MXPA00004770A - Gram-positive microorganism formate pathway - Google Patents

Abstract

The present invention relates to the formate transport system in gram-positive microorganisms and provides methods for the production of products in a gram-positive microorganism. The present invention also provides the nucleic acid and amino acid sequences of four molecules associated with formate transport, FTAP 1, FTAP 2, PurU and Def.

Description

TRANSPORTERS OF © »8fXfS IN MICROORGANISMS Field of the Invention The present invention concerns the field of molecular biology and in particular the identification of molecules involved in the transport and utilization of formates in Bacillus. The present invention also concerns methods for increasing the efficiency of polypeptides produced in Bacillus.

Introduction Gram-positive microorganisms, such as Ba c? 21 - s, nar. After many years of industrial fermentation, I decide, in part, on its ability to secrete its fermentative proacts in the medium of cultivation. The secreted proteins are exported through a cell membrane and a cell wall, and then subsequently lioeradas in the external environment. It is a bear sale to produce proteins of interest in germ-positive microorganisms since the exported proteins usually retain their native conformation. REF. 119835 Supp ann et al. (1994, Molecular Microbiology vol 11 (5), pp. 965-982) describe a generalized formate transporter in a gram-positive organism, E coli, Nagy et al. (1995, Journal of Bacteriology, vol: 177, p.1292) describe a formyl tetrahydrofolate hydrolase in E. coli. Mazel et al. (1997, J. Mol. Biol. 266: 939-949) describe a polypeptide deformylase function in the Eubacterian lineage. There is little knowledge, however, about the uptake and utilization of formate in gram-positive micro-organisms used on a large scale in fermentation methods for the production of heterologous proteins.

Genetic products that may be associated with the use of the formate have been identified in Bacil l us. An operon for the production of the tetrahydrofolate co-enzyme (THF) was exposed by de Siazieu (1997, Microbiology 143: 979-989). It is also known that a 10-form? Ltetrah drofolate synthetase activity (ligase) and a 5, 10-methylenetetrahydrofolate dehydrogenase have been reported to exist in B. subtilis (Whitehead et al., 1988, Bacteriology 170: 995-997) and Saxild et al. (1994, Mol. Gen. Genet. 242: 415-420) have identified a 5'-phosphoribosyl-1-glycinamide (GAR) transformylase that catalyzes in a carbon transfer reaction in purine biosynthesis. This enzyme, the product of PurU l ocus, was found to be dependent on the formate added either in the growth medium or in vitro assays using cell-free extracts.

Therefore, there remains a need in the matter to optimize the gram-positive expression systems as well as the production of the products with this system can be increased.

Brief Description of the Invention Prior to the present invention, very little was known about the transport, use or cycle of the formate in gram-positive microorganisms. While studying the effect of different additives on the growth of a gram-positive microorganism, Bacillus, in flasks with agitation, a phenomenon of improvement in growth was observed when the addition of sodium formate to the medium was used. Also, the phenomenon of formic acid production during the endogenous fermentation of gram-positive microorganisms was observed in the absence of the exogenous formate.

The present invention is therefore based, in part, on the modification (s) in growth observed in gram-positive myororgams in the presence of endogenous or exogenous sodium formate. The present invention is also based on the evidence presented herein that the formate is transported in Bacillus by a "simport" transport mechanism. Accordingly, the present invention provides a method for modifying the growth of gram-positive microorganisms comprising the modification of formate transport in gram-positive microorganisms.

The present invention is also based, in part, on the modification and characterization of four Bacillus proteins that were found to be encoded by Bacill genomic nucleic acid sequences subtilis that appear to be associated with transport., utilization and formate cycle: the formate transport associated with protein 1 (FTAP1) and the formate transport associated with protein 2 (FTAP2) that have approximately 35- and 30 - identity, respectively, with the protein of E. Coli FocA, a protein that channels the formate; Bacill us subtili s PurtJ, which has approximately 48% identity at the amino acid level with PurU from E. Coli, an N10-formitetrahydrofolate hydrolase which is involved in the tetrahydrofolate and formyl tetrahydrofolate cycle, and a formylmethionine deformylase (FMD), which has approximately 40% similarity to formylmethionine deformylase (YkrB).

The present invention is further based on data demonstrating that in the presence of the exogenous formate, a cultured Bacill us cell in shake flask and having an interruption of the gene encoding FTAP1 exhibits approximately a 50% decrease in growth enhancement normally seen in the presence of exogenous formate. In the presence of the exogenous formate, a Bacillus cell grown in shake flask, and having an interruption of the gene encoding FTAP2 grows more slowly and the density of the culture declines over time. Thus, it appears that FTAP1 and FTAP2 are associated with the transport and utilization of formate in Bacill us.

Accordingly, the modulation of the expression of the molecules involved in the transport, utilization and cycle of the formate, for example, FTAP1, FTAP2, PurU, and FMD either individually or in combination with each of the other associated molecules, provides a means to regulate the levels of formate production in gram-positive microorganisms. It may be desirable to increase the expression of such molecules, decrease the expression of such molecules, or regulate the expression of such molecules, for example, to provide a means to express such molecules during a defined time of cell growth, depending on the type of gram-negative microorganisms. positive and desired culture conditions.

Accordingly, the present invention provides a method for increasing the production of a product in a gram-positive microorganism comprising the steps of obtaining a micro-organism capable of expressing the product and comprising a nucleic acid encoding either or both formates of i) transport of formate associated with protein 1 (FTAP 1) and ii) transport of formate associated with protein 2 (FTAP 2); and cultivating said micro-organism in the presence of the formate and ba or suitable conditions for expression of said product. The product naturally includes products that are obtainable from a gram-positive micro-organism, such as anti-microbial compounds, antibiotics, antigens, antibodies, surfactants, chemicals and enzymes, as well as products, such as proteins and polypeptides, which are encoded by recombinantly introduced nucleic acids.

In one aspect, the product is a recombinant protein. In one embodiment, the recombinant protein is homologous to said gram-positive microorganism and in another embodiment, the recombinant protein is heterologous to said gram-positive microorganism. In another aspect of the present invention, the gram-positive organism is a Bacillus and yet another embodiment, the Bacillus includes a B. Subtilis, B. Li chemformis, B. Lentus, B. Brevis, B. Stearothermophilus, B. Alkalophil us, B.

Amyloliquefaci ens, B. Coagulans, B. Circulans, B. Laautus and Bacill us thurigensis.

In one aspect of the present invention, the recombinant proteins include hormones, enzymes, growth factor and cytokines and in another, the enzyme does not include protease, lipase, amylase, pullulanase, cellulase, glucose isomerase, lactase and a disulfide isomerase protein.

Under a large scale of Bacillus fermentation conditions effected in the absence of the exogenous formate, an excess of the exogenous formate or "oversized" formate has been observed in the culture medium. Accordingly, it may be desirable to eliminate, mutate or otherwise interrupt the genes encoding FTAP1 and 2 in order to maintain adequate endogenous formate levels. Accordingly, the present invention provides a method for producing a product in a gram-positive microorganism comprising the steps of obtaining a gram-positive microorganism capable of expressing to said product said microorganism having a mutation in the nucleic acid encoding either one or both of FTAP1 and FTAP2 said mutation that results in the inhibition of the production in said microorganism of the activity of FTAP 1 and / or FTAP 2; and b) cultivating said micro-organism under suitable conditions for the expression of said product.

