MXPA00004001A - Composition and method for prevention and treatment of. - Google Patents

Abstract

INSUFFICIENCY OR CARDIOPULMONARY AND RENAL DAMAGE ASSOCIATED TO ISCHEMIA, LIBERATION OF ENDOTOXINS, ACUTE RESPIRATORY DISTRESS SYNDROME OR PROVOKED BY THE ADMINISTRATION OF CERTAIN DRUGS The present discloses a pharmaceutical composition that comprises an agent, such as an agonist agent A2a of adenosine and/or nucleic acid comprising an oligonucleotide (oligo) which is antisense of the receptor A1, A2a, A2b or A3 adenosine mRNA, flanking regions or regions serving as bridges to intron and exon borders, oligos which are effective to prevent, alleviate or inhibit the functional cardiac, pulmonary and/or renal difficulties mediated by adenosine, damage or insufficiency, such as those observed in diseases and conditions such as ARDS, RDS, etc., hurtful secondary effects observed in the treatment of patients with SVT of the administration of testing agents of cardiac tension or of the images formation, etc.

Description

COMPOSITION AND METHOD FOR THE PREVENTION AND TREATMENT OF INSUFFICIENCY- OR CARDIOPULMONARY AND RENAL DAMAGE ASSOCIATED WITH ISCHEMIA, LIBERATION OF ENDOTOXINS, EFFORT SYNDROME RESPIRATORY ACUTE OR PROVOKED BY THE ADMINISTRATION OF CERTAIN DRUGS BACKGROUND DB THE INVENTION Field of the Invention This invention relates to a composition, formulations and methods for the prevention and therapy of heart, cardiopuimon and renal damage or failure seen e. certain diseases and conditions associated with ischemia and / or endotoxin release, acute respiratory distress syndrome (ARDS), or caused by the administration of certain drugs such as cancer chemotherapeutic agents, glycerol, radiocontrast media and adenosine that are administered, for example, in stress or strain tests and the treatment of supraventricular tachycardia (SVT).

DESCRIPTION DB THE BACKGROUND Adenosine, a natural nucleoside, can 1 - . 1 - i. * *. constitute an important natural mediator of many of the *? . r * 7 diseases, including asthma, and the like. Inhalation A_ z. * 4t áa. * A of adenosines by asthmatics, but not by normal subjects, causes broncho-constriction. Theophylline, a xanthine, can be used in the reversal of this asthmatic effect. Other experimental data suggest the possibility that adenosine receptors might also be included in allergic and inflammatory responses. It has been postulated that the modulation of signal transduction on the surface of inflammatory cells influences acute inflammation. Adenosine is said to inhibit super-oxide production by stimulated neutrophils. Additionally, the treatment of experimental allergic uveitis produced a marked reduction in inflammation. Adenosine can attenuate this behavior by reducing the hyperactivity of the central dopaminergic system. and '' Adenosine plays a unique role in the body as a regulator of cellular metabolism. It can increase the cellular level of AMP, ADP and ATP which are the intermediate compounds -, r, energetics of the cell. Adenosine can stimulate or regulate slowly the activity of; the _ r adenylate cyclase and therefore regulate the levels of cAMP. CAMP, in turn, plays a role in the release of neurotransmitters, cell division and hormone release. The main role of adenosine appears to be to act as a protective autocoid of injury. In any --_.

In the condition in which ischemia occurs, tension due to low oxygen content or trauma, adenosine seems to play a role. Defects in the synthesis, release, action and / or degradation of adenosine have been postulated to contribute to the over-activity of the neurotransmitters of the excitatory amino acids of the brain, and therefore various pathological states. Recent evidence suggests that adenosine may also play a protective role in stroke, CNS trauma, epilepsy, ischemic heart disease, coronary bypass, exposure to radiation, and inflammation. Altogether, adenosine seems to regulate *. cellular metabolism through ATP, to act as a porator for methionine, to decrease cellular oxygen demand and to protect cells from ischemic injury. Adenosine is an intercellular tissue or messenger hormone that is released when cells undergo ischemia, hypoxia, cellular stress and increased workload, and / or when demand for ATP exceeds their supply. Adenosine is a purine and its formation is directly linked to the catabolism of ATP. It seems to modulate an array of physiological processes including vascular tone, hormonal action, neuronal function, platelet aggregation, and lymphocyte differentiation. It also seems to play a role in DNA formation, ATP biosynthesis and intermediary metabolism, general . It is suggested that it regulates the formation of cAMP in the brain and in a variety of peripheral tissues. Adenosine is also said to participate in the self-regulation of blood flow in the heart, brain, skeletal muscle, adipose tissue and kidney. In the kidney, for example, it can act as a constrictor vessel, but as a vasodilator in each of the other vascular beds. Adenosine is said to antagonize the catabolic effects of hormones and to promote the action of the anabolic hormone, insulin. In addition, adenosine may also act to attenuate the release of neurotransmitters in both the central and peripheral nervous systems, inhibit insulin secretion, and prevent platelet aggregation. It has been said that adenosine modulates the function of T lymphocytes by a mechanism that comprises the regulation of protein synthesis. Adenosine regulates the formation of cAMP through two receptors A-_ and A_. Via the receptors ^ adenosine reduces the activity of adenylate cyclase, while stimulating adenylate cyclase at the A_ receptors. A ^ adenosine receptors are more sensitive to adenosine than A_ receptors. The effects on the CNS (central nervous system) of adenosine are generally believed to be mediated by A ^ receptors where peripheral effects such as hypotension, bradycardia, are said to be mediated by A_ receptors. Adenosine is said to modulate the activity of adenylate cyclase as well as the activation of nerve cells and the release of neurotransmitters such as aspartate, glutamate, GABA and serotonin. It has sedative and anti-convulsive properties and is said to inhibit both spontaneous and induced nerve activation. Its action is antagonized by caffeine and theophylline. The action of adenosine is mediated through the cell surface receptors called Al f A_a / A_b and A3, and acts as a cellular transmitter or inhibitory, purinergic neurotransmitter. Adenosine is also involved in anxiety, analgesia, sleep and depression, by modifying the CNS alertness, acting as a neuro-modulator, actions that are terminated by cellular uptake or deamination. It has also been said to potentiate the effects of histamine, produce neuronal excitability, and exert most of its central effects pre-synaptic by inhibiting the release of calcium-dependent neurotransmitters. It has also been suggested that the production and release of adenosine is closely related to energy balance. During ischemia, adenosine levels accumulate and ATP is rapidly depleted.

It seems to be released at the site of trauma or when the cellular oxygen supply is reduced by hypoxia or ischemia and in this way discourages cellular activity and increases blood flow via vascular dilatation. A localized increase of adenosine in the traumatic focus plays an important homeostatic role by slowly regulating the physiological function and thus preserving the ATP. In almost every organ, ischemia induces an elevation of adenosine levels, which results in a slowing of the function of that organ, a process that is postulated to be mediated by adenosine receptors.

In recognition of this, adenosine has been called a "retaliative metabolite" and an endogenous neuroprotective agent. Therefore, adenosine seems to play together a homeostatic role throughout the body or, in a sense, to generate the recovery time of the traumatized tissue. * Adenosine has been implicated in the regulation of coronary blood flow and is said to have negative chromotropic and inotropic effects on cardiac contractility. These effects can be mediated directly via the adenosine receptors, or indirectly by either inhibiting the release of other neurotransmitters or by antagonizing the myocardial action of norepinephrine. Adenosine injections have been used for the treatment of supraventricular tachycardia (SVT). During hypoxia, ischemia or reactive hyperaemia, adenosine appears to be released freely and through its action reduces cellular hypoxic tension by slowing down cellular metabolism. In this way, it seems to act as a self-harm anti-injury. It is believed that both the morbidity and mortality of acute coronary artery occlusion can be reduced if the local concentration of myocardial adenosine is increased. It is said that adenosine increases collateral coronary circulation and still inhibits the generation of superoxide anions by granules, thereby reducing endothelial, vascular damage. Another effect of adenosine , it seems to be unblocking the activation of the granulocytes, and in this way reducing the capillary tamponade and the phenomenon of "no reflow" that contributes to the post-attack neuro-degeneration. Adenosine and a majority of adenosine mononucleotides have been said to also possess radioprotective activity. This protective activity is thought to occur through the A-_ receptors. However, internal vasoconstriction of the kidney has been observed in the administration of radiocontrast agents for imaging purposes. Adenosine, calcium and ischemia have been postulated to play a role in this intra-renal vasoconstriction, induced by radiocontrast agents. Ischemia or oxygen depletion in many cases is said to be caused by kidney damage. Certain chemotherapeutic agents against cancer, such as cisplatin and methotrexate, as well as glycerol and the administration of metal ions such as thallium (Th), lead (Pb) and cadmium (Cd) have also been associated with kidney damage, which It can become extensive in the release of endotoxins, and even culminate in sepsis. It has been said that known antagonists of adenosine receptors attenuate kidney damage produced in this way. In this way, adenosine may have a role as a natural mediator of intra-renal vasoconstriction. In particular, the kidney has a significant number of adenosine receptors, the effect of adenosine in the kidneys could be mediated mainly through the stimulation of adenosine receptors. One of the characteristics of hypersensitive subjects in particular is the over-expression of the adenosine receptor i. When activated by adenosine, these levels are induced, for example, by ischemia or by certain agents such as glycerol, endotoxin, chemotherapeutic agents such as cisplatin and methotrexate and by radiocontrast means, the receptor x can cause life threatening kidney damage, even fatal. Antagonists of adenosine receptors, such as theophylline, 8-cyclopentyl-1, 3-propylxanthine (DPCPX), are known to counteract adenosine-mediated bronchoconstriction in asthmatics. Theophylline has also been used to prevent a reduction in the glomerular filtration rate observed in the administration of a radiocontrast medium. However, the therapeutic potential of the commercially available adenosine A receptor specific antagonists is drastically limited by their toxicity. For example, theophylline often results in significant toxicity due to its narrow therapeutic dose range. The availability of an alternative strategy to prevent and treat the renal dysfunction associated with adenosine, damage and insufficiency observed in patients with hypoxia or ischemia, and in the administration of certain drugs, particularly in hypersensitive individuals, would clearly be of prophylactic and therapeutic value, extreme. Diseases and conditions mediated by A ± of adenosine, such as asthma, allergic rhinitis, and Acute Respiratory Distress Syndrome (ARDS), including in pregnant mothers, and RDS in preterm infants, among others, are common diseases in children. industrialized countries, and in the United States of America they only account for extremely high health care costs. These diseases, or conditions, have recently increased to an alarming rate, both in terms of prevalence, morbidity and mortality. Despite this, its root causes still remain poorly understood. Acute Respiratory Distress Syndrome (ARDS) is also known in the medical literature as rigid lung, shocking lung, pumping lung and congestive atelectasis, and its incidence * is 1 in 100,000 people. ARDS is thought to be caused by an insufficiency of the respiratory system characterized by the accumulation of fluid within the lung, which in turn causes the lung to become stiff. The condition is triggered by a variety of processes that injure the lungs. In general, ARDS causes a medical emergency. It can be caused by a variety of conditions that indirectly or directly cause the blood vessels to "leak" fluid into the lungs. In the ARDS, the ability of the lungs to spread and damage the air sacs severely decreases and the lining (endothelium) of the lung is extensive. The concentration of oxygen in the blood remains low despite the high concentrations of supplemental oxygen that are generally administered to a patient. Among the systemic causes of lung injury are traumas, brain injury, shock, sepsis, multiple blood transfusions and medications. Pulmonary causes include pulmonary embolism, severe pneumonia, smoke inhalation, radiation, high altitude, near drowning, and more. The symptoms of ARDS usually develop within 24 to 48 hours of the occurrence of an injury or ailment. It is believed that cigarette smoke can be a risk factor. Among the most common symptoms of ARDS are fast, painful breathing, nasal redness, skin, lips and blue nails due to cyanosis, caused by lack of oxygen to the tissues, respiratory distress, anxiety, effort and tension. Additional symptoms that may be associated with this disease are joint stiffness and temporarily absent pain and breathing. The diagnosis of ARDS is commonly made when testing symptomatic signs. An auscultation of simple breast examination with a stethoscope, for example, will regulate abnormal breath sounds that are symptomatic of the condition. The confirmatory tests used in the diagnosis of ARDS include X-rays of the chest and measurement of arterial blood gas. In some cases, "ARDS appears to be associated with other diseases, such as patients with acute myelogenous leukemia, who develop acute tumor lysis syndrome (ATLS) after treatment with cytosine-arabinoside." In general, however, ARDS seems be associated with traumatic injury, various blood infections such as sepsis, or other systemic ailments, the administration of radiation therapy of high doses of chemotherapy and inflammatory responses that lead to multiple organ failure, and in many cases to death. premature babies (called "preemies" in English), the lungs do not develop completely, therefore, the fetus is in an anoxic state during development.In addition, the lung surfactant is not yet generally present in sufficient quantities In this early stage of life, however, premature infants often hyper-express the adenosine receptor x and / or sub-express the adenosine A_a receptor and are therefore susceptible to diseases and conditions such as bronchoconstriction, pulmonary inflammation, and ARDS, among others. The respiratory distress syndrome (RDS) that occurs in the preterm infant is an extremely serious problem. A major cause of RDS in these preterm infants is the stage of immature development of the infant, resulting in a lack of surfactant, a material critical for normal respiration. Preterm infants who exhibit RDS are ventilated, and are administered oxygen and surfactant preparations. Infants with RDS, when they survive, often develop bronchopulmonary dysplasia (BPD), also called early childhood chronic lung disease. This is also frequently fatal. The death rate of the ARDS exceeds 50%.

Although many survivors recover normal lung function, some individuals may suffer permanent lung damage, which varies from mild to moderate. In addition, patients with ARDS are often afflicted with complications, such as multiple insufficiencies of the organ systems. To date, there are no known measures to prevent or treat ARDS. However, recently it was reported that an increase in the ratio of certain fatty acid by-products of phosphatidic acid metabolism is predictive of the probability that a patient will develop ARDS and, additionally, that the predictive value of the index correlates with the severity of the condition. The treatment of the remedy is limited to compensating the severe dysfunction of the respiratory system and treating the fundamental cause of the lung injury. One of the fastest developing symptoms in ARDS is hypoxia, which is generally treated with hyperbaric oxygen administration, often at high concentrations, often requiring 100% oxygen concentrations. This is done 5.4 in many circumstances by necessity, by intubation or by passing a tube through the nose or. the mouth of the patient towards the trachea (airway). In addition, mechanical ventilation or respirator, a machine used to aid breathing, is usually necessary to additionally support the respiratory system. This treatment may need to be continued until a gradual weaning of the mechanism is tolerated. Although there is no therapeutic treatment of ARDS at the present time, other medications can be used to treat the infection, reducing inflammation and eliminating fluid within the lungs. Minimal daily tasks become extremely difficult to perform under the circumstances, and often the only recommendation that doctors can offer to ARDS patients is to join in support groups to share common experiences and problems with other ARDS victims. . As already indicated, respiratory distress syndrome also occurs in premature and lactating infants. In this way, in view of the potential to predict whether a patient can develop ARDS or not, it becomes even more important to make available a new strategy to treat acute respiratory distress syndrome (ARDS), because it has now reached if possible apply it to the prevention of ARDS also, either in adults, children, or in babies born prematurely ("premature babies"). In addition, adenosine slows the conduction time through the AV node of the heart, it can interrupt the re-entry routes through the A-node. • Y can ree the sinus rhythm, normal in patients with supraventricular tachycardias, paroxysmal (PSVT ), more commonly described as supraventricular tachycardia (SVT), including that associated with Wolff-Parkinson-White Syndrome. The systemic administration of adenosine was found to be useful for treating SVT, and as a. pharmacological means to assess cardiovascular health via an adenosine stress test commonly administered by hospitals and by doctors in private practice. It is known that adenosine administered by inhalation causes asthmatic bronchoconstriction, possibly due to degranulation of mast cells and histamine release, effects that have not yet been observed in normal subjects. The infusion of adenosine has caused respiratory compromise in patients with obstructive pulmonary disease. As a consequence of adverse side effects, observed in many patients, caution is advised in the prescription of adenosine to patients with a variety of conditions, including obstructive pulmonary disease, efisema, bronchitis, etc. and totally avoid its administration to patients with or prone to bronchoconstriction or bronchospasm, such as asthma. In addition, the administration of adenosine should continue in any patient who develops severe breathing difficulties. Allergic rhinitis afflicts one in five Americans, accounting for an estimated $ 4 billion in health care costs each year; $ 2 billion for the seasonal variant and more than $ 2 billion for the perennial variant. If the associated diseases of the airways are considered, the cost can reach $ 10 billion. But even this huge figure can underestimate the true number of victims of the disorder. Because many people misdirect their symptoms as persistent colds or breast problems, allergic rhinitis is probably misdiagnosed. If other associated diseases of the airways are considered, the cost can reach $ 10 billion. But even this huge figure can underestimate the true number of victims of the disorder. Because many people mischaracterize their symptoms as persistent colds or breast problems, allergic rhinitis is probably misdiagnosed. Rhinitis can occur at any age. Typically, IgE is combined with allergens in the nose to produce chemical mediators, the induction of cellular processes and neurogenic stimulation, causing an underlying inflammation. Symptoms include nasal congestion and discharge, sneezing and itching. Victims can also have irritated, watery, swollen eyes. During the time, allergic rhinitis may predispose the victims to the development of sinusitis, otitis media with effusion, and nasal polyposis. In addition, rhinitis can exacerbate asthma. Allergic rhinitis can also be associated with alterations in cognitive mood, fatigue and irritability. Many medications can produce adverse reactions such as sedation with some anti-histamines available without recipes, which could further deteriorate a patient's quality of life. An understanding of the pathophysiology of the nose will often dictate appropriate therapy. Cholinergic routes, when stimulated, produce typical secretions that can be identified by their glandular constituents to involve neurological stimulation. Typical secretions of increased vascular permeability are found in allergic reactions as well as upper respiratory infections. The degranulation of mast cells results in the release of preformed mediators that interact with various cells, blood vessels, and mucous glands to produce the » typical symptoms of rhinitis. Most early and late phase reactions occur in the nose after exposure to the allergen. The late phase reaction is seen in chronic allergic rhinitis, with hypersecretion and congestion as the most prominent symptoms. Feeding may occur; This is characterized by a decreased start to the stimulus after repeated exposure to the allergen. This repeated exposure causes a hypersensitivity reaction to one or many allergens. Victims can also become hyperreactive to non-specific activators such as' cold air or strong odors. Rhinitis can be seasonal or perennial, allergic or non-allergic. Non-allergic rhinitis can be induced by infections such as viruses, or be associated with nasal polyps, as it occurs in patients with idiosyncrasy to aspirin. Medical conditions such as pregnancy or hypothyroidism can cause rhinitis, as can exposure to factors of drug occupation. The so-called NARES syndrome is a non-allergic type of rhinitis associated with eosinophils in nasal secretions. s- Typically occurs in individuals of intermediate age and is accompanied by some loss of sense of pain. Ideally, attempts have been made to minimize contact with the suspected allergen. If sensitivity to the dust mite is suspected, using allergen-proof covers for the mattress and pillows can improve symptoms. Washing sheets in hot water and removing carpets and curtains are other useful strategies to reduce exposure to expensive dust. Saline alone can improve poor nasal ventilation, sneezing, and congestion, sprayed saline usually does not cause side effects and can be tested first in pregnant patients. Sprays in saline are generally used to relieve mucosal irritation or dryness associated with various nasal conditions, minimize mucosal atrophy, and dislodge encrusted or condensed mucus. Also, if used immediately prior to intranasal dosing of corticosteroids, sprays of saline can help prevent irritative, local, drug-induced side effects. Frequently, antihistamines serve as an advance in symptomatic therapy. Terfenadine and astemizole, two non-sedating antihistamines, have been associated with a ventricular arrhythmia known as Torsades de Points, usually in interaction with other medications such as - .-. _cn uetoconazole and erythromycin, or secondary to an underlying cardiac problem. To date, loratadine, another non-sedating antihistamine, and cetirizine have not been associated with a thick package in the QT interval, or with adverse cardiovascular events. The most common side effect of cetirizine is numbness (14% versus 6% in placebo). When the doses recommended by patients without known risk factors are used, non-sedating antihistamines generally have minimal risk for an adverse cardiac event. These drugs, for example, Claritin, can be effective in relieving sneezing, nose coughing, and nasal, ocular, and palate itching. Although it has not been tested for this indication, some of the non-sedating agents may be useful in patients with asthma. Studies indicate that terfenadine, loratadine, and astemizole exhibit modest bronchodilator effects, reduce bronchial hyperreactivity to histamine, and protect against exercise-induced bronchospasm and antigens, although some of these benefits may require higher doses than currently recommended. Sedative anti-histamines can help people sleep at night, but they can cause numbness and compromise performance if taken during the day. Typically, anti-histamines are combined with a decongestant to help relieve nasal congestion. Sympathomimetic drugs are used as vasoconstrictors and decongestants. The three common systemic decongestants are pseudoephedrine, phenylpropanolamine and phenylephrine. These agents can cause hypertension, palpitations and tachycardia, as well as restlessness, insomnia and migraine. The interaction of phenylpropanolamine with caffeine doses of two to three cups of coffee can significantly increase blood pressure. In addition, in medicines such as pseudoephedrine can cause hyperactivity in children. Topical decongestants should only be used for a limited period of time, since they are associated with a rebound nasal dilation with excessive use. Anticholinergic agents have a role in patients with significant rhinorrhea or for specific entities such as "gustatory rhinitis"; which is usually associated with the ingestion of spicy foods. They have also been studied for their beneficial effects in the common cold. Cromolina has a good safety record and is especially effective if used prophylactically. Administer via nasal spray, cromolyn can be effective in reducing sneezing, runny nose, and / or nasal itching. It can block hypersensitivity responses in both early and late phases. Although side effects are unusual, sometimes spraying will produce sneezing, transient migraine, and even nasal burning. Topical corticosteroids such as Vancenase are very effective agents in the treatment of rhinitis, especially for symptoms of congestion, sneezing, and a runny nose. Depending on the preparation, corticosteroid sprays from the nose can cause irritation, itching, burning, or sneezing. Local bleeding and septal perforation may also occur, especially if the aerosol is not pointed in the proper direction. Topical steroids are generally more effective than cromolyn sodium, and are particularly effective in the treatment of NARES. These agents can be highly effective in reducing the symptoms of rhinitis, but side effects limit their usefulness except for temporary therapy in patients with severe symptoms. These agents are particularly useful in shortening nasal polyps when local therapy has not been successful. Immunotherapy, while expensive and inconvenient, can often provide substantial benefits, especially for patients who experience side effects from other medications. The therapy is associated with the production of so-called blocking antibodies, and with an alteration of the cellular release of histamine. Eventually, these changes will result in decreased IgE, along with many other favorable physiological changes. Due to the increasing prevalence of IgE-mediated diseases, it is important to note the possible role of IgE-mediated hypersensitivity in atopic patients who suffer from recurrent middle ear infections. For sufferers of allergic rhinitis, a runny nose is more than a nuisance. The disorder can deteriorate the quality of life and establish the stage for non-serious ailments including psychological problems. Although it can be controlled. Currently available treatments can help minimize symptoms, such as propanolol, verapamil and adenosine. These have a mark approved by the North American Administration of Foods and Drugs, for the acute termination of supraventricular tachycardia (SVT). Verapamil has been the most commonly used agent in the general population, but it has several defects, such as its potential to provoke or exacerbate systemic hypotension, congestive heart failure, bradyarrhythmias and ventricular fibrillation. In addition, verapamil easily crosses the placenta and has been shown to cause fetal bradycardia, heart block, depression of contractility, and hypotension. Adenosine has several advantages over verapamil, including rapid onset, brevity of side effects, theoretical safety, and probable lack of transfer in placenta. Finally, adenosine may prove to be the preferred agent for the termination of supraventricular tachycardia, paroxysmal also in pregnant women. Given the high number of deaths that comprise myocardial disease, the possibility of identifying individuals who are at risk of greater importance, because early detection allows early treatment of conditions. Electrocardiographic stress tests are used for this purpose, while an individual is exercising, but they lack high sensitivity and specificity. This is particularly the case with asymptomatic patients or those with chest pain, typical of angina. In this case, in addition to exercise stress testing, cardiac perfusion images are also obtained with? -rays, such as those emitted by 201Th or 99mTc. A good number of coronary patients, however, can not exercise at an acceptable level to validate the results of the test, such as those afflicted with severe arthritis and peripheral or vascular diseases or conditions, among others. Hypertensive patients who take ß-blockers and antagonists of the field channel and also present a problem in terms of detecting a proper course and an effective stress test while exercising. It is for these groups of patients who can not exercise properly that they are more sensitive in pharmacological stress tests. In the United States of America approximately one third of the preferred patients for myocardial perfusion tests are administered pharmacological tests. For these, as well as for patients seen in general practice, two classes of drugs are used: coronary vasodilator drugs and positive inotropic agents. Only two coronary dilator agents have been approved by the FDA for the use of this test: dipyrimidol and adenosine, both of which dilate the coronary arteries by raising the level of adenosine in the blood and increasing it from 4 to 5 times the coronary blood flow. Once these changes are imparted, • the patient is administered intravenously with a radioactive agent, such as 201Ta or 99mTc to do lightning imaging? Although in a normal person, the distribution of the radiolabel will be uniform, in a subject with one or more stenosis or occlusions in the coronary arteries will exhibit areas or "defects" in the artery (s) irrigated by the radioactive mark of different (s) intensity (s), which is attributable to ischemia or myocardial necrosis. Contrary to those observed with exercise, the hemodynamic and electrocardiographic changes observed in the administration of pharmacological agents such as adenosine are slight. Usually, the pulse will increase from 10% to 20% and the systemic blood pressure from 5% to 10%, and the electrocardiographic depressions of the CT segments on the electrocardiogram (EGC) indicate a specific and serious sign of artery disease coronary Thus, for many patients, the ability to undergo a pharmacological stress stress test is of extreme importance. However, for many patients who exhibit side effects (side effects), which in many cases result in severe bronchospasm, myocardial infarction and death. Thus, the administration of adenosine in a pharmacological stress strain test is contraindicated in individuals afflicted with bronchoconstriction, asthma, including occult asthma, hypotension, and second and third degree atrioventricular block. Many patients with SVT and other subjects who would benefit from the administration of adenosine to cope with their cardiovascular function, however, have hyper-sensitive airways and thus are prone to bronchoconstriction in response to the administration of adenosine. This in itself prevents them from being given adenosine in order to avoid extreme bronchoconstriction, which can threaten life. The availability of a new strategy to prevent and / or counteract the effects associated with the adenosine receptor of disorders and conditions associated with symptoms such as pulmonary bronchoconstriction, impaired respiration, inflammation and allergy (s), among others, of great practical importance . This technology is clearly applied to the treatment of damage by heart, lung and kidney failure, for example, associated with hypoxia condition including Acute Respiratory Distress Syndrome (ARDS), asthma, respiratory distress syndrome, pain, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, obstructive pulmonary disease, chronic (COPD), allergic rhinitis, and cancers such as leukemias, lymphomas, carcinomas and the like, including colon cancer, breast cancer, lung cancer, pancreatic cancer, hepatocellular carcinoma, kidney cancer, melanoma, hepatic metastases, etc., as well as all types of cancers that can metastasize or have metastasized to the lung (s), including breast and prostate cancer, will clearly find an immediate therapeutic application. Similarly, a composition and method that is suitable for administration before, during and after other treatments or diagnostic procedures, including radiation, chemotherapy, administration of radiocontrast agents, including those containing metal ions, antibody therapy, phototherapy and cancer, and other types of surgery, and adenosine such as stress or strain tests and in the treatment of SVT, among others, that can be administered preventively, prophylactically or therapeutically, and together with other therapies, or by itself same for conditions without known therapies or as a substitute for therapies that have significant and negative side effects, is also of immediate clinical application.

