioned (14 μm) at -18 ° C with an IEC cryostat (International Equipment CO., Needham Heights, MA) and mounted on pre-cooled microscope slides. Next, the sections were fixed and processed as described by Xu et al., (1995). Hybridization was performed by applying approximately 200 μl of probe solutions (4 x 106 cpm) to cover each section and incubated at 5d ° C for 12 to 18 hrs. After hybridization, slides were immersed in 2X SSC to remove excess hybridization buffer, treated with RNase (50 μl / ml PBS) for 30 min. at 37 ° C to remove probes that were not hybridized. The sections were then washed at 5d ° C in 2X SSC for 1d min., In 50% formamide in 2X SSC for 30 min., And twice in 0.1X SSC for 15 min. The slides were again dehydrated, air-dried, coated with Kodak NTB-2 emulsion (Eastman Kodak, Rochester, NY) and exposed at 4 ° C for 1 to 4 weeks. Finally, the slides were revealed, counterstained with hematoxylin and eosin and examined microscopically.

The in situ hybridization was carried out with antisense probes - [35S] or sections through placetoms (areas of fusion of cotyledons, ie fetal and caruncle-like, ie, maternal hairs). The resulting autoradiographs were stained with hematoxylin and eosin and photographed. No specific signs of hybridization with sense probe were evident. The boPAG9 mRNA was concentrated in the most disseminated binucleated cells, whereas boPAG11 was found in all cells of the chorionic epithelium (trofectoderm). In situ hybridization was performed with antisense probes - [35S] in enmetrio-placenta sections from day 25, using dark field micrographs at 20 X and 40 X. The silver grains appeared to be white spots under dark field illumination. The cell layer at the edge of the section showed an intense boPAG6 signal. Abundant silver stains were found in the cells at the margin of the section. On contract boPAG2 mRNA gave only a weak signal within the syncytial region. Only few silver grains were visible at the edge of the section.

Results 1.- Location of boPAG mRNAs on day 100 of pregnancy The external layer of the placenta consists of two cell populations of mono and binucleated trophoblasts. To localize the site of each PAG expression specific for mono or binucleated trophoblast cells, in situ hybridization was performed to detect individual mRNA PAG. Previously published data have shown that while boPAGI is expressed in binucleated trophoblast cells (Xie et al., 1994), boPAG2 is expressed throughout the entire trofectoderm, including the most abundant mononuclear cells that comprise 80% or more of the epithelium (Xie et al., 1994). Here in situ hybridization in sections or placentas have been employed to determine in which cell type the remaining characterized boPAGs are expressed. BoPAG9 is widely expressed in disseminated binucleated cells, which are heavily coated with silver grains. In contrast, mRNA for boPAG1 1 is found throughout the entire epithelium that covers the hairs of the cotyledons. There is a correspondence between the PAGs expressed in binucleated cells and their positions in the phylogenetic tree (Figure 5), and those four PAGs that were expressed early, namely, boPAG4, 5, 6, 7 and 9, are produced by the binucleate cell invasive and therefore usually enter the maternal bloodstream. 2. - Location on day 25 of pregnancy. On day 25 of pregnancy the bovine placenta is not fully developed and the cotyledons are not firmly interdigitated with the endometrium in the form of a carbuncle. Therefore, the thickened placental membrane was processed with the endometrium adhered. After carrying out the in situ hybridization procedures, almost the entire membrane was lost.

Only the layer fused with the endometrium survived the hard procedure and remained on the surface of the endometrium. It was very difficult to identify individual cells since most of the cells (the remaining placental tissue) was fused with the underlying endometrial cells. However, this multicellular sincice fused contained an abundant amount of boPAG6 mRNA. As noted above, only the binucleate trophoblast can be fused with the endometrium. Therefore, placental cells of syncytia are usually binucleated trophoblast cells at their origin. Similarly, sections hybridized with boPAG4, 5, 7 and 9 probes also had strong signals at the interface between the remaining placental membrane and the endometrial epithelium. Therefore, they are usually expressed by binucleated trophoblastic cells. In contrast, very little mRNA was found for boPAG2, 8, 10, and 11 in the syncytial layer. A plausible explanation is either that those boPAGs are not expressed or that they are expressed at low levels in the binucleated fused trophoblastic cells of the placenta on day 2d. Therefore, they are usually found less in maternal blood than boPAG4, 5, 6, 7 and 9.

D. EXAMPLE 4 Relative expression of mRNA for different boPAG transcripts. varies during gestation in cows Materials and methods Riboprobes (cRNA) were prepared by the Riboprobes Preparation System (Promega, Wl, E.U.A.). Briefly, two regions of boPAG cDNA, representing poorly conserved regions of PAGs were generally used as probes for RPA, as well as for in situ hybridization. The first fragment (536 bp) of boPAG2, 4, 8, 9 and 1 1 cDNA, in the reaction of hexagons 6, 7, 8 and 9 was amplified using PCR ™ with the same pair of primers (SEQ ID NO: 18 and SEQ ID NO: 19) described in Example 3 for in situ hybridization. Similarly, a region (407 bp) of boPAG 1, 5, 6 or 7 cDNA corresponding to hexes 3, 4 and 5 was amplified as described in Example 3 with primers (SEQ ID NO: 20 and SEQ ID NO: 21 ). After subcloning the cDNA fragments were transcribed in vitro with cRNA in the presence of [32 P-] CTP. The total cellular RNA was extracted in a placental tissue at different stages of pregnancy, using guanidine isothiocyanate and purified on a gradient of cesium chloride (Sambrook et al., 1989, Ausubel et al., 1987). Twenty μg of RNA was used for each RPA fraction according to the manufacturer's recommendations (Ambion Inc., Austin, Texas). In synthesis, the RNA sample was coprecipitated with probes labeled with 32P-2x106 cpm / sample) and the pellet was suspended in 10 μl of hybridization buffer and incubated at 68 ° C for 10 minutes. The unhybridized cRNA was run with a mixture of RNAse A / T1 for 45 minutes at 37 ° C. The cRNA probe and the mRNA hybrids were precipitated and separated on gels of 6% long-range sequences and visualized by autoradiography. A fragment of the boPAG cDNA was amplified by PCR ™ and the products were then subcloned with TA cloning vectors. These fragments were then transcribed in vitro with reboprobes in the presence of [32 P] CTP. RNA was extracted from conceptus and bovine placenta on days 25, 45, 88, 250 and at the end of pregnancy. Next, the total RNA of the tissue (20 μm) was hybridized with cRNA probes of boPAGI, boPAG2, boPAG4, boPAGd, boPAGβ, boPAG7, boPAGd, boPAG9, boPAGIO and boPAG11. The protected DNA fragments were separated and visualized by autoradiography.

Results The gestation time of cattle is approximately 285 days. The initial immunological search of cDNA libraries previously identified three boPAGs (boPAGI, boPAG2 and boPAG3). More recently, two additional cRNAs (boPAG13 and boPAG14) were cloned from placental mRNA at term using hybridization examination (SEQ ID NO: 13) and (SEQ ID NO: 14) in a cDNA library of day 260 (Xiel et al. al., 1991; Xiel et al., 1995). On day 25 of pregnancy, 10 distant PAGs were identified (example 1, figure 1, figure 2 and figure 5). Only boPAG2 was isolated in both stages of pregnancy. These cloning data imply that the expression of individual boPAG is temporarily controlled. To confirm the temporary expression of boPAG, ribonuclease protection assays were performed to delineate the stages in which the individual boPAG genes were expressed in the placenta of cattle. This procedure was repeated at least twice for each riboprobe boPAG and for each RNA sample. The major band represents the protected mRNA boPAG. In addition, there were multiple bands in each line. Those smaller bands almost certainly protected sequences highly related to, but different from those of the riboprobe. In summary, boPAG2 was found in RNA from days 19, 25 and 260 and therefore was expressed throughout the pregnancy. Similarly, BPAGD, 10 and 11 were expressed in all pregnancy stages examined. The boPAGI that was originally characterized on day 260 of the placenta and that is the basis of the pregnancy test of Sasser et al., (1986), Zoli et al., (1992a) and Mialon et al., (1992; 1993) they were expressed at a very low level of pregnancy day. By day 45, his expression was markedly elevated. Another boPAG of the same group had different expression on day 25. However, none of them showed increased expression at day 45 of pregnancy.

E. EXAMPLE 5 Artiodactyl species related to Bos taurus also has multiple PAG genes Materials and methods Southern genomic blots of bovine DNA were performed with probes corresponding to a boPAGI segment comprising part of intron 6, hexon 7, intron 7, hexon 8, of the proximal terminus and proximal termination of intron 8 (Xie et al. , nineteen ninety five). The EcoR1 restriction enzyme was chosen that did not cleave the probe. The hybridization conditions were such that the PAG1 probe did not bind to the PAG2 gene and so that there was no hybridization for genes by other aspartic proteinaceans.

Results Multiple PAG genes were detected in all species of the Bovidae family examined. The signals were especially strong in species closely related to bos taurus of the subfamilies Bovinae (Bos frontalis gaurus, gaur, Bos grunniens, yak, Syncerus caffer, Cape buffalo) and Caprinae (for example: O 's airs, domestic sheep; ows dalli, Dali sheep, capra falconeri, goat Markhor, Nemorhaedus goral, goral, Budorcas taxicolor, takín). The gazelle and antelope species were also given a strong signal in other related subfamilies including impala, wildebeest, small African antelope, iniala. In general, the hybridization, although detectable, was weaker to the DNA of members of the Cervidae family, including the white-tailed deer and the deer Mulé, and the DNA of the Bovidae. Unexpectedly, the elk (Alces alces) gave a relatively strong signal. The giraffe (family Girafidae) had the weakest signal of the true Pecorino ruminants, possibly reflecting their early divergence (Kageyama et al., 1990). Hybridization with DNA from the Nile hippopotamus was barely detectable with the boPAGI probe used. Since the hippo (family hippotamidae, suborder Suiformes) is related to the domestic pig (Sus Scrofa), a species with multiple PAGs (Szafransca et al., 1995), this result indicates the considerable divergence of genes within the order Artiodáctyla as throughout the 55 to 65 million years of its existence. These pooled data show that there are multiple PAG genes of considerable similar structure with boPAGI in all species of ungulate ruminants examined. Therefore, a pregnancy test developed for domestic cattle (bos taurus) based on the early secretion of PAG by the placenta could also be useful in the same way in these other species.

E. EXAMPLE 6 The placenta of the domestic cat (Feli Catus) expresses a PAG related to the boPAGs Materials and methods The 30-day placentas of single-bait cats were obtained from the Taching Veterinary Hospital of the University of Missouri (University of Missouri Veterinary Taching Hospital). The tissue was cut into small pieces and frozen in liquid nitrogen. Total RNA was extracted from the frozen tissues with purified polyA + mRNA using the Micro-Fast Track ™ kit from Invitrogen, CA. This RNA was subjected to reverse transcription and the resulting cDNA collected (). PCR ™ was performed with the following primers, representing highly conserved regions of most of the boPAG genes (5TGGGTAACATCACCATTGGAAC3 '(216-236), SEQ ID NO: 22, ovPAGedr 5'CAAACATCACCACACTGCCCTCC3' (667-645), (SEQ ID NO: 23) PCR reactions were performed for 35 cycles, each cycle was 94 ° C for 1 minute, 42 ° C for 1 minute, 72 ° C for 1 minute, and the TA cloning kit (TA cloning). kit) (Invitrogen, CA) was used to clone the PCR ™ products.The plasmid DNA was isolated using a Mini Prep Kit (Promega, Madison, Wl) .The isolated plasmid DNA was targeted with EcoR1 restriction enzyme to corroborate the Insect sizes In order to more precisely locate the cat PAG expression site, in situ hybridization (as written in Example 3, section C) was used to detect the cat PAG mRNA in placental tissue of the cat. 30 days frozen cat.The transcripts of the cat PAG detected c on riboprobe-35S antisense.

Results The open reading frame of the cat PAG cDNA was 1164 bp and encoded a polypeptide of 388 amino acids with an expected Mr of 43,045 of cat PAG (SEQ ID NO: 15). The amino acid sequence (SEQ ID NO: 38) of the cat PAG showed between 50 to 60% identity of respect of all known bovine PAGs and 59.4% with porcine pepsinogen A. All these data suggest that the PAG happens of the ungulata order and is also found in non-ungulate species, such as, for example, the domestic cat. By inference they must also be found in species related to the cat (Felidae), as well as in dogs (Canidae). A pregnancy test based on PAG antigens could be useful in these species, particularly in the domestic dog (Canis familarus). All of the disclosed compositions and methods and the claims herein can be made and executed without prior experimentation in light of the present invention. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations may be applied to the compositions, steps or sequence of steps of the method described in present, without departing from the concept, spirit and field of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related can be substituted for the agents described herein by obtaining the same or similar. All of these substitutions and modifications apparent to those skilled in the art should be considered within the spirit, scope and concept of the invention as defined in the appended claims.

Vile. References The following references, to the extent that they constitute examples of procedures and other details complementary to those set forth herein, are specifically incorporated herein by reference: Abbondanzo et al., Breast Cancer Res. Treat., 16 : 1d2 (151), 1990. Allred et al., Breats Cancer Res. Treat., 16: 1d2 (149), 1990. Loving, In: MarshalTs Physiology of Reproduction, Vol 2, ed. Parkes, A.S. Little Brown and Co., Boston, pp. 127-311, 952., 1952. Atikinson et al., J. Biol. Chem., 263 (35): 26679-26685, 1993. Ausubel et al., In: Current Protocols in Molecular Biology 2: 16.9.1- 16.9.10, 1997.

BaichwaI and Sugden, In: Gene Transfer, Kucherlapati R, (Ed.), New York, Plenum Press, pp 1 17-148, 1986. Barany and Merrifield, "The Peptides", Gross and Meienhofer, (Eds.), Academic Press, New York pp 1-264. 1979. Beal et al., J. Anim Sci., 70: 924-929, 1992. Birch and Loh, Biochem. Biophys. Res. Commun., 177 (3): 920-926, 1991. Brown et al., Breast Cancer Res. Treat., 16: 192 (# 191), 1990. Butler et al., Biol. Reprod., 26: 925-933, 1932. Cameron and Malmo, Austr. Vet. J .: 70: 109-1 11, 1993. Campbell et al., J. Mol. Biol., 1dO: 1-19, 19d4. Capaldi et al., Biochem. Biophys. Res. Comm., 76: 425, 1977. Chen and Okayama, Mol. Cell Biol., 7: 2745-2752, 1987. Coffin, "In: Virology, Fields BN, Knipe DM, (Ed.), New York, Raven Press, pp. 1437-1500, 1990. Coupar et al., Gene. , 63: 1-10, 1988. Crowther, "ELISA; Theory and Practice ", in Methods in Molecule ß / 'o / oa / and Vol. 42, Publ.Humana Press, New Jersey, 1995. Davies, Ann. Rev. Biophys. Chem., 19: 189-215, 1990. Engvall and Perlmann, Immunochem 8: 871-873, 1971. Engvall, Lancet, 2 (8000): 1410, 1976. Engvall, Med. Biol., 5d (4): 193-200, 1977 Engvall, Methods Enzymol, 70 (A): 419-39, 1980. 10d Fechheimer et al., Proc. Nati Acad. Sci. USA, d4: 6463-3467, 1987. Fraley et al., Proc. Nati Acad. Sci. USA, 76: 3348-3352, 1979. Friedmann et al., Sciencie, 244.1275-1281, 1989. Fryxell, Trends Genet, 12 (9): 364-369, 1996. Gefter et al., Somatic Cell Genet. , 3: 231-236, 1977. Ghosh and Bachhawat, In: Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors and Ligands, Wu and Wu (Ed.), New York: Marcel Dekker, p. 87-104, 1991. Goding, In: Monoclonal Antibodies: Principies and Practice, 2d ed., Academic Press, Orlando, Fio., Pp. 60-61, 71-74, 1986. Gopal, Mol. Cell Biol., 5: 1188-1190, 1986. Graham and Van Der Eb, Virology, 52: 456-467, 1973. Gripenberg et al., Scand J Immunol., 7 (2): 151-7, 1978. Guillomot, J. Reprod. Fertile., 49 (suppl): 39-51, 1996. Guruprasad et al., Protei? Engine, 9: 949-866, 1996. Haig, Rev. Biol., 68: 496-532, 1993. Harland and Weintraub, J. Cell Biol., 101: 1094-1099, 1985. Harlow and Lane, In: Antibodies , to Laboratory Manual, Cold Spring Harbor Laboratory, pp 139-281, 1988. Hatzidakis et al., J. Reprod. Fertile., 98: 235-240, 1993. Hermonat and Muzycska, Proc. Nati Acad. Sci, USA, 81: 6466-6470, 1984.

Holdsworth et al., J. Endocrin, 95: 7-12, 1982. Horwich et al., J. Virol., 64: 642-650, 1990. Hughes, A.L., Mol. Biol. Evol., 11 (6): 899-910, 1994. Humblot et al., Theriogenol., 30: 257-268, 1988. Innis et al., In: PCR Protocols, Academic Press, Inc., San. Diego CA, 1990. Johnson et al., "Peptide Turn Mimetics" In: Biotechnology and Pharmacy, Pezzuto et al., (Eds.), Chapman and Hall, New York, 1993. Kageyama et al., J. Biol. Chem. , 265 (28), 17031-17038, 1990. Kind et al., J Reprod, Fertil, 59: 95-100, 1980. Kiracofe et al., J. Anim. Sci, 71: 2199-2205, 1993. Kohier and Milstein, Eur. J, Immunol. 6: 51 1-519, 1976. Kohier and Milstein, Nature, 256: 495-497, 1975. Li et al., J. Virol., 67 (7): 4070-4077, 1993. Markusfeld et al., Br Vet. J., 146: 504-508, 1990. Merrifield, Sciencie, 232: 341-347, 1986. Mialon et al., Reprod. Nutr. Dev., 33: 269-282, 1993. Mialon et al., Reprod. Nutr. Dev., 34: 65-72, 1994. Mialon, Aviat. Space Environ Med., 63 (4): 287-291, 1992. Miyamoto et al., In: Mammalian Phylogeny, Eds. Szaly, F.S., Novacek, M.J. & McKenna, C Springer, New York, pp. 268-281, 1993. Moir et al., Gene, 19: 127-138, 1982.

Nakamura et al., In: Handbook of Experimental Immunology (4th Ed.), Weir, E., Herzenberg, LA, Blackweil, C, Herzenberg, L (Eds.), Vol. 1, Chapter 27, Blackweil Scientific Publ. , Oxford, 1987. Nei et al., In: Molecular Evolutionary Genetics (Columbia Univ. Press, New York), p. 293-298, 1987. Nicolás and Rubenstein, En; "Vectors: A Survey of Molecular Cloning Vectors and Their Uses" Rodriguez and Denhardt (Eds.), Butterworth, Stoneham, pp. 494-513, 1988. Nicolau and Sene, Biochim. Biophys. Acta, 721: 185-190, 1982. Ohta et al., Biochm. Biophys. Res. Commun., 185 (3): 1 128-1 132, 1992. Ohta, S., Immunol. Lett, 44 (1): 35-40, 1995. Oltenacu et al., J. Dairy Sci., 73: 2826-2831, 1990. Patel et al., Theriogenol., 44: 827-833, 1995. Patel et al. al., Proc Nati. Acad. Sci. USA, 81: 7161-7165, 1984. Pungercar et al., Nucleic Acids Res., 18: 4602, 1990. Remington's Pharmaceutical Sciences, I d * 1 Ed., Pp 1035-1038 and 1570-1680. Ridgeway, In: "Vectors: A Survey of Molecular Cloning Vectors and Their Uses". Ed Rodriguez R.L. and Denhardt D.T., Butterworth, Stoneham, pp 467-492, 1988. Rippe et al., Mol. Cell Biol., 10: 689-695, 1990. Roberts et al., Biol Reprod., 54: 294-302, 1996.