Furthermore, based on the total homology of the amino acid sequence of Bacillus PurU with E. Coli PurU, it appears that Bacillus PurU plays a role in the formant transupport by acting as an N10-formyltetrahydroofolate hydrolase. Saxild et al. (1994, Mol. Gen. Genet 242: 415-420) speculates that B. Ssubtilis can produce formate via deformylation of N10-formyl-THFA and N-formyl-methionine. Accordingly, under growth conditions where the excess of the exogenous formate appears to exceed the formate transport process, it may be desirable to remove, mutate or otherwise interrupt the gene encoding PurU from the gram-positive microorganism cell. in order to reduce the hydrolysis of N 1 -formyltetrahydrofolate, thereby increasing the formate remaining in the cell. It may also be desirable to increase the expression of PurU under certain cell growth conditions.

Furthermore, as illustrated below, the expression of PurU can also be metabolically regulated through the addition of glycine or methionine in the culture medium.

Accordingly, the present invention provides a method for producing a product in a gram-positive microorganism comprising obtaining a gram-positive microorganism capable of expressing the product and further comprising a mutation in the nucleic acid encoding PurU, said mutation giving as a result the inhibition of the production by said micro-organism of the activity of PurU; and cultivating said microorganism under conditions suitable for the expression of said product.

Based on the total homology of the sequence with Bacillus Def, it seems that gram-positive FMD plays a role in the modification of the starting methomines. Accordingly, modifying the expression of FMD in a gram-positive host cell under a large scale of fermentation conditions may be desirable. Accordingly, the present invention provides a method for increasing the production of a product in a gram-positive microorganism comprising the steps of obtaining a gram-positive microorganism capable of expressing said product; b modify the expression of FMD in said microorganism; and c) culturing said microorganism under conditions suitable for the expression of said product.

The present invention also provides expression vectors and gram-positive microorganisms comprising isolated nucleic acids encoding FTAP 1 and / or 2 and / or PurU and / or FMD. The present invention also provides gram-positive microorganisms that have a deletion or mutation of part or all of the nucleic acid encoding FTAP 1 and / or 2 and / or PurU and / or FMD.

The present invention also provides a method for the detection of homologous B. Subtilis FTAP1, FTAP 2, PurU or FMD polymorphonucleotides, which comprise hybridizing part or all of the nucleic acid sequence of B. Subtilis FTAP1, FTAP 2, PurU or FMD with nucleic acids of gram-positive microorganisms of either genomic or cDNA origin.

Brief description of the Figures Figures 1A-1C set forth the nucleic acid sequence SEQ ID NO: 1 and the amino acid sequence SEQ ID NO: 2 of FTAP 1 (YRHG).

Figures 2A-2C set forth the nucleic acid sequence SEQ ID NO: 3 and the amino acid sequence SEQ ID NO: 4 of FTAP 2 (YWCJ).

Figures 3A-3C set forth SEQ ID NO: 5 for nucleic acids and DEC ID NO: 6 for amino acids of PurU (YKKE).

Figures 4A and 4B set forth SEQ ID NO: 7 of nucleic acids and SEQ ID NO: 8 of amino acids of FMD (Def).

Figure 5 shows the comparison of growth and pH against time of Bacillus subtilis (BG125) growth of cultures in SBG at 1% with the addition or absence of regulator MOPS and 3 g / 1 of formate sodium.

Figure 6 shows changes in pH with the sequential addition of HCl over 1% SBG, 1% SBG and 80 mM MOPS, and 3 g / 1 formate and 1% SBG.

Figure 7 shows the comparison of the growth against the time of Bacillus subtilis (BG125) cultures of SBG at 1 with absence or addition of the formate to increase the concentrations.

Figure 8 shows the uptake of the formate by the cultures in fig. 5 as measured by HPLC as described in Material and Methods.

Figure 9 shows the production of acetic acid by the cultures of Figure 5 against the time measured by HPLC as described in Material and Methods.

Figure 10 shows the uptake of glucose by the cultures of Figure 5 measured by HPLC as described in Material and Methods.

Figure 11 shows the effect of the addition of trimethoprim on the growth of bacillus subtilis in 1% SBG with additives and the formate as indicated. The trimethoprim (drug) was added to 25 Klett where indicated.

Figure 12 illustrates an amino acid alignment of FTAP1 (YRHG) with EcopFlz.pl (comprising E. Coli FocA) SEQ ID NO: 9.

Figure 13 illustrates an amino acid alignment of FTAP 2 (YWCJ) with EcopFlz.pl.

Figure 14 illustrates an amino acid alignment of E. Coli PurU SEQ ID NO: 10 with B. Subtiliss PurU (YKKE).

Figure 15 illustrates a schematic representation of molecules associated with transport formate, disablement, utilization and cycling in gram-positive microorganisms.

Figure 16 illustrates the effect of the interruption (int.) Of the yrhG gene on the cell growth of BG125. The cells containing the gene disruption were developed in 1% SBG containing 3 g / 1 of the formate and kanamycin as indicated. The growth was determined as described in Material and Methods.

Control (-C-) Formiato (?) YwcJ int. (...or... ) and cj int. + formate (?) ywcj int + kan (D) ) ywcj int. + formate + kan (0).

Figure 17 illustrates the effect of the interruption (int.) Of the ywcj gene on the cell growth of BG125. The cells containing the gene disruption were developed in 1% SBG containing 3 g / 1 of the formate and kanamycin as indicated. The growth was determined as described in Material and Methods. Control (- X.-) Formiato (®) ywcJ int. (...or... ) ywcj int. + formate (?) ywcj int + kan (D) ) ywcj int. + formate + kan (0).

Detailed Description of the Invention Definitions As used herein, the term "genus Bacillus" includes any member known to those skilled in the art, including but not limited to B. Subtilis, B. Licheniformis, B. Lentus, B. Brevis, B. Stearothermophilus, B. Amylolíquefaciens, B. Ccoagulans, B. Ciculans, B. Lautus and B. Thurigiensis.

The present invention encompasses FTAP 1, FTAP 2, PurU and FMD of gram-positive microorganisms. In a preferred embodiment, the gram-positive organism is a Bacillus. In another preferred embodiment, the gram-positive organism is Bacillus subtilis. As used herein "FTAP 1, FTAP 2, PurU and FMD of Bacillus subtilis" refer to "the amino acid sequences set forth in Figures 1, 2, 3, and 4 respectively and designated as YRHG, YWCJ, YKKE and DeF, respectively The present invention encompasses amino acid homologs of the amino acid sequences of FTAP 1, FTAP 2, PurU and FMD of Bacillus subtilis, for example, variations of the amino acid sequences set forth in Figures 1, 2, 3 and 4 , which retain functional abilities and are mentioned herein as FTAP 1, FTAP 2, PurU and FMD.

As used herein, "nucleic acid" refers to a sequence of nucleotides or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be double filament or single filament, and whether it represents the filament in the sense or antisense. As used herein, "amino acid" refers to peptide or protein sequences or portions thereof. A "homologous polynucleotide" as used herein refers to a gram-positive polynucleotide microorganism having at least 80%, at least 85%, at least 90? and at least 95 ° - identity with FTAP 1, FTAP 2, PurU or FMD of Bacillus subtilis, or which is capable of hybridizing to FTAP1 and 2, PurU or FMD of B. Subtilis under conditions of high severity.

The terms "isolated" or "purified" as used herein refers to a nucleic acid or protein or peptide that is stripped of at least one component with which it is naturally associated. In the present invention, an isolated nucleic acid can include a vector comprising the nucleic acid.