SUMMARY OF THE INVENTION The present invention relates to a pharmaceutical composition, which has protective, cardiopulmonary and / or renal activity or which is effective to prevent or treat diseases and conditions such as ARDS, and those associated with ischemia or the release of eñdotoxins or with administration of certain agents, including adenosine, for example, to treat SVT, etc. Examples are septic and toxic shock and septicemia. The main component of the composition is a nucleic acid comprising oligonucleotide (oligo), which when administered to a subject is effective to alleviate or inhibit the adenosine mediated diseases and conditions described and many others. The oligos are anti-sense to the target genes and the mRNAs that correspond to the target genes, to the genomic flanking regions such as the intron and exon boundaries, for example, the 5 'end, the 3' end and the juxta- section between the coding and non-coding regions, or all segments of the mRNA (s) encoding a receptor A, A_a, A2b and j of adenosine having agonist activity of A ^ A2b and / or antagonist activity of A_a , (in general to any agent that has adenosine A_a agonist activity), anti-sense to the target genes and the mRNAs corresponding to the target genes, to the genomic flanking reactions such as the selected intron and exon boundaries of the group consisting of the 5 'end, and the 3' end or the juxta-section between the coding and non-coding regions, or analogs to those oligos consisting of less than about 15% adenosine (A), or mixtures of the themselves, and a carrier s isiologically acceptable, and other agents such as diagnostic agents, e.g., radiocontrast media, other therapeutic agents to treat diseases or conditions or exogenous compounds that are associated with lung, cardiac or renal damage, e.g., glycerol, endotoxin and agents chemotherapeutics such as cisplatin and methotrexate, and formulation ingredients, among others. Examples of adenosine administration are in the treatment of supraventricular tachycardia (SVT) and stress or strain tests in hyper-sensitized individuals. Side effects caused by the exogenous administration of adenosine, such as extreme respiratory distress, blockage of airways, bronchoconstriction, allergy and inflammation, among others, are prevented and counteracted by the present agents and in some cases, depending on the dose administered , they are completely annulled. Other diseases or conditions afflict the kidneys and other organs and their functions by increasing endotoxin levels, and the like. Frequently, many diseases and conditions are associated by the development of ischemia or hypoxia which, either by itself or through the hybridization of another agent (s), is either associated with or causes damage and / or cardiopulmonary insufficiency or kidney, and in this way can benefit from the present invention as it is applied to protect the heart and kidneys. In this way, the pharmaceutical composition of the invention can be used to protect the lungs, heart and kidneys from damage associated or caused by other diseases or conditions or the administration of therapeutic or diagnostic agents. Furthermore, the present composition can also be applied to the treatment of numerous conditions which, in their absence, can cause considerable damage to the heart, lung and kidneys and even insufficiency, by the addition of one or more therapeutic agents * f to treat the condition of disease, as well as the agent described in this patent. For example, a pharmaceutical composition according to the invention may comprise an anti-cancer agent and the protective agent of the lungs, heart and kidneys of the invention, in effective amounts to treat cancer and prevent kidney damage, respectively. In another example, the present agent in combination with other therapeutic agents, including anti-cholinergic agents, and the like, can be used to treat food poisoning when endotoxins are released by microorganisms such as those of the Botulinium family and others, or to treat snake poisoning such as when the endotoxin is released, etc.; while ecting the subject from the effects of endotoxins, including septic shock and septicemia. Similarly, the present composition can be used to ect a subject from kidney damage while carrying out a diagnostic edure that contains an agent that has detrimental effects on the lung, heart and kidney. by administering separately or combining in a composition, the agent of the invention and a diagnostic agent. The present composition is also suitable for treating the damage associated with the administration of substances such as adenosine, cisplatin, S-radiocontrast agents and glycerol, routinely used for diagnostic and therapeutic purposes. The agents of this invention can be formulated for administration by several different routes, such as topical and systemic, eg, oral, parenteral, inhalable, and the like, and are generally administered in amounts that prevent or reduce side effects mediated by adenosine such as bronchoconstriction, allergy (s), inflammation and obstruction of the airways, among others. The present compositions and formulations are thus suitable for the prevention and relief of adenosine-mediated bronchoconstriction, allergy and / or inflammation, which are associated with the administration of adenosine from the SVT treatment and in the tests, stress or effort to hyper-sensitized individuals. These agents can be administered by themselves or together with adenosine or drugs of similar action, and in a preventive as well as therapeutic course. The present composition and formulations can be applied in this way in the prevention or relief of damage or cardiopulmonary and / or renal insufficiency, mediated by adenosine receptors, such as occurs in subjects afflicted with ischemia and as a consequence of administration or release in the organism of certain compounds such as glycerol, endotoxin, cisplatin, or radiocontrast agents used for imaging purposes, or other agents that are administered for therapeutic or diagnostic purposes, or as a consequence of an accident. Formulations of this invention, for example, topical, oral, parenteral, inhalable and the like, also uce adenosine-mediated bronchoconstriction and / or help prevent or treat ARDS symptoms. The formulations can be administered to a subject by themselves along with other therapies that are known in the art. The present composition is effective in alleviating bronchoconstriction, allergy (s) of the lung and inflammation, cardiopulmonary and renal diseases and conditions, for example, kidney damage and failure, hypoxia ARDS, COPD, etc., as well as associated cardiopulmonary (damaging) effects with the administration of certain therapeutic diagnostic agents, and optionally comprising the surfactant, and the relief described herein. In general, the oligos are anti-sense to a receptor Al f A_a, A_b or A3 of adenosine and exhibit inhibitory activity of the adenosine receptor A-_, A ^ or A3 or agonistic activity of A_a of adenosine, and analogs thereof , where A is substituted on a universal base that binds thymidine. Additionally, any adenosine A_ agonist is encompassed by this invention, not just anti-sense oligos.

These analogs test either reduced adenosine content or reduced activation activity of the adenosine receptor. The above composition is generally administered in an amount that prevents and reduces the side effects associated with the adenosine receptor such as bronchoconstriction, allergy (s), inflammation and airway obstruction, damage to the lung, heart and kidney, among others. . The present compositions and formulations, in this way, are suitable for the prevention and alleviation of bronchoconstriction associated with the adenosine receptor, allergy and / or inflammation and therefore, in the treatment of acute respiratory disorder syndrome (ARDS), asthma, side effects associated with the administration of adenosine in supraventricular tachycardia (SVT) and in tests of tension or effort to hypersensitized individuals, ischemia, damage or renal insufficiency induced by certain drugs, respiratory distress syndrome, pain, cystic fibrosis, hypertension pulmonary, pulmonary vasoconstriction, emphysema, chronic obstructive pulmonary disease (COPD) and cancers such as leukemias, lymphomas, carcinomas and the like, including colon cancer, breast cancer, lung cancer, pancreatic cancer, hepatocellular carcinoma, kidney cancer, melanoma, liver metastases, etc., as well as all types of cancers that can etastatize or have metastasized to the lung (s), including breast and prostate cancer, among others. These compositions are also suitable for use in the prevention and treatment of effects mediated by the .adenosine receptor caused by the administration of exogenous agents. The present technology is also applicable in conjunction with other methods and / or other therapies, including other therapeutic agents such as antibody therapy and chemotherapy, among others, radiation, phototherapy, cancer and other types of surgery, and is effectively administered at preventive, prophylactic or therapeutic form. The present therapeutic formulations can be administered to a subject in need of treatment in amounts comprising an anti-damage or renal insufficiency effective amount of the oligo of the invention, and optionally other agents having specific activities, carriers and other formulation ingredients as know in the technique.

BRIEF DESCRIPTION OF THE DRAWINGS Figures IA to ID illustrate the effects of anti-adenosine adenosine receptor sense oligonucleotides and anti-sense oligonucleotides of the control of mismatch in the dynamic compliance of the bronchial airway ii in a rabbit model. . The two stars represent significant differences p < 0.01, Student's t test. Figures 2A and 2B illustrate the specificity of adenosine receptor anti-sense oligonucleotides ^ as indicated by the number of receptors x (Figure 2A) and A_ (Figure 2B) of adenosine present in the airway tissue treated with the antisense oligonucleotides of the A ^ - adenosine receptor. Figures 3A and 3B illustrate the response of two hyper-sensitive monkeys (sensitive to ascaris) to a stimulus with inhaled adenosine. The bar on the right represents PC40 adenosine after administration of Oligo * I, while the bar on the left represents the PC40 value of adenosine before treatment by Oligo I. The PC40 of adenosine, represented on the axis of the Y, is the amount of adenosine in mg that causes a 40% decrease in dynamic compliance with the hypersensitive airways. Figure 3A represents the experimental results r.i t ll obtained without and with pre-treatment of first monkeys with a phosphorothioate agent of the invention (anti-sense oligo I, SEQ ID NO: 1), before the administration of adenosine. Figure 3B represents the experimental results obtained without and with a pre-treatment of a second monkey with a phosphorothioate agent of this invention (oligo I anti-sense; SEQ ID NO: 1) before the administration of adenosine. Figure 4 shows the effect of the surfactant in an experimental animal. In the figure, square 1 shows the baseline level of the rabbit surfactant. Square 2 shows the level of the surfactant after the administration of adenosine (post-adenosine stimulation). Square 3 shows the level of the surfactant for administering an anti-adenosine t-sense oligonucleotide (SEQ ID NO: 1) and then adenosine. Figure 5 shows the effect that has included rabbit BAL of saline, endotoxin alone and endotoxin after Oligo I (SEQ ID NO: 1) on the number of circulating neutrophils. Figure 6 shows the effect on net weights of the rabbit lungs of endotoxin alone and endotoxin after Oligo I (SEQ ID NO: 1) in the edema (weight difference). Figure 7 shows the effect in the BAL saline fluid of rabbit, endotoxin alone and endotoxin after Oligo I (SEQ ID NO: 1) on the total number of the total cell count.

DETAILED DESCRIPTION OF THE PREFERRED MODALITIES One aspect of this invention stems from a desire on the part of the inventor to improve his or her own prior technology for the treatment of acute bronchoconstriction, allergy and / or inflammation associated with various diseases and conditions and as an improvement in the ineffective, and existing methods to treat diseases and conditions such as Acute Respiratory Distress Syndrome (ARDS), allergic rhinitis, asthma, adenosine administration, for example, in the treatment of Supra Ventricular Tachycardia (SVT) and other arrhythmias, and in tests of tension or effort to individuals hypersensitized with adenosine, ischemia, damage or renal insufficiency induced by certain drugs, infant respiratory distress syndrome, pain, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, pulmonary disease, obstructive, chronic ( CODP), and cancers such as leukemia, lymphomas, carc inomas, and the like, including colon cancer, breast cancer, lung cancer, pancreatic cancer, hepatocellular carcinoma, kidney cancer, melanoma, hepatic metastases, etc., as well as all types of cancers that can metastasize or have metastasized to (the) lung (s), including breast and prostate cancer. Extremely dangerous, and in some cases lethal, the effects are found when adenosine receptors are activated by the administration of adenosine. Activation of the adenosine receptor, in particular, can lead to life-threatening and, in some cases, even fatal, bronchoconstriction in hyper-sensitive individuals. The inventor, moreover, wished to provide the treatment that will improve the consequence and life style of patients who undergo other procedures or who are administered other therapies, including antibody therapy, chemotherapy, radiation, phototherapy, and surgery, for example, cancer surgery, and that could be administered effectively in a preventive, prophylactic or therapeutic manner. It has been successful in this task and new and improved compositions, formulations and methods are provided in this patent that offer greatly improved results compared to previously known treatments to prevent and alleviate bronchoconstriction, allergy (s), inflammation, breathing difficulties and blockage of the airways, cardiopulmonary and renal damage, and the like. The nucleic acid and the optional surfactant and other components of the composition of the invention can be formulated alone or with a carrier or with other therapeutic agents and formulating agents as is known in the art. The compositions of this invention, in this way, can be incorporated in a variety of formulations for systemic and topical administration. The present composition and treatment are applicable to avoid cardiopulmonary and renal damage, such as that seen in association with ischemic or hypoxic conditions as well as with the administration of radio contrast media, and certain different agents, for example, those known which cause ischemia and / or cause cardiopulmonary and / or renal damage or failure, such as radiocontrast agents, glycerol and chemotherapeutic agents such as methotrexate and cisplatin. In addition, the inventor found that the present technology 'is suitable for the production and treatment of damage and renal insufficiency such as that which occurs in the ordering of food and by snakes as well as septicemia and septic or toxic shock caused by the release of endotoxins, such as when microorganisms of the Botulinum type are ingested, and the like, or even from unknown sources. To his surprise, the inventor found that the present agent has a protective effect with respect to the heart, lung and kidneys, and that it could be administered prophylactically as well as therapeutically. In addition, when other specific agents are included, the present composition can also be applied to treatment in diseases and conditions where the other agents have a detrimental, cardiopulmonary or renal side effect including diseases and conditions associated with ischemia, the administration of adenosine, for example, for the treatment of SVT or in stress or strain tests, for the treatment of cancer, for example, by the administration of an anti-cancer drug such as cisplatin and the oligo of this invention. In this manner, the anti-sense oligonucleotide (oligo) of the invention can be administered as a variety of formulations, either by itself, with or without a surfactant, or with other agents. The anti-sense oligonucleotide of this invention, in this way, can be incorporated into a variety of formulations for systemic and topical administration. The present invention also improves the state of the art in rescuing patients afflicted with ARDS. either as a consequence of multiple traumatic injuries, severe blood infections such as sepsis, or other systemic diseases, the administration of high-dose radiation therapy and chemotherapy, of inflammatory responses that lead to multiple organ insufficiencies, and in many cases to the death. Although a large number of people are afflicted with this disease or condition every year, until now, measures to prevent ARDS have not been available.