Roberts et al., Prog. Nucí. Acid Res. And Mol. Biol., 56: 287-326, nineteen ninety six. Sambrook et al., Cold Spring Harbor Laboratory Press 2nd Edition, 1989. Sarngadharan et al., Princess Talamatsu Symp, 15: 301-8, 1984. Sasser et al., J. Reprod. Fertile., 37 (Suppl): 109-1 13, 1989. Sasser et al., Biol Reprod., 35: 936-942, 1986. Smith and Johnson, et al., Gene, 67: 31-40, 1988. Stewart and Young, Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chemical Co., 1984. Streenan and Diskin, En; Embryonic Mortality in Farm Animáis, Sreenan and Diskin (Eds.), Martinus Nijhoff Publishers, 1-1 1, 1986. Szafranska et al., Biol. Reprod., 53: 21-28, 1995. Talkahasi, R., Adv. Exp. Med. Biol., 362: 581-587, 1995. Tam et al., J. Am. Chem. Soc, 105: 6442, 1983. Termin, In: Gene Transfer. Kucheriapati (Ed). New York: Plenum Press, pp. 149-188, 1986. Tur-Kaspa et al., Mol. Cell Biol., 6: 716-718, 1986. Patent of US Pat. No. 3,817,837. U.S. Patent 3,850,752. U.S. Patent 3,939,350. U.S. Patent 3,996,345. U.S. Patent 4,196,265.

U.S. Patent 4,275,149. U.S. Patent 4,277,437. U.S. Patent 4,366,241. U.S. Patent 4,367.1 10. U.S. Patent 4,452,901. U.S. Patent 4,668,621. U.S. Patent 4,683,195. U.S. Patent 4,683,202. US Patent 4,800,159. 10 Warnick et al., Theriogenol., 44: 811-825, 1995. Wedemayer. GT, Sience, 276 (5319): 1669, 1997. Wooding et al., Placenta, 13: 101-1 13, 1992. Wooding J. Reprod Fertile., 62: 15-19, 1981. Wu and Wu, Biochemistry, 27: 887-892, 1988. 15 Wu and Wu J. Biol. Chem., 262: 4429-4432, 1987. Xie et al., Biol. Reprod., 51: 1 145-1153, 1994. Xie et al. , Biol. Reprod., 54: 122-129, 1996. Xie et al., Biol. Reprod., 57: 1384-1393, 1997a. Xie et al., Gene, 159: 193-197, 1995. Xie et al., Proc. Nati Acad. Sci. USA, 88: 10247-10251, 1991. Xie et al., Proc. Nat'l. Acad. Sci. USA, 94: 12809-12816, 1997b, Xu et al., Endocrine!., 136: 981-989, 1995. Yang et al., Proc. Nati Acad. Sci. USA, 87: 9568-9572, 1990.

Yang et al., Proc. Nat'l. Acad. Sci. USA, 87: 9568-9572, 1990. Zoli et al., Biol. Reprod., 46: 623-629, 1992b. Zoli et al., Biol. Reprod., 45: 1-10, 1991. Zoli et al., Biol. Reprod., 46: 83-92, 1992a.