As used herein, the term "product" is repeated to any product as it is naturally found or that is introduced recombinantly obtainable from the gram-positive micro-organism, eg, protein, polypeptide, peptide, chemical, and that includes but is not limited to antimicrobial compounds, antibiotics, antigens, antibodies, surfactants, chemicals and enzymes. A recombinant protein is one that is encoded by a nucleic acid that has been introduced into the microorganism. The nucleic acid can be introduced into an expression vector having indicators capable of expressing the protein encoded by the introduced nucleic acid or the nucleic acid can be integrated into the chromosome of the microorganism. The recombinant protein can be heterologous to the microorganism or homologous to the micro-organism. As used herein, the term "heterologous protein" refers to a protein or polypeptide that is not naturally found in a gram-positive host cell. Examples of heterologous proteins include enzymes, such as hydrolases that include proteases, amylases, carbohydrases, and lipases; isomerases such as racemases, epimerases, tautomerases, or mutases; transferases, kinases and phosphatases. The heterologous gene can encode proteins or Ak &tti therapeutically significant peptides, such as growth factors, cytokines, ligands, receptors and inhibitors, as well as vaccines and antibodies. The gene can encode industrial proteins or commercially important peptides, such as proteases, carbohydrases such as amylases and glucoamylases, cellulases, oxidases and lipases. The gene of interest may be a naturally occurring gene, a mutated gene or a synthetic gene.

The term "homologous protein" refers to a native protein or polypeptide or as naturally found in a gram-positive host cell. The invention includes host cells that produce the homologous protein via recombinant DNA technology. The present invention encompasses a gram-positive host cell having a deletion or interruption of the nucleic acid encoding the homologous protein as naturally found, such as a protease, and having nucleic acid encoding the homologous protein re-introduced into the a recombinant form. In another embodiment, the host cell produces the homologous protein.

It is well understood in the art that formate can exist in a variety of ionization states that depend on the surrounding medium, either in solution, or outside the solution in which they are prepared or in solid form. The use of a term, such as, for example, formic acid, to designate such molecules is intended to include all ionization states of the organic molecule to which it is referred. Thus, for example, both "formic acid" and "formate" refers to the same portion, and do not attempt to specify particular ionization states.

Description of the Preferred Modalities Transport of formate in Bacillus A growth enhancement phenomenon observed when sodium formate was added to the Bacillus subtilis culture flasks revealed information on the mechanism of formate transport within the cell. The total cell density was much higher and the culture was able to maintain its growth rate for a longer period of time. The improvement of the growth of the formate was correlated with the prevention of the normal slope in pH until levels lower than 6 during the growth in medium SBG at 1%. Sodium formate concentrations ranging from 3 g / 1 (44 mM) to 21 g / i (308 M) produced a similar effect for total growth improvement. Nevertheless, while 3 g / 1 of sodium formate caused only a slight delay in the initial rate of growth, the delay became more pronounced with increased formate concentrations. The growth of B. Subtilis in SBG at 1% was accompanied by the production of acetate, the probable cause of the fall of normal pH and the fall in the growth rate. Experiments with the MOPS regulator showed that the growth enhancement due to the formate was duplicated to a large extent by the control of pH with a regulator. It was observed that the formate uptake of the medium started during the exponential growth of the beginning and was completely removed before beginning the stationary phase for both formate and formate flasks plus MOPS. In addition, the formate and formate flasks plus MOPS showed an improvement in acetate production compared to the control and control flask plus MOPS. Despite the highest concentration of acetic acid, the pH of the formate flask did not fall to levels below 6.. The proportion of glucose captured was identical in the formate, formate plus MOPS, and MOPS flasks, which suggests that the increased production of acetate by the formate is at some stage related to glucose metabolism and not to glucose transport. It seems that the control of pH by the formate is due to a "simport" transport of formate inside the cell with the removal of protons from the medium. Studies using tpmetoprim shown in the Examples suggest that the transported formate requires synthesis of tetrahydrofolate to prevent the rate of growth from slowly decreasing.

II. Sequences of FTAP 1 and 2, PurU and FMD The FTAP 1, FTAP 2, PurU and FMD polynucleotides having the sequences as shown in the figures encode Bacillus subtilis FTAP 1, FTAP 2, PurU and FMD. As it is understood by those skilled in the art, due to the degeneracy of the genetic code, a variety of polynucleotides can encode FTAP 1, FTAP2, PurU and FMD from Bacillus subtilis. The present invention encompasses all the mentioned polynucleotides.

The DNA can be obtained by standard procedures known in the art from, for example, cloned DNA (for example a DNA "pool"), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments of DNA. This one, purified from a desired cell. (See, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, Glover, DM (ed.) 1985, DNA Cloning: a Practical Approach, MRL Press, Ltd, Oxford, UK Vol. I, II.) A preferred source is genomic DNA. The sequences of nucellic acids derived from genomic DNA may contain regulatory regions in addition to coding regions. Whatever the source, the gene of FTAP 1, FTAP 2, PurU or FMD isolated could be molecularly cloned into a suitable vector for the propagation of the gene.

In the molecular cloning of the gene from the genomic DNA, fragments of DNA are generated, some of which will encode the desired gene. The DNA can be divided into specific sites using several restriction enzymes. Alternatively, one can use DNAse in the presence of manganese to fragment the DNA, or the DNA can be physically cross-linked, as for example, by somation. The linear DNA fragments can then be separated according to size by X 'techniques standards, including but not limited to, electrophoresis on agarose and polyacrylamide gel and column chromatography.

Once the DNA fragments are generated, the identification of the specific DNA fragment containing the FTAP 1, FTAP 2, PurU or FMD can be achieved in a number of ways. For example an FTAP 1, FTAP 2, PurU or FMD gene of the present invention or its specific RNA, or a fragment thereof, such as a test or primer, can be isolated and labeled and then used in hybridization assays to detect a FTAP 1, FTAP 2, PurU or FMD gene generated. (Benton, W. and Davis, R. 1977, Science 196: 180, Grunstein, M. and Hogness, D., 1975, Proc. Ati.Acid Sci. USA 72: 33961). DNA fragments that substantially cut the similarity of the sequence in the primer will hybridize under severe conditions.

The present invention encompasses homologous FTAP 1, FTAP 2, PurU and FMD polynucleotides encoding FTAP 1, FTAP 2, PurU and FMD of gram-positive microorganisms respectively, which is at least 80%, or at least 85. , or at least 90, or at least 95% identity with FTAP 1, FTAP 2, PurU and FMD obtainable from B. Subtilis while the homologue encodes a protein that retains a functional activity.

Homologs of polynucleotides of Graam positive microorganisms of B. subtilis can be identified through the hybridization of the nucleic acid of gram-positive microorganisms of either genomic or cDNA origin. The homologous sequence of polynucleotides can be detected by hybridization of DNA-DNA or DNA-RNA or amplification using tests, portions or fragments shown in the figures. Therefore, the present invention provides a method for the detection of FTAP 1, FTAP 2, PurU or FMD from B. subtilis with nucleic acid from gram-positive microorganisms of either genomic or cDNA origin.

Also included in the scope of the present invention are polynucleotide sequences of gram-positive microorganisms that are capable of hybridizing to the nucleotide sequence of FTAP 1, FTAP 2, PurU or FMD of B. subtilis under intermediate conditions at maximum severity. Hybridization conditions are based on the melting temperature (Tm) of the nucleic acid that binds to the complex, as shown in Berger and Kimmel (1987, Guide to Molecular * • &- "Cloning Techniques, Methods in Enzymology, Vol. 152, Academic Press, San Diego CA) incorporated herein by reference, and confers a definite" severity "as explained below.

"Maximum severity" typically occurs at approximately Tm - 5 ° C (5 ° C below the Tm of the test); "high severity" at approximately 5 to 10 ° C below Tm; "intermediate severity" at about 10 ° C to 20 ° C below Tm; and "low stringency" at about 20 ° C to 25 ° C below Tm. As will be understood by those skilled in the art, a hybridization of the highest severity can be used to identify or detect homologues of sequences of polmucleotide sequences.