ARDS has been and still is considered to be intractable, and the only palliative treatment has been limited to compensating for the severe dispersal of the respiratory system and treating the root cause of the lung injury. One of the fastest developing symptoms in ARDS is hypoxia, which is generally treated by the administration of the hyperbaric system, often at high concentrations. The inventor extensively investigated the etiology of the Respiratory Distress Syndrome (RDS) and ARDS and other conditions that seem to trigger the ARDS, and thus is proposing the implementation of a prophylactic or preventive and therapeutic treatment based on the administration of oligonucleotides , with or without vectors linked to these designed to treat the acute deterioration of the airways, bronchoconstriction, allergy and / or symptoms of inflammation seen in patients who develop ARDS. The present composition, formulations and methods in this manner are applicable to the prophylaxis of ARDS immediately after a potential diagnosis is made that a patient is a good candidate to develop the condition. In addition, and given that the symptoms of ARDS often develop extremely rapidly, the present technology has also been applied to the treatment of patients who are already afflicted with the respiratory and inflammatory symptoms seen in the ARDS. The present composition and formulations can be administered by themselves together with other auxiliary agents directed to alleviate ARDS symptoms, such as oxygen enriched air, surfactants, blood pressure control agents, and the like. The composition of the invention is provided in a variety of formulations for systemic and topical administration, which can be used as prescribed by a physician. The present inventor unexpectedly found that the agents of the invention, particularly those that have at least some inhibitory activity on the adenosine Ax receptor, strongly inhibit, and in some cases end, with 100% efficiency, respiratory symptoms and inflammatory, acute ARDS. The experimental work, some of which are provided in this patient's examples, has shown complete interference with, and cessation, bronchoconstriction and other unwanted side effects, associated with ARDS, which are mediated by the recipient (s) of adenosine, in each of the two animal models of human bronchial hypersensitivity: a hyper-sensitive rabbit model and a hyper-sensitive cyanomological monkey model, both of which are widely recognized by the scientific community as models of bronchoconstriction, allergy and inflammation that comprise the respiratory airways in humans. The agent of this invention, therefore, has been shown to prevent and counteract these symptoms associated with ARDS, associated with adenosine receptors, possibly with the adenosine A receptor. The prevention and suppression of ARDS symptomatology seen in the administration of the agent of this invention is clearly applicable to the prevention of ARDS and the treatment of patients afflicted by this condition by itself, whether before, concurrent with, and subsequent to palliative therapy. The present invention is now set forth to save a large number of lives previously lost unnecessarily, given the high morbidity and mortality associated with ARDS. Respiratory distress syndrome (RDS) occurs in preterm infants (premature infants), and is an extremely serious problem. A major cause of RDS in these preterm infants is the immature stage of development of the infant, resulting in low levels or lack of surfactant, a material critical for normal respiration. Preterm infants (premature infants) who exhibit RDS are ventilated, and are given oxygen and surfactant preparations. When they survive, infants with RDS frequently develop bronchopulmonary dysplasia (BPD), also called early childhood pulmonary disease (CLD). This condition is often also fatal. The causes of surfactant depletion in the preterm infant are unknown. However, it is known that the solution of the surfactant is regulated in an accelerated way through the adenosine A_a receptors and is inhibited through the A * - adenosine vectors. It has been shown that adenosine and ATP receptor A agonists mobilize intracellular calcium and activate potassium and chloride currents in cystic fibrosis and normal airway epithelial cells. Additionally, the A ± adenosine receptor is also known to be involved in tissue protection from the effects of oxygen deprivation or hypoxia. Based on these and other training pieces, the inventor has hypothesized that, during the normal development of the fetus, there is a relationship of change (increase) of the A2a adenosine receptor to the A ^ - receptor of ade.Tosine (A2a: A1 ratio) such that the A ^ receptor protects the fetal lung tissue during fetal anoxia and inhibits the premature secretion of the surfactant. A ^ adenosine receptor expression decreases as the fetus reaches the term. Accordingly, he has hypothesized that the adenosine A_a receptor is expressed less in the early total stages, and its expression increases as the fetus reaches the term, assuring normal levels of surfactant secretion at birth. In the preterm infant, an existing high A1: A2a ratio does not have an opportunity to reverse itself because the infant was born before adequate expression of the A_ adenosine receptor is present and while there is still a significant expression of A ^ of adenosine. This causes a decreased production of the surfactant at birth and subsequently. Accordingly, it has been assumed that the administration of an anti-sense adenosine oligonucleotide will produce the level of the adenosine receptor, formed. In addition, it has also been assumed that the administration of any adenosine A_a agonist, whether or not an oligonucleotide, will specifically stimulate this receptor. Any therapy or a combination of both will be adequate to treat RDS, particularly in premature babies. Rhinitis is not a disease, it is a term that describes a group of symptoms produced by nasal irritation or inflammation. Allergies, however, including allergic rhinitis, affect an estimated 40 to 50 million people in the United States of America. Some allergies can interfere with daily activities or decrease the quality of life. Rhinitis is a term that describes the symptoms produced by nasal irritation or inflammation. Symptoms of rhinitis include a runny nose, itching, sneezing and stuffy nose due to blockage or congestion. These symptoms are the natural response of the nose to inflammation and irritation. Arbitrarily, rhinitis that lasts less than six weeks is called acute rhinitis, and persistent symptoms are called chronic rhinitis. Acute rhinitis is usually caused by infections or chemical irritation. Chronic rhinitis can be caused by adherence or by a variety of other factors. The nose normally produces mucus, which traps substances such as dust, pollen, pollution and germs such as bacteria and viruses. The mucus flows from the front of the nose and fills down back to the throat. When the production of mucus is excessive, it can flow from the front like a curling nose or become perceptible from the back, such as a post-nasal drip. Nasal mucus, normally a clear, diluted fluid, becomes thick or colored, perhaps due to dryness, infection or contamination. When the post-nasal drip is excessive, thick, or contains irritating substances, coughing is the natural response to clearing the throat. Itching and sneezing are also natural responses to irritation caused by allergic reactions, chemical exposures that include cigarette smoke, changes in temperature, infections, and other factors. The nasal tissues are congested and decongest periodically. In most people, the nasal congestion changes back and forth from one side of the nose to the other in a cycle of several hours. Some people, especially those with narrow nasal passages, perceive this cycle more than others.Exhausting exercise due to changes in the position of the head can affect nasal congestion.Strong congestion can result in facial pressure and pain, as well as dark circles under the eyes Sinusitis is the inflammation or infection of any of the four groups of sinus cavities in the skull, which are open in the nasal passages. Sinusitis is not the same as rhinitis, although the two may be associated and their symptoms may be similar. The terms breast problem or sinus congestion are sometimes misused to mean congestion of the nasal passage itself. Most cases of nasal congestion, however, are not associated with sinusitis. Known by most people as hay fever, allergic rhinitis is a very common medical problem that affects more than 15 percent of the population, both adults and children. Allergic rhinitis takes two different forms, seasonal and perennial. Symptoms of seasonal allergic rhinitis occur in the spring, summer, and / or early fall that are usually caused by allergic sensitivity to pollens from trees, lawns, or weeds, or to the spores of molds carried by air. . Other people experience symptoms throughout the year, a condition called perennial allergic rhinitis. In general, it is caused by sensitivity to house dust, house dust mites, animal dander and / or mold spores. Hidden or underlying food allergies are considered a possible cause of perennial nasal symptoms. Some people may experience both types of rhinitis, with the perennial symptoms that prevail during specific pollen seasons. However, there are other causes for rhinitis. When a sensitive person inhales an allergen (substance that causes allergy) such as ragweed pollen, the body's immune system reacts abnormally with the allergen. The allergen binds to allergic antibodies (immunoglobulin E) that bind to cells that produce histamine and other chemicals. The pollen "activators"; These cells in the nasal membranes, which causes them to release histamine and other chemicals. Histamine dilates the small blood vessels in the nose and fluids drain into the surrounding tissues, leading to runny noses, watery eyes, itching, swelling and other allergy symptoms. The antibodies circulate in the bloodstream, but they are located in the tissues of the nose and on the skin. This makes it possible to show the presence of these antibodies by the skin test, or less commonly, with a special blood test. A positive skin test reflects the type of reaction that continues in the nose. Hay fever is a term throughout the century that has come to describe the symptoms of allergic rhinitis, especially when it occurs in late summer. However, the symptoms are not caused by hay (ragweed is one of the main culprits) and it is not accompanied by fever. In this way, doctors prefer the term "allergic rhinitis"; because it is more accurate. Similarly, spring symptoms are sometimes called rose fever but it is only coincidence that the roses are in bloom during the pollination season of the lawns. Roses and other ostentatious, aromatic flowers depend on bees, not wind, for pollination, so that pollen enters through the air to cause allergies. A common issue for sufferers of allergic rhinitis is if they can move to a place where their allergies will be absent. Some allergens are difficult to evade. Ambrosia that affects 75% of allergic rhinitis victims covers most of the United States of America. There is less ragweed in a band along the west coast, the tip more toward south Florida and northern Maine, but it is still present. At the level of Alaska and Hawaii they have little ambrosia. A movement can be of questionable value because a person can escape from an allergy to ragweed, for example, only to develop sensitivity to lawns or other allergens in the new location. Some known complications include ear infections, sinusitis, ulcerated throats, recurrent, cough, migraine, fatigue, irritability, altered sleep patterns and poor school performance. Occasionally, children may develop altered facial growth and orthodontic problems. In some cases, allergy treatment can eliminate or alleviate most of these problems. Rhinitis can result from many different causes of an allergic reaction. Not all symptoms of rhinitis are the result of allergies. The following are the three most common causes of rhinitis with some of their characteristics: rhinitis or allergic sensitivity is caused in general 'by allergic dust hay fever, food, animals, pollens, molds, perennial and / or seasonal infectious colds or viruses of the flu, bacteria and others, and last in general 3-7 days. Non-allergic rhinitis can be caused by irritating smoke, air pollution, exhaust fumes, aerosol spray, fragrance, paint fumes, etc. The most common condition that causes rhinitis is the common cold, an example of infectious rhinitis. Most infections are of a relatively short life, three to seven days. Colds can be caused by any of more than 200 viruses. Children, particularly children and youth at school or day care centers, may have eight to 12 colds each year. Fortunately, the frequency of colds decreases after immunity has occurred from exposure to many viruses. Colds usually start with a feeling of congestion, followed quickly by a runny nose and sneezing. During the following days, the congestion becomes more prominent, the nasal mucus may become colored, and there may be a slight fever and cough. Cold symptoms are resolved in a couple of weeks, although the cold can persist sometimes. Cold symptoms that last longer may be due to other causes, such as chronic rhinitis or sinusitis. Allergic rhinitis very often has no cure. Most treatments aim to keep your symptoms under control by avoiding or reducing exposure to substances that cause symptoms and alternating the medication when needed. The dryness of the nasal tissues may be a normal effect of aging, or a characteristic of a nasal condition associated with a foul-smelling nasal discharge. Rhinitis can also be a characteristic of an endocrine disease, such as hypothyroidism, or it can occur during pregnancy. Rhinitis can be used or even improved during pregnancy. Alcoholic beverages can cause the blood vessels in the nose to temporarily enlarge and produce significant nasal congestion. Sometimes, several conditions can coexist in the same person. In an individual, allergic rhinitis can be complicated by vasomotor rhinitis, deviation of the septum (curvature of the bone that separates the two sides of the nose) or nasal polyps. The use of decongestants in aerosol for chronic sinusitis, deviation of the septum or vasomotor rhinitis can cause rhinitis medicamentosa. Any of these conditions will get worse when you catch a cold. Nasal symptoms caused by more than one problem can be difficult to treat, often requiring the cooperation of an allergist-immunologist and an otolaryngologist (ear, nose and throat specialist). Once allergic rhinitis is diagnosed, treatment options include avoidance, medication, and immunotherapy (allergy shots), none of which offer a complete cure. An individual ragweed plant can release a million pollen grains in just one day. The pollen of the ambrosia, lawns and trees is too small and floating so the wind can transport it for miles from its source. Mold spores, which grow on the outside in fields of dead leaves, are also everywhere and can exceed the number of pollen grains in the air even when the pollen season is at its worst. While it is difficult to trap pollen and mold, exposure can be reduced by keeping the windows closed, using summer air conditioning and a HEPA filter (Air in Energy Particles) or an electrostatic precipitator to clean the dust and the mold of the air. Early morning is a good time to limit outdoor activities because the outside air is more heavily saturated with pollen and mold between 5 and 10 a.m., etc. Other measures of avoidance, medications such as anti-histamines and decongestants are the most commonly used for allergic rhinitis. No medication, such as cromolyn, inhibits the release of chemicals that cause allergic reactions. The nasal sprays with corticosteroids that reduce the inflammation of the allergic actuator. Medications help relieve stuffy nose, runny nose, sneezing and itching. They are available in many forms, including tablets, nasal sprays, eye drops and liquids. Most of these medications cause side effects. Allergy immunotherapy, known as allergy injections, can be recommended for people who do not respond well to medication treatment, experience side effects from medications, or have allergen exposure that is unavoidable. However, immunotherapy does not cure allergies but can be very effective in the control of allergic symptoms. All allergy shots will actually be at varying intervals for a period of three to five years. An immunotherapy treatment program may consist of injections of an allergy extract, diluted, administered frequently in increasing doses until a maintenance dose is reached. Then, the injection schedule is changed so that it will be the same dose with longer intervals between injections. Immunotherapy helps the accumulated resistance of the body to the effects of the allergen, reduces the intensity of the symptoms caused by exposure to the allergen, and sometimes can actually make test reactions disappear in the skin. As the resistance develops, the symptoms should improve, but the improvement of the immunotherapy will take several months for it to appear. Immunotherapy does not help with the symptoms produced by non-allergic rhinitis. Anti-histamines are the cheapest and most commonly used treatment for rhinitis. These medications counteract the effects of histamine, the irritant chemical released inside your body when the allergic reaction takes place. Although other chemicals are included, histamine is primarily responsible for causing the symptoms. Antihistamines do not cure, but they help relieve: nasal allergy symptoms, such as sneezing, itching and discharge; Eye symptoms, such as itching, burning, tearing and clear discharge; skin conditions, such as hives, eczema, irritation and some rashes; and other allergic conditions as determined by your doctor. There are dozens of different antihistamines and wide variations in the way patients respond to them. Some are available without recipes and others require a prescription. In general, they work well, but they produce side effects. The body tends to accumulate resistance to some anti-histamines over time. That trend varies from individual to individual. People with dry nose or thick nasal mucus should avoid taking antihistamines without consulting a doctor. Contact your doctor for advice if an anti-histamine causes numbness or other side effects. The short-acting anti-histamines can be taken every four to six hours, while the prolonged-release antihistamines are taken every 24 hours. Short-acting anti-histamines are often useful taken 30 minutes before allergic exposure (food outdoors during the ragweed season). The prolonged-release anti-histamines are more suitable for chronic (long-term) use for those who need daily medication. The most common side effect is sedation or numbness. For this reason, it is important that you do not drive a car or work with dangerous machinists the first time you take antihistamines. You should take anti-histamines for the first time at home, several hours before bed time. When you are sure that the medicine will not cause sedation, then it can be taken at any time as prescribed during the day. In people who do not experience numbness, the sedation effect usually decreases over time. Some of the newer anti-histamines cause little numbness. Another frequently found side effect is the excessive safety of the mouth, nose and eyes. Less common side effects include restlessness, nervousness, overexcitability, insomnia, dizziness, headaches, euphoria, faintness, visual disturbances, decreased appetite, nausea, vomiting, abdominal pain, constipation, diarrhea, increased or decreased urination, high or low blood pressure, nightmares (especially in children) ulcerated throat, unusual bruising or hemorrhage, narrowing of the chest or palpitations. Alcohol and tranquilizers increase the sedation side effects of antihistamines and therefore should be avoided during therapy. Decongestants help relieve bad mood and pressure caused by nasal, swollen, allergic tissue. They do not contain anti-histamines, so they do not cause the side effects of anti-histamines. They do not relieve the other symptoms of allergic rhinitis, such as a runny nose, post-nasal drip, and sneezing. Decongestants are available as prescription and over-the-counter medications and are often seen in combination with anti-histamines or other medications. It is not uncommon for patients who use decongestants to experience insomnia if they take the medication in the evening or at night. If this occurs, a dose reduction may be required. Sometimes, the man with the enlarged prostate can find urinary problems while he is with the effects of decongestants. Patients who use medications to manage emotional or behavioral problems should discuss this with their doctor before using decongestants. Pregnant patients should also have a check-up with their doctor before starting decongestants. Decongestant nasal sprays without prescription work within minutes and last for hours, but can not be used for more than a few days at a time without the doctor's order. Oral decongestants are found in many medications sold without prescription and under prescription, and may be the treatment of choice for nasal congestion. They do not cause rhinitis medicamentosa, but they need to be avoided by some patients with high blood pressure. If you have high blood pressure, you should check with your doctor before using them. Over-the-counter saline nasal sprays help counteract the symptoms of dry nasal passages or thick nasal mucus. Unlike nasal decongestant sprays, a saline nasal spray can be used as often needed. Sometimes, the doctor may recommend washing (showering) the nasal passage. Corticosteroids counteract the inflammation caused by the body's release of substances that cause allergy, as well as those caused by other non-allergic factors. In this way, they work in general for many causes of rhinitis symptoms and are sometimes useful for chronic sinusitis. Corticosteroids are sometimes injected or taken orally, but usually on a short-term basis for extremely extreme symptoms. Doctors warn that injected or oral steroids can produce several side effects when used for prolonged periods or are used repetitively and for this reason, should be used with extreme caution. In rhinitis, a corticosteroid is safer when used when spraying it on the nose. Side effects are less common, but may include nasal ulceration, general nasal infection, or hemorrhage. Cromoline is a medication that blocks the body's release of substances that cause allergy. It does not work in all patients. The full dose is four times a day and the improvement can take several weeks for it to appear. Atropine and Ipratropium bromide of drug released are sometimes used to relieve the nose rhinitis of rhinitis; in fact, most anti-histamines have a light atropine-like effect. Atropine can be taken orally and as a nasal spray. It is a component of some anti-histamine decongestant preparations. Antibiotics are for the treatment of bacterial infections. They do not affect the course of uncomplicated common colds, and they are not of benefit for noninfectious rhinitis, including allergic rhinitis. In chronic sinusitis, antibiotics can only help temporarily and surgery may be needed. . Eye allergy preparations are used when the eyes are affected by the same allergens that activate rhinitis, causing redness, watery eyes and itching. Eye preparations are available as prescription and nonprescription medications. All anti-histamines without prescription (combined with decongestants) are "first generation" anti-histamines and generally cause numbness, slow reaction time and dry mouth in most people. Examples are Actifed (and combination products), alKa Seitzer Plus Sinus Allergy and Medicine, Allerest (and combination products), ARM, BC Cold Powder Multi-Symptom Formula Benadryl (and combination products), Chlor-trimeton (and products) of combination), Comtrex Multi-Symptom Day / Night, Maximum Strength Contain, Coricidin (and combination products), Dimetane, Dimetapp (and combination products), Drixoral (and combination products), PediaCare Night Rest Cough-Cold Liquid, Sinarest, Sudafed Plus, Tavist (and combination products), Triaminic Allergy, Tylenol Allergy Sinus / Tylenol PM, Vicks NyQuil (and combination products), and Vicks Pediatric Formula 44M Cought & Cold, among others. The following medications are second generation antihistamines and generally do not cause extreme side effects of the first generation anti-histamines, such as numbness, a slow reaction time in the dry mouth. Examples of antihistamines under prescription are Allegra, Claritin, Hismanal and Zyrtec. The latter can cause heart problems when combined with certain different medications, while Hismanol has side effects of low sedation. The following contain first-generation anti-histamines and cause general numbness, a slow reaction time and dry mouth: Atarax, Antivert, Dallergy, Naldecon, Periactin, Rynatan, Tamaril, Trinalin and Vistaril. The following are examples of oral decongestants without a prescription: Actifed allergy Daytime, Allerest, Drixoral Non-Drowsy Formula, Efidac / 24, PediaCare Infants' Decongestant Drops and Tablets Sudafed. Examples of prescription oral decongestants are: Dura Vent, Entex LA, Entex PSE, Exgest LA, Respaire, Sinuvent and Guaifed PD. Examples of non-prescription decongestant nasal sprays are Afrin related products, Cheracol, Dristan, 12-Hour Duration, 4-Way Rapid Action and NTZ Prolonged Action. Its prolonged use, however, can cause a rebound congestion. Other examples are Neo Synephrine and related products. Nostril / Nostrilla, Otrivin, Privine and Vicks Sinex Long-acting / Steam / Vaporub / VapoSteam / Vatronol. An example of an anti-allergy nasal spray without a prescription is Nasalcrom and the nonprescription saline nasal sprays are Afrin Saline Mist, Ayr, NaSal Moisturizer AF, Ocean and Salinex. An example of an anti-histamine nasal spray on prescription is Astelin. Examples of Atropine-type nasal sprays, under prescription, are Atrovent and nasal corticosteroid sprays under prescription, which do not contain anti-histamines or decongestants. Other suitable therapeutic agents for the treatment of allergic rhinitis are Beconase (Pockethaler and Beconase AQ), Flonase, Nasacort (Nasal Inhaler and Nasacort-AQ) Nasalide, Rhinocort and Vancenase (Prockethaler and Vancenase DS). Examples of prescription oral corticosteroids that do not contain antihistamines are Deltasone, Pred Liquid, Medrol, Pediapred and Prelone. The present inventor assumed that the administration of the present agents would be effective for the treatment of allergic rhinitis whose symptoms were measured by the adenosine receptors. In addition, the inventor showed the effectiveness of the present therapy, for example, at the level of the lung surfactant in an animal model in which the A ± adenosine receptor is known to be highly expressed, the lung of the allergic rabbit. See, Ail, S. et al., Adenosine-induced bronchoconstriction in allergic rabbit model, Am. J. Physiol. 266: L271-277 (1994); Ali, S. et al., Adenosine-induced bronchoconstriction and contraction of airway smooth muscle from allergic rabbits with late-phase airway obstruction: Evidence for an inducible adenosine adenosine ^ receptor, JPET 268 (3): 1328-1334 (1994). In the normal lung, the A ^ adenosine receptor is generally not expressed, whereas the A_a adenosine receptor is expressed. The experimental setting and the results are shown in Example 37 below. In the past, anti-sense oligonucleotides received considerable theoretical consideration since they are potentially useful as pharmacological agents for the treatment of human disease. R. Wagner, Nature 372: 333-335 (1994). However, it has been difficult to really apply them to alleviate and cure human diseases. An important consideration in the pharmacological application of these molecules has been the insufficiency of the various routes of administration to distribute the compounds to their target as long as the invasion of the circulation is prevented and therefore, other tissues not selected as targets that, in this way, they produce excess side effects. Most in vivo experiments using antisense oligonucleotides comprised a direct application of the oligo to the limited regions of the brain. See, C. Wahlestedt, Trends in Pharmacol. Sci. 15: 42-46 (1994); J. Lai et al., Neuroreport 5: 1049-1052 (1994); K. Standifer et al., Neuron 12: 805-810 (1994); A. Akabayashi et al., Brain Res. 21: 55-61 (1994). Others applied them in the spinal fluid. See, for example, L. Tseng et al., European J. Pharmacol. 258: Rl-3 (1994); R. Raffa et al., European. Pharmacol. 258: R5-7 (1994); F. Gillardon et al., European J. Neurosci, 6: 880-884 (1994). These applications, clearly, have no clinical utility due to their invasive nature. In this way, the systemic administration of the antisense oligonucleotides has significant problems with respect to their pharmacological application, nor by any means of which is the difficulty in selectively targeting the tissues comprised in the disease. The systemic administration of the anti-sense oligonucleotides also has significant problems with respect to their pharmacological application, nor by any means of which is the difficulty in selection as targets selectively in the tissues comprised in the disease. The respiratory system, and in particular the lung, as the final port of entry into the body, however, is an excellent route of administration for anti-sense oligonucleotides. This is not only for the treatment of lung disease, but also when the lung is used as a means of distribution, particularly because of its non-invasive and tissue-specific nature. In this way, the local distribution of anti-sense oligonucleotides directly to the target tissue allows the therapeutic use of these compounds. Fomivirsen (ISIS 2302) is an example of a local distribution of drug in the eye to treat cytomegalovirus rhinitis (CMV), for which a new drug application has been filed by ISIS. The administration of a drug through the lung offers the additional advantage by inhalation is non-invasive while direct injection into the vitreous of the eye is invasive. The composition and formulations of this invention have been shown to have excellently high efficacy in preventing and treating a condition disease associated with bronchoconstriction, difficult breathing, blocked and obstructed lung areas, allergy (s) and / or inflammation. The examples given below show a complete inhibition of these symptoms associated with the adenosine receptor in the rabbit model for human bronchoconstriction, allergy (s) and inflammation as well as the elimination of the ability of the adenosine receptor agonist par excellence, adenosine , to cause bronchoconstriction in hypersensitive monkeys, which are animal models for human hypersensitivity to adenosine receptor agonists. The pharmaceutical composition and formulations of the invention, therefore, are suitable for preventing and alleviating the symptoms associated with the stimulation of adenosine receptors, such as A adenosine receptors. The compositions and formulations of this invention, in this manner, are not suitable for preventing adverse side aspects of adenosine-mediated hypersensitivity in certain individuals, which is generally seen to affect respiratory activity. Examples of diseases and conditions, which can be treated prophylactically, prophylactically and therapeutically with the compositions and formulations of this invention, are pulmonary vasoconstriction, inflammation, allergies, asthma, impaired respiration, acute respiratory distress syndrome (ARDS), damage or pulmonary, cardiac and renal failure, for example, associated with ischemia as well as the administration of certain drugs, side effects associated with the administration of adenosine, for example, in supraventricular tachycardia (SVT) and stress or strain tests with adenosine, infant respiratory distress syndrome (infantile RDS), pain, cystic fibrosis (CF), pulmonary hypertension, pulmonary vasoconstriction due to allergic rhinitis, emphysema, obstructive pulmonary disease, chronic (COPD), and cancers such as leukemias, lymphomas, carcinomas, and the like, for example, colon cancer, breast cancer, lung cancer, pancreatic cancer, hepatocellular carcinoma, kidney cancer, melanoma , hepatic metastases, etc., as well as other metastatic cancers, for example, cancers that metastasize to the lung (s), breast and prostate. The present compositions and formulations are suitable for administration before, during and after other treatments, including radiation, chemotherapy, antibody therapy, phototherapy and cancer, and other types of surgery. The present compositions and formulations can also be effectively administered as a substitute for therapies that have significant, negative, side effects. All nucleotide sequences are represented in this patent by an individual strand only, and in the 5 'to 31 direction, from left to right. All amino acids and nucleotides are represented in the manner recommended by the IUPAC-IUB Biochemical Nomenclature commission, or (for amino acids) by the three-letter code, in accordance with 37 CFR § 1.822 and the established use. See, for example, Patentln User Manual, 99-102 (Nov. 1990) (North American Patent and Trademark Office, Office of the Assistant Patent Commissioner, Washington, D.C. 20231); U.S. Patent No. 4,871,670 to Hudson et al., In column 3, lines 20-43. Relevant sections of the descriptions of the aforementioned, and all other patents and references cited in this patent are not incorporated herein by reference. The method of the present invention can be used as well as to reduce damage or heart failure, pulmonary and renal, mediated by adenosine, which results from any reason, including, but not limited to, ischemia, septicemia, septic shock, and the like, administration of certain compounds such as radiocontrast agent used for imaging and diagnostic purposes, many of which have metal atoms, adenosine used to treat SVT and in stress or strain tests, and the like. The method of the present invention can also be used to reduce the bronchoconstriction associated with the adenosine receptor in the lungs of a subject for any reason, including, but not limited to, bronchoconstriction allergy (s) and / or inflammation, such as those associated with COPD. , ARDS, allergic rhinitis, pulmonary vasoconstriction, asthma, the administration of certain exogenous agents, pain, CF, emphysema, and cancer, among others. The compositions and formulations of the invention comprise a surfactant and an oligonucleotide which is anti-sense to the A ^ Ab and A3 adenosine receptors which have been shown to be effective in the down-regulation of adenosine receptors ^, A_a, A2b or A3 , respectively, in the cell. Others that are anti-sense to the adenosine A_a receptor are also effective as long as they have some adenosine inhibitory activity or A_a adenosine agonist activity. Similarly, the non-nucleic acid agonists A_a are suitable. A new . .. *. The treatment characteristic, compared to the additional treatments for adenosine-mediated bronchoconstriction and other symptoms, is that the compositions and formulations of this invention can be administered directly into the respiratory system of an individual, and even to his or her lungs. In addition, the present treatment can reduce the amount or level of a receptor protein itself instead of only acting on the receptor as in the case with the treatments and / or where the agent is only an antagonist acting at the receptor site. The selective characteristic of the present compositions and formulations together with their administration by a selected route results in reduced toxicity. The present composition, formulations and preventive, maintenance and therapeutic methods were designed to be applied to the treatment of side effects produced by either the exogenous administration of adenosine, and other agents having undesired adenosine-like effects, described herein, or of agents that produce an endogenous release of adenosine. The agent of the invention can be administered either alone or with other therapeutic agents at diagnosis including adenosine, dipyrimidol, other adenosine receptor stimulants, adenosine releasing agents, etc. The present compositions and formulations for systemic and topical administration may be administered prior to, in conjunction with, or subsequent to the administration of adenosine or other active agents to the adenosine receptor. The present inventors unexpectedly found that the agents of the invention, particularly those that have at least some inhibitory activity on the adenosine Ax receptor, strongly inhibit, and in some cases end, with 100% efficacy, the ability of adenosine to cause bronchoconstriction in the hypersensitive airways. The experimental work, some of which is provided in the examples of this patent, has shown a complete interference with, and cessation of, the ability of adenosine to induce bronchoconstriction and other unwanted side effects associated with its activity in the adenosine receptor (s) in each of the two animal models of bronchial hyperresponsiveness, human: hypersensitive rabbit model and a cinamólogus, hypersensitive monkey model, both of which are widely known by the scientific community as models for human adenosine hypersensitivity. The agents of this invention, therefore, have been shown to prevent the adverse side effects of adenosine in the hypersensitive lung mediated via an adenosine Ax receptor. The suppression of the side effects of adenosine seen in the administration of the agent is clearly applicable to the treatment of subjects hyper-sensitized together with adenosine or by themselves, either before, simultaneously with, or subsequent to the administration of adenosine to afflicted subjects. with SVT. In addition, the present agents are also effective for administration to subjects who need to undergo the stress or strain test with adenosine but who before this invention, were prevented from the benefits associated with the administration of this test. The present example now allows the free administration of adenosine or adenosine type agents to people with asthma and other respiratory diseases by preventing or alleviating the bronchial, allergic and / or inflammatory side effects produced by them. To summarize, adenosine is a natural nucleotide used in the treatment of paroxysmal supraventricular tachycardia (PSVT or SVT), including SVT associated with Wolff-Parkinson-White Syndrome, and as a pharmacological means to assess cardiovascular health via a stress and strain test with adenosine. Many patients with SVT and carbohydrates for stress or stress testing with adenosine have hypersensitive airways associated with over-expression of adenosine receptors, particularly the adenosine receptor. When activated by adenosine, the Ax receptor can cause life-threatening, and in some cases even fatal, bronchoconstriction in the hypersensitive airways. The present invention, therefore, allows the therapeutic and diagnostic uses of adenosine in subjects and in whose health and also those who have been previously threatened by the administration of adenosine, such as asthmatics of those afflicted by other conditions associated with hyperosinemia. -sensitivity to this compound.