LIST OF SEQUENCES < 1 10 > Roberts, R. Michael Green, Jonathan Xie, Sancei < 120 > COMPOSITIONS AND METHODS FOR EARLY EARLY DIAGNOSIS < 130 > UVMO003 / UVMO003P < 140 > Unknown < 141 > 1999-03-19 < 150 > 60 / 078,783 < 151 > 1998-03-20 < 150 60 / 106,188 < 151 > 1998-10-28 < 160 > 56 < 170 > Patentln Ver. 2.0 < 21O > 1 < 211 > 1295 < 212 > DNA < 213 > bovidae < 400 > 1 cttggatcca ggaaataaac atgaagtggc ttgtgctcct cgggctggtg gccttctcag 60 agtgcatagt caaaatacct ctaaggagac tgaagaccat gagaaatgtc gtcagtggaa 120 aaaacatgct gaacaatttt ctgaaggagc atgcttacag tctgtcccag atttcttttc 180 tctaactact gtggctcaaa gaaacatcaa cacccgctga tacatgggta ggatttggtc 240 acatcaccat tggaacaccc cctcaggaat tccaggttgt ctttgacaca gcctcatctg 300 acttgtgggt gccctccgac ttttgcacta gtccagcctg ttctacacac gttaggttca 360 _ gacatcttca gtcttccact ttccggctta ccaataagac cttcaggatc acctatggat 420 ctgggagaat gaaaggagtt gttgttcatg acacagttcg gattgggaac cttgtaagta 480 ctgaccagcc atttggtcta agcattgagg aatacgggtt tgagggcaga atttatgatg 540 gtgtcttggg cttgaactac cccaacatat ccttctctgg agccatcccc atctttgaca 600 agctgaagaa tcaacgtgcc atttctgagc ctgtttttgc cttctacttg agcaaagatg 660 agcgggaggg cagtgtggtg atgtttggtg gggtggacca ccgctattat gagggagagc 720 tcaactgggt acccctgatc caagcaggcg actggagtgt acacatggac cgcatctcca 780 ttgaaagaaa gattattgct tgttctgatg gctgcaaggc ccttgtggac accgggacat 840 cagatatcgt aggtcc AAGA ataacatcca agactggtca taggctcatc ggtgccatac 900 cacggggttc cgagcactac gttccatgtt ctgaggtcaa taccctgccc tctattgtct 960 tcaccatcaa cggcatcaac tacccagtgc caggtcgagc ctacatcctc aaggatgata 1020 gaggccgctg ctataccacc tttcaagaga accgagtgag ttcatctaca gagacctggt 1080 acctgggtga cgtcttcctg agactgtatt tctcggtctt tgatcgagga aatgacagaa 1140 ttggcctggc acgggcagtg taaatgctta gagtggttca ggaatcagta aggccactcc 1200 taacacacac tcactcacac tttggcactc ctgcccagaa tgctggtgaa ctgtatttgg 1260 tggtcttcac actctattct tagtaaagaa taaag 1295 < 210 > 2 < 211 > 1258 < 212 > DNA < 213 > bovidae < 400 > 2 gaaagaagca tgaagtggct tgtgctcctc gggctggtgg ccctctcaga gtgcatagtc 60 attttgcctc taaagaaaat gaagaccttg cgagaaaccc tgagggaaaa aaacttgctg 120 tggaggaaca aacaatttcc agcttacaga ctgtccaaga atgactccaa aataactatt 180 cacccgctga ggaactatct ggatactgcc tacgtgggta acatcaccat tggaacaccc 240 cctcaggagt tccgggtcgt ctttgacaca ggctcagcta acttgtgggt gccctgcatc 300 acctgtacca gtccagcctg ttatacacac aaaaccttca atcctcaaaa ttcttcaagc 360 ttccgggaag taggctcgcc tatcaccatc ttctatggat ctgggataat tcagggattt 420 cttggctctg acaccgttcg gatcgggaac cttgttagcc ctgaacagtc gtttggccta 480 agcctggagg aatacgggtt tgattctcta ccctttgatg gtatcctggg cttggctttt 540 cccgccatgg gcatcgaaga taccatcccc atctttgaca acttgtggtc acacggtgcc 600 ttttctgagc ctgtcttcgc cttctacttg aacacaaaca agccagaggg cagtgtggtg 660 atgtttggtg gggtggacca ccgctactac aagggagagc tcaactggat accagtgtcc 720 caaactagcc attggcagat aagcatgaac aacatcagca tgaatgggac tgtgactgct 780 tgttcttgtg gatgtgaggc ccttttggac accgggacat caatgatcta cggcccaaca 840 aaactggtca ccaacatc ca 900 caagctcatg aacgccaggc ttgagaattc tgagtatgtg gtttcatgtg atgctgtcaa gaccctgcct cctgtcatct tcaacatcaa tggcatcgac 960 tatccactgc gccctcaagc ctacatcatc aagattcaaa acagctgccg cagcgtcttt 1020 caaggaggca cagaaaatag ctctctaaac acctggatcc ttggtgatat cttcctgagg 1080 cagtacttct cggtttttga tcgtaaaaat agaaggattg gcctggctcc ggcagtgtaa 1140 atgcttggac tatcagcaag catttgacta aatcagtcag gctgctccta acacacactc 1200 gctcacacta ggcactcctg ccagcgatgc tggtgaattg tgtttggtgc tgcaaacc 1258 < 210 > 3 < 211 > 1266 < 212 > DNA < 213 > bovidae < 400 > 3 ggcttgtgct cctcgggctg gtggccttct cagagtgcat agtcaaaata cctctaagga 60 gagtgaagac catgagaaat accgtcagtg gaaaaaacat actgaacaat atcctgaagg 120 agcatgttta cagactgtcc cagatttctt ttcgtggctc aaatctaact actcacccgc 180 tgagaaacat caaggatttg atatacgtgg gtaacatcac cattggaaca ccccctcagg 240 aattccaggt tgtctttgac acaggctcat ctgacttttg ggtgccctct gacttttgca 300 ctgttctaca ctagtcgagc cacgttaggt tcagacatct tcagtcttcc accttccggc 360 tcaccaataa gaccttcagg atcacctatg gatctgggag aatgaaagga gttgttgctc 420 atgacacagt tcggattggg gaccttgtaa gtactgacca accgtttggt ctaagtgtgg 480 aggaatatgg gtttgagggc agagcttatt atgatggtgt cttgggcttg aactacccca 540 acatatcctt ctctggagcc atccccatct ttgacaacct gaagaatcaa ggtgccattt 600 ttttgccatt ctgagcctgt ctactgagca aagacgagca ggagggcagt gtggtgatgt 660 ttggtggggt ggaccaccgc tactatgagg gagagctcaa ctgggtacca ttgattgaag 720 cgggtgactg gattatacac atggaccgca tctccatgaa aagaaagatt attgcttgtt 780 ctggcagctg cgaggccatt gttgacactg ggacatcagc aatagaaggc ccaagaaaac 840 tggtaaataa gatacacaag ctcatcggcg ccaggccacg gcattccaag tactacattt 900 catgttctgc ggtcaatacc ctgccttcta ttatcttcac catcaacggc atcaactacc 960 catgtccagg tcgagcctac gtgctcaagg attctagagg ccgctgcta t tccatgtttc 1020 agtgagttca aagagaacaa tctacagaga cctggatcct gggcgatgtc tttctgaggg 1080 tgtatttctc 'agtctttgat cgaggaaatg acaggattgg gcagtgtaaa cctggcacga 1140 tgcttggagt ggttcaggaa tcagtaaggc cgctcctaac acacactcac tcacactagg 1200 cactcctgcc caggatggtg gtgaactgta tttggtggtc tgtacaccct attctctcgt gccgtt 1260 1266 < 210 > 4 < 211 > 1359 < 212 > DNA < 213 > bovidae < 400 > 4 acaaaaaccc tcagtggaaa aaacatgctg aacaatttcg tgaaggagca tgcttacaga 60 ctgtcccaga tttcttttcg tggctcaaat ctaactattc acccgctgag aaacatcagg 120 gattttttct atgtgggtaa catcaccatt gggacacccc ctcaggaatt ccaggttatc 180 tttgacacag gctcatctga gttgtgggtg ccctccatct tttgcaacag ctcaacctgt 240 tctaaacacg ataggttcag acátcttgág tcttctacct tccggcttag caggaggacc 300 ttcagcatca cctatggatc tgggagaatt gaagcacttg ttgttcatga cacagttcgg 360 attggggacc ttgtaagtac tgatcagcag ttcggtctat gcctagaaga atctgggttt 420 gagggcatga gatttgatgg cgtcttgggc ttgagctata ccaacatatc cccctctgga 480 gccatcccca tcttttacaa gctgaagaat gaaggtgcca tttctgaacc tgtttttgcc 540 gcaaagatga ttctacttga gcgggagggc agtgtggtga tgtttggtgg ggcggaccac 600 agggagagct cgctactaca caactggata ccattgatga ctggagtgta aagcaggcga 660 cacatggacc gcatctccat gaaaagaaag gttattgctt gctctggcgg ctgcaaggcc 720 cggggtcatc cttgtggaca agatatcgta ggcccaagta cactggtcaa taacatctgg 780 aagctcatcg gtgccacgcc acagggttct gagcactacg tttcatgttc tgcggtcaat 840 agcctaccct ctatta 'Tctt caccatcaaa agcaacaact accgagtgcc aggtcaagcc 900 tacatcctca aggattctag aggccgctgc tttactgcct ttaaagggca tcaacagagt 960 tcatctacag agatgtggat cctgggtgac gtctttctga ggctgtattt ctcagtcttt 1020 gatcgaagaa aggacagaat tggcctggcc accaaggtgt gaatgcttgg agtggttcag 1080 gaatcagtaa ggccactcct aacacacact cactcacact ttgggcactc ctgcccaagg 1140 aatgctggtg aactgtaatt tggtggtctg tacaccctat tctctgggaa gaaggcaatg 1200 gcaccccact ccagtactct tgcctggaaa atcacatgga gtgggctcca cagaagcctg 1260 gtccatgggg tttctaagag tcgggcaata actgagcacc ttcacttata ctttcacttt 1320 acaccctatt ctcaataaaa gataaatggt ttcactctt 1359 < 210 > 5 < 211 > 1317 < 212 > DNA < 213 > bovidae < 400 > 5 ccctgagtac ttggagccag gaaagaagta tgaagtggct tgtgctcctt gggctgctga 60 cctcctcaga gtgcatagtc atdctacc € c taacaaaagt gaagaccatg agaaaaaccc 120 aaacatgctg tcagtgaaaa tgaaggaaca aacaatttcc ctgtcccaga ggcttacaga 180 tttcttctcg tggctcaaat ataactattc atcccctgag gaacatcatg gatatggtct 240 atgtgggtaa aatcaccatt ggaacacccc ctcaggaatt ccaggttgtc tttgacacag 300 gctcatctga gttgtgggtg ccctccgtct tttgccccag ttcagcctgt tctactcaca 360 ttaggttcag acatcttgag tcttccactt ccggcctaac ccaaaagacc ttcagcatca 420 cctatggatc tgggagcacg aagggatttc ttgcttatga caccgttcgg attggggacc 480 ttctaagtac tgatcaggaa ttcggactaa gcatggaaga acacgggttt gaggatctac 540 cttttgatgg cgtcttgggc ttgaactacc ctgacatgtc accatcccca cttcataaca 600 tctttgacaa cctcaagaat caaggtgcct tttctgagcc tgtttttgcc ttctacttgg 660 gcaaggtgaa gggcagtgtg gtgatgtttg gtggggtgga ccacacctac tacaagggag 720 agctcaactg ggtgccattg atccaggcag gtgagtggag tctacacatg gaccgcatct 780 ccatgaaaag aaaggttatt gcttgttctg gtggctgcga ggccttctat gacactggaa 840 catcactgat ccttgg ccca agaagactgg tcaataacat ccagaagctc atcggtgcca 900 cgccacaggg ttccgagcac tacatttcat gttttgctgt catatccctg ccctctatta 960 tcttcaccat caacggcatc aacatcccag tgccagctcg agcctacatc cacaaggatt 1020 ctagaggcca ctgctatccc acctttaaag agaacacagt gagtacatcc acagagacct 1080 ggatcctggg tgacgtcttc ctgaggctct atttctcagt ggaaatgaca ttttgatcga 1140 ggattggcct ggcacaggtg taaatgcttg gagtggttca ggaatcagta aggccgctcc 1200 taacacacac tcactcacac tttgagactc ctgcccagga tgctggtgaa ctgtatttgg 1260 tggtctgcac accctattct caggaaagaa taaagggttt cactcttaat ggtgctg 1317 < 210 > 6 < 211 > 1322 < 212 > DNA < 213 > bovidae < 400 > 6 aatcacatga ggagccagaa agtggcttgt gctcctcggg ctggtggcct tctcagagtg 60 atacctctaa catagtcaaa ggagagtgaa aatgctatca gacaatgaga gtggaaaaaa 120 aatatcctga cacgctgaac aggagcatgc ttacagactg ccccagattt cttttcgtgg 180 ctcaaatcta actcacccac tgagaaacat cagggatttg ttctacgtgg gtaacatcac 240 cattgggaca ccccctcagg aattccaggt tatctttgac acaggctcat ctgacttgtg 300 atcttttgca ggtggcctcc acagctcatc ctgtgctgca cacgttaggt tcagacatca 360 tcagtcttcc accttccggc ctaccaataa gaccttcagg atcacctatg gatctgggag 420 aatgaaagga gttgttgttc atgacacagt tcggattggg gaccttgtaa gtactgacca 480 gccattcggt ctatgcctga aagactctgg gtttaagggc ataccttttg atggcatctt 540 gggcttgagc taccccaaca aaaccttctc tggagccttc cccatctttg acaagctgaa 600 gaatgaaggt gccatttctg agcctgtttt tgccttctac ttgagcaaag acaagcagga 660 gggcagtgtg gtgatgtttg gtggggtgga ccaccgctac tacaaggggg agctcaactg 720 ggtaccattg atccaagtgg gtgactggtt tgtacacatg gaccgcacta ccatgaaaag 780 aaaggttatt gcttgttctg atggctgcaa ggcccttgtg gacaccggga catcagatat 840 cgtaggccca agtacactgg tcaataacat ctggaagctc atccgtgcca ggccactggg 900 tcctcagtac ttcgtttcat gttctgcggt caatacactg ccctctatta tcttcaccat 960 caacggcatc aactaccgac tgccagctcg agcctacatc cacaaggatt ctagaggccg 1020 ctgctatacc gcctttaaag agcaccgatt cagttcacct atagagacct ggctcctggg 1080 tgacgtcttc ctgaggcggt atttctcagt ctttgatcga ggaaatgaca ggattggcct 1140 ggcacgggca gtgtaaatgc tcaggaatca ttagagtggc tcctaacaca gtaaggccgt 1200 ccttaactca cactttgggc actcttgcct aggatgctgg tgaactgtat ttggtgctcg 1260 tacacccatt ctagtaaaga ataaagggtt tcacttaacg ggtgctgaaa 1320 aaaaaaaaaa 1322 <aa; 210 > 7 < 21 1 > 121 1 < 212 > DNA < 213 > bovidae < 400 > 7 acaccaaaac ttccctgagt acttggaacc aggaaagaag catgaagtgg cttgtgctcc 60 tcgggctggt ggccttctca gagtgcatag tcaaaatacc gtgaagacca tctaaggaga 120 tgagaaaaac tctcagtgga aaaaacatgc tgaacaattt cttgaaggag gatccttaca 180 gactgtccca catttctttt cgtggctcaa atctaactat tcacccgctg agaaacatca 240 ctatgtcgga gagatatctt aacatcacca ttggaacacc ccctcaggaa ttccaggtta 300 tctttgacac aggctcatct gacttgtggg tgccctcgat cgattgcaac agtacatcct 360 gtgctacaca tgttaggttc agacatcttc agtcttccac cttccggcct accaataaga 420 ccttcaggat catctatgga tctgggagaa tgaacggagt tattgcttat gacacagttc 480 ggattgggga ccttgtaagt accgaccagc catttggtct aagcgtggag gaatatgggt 540 ttgcgcacaa aagatttgat ggcatcttgg gcttgaacta tcctggtcta ctggaaccta 600 aggccatgcc catctttgac aagctgaaga atgaaggtgc catttctgag cctgtttttg 660 ccttctactt gagcaacatc accatgaaca gagaggttat tgcttgttct gaaggctgtg 720 cggcccttgt ggacactggg tcatcaaata tccaaggccc aggaagactg attgataaca 780 tacagaggat catcggcgcc acgccacggg gttccaagta ctacgtttca tgttctgcgg 840 tcaatatcct gccctcta tt atcttcacca tcaacggcgt caactaccca gtgccacctc 900 gagcttacat cctcaaggat tctagaggcc actgctatac cacctttaaa gagaaaagag 960 tgaggagatc tacagagagc tgggtcctgg gtgaagtctt cctgaggctg tatttctcag 1020 tctttgatcg aggaaatgac aggattggcc tggcacggcg agtgtaaatg cttggtctgg 1080 attaaggcca ctcaagaatc ctcctaacac acactcactc acactttggg cactgctgcc 1140 aggatgctgg tgaactgtat ttgtgttctg tacaccctat tctcagtaaa gaataaaggg tttcagctct 1200 t 1211 < 210 > 8 < 211 > 1340 < 212 > DNA < 213 > bovidae < 400 > 8 caggaattcg cggccgcgtc gacggaaaga agcatgaagt ggcttgtgct tctcgggctg 60 gtggccctct cagagtgcat agtcaaaatc cctctaacga agatgaagac catgcaagaa 120 gccatcaggg aaaaacaatt gctggaagat ttcttggatg aacaacctca cagcctgtcc 180 cagcattctg atcctgacaa gaaattctct tctcaccaac tgaagaattt ccagaatgct 240 gtctactttg gtacgatcac cattggaaca cctcctcaag agttccaggt caactttgac 300 accggctcat ctgacttgtg ggtgccctct gtcgactgcc aaagtccctc ctgctctaaa 360 cataagagat tcgaccctca gaagtccacc accttccagc gaaaattgaa ctttgaacca 420 ctcgtctacg gctctgggac catgaaaggg gttcttggct ctgacaccat tcagatcggg 480 tcgtgaacca aaccttgtca gatttttggc ttgagccaga atcagtccag tggcgtcctg 540 gaacaagtac cttatgatgg catcctgggc ttggcctacc ccagcctcgc catccagggg 600 accaccccag tcttcgacaa cctgaagaat cgagaagtca tttctgagcc agtctttgcc 660 ttctacttga gctcccggcc agaaaacatc agcacggtga tgtttggcgg ggtggaccac 720 acctaccaca agggaaaact ccagtggatc ccagtgaccc aagcccgctt ctggcaggta 780 gccatgagca gcatgaccat gaacgggaat gtggtcggtt gttcccaagg atgtcaggcc 840 gttgtggata ctgggacc tc gttgctggtt gggccaactc acctggtcac tgacatcctg 900 aagctcatca accctaatcc tatcctgaat gacgagcaaa tgctttcatg tgatgccatc 960 aatagcctgc ctacgctcct cctcaccatc aacggcatcg tctaccctgt gccccctgac 1020 tactacatcc agaggttttc tgaaaggatc tgctttatca gctttcaagg gggcacagag 1080 atcttgaaaa atttgggaac ctcggagacc tggatcctgg gtgatgtctt cctgaggctg 1140 tatttttcag tttatgaccg aggaaataac aggattggcc tggctcctgc agcataaatt 1200 caggaatcaa cgggctgcta tcagggccag acaaacacac actcactcac atgcagggcc 1260 atcccaccca gggatgctgg tgaactatgc ctgatgctct gcaaagccgt attctcagta 1320 aagaataaaa gattcatttc 1340 < 210 > 9 < 211 > 1311 < 212 > DNA < 213 > bovidae < 400 > 9 accccaaact tccctgagta cctggagcca gtaaagaagc atgaagtgga ttgtgctcct 60 cgggctggtg gccttctcag agtgcatagt caaaatacct ctaaggcaag tgaagaccat 120 gagaaaaacc ctcagtggaa aaaacatgct gaagaatttc ttgaaggagc atccttacag 180 actgtcccag atttcttttc gtggctcaaa tctaactatt cacccgctga ggaacatcat 240 tacgtgggta gaatttggtc acatcaccat tggaacaccc cctcaggaat tccaggttgt 300 ctttgacaca ggctcatctg acttgtgggt gccctccttt tgtaccatgc cagcatgctc 360 tgcaccggtt tggttcagac aacttcagtc ttccaccttc cagcctacca ataagacctt 420 * - -caccatcacc tatggatctg ggagcatgaa gggatttctt gcttatgaca cagttcggat 480 tggggacctt gtaagtactg atcagccgtt cggtctaagc gtggtggaat atgggttgga 540 * c gggcagaaat tatgatggtg tcttgggctt gaactacccc aacatatcct tctctggagc 600 catccccatc tttgacaacc tgaagaatca aggtgccatt tctgagcctg tttttgcctt 660 ctacttgagc aaaaacaagc aggagggcag tgtggtgatg tttggtgggg tggaccacca 720 gtactacaag ggagagctca actggatacc actgattgaa gcaggcgaat ggagagtaca 780 catggaccgc atctccatga aaagaacggt tattgcttgt tctgatggct gtgaggccct 840 tgtgcacact gggacatcac atatcgaagg cccaggaaga ctggtgaata acatacacag 900 gctcatccgc accaggccat ttgattccaa gcactacgtt tcatgttttg ccaccaaata 960 attactttca cctgccctct tcatcaacgg catcaagtac ccaatgacag ctcgagccta 1020 catctttaag gattctagag gccgctgcta ttccgctttt aaagagaaca cagtgagaac 1080 atctagagag acctggatcc tcggtgatgc cttcctgagg cggtatttct cagtctttga 1140 tcgaggaaat gacaggattg gcctggcacg ggcagtgtaa atgcttagag tggttcagga 1200 atcagtaagg ccgttcctaa cacacactaa ctcacacttt gggcactctt gcctaggatg 1260 ctggtgaacc tgtctttggt ggtcttgtac caccctattc tcagtaaaga a 1311 < 210 > 10 < 211 > 1328 < 212 > DNA < 213 > bovidae < 400 > 10 tccgactctg tcttgagcac ttcagtggag gacaaaagca tgaagtggct tggacttctc 60 gggctggtag ctctctcaga gtgcatggtc ataatccctc ttaggcaaat gaagaccatg 120 cgagaaaccc taagggaaag acatttgctg acaaatttct ctgaggaaca cccttacaac 180 ctgtcccaga aagctgctaa tgatcaaaac ataatttatc atcatccctt gaggagctat 240 aaggattttt cctacatcgg caacatcaac attggaacac cccctcagga gttccaggtc 300 ctctttgaca ccggctcatc tagcttgtgg gtgccctcca tatactgcca gagttccagc 360 tgctataaac acaatagctt cgtcccttgt aactcctcca ccttcaaggc cacgaacaag 420 atcttcaata ccaactacac cgctacatcg ataaagggat atcttgtcta tgacactgtt 480 cggatcggga accttgttag tgtggcccag ccatttggcc taagcctgaa ggagtttggg 540 tttgacgatg taccatttga tggcatcctg ggactaggtt acccacgccg cactatcaca 600 ggggccaacc cgatcttcga caacctgtgg aaacaaggag tcatttctga gcctgtcttt 660 gccttctact tgagcagtca gaaagagaac ggcagcgtgg tgatgtttgg aggggtgaac 720 cgtgcctact ataagggaga actcaactgg gtaccagtgt cccaagtggg cagctggcat 780 ataaacatag acagcatctc catgaatggg acagtggttg cttgtaaacg tggctgccag 840 gcctcttgga tacgggg acg cctttctgcg tggcccaaga ggatcgtcag caaaatccag 900 aaactcatcc atgccaggcc catcgatcgt gagcacgtgg tttcctgcca agccatcggg 960 acactgcctc ctgctgtctt cactatcaat gggatagact atccagtacc cgcccaagct 1020 tacatccaaa gtttgtcggg ctactgcttc agcaactttc ttgtgcgccc acagcgtgtg 1080 aacgagtcgg agacctggat cctgggtgac gtcttcctga ggctgtattt ctcagttttc 1140 gatcgaggaa acaacaggat tggcctggct cccgcagtgt aaatgctggg ctacttcagg 1200 aatcaatcag gcccactcca aacacatact catgtgaggg caccctgggt ggggccaggg 1260 atgctggtga actctgtttg ttgcgctgca aagccctact ctctatagag aataaaggat 1320 ttcatctc 1328 < 21O > 11 < 211 > 1285 < 212 > DNA < 