The term "hybridization" as used herein will include "the process by which a nucleic acid strand together with a complementary strand traverses a base pair" (Coombs J (1994) Dictíonary of Biology, Stockton Press, New York, NY ).

The amplification process as carried out in the polymerase chain reaction (PCR) technology is described in Diffenbach CW and GS Dveksler (1995, PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview NY). A nucleic acid sequence of at least about 10 nucleotides and as many as about 60 nucleotides of FTAP 1, FTAP 2, PurU or FMD B. Subtilis preferably about 12 to 30 nucleotides, and more preferably about 20-25 nucleotides can be used as a test or PCR primer.

The amino acid sequences of FTAP 1, FTAP 2, PurU and FMD of B. subtilis (shown in Figures 1, 2, 3 and 4 respectively) were identified via a FASTA investigator of genomic nucleic acid sequences from Bacillus subtilis. The present invention encompasses amino acid variants of gram-positive micro-organisms of FTAP 1, FTAP 2, PurU and FMD of B. Subtilis which are at least 80 L identical, at least 85% identical, at least 90 identical and at least 95 % identical to FTAP 1, FTAP 2, PurU and FMD of B. Subtilis while amino acid sequence variants retain functional activity.

III. Expression Systems The present invention provides host cells, expression methods and systems for the production and enhanced secretion of heterologous and homologous proteins in gram-positive microorganisms. In one embodiment, a host cell is genetically engineered to have a deletion or mutation in the gene encoding a FTAP 1, FTAP 2, PurU or gram-positive FMD such that the respective activity is eliminated. In another embodiment of the present invention, a gram-positive microorganism is genetically engineered to increase the levels of FTAP 1, FTAP 2, PurU or FMD, or other molecules associated with the transport, utilization or cycling of the formate.

Inactivation of FTAP 1 6 2 6 PurU in a host cell The production of an expression of a gram-positive microorganism in a host cell incapable of producing the formate as it is naturally associated with the protein necessitates the replacement and / or inactivation of the gene as it naturally occurs from the genome of the host cell. In a preferred embodiment, the mutation is a non-reversible mutation. - .. j ^ One method for mutating the nucleic acid encoding a gram-positive formate associated with a protein is to clone the nucleic acid or part of it, modify the nucleic acid by site-directed mutagenesis, and reintroduce the mutated nucleic acid into the cell on a plasmid. By homologous recombination, the mutated gene can be introduced into the chromosome. In the host host cell, the result is that the nucleic acid as found naturally and the mutated nucleic acid are placed in tandem on the chromosome. After a second recombination, the modified sequence is on the left in the chromosome which has thus effectively introduced the mutation in the chromosomal gene for progeny of the host host cell.

Another method to inactivate the activity is by eliminating the copy of the chromosomal gene. In a preferred embodiment, the complete gene is eliminated, the elimination takes place in such a way that making the inversion is impossible. In another preferred embodiment, a partial deletion is produced, provided that the left nucleic acid sequence in the chromosome is also shortened by homologous recombination with a plasmid encoded by the FTAP 1, FTAP 2, PurU and FMD gene. In another preferred embodiment, the nucleic acid encoding the catalytic amino acid residues are removed.

The elimination in the gram-positive microorganisms of the transport, utilization and cycle of the formate associated with proteins can be carried out as follows. A gene encoding a protein-associated formate that includes its 5 'and 3' regions is isolated and inserted into a cloning vector. The coding region of the gene is removed from the vector in vitro, leaving behind a sufficient amount of the 5 'and 3' side sequences to provide homologous recombinations with the gene as naturally found in the host host cell. The vector is then transformed into the gram-positive host cell. The vector is integrated into the chromosome via homologous recombination in the lateral regions. This method leads to a gram-positive strain in which the formate associated with the gene has been eliminated.

The vector used in an integration method is preferably a plasmid. A selectable marker can be included to facilitate the identification of recombinant microorganisms. Additionally, as will be appreciated by one skilled in the art, the vector is preferably one that can be selectively integrated into the chromosome. This can be achieved by introducing an inducible replication origin, for example, a temperature-sensitive origin in the plasmid. By growth of the transporters at a temperature at which the replication origin is sensitive, the replication function of the plasmid is inactivated, thereby providing a means of selection of the chromosomal integrants. The members can be selected by growth at high temperatures in the presence of a selectable marker, such as an antibiotic. The integration mechanisms are described in WO 88/06623.

Integration by the Campbell-type mechanism can take place in the lateral 5 'region of the protease gene, resulting in a Gram-positive protease strain that drives the complete vector plasmid to the chromosome in the formate-associated locus protein. Since illegitimate recombination will give different results, it will be necessary to determine if the complete gene has been eliminated, those that form restriction sequences or maps through the nucleic acids.

Another method of inactivating the gene as it is naturally found is to mutate the copy of the chromosomal gene by Z transformation of a gram-positive microorganism with oligonucleotides that are mutagenic. Alternatively, the chromosomal gene can be replaced with a mutant gene by homologous recombination. The present invention encompasses host cells that have deletions or additional mutations of proteases, such as deletions or mutations in apr, npr, epr and others known to the person skilled in the art.

IV. Production of FTAP 1, FTAP 2, PurU or FMD For the production of FTAP 1, FTAP 2, PurU or FMD in a host cell, an expression vector comprising At least one copy of nucleic acid encoding FTAP 1, FTAP 2, PurU or FMD in a gram-positive microorganism, and preferably comprising multiple copies, is transformed into the host cell under conditions suitable for the expression of the protein.

In accordance with the present invention, the polynucleotides that encode an FTAP1, FTAP2, PurU or fragments thereof in a gram-positive microorganism, or sequences of homologous polynucleotides or fusion proteins that encode variants of amino acids of FTAP 1, FTAP 2, PurU or FMD in B. Subtilis " r ^ a that retain the activity can be used to generate recombinant DNA molecules which direct their expression in host cells. In a preferred embodiment, the host cells of gram-positive microorganisms belong to the genus Bacillus. In another preferred embodiment, the gram positive host cell is B. Subtilis.

As will be understood by the person skilled in the art, it may be advantageous to produce polynucleotide sequences which possess codons not as they are naturally found. Codons preferred by a particular gram-positive host cell (Murray E et al. (1989) Nuc Acids Res 17: 477-508) can be selected, for example, to increase the rate of expression or to produce recombinant RNA transcripts that have desirable properties, such as a long half-life, said transcripts produced from a sequence as found naturally.

Polynucleotide sequences of FTAP 1, FTAP 2, PurU or FMD which can be used according to the invention include deletions, insertions or substitutions of different nucleotide residues which result in a polynucleotide encoding the same or a functionally equivalent FTAP 1, FTAP 2, PurU or FMD homolog, respectively. As used herein, "deletion" is defined as a change in either a nucleotide or amino acid sequence in which one or more nucleotide or amino acid residues, respectively, are absent.

As used herein an "insert" or "addition" is the change in a nucleotide or amino acid sequence that results in the addition of one or more nucleotide or amino acid residues, respectively, in comparison to the protein as It is naturally.

As used in the present "substitution" it is the result of the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids, respectively.

The encoded protein may also exhibit deletions, insertions or substitutions of amino acid residues that produce a stealthy change and re-release a variant of FTAP 1, FTAP 2, PurU or FMD functionally. Deliberate amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the antipathetic nature of the residues as well as the variants retain the ability to modulate secretion. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with non-charged polar head groups having similar hydrophilicity values include leucma, ísoleucma, valine; glycine; alamna; aspargma; glutamine; serine; threonine; phenylalanine and tyrosine.