One of the present agents, ie, Oligo I (SEQ ID NO: 1; EPI 2010) was shown to be effective in the one-time elimination with virtually 100% efficiency, the ability of adenosine to induce bronchoconstriction in hyper-sensitive airways. The complete termination of the ability of adenosine to induce bronchoconstriction is mixed in the example description in two animal models of human bronchial hyperresponsiveness: the hyper-sensitive rabbit and the hyper-sensitive, cinnamic monkey. The oligos of this invention, therefore, are suitable to prevent adverse side aspects of the administration of adenosine in the hyper-responsive lung. As used herein, the terms "prevent", "prevent", "treat" or "treat" refer to a preventive and therapeutic treatment that decreases the likelihood that the subject administered with this treatment manifests symptoms associated with the treatment. stimulation and the adenosine receptor. The term "slowly regulate" refers to inducing a decrease in production, secretion or availability and thus, a decrease in the concentration of the adenosine A ^, A_b or A3 receptor, intracellular or an increase in the concentration of the A2a adenosine receptor. At least it adapts the use of A2a agonists.

Although the present invention relates mainly to the treatment of human subjects, it is also applicable to the treatment of animals, such as other vertebrates, including mammals, large and small, wild and domesticated pets, for example dogs and cats, for veterinary purposes. In general, "anti-sense" refers to oligonucleotides, often synthetic, small, that resemble the individual strand DNA, targeted to a specific gene, its flanking regions, mRNA or protein encoded by the gene and mRNA, which is it can be used to inhibit gene expression by inhibiting the function of white messenger RNA (mRNA). Milligan, J. F. et al., J. Med. Chem. 36 (14), 1937 (1993). The present invention is thus proposed to inhibit the gene expression of the adenosine receptor ^, A2b or A3 as well as to promote gene expression of the adenosine A_a receptor. As is generally known in the art, inhibition of gene expression must be brought about by hybridization of the anti-ser.Lido oligonucleotide to the coding sequences (homosense) in a specific, white, messenger RNA (mRNA) by example, by hydrogen bonding in accordance with the Watson-Crick base mating rules. In general, exogenously administered anti-sense oligos decrease mRNA and protein levels of the target gene or cause changes in growth characteristics or forms of • the cells. Ibid. See, also Helene, C. and Toulme, J., Biochim. Biophys. Acta 1049: 99-125 (1990); Cohen, J. S., Ed., Oligodeoxynucleotides as Anti-sense Inhibitors of Gene 5 Expression; CRC Press: Boca Ratón, FL (1987). As used herein, "antisense adenosine receptor oligonucleotide (oligo)" is a short sequence of synthetic nucleotides that (1) hybridizes to any coding sequence in an mRNA that encodes a Adenosine receptor, for example, the A * -, A_b or 3 adenosine receptor, under in vivo hybridization conditions described below, and that (2) in hybridization causes a decrease in gene expression of the receptor ^, A_b or Aj of adenosine. As used in this patent, a A_ adenosine agonist is any compound or agent that activates an agonist response mediated by A2a or increases the level of A2a receptor. As used in this patent, an A_a adenosine agonist is any compound or agent that activates an agonist response mediated by A_a or increases the level of the receiver A_a. The mRNA sequence of the A ^, A2a A_b and A3 adenosine receptors can be derived from the DNA base sequence of the genes expressing any adenosine receptor? - - A3 and A3. The receptor sequence ^ of , human, genomic adenosine is known and described in U.S. Patent No. 5,320,962 to G. Stiles' et al. The A_b adenosine receptor is also known. See, • for example, GenBank, Accession No. X68486; GenBank Access No. X68487. The adenosine receptor 3 has been cloned, sequenced and expressed in rats and humans. See, F. Zhou et al., Proc. Nat'l. Acad. Sci. (USA) 89: 7432 (1992); M.A. Jacobson et al., U.S. Patent Application No. 9304582.1 (1993). The anti-sense oligonucleotides that regulate the production of the receptor in a lentifying way A ^, A_b and A3 of adenosine and accelerating the adenosine A_a receptor and accelerating the adenosine A_a receptor can be introduced according to normal techniques. A_a adenosine agonists are known in the art and do not need to be polished in the present. The agent of this invention binds specifically with any sequence of a molecule of • mRNA that is associated with or codes for a A ^, A ^, A2b or A3 adenosine receptor, and prevents translation of the mRNA molecule. One embodiment of the present invention of the anti-sense oligonucleotide has one of the following sequences. In another preferred embodiment, the agent of the invention comprises fragments of these sequences or combinations thereof as well as sequences with decreased adenosine contents compared to natural sequences, where one or more adenosines are replaced by a universal or adenosine analog base that does not activate adenosine receptors, particularly A ^ - adenosine receptors.