213 > bovidae < 400 > 11 gagatgaagt ggcttgtgtt ccttgggctg gtggccttct cagagtgcat agtcataatg 60 cttctaacta aaacgaagac aatgcgagaa atctggaggg aaaaaaaatt gctgaacagt 120 ttcctggagg aacaagccaa tagaatgtcc gatgattctg ctagtgaccc caaattatct 180 actcaccccc tgaggaacgc tctggatatg gcctatgtgg gtaacatcac cattggaaca 240 ccccctaagg agttccgggt tgtctttgac acgggctcat ctgacttgtg ggtgccctcc 300 atcaagtgca tcagtcctgc ctgtcataca catattacct tcgaccatca caaatcttcc 360 accttccggc ttacgcgcag gcccttccac atcctctacg gatctgggat gatgaacgga 420 gttcttgcct atgacactgt tcggatcggg aaacttgtca gcactgacca gccgtttggc 480 ctaagcctgc agcaattcgg gtttgataat gcaccctttg atggtgtcct gggcttgtcc 540 taccccagcc tcgctgtccc aggaaccatc cccatctttg acaagctgaa gcaacaaggt 600 gccatttctg aacctatctt tgccttctac ttgagcaccc gcaaggagaa tggcagtgtg 660 ttgatgttag gtggggtgga ccactcctac cacaagggaa agctcaactg gataccagtg 720 tcccaaacca aaagctggct aataactgtg gaccgcatct ccatgaatgg gagagtgatt 780 acggctgcga ggctgtgaac gataccggga ggctcttgtg ccatggccca catcactgat 840 gcaagaccag tcaccaa cat ccaaaagttc atccacgcta tgccctacgg ttccgagtac 900 atggttttgt gtcctgtcat cagtatcctg cctcctgtca tcttcaccat caatggcatc 960 gattactcag tgcctcgtga agcctacatc caaaagattt ctaatagctt atgccttagc 1020 acctttcatg gggacgacac agaccaatgg atcctgggtg acgtcttcct gaggctgtat 1080 ttctcagttt atgaccgagg aaataacagg attggcctgg ctcctgctgt gtaaatgctt 1140 ggacttgttc aggaatcatt caggccagtc ctaacacaca cttgctcaca ctttagactc 1200 ctgcccagga tgctggtaaa tgctctgaaa ctgtgtttgg cactgaaaaa gtcatattct 1260 taaaaggttt cactcttaac atctt 1285 < 210 > 12 < 211 > 1130 < 212 > DNA < 213 > bovidae < 400 > 12 atgaagtggc ttgtgctcct cgggctggtg gccctctcag agtgcatagt cattttgcct 60 ctaaggaaaa tgaagacctt gcgagaaacc ctgagggaaa aaaacttgct gaacaatttc 120 ctggaagaac gagcttacag actgtccaag aaagactcca aaataactat tcaccccctt 180 aaaactatct ggatatggcc tacgtgggta atatcaccat tggaacaccc cctcaggaat 240 tccgggtcgt ctttgacaca ggctcagctg acttgtgggt gccttccatc agctgtgtca 300 gtccagcctg ttatacacac aaaaccttca atcttcacaa ttcttccagc ttcgggcaaa 360 cacaccagcc tattagcatc tcctatggac ctgggataat tcagggattt cttggctctg 420 acaccgttcg gatcgggaac cttgttagcc ttaaacagtc gtttggccta agccaggagg 480 aatatgggtt tgatggtgca ccctttgatg gcgtcctggg cttggcctac ccctccatca 540 gcatcaaagg tatcatcccc atctttgaca acttgtggtc gcaaggtgcc ttttctgaac 600 ctgtctttgc cttctacttg aacacatgcc agccggaagg cagtgtggtg atgtttggtg 660 gagtggacca ccgctactac aagggagagc tcaactggat accagtgtcc caaactcgct 720 actggcagat aagcatgaac cgcatcagca tgaacgggaa tgttactgct tgttctcgtg 780 gatgtcaggc ccttttggac accgggacat tggcccaaca caatgatcca agactgatca 840 ccaacatcca caagctcatg aacgccaggc accagggttc ggagtatgtg gtttcatgtg 900 atgccgtcaa gaccctgcct cctgtcatct tcaacatcaa tggcatcgac tatccactgc 960 cccctcaagc ctacatcacc aaggctcaaa acttctgcct tagcatcttt catgggggca 1020 cagaaactag ctctccagag acctggatcc tgggtggcgt cttcctgaga cagtacttct 1080 cagtttttga tcgaagaaat gacagtattg gcctggcaca ggtgtaaatg 1130 < 210 > 13 < 211 > 1173 < 212 > DNA < 213 > bovidae < 400 > 13 cccaagctta tgaagtggct tgtgctcctc gggctggtgg ccctctcaga gtgcatagtc 60 attttgcctc taaagaaaat gaagaccttg cgagaaaccc tgagggaaaa aaacttgctg 120 tggaggaaca aacaatttcc agcttacaga ctgtccaaga atgactccaa aataactatt 180 caccccctga ggaactatct ggatactgcc tacgtgggta acatcaccat tggaacaccc 240 cctcaggagt tccgggtcgt ctttgacaca ggctcagcta acttgtgggt gccctgcatc 300 acctgtacca gtccagcctg ttatacacac aaaaccttca atcctcaaaa ttcttcaagc 360 ttccgggaag taggctcgcc tatcaccatc ttctatggat ctgggataat tcagggattt 420 cttggctctg acaccgttcg gatcgggaac cttgttagcc ttaaacagtc gtttggccta 480 agccaggagg aa atgggtt tgatggtgca ccctttgatg gcgtcctggg cttggcctac 540 ccctccatca gcatcaaagg tatcatcccc atctttgaca acttgtggtc gcacggtgcc 600 ttttctgagc ctgtcttcgc cttctacttg aacacaaaca agccagaggg cagtgtggtg 660 atgtttggtg gggtggacca ccgctactac aagggagagc tcaactggat accagtgtcc 720 caaactagcc attggcagat aagcatgaac aacatcagca tgaatgggac tgtgacggct 780 tgttcttgtg gatgtgaggc ccttttggac accgggacat cggcccaaca caatgatcta 840 aaactggtca ccaacat cca caagctcatg aacgccaggc ttgagaattc tgagtatgtg 900 gtttcatgtg atgctgtcaa gaccctgcct cctgtcatct tcaacatcaa tggcatcgac 960 tatccactgc gccctcaagc ctacatcatc aagattcaaa acaactgccg cagcgtcttt 1020 caaggaggca cagaaaatag ctctctaaac acctggatcc ttggtgatat cttcctgagg 1080 cggtttttga cagtacttct tcgtaaaaat agaaggattt gctggcacag gtgggtaccg 1140 actacaagga cgacgatgac aagtaagctt ccg 1173 < 210 > 14 < 211 > 1176 < 212 > DNA < 213 > bovidae < 400 > 14 cccaagctta tgaagtggct tgtgctcctt gcgctggtgg ccttctcaga gtgcataatc 60 aaaatacctc taaggagagt gaagaccatg agcaataccg ccagtggaaa aaacatgctg 120 tgaagaagca aacaatttcc tccttacaga ttgtcccaga tttcttttcg tggctcaaat 180 d ctcactactc acccactgat gaacatctgg gatttgctct acctgggtaa catcaccatt 240 ggaacacccc ctcaggaatt ccaggttctc tttgacacag gctcatctga cttgtgggtc 300 ccctctctct tgtgcaacag ctcaacctgt gctaaacacg ttatgttcag 0 acatcgtctg 360 tcttccacct accggcctac caataagacc ttcatgatct tctatgcagt tgggaaaatt 420 gaaggagttg ttgttcgtga cacagttcgg attggggacc ttgtaagtgc ggaccagacg 480 d tttggtctaa gcattgcaga aactgggttt gagaacacaa ctcttgatgg catcttgggc 540 ttgagctacc ccaacacatc ctgctttgga accatcccca tctttgacaa gctgaagaat 600 gaaggtgcca tttctgagcc tgtactacat agtgtgagac gcaaagatga 0 gcaggagggc 660 agtgtagtga tgtttggtgg tgtggaccac agttactaca agggagagct caactgggta 720 aagcaggcga ccattgatca cgtgtggaca ctggagtgta gcatcaccat gaaaagagag 780 gttattgctt gttctgacgg ctgcagggcc ctggtggaca ccggttcatc acatatccaa 840 ggcccaggaa gactgatcga taacgtacag aagctgatag gcaccatgcc acagggatcc 900 atgcactatg ttccatgttc tgcggtcaat accctgccct ctattatctt caccatcaac 960 agcatcagct acacagtgcc agctcaagcc tacatcctca agggttctag gggccgctgc 1020 tattccacct ttcaagggca cactatgagt tcatctacag agacctggat cctgggtgat 1080 gtcttcctga gtcagtattt ctcggtcttt gatcgaggaa atgacaggat tggcctggca 1140 ccgactacaa caggtgggta ggacgacgat gaaagt 1176 < 210 > 15 < 211 > 1360 < 212 > DNA < 213 > Felis domestica < 400 > 15 aggaaagaag catgaagtgg ctttgggtcc ttgggctggt ggccctctca gagtgcttag 60 tcacaatccc tctgacgagg gtcaagtcca tgcgagaaaa cctcagggag aaagacaggc 120 tgaaggattt cctggagaac acctggccta catccttaca gactctgtaa caagtttgtt 180 atctggacct ggggatatat tttgaaccga tgaggaacta cctggatctg gcctacgttg 240 gcaccatcag cattggaacg cccccccagg agttcaaggt catctttgac accggctcat 300 ctgacttgtg ggtgccctcc atctactgct ctagccctgc ctgcgctaat cacaacgtct 360 tcaaccctct gcggtcctcc accttccgga tctcgggccg gcccatccac ctccagtacg 420 gctccgggac gatgtcagga tttctggcct acgacaccgt tcggttcggg ggcctcgttg 480 acgtggccca ggcgtttggc ctgagcctga gggagcccgg caagttcatg gaatacgcag 540 ttttcgacgg catcctgggc ctggcctacc ccagcctcag cctcagaggg accgtccctg 600 cctgtggaag tcttcgacaa tttctcagga cagggtctca ttctacttga gctctttgcc 660 gcaaaaagga cgaagaaggc agtgtggtga tgttcggcgg tgtggaccac tcctactaca 720 gcggagacct caactgggtg ccggtgtcca aacggctgta tccatggaca ctggcagtta 780 gcatctccat gaacggggaa gtcattgctt gtgacggtgg ctgccaggcc atcattgata 840 caggaacctc gctgctgatt ggcccatctc acgttgtctt caacatccag atgatcatcg 900 gcgccaacca gtcctacagc ggcgagtacg tagttgactg cgatgccgcc aacaccctgc 960 ccgacatcgt cttcaccatc aacggcatcg actacccggt gccagccagt gcctacatcc 1020 aggagggtcc tcagggcacc tgctacagcg gctttgacga gagcggagac agcttgttgg 1080 tctcagactc ctggatcctg ggcgatgtct tcctgaggtt gtatttcacc gtcttcgacc 1140 gagagaacaa caggattggc ctggccctgg cagtgtaaac gctccaggaa actggggcca 1200 gcaaccgtgc ccaccccaaa cccgcgcgcg cgtgtgcgca cacacacaca cacacacccc 1260 gcagtcaggg cattcctgcc caggggccgg cttgaactgt gtcttcggct ctgccaatcc 1320 cttctcccag tggagaataa aagacctcat cttccacggt 1360 < 210 > 16 < 211 > 29 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 16 cccaagctta tgaagtggct tgtgctcct 29 < 210 > 17 < 21 1 > 69 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 17 gggaagctta cttgtcatcg tcgtccttgt agtcggtacc cacctgtgcc aggccaatcc 60 tgtcatttc 69 < 210 > 18 < 21 1 > 21 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 18 cctcttttgc cttctacttg to 21 < 210 > 19 < 211 > 29 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 19 gcgctcgagt tacactgccc gtgccaggc 29 < 210 > 20 < 211 > 21 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 20 tgggtaacat caccattgga to 21 < 210 > 21 < 211 > 20 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 21 tttctgagcc tgtttttgcc 20 < 210 > 22 < 211 > 22 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 22 tgggtaacat caccattgga ac 22 < 210 > 23 < 21 1 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of artificial sequence: primer for PCR < 400 > 23 caaacatcac cacactgccc tcc 23 < 210 > 24 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 24 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys lie 1 5 10 15 Val Lys lie Pro Leu Arg Arg Leu Lys Thr Met Arg Asn Val Val Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Glu His Wing Tyr Ser Leu 35 40 45 Being Gln lie Being Phe Arg Gly Being Asn Leu Thr Thr His Pro Leu Arg 50 55 60 Asn lie Lys Asp Leu Val Tyr Met Gly Asn lie Thr lie Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Ala Ser Ser Asp Leu Trp 85 90. 95 Val Pro Ser Asp Phe Cys Thr Ser Pro Wing Cys Ser Thr His Val Arg 100 105 110 Phe Arg His Leu Gln Ser Ser Thr Phe Arg Leu Thr Asn Lys Thr Phe 115 120 125 Arg lie Thr Tyr Gly Ser Gly Arg Met Lys Gly Val Val Val His Asp 130 135 140 Thr Val Arg lie Gly Asn Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Ser lie Glu Glu Tyr Gly Phe Glu Gly Arg lie Tyr Asp Gly_ Val Leu 165 170 175 Gly Leu Asn Tyr Pro Asn lie Be Phe Ser Gly Ala lie Pro lie Phe 180 185 190 Asp Lys Leu Lys Asn Gln Arg Ala lie Ser Glu Pro Val Phe Ala Phe 195 200 205 Tyr Leu Ser Lys Asp Glu Arg Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Glu Gly Glu Leu Asn Trp Val Pro Leu lie 225 230 235 240 Gln Wing Gly Asp Trp Ser Val His Met Asp Arg lie Ser lie Glu Arg 245 250 255 Lys lie lie Ala Cys Ser Asp Gly Cys Lys Ala Leu Val Asp Thr Gly 260 265 270 -Thr Ser Asp lie Val Gly Pro Arg Arg Leu Val Asn Asn lie His Arg 275 280 285 Leu lie Gly Ala lie Pro Arg Gly Ser Glu His Tyr Val Pro Cys Ser 290 295 300 Glu Val Asn Thr Leu Pro Ser lie Val Phe Thr lie Asn Gly lie Asn 305 310 315 320 Tyr Pro Val Pro Gly Arg Ala Tyr lie Leu Lys Asp Asp Arg Gly Arg 325 330 335 Cys Tyr Thr Thr Phe Gln Glu Asn Arg Val Ser Ser Ser Thr Glu Thr 340 345 350 Trp Tyr Leu Gly Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg lie Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 25 < 211 > 376 < 212 > PRT < 213 > bovidae < 400 > 25 Met Lys Trp Leu Val Leu Leu Gly Leu Val Ala Leu Ser Glu Cys lie 1 5 10 15 Val lie Leu Pro Leu Lys Lys Met Lys Thr Leu Arg Glu Thr Leu Arg 20 25 30 Glu Lys Asn Leu Leu Asn Asn Phe Leu Glu Glu Gln ^ Ala TyrTArg Leu 35 40 45 Ser Lys Asn Asp Ser Lys lie Thr lie His Pro Leu Arg Asn Tyr Leu 50 55 60 Asp Thr Wing Tyr Val Gly Asn lie Thr lie Gly Thr Pro Pro Gln Glu 65 70 75 80 Phe Arg Val Val Phe Asp Thr Gly Ser Wing Asn Leu Trp Val Pro Cys 85 90 95 lie Thr Cys Thr Ser Pro Wing Cys Tyr Thr His Lys Thr Phe Asn Pro 100 105, 110 Gln Asn Being Being Phe Arg Glu Val Gly Ser Pro lie Thr? Le Phe 115 120 125 Tyr Gly Ser Gly lie lie Gln Gly Phe Leu Gly Ser Asp Thr Val Arg 130 135 140 lie Gly Asn Leu Val Ser Pro Glu Gln Ser Phe Gly Leu Ser Leu Glu 145 150 155 - 160 Glu Tyr Gly Phe Asp Ser Leu Pro Phe Asp Gly lie Leu Gly Leu Wing 165 170 175 Phe Pro Wing Met Gly Lie Glu Asp Thr lie Pro lie Phe Asp Asn Leu 180 185 190 Trp Ser His Gly Wing Phe Ser Glu Pro Val Phe Wing Phe Tyr Leu Asn 195 200 205 Thr Asn Lys Pro Glu Gly Val Val Met Phe Gly Gly Val Asp His 210 215 220 Arg Tyr Tyr Lys Gly Glu Leu Asn Trp lie Pro Val Ser Gln Thr Ser 225 230 235 240 His Trp Gln lie Ser Met Asn Asn Lie Ser Met Asn Gly Thr Val Thr 245 250 _255 Wing Cys Ser Cys Gly Cys Glu Wing Leu Leu Asp Thr Gly Thr Ser Met 260 265 270 lie Tyr Gly Pro Thr Lys Leu Val Thr Asn lie His Lys Leu Met Asn 275 280 285 Wing Arg Leu Glu Asn Ser Glu Tyr Val Val Ser Cys Asp Ala Val Lys 290 295 300 Thr Leu Pro Pro Val lie Phe Asn lie Asn Gly lie Asp Tyr Pro Leu 305 310 315 320 Arg Pro Gln Ala Tyr lie lie Lys lie Gln Asn Ser Cys Arg Ser Val 325 330 335 Phe Gln Gly Gly Thr Glu Asn Being Ser Leu Asn Thr Trp lie Leu Gly 340 345 350 Asp lie Phe Leu Arg Gln Tyr Phe Ser Val Phe Asp Arg Lys Asn Arg 355 360 365 Arg lie Gly Leu Ala Pro Ala Val 370 375 < 210 > 26 < 21 1 > 381 < 212 > PRT < 213 > bovidae < 400 > 26 Met Asp Asp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys lie 1 5 10 15 Val Lys lie Pro Leu Arg Arg Val Lys Thr Met Arg Asn Thr Val Ser 20 25 30 Gly Lys Asn lie Leu Asn Asn lie Leu Lys Glu His Val Tyr Arg Leu 35 40 45 Ser Gln lie Ser Phe Arg Gly Ser Asn Leu Thr Thr His Pro Leu Arg 50 55 60 Asn lie Lys Asp Leu lie Tyr Val Gly Asn lie Thr lie Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Gly Ser Ser Asp Phe Trp 85 90 95 Val Pro Ser Asp Phe Cys Thr Ser Arg Ala Cys Ser Thr His Val Arg 100 105 110 Phe Arg His Leu Gln Ser Ser Thr Phe Arg Leu Thr Asn Lys Thr Phe 115 120 125 Arg lie Thr Tyr Gly Ser Gly Arg Met Lys Gly Val Val Ala His Asp 130 135 140 Thr Val Arg lie Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Ser Val Glu Glu Tyr Gly Phe Glu Gly Arg Ala Tyr Tyr Asp Gly Val 165 170 175 Leu Gly Leu Asn Tyr Pro Asn lie Be Phe Ser Gly Ala lie Pro lie 180 185 190 Phe Asp Asn Leu Lys Asn Gln Gly Ala lie Ser Glu Pro Val Phe Wing 195 200 205 lie Leu Leu Ser Lys Asp Glu Gln Glu Gly Ser Val Val Met Phe Gly 210 215 220 Gly Val Asp His Arg Tyr Tyr Glu Gly Glu Leu Asn Trp Val Pro Leu 225 230 235 -, 24O lie Glu Wing Gly Asp Trp lie lie His Met Asp Arg lie Ser Met Lys 245 250 -255 Arg Lys lie lie Ala Cys Ser Gly Ser Cys Glu Ala lie Val_Asp Thr 260 265 270 Gly Thr Ser Ala lie Glu Gly Pro Arg Lys Leu Val Asn Lys lie His 275 280 285 Lys Leu lie Gly Ala Arg Pro Arg His Ser Lys Tyr Tyr lie Ser Cys 290 295 300 Ser Wing Val Asn Thr Leu Pro Ser lie lie Phe Thr lie Asn Gly lie 305 310 315 320 Asn Tyr Pro Cys Pro Gly Arg Ala Tyr Val Leu Lys Asp Ser Arg Gly 325 330 335 Arg Cys Tyr Ser Met Phe Gln Glu Asn Lys Val Ser Ser Ser Thr Glu 340 345 350 Thr Trp lie Leu Gly Asp Val Phe Leu Arg Val Tyr Phe Ser Val Phe 355 360 365 Asp Arg Gly Asn Asp Arg lie Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 27 < 21 1 > 380 < 212 > PRT < 213 > bovidae < 400 > 27 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys lie 1 5 10 15 Val Lys lie Pro Leu Arg Arg Val Lys Thr Met Thr Lys Thr Leu Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Val Lys Glu His Wing Tyr Arg Leu 35 40 45 Ser Gln lie Ser Phe Arg Gly Ser Asn Leu Thr lie His Pro Leu Arg 50 55 60 Asn lie Arg Asp Phe Phe Tyr Val Gly Asn lie Thr lie Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val lie Phe Asp Thr Gly Ser Ser Glu Leu Trp 85 90 95 Val Pro Ser lie Phe Cys Asn Ser Ser Thr Cys Ser Lys His Asp Arg 100 105 110 Phe Arg His Leu Glu Be Ser Thr Phe Arg Leu Ser Arg Arg Thr Phe 115 120 125 Ser lie Thr Tyr Gly Ser Gly Arg lie Glu Ala Leu Val Val His Asp 130 135 140 Thr Val Arg lie Gly Asp Leu Val Ser Thr Asp Gln Gln Phe Gly Leu 145 150 155 160 Cys Leu Glu Glu Be Gly Phe Glu Gly Met Arg Phe Asp Gly Val Leu 165 170 175 Gly Leu Ser Tyr Thr Asn lie Ser Pro Gly Ala lie Pro lie Phe 180 185 190 Tyr Lys Leu Lys Asn Glu Gly Ala lie Ser Glu Pro Val Phe Wing Phe 195 200 205 Tyr Leu Ser Lys Asp Glu Arg Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Wing Asp His Arg Tyr Tyr Lys Gly Glu Leu Asn Trp lie Pro Leu Met 225 230 235 240 Lys Ala Gly Asp Trp Ser Val His Met Asp Arg lie Ser Met Lys Arg 245 250 255 Lys Val lie Wing Cys Ser Gly Gly Cys Lys Wing Leu Val Asp Thr Gly 260 265 270 Ser Ser Asp Lie Val Gly Pro Ser Thr Leu Val Asn Asn Lie Trp Lys 275 280 285 Leu lie Gly Ala Thr Pro Gln Gly Ser Glu His Tyr Val Ser Cys Ser 290 295 300 Wing Val Asn Ser Leu Pro Ser lie lie Phe Thr lie Lys Ser Asn Asn 305 310 315 320 Tyr Arg Val Pro Gly Gln Wing Tyr lie Leu Lys Asp Ser Arg Gly Arg 325 330 335 Cys Phe Thr Wing Phe Lys Gly His Gln Gln Being Ser Thr Glu Met 340 345 350 Trp lie Leu Gly Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Arg Lys Asp Arg lie Gly Leu Wing Thr Lys Val 370 375 380 < 210 > 28 < 211 > 377 < 212 > PRT < 213 > bovidae < 400 > 28 Met Lys Trp Leu Val Leu Leu Gly Leu Leu Thr Ser Ser Glu Cys lie 1 5 10 15 Val lie Leu Pro Leu Thr Lys Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Glu Lys Asn Met Leu Asn Asn Phe Leu Lys Glu Gln Ala Tyr Arg Leu 40 45 Ser Gln lie Ser Arg Gly Ser Asn lie Thr lie His Pro Leu Arg 50 55 60 Asn lie Met Asp