The FTAP 1, FTAP 2, PurU or FMD polucleotides of the present invention can be designed to modify the cloning, process and / or expression of the product gene. For example, the mutations can be by ducts using techniques that are known in the art, for example mutagenesis in site-directed to insert new restriction sites, alter glycosylation patterns or change the preference of codons, for example.

In one embodiment of the present invention, a FTAP 1, FTAP 2, PurU or FMD polymorphid of gram-positive microorganism can be ligated to a heterologous sequence to encode a fusion protein. A fusion protein can also be designed to contain a division site located between the nucleotide sequence of FTAP 1, FTAP 2, PurU or FMD and the sequence of heterologous proteins, as well as the protein can be divided and purified away from the portion Heterologous V. Vector sequences The expression vectors used to express the proteins of the present invention in gram-positive microorganisms comprise at least one promoter associated with a protein selected from the group consisting of FTAP 1, FTAP 2, PurU and FMD, said promoter is functional in the cell Guest. In one embodiment of the present invention, the promoter is the wild-type promoter for the selected protein and in another embodiment of the present invention, the promoter is heterologous to the protein, but still functional in the host cell. In a preferred embodiment of the present invention, the nucleic acid encoding the protein is stably integrated or otherwise stably maintained in the genome of the microorganism.

In a preferred embodiment, the expression vector contains a multiple cloning site cartridge that preferably comprises at least one unique endonuclease restriction site in the vector, for nucleic acid manipulation facilities. In a preferred embodiment, the vector also comprises one or more selectable markers. As used herein, the term "selectable marker" refers to a gene capable of expression in the gram-positive host that takes into account the ease of selection of the hosts that contain the vector. Examples of such selectable markers include but are not limited to antibiotics, such as erythromycin, actinomycin, cyclophenicol, and tetracycly.

SAW. Transformation A variety of host cells can be used for the production of FTAP 1, FTAP 2, PurU and FMD including bacteria, fungi, mammals and insect cells. General transformation procedures are discussed in Currents Protocols in Molecular Biology, vol. 1, edited by Ausubel et al., John Wiley & Sons, Inc. 1987, chapter 9 and include methods of calcium phosphate, transformation using DEAE-Dextran and. electroporation The transformation methods of plants are discussed in Rodriguez (WO 95/14099, published on May 26, 1995).

In a preferred embodiment, the host cell is a gram-positive microorganism and in another preferred embodiment, the host cell is Bacillus. In one embodiment of the present invention, the nucleic acid encoding one or more proteins of the present invention is introduced into a host cell via an expression vector capable of replicating in the host cell Bacillus. Replication plasmids suitable for Bacillus are described in Molecular Biological Methods for Bacillus, Ed. Harwood and Cutling, John Wiley Sons, 1980, expressly incorporated herein by reference; see Chapter 3 on plasmids. Replication plasmids suitable for B. Subtilis are listed on page 92.

In another embodiment, the nucleic acid encoding a protein of the present invention is stably integrated into the genome of the microorganism. Preferred host cells are gram-positive host cells. Another preferred host is Bacillus. Another preferred host is Bacillus subtilis. Several strategies have been described in the literature for the direct cloning of DNA in Bacillus. The transformation of the plasmid that releases the marker involves the uptake of a donor plasmid by competent cells carrying a partially homologous resident plasmid (Contente et al., Plasmid 2: 555-571 (1971); Haima et al., Mol. Gen. Genet. 223: 185-191 (1990), Weinrauch et al, J. Bactenol 154 (3): 1077-1087 (1983), and Weinnrauch et al., J. Bactenol 169 (3): 1205-1211 (1987); ). The incoming donor plasmid recombines with the homologous regions of the "auxiliary" plasmid resident in a process that mimics chromosomal transformation.

Transformation by protoplast transformation is described by B. Subtiiis in Chang and Cohen, (1979) Mol. Genet 168: 111-115; by B. Mega teri um in Vorob eva et al., (1980) FEMS Microbiol. Letters 7: 261-263; by B. Amyl oliq? Efaciens in Smith et al. (1986) Appl. And Env. Microbiol. 51: 634; by B. Th urigi ensi s in Figher et al., (1981) Arch.

Microbiol. 139; 213-217; by B. Sphaep cus in Me Donald (1984) J. Gen. Microbiol. 130: 203; and B. Larvae in Bakhiet et al., (1985) 49: 577. Mann et al., (1986, Current Microbiol.13: 131-135) report on transformation of Bacillus protoplasts and Holubova (1985) Folia Microbiol. 30: 97) discloses methods for introducing DNA into protoplasts using DNA containing liposomes.

VII. Identification of Transformants If a host cell has been transformed with a mutated or naturally occurring gene encoding an FTAP 1, FTAP 2, PurU or FMD, detection of the presence / absence of the expression gene marker may suggest that the gene of interest is present however the expression would be confirmed. For example, if the nucleic acid encoding an FTAP 1, FTAP 2, PurU or FMD is inserted into a marker gene sequence, recombinant cells containing the insert can be identified by the absence of the marker gene function. Alternatively, a marker gene can be placed in tandem with a nucleic acid encoding FTAP1, FTAP 2, PurU or FMD under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of FTAP 1, FTAP 2, PurU and FMD as well.

Alternatively, host cells that contain the sequence encoding an FTAP 1, FTAP 2, PurU and FMD and expresses the protein can be identified by a variety of procedures known to those skilled in the art. These methods include, but are not limited to, DNA-DNA or DNA-RNA hybridization and protein assay or immunoassay techniques which include membrane-based, solution-based, or fragment-based technologies for the detection and / or quantification of nucleic acid or protein.

The presence of the polynucleotide sequence can be detected by hybridization or DNA-DNA or DNA-RNA amplification using tests, portions or fragments of FTAP 1, FTAP 2, PurU or FMD of B. Subtilis.

VIII. Secretion of Recombinant Proteins Means for determining the secretion levels of a heterologous or homologous protein in a gram-positive host cell and of detecting secreted proteins include, using polyclonal or monoclonal antibodies specific for the protein. Examples include enzyme-linked immunosorbent assays (ELISA), radioin unassays (RIA) and separation of fluorescent activated cells (FACS). These and other tests are described, among other parts, at Hampton R.

Y collaborators (1990), Serological Methods, a Laboratory Manual, APS Press, St. Paul MN) and Maddox DE et al. (1983, J. Exp. Med. 158: 1211).

A wide variety of labeling and conjugation techniques are known to those skilled in the art and can be used in various amino acid and nucleic acid assays. Means for producing labeled hybridization or PCR tests for detecting specific polynucleotide sequences include oligolabeling, fragment translation, end labeling or PCR amplification using a labeled nucleotide. Alternatively, the nucleotide sequence, or any portion thereof, can be cloned into a vector for the production of an mRNA test. Such vectors are known in the art, are commercially available, and can be used to synthesize in vitro RNA tests by addition of an RNA polymerase such as T7, T3 or SP6 and labeled nucleotides.

A number of companies such as Pharmacia Biotech (Piscataway NJ), Promega (Madison Wl), and US Biochemical Corp (Cleveland OH) supplies commercial equipment and protocols for these procedures. Suitable reporter molecules or labels include radionucleotide, enzymatic, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like. Patents that disclose the use of such labels include US Patent 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; 4,366,241. Also recombinant immunoglobulins can be produced as set forth in U.S. Patent Nos. 4,816,567 and incorporated herein by reference.