'-GAT GGA GGG CGG CAT GGC GGG-3' (SEQ ID No. 1) 5 '-GTT GTT GGG CAT CTT GCC-3' (SEQ ID No. 3) 5 i _GTG GGC CTA GCT CTC GCC-3 ' (SEQ ID No. 5) In yet another embodiment, oligos that are anti-sense to the adenosine A_a receptor and have agonistic activity and other A_a adenosine receptor agents are used for the treatment of RDS and other respiratory problems in premature infants. In another embodiment of the invention, the antisense oligonucleotide sequence puts the initiation codon of the A- receptor in parentheses. of adenosine, for example, that of the receptor mRNA, human. The anti-sense antisense oligonucleotide of the human adenosine receptor, human, preferred may have SEQ ID NO: 7 any of its fragments, including one of the following sequences. In another preferred embodiment, fragments of these sequences and / or combinations thereof are also within the limits of the invention. 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (SEQ ID No. 7), 5'-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-31 (Fragment 1) (SEQ ID No. 8) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGTG CAT GGC GGG CAC AGG CTG G-31 (Fragment 2) (SEQ ID No. 9) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 3) (SEQ ID No. 10) 5' -GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 4) (SEQ ID No. 11) 5' -GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 5) (SEQ ID No. 12) 5' -GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 6) (SEQ ID No. 13) 5' -GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-31 (Fragment 7) (SEQ ID No. 14) 5 »-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 8) (SEQ ID No. 15) 5' -GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 9) (SEQ ID No. 16) 5' -GGC GGC CTG GAA AGC TGA GAT GGG GGG CGG CAT GGC GGG CA- 3! (Fragment 10) (SEQ ID No. 17) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 11) (SEQ ID No. 18) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3' (Fragment 12) (SEQ ID No.19) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 ' (Fragment 13) (SEQ ID No. 20) • 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3' (Fragment 14) (SEQ ID No. 21) 5 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC-3' (Fragment 15) (SEQ ID No. 22) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GG-3' (Fragment 16) (SEQ ID No. 23) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT G-3' 10 (Fragment 17) (SEQ ID No. 24) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT-3 ' (Fragment 18) (SEQ ID No. 25) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CA-3' (Fragment 19) (SEQ ID No. 26) 15 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG C-3' (Fragment ) (SEQ ID No. 27) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG-3' (Fragment 21) (SEQ ID No. 28) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CG-3' (Fragment 22) 20 (SEQ ID No. 29) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG C -3 '(Fragment 23) (SEQ ID No. 30) 5' -GGC GGC CTG GAA AGC TGA GAT GGA GGG-3 '(Fragment 24) (SEQ ID No. 31) 25 5' -GGC GGC CTG GAA AGC TGA GAT GGA GG-3 '(Fragment 25) (SEQ ID No. 32) 5' -GGC GGC CTG GAA AGC TGA GAT GGA G-3 * (Fragment 26) (SEQ ID No. 33) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA-3 '(Fragment 27) (SEQ ID No. 34) 5' -GGC GGC CTG GAA AGC TGA GAT GG-3 '(Fragment 28) (SEQ ID No. 35) 5' -GGC GGC CTG GAA AGC TGA GAT G-3 '(Fragment 29) (SEQ ID No. 36) 5' -GGC GGC CTG GAA AGC TGA GAT-3 '(Fragment 30) (SEQ ID No. 37) 5' -GGC GGC CTG GAA AGC TGA GA-3 '(Fragment 31) (SEQ ID No. 38) 5' -GGC GGC CTG GAA AGC TGA G-3 '(Fragment 32) (SEQ ID No. 39) 5' -GGC GGC CTG GAA AGC TGA- 3 '(Fragment 33) (SEQ ID No. 40) 5 '-GGC GGC CTG GAA AGC TG-3' (Fragment 34) (SEQ ID No. 41) '-GGC GGC CTG GAA AGC T-3' (Fragment 35) (SEQ ID No. 42) 5 '-GGC GGC CTG GAA AGC-3' (Fragment 36) (SEQ ID No. 43) 5 '-GGC GGC CTG GAA AG-3 '(Fragment 37) (SEQ ID No. 44) 5' -GGC GGC CTG GAA A-3 '(Fragment 38) (SEQ ID No. 45) 5' -GGC GGC CTG GAA-3 '( Fragment 39) (SEQ ID No. 46) 5 '-GGC GGC CTG GA-3' (Fragment 40) (SEQ ID No. 47) 5 '-GGC GGC CTG G-3' (Fragment 41) (SEQ ID No. 48) 5 '-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 42) (SEQ ID No. 49) 5' -GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 43) (SEQ ID No. 50) 5' -GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3! (Fragment 44) (SEQ ID No. 51) 5 '-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 45) (SEQ ID No. 52) 5' -GC GGC CG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-31 (Fragment 46) (SEQ ID No. 53) 5 ' -GC GGC CG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 47) (SEQ ID No. 54) 5'-GC GGC CG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 48) (SEQ ID No. 55) 5' -GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 49) (SEQ ID No. 56) 5' -GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 50) (SEQ ID No. 57) 5' -GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 51) (SEQ ID No. 58) 5'-GC GGC CTG GAA AGC TGA GAT GGG GGG CGG CAT GGC GGG CA-3 ' (Fragment 52) (SEQ ID No. 59) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3 ' (Fragment 53) (SEQ ID No. 60) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3 '(Fragment 54) (SEQ ID No. 61) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 ' (Fragment 55) (SEQ ID No. 62) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3 '(Fragment 56) (SEQ ID No. 63) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC-3 ' (Fragment 57) (SEQ ID No. 64) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GG-3 ' (Fragment 58) (SEQ ID No. 65) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT G-3 ' (Fragment 59) (SEQ ID No. 66) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT-3 '(Fragment 60) (SEQ ID No. 67) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CA-3 '(Fragment 61) (SEQ ID No. 68) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG C-3 '(Fragment 62) (SEQ ID No. 69) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CGG-3 '(Fragment 63) (SEQ ID No. 70) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG CG-3 '(Fragment 64) (SEQ ID No. 71) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG C-3 • (Fragment 65) (SEQ ID No. 72) 5'-GC GGC CTG GAA AGC TGA GAT GGA GGG-3 '(Fragment 66) (SEQ ID No. 73) 5'-GC GGC CTG GAA AGC TGA GAT GGA GG-3' (Fragment 67) (SEQ ID No. 74) 5'-GC GGC CTG GAA AGC TGA GAT GGA G-3 '(Fragment 68) (SEQ ID No. 75) 5'-GC GGC CTG GAA AGC TGA GAT GGA-3 '(Fragment 69) (SEQ ID No. 76) 5'-GC GGC CTG GAA AGC TGA GAT GG-3 '(Fragment 70) (SEQ ID No. 77) 5'-GC GGC CTG GAA AGC TGA GAT G-3 '(Fragment 71) (SEQ ID No. 78) 5'-GC GGC CTG GAA AGC TGA GAT-3' (Fragment 72) (SEQ ID No . 79) 5'-GC GGC CTG GAA AGC TGA GA-3 '(Fragment 73) (SEQ ID No. 80) 5'-GC GGC CTG GAA AGC TGA G-3 '(Fragment 74) (SEQ ID No. 81) 5'-GC GGC CTG GAA AGC TGA-3 '(Fragment 75) (SEQ ID No. 82) '-GC GGC CTG GAA AGC TG-3 '(Fragment 76) (SEQ ID No. 83) '-GC GGC CTG GAA AGC T-3 '(Fragment 77) (SEQ ID No. 84) 5'-GC GGC CTG GAA AGC-3' (Fragment 78) (SEQ ID No. 85) '-GC GGC CTG GAA AG-3 '(Fragment 79) (SEQ ID No. 86) '-GC GGC CTG GAA A-3 '(Fragment 80) (SEQ ID No. 87) 5'-GC GGC CTG GAA-3' (Fragment 81) (SEQ ID No. 88) 5'-GC GGC CTG GA -3 '(Fragment 82) (SEQ ID No. 89) 5'-C GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 86) (SEQ ID No. 90) 5 ' -CGGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 84) (SEQ ID No. 91) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-31 (Fragment 85) (SEQ ID No. 92) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 86) (SEQ ID No. 93) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 87) (SEQ ID No. 94) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 88) (SEQ ID No. 95) 5' -C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 89) (SEQ ID No. 96) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3' (Fragment 90) (SEQ ID No. 97) 5'- C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A- 3 '(Fragment 91) (SEQ ID No. 98) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3' (Fragment 92) (SEQ ID No. 99) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 ' (Fragment 93) (SEQ ID No. 100) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3 ' (Fragment 94) (SEQ ID No. 101) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3 '(Fragment 95) (SEQ ID No. 102) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 ' (Fragment 96) ((SEQ ID No. 103) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3 ' (Fragment 97) (SEQ ID No. 104) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GGC-3 ' (Fragment 98) (SEQ ID No. 105) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT GG-3 ' (Fragment 99) (SEQ ID No. 106) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CAT G-3 '(Fragment 100) (SEQ ID No. 107) 5'-C GGC GTG GAA AGC TGA GAT GGG GGG CGG CAT-3 '(Fragment 101) (SEQ ID NO.108) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG CA-3 '(Fragment 102) (SEQ ID NO: 109) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG C-3 '(Fragment 103) (SEQ ID NO: 110) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CGG-3 '(Fragment 104) (SEQ ID No. 111) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG CG- 3 '(Fragment 105) (SEQ ID No. 112) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG C-3' (Fragment 106) (SEQ ID No. 113) 5'-C GGC GTG GAA AGC TGA GAT GGA GGG-3 '(Fragment 107) (SEQ ID No. 114) 5'-C GGC GTG GAA AGC TGA GAT GGA GG-3' (Fragment 108) (SEQ ID No. 115) 5'-C GGC GTG GAA AGC TGA GAT GGA G-3 '(Fragment 109) (SEQ ID No. 116) 5'-C GGC GTG GAA AGC TGA GAT GGA-3 '(Fragment 110) (SEQ ID No. 117) 5'-C GGC GTG GAA AGC TGA GAT GG-3' (Fragment 111) (SEQ ID No. 118) 5'-C GGC GTG GAA AGC TGA GAT G-3 '(Fragment 112) (SEQ ID No. 119) 5'-C GGC GTG GAA AGC TGA GAT-3 '(Fragment 113) (SEQ ID No. 120) 5'-C GGC GTG GAA AGC TGA GA-3 '(Fragment 114) (SEQ ID No. 121) 5'-C GGC GTG GAA AGC TGA G-3 '(Fragment 115) (SEQ ID No. 122) 5'-C GGC GTG GAA AGC TGA-3' (Fragment 116) (SEQ ID No. 123) '-C GGC GTG GAA AGC TG-3 '(Fragment 117) (SEQ ID No. 124) '-C GGC GTG GAA AGC T-3 '(Fragment 118) (SEQ ID No. 125) '-C GGC GTG GAA AGC-3 * (Fragment 119) (SEQ ID No. 126) 5'-C GGC GTG GAA AG-3 '(Fragment 120) (SEQ ID No. 127)' '-C GGC GTG GAA A-3 '(Fragment 121) (SEQ ID No. 128) '-C GGC GTG GAA-3 '(Fragment 122) (SEQ ID No. 129) '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 123) (SEQ ID No. 130) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 124) (SEQ ID No. 131 5' -GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 125) (SEQ ID No. 132) 5' -GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AGG CTG-3 '(Fragment 126) (SEQ ID No. 133) 5' -GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AGG CT-3 '(Fragment 127) (SEQ ID No. 134) 5' -GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AGG C-3 '(Fragment 128) (SEQ ID No. 135) 5' - GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AGG-3 '(Fragment 129) (SEQ ID No. 136) 5' -GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC AG- 3 '(Fragment 130) (SEQ ID No. 137) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC A-3' (Fragment 131) (SEQ ID No. 138) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CAC-3' (Fragment 132) (SEQ ID No. 139) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG CA-3' (Fragment 133) (SEQ ID No. 140) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG "C-3" (Fragment 134) (SEQ ID No. 141) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GGG-3' (Fragment 135) (SEQ ID No. 142) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC GG-3' (Fragment 136) (SEQ ID No. 143) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GGC G-3 ' (Fragment 137) (SEQ ID No. 144) 5 '-GGC CTG GAA AGC TGA GAT GGG GCG CAT GGC-3' (Fragment 138) (SEQ ID No. 145) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT GG-3 '(Fragment 139) (SEQ ID No. 146) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT G-3' (Fragment 140) (SEQ ID No. 147) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CAT-3' (Fragment 141) (SEQ ID No. 148) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG CA-3' (Fragment 142) (SEQ ID No. 149) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG C-3' (Fragment 143) (SEQ ID No. 150) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG GCG-3 '(Fragment 144) (SEQ ID No. 151) 5' -GGC CTG GAA AGC TGA GAT GGA GGG GC-3 '(Fragment 145) (SEQ ID No. 152) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG G-3' (Fragment 146) (SEQ ID No. 153) 5 '-GGC CTG GAA AGC TGA GAT GGA GGG-3' (Fragment 147) (SEQ ID No. 154) 5 '-GGC CTG GAA AGC TGA GAT GGA GG-3' (Fragment 148) (SEQ ID No. 155) 5 '-GGC CTG GAA AGC TGA GAT GGA G-3' (Fragment 149) (SEQ ID No. 156) 5 '-GGC CTG GAA AGC TGA GAT GGA-3' (Fragment 150) (SEQ ID No. 157) 5 '-GGC CTG GAA AGC TGA GAT GG-3' (Fragment 151) (SEQ ID No. 158) 5 '-GGC CTG GAA AGC TGA GAT G-3' (Fragment 152) (SEQ ID No. 159) 5 '-GGC CTG GAA AGC TGA GAT-3' (Fragment 153) (SEQ ID * No. '160) 5' -GGC CTG GAA AGC TGA GA-3 * (Fragment 154) (SEQ ID No. 161) 5 '-GGC CTG GAA AGC TGA G-3' (Fragment 155) (SEQ ID No. 162) 5 '-GGC CTG GAA AGC TGA-3 • (Fragment 156) (SEQ ID No. 163) '-GGC CTG GAA AGC TG-3' (Fragment 157) (SEQ ID No. 164) '-GGC CTG GAA AGC T-3' (Fragment 158) (SEQ ID No. 165) '-GGC CTG GAA AGC-3' (Fragment 159) (SEQ ID No. 166) '-GGC CTG GAA AG-3' (Fragment 160) (SEQ ID No. 167) 5 '-GGC CTG GGA A-3' (Fragment 161) (SEQ ID No. 168) 5 '-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 162) (SEQ ID No. 169) 5' -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 163) (SEQ ID No. 170) 5' -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-31 (Fragment 164) (SEQ ID No. 171) 5 ' -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 165) (SEQ ID No. 172) 5' -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 166) (SEQ ID No. 173) 5' - GC CTG GAA AGC TGA GAT GGG GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 167) (SEQ ID No. 174) 5' -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG- 3 '(Fragment 168) (SEQ ID No. 175) 5' -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 ' (Fragment 169) (SEQ ID No. 176) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 ' (Fragment 170) (SEQ ID No. 177) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 171) (SEQ ID No. 178) 5'-GC CTG GAA AGC TGA GAT GGG GGG CGG CAT GGC GGG CA-3 ' (Fragment 172) (SEQ ID No. 179) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3 ' (Fragment 173) (SEQ ID No. 180) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3 ' (Fragment 174) (SEQ ID No. 181) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 ' (Fragment 175) (SEQ ID No. 182) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3 '(Fragment 176) (SEQ ID No. 183) 5' -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC-3 '(Fragment 177) (SEQ ID No. 184) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GG-3 '(Fragment 178) (SEQ ID No. 185) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT G-3 '(Fragment 179) (SEQ ID No. 186) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CAT-3 '(Fragment 180) (SEQ ID No. 187) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG CA-3 '(Fragment 181) (SEQ ID No. 188) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG C- 3 '(Fragment 182) (SEQ ID No. 189) 5'-GC CTG GAA AGC TGA GAT GGA GGG CGG -3 '(Fragment 183) (SEQ ID No. 190) 5'-GC CTG GAA AGC TGA GAT GGA GGG CG-3 '(Fragment 184) (SEQ ID No. 191) 5'-GC CTG GAA AGC TGA GAT GGA GGG C-3 '(Fragment 185) (SEQ ID No. 192) 5'-GC CTG GAA AGC TGA GAT GGA GGG-3 '(Fragment 186) (SEQ ID No. 193) 5'-GC CTG GAA AGC TGA GAT GGA GG-3' (Fragment 187) (SEQ ID No. 194) 5'-GC CTG GAA AGC TGA GAT GGA G-3 '(Fragment 188) (SEQ ID No. 195) 5'-GC CTG GAA AGC TGA GAT GGA-3 '(Fragment 189) (SEQ ID No. 196) 5'-GC CTG GAA AGC TGA GAT GG-3' (Fragment 190) (SEQ ID No. 197) 5'-GC CTG GAA AGC TGA GAT G-3 '(Fragment 191) (SEQ ID No. 198) 5'-GC CTG GAA AGC TGA GAT-3' (Fragment 192) (SEQ ID No. 199) 5'-GC CTG GAA AGC TGA GA-3 '(Fragment 193) (SEQ ID No. 200) 5'-GC CTG GAA AGC TGA G-3 '(Fragment 194) (SEQ ID No. 201) '-GC CTG GAA AGC TGA-3 '(Fragment 195) (SEQ ID No. 202) '-GC CTG GAA AGC TG-3 '(Fragment 196) (SEQ ID No. 203) '-GC CTG GAA AGC T-3 '(Fragment 197) (SEQ ID No. 204) '-GC CTG GAA AGC-3 '(Fragment 198) (SEQ ID No. 205) 5'-GC CTG GAA AG-3' (Fragment 199) (SEQ ID No. 206) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-31 (Fragment 200) (SEQ ID No. 207) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 201) (SEQ ID No. 208) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 202) (SEQ ID No. 209) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 203) (SEQ ID No. 210) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 204) (SEQ ID No. 211) 5'- C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 205) (SEQ ID No. 212) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 206) (SEQ ID No. 213) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 • (Fragment 207) (SEQ ID No. 214) 5'-C CTG GAA AGC TGA GAT GGG GGG CGG CAT GGC GGG CAC A-3 ' (Fragment 208) (SEQ ID No. 215) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 209) (SEQ ID No. 216) 5'-C CTG GAA AGC TGA GAT GGG GGG CGG CAT GGC GGG CA-3 ' (Fragment 210) (SEQ ID No. 217) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3 ' (Fragment 211) (SEQ ID No. 218) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3 ' (Fragment 212) (SEQ ID No. 219) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 * (Fragment 213) (SEQ ID No. 220) 5 * -C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3 '(Fragment 214) (SEQ ID No. 221) 5 * -C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC-3 '(Fragment 215) (SEQ ID No. 222) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT GG-3 '(Fragment 216) (SEQ ID No. 223) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT G-3 '(Fragment 217) (SEQ ID No. 224) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CAT -3 '(Fragment 218) (SEQ ID No. 225) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG CA-3 '(Fragment 219) (SEQ ID No. 226) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG C-3 * (Fragment 220) (SEQ ID No. 227) 5'-C CTG GAA AGC TGA GAT GGA GGG CGG -3 '(Fragment 221) (SEQ ID No. 228) 5'-C CTG GAA AGC TGA GAT GGA GGG CG-3 '(Fragment 222) (SEQ ID No. 229) 5'-C CTG GAA AGC TGA GAT GGA GGG C-3 * (Fragment 223) (SEQ ID No. 230) 5'-C CTG GAA AGC TGA GAT GGA GGG-3 '(Fragment 224) (SEQ ID No. 231) 5'-C CTG GAA AGC TGA GAT GGA GG-3' (Fragment 225) (SEQ ID No. 232) 5'-C CTG GAA AGC TGA GAT GGA G-3 '(Fragment 226) (SEQ ID No. 233) 5'-C CTG GAA AGC TGA GAT GGA-3 '(Fragment 227) (SEQ ID No. 234) 5'-C CTG GAA AGC TGA GAT GG-3 '(Fragment 228) (SEQ ID No. 235) 5'-C CTG GAA AGC TGA GAT G-3 '(Fragment 229) (SEQ ID No. 236) 5 * -C CTG GAA AGC TGA GAT-3' (Fragment 230) (SEQ ID No. 237) 5'-C CTG GAA AGC TGA GA-3 '(Fragment 231) (SEQ ID No. 238) * -C CTG GAA AGC TGA G-3 '(Fragment 232) (SEQ ID No. 239) 5'-C CTG GAA AGC TGA-3' (Fragment 233) (SEQ ID No. 240) '-C CTG GAA AGC TG-3 '(Fragment 234) (SEQ ID No. 241) '-C CTG GAA AGC T-3 '(Fragment 235) (SEQ ID No. 242) '-C CTG GAA AGC-3 '(Fragment 236) (SEQ ID No. 243) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 237) (SEQ ID No 244) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 238) (SEQ ID No. 245) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 239) (SEQ ID No. 246) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG- 3 '(Fragment 240) (SEQ ID No. 247) 5 * -CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 241) (SEQ ID No. 248) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 242 ) (SEQ ID No. 249) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 243) (SEQ ID No. 250) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3' (Fragment 244) (SEQ ID No. 251) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3' (Fragment 245) (SEQ ID No. 252) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 246) (SEQ ID No. 253) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 '(Fragment 247) (SEQ ID No. 254) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 248) (SEQ ID No. 255) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3 * (Fragment 249) ( SEQ ID No. 256) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3' (Fragment 250) (SEQ ID NO. 257) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3 * (Fragment 251) (SEQ ID No. 258) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC-3' (Fragment 252) (SEQ ID No. 259) 5 '-CTG GAA AGC TGA GAT GGA GGG CGG CAT GG- 3 '(Fragment 253) (SEQ ID No. 260) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT G-3 '(Fragment 254) (SEQ ID No. 261) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT-3 '(Fragment 255) (SEQ ID No. 262) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CA-3 '(Fragment 256) (SEQ ID No. 263) 5' -CTG GAA AGC TGA GAT GGA GGG CGG C-3 '(Fragment 257) (SEQ ID No. 264) 5' -CTG GAA AGC TGA GAT GGA GGG CGG -3 '(Fragment 258) (SEQ ID No. 265) 5 '-CTG GAA AGC TGA GAT GGA GGG CG-3' (Fragment 259) (SEQ ID No. 266) 5 '-CTG GAA AGC TGA GAT GGA GGG C-3' (Fragment 260) (SEQ ID No. 267) 5 '-CTG GAA AGC TGA GAT GGA GGG-3' (Fragment 261) (SEQ ID No. 268) 5 '-CTG GAA AGC TGA GAT GGA GG-3' (Fragment 262) (SEQ ID No. 269) 5 '-CTG GAA AGC TGA GAT GGA G-3' (Fragment 263) (SEQ ID No. 270) 5 '-CTG GAA AGC TGA GAT GGA-3' (Fragment 264) (SEQ ID No. 271) 5 '-CTG GAA AGC TGA GAT GG-3' (Fragment 265) (SEQ ID No. 272) 5 '-CTG GAA AGC TGA GAT G-3' (Fragment 266) (SEQ ID No. 273) 5 '-CTG GAA AGC TGA GAT-3' (Fragment 267) (SEQ ID No. 274) 5 '-CTG GAA AGC TGA GA-3' (Fragment 268) (SEQ ID No. 275) '-CTG GAA AGC TGA G-3' (Fragment 269) (SEQ ID No. 276) '-CTG GAA AGC TGA-3' (Fragment 270) (SEQ ID No. 277) '-CTG GAA AGC TG-3' (Fragment 271) (SEQ ID No. 278) 5 '-CTG GAA AGC T-3' (Fragment 272) (SEQ ID No. 279) 5 * -TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 273) (SEQ ID No. 280) 5' -TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 274) (SEQ ID No. 281) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 275) (SEQ ID No. 282) 5 '- TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 276) (SEQ ID No. 283) 5 * -TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 277) (SEQ ID No. 284) 5 * -TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 ' (Fragment 278) (SEQ ID No. 285) 5 * -TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 ' (Fragment 279) (SEQ ID No. 286) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 280) (SEQ ID No. 287) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 ' (Fragment 281) (SEQ ID No. 288) 5'-TG GAA AGC TGA GAT GGG GGG CGG CAT GGC GGG CAC-3 ' (Fragment 282) (SEQ ID No. 289) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 ' (Fragment 283) (SEQ ID No. 290) 5 '-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 284) (SEQ ID No. 291) 5 * -TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3 * (Fragment 285) (SEQ ID No. 292) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 '(Fragment 286) (SEQ ID No. 293) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3 '(Fragment 287) (SEQ ID No. 294) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT GGC-3 '(Fragment 288) (SEQ ID No. 295) 5 * -TG GAA AGC TGA GAT GGA GGG CGG CAT GG-3 '(Fragment 289) (SEQ ID No. 296) 5'-TG GAA AGC TGA GAT GGA GGG CGG CAT G- 3 '(Fragment 290) (SEQ ID No. 297) 5'-TG GAA AGC TGA GAT GGG CGG CAT-3' (Fragment 291) (SEQ ID No. 298) 5'-TG GAA AGC TGA GAT GGG GGG CGG CA-3 '(Fragment 292) (SEQ ID No. 299) 5 - TG GAA AGC TGA GAT GGA GGG CGG C-3 '(Fragment 293) (SEQ ID No. 300) 5'-TG GAA AGC TGA GAT GGA GGG CGG -3 »(Fragment 294) (SEQ ID No. 301) 5'-TG GAA AGC TGA GAT GGG CG-3 '(Fragment 295) (SEQ ID No. 302) 5'-TG GAA AGC TGA GAT GGG GGG C-3' (Fragment 296) (SEQ. ID No. 303),, '-TG GAA AGC TGA GAT GGA GGG-3 '(Fragment 297) (SEQ ID No. 304) 5'-TG GAA AGC TGA GAT GGA GG-3 '(Fragment 298) (SEQ ID No. 305) 5'-TG GAA AGC TGA GAT GGA G-3 '(Fragment 299) (SEQ ID No. 306) 5 * -TG GAA AGC TGA GAT GGA-3 '(Fragment 300) (SEQ ID No. 307) 5 * -TG GAA AGC TGA GAT GG-3' (Fragment 301) (SEQ ID No. 308) 5'-TG GAA AGC TGA GAT G-3 '(Fragment 302) (SEQ ID No. 309) '-TG GAA AGC TGA GAT-3 '(Fragment 303) (SEQ ID No. 310) 5'-TG GAA AGC TGA GA-3' (Fragment 304) (SEQ ID No. 311) '-TG GAA AGC TGA G-3 '(Fragment 305) (SEQ ID No. 312) '-TG GAA AGC TGA-3 '(Fragment 306) (SEQ ID No. 313) 5'-TG GAA AGC TG-3 • (Fragment 307) (SEQ ID No. 314) 5' -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 308) (SEQ ID No. 315) 5' -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 309) (SEQ ID No. 316) 5' -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 310) (SEQ ID No. 317) 5'- G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 ' (Fragment 311) (SEQ ID No. 318) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 ' (Fragment 312) (SEQ ID No. 319) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 313) (SEQ ID No. 320) 5 * -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 314) (SEQ ID No. 321) 5 * -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3' (Fragment 315) (SEQ ID No. 322) 5 * -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 316) (SEQ ID No. 323) 5 * -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3' (Fragment 317) (SEQ ID No. 324) 5 * -G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 '(Fragment 318) (SEQ ID No. 325) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3 '(Fragment 319) (SEQ ID No. 326) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3' (Fragment 320) (SEQ ID No. 327) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 '(Fragment 321) (SEQ ID No. 328) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3 * (Fragment 322) (SEQ ID No. 329) 5 * -G GAA AGC TGA GAT GGA GGG CGG CAT GGC-3 '(Fragment 323) (SEQ ID No. 330) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT GG- 3 '(Fragment 324) (SEQ ID No. 331) 5 * -G GAA AGC TGA GAT GGA GGG CGG CAT G-3 '(Fragment 325) (SEQ ID No. 332) 5'-G GAA AGC TGA GAT GGA GGG CGG CAT-3 '(Fragment 32 * 6) (SEQ ID No. 333) 5'-G GAA AGC TGA GAT GGA GGG CGG CA-3' (Fragment 327) (SEQ ID No. 334) 5'-G GAA AGC TGA GAT GGA GGG CGG C-3 '(Fragment 328) (SEQ ID No. 335) 5'-G GAA AGC TGA GAT GGA GGG CGG -3' (Fragment 329) ( I KNOW THAT ID No. 336) 5'-G GAA AGC TGA GAT GGA GGG CG-3 '(Fragment 330) (SEQ ID No. 337) 5'-G GAA AGC TGA GAT GGA GGG C-3 '(Fragment 331) (SEQ ID No. 338) 5'-G GAA AGC TGA GAT GGA GGG-3 '(Fragment 332) (SEQ ID No. 339) 5'-G GAA AGC TGA GAT GGA GG-3 '(Fragment 333) (SEQ ID No. 340) 5'-G GAA AGC TGA GAT GGA G-3' (Fragment 334) (SEQ ID No. 341) 5'-G GAA AGC TGA GAT GGA-3 * (Fragment 335) (SEQ ID No. 342) 5'-G GAA AGC TGA GAT GG-3 '(Fragment 336) (SEQ ID No. 343) * -G GAA AGC TGA GAT G-3 * (Fragment 337) (SEQ ID No. 344) * -G GAA AGC TGA GAT-3 '(Fragment 338) (SEQ ID No. 345) '-G GAA AGC TGA GA-3 '(Fragment 339) (SEQ ID No. 346) '-G GAA AGC TGA G-3 '(Fragment 340) (SEQ ID No. 347) 5'-G GAA AGC TGA-3' (Fragment 341) (SEQ ID No. 348) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 * (Fragment 342) (SEQ ID No. 349) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3' (Fragment 343) (SEQ ID No. 350) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 344) (SEQ ID No. 351) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 345) (SEQ ID No. 352) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 346) (SEQ ID No. 353) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 ' (Fragment 347) (SEQ ID No. 354) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 348) (SEQ ID No. 355) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3' (Fragment 349) (SEQ ID No. 356) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3' (Fragment 350) (SEQ ID No. 357) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3' (Fragment 351) (SEQ ID No. 358) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 '(Fragment 352) (SEQ ID No. 359) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 353) (SEQ ID No. 360) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3' (Fragment 354) (SEQ ID No. 361) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC GG- 3 '(Fragment 355) (SEQ ID No. 362) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC G-3' (Fragment 356) (SEQ ID No. 363) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT GGC-3 '(Fragment 357) (SEQ ID No. 364) 5 * -GAA AGC TGA GAT GGA GGG CGG CAT GG-3' (Fragment 358) (SEQ ID No. 365) 5 '-GAA AGC TGA GAT GGA GGG CGG CAT G -3 '(Fragment 359) (SEQ ID No. 366) 5' -GAA AGC TGA GAT GGA GGG CGG CAT-3 '(Fragment 360) (SEQ ID No. 367) 5 '-GAA AGC TGA GAT GGA GGG CGG CA-3' (Fragment 361) (SEQ ID No. 368) 5 '-GAA AGC TGA GAT GGA GGG CGG C-3' (Fragment 362) (SEQ ID No. 369) 5 '-GAA AGC TGA GAT GGA GGG CGG -3' (Fragment 363) (SEQ ID No. 370) 5 '-GAA AGC TGA GAT GGA GGG CG-3' (Fragment 364) (SEQ ID No. 371) 5 '-GAA AGC TGA GAT GGA GGG C-31 (Fragment 365) (SEQ ID No. 372) 5 * -GAA AGC TGA GAT GGA GGG-3 '(Fragment 366) (SEQ ID No. 373) 5' -GAA AGC TGA GAT GGA GG-3 * (Fragment 367) (SEQ ID No. 374) 5 '-GAA AGC TGA GAT GGA G-3' (Fragment 368) (SEQ ID No. 375) 5 '-GAA AGC TGA GAT GGA-3' (Fragment 369) (SEQ ID No. 376) '-GAA AGC TGA GAT' GG-3 '(Fragment 370) (SEQ ID No. 377) '-GAA AGC TGA GAT G-3' (Fragment 371) (SEQ ID No. 378) '-GAA AGC TGA GAT-3' (Fragment 372) (SEQ ID No. 379) '-GAA AGC TGA GA-3' (Fragment 373) (SEQ ID No. 380) 5 '-GAA AGC TGA G-3' (Fragment 374) (SEQ ID No. 381) 5 '-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 375) (SEQ ID No. 382) 5' -AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 ' (Fragment 376) (SEQ ID No. 383) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 ' (Fragment 377) (SEQ ID No. 384) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 ' (Fragment 378) (SEQ ID No. 385) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 * (Fragment 379) (SEQ ID No. 386) 5 '-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 ' (Fragment 380) (SEQ ID No. 387) 5 * -AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 ' (Fragment 381) (SEQ ID No. 388) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 382) (SEQ ID No. 389) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 ' (Fragment 383) (SEQ ID No. 390) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 384) (SEQ ID No. 391) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 '(Fragment 385) (SEQ ID No. 392) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3 '(Fragment 386) (SEQ ID No. 393) 5 '-AA AGC TGA GAT GGA GGG CGG CAT GGC GGG-3' (Fragment 387) (SEQ ID No. 394) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC GG-3 '(Fragment 388) (SEQ ID No. 395) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC G-3 '(Fragment 389) (SEQ ID No. 396) 5'-AA AGC TGA GAT GGA GGG CGG CAT GGC-3' ( Fragment 390) (SEQ ID No. 397) 5'-AA AGC TGA GAT GGA GGG CGG CAT GG-3 '(Fragment 391) (SEQ ID No. 398) 5 * -AA AGC TGA GAT GGA GGG CGG CAT G-3 * (Fragment 392) (SEQ ID No. 399) 5'-AA AGC TGA GAT GGA GGG CGG CAT-3 '(Fragment 393) (SEQ ID No. 400) 5'-AA AGC TGA GAT GGA GGG CGG CA-3 '(Fragment 394) (SEQ ID No. 401) 5 * -AA AGC TGA GAT GGA GGG CGG C-3' (Fragment 395) (SEQ ID No. 402) 5'-AA AGC TGA GAT GGA GGG CGG -3 '(Fragment 396) (SEQ ID No. 403) 5 * -AA AGC TGA GAT GGA GGG CG-3 '(Fragment 397) (SEQ ID No. 404) 5'-AA AGC TGA GAT GGA GGG C-3 * (Fragment 398) (SEQ ID No. 405) 5 * -AA AGC TGA GAT GGA GGG-3 '(Fragment 399) (SEQ ID No. 406) 5 * -AA AGC TGA GAT GGA GG-3' (Fragment 400) (SEQ ID No. 407) 5 * -AA AGC TGA GAT GGA G-3 * (Fragment 401) (SEQ ID No. 408) * -AA AGC TGA GAT GGA-3 * (Fragment 402) (SEQ ID No. 409) 5'-AA AGC TGA GAT GG-3 '(Fragment 403) (SEQ ID No. 410) '-AA AGC TGA GAT G-3 '(Fragment 404) (SEQ ID No. 411) '-AA AGC TGA GAT-3 '(Fragment 405) (SEQ ID No. 412) 5'-AA AGC TGA GA-3 * (Fragment 406) (SEQ ID No. 413) 5' -A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 407) (SEQ ID No. 414) 5 * -A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3' (Fragment 408) (SEQ ID No. 415) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 409) (SEQ ID No. 416) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 * (Fragment 410) (SEQ ID No. 417) 5' -A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 ' (Fragment 411) (SEQ ID No. 418) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3' (Fragment 412) (SEQ ID No. 419) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 ' (Fragment 413) (SEQ ID No. 420) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3' (Fragment 414) (SEQ ID No. 421) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3' (Fragment 415) (SEQ ID No. 422) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3' (Fragment 416) (SEQ ID No. 423) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 t (Fragment 417) (SEQ ID No. 424) 5' -A AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3 '(Fragment 418) (SEQ ID No. 425) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GGG-3' (Fragment 419) (SEQ ID No. 426) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC GG-3' (Fragment 420) (SEQ ID No. 427) 5 * -A AGC TGA GAT GGA GGG CGG CAT GGC G-3 '(Fragment 421) (SEQ ID No. 428) 5 '-A AGC TGA GAT GGA GGG CGG CAT GGC-3' (Fragment 422) (SEQ ID No. 429) 5 '-A AGC TGA GAT GGA GGG CGG CAT GG-3' (Fragment 423) (SEQ ID No. 430) 5 '-A AGC TGA GAT GGA GGG CGG CAT G-3' (Fragment 424) (SEQ ID No. 431) 5 '-A AGC TGA GAT GGA GGG CGG CAT-3' (Fragment 425) (SEQ ID No. 432) 5 '-A AGC TGA GAT GGA GGG CGG CA-3' (Fragment 426) (SEQ ID No. 433) 5 '-A AGC TGA GAT GGA GGG CGG C-3' (Fragment 427) (SEQ ID No. 434) 5 '-A AGC TGA GAT GGA GGG CGG -3' (Fragment 428) (SEQ ID.