Met Val Tyr Val Gly Lys lie Thr lie Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Gly Ser Ser Glu Leu Trp 85 90 - 95 Val Pro Ser Val Phe Cys Pro Ser Ser Ala Cys Ser Thr His lie Arg 100 105 110 Phe Arg His Leu Glu Ser Ser Thr Ser Gly Leu Thr Gln Lys Thr Phe 115 120 125 Ser lie Thr Tyr Gly Ser Gly Ser Thr Lys Gly Phe Leu Wing Tyr Asp 130 135 140 Thr Val Arg lie Gly Asp Leu Leu Ser Thr Asp Gln Glu Phe Gly Leu 145 150 155 160 Ser Met Glu Glu His Gly Phe Glu Asp Leu Pro Phe Asp Gly Val Leu 165 170 175 Gly Leu Asn Tyr Pro Asp Met Ser Phe lie Thr Thr lie Pro lie Phe 180 185 190 Asp Asn Leu Lys Asn Gln Gly Wing Phe Ser Glu Pro Val Phe Wing Phe 195 200 205 Tyr Leu Gly Lys Val Lys Gly Ser Val Val Met Phe Gly Gly "Val Asp 210 215 220 His Thr Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro Leu lie Gln Ala 225 230 235 240 Gly Glu Trp Ser Leu His Met Asp Arg lie Ser Met Lys Arg Lys Val 245 250 255 lie Wing Cys Ser Gly Gly Cly Glu Wing Phe Tyr Asp Thr Gly Thr Ser 260 265 270 Leu lie Leu Gly Pro Arg Arg Leu Val Asn Asn lie Gln Lys Leu lie 275 280 285 Gly Ala Thr Pro Gln Gly Ser Glu His Tyr lie Ser Cys Phe Ala Val 290 295 300 lie Ser Leu Pro Ser lie lie Phe Thr lie Asn Gly lie Asn lie Pro 305 310 315 320 Val Pro Ala Arg Ala Tyr lie His Lys Asp Ser Arg Gly His Cys Tyr 325 330 335 Pro Thr Phe Lys Glu Asn Thr Val Ser Thr Ser Thr Glu Thr Trp lie 340 345 350 Leu Gly Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Phe. Asp Arg Gly 355 360 365 Asn Asp Arg lie Gly Leu Ala Gln Val 370 375 < 210 > 29 < 211 > 379 < 212 > PRT < 213 > bovidae < 400 > 29 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys lie 1 5 10 15 Val Lys lie Pro Leu Arg Arg Val Lys Thr Met Arg Asn Ala lie Ser 20 25 30 Gly Lys Asn Thr Leu Asn Asn lie Leu Lys Glu His Wing Tyr Arg Leu 40 45 Pro Gln lie Ser Phe Arg Gly Ser Asn Leu Thr His Pro Leu Arg Asn 50 55 60 lie Arg Asp Leu Phe Tyr Val Gly Asn lie Thr lie Gly Thr Pro Pro 65 70 75 80 Gln Glu Phe Gln Val lie Phe Asp Thr Gly Ser Ser Asp Leu Trp Val 85 90 95 Ala Lie lie Phe Cys Asn Ser Be Ser Cys Ala Ala His Val Arg Phe 100 105 110 Arg His His Gln Ser Ser Thr Phe Arg Pro Thr Asn Lys Thr Phe Arg 115 120 125 lie Thr Tyr Gly Ser Gly Arg Met Lys Gly Val Val Val His Asp Thr 130 135 140 Val Arg lie Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu Cys 145 150 155 160 Leu Lys Asp Ser Gly Phe Lys Gly lie Pro Phe Asp Gly lie Leu Gly 165 170 175 Leu Ser Tyr Pro Asn Lys Thr Phe Ser Gly Wing Phe Pro lie Phe Asp 180 185 190 Lys Leu Lys Asn Glu Gly Ala lie Ser. Glu Pro Val Phe Wing Phe Tyr 195 200 205 Leu Ser Lys Asp Lys Gln Glu Gly Ser Val Val Met Phe Gly Gly Val 210 215 220 Asp His Arg Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro Leu lie Gln 225 230 235 240 Val Gly Asp Trp Phe Val His Met Asp Arg Thr Thr Met Lys Arg Lys 245 250 255 Val lie Ala Cys Ser Asp Gly Cys Lys Ala Leu Val Asp Thr Gly Thr 260 265 270 Ser Asp lie Val Gly Pro Ser Thr Leu Val Asn Asn lie Trp Lys Leu 275 280 285 lie Arg Ala Arg Pro Leu Gly Pro Gln Tyr Phe Val Ser Cys Ser Ala 290 295 300 Val Asn Thr Leu Pro Ser lie lie Phe Thr lie Asn Gly lie Asn Tyr 305 310 315 320 Arg Leu Pro Ala Arg Ala Tyr lie His Lys Asp Ser Arg Gly Arg Cys 325 330 335 Tyr Thr Wing Phe Lys Glu His Arg Phe Ser Ser Pro lie Glu Thr Trp 340 345 350 Leu Leu Gly Asp Val Phe Leu Arg Arg Tyr Phe Ser Val Phe Asp Arg 355 360 365 Gly Asn Asp Arg lie Gly Leu Ala Arg Ala Val 370 375 < 210 > 30 < 211 > 341 < 212 > PRT < 213 > bovidae < 400 > 30 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys lie 1 5 10 15 Val Lys lie Pro Leu Arg Arg Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Glu Asp Pro Tyr Arg Leu 35 40 45 Ser His lie Ser Phe Arg Gly Ser Asn Leu Thr lie His Pro Leu Arg 50 55 60 Asn lie Arg Asp lie Phe Tyr Val Gly Asn lie Thr lie Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val lie Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser lie Asp Cys Asn Ser Thr Ser Cys Ala Thr His Val Arg 100 105 110-Phe Arg His Leu Gln Ser Ser Thr Phe Arg Pro Thr Asn Lys Thr Phe 115 120 125 Arg lie lie Tyr Gly Ser Gly Arg Met Asn Gly Val lie Ala Tyr Asp 130 135 '140 Thr Val Arg lie Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Ser Val Glu Glu Tyr Gly Phe Wing His Lys Arg Phe Asp Gly lie Leu 165 170 175 Gly Leu Asn Tyr Trp Asn Leu Ser Trp Ser Lys Ala Met Pro lie Phe 180 185 190 Asp Lys Leu Lys Asn Glu Gly Ala lie Ser Glu Pro Val Phe Wing Phe 195 200 205 Tyr Leu Ser Asn lie Thr Met Asn Arg Glu Val lie Wing Cys Ser Glu 210 215 220 Gly Cys Ala Ala Leu Val Asp Thr Gly Ser Ser Asn lie Gln Gly Pro 225 230 235 240 Gly Arg Leu lie Asp Asn lie Gln Arg lie lie Gly Ala Thr Pro Arg 245 250 255 Gly Ser Lys Tyr Tyr Val Ser Cys Ser Wing Val Asn lie Leu Pro Ser 260 265 270 lie lie Phe Thr lie Asn Gly Val Asn Tyr Pro Val Pro Pro Arg Ala 275 280 285 Tyr lie Leu Lys Asp Ser Arg Gly His Cys Tyr Thr Thr Phe Lys Glu 290 295 300 Lys Arg Val Arg Arg Ser Thr Glu Ser Trp Val Leu Gly Val Val Phe 305 310 315 320 Leu Arg Leu Tyr Phe Ser Val Phe Asp Arg Gly Asn Asp Arg lie Gly 325 330 335 Leu Ala Arg Arg Val 340 < 210 > 31 < 211 > 387 < 212 > PRT < 213 > bovidae < 400 > 31 Met Lys Trp Leu Val Leu Leu Gly Leu Val Ala Leu Ser Glu Cys lie 1 5 10 15 Val Lys lie Pro Leu Thr Lys Met Lys Thr Met Gln Glu Ala lie Arg 20 25 30 Glu Lys Gln Leu Glu Asp Phe Leu Asp Glu Gln Pro His Ser Leu 35 40 45 Ser Gln His Ser Asp Pro Asp Lys Lys Phe Ser His Gln Leu Lys 50 55 60 Asn Phe Gln Asn Wing Val Tyr Phe Gly Thr He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Asn Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser Val Asp Cys Gln Pro Pro Ser Cys Ser Lys His Lys Arg 100 105 110 Phe Asp Pro Gln Lys Ser Thr Thr Phe Gln Pro Leu Asn Gln Lys He 115 120 125 Glu Leu Val Tyr Gly Ser Gly Thr Met Lys Gly Val Leu Gly Ser Asp 130 135 140 Thr He Gln He Gly Asn Leu Val He Val Asn Gln He Phe Gly Leu 145 150 155 160 Ser Gln Asn Gln Ser Ser Gly Val Leu Glu Val Valn Tyr Asp Gly 165 170 175 He Leu Gly Leu Wing Tyr Pro Being Leu Wing He Gln Gly Thr Thr Pro 180 185 190 Val Phe Asp Asn Leu Lys Asn Arg Glu Val He Ser Glu Pro Val Phe 195 200 205 Wing Phe Tyr Leu Ser Ser Arg Pro Glu Asn He Ser Thr Val Met Phe 210 215 220 Gly Gly Val Asp His Thr Tyr His Lys Gly Lys Leu Gln Trp He Pro 225 230 235 240 Val Thr Gln Wing Arg Phe Trp Gln Val Wing Met Ser Ser Met Thr Met 245 250 255 Asn Gly Asn Val Val Gly Cys Ser Gln Gly Cys Gln Ala Val Val Asp 260 265 270 Thr Gly Thr Ser Leu Leu Val Gly Pro Thr His Leu Val Thr Asp He 275 280 285 Leu Lys Leu He Asn Pro Asn Pro He Leu Asn Asp Glu Gln Met Leu 290 295 300 Ser Cys Asp Ala He Asn Ser Leu Pro Thr Leu Leu Leu Thr He Asn 305 310 315 320 Gly He Val Tyr Pro Val Pro Pro Asp Tyr Tyr He Gln Arg Phe Ser 325 330 335 Glu Arg He Cys Phe He Being Phe Gln Gly Gly Thr Glu He Leu Lys 340 345 350 Asn Leu Gly Thr Ser Glu Thr Trp He Leu Gly Asp Val Phe Leu Arg 355 360 365 Leu Tyr Phe Ser Val Tyr Asp Arg Gly Asn Asn Arg He Gly Leu Ala 370 375 380 Pro Ala Ala 385 < 210 > 32 < 21 1 > 379 < 212 > PRT < 213 > bovidae < 400 > 32 Met Lys Trp He Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 Val Lys He Pro Leu Arg Gln Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Gly Lys Asn Met Leu Lys Asn Phe Leu Lys Glu His Pro Tyr Arg Leu 40 45 Being Gln He Being Phe Arg Gly Being Asn Leu Thr He His Pro Leu Arg 50 55 60 Asn He Met Asn Leu Val Tyr Val Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser Phe Cys Thr Met Pro Ala Cys Ser Ala Pro Val Trp Phe 100 105 110? Arg Gln Leu Gln Be Ser Thr Phe Gln Pro Thr Asn Lys Thr Phe Thr 115 120 125 He Thr Tyr Gly Ser Gly Ser Met Lys Gly Phe Leu Wing Tyr Asp Thr 130 135 140 Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu Ser 145 150 155 160 Val Val Glu Tyr Gly Leu Glu Gly Arg Asn Tyr Asp Gly Val Leu Gly 165 170 175 Leu Asn Tyr Pro Asn He Ser Phe Ser Gly Ala He Pro He Phe Asp 180 185 190 Asn Leu Lys Asn Gln Gly Ala He Ser Glu Pro Val Phe Ala Phe Tyr 195 200 205 Leu Ser Lys Asn Lys Gln Glu Gly Ser Val Val Met Phe Gly Gly Val 210 215 220 Asp His Gln Tyr Tyr Lys Gly Glu Leu Asn Trp He Pro Leu He Glu 225 230 235 240 Wing Gly Glu Trp Arg Val His Met Asp Arg He Ser Met Lys Arg Thr 245 250 255 Val He Wing Cys Ser Asp Gly Cys Glu Wing Leu Val His Thr Gly Thr 260 265 270 Ser His He Glu Gly Pro Gly Arg Leu Val Asn Asn He His Arg Leu 275 280 285 He Arg Thr Arg Pro Phe Asp Ser Lys His Tyr Val Ser Cys Phe Wing 290 295 300 Thr Lys Tyr Leu Pro Ser He Thr Phe He He Asn Gly He Lys Tyr 305 310 315 320 Pro Met Thr Ala Arg Ala Tyr He Phe Lys Asp Ser Arg Gly Arg Cys 325 330 -335 Tyr Ser Wing Phe Lys Glu Asn Thr Val Arg Thr Ser Arg Glu Thr Trp 340 345 350 He Leu Gly Asp Wing Phe Leu Arg Arg Tyr Phe Ser Val Phe Asp Arg 355 360 365 Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val - 370 375 < 210 > 33 < 21 1 > 380 < 212 > PRT < 213 > bovidae < 400 > 33 Met Lys Trp Leu Gly Leu Leu Gly Leu Val Ala Leu Ser Glu Cys Met 1 5 10 15 Val He He Pro Leu Arg Gln Met Lys Thr Met Arg Glu Thr Leu Arg 20 25 30 Glu Arg His Leu Leu Thr Asn Phe Ser Glu Glu His Pro Tyr Asn Leu 40 45 Ser Gln Lys Ala Ala Asn Asp Gln Asn He He Tyr His His Pro Leu 50 55 60 Arg Ser Tyr Lys Asp Phe Ser Tyr He Gly Asn He Asn He Gly Thr 65 70 75 80 Pro Pro Gln Glu Phe Gln Val Leu Phe Asp Thr Gly Ser Ser Ser Leu 85 90 95 Trp Val Pro Ser He Tyr Cys Gln Ser Ser Cys Tyr Lys His Asn 100 105 110 Ser Phe Val Pro Cys Asn Be Ser Thr Phe Lys Wing Thr Asn Lys He 115 120 125 Phe Asn Thr Asn Tyr Thr Ala Thr Ser He Lys Gly Tyr Leu Val Tyr 130 135 140 Asp Thr Val Arg He Gly Asn Leu Val Ser Val Ala Gln Pro Phe Gly 145 150 '155 160 Leu Ser Leu Lys Glu Phe Gly Phe Asp Asp Val Pro Phe Asp Gly He 165 170 175 Leu Gly Leu Gly Tyr Pro Arg Arg Thr He Thr Gly Wing Asn Pro He 180 185 190 Phe Asp Asn Leu Trp Lys Gln Gly Val He Ser Glu Pro Val Phe Ala 195 200 205 Phe Tyr Leu Ser Ser Gln Lys Glu Asn Gly Ser Val Val Met Phe Gly 210 215 220 Gly Val Asn Arg Ala Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro Val 225 230 235 240 Being Gln Val Gly Being Trp His He Asn He Asp Being He Being Met Asn 245 250 255 Gly Thr Val Val Wing Cys Lys Arg Gly Cys Gln Wing Ser Trp He Arg 260 265 270 Gly Arg Leu Ser Wing Trp Pro Lys Arg He Val Ser Lys He Gln Lys 275 280 285 Leu He His Wing Arg Pro He Asp Arg Glu His Val Val Ser Cys Gln 290 295 300 Wing He Gly Thr Leu Pro Pro Wing Val Phe Thr He Asn Gly He Asp 305 310 315 - 320 Tyr Pro Val Pro Wing Gln Wing Tyr He Gln Ser Leu Ser Gly Tyr Cys 325 330 -335 Phe Ser Asn Phe Leu Val Arg Pro Gln Arg Val Asn Glu Ser Glu Thr 340 345 350 Trp He Leu Gly Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asn Arg He Gly Leu Ala Pro Wing Val 370 375 380 < 210 > 34 < 211 > 376 < 212 > PRT < 213 > bovidae < 400 > 34 Met Lys Trp Leu Val Phe Leu Gly Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 Val He Met Leu Leu Thr Lys Thr Lys Thr Met Arg Glu He Trp Arg 20 25 30 Glu Lys Lys Leu Leu Asn Ser Phe Leu Glu Glu Gln Wing Asn Arg Met 35 40 45 Ser Asp Asp Ser Wing Ser Asp Pro Lys Leu Ser Thr His Pro Leu Arg 50 55 60 Asn Ala Leu Asp Met Ala Tyr Val Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Lys Glu Phe Arg Val Val Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser He Lys Cys He Ser Pro Ala Cys His Thr His He Thr 100 105 110 Phe Asp His His Lys Ser Ser Thr Phe Arg Leu Thr Arg Arg Pro Phe 115 120 125 His He Leu Tyr Gly Ser Gly Met Met Asn Gly Val Leu Ala Tyr Asp 130 135 140 Thr Val Arg He Gly Lys Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Being Leu Gln Gln Phe Gly Phe Asp Asn Wing Pro Phe Asp Gly Val Leu 165 170 175 Gly Leu Ser Tyr Pro Ser Leu Wing Val Pro Gly Thr He Pro He Phe 180 185 190 Asp Lys Leu Lys Gln Gln Gly Wing He Ser Glu Pro He Phe Wing Phe 195 200 205 Tyr Leu Ser Thr Arg Lys Glu Asn Gly Ser Val Leu Met Leu Gly Gly 210 215 220 Val Asp His Ser Tyr His Lys Gly Lys Leu Asn Trp He Pro Val Ser 225 230 235 240 Gln Thr Lys Ser Trp Leu He Thr Val Asp Arg He Ser Met Asn Gly 245 250 255 Arg Val He Gly Cys Glu His Gly Cys Glu Ala Leu Val Asp Thr Gly 260 265 270 Thr Ser Leu He His Gly Pro Wing Arg Pro Val Thr Asn He Gln Lys 275 280 285 Phe He His Wing Met Pro Tyr Gly Ser Glu Tyr Met Val Leu Cys Pro 290 295 300 Val He Ser He Leu Pro Pro Val He Phe Thr He Asn Gly He Asp 305 310 315 320 Tyr Ser Val Pro Arg Glu Ala Tyr He Gln Lys He Ser Asn Ser Leu 325 330 335 Cys Leu Ser Thr Phe His Gly Asp Asp Thr Asp Gln Trp He Leu Gly 340 345 350 Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Tyr Asp Arg Gly Asn Asn 355 360 365 Arg He Gly Leu Wing Pro Wing Val 370 375 < 210 > 35 < 211 > 375 < 212 > PRT < 213 > bovidae < 400 > 35 Met Lys Trp Leu Val Leu Leu Gly Leu Val Ala Leu Ser Glu Cys He 1 5 10 15 Val He Leu Pro Leu Arg Lys Met Lys Thr Leu Arg Glu Thr Leu Arg 20 25 30 Glu Lys Asn Leu Leu Asn Asn Phe Leu Glu Glu Arg Ala Tyr Arg Leu 35 40 45 Ser Lys Lys Asp Ser Lys lie Thr He His Pro Leu Lys Asn Tyr Leu 50 55 60 Asp Met Wing Tyr Val Gly Asn He Thr He Gly Thr Pro Pro Gln Glu 65 70 75 80 Phe Arg Val Val Phe Asp Thr Gly Ser Wing Asp Leu Trp Val Pro Ser 85 90 95 He Ser Cys Val Ser Pro Ala Cys Tyr Thr His Lys Thr Phe Asn Leu 100 105 110 _ His Asn Being Being Phe Gly Gln Thr His Gln Pro Being Ser 115 120 125 Tyr Gly Pro Gly He He Gln Gly Phe Leu Gly Being Asp Thr _Val Arg 130 135 140 He Gly Asn Leu Val Ser Leu Lys Gln Ser Phe Gly Leu Ser Gln Glu 145 150 '155 160 Glu Tyr Gly Phe Asp Gly Wing Pro Phe Asp Gly Val Leu Gly Leu Wing 165 170 175 Tyr Pro Be He Be He Lys Gly He He Pro He He Phe Asp Asn Leu 180 185 190 Trp Ser Gln Gly Wing Phe Ser Glu Pro Val Phe Wing Phe Tyr Leu Asñ 195 200 205 Thr Cys Gln Pro Glu Gly Ser Val Val Met Phe Gly Gly Val Asp His 210 215 220 Arg Tyr Tyr Lys Gly Glu Leu Asn Trp He Pro Val Ser Gln Thr Arg 225 230 235 240 Tyr Trp Gln He Ser Met Asn Arg He Ser Met Asn Gly Asn Val Thr 245 250 255 Ala Cys Ser Arg Gly Cys Gln Ala Leu Leu Asp Thr Gly Thr Ser Met 260 265 270 He His Gly Pro Thr Arg Leu He Thr Asn He His Lys Leu Met Asn 275 280 285 Wing Arg His Gln Gly Ser Glu Tyr Val Val Ser Cys Asp Wing Val Lys 290 295 300 Thr Leu Pro Pro Val He Phe Asn He Asn Gly He Asp Tyr Pro Leu 305 310 315 320 Pro Pro Gln Wing Tyr He Thr Lys Wing Gln Asn Phe Cys Leu Ser He 325 330 335 Phe His Gly Gly Thr Glu Thr Ser Ser Pro Glu Thr Trp He Leu Gly 340 345 350 Gly Val Phe Leu Arg Gln Tyr Phe Ser Val Phe Asp Arg Arg Asn Asp 355 360 365 Ser He Gly Leu Ala Gln Val 370 375 < 210 > 36 < 211 > 391 < 212 > PRT < 213 > bovidae < 400 > 36 Met Lys Trp Leu Val Leu Leu Gly Leu Val Ala Leu Ser Glu Cys He 1 5 10 15 Val He Leu Pro Leu Lys Lys Met Lys Thr Leu Arg Glu Thr Leu Arg 20 25 30 Glu Lys Asn Leu Leu Asn Asn Phe Leu Glu Glu Gln Ala Tyr Arg Leu 35 40 45 Ser Lys Asn Asp Ser Lys He Thr He His Pro Pro Leu Arg Asn Tyr Leu 50 55 60 Asp Thr Wing Tyr Val Gly Asn He Thr He Gly Thr Pro Pro Gln Glu 65 70 75 80 Phe Arg Val Val Phe Asp Thr Gly Ser Wing Asn Leu Trp Val Pro Cys 85 90 95 He Thr Cys Thr Ser Pro Wing Cys Tyr Thr His Lys Thr Phe Asn Pro 100 105 110 Gln Asn Being Ser Phe Arg Glu Val Gly Pro Pro He Thr He Phe 115 120 125 Tyr Gly Ser Gly He He Gln Gly Phe Leu Gly Ser Asp Thr Val Arg 130 135 140 He Gly Asn Leu Val Ser Leu Lys Gln Be Phe Gly Leu Ser Gln Glu 145 150 155 160 Glu Tyr Gly Phe Asp Gly Wing Pro Phe Asp Gly Val Leu Gly Leu Wing 165 170 175 Tyr Pro Be He Be He Lys Gly He He Pro He He Phe Asp Asn Leu 180 -. 180 -L85 190 Trp Ser His Gly Wing Phe Ser Glu Pro Val Phe Wing Phe Tyr Leu Asn 195 200 205 Thr Asn Lys Pro Glu Gly Ser Val Val Met Phe Gly Val Asp His 210 215 220 Arg Tyr Tyr Lys Gly Glu Leu Asn Trp He Pro Val Ser Gln Thr Ser 225 230 235 -. 