IX. Protein Purification Gram positive host cells transformed with polynucleotide sequences that encode heterologous or homologous proteins can be cultured under conditions suitable for the expression and recovery of the encoded protein from the culture cell. The protein produced by a recombinant gram positive host cell comprising an FTAP 1, FTAP 2, PurU and FMD of the present invention will be secreted into the culture medium. Other recombinant constructs can join the sequences of polynucleotides heterologous or homologous to the nucleotide sequence encoding a polypeptide region which will facilitate the purification of soluble proteins (Kroll Í > J et al. (1993) DNA Cell Biol 12: 441-53 ).

Such regions that facilitate such purification include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals.

(Porath J (1992) Protein Expr Purif 3: 263-281), regions A of proteins that allow purification on an immobilized immunoglobulin, and the region used in the purification system affinity / extension FLAG (Inmunex Corp, Seattle WA). The inclusion of a divisible binding sequence such as Factor XA or enterokinase (Invitrogen, San Diego CA) between the purification region and the heterologous protein can be used to facilitate purification.

X. Uses of the Present Invention FTAP1, FTAP 2, PurU and FMD and genetically engineered host cells The present invention provides genetically engineered gram positive micro organisms that preferably comprise mutations or non-deletions. -aift & - ftí-- -5 ?? - 8 »reversible in the gene as it is naturally encoding FTAP1, FTAP 2, PurU or FMDtales that the activity is diminished or eliminated altogether.

In another embodiment, the microorganism is further engineered to produce a recombinant protein or pellipeptide. In a preferred embodiment, the host cell is a Bacillus. In another preferred embodiment, the host cell is a Bacillus subtilis.

In an alternative embodiment, a host cell is genetically engineered to produce a FTAP 1, FTAP 2, PurU or gram-positive FMD. In a preferred embodiment, the host cell is developed under large scale fermentation conditions, FTAP 1, FTAP 2, PurU or FMD is isolated and / or purified.

Polynucleotides FTAP 1, FTAP 2, PurU and FMD An FTAP 1, FTAP 2, PurU or FMD polynucleotide from Bacillus subtilis, or any part thereof, provides the basis for detecting the presence of homologous polymorphonuclei from gram-positive micro-organisms through hybridization techniques and PCR technology.

Accordingly, one aspect of the present invention is to provide for nucleic acid hybridization and PCR assays that can be used to detect polynucleotide sequences, including cDNA and genomic sequences, that encode FTAP 1, FTAP 2, PurU or FMD gram positive or portions of these.

All publications and patents mentioned in the above specification are incorporated herein by reference. Various modifications and variations of the described methods and systems of the invention will be obvious to those skilled in the art without departing from the scope and spirit of the invention. Although the mention has been described in connection with preferred embodiments, it would be understood that the invention as claimed would not be unduly limited to such specific modalities. Actually, various modifications of the embodiments described for carrying out the invention that are obvious to those skilled in molecular biology or related fields are within the scope of the following claims.

EXAMPLES Materials and methods Strains and bacterial media The Bacillus subtilis strain used was a derivative of 168 called BG125 (hisAl thrS trpC2) provided by J. A. Hoch. The strain was developed on Luria-Bertam agar (LA 1 of SBG medium containing the following: soy broth, Difco, 10 g / L, glucose, Sigma, 10 g / L, yeast extract, Difco, 5 g / L, NaCl, Norton, 10 g / L, pH 7.0, 1 of SBG plus MOPS, Sigma, contained in 80 mM of MOPS pH 7.0 Sodium formate, EM Science, at various concentrations were added to SBG at 1 ° >The pH of all media was adjusted to 7 with NaOH.The growth media for bacterial formate tests was SBG at 1 E supplemented with 50 mM of MES, Sigma, 50 mM of HEPES, Sigma, followed by pH adjustment to the indicated pH value with either HCl or NaOH The formic acid was then added to a final concentration of 50 mM which did not result in changes in the pH of the growth medium Competent MM294 cells (Ausubel et al. 1992, Short Protocols in Molecular Biology, John Wiley and Sons, New York) were used for the processing and propagation of plasmids. LB and agar were used to develop the MM294 cells and were supplemented with 50 μg / ml of carbenicillm for selection, the BG125 were developed on LB agar or in liquid LB medium supplemented with 10 μg / ml of kanamycin for selection.

Tpmetoprim was dissolved in 50% ethanol and added to a final concentration of 50 μg / ml where it was indicated when the growth reached a Klett reading between 20-30 units. Additions for experiments with tpmetoprim were added to the following final concentrations: 10 μg / ml glycine, 10 μg / ml methionine, 50 μg / ml thymidine, 20 μg / ml adenosm, and 20 μg / ml guanosine .

DNA manipulations Extraction of the chromosomal DNA, extraction of the plasmid DNA, extraction of the DNA fragment and PCR clearance of the gel were carried out using the QIAGEN Blood & the Cell Culture DNA team, the QIAprep Spin Miniprep team, the QIAquick PCR purification team and the QIAquick gel extraction equipment respectively. The enzymatic amplification of «8» f-rf • DNA by PCR was in accordance with the standard protocol. Restriction endonuclease digestion and DNA ligation were performed as specified by the manufacturers. The identity of the DNA sequence investigated for 'yrhG (FTAP 1) and ywcJ (FTAP 2) was carried out using the GCG (Genetic Computer Group) computer program.

Construction of the Plasmid The cloning vector used in this study was a passage vector pUC / Ts / Kan, E. Coli B. subtypes. The plasmid consists of plasmid pUC19, the origin of temperature-sensitive replication plasmid pE194Ts derived from Staphylococcus aureus (Fleming et al., 1995, App. Env.Microb.61: 3775-3780), and the kanamycin gene of Streptococcus faecalis ( Trieu-Cuot et al., 1983, Gene 23: 331-341).

A 0.438-Kb DNA segment of the yrhG gene was amplified from the BG125 chromosomal DNA of B. Subtilis by PCR using Taq DNA polymerase (Boehr ger Mannheim), and the oligonucleotide primer GCGCGCGGATCCGTAATTGGATCTTCCGAAAGAATGG (SEQ ID No. 11) and GCGCGCCTGCAGGGAACCAGATGCCAAGGATTTTTCC (SEQ ID No. 12) (the BamHl and E * S 1 eÉftán sites underlined). The product obtained by PCR was digested with BamHl and Pstl and ligated with the BamHl-Pstl d @ fragment, 5.3 Kb from the pUC / Ts / Kan plasmid to construct the plasmid with pTRANSl with the yrthG-homologous interruption. Plasmid pTRANS2 was constructed in a similar manner by amplification of a 0.543 kB DNA of the ywcj gene using the Taq DNA polymerase and the oligonucleotide primers GCGCGCGGATCCTTGGTTTTGGCATTACAGCCGR (SEQ ID: 13) and GCGCGCCTGCAGAGGGTGCTCGATCAAAAGCGAGATGG (SEQ ID No. 14) (the BamHl and Pstl sites are underlined). The PCR product was digested with BamHl and Pstl and ligated with the 5.3 Kb BamHl-Pstl fragment of the pUC / Ts / Kan plasmid to construct the plasmid with the interruption ywc-homology. The formation of the DNA sequence was performed on both plasmids with interruption pTRANSl and pTRANS2 to verify the presence of the fragment generated by correct PCR using a 373A DNA sequence former from Applied Biosystems. The sequence-forming primers used were reverse sequence forming primer mpl9 / pUC19 24-mer and the sequence forming primer mpl9 / pUC19 24-mer from New England Biolabs.