No. 435) 5 '-A AGC TGA GAT GGA GGG CG-3' (Fragment 429) (SEQ ID No. 436) 5 '-A AGC TGA GAT GGA GGG C-3' (Fragment 430) (SEQ ID No. 437) 5 '-A AGC TGA GAT GGA GGG-3' (Fragment 431) (SEQ ID No. 438) 5 '-A AGC TGA GAT GGA GG-3 * (Fragment 432) (SEQ ID No. 439) 5' -A AGC TGA GAT GGA G-31 (Fragment 433) (SEQ ID No. 440) '-A AGC TGA GAT GGA-3' (Fragment 434) (SEQ ID No. 441) '-A AGC TGA GAT GG-3' (Fragment 435) (SEQ ID No. 442) * -A AGC TGA GAT G-3 '(Fragment 436) (SEQ ID No. 443) '-A AGC TGA GAT-3' (Fragment 437) (SEQ ID No. 444) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 438) (SEQ ID No. 445 ) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3' (Fragment 439) (SEQ ID No. 446) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 440) (SEQ ID No. 447) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 ' (Fragment 441) (SEQ ID No. 448) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 442) (SEQ ID No. 449) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3' (Fragment 443) (SEQ ID No. 450) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 444) (SEQ ID No. 451) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 * (Fragment 445) (SEQ ID No. 452) 5 * -AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 * (Fragment 446) (SEQ ID No. 453) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3' (Fragment 447) (SEQ ID No. 454) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CA-3' (Fragment 448) (SEQ ID No. 455) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 449) (SEQ ID No. 456) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG-3 '(Fragment 450) (SEQ ID No. 457) 5' -AGC TGA GAT GGG CGG CAT GGC GG-3 '(Fragment 451) (SEQ ID No. 458) 5' -AGC TGA GAT GGA GGG CGG CAT GGC G -3 '(Fragment 452) (SEQ ID No. 459) 5' -AGC TGA GAT GGA GGG CGG CAT GGC-3 '(Fragment 453) (SEQ ID No. 460) 5 '-AGC TGA GAT GGA GGG CGG CAT GG-3' (Fragment 454) (SEQ ID No. 461) 5 '-AGC TGA GAT GGA GGG CGG CAT G-3' (Fragment 455) (SEQ ID No. 462) 5 '-AGC TGA GAT GGA GGG CGG CAT-3 * (Fragment 456) (SEQ. ID No. 463) 5 '-AGC TGA GAT GGA GGG CGG CA-3' (Fragment 457) (SEQ ID No. 464) 5 '-AGC TGA GAT GGA GGG CGG C-3' (Fragment 458) (SEQ ID No. 465) 5 '-AGC TGA GAT GGA GGG CGG -3' (Fragment 459) (SEQ ID No. 466) 5 '-AGC TGA GAT GGA GGG CG-3' (Fragment 460) (SEQ ID No. 467) 5 '-AGC TGA GAT GGA GGG C-3' (Fragment 461) (SEQ ID No. 468) 5 '-AGC TGA GAT GGA GGG-3' (Fragment 462) (SEQ ID No. 469) '-AGC TGA GAT GGA GG-3' (Fragment 463) (SEQ ID No. 470) 5 '-AGC TGA GAT GGA G-3' (Fragment 464) (SEQ ID No. 471) 5 '-AGC TGA GAT GGA-3 '(Fragment 465) (SEQ ID No. 472) 5' -AGC TGA GAT GG-31 (Fragment 466) (SEQ ID No. 473) 5 '-AGC TGA GAT G-3' (Fragment 467) ( SEQ ID No. 474) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 468) (SEQ ID No. 475) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 ' (Fragment 469) (SEQ ID No. 476) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 ' (Fragment 470) (SEQ ID No. 477) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 ' (Fragment 471) (SEQ ID No. 478) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 ' (Fragment 472) (SEQ ID No. 479) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 * (Fragment 473) (SEQ ID No. 480) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 474) (SEQ ID No. 481) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 475) (SEQ ID No. 482) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 476) (SEQ ID No. 483) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 477) (SEQ ID No. 484) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG CA-3 '(Fragment 478) (SEQ ID No. 485) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG C- 3 '(Fragment 479) (SEQ ID No. 486) 5'-GC TGA GAT GGA GGG CGG CAT GGC GGG-3 * (Fragment 480) (SEQ ID No. 487) 5 * -GC TGA GAT GGA GGG CGG CAT GGC GG-3 '(Fragment 481) (SEQ ID No. 488) 5'-GC TGA GAT GGA GGG CGG CAT GGC G-3' (Fragment 482) (SEQ ID No. 489) 5 * -GC TGA GAT GGA GGG CGG CAT GGC-3 '(Fragment 483) (SEQ ID No. 490) 5'-GC TGA GAT GGA GGG CGG CAT GG-3' (Fragment 484) (SEQ ID No. 491) 5'-GC TGA GAT GGA GGG CGG CAT G-3 '(Fragment 485) (SEQ ID No. 492) 5'-GC TGA GAT GGA GGG CGG CAT-3 '(Fragment 486) (SEQ ID No. 493) 5'-GC TGA GAT GGA GGG CGG CA-3 * (Fragment 487) (SEQ ID No. ' 494) 5'-GC TGA GAT GGA GGG CGG C-3 '(Fragment 488) (SEQ ID No. 495) 5'-GC TGA GAT GGA GGG CGG -3' (Fragment 489) (SEQ ID.No. 496) 5'-GC TGA GAT GGA GGG CG-3 '(Fragment 490) (SEQ ID No. 497) 5'-GC TGA GAT GGA GGG C-3 '(Fragment 491) (SEQ ID No. 498) 5 * -GC TGA GAT GGA GGG-3' (Fragment 492) (SEQ ID No. 499) * -GC TGA GAT GGA GG-3 '(Fragment 493) (SEQ ID No. 500) '-GC TGA GAT GGA G-3 '(Fragment 494) (SEQ ID No. 501) '-GC TGA GAT GGA-3 '(Fragment 495) (SEQ ID No. 502) 5'-GC TGA GAT GG-3' (Fragment 496) (SEQ ID No. 503 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 ' (Fragment 497) (SEQ ID No. 504) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 ' (Fragment 498) (SEQ ID No. 505) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 ' (Fragment 499) (SEQ ID No. 506) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 ' (Fragment 500) (SEQ ID No. 507) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 501) (SEQ ID No. 508) 5 * -C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 ' (Fragment 502) (SEQ ID No. 509) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 503) (SEQ ID No. 510) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 504) (SEQ ID No. 511) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 505) (SEQ ID No. 512) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 • (Fragment 506) (SEQ ID No. 513) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CA- 3 '(Fragment 507) (SEQ ID No. 514) 5 * -C TGA GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 508) (SEQ ID No. 515 5'-C TGA GAT GGA GGG CGG CAT GGC GGG-3 '(Fragment 509) (SEQ ID No. 516) 5'-C TGA GAT GGA GGG CGG CAT GGC GG-3' (Fragment 510) (SEQ ID No. 517) 5 * -C TGA GAT GGA GGG CGG CAT GGC G-3 '(Fragment 511) (SEQ ID No. 518) 5'-C TGA GAT GGA GGG CGG CAT GGC-3' (Fragment 512) ( SEQ ID No. 519) 5'-C TGA GAT GGA GGG CGG CAT GG-3 '(Fragment 513) (SEQ ID No. 520) 5'-C TGA GAT GGA GGG CGG CAT G-3 '(Fragment 514) (SEQ ID No. 521) 5'-C TGA GAT GGA GGG CGG CAT-3 '(Fragment 515) (SEQ ID No. 522) 5'-C TGA GAT GGA GGG CGG CA-3 '(Fragment 516) (SEQ ID No. 523) 5 * -C TGA GAT GGA GGG CGG C-3' (Fragment 517) (SEQ ID No. 524) 5'-C TGA GAT GGA GGG CGG -3 '(Fragment 518) (SEQ ID No. 525) 5'-C TGA GAT GGA GGG CG-3 '(Fragment 519) (SEQ ID No. 526) * * 5 * -C TGA GAT GGA GGG C-3' (Fragment 520) (SEQ ID No. 527) '-C TGA GAT GGA GGG-3 '(Fragment 521) (SEQ ID No. 528) '-C TGA GAT GGA GG-3 '(Fragment 522) (SEQ ID No. 529) '-C TGA GAT GGA G-3 '(Fragment 523) (SEQ ID No. 530) 5 * -C TGA GAT GGA-3' (Fragment 524) (SEQ ID No. 531) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 ' (Fragment 525) (SEQ ID No. 532) 5 * -TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 ' (Fragment 526) (SEQ ID No. 533) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 527) (SEQ ID No. 534) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 528) (SEQ ID No. 535) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 529) (SEQ ID No. 536) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 530) (SEQ ID No. 537) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 * (Fragment 531) (SEQ ID No. 538) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC AG-3' (Fragment 532) (SEQ ID No. 539) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC A-3' (Fragment 533) (SEQ ID No. 540) 5 '-TGA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 534) (SEQ ID No. 541) 5' -TGA GAT GGA GGG CGG CAT GGC GGG CA-3 '(Fragment 535) (SEQ ID No. 542) 5' -TGA GAT GGA GGG CGG CAT GGC GGG C -3 '(Fragment 536) (SEQ ID No. 543) 5' -TGA GAT GGA GGG CGG CAT GGC GGG-3 '(Fragment 537) (SEQ ID No. 544) 5 '-TGA GAT GGA GGG CGG CAT GGC GG-3' (Fragment 538) (SEQ ID No. 545) 5 '-TGA GAT GGA GGG CGG CAT GGC G-3' (Fragment 539) (SEQ ID No. 546) 5 '-TGA GAT GGA GGG CGG CAT GGC-3' (Fragment 540) (SEQ ID No. 547) 5 '-TGA GAT GGA GGG CGG CAT GG-3' (Fragment 541) (SEQ ID No. 548) 5 '-TGA GAT GGA GGG CGG CAT G-3' (Fragment 542) (SEQ ID No. 549) 5 '-TGA GAT GGA GGG CGG CAT-3' (Fragment 543) (SEQ ID No. 550) 5 '-TGA GAT GGA GGG CGG CA-3' (Fragment 544) (SEQ ID No. 551) 5 '-TGA GAT GGA GGG CGG C-3' (Fragment 545) (SEQ ID No. 552) 5 '-TGA GAT GGA GGG CGG -3' (Fragment 546) (SEQ ID No. 553) '-TGA GAT GGA GGG CG-3' (Fragment 547) (SEQ ID No. 554) 5 '-TGA GAT GGA GGG C-3' (Fragment 548) (SEQ ID No. 555) 5 '-TGA GAT GGA GGG-3 '(Fragment 549) (SEQ ID No. 556) 5' -TGA GAT GGA GG-3 '(Fragment 550) (SEQ ID No. 557) 5' -TGA GAT GGA G-3 '(Fragment 551) (SEQ ID No. 558) 5 * -GA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 552) (SEQ ID No. 559) 5' -GA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 553) (SEQ ID No. 560) 5'-GA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 554) (SEQ ID No. 561) 5'-GA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 555) (SEQ ID No. 562) 5 * -GA GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 556) (SEQ ID No. 563) 5'-GA GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 557) (SEQ ID No. 564) 5'-GA GAT GGA GGG CGG CAT GGC GGG CAC AGG -3 '(Fragment 558) (SEQ ID No. 565) 5'-GA GAT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 559) (SEQ ID No. 566) 5'-GA GAT GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 560) (SEQ ID No. 567) 5'-GA GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 561) (SEQ ID No. 568) 5'-GA GAT GGA GGG CGG CAT GGC GGG CA-3 '(Fragment 562) (SEQ ID No. 569) 5'-GA GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 563) (SEQ ID No. 570) 5'-GA GAT GGA GGG CGG CAT GGC GGG-3 '(Fragment 564) (SEQ ID No. 571) 5'-GA GAT GGA GGG CGG CAT GGC GG-3 '(Fragment 565) (SEQ ID No. 572) 5'-GA GAT GGG CGG CAT GGC G-3 '(Fragment 566) (SEQ ID No. 573) 5'-GA GAT GGA GGG CGG CAT GGC-3 '(Fragment 567) (SEQ ID No. 574) 5'-GA GAT GGA GGG CGG CAT GG-3' (Fragment 568) (SEQ ID No. 575) 5'-GA GAT GGA GGG CGG CAT G-3 '(Fragment 569) (SEQ ID No. 576) 5'-GA GAT GGA GGG CGG CAT-3 '(Fragment 570) (SEQ ID No. 577) 5'-GA GAT GGA GGG CGG CA-3 '(Fragment 571) (SEQ ID No. 578) 5'-GA GAT GGA GGG CGG C-3 '(Fragment 572) (SEQ ID No. 579) 5'-GA GAT GGA GGG CGG -3' (Fragment 573) (SEQ ID No. 580) '-GA GAT GGA GGG CG-3 '(Fragment 574) (SEQ ID No. 581) '-GA GAT GGA GGG C-3 '(Fragment 575) (SEQ ID No. 582) '-GA GAT GGA GGG-3 '(Fragment 576) (SEQ ID No. 583) 5'-GA GAT GGA GG-3' (Fragment 577) (SEQ ID No. 584) 5 '-A GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 'i faith (Fragment 578) (SEQ ID No. 585) 5' -A GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 579) (SEQ ID No. 586) 5 '-A GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 580) (SEQ ID No. 587) 5 '-A GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 581) (SEQ ID No. 588) 5 * -A GAT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 582) (SEQ ID No. 589) 5 '-A GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3' (Fragment 583) (SEQ ID No. 590) 5 '-A GAT GGA GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 584) (SEQ ID No. 591) 5 '-A GAT GGA GGG CGG CAT GGC GGG CAC AG- 3 '(Fragment 585) (SEQ ID No. 592) 5' -A GAT GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 586) (SEQ ID No. 593) 5' -A GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 587) (SEQ ID No. 594) 5 '-A GAT GGA GGG CGG CAT GGC GGG CA-3' (Fragment 588) (SEQ ID No. 595) 5 '-A GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 589) (SEQ ID No. 596) 5 '-A GAT GGA GGG CGG CAT GGC GGG-3' (Fragment 590) (SEQ ID No. 597) 5 '-A GAT GGA GGG CGG CAT GGC GG-3' (Fragment 591) (SEQ ID No. 598) 5 '-A GAT GGA GGG CGG CAT GGC G-3' (Fragment 592) (SEQ ID No. 599) 5 '-A GAT GGA GGG CGG CAT GGC-3' (Fragment 593) (SEQ ID No. 600) 5 '-A GAT GGA GGG CGG CAT GG-3' (Fragment 594) (SEQ ID No. 601) 5 '-A GAT GGA GGG CGG CAT G-3' (Fragment 595) (SEQ ID No. 602) 5 '-A GAT GGA GGG CGG CAT-3' (Fragment 596) (SEQ ID No. 603) 5 * -A GAT GGA GGG CGG CA-3 '(Fragment 597) (SEQ ID No. 604) '-A GAT GGA GGG CGG C-3' (Fragment 598) (SEQ ID No. 605) 5 '-A GAT GGA GGG CGG -3' (Fragment 599) (SEQ ID No. 606) '-A GAT GGA GGG CG-3' (Fragment 600) (SEQ ID No. 607) '-A GAT GGA GGG C-3' (Fragment 601) (SEQ ID No. 608) '-A GAT GGA GGG-3' (Fragment 602) (SEQ ID No. 609) 5 '-GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 603) (SEQ ID No. 610) 5 '-GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3' (Fragment 604) (SEQ ID No. 611) 5 '-GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 * (Fragment 605) (SEQ ID No. 612) 5 * -GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 606) (SEQ ID No. 613) 5' -GAT GGA GGG CGG CAT GGC GGG CAC AGG CT- 3 '(Fragment 607) (SEQ ID No. 614) 5 '-GAT GGA GGG CGG CAT GGC GGG CAC AGG C-3' (Fragment 608) (SEQ ID No. 615) 5 '-GAT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 609) (SEQ ID No. 616) 5' -GAT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 610) (SEQ ID No. 617) 5' -GAT GGA GGG CGG CAT GGC GGG CAC A -3 '(Fragment 611) (SEQ ID No. 618) 5' -GAT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 612) (SEQ ID No. 619) 5 '-GAT GGA GGG CGG CAT GGC GGG CA-3' (Fragment 613) (SEQ ID No. 620) 5 '-GAT GGA GGG CGG CAT GGC GGG C-3' (Fragment 614) (SEQ ID No. 621) 5 '-GAT GGA GGG CGG CAT GGC GGG-3' (Fragment 615) (SEQ ID No. 622) 5 * -GAT GGA GGG CGG CAT GGC GG-3 '(Fragment 616) (SEQ ID No. 623) 5 '-GAT GGA GGG CGG CAT GGC G-3' (Fragment 617) (SEQ ID No. 624) 5 '-GAT GGA GGG CGG CAT GGC-3' (Fragment 618) (SEQ ID No. 625) 5 '-GAT GGA GGG CGG CAT GG-3 * (Fragment 619) (SEQ ID No. 626) 5' -GAT GGA GGG CGG CAT G-3 '(Fragment 620) (SEQ ID No. 627) 5' -GAT GGA GGG CGG CAT-3 '(Fragment 621) (SEQ ID No. 628) 5' -GAT GGA GGG CGG CA-3 '(Fragment 622) (SEQ ID No. 629) 5' -GAT GGA GGG CGG C-3 '(Fragment 623) (SEQ ID No. 630) 5' -GAT GGA GGG CGG -3 '(Fragment 624) ) (SEQ ID No. 631) 5 '-GAT GGA GGG CG-3' (Fragment 625) (SEQ ID No. 632) 5 * -GAT GGA GGG C-3 '(Fragment 626) (SEQ ID No. 633 5 '-AT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 627) (SEQ ID No. 634) 5'-AT GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 628) (SEQ ID No. 635) 5 '-AT GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 629) (SEQ ID No. 636) 5'-AT GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 630) (SEQ ID No. 637) 5'-AT GGA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 631) (SEQ ID No. 638) 5 * -AT GGA GGG CGG CAT GGC GGG CAC AGG C- 3 '(Fragment 632) (SEQ ID No. 639) 5'-AT GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 633) (SEQ ID No. 640) 5 * -AT GGA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 634) (SEQ ID No. 641) 5'-AT GGA GGG CGG CAT GGC GGG CAC A-3' (Fragment 635) (SEQ ID No. 642) 5'-AT GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 636) (SEQ ID No. 643) 5'-AT GGA GGG CGG CAT GGC GGG CA-3' (Fragment 637) (SEQ ID No. 644) 5'-AT GGA GGG CGG CAT GGC GGG C-3 '(Fragment 638) (SEQ ID No. 645) 5'-AT GGA GGG CGG CAT GGC GGG-3 '(Fragment 639) (SEQ ID No. 646) 5'-AT GGA GGG CGG CAT GGC GG-3 '(Fragment 640) (SEQ ID No. 647) 5'-AT GGA GGG CGG CAT GGC G-3 '(Fragment 641) (SEQ ID No. 648) 5'-AT GGA GGG CGG CAT GGC-3' (Fragment 642) (SEQ ID No. 649) 5 * -AT GGA GGG CGG CAT GG-3 '(Fragment 643) (SEQ ID No. 650) 5'-AT GGA GGG CGG CAT G-3 '(Fragment 644) (SEQ ID No. 651) '-AT GGA GGG CGG CAT-3 '(Fragment 645) (SEQ ID No. 652) * -AT GGA GGG CGG CA-3 '(Fragment 646) (SEQ ID No. 653) '-AT GGA GGG CGG C-3 '(Fragment 647) (SEQ ID No. 654) * -AT GGA GGG CGG -3 '(Fragment 648) (SEQ ID No. 655) 5 * -AT GGA GGG CG-3' (Fragment 649) (SEQ ID No. 656) 5'-T GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 650) (SEQ ID No. 657) 5'-T GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 651) (SEQ ID No. 658) 5'-T GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 652) (SEQ ID No. 659) 5 * -T GGA GGG CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 653) (SEQ ID No. 660) 5'-T GGA GGG CGG CAT GGC GGG CAC AGG CT- 3 • (Fragment 654) (SEQ ID No. 661) 5'-T GGA GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 655) (SEQ ID No. 662) 5'-T GGA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 656) (SEQ ID No. 663) 5'-T GGA GGG CGG CAT GGC GGG CAC AG-3"(Fragment 657) (SEQ ID No. 664) 5 * -T GGA GGG CGG CAT GGC GGG CAC A-3 '(Fragment 658) (SEQ ID No. 665) 5'-T GGA GGG CGG CAT GGC GGG CAC-3 '(Fragment 659) (SEQ ID No. 666) 5'-T GGA GGG CGG CAT GGC GGG CA-3' (Fragment 660) (SEQ ID No. 667) 5'-T GGA GGG CGG CAT GGC GGG C-3 '(Fragment 661) (SEQ ID No. 668) 5'-T GGA GGG CGG CAT GGC GGG-3 '(Fragment 662) (SEQ ID No. 669) 5'-T GGA GGG CGG CAT GGC GG-3 '(Fragment 663) (SEQ ID No. 670) 5'-T GGA GGG CGG CAT GGC G-3 '(Fragment 664) (SEQ ID No. 671) 5'-T GGA GGG CGG CAT GGC-3' (Fragment 665) (SEQ ID No. 672) 5'-T GGA GGG CGG CAT GG-3 '(Fragment 666) (SEQ ID No. 673) '-T GGA GGG CGG CAT G-3 '(Fragment 667) (SEQ ID No. 674) 5 * -T GGA GGG CGG CAT-3' (Fragment 668) (SEQ ID No. 675) '-T GGA GGG CGG CA-3 '(Fragment 669) (SEQ ID No. 676) '-T GGA GGG CGG C-3 '(Fragment 670) (SEQ ID No. 677) '-T GGA GGG CGG -3 '(Fragment 671) (SEQ ID No. 678) 5' -GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 672) SEQ ID No. 679) 5' - GGA GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 673) (SEQ ID No. 680) 5 '-GGA GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 674) (SEQ ID No. 681) 5 '-GGA GGG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 675) (SEQ ID No. 682) 5 '-GGA GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 676) (SEQ ID No. 683) 5 '-GGA GGG CGG CAT GGC GGG CAC AGG C-3' (Fragment 677) (SEQ ID No. 684) 5 '-GGA GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 678 ) (I KNOW THAT ID No. 685) 5 '-GGA GGG CGG CAT GGC GGG CAC AG-3' (Fragment 679) (SEQ ID No. 686) 5 '-GGA GGG CGG CAT GGC GGG CAC A-3' (Fragment 680) (SEQ ID No. 687) 5 '-GGA GGG CGG CAT GGC GGG CAC-3' (Fragment 681) (SEQ ID No. 688) 5 '-GGA GGG CGG CAT GGC GGG CA-3' (Fragment 682) (SEQ ID No. 689) 5 '-GGA GGG CGG CAT GGC GGG C-3' (Fragment 683) (SEQ ID No. 690) 5 '-GGA GGG CGG CAT GGC GGG-3' (Fragment 684) (SEQ ID No. 691) 5 '-GGA GGG CGG CAT GGC GG-3' (Fragment 685) (SEQ ID No. 692) 5 '-GGA GGG CGG CAT GGC G-3' (Fragment 686) (SEQ ID No. 693) 5 '-GGA GGG CGG CAT GGC-3' (Fragment 687) (SEQ ID No. 694) 5 '-GGA GGG CGG CAT GG-3' (Fragment 688) (SEQ ID No. 695) '-GGA GGG CGG CAT G-3' (Fragment 689) (SEQ ID No. 696) '-GGA GGG CGG CAT-3' (Fragment 690) (SEQ ID No. 697) '-GGA GGG CGG CA-3' (Fragment 691) (SEQ ID No. 698) 5 '-GGA GGG CGG C-3' (Fragment 692) (SEQ ID No. 699) 5'-GA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 693) (SEQ ID No. 700) 5 * -GA GGG CGG CAT GGC GGG CAC AGG CTG GG-3' (Fragment 694) (SEQ ID No. 701) 5 * -GA GGG CGG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 695) (SEQ ID No. 702 5'-GA GGG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 696) (SEQ ID No. 703) 5 ' -GA GGG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 697) (SEQ ID No. 704) 5'-GA GGG CGG CAT GGC GGG CAC AGG C-3' (Fragment 698) (SEQ ID No. 705) 5'-GA GGG CGG CAT GGC GGG CAC AGG-3 '(Fragment 699) (SEQ ID No. 706) 5'-GA GGG CGG CAT GGC GGG CAC AG-3 '(Fragment 700) (SEQ ID No. 707) 5'-GA GGG CGG CAT GGC GGG CAC A-3' (Fragment 701) (SEQ ID No. 708) 5'-GA GGG CGG CAT GGC GGG CAC-3 '(Fragment 702) (SEQ ID No. 709) 5'-GA GGG CGG CAT GGC GGG CA-3 '(Fragment 703) (SEQ ID No. 710) 5 * -GA GGG CGG CAT GGC GGG C-3 '(Fragment 704) (SEQ ID No. 711) 5'-GA GGG CGG CAT GGC GGG-3 '(Fragment 705) (SEQ ID No. 712) 5'-GA GGG CGG CAT GGC GG-3' (Fragment 706) (SEQ ID No. 713) 5 * -GA GGG CGG CAT GGC G-3 '(Fragment 707) (SEQ ID No. 714) '-GA GGG CGG CAT GGC-3 '(Fragment 708) (SEQ ID No. 715) 5'-GA GGG CGG CAT GG-3' (Fragment 709) (SEQ ID No. 716) '-GA GGG CGG CAT G-3 '(Fragment 710) (SEQ ID No. 717) '-GA GGG CGG CAT-3 '(Fragment 711) (SEQ ID No. 718) 5 * -GA GGG CGG CA-3' (Fragment 712) (SEQ ID No. 719) 5 '-A GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 713) (SEQ ID No. 720) 5' -A GGG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 714) (SEQ ID No. 721) 5 '-A GGG CGG CAT GGC GGG CAC AGG CTG G-3 * (Fragment 715) (SEQ ID No. 722) 5 '-A GGG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 716) (SEQ ID No. 723) 5 '-A GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 717) (SEQ ID No. 724) 5 '-A GGG CGG CAT GGC GGG CAC AGG C-3' (Fragment 718) (SEQ ID No. 725) 5 '-A GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 719) ( SEQ ID No. 726) 5 '-A GGG CGG CAT GGC GGG CAC AG-3' (Fragment 720) (SEQ ID No. 727) 5 '-A GGG CGG CAT GGC GGG CAC A-3 * (Fragment 721) ( SEQ ID No. 728) 5 '-A GGG CGG CAT GGC GGG CAC-3' (Fragment 722) (SEQ ID No. 729) 5 '-A GGG CGG CAT GGC GGG CA-3' (Fragment 723) (SEQ ID No. 730) 5 * -A GGG CGG CAT GGC GGG C-3 '(Fragment 724) (SEQ ID No. 731) 5 '-A GGG CGG CAT GGC GGG-3' (Fragment 725) (SEQ ID No. 732) 5 '-A GGG CGG CAT GGC GG-3' (Fragment 726) (SEQ ID No. 733) '-A GGG CGG CAT GGC G-3' (Fragment 727) (SEQ ID No. 734) '-A GGG CGG CAT GGC-3' (Fragment 728) (SEQ ID No. 735) '-A GGG CGG CAT GG-3' (Fragment 729) (SEQ ID No. 736) '-A GGG CGG CAT G-3' (Fragment 730) (SEQ ID No. 737) 5 '-A GGG CGG CAT-3' (Fragment 731) (SEQ ID No. 738) 5 '-GGG CGG CAT GGC GGG CAC AGG CTG. GGC-3 '(Fragment 732) (SEQ ID No. 739) 5 '-GGG CGG CAT GGC GGG CAC AGG CTG GG-3' (Fragment 733) (SEQ ID No. 740) 5 '-GGG CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 734) (SEQ ID No. 741) 5 '-GGG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 735) (SEQ ID No. 742) 5 '-GGG CGG CAT GGC GGG CAC AGG CT-3' (Fragment 736) (SEQ ID No. 743) 5 * -GGG CGG CAT GGC GGG CAC AGG C-3 '(Fragment 737) (SEQ ID No. 744) 5 '-GGG CGG CAT GGC GGG CAC AGG-3' (Fragment 738) (SEQ ID No. 745) 5 '-GGG CGG CAT GGC GGG CAC AG-3' (Fragment 739) (SEQ ID No. 746) 5 * -GGG CGG CAT GGC GGG CAC A-3 '(Fragment 740) (SEQ ID No. 747) 5 '-GGG CGG CAT GGC GGG CAC-3' (Fragment 741) (SEQ ID No. 748) 5 '-GGG CGG CAT GGC GGG CA-3' (Fragment 742) (SEQ ID No. 749) 5 '-GGG CGG CAT GGC GGG C-3' (Fragment 743) (SEQ ID No. 750) 5 '-GGG CGG CAT GGC GGG-3' (Fragment 744) (SEQ ID No. 751) '-GGG CGG CAT GGC GG-3' (Fragment 745) (SEQ ID No. 752) '-GGG CGG CAT GGC G-3' (Fragment 746) (SEQ ID No. 753) '-GGG CGG CAT GGC-3' (Fragment 747) (SEQ ID No. 754) '-GGG CGG CAT GG-3' (Fragment 748) (SEQ ID No. 755) 5 '-GGG CGG CAT G-3' (Fragment 749) (SEQ ID No. 756) 5'-GG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 750) (SEQ ID No. 757) 5'-GG CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 751) (SEQ ID No. 758) 5'-GG CGG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 752) (SEQ ID No. 759) 5'-GG CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 753 ) (I KNOW THAT ID No. 760) 5'-GG CGG CAT GGC GGG CAC AGG CT-3 '(Fragment 754) (SEQ ID No. 761) 5'-GG CGG CAT GGC GGG CAC AGG C-3' (Fragment 755) (SEQ ID No. 762) 5'-GG CGG CAT GGC GGG CAC AGG-3 • (Fragment 756) (SEQ ID No. 763) 5'-GG CGG CAT GGC GGG CAC AG-3 '(Fragment 757) (SEQ ID No. 764) 5 * -GG CGG CAT GGC GGG CAC A-3 '(Fragment 758) (SEQ ID No. 765) 5'-GG CGG CAT GGC GGG CAC-3 '(Fragment 759) (SEQ ID No. 766) 5'-GG CGG CAT GGC GGG CA-3' (Fragment 760) (SEQ ID No. 767) 5'-GG CGG CAT GGC GGG C-3 '(Fragment 761) (SEQ ID No. 768) '-GG CGG CAT GGC GGG-3 '(Fragment 762) (SEQ ID No. 769) 5'-GG CGG CAT GGC GG-3' (Fragment 763) (SEQ ID No. 770) '-GG CGG CAT GGC G-3 '(Fragment 764) (SEQ ID No. 771) '-GG CGG CAT GGC-3 '(Fragment 765) (SEQ ID No. 772) _ '-GG CGG CAT GG-3 '(Fragment 766) (SEQ ID No. 773) 5'-G CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 767) (SEQ ID No. 774) 5'- G CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 768) (SEQ ID No. 775) 5 * -G CGG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 769) (SEQ ID No. 776) 5'-G CGG CAT GGC GGG CAC AGG CTG-3 '(Fragment 770) (SEQ ID No. 777) 5'-G CGG CAT GGC GGG CAC AGG CT-3. * (Fragment 771) (SEQ ID No. 778) 5 * -G CGG CAT GGC GGG CAC AGG C-3 '(Fragment 772) (SEQ ID No. 779) 5'-G CGG CAT GGC GGG CAC AGG-3' (Fragment 773) (SEQ ID No . 780) 5'-G CGG CAT GGC GGG CAC AG-3 '(Fragment 774) (SEQ ID No. 781) 5'-G CGG CAT GGC GGG CAC A-3 • (Fragment 775) (SEQ ID No. 782) 5 * -G CGG CAT GGC GGG CAC-3 '(Fragment 776) (SEQ ID No. 783) 5 * -G CGG CAT GGC GGG CA-3 '(Fragment 777) (SEQ ID No.' 784) 5 * -G CGG CAT GGC GGG C-3 '(Fragment 778) (SEQ ID No. 785) '-G CGG CAT GGC GGG-3 '(Fragment 779) (SEQ ID No. 786) '-G CGG CAT GGC GG-3 '(Fragment 780) (SEQ ID No. 787) * -G CGG CAT GGC G-3 '(Fragment 781) (SEQ ID No. 788) '-GCG CAT GGC-3 '(Fragment 782) (SEQ ID No. 789) 5' -CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 783) (SEQ ID No. 790) 5' -CGG CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 784) (SEQ ID No. 791) 5 '-CGG CAT GGC GGG CAC AGG CTG G-3' (Fragment 785) (SEQ ID No. 792) 5 '-CGG CAT GGC GGG CAC AGG CTG-3' (Fragment 786) (SEQ ID.