240 His Trp Gln He Ser Met Asn Asn He Met Met Asn Gly Thr Val Thr 245 250 255 Ala Cys Ser Cys Gly Cys Glu Ala Leu Leu Asp Thr Gly Thr Ser Met 260 265 270 He Tyr Gly Pro Thr Lys Leu Val Thr Asn He His Lys Leu Met Asn 275 280 285 Wing Arg Leu Glu Asn Ser Glu Tyr Val Val Ser Cys Asp Wing Val Lys 290 295 300 Thr Leu Pro Pro Val He Phe Asn He Asn Gly He Asp Tyr Pro Leu 305 310 315 -_ 320 Arg Pro Gln Wing Tyr He He Lys He Gln Asn Asn Cys Arg Ser Val 325 330 335 Phe Gln Gly Gly Thr Glu Asn Being Ser Leu Asn Thr Trp He Leu Gly 340 345 350 Asp He Phe Leu Arg Gln Tyr Phe Ser Val Phe Asp Arg Lys Asn Arg 355 360 365 Arg He Cys Trp His Arg Trp Val Pro Thr Thr Arr Thr Thr Met Thr 370 375 380 Ser Lys Leu Pro Pro Lys Leu 385 390 < 210 > 37 < 211 > 392 < 212 > PRT < 213 > bovidae < 400 > 37 Met Lys Trp Leu Val Leu Leu Ala Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 He Lys He Pro Leu Arg Arg Val Lys Thr Met Ser Asn Thr Wing Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Lys His Pro Tyr Arg Leu 35 40 45 Being Gln He Being Phe Arg Gly Being Asn Leu Thr Thr His Pro Leu Met 50 55 60 Asn He Trp Asp Leu Leu Tyr Leu Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Leu Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser Leu Leu Cys Asn Ser Ser Thr Cys Ala Lys His Val Met 100 105 110 Phe Arg His Arg Leu Ser Ser Thr Tyr Arg Pro Thr Asn Lys Thr Phe 115 120 125 Met He Phe Tyr Wing Val Gly Lys He Glu Gly Val Val Val Arg Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Wing Asp Gln Thr Phe Gly Leu 145 150 155 160 Ser He Wing Glu Thr Gly Phe Glu Asn Thr Thr Leu Asp Gly He Leu 165 170 175 Gly Leu Ser Tyr Pro Asn Thr Ser Cys Phe Gly Thr He Pro He Phe 180 185 190 Asp Lys Leu Lys Asn Glu Gly Wing He Ser Glu Pro Val Leu His Ser 195 200 205 Val Arg Arg Lys Asp Glu Gln Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Ser Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro Leu He 225 230 235 240 Lys Wing Gly Asp Trp Ser Val Arg Val Asp Ser He Thr Met Lys Arg 245 250 255 Glu Val He Wing Cys Ser Asp Gly Cys Arg Wing Leu Val Asp Thr Gly 260 265 270 Ser Ser His He Gln Gly Pro Gly Arg Leu He Asp Asn Val Gln Lys 275 280 285 Leu He Gly Thr Met Pro Gln Gly Ser Met His Tyr Val Pro Cys Ser 290 295 300 Wing Val Asn Thr Leu Pro Be He He Phe Thr He Asn Ser Be Ser 305 310 315 320 Tyr Thr Val Pro Wing Gln Wing Tyr He Leu Lys Gly Ser Arg Gly Arg 325 330 335 Cys Tyr Ser Thr Phe Gln Gly His Thr Met Ser Ser Ser Thr Glu Thr 340 345 350 Trp He Leu Gly Asp Val Phe Leu Ser Gln Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg He Gly Leu Wing Gln Val Gly Thr Asp Tyr Lys 370 375 380 Asp Asp Asp Glu Ser Pro Lys Leu 385 390 < 210 > 38 < 211 > 388 < 212 > PRT < 213 > Felis domestica < 400 > 38 Met Lys Trp Leu Trp Val Leu Gly Leu Val Ala Leu Ser Glu Cys Leu 1 5 10 15 Val Thr He Pro Leu Thr Arg Val Lys Ser Met Arg Glu Asn Leu Arg 20 25 30 Glu Lys Asp Arg Leu Lys Asp Phe Leu Glu Asn His Pro Tyr Asn Leu 40 45 Wing Tyr Lys Phe Val Asp Ser Val Asn Leu Asp Leu Gly He Tyr Phe 50 55 60 Glu Pro Met Arg Asn Tyr Leu Asp Leu Wing Tyr Val Gly Thr He Ser 65 70 75 80 He Gly Thr Pro Pro Gln Glu Phe Lys Val He Phe Asp Thr Gly Ser 85 90 95 Being Asp Leu Trp Val Pro Being He Tyr Cys Being Ser Pro Wing Cys Wing 100 105 110 Asn His Asn Val Phe Asn Pro Leu Arg Being Ser Thr Phe Arg He Ser 115 120 125 Gly Arg Pro He His Leu Gln Tyr Gly Ser Gly Thr Met Ser Gly Phe 130 135 140 Leu Ala Tyr Asp Thr Val Arg Phe Gly Gly Leu Val Asp Val Ala Gln 145 150 155 160 Wing Phe Gly Leu Ser Leu Arg Glu Pro Gly Lys Phe Met Glu Tyr Wing 165 170 175 Val Phe Asp Gly He Leu Gly Leu Wing Tyr Pro Ser Leu Ser Leu Arg 180 185 190 Gly Thr Val Pro Val Phe Asp Asn Leu Trp Lys Gln Gly Leu He Ser 195 200 205 Gln Glu Leu Phe Wing Phe Tyr Leu Ser Lys Lys Asp Glu Glu Gly Ser 210 215 220 Val Val Met Phe Gly Gly Val Asp His Ser Tyr Tyr Ser Gly Asp Leu 225 230 235 240 Asn Trp Val Pro Val Ser Lys Arg Leu Tyr Trp Gln Leu Ser Met Asp 245 250 255 Be He Be Met Asn Gly Glu Val He Wing Cys Asp Gly Gly Cys Gln 260 265 270 Wing He He Asp Thr Gly Thr Ser Leu Leu He Gly Pro Ser His Val 275 280 285 Val Phe Asn He Gln Met He He Gly Wing Asn Gln Ser Tyr Ser Gly 290 295 300 Glu Tyr Val Val Asp Cys Asp Wing Wing Asn Thr Leu Pro Asp He Val 305 310 315 320 Phe Thr He Asn Gly He Asp Tyr Pro Val Pro Wing Ser Wing Tyr He 325 330 -335 Gln Glu Pro Gln Gly Thr Cys Tyr Ser Gly Phe Asp Glu Ser Gly 340 345 350 Asp Ser Leu Leu Val Ser Asp Ser Trp He Leu Gly Asp Val Phe Leu 355 360 365 Arg Leu Tyr Phe Thr Val Phe Asp Arg Glu Asn Asn Arg He Gly Leu 370 375 380 Ala Leu Ala Val 385 < 210 > 39 < 21 1 > 1 158 < 212 > DNA < 213 > bovidae < 400 > 39 aggaaagaag catgaagtgg cttgtggtcc tcgggctggt ggccttctca gagtgcatag 60 tcaaaatacc tctaaggaga gtgaagacca tgagaaaaac tctcagtgga aaaaacatgc 120 tgaacaattt cttgaaggag gatccttaca gactgtccca gatttctttt cgtggctcaa 180 atctaactat tcacccgctg agaaacatca gagatatctt aacatcacca ctatgtcgga 240 ttggaacacc ccctcaggaa ttccaggtta tctttgacac aggctcatct STAP g ggg 300 tgccctcgat cgattgcaac agtacatcct gtgctacaca tgttaggttc agacatcttc 360 agtcttccac cttccggcct accaataaga ccttcaggat catctatgga tctgggagaa 420 tgaacggagt tattgcttat gacacagttc ggattgggga ccttgtaagt accgaccagc 480 catttggtct aagcgtggag gaatatgggt ttgcgcacaa aagatttgat ggcatcttgg 540 ctggaaccta gcttgaacta tcctggtcta aggccatgcc catctttgac aagctgaaga 600 atgaaggcgc catttctgag cctgtttttg ccttctactt gagcaaagac aagcgggagg 660 gcagtgtggt gatgtttggt ggggtggacc accgctacta caagggagag ctcaagtggg 720 taccactgat ccaagcagtc gactggagtg tacacgtaga ccgcatcacc atgaacagag 780 ttgttctgaa aggttattgc ggctgtgcgg cccttgtgga cactgggtca tcaaatatcc 840 aaggcccaag aagactg att gataacatac agaggatcat cggcgccacg ccacggggtt 900 ccaagtacta cgtttcatgt tctgcggtca atatcctgcc ctctattatc ttcaccatca 960 acggcgtcaa ctacccagtg ccacctcgag cttacatcct caaggattct agaggccact 1020 gctataccac ctttaaagag aaaagagtga ggagatctac agagagctgg gtcctgggtg 1080 aagtcttcct gaggctgtat ttctcagtct ttgatcgagg aaatgacagg attggcctgg cacgggcagt gtaactcg 1140 1158 < 210 > 40 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 40 Met Lys Trp Leu Val Val Leu Gly Leu Val Ala Phe Ser Glu Cys He 1 5 10 15 Val Lys He Pro Leu Arg Arg Val Lys Thr Met Arg Lys Thr Leu Ser 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Glu Asp Pro Tyr Arg Leu 40 45 Being Gln He Being Phe Arg Gly Being Asn Leu Thr He His Pro Leu Arg 50 55 60 Asn He Arg Asp He Phe Tyr Val Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val He Phe Asp Thr Gly Ser As Asp Leu Trp 85 90 95 Val Pro Ser He Asp Cys Asn Ser Thr Ser Cys Ala Thr His Val Arg 100 105 110 Phe Arg His Leu Gln Ser Ser Thr Phe Arg Pro Thr Asn Lys Thr Phe 115 120 125 Arg He He Tyr Gly Ser Gly Arg Met Asn Gly Val He Wing Tyr Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Ser Val Glu Glu Tyr Gly Phe Wing His Lys Arg Phe Asp Gly He Leu 165 170 175 Gly Leu Asn Tyr Trp Asn Leu Ser Trp Ser Lys Ala Met Pro He Phe 180 185 190 Asp Lys Leu Lys Asn Glu Gly Wing He Ser Glu Pro Val Phe Ala Phe 195 200 205 Tyr Leu Ser Lys Asp Lys Arg Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Lys Gly Glu Leu Lys Trp Val Pro Leu He 225 230 235 240 Gln Ala Val Asp Trp Ser Val His Val Asp Arg He Thr Met Asn Arg 245 250 255 Glu Val He Wing Cys Ser Glu Gly Cys Wing Wing Leu Val Asp Thr Gly 260 265 270 Being Ser Asn He Gln Gly Pro Arg Arg Leu He Asp Asn He Gln Arg 275 280 285 He He Gly Ala Thr Pro Arg Gly Ser Lys Tyr Tyr Val Ser Cys Ser 290 295 300 Val Wing Asn He Leu Pro Ser He He Phe Thr He Asn Gly Val Asn 305 310 315 320 Tyr Pro Val Pro Pro Arg Ala Tyr He Leu Lys Asp Ser Arg Gly His 325 330 335 Cys Tyr Thr Thr Phe Lys Glu Lys Arg Val Arg Arg Ser Thr Glu Ser 340 345 350 Trp Val Leu Gly Glu Val Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 41 < 211 > 1155 < 212 > DNA < 213 > bovidae < 400 > 41 aggaaagaag catgaagtgg attgtgctcc tcgggctgat ggccttctca gagtgcatag 60 tccaaatacc tctaaggcaa gtgaagacca tgagaaaaac cctcagtgga aaaaacatgc 120 tgaagaattt cttgaaggag catccttaca gactgtccca gatttctttt cgtggctcaa 180 atctaactat tcacccgctg aggaacatca tgaatttggt ctacgtgggt aacatcacca 240 ttggaacacc ccctcaggaa ttccaggttg tctttgacac aggctcatct gacttgtggg 300 tgccctcctt ttgtaccatg ccagcatgct ctgcaccggt ttggttcaga caacttcagt 360 cttccacctt ccagcctacc aataagacct tcaccatcac ctatggatct gggagcatga 420 agggatttct tgcttatgac acagttcgga ttggggacct tgtaagtact gatcagccgt 480 tcggtctaag cgtggtggaa tatgggttgg agggcagaaa ttatgatggt gccttgggct 540 tgaactaccc caacatatcc ttctctggag ccatccccat ctttgacaac ctgaagaatc 600 aaggtgccat ttctgagcct gtttttgcct tctacttgag caaaaacaag caggagggca 660 gtgtggtgat gtttggtggg gtggaccacc agtactacaa gggagagctc aactggatac 720 agcaggcgaa cactgattga tggagagtac acatggaccg catctccatg aaaagaacgg 780 ttattgcttg ttctgatggc tgtgaggccc ttgtgcacac tgggacatca catatcgaag 840 gcccaggaag actggtg aat aacatacaca ggctcatccg tttgattcca caccaggcca 900 agcactacgt ttcatgtttt gccaccaata ccctgccctc tattactttc atcatcaacg 960 cccaatgaca gcatcaagta acatctttaa gctcgagcct ggattctaga ggccgctgct 1020 attccgcttt taaagagaac acagtgagaa catctagaga gacctggatc ctcggtgatg 1080 ccttcctgag gcggtatttc tcagtctttg atcgaggaaa tgacaggatt ggcctggcac gggcagtgta actcg 1140 1155 < 210 > 42 < 211 > 379 < 212 > PRT < 213 > bovidae < 400 > 42 Met Lys Trp He Val Leu Leu Gly Leu Met Wing Phe Ser Glu Cys He 1 5 10 15 Val Gln He Pro Leu Arg Gln Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Gly Lys Asn Met Leu Lys Asn Phe Leu Lys Glu His Pro Tyr Arg Leu 35 40 45 Ser Gln He Ser Phe Arg Gly Ser Asn Leu Thr He His Pro Leu Arg 50 55 60 Asn He Met Asn Leu Val Tyr Val Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser Phe Cys Thr Met Pro Wing Cys Ser Wing Pro Val Trp Phe 100 105 110 Arg Gln Leu Gln Be Ser Thr Phe Gln Pro Thr Asn Lys Thr Phe Thr 115 120 125 He Thr Tyr Gly Ser Gly Ser Met Lys Gly Phe Leu Wing Tyr Asp Thr 130 135 140 Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu Ser 145 150 155 160 Val Val Glu Tyr Gly Leu Glu Gly Arg Asn Tyr Asp Gly Wing Leu Gly 165 170 175 Leu Asn Tyr Pro Asn He Be Phe Ser Gly Ala He Pro He Phe Asp 180 185 190 Asn Leu Lys Asn Gln Gly Wing He Ser Glu Pro Val Phe Wing Phe Tyr 195 200 205 Leu Ser Lys Asn Lys Gln Glu Gly Ser Val Val Met Phe Gly Gly Val 210 215 220 Asp His Gln Tyr Tyr Lys Gly Glu Leu Asn Trp He Pro Leu He Glu 225 230 235 240 Wing Gly Glu Trp Arg Val His Met Asp Arg He Ser Met Lys Arg Thr 245 250 255 Val He Wing Cys Ser Asp Gly Cys Glu Wing Leu Val His Thr Gly Thr 260 265 270 Ser His He Glu Gly Pro Gly Arg Leu Val Asn Asn He His Arg Leu 275 280 285 He Arg Thr Arg Pro Phe Asp Ser Lys His Tyr Val Ser Cys Phe Wing 290 295 300 Thr Asn Thr Leu Pro Ser He Thr Phe He He Asn Gly He Lys Tyr 305 310 315 320 Pro Met Thr Ala Arg Ala Tyr He Phe Lys Asp Ser Arg Gly Arg Cys 325 330 335 Tyr Ser Ala Phe Lys Glu Asn Thr Val Arg Thr Ser Arg Glu Thr Trp 340 345 350 He Leu Gly Asp Ala Phe Leu Arg Arg Tyr Phe Ser Val Phe Asp Arg 355 360 365 Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val _ 370 375 < 210 > 43 < 211 > 1154 < 212 > DNA < 213 > bovidae < 400 > 43 aggaaagaag catgaagtgg cttgtgctcc tagggctggt ggccttctca gagtgcgtag 60 tcaaaatacc tctaaggaga gtgaagacca tgacaaaaac cctcagtggg aaaaacatgc 120 tgaacaattt cctgaaggag gactgtccca catgcttaca catggctcaa gatttctttt 180 atctaactat tcacccgctg agaaacatca gggatttgtt ctacatgggt aacatcacca 240 ttggaacacc ccctcaggaa ttcctggttg tctttgacac aggctcatct gacttgtggg 300 ttccctccga cttttgcacc agtccagcct gttctaaaca ctttaggttc agacatcttc 360 agtcttccac attccggctt accaataaga ccttcagcat tgaatacgga tctgggacaa 420 tggaaggaat tgttgctcat gacacagttc ggattgggga ccttgtaagc actgaccagc 480 aagcatgaca cgtttggtct gaatccgggt ttgagggtat accttttgat ggcgtcttgg 540 ccccaacata gcttgaacta tccttctctg gagccatccc catctttgac aagctgaaga 600 atcaaggtgc catttctgag cctgtttttg ccttctattt gagcaaagac gagcaggagg 660 gcagtgtggt gatgtttggt ggggtggacc accgctacta caagggagag ctcaaatggg 720 taccattgat tgaagcgggt gactggattg tacacatgga ctgcatctcc atgagaagaa 780 aggttattgc ttgttctggc ggctgtgagg ccgttgttga tcaatgatca caccggggta 840 aaggcccaaa aacactg gtt gataacatcc agaagctcat cggtgccact ctacggggtt 900 tcaagcacta cgtttcatgt tctgcagtcg ataccctgcc ctctattacc ttcaccataa 960 acggtatcaa ctaccgagtg ccagctcgag cctacatcct caaggattct agaggctgct 1020 gctatagcag ctttcaagag accactgtga gtccatctac agagacctgg atcctgggtg 1080 acgtcttcct gagactgtat ttctcagtct ttgatcgagg aaatgacagg attgggctgg cacgggcagt GTAA 1140 1154 < 210 > 44 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 44 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys Val 1 5 10 15 Val Lys He Pro Leu Arg Arg Val Lys Thr Met Thr Lys Thr Leu Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Glu His Wing Tyr Arg Leu 40 45 Ser Gln Be Ser Phe His Gly Ser Asn Leu Thr He His Pro Leu Arg 50 55 60 Asn He Arg Asp Leu Phe Tyr Met Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Leu Val Val Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser Asp Phe Cys Thr Ser Pro Wing Cys Ser Lys His Phe Arg 100 105 110 Phe Arg His Leu Gln Ser Ser Thr Phe Arg Leu Thr Asn Lys Thr Phe 115 120 125 Ser He Glu Tyr Gly Ser Gly Thr Met Glu Gly He Val Wing His Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Being Met Thr Glu Being Gly Phe Glu Gly He Pro Phe Asp Gly ^ Val Leu 165 170 175 Gly Leu Asn Tyr Pro Asn He Be Phe Ser Gly Wing He Pro He Phe 180 185 190 Asp Lys Leu Lys Asn Gln Gly Wing He Ser Glu Pro Val Phe Ala Phe 195 200 205 Tyr Leu Ser Lys Asp Glu Gln Glu Gly Ser Val Val Met Phe "Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Lys Gly Glu Leu Lys Trp Val Pro Leu He 225 230 235 240 Glu Wing Gly Asp Trp He Val His Met Asp Cys He Ser Met Arg Arg 245 250 255 Lys Val He Wing Cys Ser Gly Gly Cys Glu Wing Val Val Asp Thr Gly 260 265 270 Val Ser Met He Lys Gly Pro Lys Thr Leu Val Asp Asn He Gln Lys 275 280 285 Leu He Gly Wing Thr Leu Arg Gly Phe Lys His Tyr Val Ser Cys Ser 290 295 300 Wing Val Asp Thr Leu Pro Be He Thr Phe Thr He Asn Gly He Asn 305 310 315 - 320 Tyr Arg Val Pro Ala Arg Ala Tyr He Leu Lys Asp Ser Arg Gly Cys 325 330 335 Cys Tyr Be Ser Phe Gln Glu Thr Thr Val Ser Pro Ser Thr Glu Thr 340 345 350 Trp He Leu Gly Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 45 < 211 > 1168 < 212 > DNA < 213 > bovidae < 400 > 45 aggaaagaag catgaagtgg cttgtgctcc tcgggctggt ggccttctca gagtgcatag 60 tcaaaatacc tctaaggaga gtgaagacca tgagaaaaac cctcagtgga aaaaacacgc 120 tgaacaattt cttgaaggag gactgtccca catccttaca tatttctttt cgtggctcaa 180 atctaactac tctgccgctg agaaacatca gagatatgct ctacgtgggt aacatcacca 240 ttggaacacc ccctcaagaa ttccaggttg tctttgacac aggttcatct gacttgtggg 300 tgccctctga cttttgcacc agtccagcct gttctacaca cgttaggttc agacattttc 360 agtcttccac cttccggcct accactaaga ccttcaggat tctgggagaa catctatgga 420 tgaaaggagt tgttgcgcat gacacagttc ggattgggaa ccttgtaagt actgaccagc 480 cgttcggcct aagcatggcg gaatacgggt tggagagcag aagatttgat ggcatcttgg 540 ccccaatcta gcttgaacta tcctgctctg gggccattcc catctttgat aagctgaaga 600 atcaaggtgc catttctgat cctatttttg ccttctactt gagcaaagac aagcgagagg 660 gcagtgtggt gatgtttggt ggggtggacc accgctacta caagggagag ctcaactggg 720 taccactgat tcgagcaggt gactggattg tacacgtaga ccgcatcacc atgaaaagag 780 aggttattgc ttgttctgat ggctgcgcgg cactgggaca cccttgtgga tcacttatcc 840 aaggcccagg aagagtgatc gataacatac acaagctcat tggtgccacg ccacggggtt 900 ccaagcatta cgtttcatgt tctgtggtca atactctgcc ctctattatc ttcaccatca 960 atggcatcaa ctacccagtg ccagctccag cctacatcct caaggattct agaggctact 1020 gctataccgc ctttaaagag caaagagtga ggagatctac agagagctgg ttactgggtg 1080 • acgtcttcct gaggctgtat ttctcagtct ttgatcgagg aaatgacagg attggcctgg 1140 cacgggcagt gtaactcgaa tcactagt 1168 < 210 > 46 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 46 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 # i 4 Val Lys He Pro Leu Arg Arg Val Lys Thr Met Arg Lys Thr Leu Ser 20 2 * 5 30 Gly Lys Asn Thr Leu Asn Asn Phe Leu Lys Glu His Pro Tyr Arg Leu 40 45% • Ser His He Be Phe Arg Gly Ser Asn Leu Thr Thr Leu Pro Leu Arg 50 55 60 Asn He Arg Asp Met Leu Tyr Val Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Gly Ser As Asp Leu Trp 85 90. 