Introduction of gene breaks in B. Subtilis In the construction of strain B. subtilis containing an interruption of either the yrhG or ywcJ gene, pTRANSl and pTRANS2 were separately transformed into BG125 by protoplast transformation as described (Chang et al., 1979, Mol. Gen. Genet. 168: 11-115) and plated on medium for protoplast regeneration with 200 μg / ml kanamycin at 30 ° C. Resulting kanamycin resistant transformants that were developed overnight in liquid medium LB containing kanamycin at 45 ° C. The isolated colonies were then frozen in liquid medium LB plus glolol at 30. a - 70 ° C for preservation.

Growth conditions Before shaking the experiment flask the BG125 were developed from the frozen stock on LB agar and grown overnight at 37 ° C. The cells were removed from the plates to 6 ml of SBG to 1 l in test tubes and grown at 37 ° C for three hours. 0.2 ml of the seeded culture was used to inoculate a pre-heated nephelometer flask containing 20 ml of the appropriate medium. The flasks were incubated at 37 ° C (except where indicated) and at 300 rpm in a New Brunswick Scientific Agitator. To a certain period of time, the amount of growth cells was determined by the Klett-Summerson Photoelectric Colorimeter method, the pH of the flask was taken using a Corning pHimetre, and 1.25 ml were removed by further processing. The sample was centrifuged in an eppendorf microcentrifuge and 1 ml of the supernatant was removed and mixed with 30 μls of perchloric acid for HPLC analysis. The remaining supernatant was separated by analysis with glucose. All samples were stored at -70 ° C until analysis. The pH titrations of the medium were carried out by stepwise addition of HCl followed by pH measurement. The bacteriological tests of pH and for on B. subtilis were carried out by growth of BG125 as described above in SBG at 1 at a density of 5 X 10"cfu / ml.The cells were then adjusted to a concentration of 5 X 104 cfu / ml regulated with 1% SBG adjusted to the indicated pH, with and without 50 mM formate.The cultures were then incubated at 37 ° C with shaking for 3 hours.The samples were taken at, 2 and 3 hours, .. "i. diluted in series and placed in plates of LB at 37 ° C for determination of cellular feasibility.

Analysis of metabolic by-products.

One ml of supernatant of the culture treated with acid was filtered through a 0.2 μm membrane filter.

The concentrations of the metabolic by-products were determined by high performance liquid chromatography (HPLC). A Shodex SH1011 cation exchange column heated to 50 ° C was used. The solvent (used was 5 mM sulfuric acid (H2S04) at an expense of 0.4 ml / min.) The HPLC system consisted of a Waters model 510 pump with an SSI impulse damper model LP-21, a refractive index detector ( Rl) Waters model 410 Differential Refactometer, a Waters model WISP 712 autoinjector that injects, injections of 20 μl per sample HPLC was mapped with a Millenium 2.15.01 HPLC control system for mobile phase flow control, integration, and collection and storage of data To identify different peaks, they were run standard and compared to the peaks in the samples.The standards ranged were: acetoin, acetic acid, 2, 3-butanediol, butyric acid, citric acid, formic acid, ethanol, fumaric acid, malic acid, glycerol, lactic acid, propionic acid, and pyruvic acid, all from Sigma.

Example I Example I illustrates that the addition of formate increases growth by pH control.

BG125 was developed as described in Materials and Methods. In 1 ° SBG medium (pH 7) with and without 3 g / 1 (44 mM) of sodium formate, the addition of sodium formate results in more total growth compared to the control flask and taambien acted to prevent the pH drop of the shake flask to levels lower than 6.5 while the pH control flask dropped to 5.5 (Fig. 5). With a pKa of 3.73, the formate would have little regulatory activity at an initial pH of 7. To eliminate any regulatory effect of our medium, a pH titration experiment was carried out with SBG at 1 o, and the SBG to 1 containing either 3 g / 1 sodium formate or 80 mM MOPS. Fig. 6 shows that in SBG to 1 , and SBG at 1 with sodium formate there is little regulatory activity lower than pH 5.0. SBG medium at 1 ~ containing MOPS (pKa 7.20) showed regulatory activity in the expected range, when the BG125 was developed in 1% SBG containing 0 mM MOPS, which prevented a pH drop to levels below 6.3 , the growth of the strain was close to the njKÉ¡ $. & s of the flask containing formate (figure 5). In addition, a flask containing MOPS plus formate developed almost identically to the MOPS flask (Fig. 5).

Example II Example II illustrates that the increase in formate concentrations causes a delay in the initial growth rate.

When using 3 g / 1 of sodium formate, a slight delay in the initial growth rate was observed. For further investigation of this delay, the growth of BG125 with higher concentrations of sodium formate (up to 21 g / 1) was examined. It was found that there was a correlation between the increase in formate concentrations and the duration of the initial delay period (Fig. 7). All the crops examined again had growth after the retracement period in similar proportions and - £? Ss3 ^ se ^ z. reached higher densities than the control flask.

Example III Example III illustrates that the addition of formate results in an increase in acetate production.

To further study the effect of formate on the growth of BG125, the production of various organic by-products and the glucose utilization in the shake flasks of Figure 5 were also studied. Figure 8 shows that formate uptake from the medium began during the early exponential growth and was completely removed before the start of the stationary phase for both the formate flask and the formate flask plus MOPS (Fig. 5). The measurement of acetate levels (Fig. 9) revealed the production of large amounts of this compound in all the flasks which is probably the cause of the fall in pH during growth in SBG at 1%; however, the amounts of acetate produced varied. The control flask, SBG 1 only, acetate production was slow first, and reached approximately 1.5 g / 1. The flask regulated with MOPS became close to 2 g / 1 acetate in a faster proportion than the control. The two flasks containing the formate continued to produce acetate for a longer period and reached between 2.5 and 3 g / 1.

Example IV Example IV illustrates that glucose uptake did not improve by the formate.

When the glucose levels were examined during the experiment (Fig. 10) the flasks with MOPS, formate, and MOPS plus formate used glucose in the same proportion until it was not detectable for 450 minutes. The control flask used glucose in the same proportion up to 250 minutes when the dressing was slow and stopped at 6 g / 1.

Example V Example V shows that the addition of trimethoprim exhibits growth in the presence of formate.

To study the effect of trimethoprim, an inhibitor of tetrahydrofolate synthesis, an experiment was carried out in which trimethoprim was added to the flasks containing 1% SBG, 1% SBG plus formate plus growth additives. and a control containing 1% SBG plus growth additives.The effect of the ethanol used to dissolve trimethoprim was also examined.Figure 11 shows that the addition of trimethoprim had an inhibitory effect on the growth of B. subtilis in the medium of SBG at 1% compared to growth in 1% SBG alone The addition of additives as a tetrahydrofolate-dependent supplement standard to a flask containing trimethoprim partially restored the growth of the strain When the formate was added to a flask contained tpmetoprim and growth-enhancing additives, the growth rate was then significantly reduced, but still higher than that of the trimmed flask Ethoprim alone Ethanol had no effect on growth.

Example VI Formate improves the low pH bacterial effect on B. subtilis cultures in order to determine if any of the observed effects of formate at pH 7.0 co or the growth delay of B. subtilis involved lethal toxicity in a portion of the population cell, the effect of formate on cell viability in a culture at pH 7 or lower was examined. With a pKa of 3.75, the formate was expected to be toxic near this pH. The BG125 cultures were inoculated in 1% SBG solution regulated with and without 50 mM formate at pH 3.6, 4.0, 4.6 and 7.0. The results showed that the cultures with and without formate lost the total viability in two hours of incubation at a pH of 3.6. After one hour at pH 3.6, the percent of survivors based on the initial titre was 1.8% while the addition of formate consistently decreased the percentage of survivors to an average of 0.13%. Incubation at a pH of 4.0 s without formate resulted in a lower viability loss than at a pH of 3.6, reaching 38% of survivors for 3 hours of incubation. The formate increased the loss of viability at a pH of 4.0 dropped to 1.2% for 3 hours. Cultures incubated at pH 4.6 did not show any decline in viability without format. Incubation at a pH of 7 also showed no decline in viability and an increase in cell count suggests that some growth took place as expected for this formate concentration.