No. 793) 5 '-CGG CAT GGC GGG CAC AGG CT-3' (Fragment 787) (SEQ ID No. 794) 5 '-CGG CAT GGC GGG CAC AGG C-3' (Fragment 788) (SEQ ID No. 795) 5 '-CGG CAT GGC GGG CAC AGG-3 * (Fragment 789) (SEQ ID No. 796) 5 * -CGG CAT GGC GGG CAC AG-3 • (Fragment 790) (SEQ ID No. 797) 5 '-CGG CAT GGC GGG CAC A-3 * (Fragment 791) (SEQ ID No. 798) 5 '-CGG CAT GGC GGG CAC-3' (Fragment 792) (SEQ ID No. 799) '-CGG CAT GGC GGG CA-3' (Fragment 793) (SEQ ID No. 800 5 '-CGG CAT GGC GGG C-3' (Fragment 794) (SEQ ID No. 801) '-CGG CAT GGC GGG-3' (Fragment 795) (SEQ ID No. 802) '-CGG CAT GGC GG-3' (Fragment 796) (SEQ ID No. 803) 5 '-CGG CAT GGC G-3' (Fragment 797) (SEQ ID No. 804) 5 * -GG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 798) (SEQ ID No. 805) 5'-GG CAT GGC GGG CAC AGG CTG GG-3' (Fragment 799) (SEQ ID No. 806) 5'-GG CAT GGC GGG CAC AGG CTG G-3 '(Fragment 800) (SEQ ID No. 807) 5 - GG CAT GGC GGG CAC AGG CTG-3 '(Fragment 801) (SEQ ID Do not . 808) 5'-GG CAT GGC GGG CAC AGG CT-3 '(Fragment 802) (SEQ ID No. 809) 5'-GG CAT GGC GGG CAC AGG C-3 '(Fragment 803) (SEQ ID No. 810) 5'-GG CAT GGC GGG CAC AGG-3' (Fragment 804) (SEQ ID No. 811) 5'-GG CAT GGC GGG CAC AG-3 '(Fragment 805) (SEQ ID No. 812) 5'-GG CAT GGC GGG CAC A-3 '(Fragment 806) (SEQ ID No. 813) '-GG CAT GGC GGG CAC-3 '(Fragment 807) (SEQ ID No. 814) * -GG CAT GGC GGG CA-3 '(Fragment 808) (SEQ ID No. 815) * -GG CAT GGC GGG C-3 '(Fragment 809) (SEQ ID No. 816) '-GG CAT GGC GGG-3 * (Fragment 810) (SEQ ID No. 817) 5'-GG CAT GGC GG-3 '(Fragment 811) (SEQ ID No. 818) 5'-G CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 812) (SEQ ID No. 819) 5'-G CAT GGC GGG CAC AGG CTG GG-3 '(Fragment 813) (SEQ ID No. 820) 5'-G CAT GGC GGG CAC AGG CTG G-3 '(Fragment 814) (SEQ ID No. 821) 5'-G CAT GGC GGG CAC AGG CTG-3' (Fragment 815) (SEQ ID No . 822) 5'-G CAT GGC GGG CAC AGG CT-3 • (Fragment 816) (SEQ ID No. 823) 5'-G CAT GGC GGG CAC AGG C-3 '(Fragment 817) (SEQ ID No. 824) 5'-G CAT GGC GGG CAC AGG-3 '(Fragment 818) (SEQ ID No. 825) 5'-G CAT GGC GGG CAC AG-3 '(Fragment 819) (SEQ ID No. 826) '-G CAT GGC GGG CAC A-3 '(Fragment 820) (SEQ ID No. 827) '-G CAT GGC GGG CAC-3 '(Fragment 821) (SEQ ID No. 828) _ '-G CAT GGC GGG CA-3 * (Fragment 822) (SEQ ID No. 829) '-G CAT GGC GGG C-3 '(Fragment 823) (SEQ ID No. 830) 5'-G CAT GGC GGG-3' (Fragment 824) (SEQ ID No. 831) 5 '-CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 825) (SEQ ID No. 832) 5 '-CAT GGC GGG CAC AGG CTG GG-3' (Fragment 826) (SEQ ID No. 833) 5 '-CAT GGC GGG CAC AGG CTG G-3 * (Fragment 827) (SEQ ID No. 834) 5 '-CAT GGC GGG CAC AGG CTG-3' (Fragment 828) (SEQ ID No. 835) 5 '-CAT GGC GGG CAC AGG CT-3' (Fragment 829) (SEQ ID No. 836) 5 '-CAT GGC GGG CAC AGG C-3' (Fragment 830) (SEQ ID No. 837) 5 ' -CAT GGC GGG CAC AGG-3 '(Fragment 831) (SEQ ID No. 838) 5' -CAT GGC GGG CAC AG-3 '(Fragment 832) (SEQ ID No. 839) 5' -CAT GGC GGG CAC A -3 '(Fragment 833) (SEQ ID No. 840) 5'-CAT GGC GGG CAC-3' (Fragment 834) (SEQ ID No. 841) 5 '-CAT GGC GGG CA-3' (Fragment 835) ( SEQ ID No. 842) 5 '-CAT GGC GGG C-3' (Fragment 836) (SEQ ID No. 843) 5'-AT GGC GGG CAC AGG CTG GGC-3 '(Fragment 837) (SEQ ID No. 844) ) 5 * -AT GGC GGG CAC AGG CTG GG-3 '(Fragment 838) (SEQ ID No. 845) 5 * -AT GGC GGG CAC AGG CTG G-3 '(Fragment 839) (SEQ ID No. 846) 5'-AT GGC GGG CAC AGG CTG-3 * (Fragment 840) (SEQ ID No. 847) 5'-AT GGC GGG CAC AGG CT-3 '(Fragment 841) (SEQ ID No. 848) 5' -AT GGC GGG CAC AGG C-3 * (Fragment 842) (SEQ ID No. 849) 5 * -AT GGC GGG CAC AGG-3 '(Fragment 843) (SEQ ID No. 850) 5'-AT GGC GGG CAC AG-3 '(Fragment 844) (SEQ ID No. 851) 5'-AT GGC GGG CAC A-3' (Fragment 845) (SEQ ID No. 852) 5'-AT GGC GGG CAC-3 '(Fragment 846) ) (SEQ ID No. 853) 5'-AT GGC GGG CA-3 '(Fragment 847) (SEQ ID No. 854) 5'-T GGC GGG CAC AGG CTG GGC-3' (Fragment 848) (SEQ ID No . 855) 5 * -T GGC GGG CAC AGG CTG GG-3 '(Fragment 849) (SEQ ID No. 856) 5'-T GGC GGG CAC AGG CTG G-3 '(Fragment 850) (SEQ ID No. 857) 5'-T GGC GGG CAC AGG CTG-3 '(Fragment 851) (SEQ ID No. 858) 5'-T GGC GGG CAC AGG CT-3 * (Fragment 852) (SEQ ID No. 859) * -T GGC GGG CAC AGG C-3 '(Fragment 853) (SEQ ID No. 860) '-T GGC GGG CAC AGG-3 '(Fragment 854) (SEQ ID No. 861) '-T GGC GGG CAC AG-3 '(Fragment 855) (SEQ ID No. 862) '-T GGC GGG CAC A-3 '(Fragment 856) (SEQ ID No. 863) '-T GGC GGG CAC-3 '(Fragment 857) (SEQ ID No. 864) 5' -GGC GGG CAC AGG CTG GGC-3 '(Fragment 858) (SEQ ID No. 865) '-GGC GGG CAC AGG CTG GG-3' (Fragment 859) (SEQ ID No. 866) 5 '-GGC GGG CAC AGG CTG G-3' (Fragment 860) (SEQ ID No. 867) 5 '-GGC GGG CAC AGG CTG-3' (Fragment 861) (SEQ ID No. 868) 5 '- GGC GGG CAC AGG CT-3 * (Fragment 862) (SEQ ID No. 869) 5 '-GGC GGG CAC AGG C-3' (Fragment 863) (SEQ ID No. 870) 5 '-GGC GGG CAC AGG-3 '(Fragment 864) (SEQ ID No. 871) 5' -GGC GGG CAC AG-3 '(Fragment 865) (SEQ ID No. 872) 5 * -GGC GGG CAC A-3' (Fragment 866) (SEQ ID No. 873) 5 * -GC GGG CAC AGG CTG GGC-3 * (Fragment 867) (SEQ ID No. 874) 5 * -GC GGG CAC AGG CTG GG-3 '(Fragment 868) (SEQ ID No. 875) 5'-GC GGG CAC AGG CTG G-3 '(Fragment 869) (SEQ ID No. 876) 5 * -GC GGG CAC AGG CTG-3' (Fragment 870) (SEQ ID No. 877) 5 * -GC GGG CAC AGG CT-3 '(Fragment 871) (SEQ ID No. 878) 5' -GC GGG CAC AGG C-3 '(Fragment 872) (SEQ ID No. 879) 5'-GC GGG CAC AGG-3' ( Fragment 873) (SEQ ID No. 880) 5'-GC GGG CAC AG-3 '(Fragment 874) (SEQ ID No. 881) 5'-C GGG CAC AGG CTG GGC-3' (Fragment 875) (SEQ ID No. 882) 5 * -C GGG CAC AGG CTG GG-3 '(Fragment 876) (SEQ ID No 883) 5'-C GGG CAC AGG CTG G-3 '(Fragment 877) (SEQ ID No. 884) * 5'-C GGG CAC AGG CTG-3' (Fragment 878) (SEQ ID No. 885) 5 '-CGGG CAC AGG CT-3' (Fragment 879) (SEQ ID No. 886) 5'-C GGG CAC AGG C-3 '(Fragment 880) (SEQ ID No. 887) 5'-C GGG CAC AGG -3 '(Fragment 881) (SEQ ID No. 888) 5' -GGG CAC AGG CTG GGC-3 '(Fragment 882) (SEQ ID No. 889) 5' -GGG CAC AGG CTG GG-31 (Fragment 883) (SEQ ID No. 890) 5 '-GGG CAC AGG CTG G-3' (Fragment 884) (SEQ ID No. 891) 5 '-GGG CAC AGG CTG-3' (Fragment 885) (SEQ ID No. 892) 5 '-GGG CAC AGG CT-3' (Fragment 886) (SEQ ID No. 893) 5'-GG CAC AGG C-3 '(Fragment 887) (SEQ ID No. 894) 5'-GG CAC AGG CTG GGC -3 '(Fragment 888) (SEQ ID No. 895) 5'-GG CAC AGG CTG GG-3' (Fragment 889) (SEQ ID No. 896) 5 * -GG CAC AGG CTG G-3 * (Fragment 890) ) (SEQ ID No. 897) 5 * -GG CAC AGG CTG-3 '(Fragment 891) (SEQ ID No. 898) 5'-GG CAC AGG CT-3' (Fragment 892) (SEQ ID No. 899) 5'-G CAC AGG CTG GGC-3 '(Fragment 893) (SEQ ID No. 900) 5'-G CAC AGG CTG GG-3' (Fr Aggregate 894) (SEQ ID No. 901) 5'-G CAC AGG CTG G-3 '(Fragment 895) (SEQ ID No. 902) 5'-G CAC AGG CTG-3' (Fragment 896) (SEQ ID No 903) 5 '-CAC AGG CTG GGC-3' (Fragment 897) (SEQ ID No. 904) 5 * -CAC AGG CTG GG-3 '(Fragment 898) (SEQ ID No. 905) 5' -CAC AGG CTG G-3 '(Fragment 899) (SEQ ID No. 906) 5'-AC AGG CTG GGC-3 • (Fragment 900) (SEQ ID No. 907) 5 * -AC AGG CTG GG-3' (Fragment 901 ) (SEQ ID No. 908) 5'-C AGG CTG GGC-31 (Fragment 902) (SEQ ID No. 909) 5 '-GGC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 903) (SEQ ID No. 910) 5' -GC GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC GG CTG GGC-3 '(Fragment 904) (SEQ ID No. 911) 5'-C GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC GG CTG GGC-3 '(Fragment 905) (SEQ ID No. 912) 5' -GGC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC- 3 '(Fragment 906) (SEQ ID No. 913) 5 * -GC CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 907) (SEQ ID No. 914) 5'- C CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 908) (SEQ ID No. 915) 5' -CTG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 909) (SEQ ID No. 916) 5' -TG GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 • (Fragment 910) (SEQ ID No. 917) 5 '-G GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 911) (SEQ ID No. 918) 5' -GAA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 912) (SEQ ID No. 919) 5 * -AA AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 913) (SEQ ID No. 920) 5' -A AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 ' (Fragment 914) (SEQ ID No. 921) 5 '-AGC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 r (Fragment 915) (SEQ ID No. 922) 5 * -GC TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 ' (Fragment 916) (SEQ ID No. 923) 5'-C TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 917) (SEQ ID No. 924) 5' -TGA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 ' (Fragment 918) (SEQ ID No. 925) 5 '-GA GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 919) (SEQ ID No. 926) 5 * -A GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 920) (SEQ ID No. 927) 5' -GAT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 ' (Fragment 921) (SEQ ID No. 928) 5'-AT GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 922) (SEQ ID No. 929) 5 * -T GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 923) (SEQ ID No. 930) 5 '-GGA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 924) (SEQ ID No. 931) 5 * -GA GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 * (SEQ ID No. 925) (SEQ ID No. 932) 5 '-A GGG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 926) (SEQ ID No. 933) 5 '-GGG CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 927) (SEQ ID No. 934) 5'-GG CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 928) (SEQ ID No. 935) 5'-G CGG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 929) (SEQ ID No. 936) 5 '-CGG CAT GGC GGG CAC AGG CTG GGC-3' (Fragment 930) (SEQ ID No. 937) 5'-GG CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 931) (SEQ ID No. 938) 5'-G CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 932) (SEQ ID No. 939) 5' -CAT GGC GGG CAC AGG CTG GGC-3 '(Fragment 933) (SEQ ID.