95 Val Pro Ser Asp Phe Cys Thr Ser Pro Wing Cys Ser Thr His Val Arg 100 105 110 Phe Arg His Phe Gln Ser Ser Thr Phe Arg Pro Thr Thr Lys Thr Phe 115 120 125 Arg He He Tyr Gly Ser Gly Arg Met Lys Gly Val Val Ala His Asp 130 135 140 Thr Val Arg He Gly Asn Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Being Met Wing Glu Tyr Gly Leu Glu Being Arg Arg Phe Asp Gly He Leu 165 170 175 Gly Leu Asn Tyr Pro Asn Leu Ser Cys Ser Gly Ala He Pro He Phe 180 185 190 Asp Lys Leu Lys Asn Gln Gly Wing He Ser Asp Pro He Phe Wing Phe 195 200 205 Tyr Leu Ser Lys Asp Lys Arg Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro Leu He 225 230 235 240 Arg Ala Gly Asp Trp He Val His Val Asp Arg He Thr Met Lys Arg 245 250 255 Glu Val He Ala Cys Ser Asp Gly Cys Ala Ala Leu Val Asp Thr Gly 260 265 270 Thr Ser Leu He Gln Gly Pro Gly Arg Val He Asp Asn He His Lys 275 280 285 Leu He Gly Wing Thr Pro Arg Gly Ser Lys His Tyr Val Ser Cys Ser 290 295 300 Val Val Asn Thr Leu Pro Ser He He Phe Thr He Asn Gly He Asn 305 310 315 320 Tyr Pro Val Pro Wing Pro Tyr He Leu Lys Asp Ser Arg "Gly Tyr 325 330 335 Cys Tyr Thr Wing Phe Lys Glu Gln Arg Val Arg Arg Ser Thr Glu Ser 340 345 350 Trp Leu Leu Gly Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 47 < 211 > 1158 < 212 > DNA < 213 > bovidae < 400 > 47 aggaaagaag catgaagtgg cttgtgctcc tctggctagt ggccttctca gagtgtatag 60 tcaaaatacc tctaaggcaa gtgaagacca tgagaaaaac cctcagtgga aaaaacacgc 120 cttgaaggaa tgaacaattt catacttaca gtctgtccca gatttcttct cgtggttcaa 180 atctaactat tcacccactg agaaacatca tggatatgct ctacgtgggt aacatcacca 240 ttggaacacc ccctcaggaa ttccaggttg tctttgacac aggctcatct gacttgtggg 300 tgccctccgt cttttgccaa agtctagcct gtgctacaaa ggttatgttc atacatcttc 360 attcttccac cttccggcat acccaaaagg tcttcaacat caagtacaat actggaagga 420 tgaaaggact tcttgtttat gacactgttc ggattgggga ccttgtaagt actgaccagc 480 cattctgtat aagcctggca gaagttgggt ttgacggtat accttttgat ggtgtcttgg 540 gcttgaacta tccgaacatg tccttctctg gagccatccc catctttgac aacctgaaga 600 atgaaggtgc catttctgag cctgtttttg ccttctactt gagcaaagac aagcgggagg 660 gcagtgtggt gatgtttggt ggggtggacc accgctacta caagggagag ctcaactggg 720 tgccattgat ccaagcgggc ggctggactg tacacgtgga ccgcatctcc atgaaaagaa 780 ttgttctgga agattattgc cccttgtgga ggctgcgagg gcactgatca caccggaaca 840 aaggcccaag aagactg gtc aataacatac agaagctcat cggcaccacg ccacggggtt 900 ccaagcacta cgtttcatgt tctgtggtca ataccctgcc ctctattatc ttcaccatca 960 acggcatcaa ctacccggtg ccagcacgag cctacatcct caaggattct gaaagcaact 1020 gctatacaac ctttaaagag aacacagtga ggacgtctag agagacctgg atcctgggtg 1080 acgtcttccc gaggctgtat ttctcagtct ttgatcgagg aaatgacagg attggcctgg cacgggcagt gtaactcg 1140 1158 < 210 > 48 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 48 Met Lys Trp Leu Val Leu Leu Trp Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 Val Lys He Pro Leu Arg Gln Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Gly Lys Asn Thr Leu Asn Asn Phe Leu Lys Glu His Thr Tyr Ser Leu 40 45 Being Gln Be Being Being Arg Gly Being Asn Leu Thr He His Pro Leu Arg 50 55 60 Asn He Met Asp Met Leu Tyr Val Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser Val Phe Cys Gln Ser Leu Ala Cys Ala Thr Lys Val Met 100 105 110 Phe He His Leu His Ser Ser Thr Phe Arg His Thr Gln Lys Val Phe 115 120 125 Asn He Lys Tyr Asn Thr Gly Arg Met Lys Gly Leu Leu Val Tyr Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Cys He 145 150 155 160 Be Leu Ala Glu Val Gly Phe Asp Gly He Pro Phe Asp Gly Val Leu 165 170 175 Gly Leu Asn Tyr Pro Asn Met Ser Phe Ser Gly Wing He Pro He Phe 180 185 190 Asp Asn Leu Lys Asn Glu Gly Wing He Ser Glu Pro Val Phe Ala Phe 195 200 205 Tyr Leu Ser Lys Asp Lys Arg Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro Leu He 225 230 235 240 Gln Ala Gly Gly Trp Thr Val His Val Asp Arg He Ser Met Lys Arg 245 250, -255 Lys He He Wing Cys Ser Gly Gly Cys Glu Wing Leu Val Asp Thr Gly 260 265 270 Thr Ala Leu He Lys Gly Pro Arg Arg Leu Val Asn Asn He Gln Lys 275 280 285 Leu He Gly Thr Thr Pro Arg Gly Ser Lys His Tyr Val Ser Cys Ser 290 295 300 Val Val Asn Thr Leu Pro Be He He Phe Thr He Asn Gly He Asn 305 310 315 - 320 Tyr Pro Val Pro Ala Arg Ala Tyr He Leu Lys Asp Ser Glu Ser Asn 325 330"335 Cys Tyr Thr Thr Phe Lys Glu Asn Thr Val Arg Thr Ser Arg Glu Thr 340 345 350 Trp He Leu Gly Asp Val Phe Pro Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 49 < 211 > 1158 < 212 > DNA < 213 > bovidae < 400 > 49 taggaaagaa gcatgaagtg gcttgtgctc ctcgggctgg tggccttctc agagtgcata 60 gtcaaaatac ctctaaggag agtgaagacc atgagaaaaa ccctcagtgg aaaaaacatc 120 ctgaacaatt tcctgaagga acatgcttac agactgtccc agatttcttc ttgtggctca 180 aatctaactt ttcacccctt gagaaacatc aaggataggc tctacgtggg taacatcacc 240 cccctcaaga attggaacac attccaggtt atctttgaca caggctcatc tgacttgtgg 300 gtgacctccg tcttttgcac cagcccaacc tgttctacac atgttatgtt cagacatttt 360 gattcttcca ccttccggcc taccaaaaag accttcagca tcaactacgg ttctggaagg 420 atgaaaggag ttgttgttca tgacacagtt cggattgggg accttgtaag tactgaccag 480 ccatttggtc taagtgtggt ggaacttggg tttgatggta traccttttga tggcgtcatg 540 ggcttgaact accccaaact atccttctct ggagccattc ccatctttga caacctgagg 600 aatcaaggtg ccatttctga gcctgttttt gccttctact tgagcaaaga cgagcaggag 660 ggcagtgtgg tgatgtttgg tggggtggac caccgctact acaagggaga gctcaactgg 720 ataccactga tccaagcagg cgactggagt gtacacatgg acagcatctc catgaaaaga 780 aaggttattg cttgctctgg tggctgcaag gccgttgtgg acaccgggac atcactgatt 840 gaaggcccaa gaagac TGGT cagaagctca caataacata tcagagccat gccacggggt 900 tccgagtact acgtttcatg ttctgcggtc aataccctgc cccctattat cttcaccatc 960 aaaggcatca actacccagt gccagctcaa gcctacatcc tcaaggattc tagaggccac 1020 cctttaaaga tgctatacca ggacagattg agtccaccat ctacagagac ctggatcctg 1080 ggtgacgtct tcctgaggcg gtatttctcg gtctttgatc gaggaaatga caggattggc 1140 1158 cagtgtaa ctggcacggg < 210 > 50 < 211 > 381 < 212 > PRT < 213 > bovidae t i * «- • * < 400 > 50 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 Val Lys He Pro Leu Arg Arg Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Gly Lys Asn He Leu Asn Asn Phe Leu Lys Glu His Wing Tyr Arg Leu 35 40 45 Ser Gln He Ser Ser Cys Gly Ser Asn Leu Thr Phe His Pro Leu Arg 50 55 60 Asn He Lys Asp Arg Leu Tyr Val Gly Asn He Thr He Gly_Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val He Phe Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Thr Ser Val Phe Cys Thr Ser Pro Thr Cys Ser Thr His Val Met F 100 105 110 Phe Arg His Phe Asp Ser Ser Thr Phe Arg Pro Thr Lys Lys Thr Phe 115 120 125 Ser He Asn Tyr Gly Ser Gly Arg Met Lys Gly Val Val Val His Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 - 160 Ser Val Val Glu Leu Gly Phe Asp Gly He Pro Phe Asp Gly Val Met 165 170 175 Gly Leu Asn Tyr Pro Lys Leu Ser Phe Ser Gly Wing He Pro He Phe 180 185 190 Asp Asn Leu Arg Asn Gln Gly Wing He Ser Glu Pro Val Phe Wing Phe 195 200 205 Tyr Leu Ser Lys Asp Glu Gln Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Lys Gly Glu Leu Asn Trp He Pro Leu He 225 230 235 240 Gln Ala Gly Asp Trp Ser Val His Met Asp Ser He Met Met Lys Arg 245 - 250 255 Lys Val He Wing Cys Ser Gly Gly Cys Lys Wing Val Val Asp Thr Gly 260 265 270 Thr Ser Leu He Glu Gly Pro Arg Arg Leu Val Asn Asn He Gln Lys 275 280 285 Leu He Arg Wing Met Pro Arg Gly Ser Glu Tyr Tyr Val Ser Cys Ser 290 295 300 Wing Val Asn Thr Leu Pro Pro He He Phe Thr He Lys Gly He Asn 305 310 315 320 Tyr Pro Val Pro Ala Gln Ala Tyr He Leu Lys Asp Ser Arg Gly His 325 330 335 Cys Tyr Thr Thr Phe Lys Glu Asp Arg Leu Ser Pro Pro Ser Thr Glu 340 345 350 Thr Trp He Leu Gly Asp Val Phe Leu Arg Arg Tyr Phe Ser Val Phe 355 360 365 Asp Arg Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 51 < 211 > 1154 < 212 > DNA < 213 > bovidae < 400 > 61 aggaaagaag catgaagtgg cttgtggtcc tcggacttgt ggccttctca gagtgcatag 60 tcaaaatacc tctaaggaga gtgaagacca tgagaaaagc cctcagtgga aaaasrcatgc 120 cctgaaggaa tgaacaattt catgcttaca gactgtccca gatttctttt cgtggctcaa 180 atctaactag tcacccgctg agaaacatca aggatttggt ctacctggct aatatcacca 240 ttggaacacc ccctcaggag ttccaggttt tccttgacac aggctcatct gacttgtggg 300 tgccctctga cttttgcacc agcccaggct gttctaaaca cgttagattc agacatcttc 360 agtcttccac cttccggctt accaataaga ccttcagcat tctgggagaa cacctatgga 420 ttaaaggagt tgttgctcat gacacagttc ggattgggga ccttgtaagc actgaccagc 480 aagcatggca cgttcagtct gaatacgggc ttgagcatat accttttgat ggcatcttgg 540 ccccaacgta gcttgaacta tcttcttctg gagcaatccc tatctttgac aagctgaaga 600 atcaaggtgc catttctgaa cctgtttttg ccttctactt gagcaaagac aagcaggagg 660 gcagtgtggt gatgtttggt ggggtggacc atcgctatta caggggaaag ctcaactggg 720 ccaagcggga taccattgat aactggatta tacacatgga cagcatctcc attgaaagaa 780 aggttattgc ttgttctgga ggctgcgtgg cctttgttga catcgggaca gcattcatcg 840 aaggcccaaa accact GGTC gataacatgc agaagctcat cagggccaag ccatggcgtt 900 ccaagcacta tgtttcatgt tctgcggtca atacactgcc ctctattacc ttcaccatca 960 acggcatcaa ctacccagtg ccaggtcgag cctacatcct caaggattct agacgccgtt 1020 gctatagcac ctttaaagag atcccattga gtccaactac agagttctgg atgctgggtg 1080 acgtcttcct gaggctgtat ttctcagtct ttgatcgagg aaatgacagg attgggctgg cacgggcagt GTAA 1140 1154 < 210 > 52 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 62 Met Lys Trp Leu Val Val Leu Gly Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 Val Lys He Pro Leu Arg Arg Val Lys Thr Met Arg Lys Ala Leu Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Glu His Wing Tyr Arg Leu 35 40 45 Ser Gln He Ser Phe Arg Gly Ser Asn Leu Thr Ser His Pro Leu Arg 50 55 60 Asn He Lys Asp Leu Val Tyr Leu Wing Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Phe Leu Asp Thr Gly Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser Asp Phe Cys Thr Ser Pro Gly Cys Ser Lys His Val Arg 100 105 110 Phe Arg His Leu Gln Ser Ser Thr Phe Arg Leu Thr Asn Lys Thr Phe 115 120 125 Ser He Thr Tyr Gly Ser Gly Arg He Lys Gly Val Val Ala "His Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Ser Leu 145 150 155 160 Ser Met Wing Glu Tyr Gly Leu Glu His He Pro Phe Asp Gly He Leu 165 170 175 Gly Leu Asn Tyr Pro Asn Val Ser Ser Ser Gly Ala He Pro He Phe 180 185 190 Asp Lys Leu Lys Asn Gln Gly Ala He Ser Glu Pro Val Phe Ala Phe 195 200 205 Tyr Leu Ser Lys Asp Lys Gln Glu Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Arg Gly Lys Leu Asn Trp Val Pro Leu He 225 230 235 240 Gln Wing Gly Asn Trp He He His Met Asp Ser He Ser He Glu Arg 245 250 255 Lys Val He Wing Cys Ser Gly Gly Cys Val Wing Phe Val Asp He Gly 260 265 270 Thr Ala Phe He Glu Gly Pro Lys Pro Leu Val Asp Asn Met Gln Lys 275 280 285 Leu He Arg Ala Lys Pro Trp Arg Ser Lys His Tyr Val Ser Cys Ser 290 295 300 Wing Val Asn Thr Leu Pro Be He Thr Phe Thr He Asn Gly He Asn 305 310 315 320 Tyr Pro Val Pro Gly Arg Ala Tyr He Leu Lys Asp Ser Arg Arg Arg 325 330.-335 Cys Tyr Ser Thr Phe Lys Glu He Pro Leu Ser Pro Thr Thr Glu Phe 340 345 350 Trp Met Leu Gly Asp Val Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 53 < 211 > 1164 < 212 > DNA < 213 > bovidae < 400 > 53 aggaaagaag catgaagtgg cttgtgctcc tcggtctggt ggccttctca gagtgcatat 60 tcaaaatacc tctaaggaga gtgaagacca tgagaaaaac cctcagtgga aaaaacatgc 120 tgaacaattt cctgaaggag catccttaca aactgtccca gatttctttt cgtggctcaa 180 atctaaccac tctcccactg aggaacatct gggatatatt ctacataggt accatcacca 240 ttggaacacc ccctcaggaa ttccaggttg tctttgacac agcctcatct gacttgtggg 300 tgccctccat catttgcaac agctcaacct gttctacaca cgttagattc agacatcgtc 360 agtcttccac cttccggctt accaataaga cgttcgggat tctgggagaa cacgtatgga 420 tgaaaggagt tgttgttcat gacacagttc ggattgggga ccttgtaagt actgaccagc 480 cattcggtct aagcgtggcg gaatacgggt ttgagggcag aagatttgat ggtgtcttgg 540 ccccaacata gcttgaacta tccttctcta aagccatccc catctttgat aagctgaaga 600 atgaaggtgc catttcagag cctgtttttg ccttctactt gagcaaagac aagcagaagg 660 gcagtgtggt gatgtttggt ggggtggacc accgctacta caaaggagag ctcaactggg 720 taccattgat ccgagcgggt gactggagtg tacacgtaga ccgcatcacc atgaaaggag 780 aggttattgg ttgttctgat ggctgcacgg caccgggtca ccatggtgga tcaaatatcc 840 aaggcccagg aagagtg atc gataacatac acaagctcat tggtgccaca ccacggggtt 900 ccaagcacta cgtttcatgt tctgcggtca gtgctctgcc ctctgttgtc ttcaccatca 960 atggcatcaa ctacccagtg ccagctcgag cctacgtcct caaggatttt acaggcaact 1020 gctacaccac ctttaaagag aaaagggtaa ggagatctac ggagttctgg atcctgggtg 1080 aagccttcct gaggctgtat ttctcggtct ttgatcgagg aaatgacagg attggcctgg cacgggcagt GTAA 1140 1154 < 210 > 54 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 54 Met Lys Trp Leu Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 Phe Lys He Pro Leu Arg Arg Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Glu His Pro Tyr Lys Leu 40 45 Ser Gln Be Ser Phe Arg Gly Ser Asn Leu Thr Thr Leu Pro Leu Arg 50 55 60 Asn He Trp Asp He Phe Tyr He Gly Thr He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Ala Ser Ser Asp Leu Trp 85 90 95 Val Pro Ser He He Cys Asn Ser Ser Thr Cys Ser Thr His Val Arg 100 105 110 Phe Arg His Arg Gln Ser Ser Thr Phe Arg Leu Thr Asn Lys Thr Phe 115 120 125 Gly He Thr Tyr Gly Ser Gly Arg Met Lys Gly Val Val Val His Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Ser Val Ala Glu Tyr Gly Phe Glu Gly Arg Arg Phe Asp Gly Val Leu 165 170 -175 Gly Leu Asn Tyr Pro Asn He Ser Phe Ser Lys Ala He Pro He He Phe 180 185 190 Asp Lys Leu Lys Asn Glu Gly Wing He Ser Glu Pro Val Phe Wing Phe 195 200 205 Tyr Leu Ser Lys Asp Lys Gln Lys Gly Ser Val Val Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro, Leu He 225 230 235 240 Arg Ala Gly Asp Trp Ser Val His Val Asp Arg He Thr Met Lys Gly 245 250 255 Glu Val He Gly Cys Ser Asp Gly Cys Thr Ala Met Val Asp Thr Gly 260 265 270 Ser Ser Asn He Gln Gly Pro Gly Arg Val He Asp Asn He His Lys 275 280 285 Leu He Gly Wing Thr Pro Arg Gly Ser Lys His Tyr Val Ser Cys Ser 290 295 300 Wing Val Ser Wing Leu Pro Ser Val Val Phe Thr He Asn Gly He Asn 305 310 315 320 Tyr Pro Val Pro Ala Arg Ala Tyr Val Leu Lys Asp Phe Thr Gly Asn 325 330 335 Cys Tyr Thr Thr Phe Lys Glu Lys Arg Val Arg Arg Ser Thr Glu Phe 340 345 350 Trp He Leu Gly Glu Wing Phe Leu Arg Leu Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Asp Arg He Gly Leu Ala Arg Ala Val 370 375 380 < 210 > 55 < 21 1 > 1320 < 212 > DNA < 213 > bovidae < 400 > 55 agaagcatga gtcgacggaa agtgggttgt gctccttggg ctggtggcct tctcagagtg 60 atacctctaa catagtcaaa ggcgagtgaa aaaaccctca gaccatgaga gtggtaaaaa 120 catgctgaac aatttcttga aggagcatgg taacagattg tccaagattt cttttcgtgg 180 ctcaaatcta actactctcc cgctgagaaa catcgaggat ttgatgtacg tgggtaacat 240 caccattgga acacccccac aggaattcca ggttgtcttt gatacaggct catctgactt 300 ttgggtgccc tccgactttt gcactagtcc agactgtatt gattcagaca acacacgtta 360 acatcagtct tccaccttcc ggcctaccaa taagaccttc agcatcacct atggatctgg 420 gagaatgaga ggagttgttg ttcatgacac agttcggatt ggggaccttg taagtactga 480 ccagccgttc ggtctaagcg tgtcagaata cgggtttaag gacagagctt atgatggcat 540 cctgggcttg aactaccccg acgaatcctt ctctgaagcc atccccatct ttgacaagct 600 aaagaatgaa ggtgccattt ctgagcctat ttttgccttc tacttgagca aaaaaaagcg 660 ggagggcagt gtggtgatgt ttggtggggt ggaccaccgc tactacaagg gagagctcaa 720 ctgggtacca ttgatcgaag agggtgactg gagtgtacgc atggacggca tctccatgaa 780 aacaaaggta gttgcttgtt ctgacggctg cgaggctgtt gttgacactg ggacatcact 840 gataaaaggc ccaagaaaac tggtcaataa aatacagaag ctcattggtg ccacgccacg 900 gggttccaag cactacgttt attgttctgc ggtcaatgct ctgccctcta ttatcttcac 960 catcaatggc atcaactacc cagtgccagc tcgagcctac attctcaagg attctagagg 1020 ccgctgctat accgccttta aaaagcaacg attcagttca tctacagaga cctggctcct 1080 gggtgacgcc ttcctgaggg tgtatttctc ggtctttgat cgaggaaatg gcaggattgg 1140 cctggcacag gcagtgtaaa tgcttggagt ggttcaagaa tcagtaaggc cgcttntaac 1200 acacactcac tcacactagg gcactcctgc ccaggatggt ggtgaactgt atttggtggt 1260 ctgtacaccc tattctcagt gaagaataaa cggtttcact cttaatggtg ctgaaaaaaa 1320 < 210 > 56 < 211 > 380 < 212 > PRT < 213 > bovidae < 400 > 56 Met Lys Trp Val Val Leu Leu Gly Leu Val Wing Phe Ser Glu Cys He 1 5 10 15 Val Lys He Pro Leu Arg Arg Val Lys Thr Met Arg Lys Thr Leu Ser 20 25 30 Gly Lys Asn Met Leu Asn Asn Phe Leu Lys Glu His Gly Asn Arg Leu 35 40 45 Ser Lys Be Ser Phe Arg Gly Ser Asn Leu Thr Thr Leu Pro Leu Arg 50 55 60 Asn He Glu Asp Leu Met Tyr Val Gly Asn He Thr He Gly Thr Pro 65 70 75 80 Pro Gln Glu Phe Gln Val Val Phe Asp Thr Gly Ser Ser Asp Phe Trp 85 90 95 Val Pro Ser Asp Phe Cys Thr Ser Pro Asp Cys He Thr His Val Arg 100 105 110 Phe Arg Gln His Gln Ser Ser Thr Phe Arg Pro Thr Asn Lys Thr Phe 115 120 125 Ser He Thr Tyr Gly Ser Gly Arg Met Arg Gly Val Val Val His Asp 130 135 140 Thr Val Arg He Gly Asp Leu Val Ser Thr Asp Gln Pro Phe Gly Leu 145 150 155 160 Ser Val Ser Glu Tyr Gly Phe Lys Asp Arg Wing Tyr Asp Gly He Leu 165 170 175 Gly Leu Asn Tyr Pro Asp Glu Be Phe Ser Glu Ala He Pro He Phe 180 185 190 Asp Lys Leu Lys Asn Glu Gly Wing He Ser Glu Pro He Phe Wing Phe 195 200 205 Tyr Leu Ser Lys Lys Lys Arg Glu Gly Val Val Met Met Phe Gly Gly 210 215 220 Val Asp His Arg Tyr Tyr Lys Gly Glu Leu Asn Trp Val Pro Leu He 225 230 235 240 Glu Glu Gly Asp Trp Ser Val Arg Met Asp Gly He Ser Met Lys Thr 245 250 255 Lys Val Val Wing Cys Ser Asp Gly Cys Glu Wing Val Val Asp Thr Gly 260 265 270 Thr Ser Leu He Lys Gly Pro Arg Lys Leu Val Asn Lys Ile Gln Lys 275 280 285 Leu He Gly Wing Thr Pro Arg Gly Ser Lys His Tyr Val Tyr Cys Ser 290 295 300 Wing Val Asn Wing Leu Pro Being He He Phe Thr He Asn Gly He Asn 305 310 315 - - 320 Tyr Pro Val Pro Ala Arg Ala Tyr He Leu Lys Asp Ser Arg Gly Arg 325 330 '335 Cys Tyr Thr Wing Phe Lys Lys Gln Arg Phe Ser Ser Ser Thr Glu Thr 340 345 350 Trp Leu Leu Gly Asp Wing Phe Leu Arg Val Tyr Phe Ser Val Phe Asp 355 360 365 Arg Gly Asn Gly Arg He Gly Leu Wing Gln Ala Val 370 375 380