These results suggest that a fermentation of gram-positive microorganisms will need to have a controlled pH and would not fall to pH levels below 4.6 if formic acid is produced during cultivation.

Example VII Homologs of FTAP 1 and FTAP 2 The homologs of FTAP 1 (YrhG) and FTAP 2 (YwcJ) are displayed in Tables ÍA and IB. All the homologs found indicated that YrhG and YwcJ are related to proteins involved in the transport of formate or other small molecules. YrhG and YwcJ were predicted to be hydrophobic proteins of similar size that exhibit multiple transmembrane regions.

Example VIII Example VIII illustrates the example that an interruption of the gene encoding FTAP 1 or FTAP 2 had -syls- or on the growth of Bacillus cells, illustrated in Figures 16 and 17, respectively.

For both genes, the spara PCR primers were consstructed to amplify an internal region of the genes for gene disruption. These internal fragments were cloned into a plasmid replica with a temperature sensitive replication origin for Bacillus. When the plasmidp was transformed into the B. subtilis test strains, it was maintained by antibiotic selection of the plasmid markers.

When the temperature was raised in the presence of an antibiotic, clones were obtained in which the plasmid was integrated via the region of homology in the Bacillus chromosome. This resulted in the interruption of the genes that are being examined which were maintained by growth of the cells above the temperature of the replication origin in the presence of antibiotic. The members were examined in shake flasks containing 1 - SBG, antibiotic, and with and without formate. The presence of antibiotic only in the members was examined and had no effect on growth.

The members were examined against the control flasks that contained the strain without the plasmids.

The results showed that the interruption of each of the genes had an effect on growth, only when the formate was added. The interruption of YrhG reduced the effect of normal growth improvement. From the formate to the middle. This would explain the decrease in formate uptake due to the interruption. The interruption of YwcJ (FTAP 2) resulted in a toxic effect which caused a decline in growth below the growth of the control strain without formate. Therefore it seems that each gene has a role in the transport or utilization of the formate.

Other examples and various modifications of the foregoing description and examples will be obvious to the person skilled in the art after reading the disclosure without deviating from the spirit and scope of the invention, and it was intended that such examples or modifications be included in the scope of the appended claims . All publications and patents referred to herein are incorporated herein by reference in their entirety. ? o ro o TABLE A Identities of the amino acid sequences between Jas' proteins YrhG and YwcJ with the related polypeptides. Identity with the orotein YrhG t • Salmonella thyphimuriun b Melhanobacteria c Haemophilus infl? Enzae broken TABLE 1 B Os All values are percentages of sequence identity • Salmonella thyphimunun b ethanobactepa c Haemophri? S influenzae It is noted that in relation to this date the best method known by the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Having described the invention as above, it is claimed as property in the following:

Claims (31)

1. A method for producing a product in a gram-positive microorganism that is characterized in that it comprises: a) obtaining a microorganism capable of expressing the product, said microorganism comprising either one or both of i) transport of formate associated with protein 1 (FTAP 1) and n) transport of formate associated with protein 2 (FTAP 2); Y b) cultivating said microorganism in the presence of the formate and under conditions suitable for the production of said product.

2. The method of Claim 1 which is characterized in that said product is a recombinant protein.

3. The method of Claim 2 which is characterized in that said recombinant protein is homologous to said microorganism. * hk .: > '.jék

4. The method of Claim 2 which is characterized in that said recombinant protein is heterologous to said microorganism.

5. The method of Claim 1 which is characterized in that said gram-positive organism is a Bacillus.

6. The method of claim 5 which is characterized in that said Bacillus includes B. subtilis, B. li cheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. coagulans, B. Circulans, B. lautus and Bacillus thuringiensis.

7. The method of claim 2, characterized in that said recombinant protein includes hormones, enzymes, growth factor and cytokines.

8. The method of claim 7 which is characterized in that said protein is an enzyme.

9. The method of claim 8 which is characterized in that said enzyme includes the protease, lipase, amylase, pullulase, cellulase, glucose isomerase, laccase and a disulfide isomerase protein.

10. The method of Claim 1 which is characterized in that said FTAP 1 has the amino acid sequence as set forth in Figure 1.

11. The method of Claim 1, characterized in that said FTAP 1 has the amino acid sequence as set forth in Figure 2.

12. A method for producing a product in a gram-positive microorganism which is characterized in that it comprises: a) obtaining a gram-positive microorganism capable of expressing the product and further comprising a mutation in the nucleic acid encoding PurU, said mutation results in an inhibition of the proinduction by diene microorganism of the PurU activity; Y b) cultivating said microorganism under conditions suitable for the production of said product.

13. The method of Claim 12 which is characterized in that said product is a recombinant protein. --S? ..

14. The method of Claim 13 which is characterized in that said recombinant protein is homologous to said gram-positive microorganism.

15. The method of Claim 13 which is characterized in that said recombinant protein is heterologous to said microorganism.

16. The method of Claim 13 which is characterized in that said gram-positive micro-organism is a Bacillus.

17. The method of claim 16 which is characterized in that said Bacillus includes B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. coagulans, B. circulans, B. lautus and Bacill us thuringiensis.

18. The method of Claim 13 which is characterized in that said protein includes hormones, enzymes, growth factor and cytokine.

19. The method 18 which is characterized in that said protein is an enzyme.

20. The method of Claim 19 which is characterized in that said enzyme includes protease, lipase, amylase, pululase, cellulase, glucose isomerase, laccase and a disulfide isomerase protein.

21. A method for producing a product in a gram-positive microorganism that is characterized in that it comprises the steps of: a) obtain a gram-positive microorganism capable of expressing said product, said microorganism having a mutation in the nucleic acid that encodes either one or both of FTAP 1 and FTAP 2 said mutation that results in an inhibition of the production by said microorganism of the activity of FTAP 1 and FTAP 2; Y b) cultivating said microorganism under conditions suitable for the expression of said product.

22. A method for producing a product in a gram-positive microorganism that is characterized * ßrf-_8J ... ív. ' This is because it comprises the steps of a) obtaining a gram-positive microorganism capable of expressing said product; b) modify the expression of FMD in said microorganism; and c) culturing said microorganism under conditions suitable for the expression of said product.

23. The method of claims 21 or 22 which is characterized in that said product is a recombinant protein.

24. A method to modify the growth of gram-positive microorganisms that is characterized in that it comprises modifying the transport of the formate in the gram-positive microorganism.

25. A gram-positive microorganism which is characterized in that it comprises an isolated nucleic acid encoding either one or both of FTAP 1 and FTAP 2.

26. A gram-positive microorganism that is characterized by having a mutation of the gene encoding PurU, said mutation which results in the inhibition of PurU activity.

27. The microorganism of Claim 25 or 26 which is characterized in that it additionally comprises a nucleic acid encoding a protein.

28. The microorganism of Claim 27 which is characterized in that said protein is an enzyme.

29. The microorganism of Claim 28 which is characterized in that said enzyme includes protease, lipase, amylase, pullulase, cellulase, glucose isomerase, laccase and a disulfide isomerase protein.

30. An expression vector that is characterized in that it comprises a nucleic acid encoding at least one of the FTAP 1, FTAP 2, PurU and FMD.

31. A host cell which is characterized in that it comprises the expression vector of Claim 30. JÜ = -Í.