Claims (9)

1. NOVELTY OF THE INVENTION CLAIMS 1. A method for detecting pregnancy in a bovine animal comprising: a) obtaining a sample of said animal; and b) detecting at least one pregnancy associated antigen (PAG) where said PAG is present in early pregnancy and absent approximately two months after calving; whereby the presence of the PAG indicates that said animal is pregnant. 2. The method according to claim 1, further characterized in that said PAG is selected from the group consisting of PAG2, PAG4, PAG5, PAG6, PAG7 and PAG9. 3. The method according to claim 1, further characterized in that said sample is saliva, serum, blood, milk or urine. 4. The method according to claim 3, further characterized in that said sample is saliva. 5. The method according to claim 3, further characterized in that said sample is serum. 6. The method according to claim 3, further characterized in that said sample is blood. 7. - The method according to claim 3, further characterized in that said sample is milk. 8. The method according to claim 3, further characterized in that said sample is urine. 9. The method according to claim 1, further characterized in that said detection comprises an immunological detection. 10. The method according to claim 9, further characterized in that said immunological detection comprises the detection of BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG 7v; bo PAG9v; BoPAG 15; boPAG 16; boPAG 17, boPAG 18; boPAG 19; boPAG 20 or boPAG 21 with polyclonal antisera. 1. The method according to claim 9, further characterized in that said immunological detection comprises the detection of BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG 7; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21 with a monoclonal antibody preparation. 12. The method according to claim 9, further characterized in that said immunological detection comprises an ELISA. 13. - The method according to claim 9, further characterized in that said immunological detection comprises an RIA. 14. The method according to claim 9, further characterized in that said immunological detection comprises a Western blot. 15. The method according to claim 3, further characterized in that the PAG is BoPAG2. 16. The method according to claim 3, further characterized in that the PAG is BoPAG4. 17. The method according to claim 3, further characterized in that the PAG is BoPAGd. 18. The method according to claim 3, further characterized in that the PAG is BoPAGd. 19. The method according to claim 3, further characterized in that the PAG is BoPAG7. 20. The method according to claim 3, further characterized in that the PAG is BoPAG9. 21. The method according to claim 3, further characterized in that the PAG is BoPAG7v. 22. The method according to claim 3, further characterized in that the PAG is BoPAG9v. 23. - The method according to claim 3, further characterized in that the PAG is BoPAG 15. 24.- The method according to claim 3, further characterized in that the PAG is BoPAG 16. 25.- The method according to the claim 3, further characterized in that the PAG is BoPAG 17. 26.- The method according to claim 3, further characterized in that the PAG is BoPAG18. 27. The method according to claim 3, further characterized in that the PAG is BoPAG 19. 28.- The method according to claim 3, further characterized in that the PAG is BoPAG 20. 29.- The method of compliance with claim 3, further characterized in that the PAG is BoPAG 21. 30.- The method according to claim 1, which also comprises the detection of a second PAG in said sample. 31. The method according to claim 30, further comprising the detection of a third PAG in said sample. 32. The method according to claim 12, further characterized in that said ELISA is a sandwich ELISA comprising the binding of a PAG with a first antibody preparation fixed to a substrate and a second antibody preparation marked with an enzyme. 33. - The method according to claim 32, further characterized in that said enzyme is alkaline phosphatase or horseradish peroxidase. 34. The method according to claim 32, further characterized in that said first antibody preparation is monoclonal. 35.- An antibody composition that reacts immunologically with BoPAG2, BoPAG4, BoPAG5, B0PAG6, BoPAG7, BoPAG9, boPAG 7v; boPAGTv; bPAG 15; boPAG 16; boPAG17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21. 36.- An antibody composition that reacts immunologically with BoPAG2. 37.- An antibody composition that reacts immunologically with BoPAG4. 38.- An antibody composition that reacts immunologically with BoPAGd. 39.- An antibody composition that reacts immunologically with B0PAG6. 40.- An antibody composition that reacts immunologically with BoPAG7. 41.- An antibody composition that reacts immunologically with BoPAG9. 42. - An antibody composition that reacts immunologically with BoPAG 7v. 43.- An antibody composition that reacts immunologically with BoPAG9v. 44.- An antibody composition that reacts immunologically with BoPAG 15. 45.- An antibody composition that reacts immunologically with BoPAG 16. 46.- An antibody composition that reacts immunologically with BoPAG 17. 47.- An antibody composition that Reacts immunologically with BoPAG 18. 48.- An antibody composition that reacts immunologically with BoPAG 19. 49.- An antibody composition that reacts immunologically with BoPAG 20. 50.- An antibody composition that reacts immunologically with BoPAG 21. 51. - A cell that secretes a monoclonal antibody that reacts immunologically with BoPAG2, BoPAG4, BoPAG5, B0PAG6, BoPAG7, BoPAG9, boPAG 7v; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21. 52. - A method for making a monoclonal antibody against BoPAG2, BoPAG4, BoPAG5, B0PAG6, BoPAG7, BoPAG9, boPAG 7v; boPAG9v; boPAG 15; boPAG 16; boPAG 17; boPAG 18; boPAG 19; boPAG 20 or boPAG 21 comprising: a) immunizing an animal with a BoPAG preparation; b) obtaining antibody secreting cells from said immunized animal; c) immortalizing said antibody secreting cells; and d) identifying an immortalized cell that secretes the antibodies that immunologically bind with the immunizing BoPAG. 53. A method for identifying a pregnancy-associated glycoprotein (PAG) that is an early indicator of pregnancy in an euterio animal, comprising: a) obtaining a cDNA library prepared from the placenta of said animal between the 15 and 30 days of pregnancy; and b) hybridizing said library under conditions of high stringency with a nucleic acid probe derived from PAG; whereby the hybridization of said probe allows to identify said PAG. 54.- A method to identify a pregnancy-associated glycoprotein (PAG) that is an early indicator of pregnancy in an euterio animal, which comprises: a) obtaining an RNA preparation from the placenta of said animal between days 15 and 30 of the pregnancy; and b) performing an RT-PCR ™ with said preparation using primers derived from PAG; whereby the amplification makes it possible to identify said PAG. 56.- BoPAG2 polypeptide isolated and purified. 56. The polypeptide according to claim 55, further characterized in that said polypeptide comprises the sequence of SEQ ID No.:25. 57.- An isolated and purified BoPAG4 polypeptide. 58.- The polypeptide according to claim 57, further characterized in that said polypeptide comprises the sequence of SEQ ID No.:27. 59.- An isolated and purified BoPAGd polypeptide. The polypeptide according to claim 59, further characterized in that said polypeptide comprises the sequence of SEQ ID NO: 28. 61 .- A polypeptide B0PAG6 isolated and purified. 62.- The polypeptide according to claim 61, further characterized in that said polypeptide comprises the sequence of SEQ ID No.:29. 63.- An isolated and purified BoPAG7 polypeptide. 64.- The polypeptide according to claim 63, further characterized in that said polypeptide comprises the sequence of SEQ ID NO: 30. 65.- An isolated and purified BoPAG9 polypeptide. 66.- The polypeptide according to claim 65, further characterized in that said polypeptide comprises the sequence of SEQ ID No.:32. 67. - An isolated and purified BoPAG7v polypeptide. 68.- The polypeptide according to claim 67, further characterized in that said polypeptide comprises the sequence of SEQ ID NO: 40. 69.- An isolated and purified BoPAG9v polypeptide. The polypeptide according to claim 69, further characterized in that said polypeptide comprises the sequence of SEQ ID NO: 42. 71.- An isolated and purified BoPAG polypeptide. 72. The polypeptide according to claim 71, further characterized in that said polypeptide comprises the sequence of SEQ ID No.:44. 73.- A BoPAG 16 polypeptide isolated and purified. The polypeptide according to claim 73, further characterized in that said polypeptide comprises the sequence of SEQ ID NO: 46. 75.- A BoPAG 17 polypeptide isolated and purified. 76. The polypeptide according to claim 75, further characterized in that said polypeptide comprises the sequence of SEQ ID No.:48. 77.- A BoPAG polypeptide 18 isolated and purified. 78. The polypeptide according to claim 77, further characterized in that said polypeptide comprises the sequence of SEQ ID N °: 50. 79.- A BoPAG19 polypeptide isolated and purified. 80. The polypeptide according to claim 79, further characterized in that said polypeptide comprises the sequence of SEQ ID NO: 52. 81.- An isolated and purified BoPAG20 polypeptide. 82. The polypeptide according to claim 81, further characterized in that said polypeptide comprises the sequence of SEQ ID NO: 54. 83.- An isolated and purified BoPAG21 polypeptide. 84.- The polypeptide according to claim 83, further characterized in that said polypeptide comprises the sequence of SEQ ID N °: 56. 85.- An isolated and purified nucleic acid encoding BoPAG2. 86. The nucleic acid according to claim 85, further characterized in that said nucleic acid comprises the sequence of SEQ ID No. 2.
2. 2. The nucleic acid according to claim 85, further characterized in that said nucleic acid encodes the BoPAG2 polypeptide comprising the sequence SEQ ID N °: 26. 88.- An isolated and purified nucleic acid encoding BoPAG4. 89. - The nucleic acid according to claim 88, further characterized in that said nucleic acid comprises the sequence of SEQ ID No.: 4. The nucleic acid according to claim 88, further characterized in that said nucleic acid encodes the BoPAG4 polypeptide comprising the sequence SEQ ID N °: 27. 91.- An isolated and purified nucleic acid encoding BoPAGd. 92.- The nucleic acid according to claim 91, further characterized in that said nucleic acid comprises the sequence of SEQ ID No.: 5. The nucleic acid according to claim 91, further characterized in that said nucleic acid encodes the BoPAGd polypeptide comprising the sequence SEQ ID NO: 28. 94.- An isolated and purified nucleic acid encoding B0PAG6. 95. The nucleic acid according to claim 94, further characterized in that said nucleic acid comprises the sequence of SEQ ID N °: 6. The nucleic acid according to claim 94, further characterized in that said nucleic acid encodes the polypeptide B0PAG6 comprising the sequence SEQ ID NO: 29. 97.- An isolated and purified nucleic acid encoding BoPAG7. 98. - The nucleic acid according to claim 97, further characterized in that said nucleic acid comprises the sequence of SEQ ID N °: 7. 99.- The nucleic acid according to claim 97, further characterized in that said nucleic acid encodes the BoPAG7 polypeptide comprising the sequence SEQ ID N °: 30. 100.- Un. isolated and purified nucleic acid encoding BoPAG9. 101. The nucleic acid according to claim 100, further characterized in that said nucleic acid comprises the sequence of SEQ ID No. 9. 9. The nucleic acid according to claim 100, further characterized in that said nucleic acid encodes the BoPAG9 polypeptide comprising the sequence SEQ ID No.:32. 103.- An isolated and purified nucleic acid encoding BoPAG7v. 104. The nucleic acid according to claim 103, further characterized in that said nucleic acid comprises the sequence of SEQ ID NO: 39. 105. - The nucleic acid according to claim 103, further characterized in that said nucleic acid encodes the BoPAG7v polypeptide comprising the sequence SEQ ID No.:40. 106. - An isolated and purified nucleic acid encoding BoPAG9v. 107. The nucleic acid according to claim 106, further characterized in that said nucleic acid comprises the sequence of SEQ ID N °: 41. 108. - The nucleic acid according to claim 106, further characterized in that said nucleic acid encodes the BoPAG9v polypeptide comprising the sequence SEQ ID NO: 42. 109.- An isolated and purified nucleic acid encoding BoPAG 15. 1 10. The nucleic acid according to claim 109, further characterized in that said nucleic acid comprises the sequence of SEQ ID NO: 43. 1 11. The nucleic acid of claim 109, wherein said nucleic acid encodes the BoPAGI d polypeptide comprising the sequence SEQ ID N °: 44. 1 12.- A nucleic acid isolated and purified that encodes BoPAG16. 13. The nucleic acid according to claim 12, further characterized in that said nucleic acid comprises the sequence of SEQ ID NO: 45. 14. The nucleic acid according to claim 12, further characterized in that said nucleic acid encodes the BoPAG16 polypeptide comprising the sequence SEQ ID NO: 46. 115. An isolated and purified nucleic acid encoding BoPAG17. 116. The nucleic acid according to claim 115, further characterized in that said nucleic acid comprises the sequence of SEQ ID N °: 47. The nucleic acid according to claim 115, further characterized in that said nucleic acid encodes the BoPAG17 polypeptide comprising the sequence SEQ ID No.:48. 1 18. An isolated and purified nucleic acid encoding BoPAG 18. 1 19. The nucleic acid according to claim 18, further characterized in that said acid The nucleic acid comprises the sequence of SEQ ID No.:49. 120. The nucleic acid according to claim 18, further characterized in that said nucleic acid encodes the BoPAG polypeptide 18 comprising the sequence of SEQ ID No.:50. . 121. An isolated and purified nucleic acid encoding BoPAG 19. 122. - The nucleic acid according to claim 121, further characterized in that said nucleic acid comprises the sequence of SEQ ID NO: d1. 123. The nucleic acid according to claim 121, further characterized in that said nucleic acid encodes the BoPAG19 polypeptide comprising the sequence of SEQ ID NO: 52. 124. An isolated and purified nucleic acid encoding BoPAG20. 125. The nucleic acid according to claim 124, further characterized in that said nucleic acid comprises the sequence of SEQ ID No.:53. The nucleic acid according to claim 124, further characterized in that said nucleic acid encodes the BoPAG20 polypeptide comprising the sequence of SEQ ID NO: 54. 127.- An isolated and purified nucleic acid encoding BoPAG21. 128. The nucleic acid according to claim 127, further characterized in that said nucleic acid comprises the sequence of SEQ ID N °: 56. 129. - The nucleic acid according to claim 127, further characterized in that said nucleic acid encodes the BoPAG21 polypeptide comprising the sequence of SEQ ID NO: 56. 130. - An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 9, or the complement thereof. 131. The oligonucleotide according to claim 130, further characterized in that said oligonucleotide is approximately 20 bases in length. 132. An oligonucleotide comprising at least 16 consecutive bases approximately of the sequence of SEQ ID No. 7, or the complement thereof. 133. The oligonucleotide according to the claim 132, further characterized in that said oligonucleotide is approximately 20 bases in length. 134. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 6, or the complement thereof. 13d.- The oligonucleotide according to claim 134, further characterized in that said oligonucleotide is approximately 20 bases in length. 136. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 5, or the complement thereof. 137. The oligonucleotide according to claim 136, further characterized in that said oligonucleotide is approximately 20 bases in length. 138. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No. 4, or the complement thereof. 139. The oligonucleotide according to claim 138, further characterized in that said oligonucleotide is approximately 20 bases in length. 140. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No. 2, or the complement thereof. 141. The oligonucleotide according to claim 140, further characterized in that said oligonucleotide is approximately 20 bases in length. 142. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 39, or the complement thereof. 143. The oligonucleotide according to claim 142, further characterized in that said oligonucleotide is approximately 20 bases in length. 144. - An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 41, or the complement thereof. 145. The oligonucleotide according to claim 144, further characterized in that said oligonucleotide is approximately 20 bases in length. 146. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No.:43, or the complement thereof. 147.- The oligonucleotide according to the claim 146, further characterized in that said oligonucleotide is approximately 20 bases in length. 148.- An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No.:45, or the complement thereof. 149. The oligonucleotide according to claim 148, further characterized in that said oligonucleotide is approximately 20 bases in length. 150. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No. 47, or the complement thereof. 151. The oligonucleotide according to claim 150, further characterized in that said oligonucleotide is approximately 20 bases in length. 152.- An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No.:49, or the complement thereof. 153. The oligonucleotide according to claim 152, further characterized in that said oligonucleotide is approximately 20 bases in length. 154. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 51, or the complement thereof. 165. The oligonucleotide according to claim 154, further characterized in that said oligonucleotide is approximately 20 bases in length. 156. An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID No.:53, or the complement thereof. 157. The oligonucleotide according to claim 156, further characterized in that said oligonucleotide is approximately 20 bases in length. 158. - An oligonucleotide comprising at least 15 consecutive bases approximately of the sequence of SEQ ID NO: 55, or the complement thereof. 159. The oligonucleotide according to claim 158, further characterized in that said oligonucleotide is approximately 20 bases in length. 160.- A kit comprising: (a) a first preparation of monoclonal antibodies that bind immunologically with BoPAG2, BoPAG4, BoPAGd, B0PAG6, BoPAG7, BoPAG9, boPAG7v, boPAGTv; boPAG 15; boPAG 16; boPAG 17; boPAG 18, boPAG 19; boPAG 20 or boPAG twenty-one; and (b) as a means a suitable container for the same. 161. The kit according to claim 160, further comprising: (c) a second preparation of monoclonal antibodies that immunologically bind to the same BoPAG as said first monoclonal antibody, but wherein said first and second monoclonal antibodies bind to different epitopes; and (d) as a means a suitable container for the same. 162. The kit according to claim 161, further characterized in that said first antibody preparation is attached to a support. 163. The kit according to claim 162, further characterized in that said support is a polystyrene plate, a test tube or a rod. 164. The kit according to claim 161, further characterized in that said second antibody preparation comprises a detectable label. 165. The kit according to claim 164, further characterized in that said detectable label is a fluorescent label. 166. The kit according to claim 164, further characterized in that said detectable label is a chemiluminescent label. 167. The kit according to claim 164, further characterized in that said detectable label is an enzyme. 168. The kit according to claim 167, further characterized in that said enzyme is alkaline phosphatase or horseradish peroxidase. 169. The kit according to claim 167, further comprising a substrate for said enzyme. 170. The kit according to claim 161, further comprising: (e) a buffer or diluent; and (f) as a means a suitable container for the same. 171. A method for detecting pregnancy in a non-bovine euterol animal comprising: (a) obtaining a sample of said animal; and (b) detecting at least one pregnancy associated antigen (PAG) in said sample, wherein said PAG is present in the early stage of pregnancy, whereby the presence of the PAG indicates that said animal is pregnant. 172. The method according to claim 171, further characterized in that said animal belongs to the suborder of the Ruminants. 173. The method according to claim 172, further characterized in that said animal belongs to the family Bovidae. 174. The method according to claim 173, further characterized in that said animal is a goat or a sheep. 175. The method according to claim 174, further characterized in that said animal is a sheep. 176. The method according to claim 172, further characterized in that said animal belongs to the Perisodactyla order. 177. The method according to claim 176, further characterized in that said animal on a horse or a rhinoceros. 178. The method according to claim 177, further characterized in that said animal is a horse. 179. The method according to claim 171, further characterized in that said animal belongs to the order Carnivora. 180. The method according to claim 179, further characterized in that said animal is a dog or a cat. 181. The method according to claim 179, further characterized in that said animal is a human being.