No. 940) 5'-AT GGC GGG CAC AGG CTG GGC-3 '(Fragment 934) (SEQ- ID No. 941) 5'-T GGC GGG CAC AGG CTG GGC-3 '(Fragment 935) (SEQ ID No. 942) 5 '-GGC GGG CAC AGG CTG GGC-3' (Fragment 936) (SEQ ID No. 943) 5 * -GC GGG CAC AGG CTG GGC-3 '(Fragment 937) (SEQ ID No. 944) 5'-C GGG CAC AGG CTG GGC-3 '(Fragment 938) (SEQ ID No. 945) '-GGG CAC AGG CTG GGC-3' (Fragment 939) (SEQ ID No. 946) 5'-GG CAC AGG CTG GGC-3 * (Fragment 940) (SEQ ID No. 947) 5 * -G CAC AGG CTG GGC-3 '(Fragment 941) (SEQ ID No. 948) 5' -CAC AGG CTG GGC-3 '(Fragment 942) (SEQ ID No. 949) 5'-AC AGG CTG GGC-3' (Fragment 943 ) (SEQ ID No. 950) 5'-C AGG CTG GGC-3 '(Fragment 944) (SEQ ID No. 951) 5' -AGG CTG GGC-3 '(Fragment 945) (SEQ ID No. 952) Other fragments of adenosine, for example those with a low content of adenosine lacking completely adenosine, are also suitable in some cases even preferred, for use with the invention. The following sequences, their fragments and combinations are a particularly preferred group of anti-sense oligos.

TTT TCC TTC CTT TGT CTC TCT TC (FRAG 946) (SEQ ID No. 953) GCT CCC GGC TGC CTG (Fragment 947) (SEQ ID No. 954) CTG GGC CGT GCG GCT CTG TCG CTC CCG GT (Fragment 948) ( SEQ ID No. 955) CCG CCG CCC TCC GGG GGG TC (Fragment 949) (SEQ ID No. 956) TGC TGC CGT TGG CTG CCC (Fragment 950) (SEQ ID No. 957) CTT CTG CGG GTC GCC GG (Fragment 951 ) (SEQ ID No. 958) TGC TGG GCT TGT GGC (Fragment 952) (SEQ ID No. 959) GGC CTC TCT TCT GGG (Fragment 953) (SEQ ID No. 960) CCT GGT CCC TCC CT (Fragment 954) ( SEQ ID No. 961) GGT GGC TCC TCT GC (Fragment 955) (SEQ ID No. 962) GCT TGG TCC TGG GGC TGC (Fragment 956) (SEQ ID No. 963) TGC TCT CCT CTC CTT (SEQ ID No. 957 ) (SEQ ID No. 964) In another embodiment of this invention, oligos are anti-sense to an adenosine A_a receptor, and they must either regulate them "in an accelerating manner", or if they have any A ^ activity of adenosine they are treated as different anti-sense oligos. The following sequences are preferred examples of the anti-sense oligos associated with the human adenosine A_a receptor. Another preferred group is composed of fragments of these sequences as described above in general, and combinations thereof, as well as mixtures. Also preferred are those sequences, fragments and combinations thereof where one or more adenosines are substituted by a universal base or an adenosine analog which is either not an agonist or a ligand for the A ^^ adenosine receptor, or which acts as a receptor agonist Al t such as, for example, theophylline or emprophyllin.

'-TGC TTT TCT TTT CTG GGC CTG-3' (Fragment 958) (SEQ ID No. 965) 5 '-TGT GGT CTG TTT TTT TCT G-3' (Fragment 959) (SEQ ID No. 966) 5 * -GCC CTG CTG GGG CGC TCT CC-3 '(SEQ ID No. 960) (SEQ ID No. 967) 5' -GCC GCC CGC CTG GCT CCC-3 '(Fragment 961) (SEQ ID No. 968) 5 * -GGB GCC CBVT GBT GGG CBT GCC-3 * (Fragment 962) (SEQ ID No. 969) 5 '-GTG GTT CTT GCC CTC CTT TGG CTG-3' (Fragment 963) (SEQ ID No. 970) 5 '-CCG TGC CCG CTC CCC GGC-3' (Fragment 964) (SEQ ID No. 971) 5 '-CTC CTG GCG GGT GGC CGT TG-3 * (Fragment 965) (SEQ ID No. 972) 5' -GGC CCG TGT TCC CCT GGG-3 '(Fragment 966) (SEQ ID No. 973) 5 '-GCC TGG GGC TCC CTT CTC TC-3' (Fragment 967) (SEQ ID No. 974) 5 '-GCC CTT CTT GCT GGG CCT C (Fragment 968) (SEQ ID No. 975) 5' -TGC TGC TGC TGG TGC TGT GGC CCC C-3 '(Fragment 969) (SEQ ID No. 976) GTACACCGAGGAGCCCATGATGGGCATGCCACAGACGACAGGC (Fragment 970) (SEQ ID No. 977) GTBCBCCGBGGBGCCCBTGBTGGGCCBTGCCBCBGBCGBCBGGC (Fragment 971) (SEQ ID NO 978) As indicated above, all types of adenosine A2a agonists, whether or not they are nucleic acids, are also included in this patent. These are known in the art and should generally have agonistic activity and either lack or have low adenosine agonistic activity and / or have adenosine activity, antagonistic. In another embodiment, the anti-sense oligo of the invention may be a sequence that is anti-sense to the A_b adenosine receptor. By way of example, the following sequences associated with the human receptor are provided. These sequences as well as their fragments and combinations, desadesosine fragments and those where one or more A are substituted with a universal or analogous adenosine base as described above, is preferred.

'-GGC GCC GTG CCG CGT CTT GGT GGC GGC GG-3' (Fragment 972) (SEQ ID No. 979) 5 '-GTT CGC GCC CGC GCG GGG CCC CTC CGG TCC-3 * (Fragment 973) (SEQ ID No. 980) 5 '-TTG GCC CGC GCG CCC GCC CGT CTC GGG CTG GGC GG-3 (Fragment 974) (SEQ ID No. 981) 5' -CGG GTC GGG GCC CCC CGC GGC C-3 '(Fragment 975) (SEQ ID No. 982) 5 '-GCC TCG GGG CTG GGG CGC TGG TGG CGG GG-3' (Fragment 976) (SEQ ID No. 983) 5 '-CCG CGC CTC CGC CTG CCG CTT CTG-3' (Fragment 977) ( I KNOW THAT ID No. 984) 5 '-GCT GGG CCC CGG GCG CCC CCT-3' (Fragment 978) (SEQ ID No. 985) 5 '-CCC CTC TTG CTC GGG TCC CCG TG-3' (Fragment 979) (SEQ ID No. 986) ACAGCGCGTCCTGTGTCTCCAGCAGCATGGCCGGGCCAGCTGGGCCCC (Fragment 980) (SEQ ID NO 987) BCBGCGCGTCCTGTGTCTCCBGCBGCBTGGCCGGGCCBGCTGGGCCC C (Fragment 981) (SEQ ID No. 988) In yet another embodiment, the oligo of this invention can be anti-sense or any fragment of the adenosine A3 receptor gene or mRNA, including regions of overlap with the flanking regions or introns. The following are examples of these fragments associated with the human receptor. These are preferred sequences. Also preferred are their fragments and combinations, as well as fragments of desadenosine and those where one or more A are substituted by a universal or analogous A base as described above.

ACA GAG CA TGC TGT TGT TGG GCA TCT TGC CTT CCC AGG G (Fragment 982) (SEQ ID No. 989) BCG GBG CB TGC TGT TGT TGG GCB TCT TGC CTT CCC BGG G (Fragment 983) (SEQ ID No. 990) CCC TTT TCT GGT GGG GTG (Fragment 984) (SEQ ID No. 991) GTG CTG TTG TTG GGC (Fragment 985) (SEQ ID No. 992) TTT CTT CTG TTC CC (Fragment 986) (SEQ ID No. 993) CCC TTT TCT GGT GGG GTG (Fragment 987) (SEQ ID No. 994) GTG CTG TTG TTG GGC (Fragment 988) (Fragment 995) TTT CTT CTG TTC CC (Fragment 989) (Fragment 996) In the anti-sense oligonucleotides of the present invention, exemplified by the preceding sequences, several adenosine bases can be replaced with an appropriate "separator" or universal base (for example 1 [β-D-2 '-deoxyribofuranosyl] -5- nitroindiol], or with an adenosine agonist or antagonist that does not stimulate (or inhibit) adenosine Al t, b or A3 receptors, but that can stimulate the receiver A ^. A preferred universal base for the treatment of SVT is one that exhibits adenosine A_a agonistic activity. In this manner, a specific adenosine receptor gene can be selected as a target to obtain one or more anti-sense oligonucleotides (oligo) that selectively bind to the corresponding mRNA, and then, if necessary, its adenosine content is it can be reduced by substituting one or more universal bases or adenosine analogues unable to activate the adenosine ^, A_b or A3 receptors or that activate the A- receptor. of adenosine. Thus, in addition to "regulating in a lentifying manner" the specific genes of the adenosine receptor, the present oligos have an increased effect when administered by either the selection of genes, RNA and flanking regions that are lacking, or have a low A content, or alternatively one or more of the adenosines present in the oligonucleotides are substituted with other oligonucleotide bases, called universal bases, that bind to thymidine (T) but lack the ability to activate the adenosine receptors and otherwise they can not activate the adenosine receptors. Since adenosine (A) is a nucleotide base complementary to thymidine (T), when a T appears in the RNA, the anti-sense oligo will have an A in the same position. The method of the present invention can be used to treat ailments associated with or causing cardiac, pulmonary and / or renal damage, and even insufficiency in a subject, despite its cause. The antisense agent (s) of the invention preferably have a low content of A (or reduced) to prevent their release in in vivo degradation of the agent (s), preferably up to about 15% , more preferably up to about 10%, even more preferably up to about 5%, and even more preferred which is devoid of A ("desadenosine oligos"). The oligos of this invention can be obtained by first selecting the fragments of a nucleic acid or target having at least 4 contiguous nucleic acids selected from the group consisting of G and C, and then obtaining a first oligonucleotide of 4 to 60 nucleotides long comprising selected fragments and having a C and G nucleic acid content of up to and including about 15%. The final step can be carried out by obtaining a second oligonucleotide of 4 to 60 nucleotides in length comprising a sequence that is anti-sense of the selected fragment, the second oligonucleotide having an adenosine base content of up to and including approximately fifteen%. This method may also comprise, when the selected fragment comprises at least one thymidine base, the substitution of an adenosine base in the corresponding nucleotide of the anti-sense fragment with a universal base selected from the group consisting of heteroaromatic bases which are bind to a thymidine base, but which has an antagonistic activity and less than about 0.3 adenosine base agonist activity at A receptors? r A ^ and A3 of adenosine, and heteroaromatic bases that have no activity or have an agonist activity at the A_a adenosine receptor. The analogous heteroaromatic bases can be selected from all pyrimidines and purines, which can be substituted by O, halo, NH2, SH, SO, S02, S03, COOH and primary and secondary amino, branched and fused, alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, alkoxy, alkenoxy, acyl, cycloacyl, arylacyl, alkyloxy, cycloalkoxy, aroyl, arylthio, arylsulfoxyl, halocycloalkyl, alkylcycloalkyl, alkenylcycloalkyl, alkynylcycloalkyl, haloaryl, alkylaryl, alkenylaryl, alkynylaryl, arylalkyl, arylalkenyl, arylalkynyl, arylcycloalkyl, which may be optionally substituted by 0, halo, NH2, primary, secondary and tertiary amine, SH, SO, S02, S03, cycloalkyl, heterocycloalkyl and heteroaryl. The pyrimidines and purines may be substituted at all positions as is known in the art, but those which are substituted at positions 1, 2, 3, 4, 7 and / or 8 are preferred. More preferred are pyrimidines and purines such as theophylline, caffeine, difiline, etofilina, acefilina, piperazina, bamifilina, emprofilina and xanthine that have the chemical formula wherein R 'R ** are independently H, alkyl, alkenyl or alkynyl and RJ is H, aryl, dicycloalkyl, dicycloalkenyl, dicycloalkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, 0-cycloalkyl, O-cycloalkenyl, O-cycloalkynyl, NH2-alkylamino -tetoxyalkyloxy-aryl, mono- and di-alkylaminoalkyl-N-alkylamino-S02aryl, among others. However, other methods can also be used. The inventor reduced the adenosine content of the anti-sense oligos corresponding to the thymidines (T) present in the target material, RNA, flanking regions, bridge sections to less than about 15%, or completely removed A from the sequence of oligonucleotides as a means to prevent their products defragmenting the release of adenosine into the pulmonary tissue environment and thereby aggravating the condition of the subject and / or counteracting the beneficial effect of the agent administered. Also part of this invention are chemical analogs of oligonucleotides in which, for example, the phosphodiester linkages have been modified, for example, to a methylphosphonate, a phosphotriester, a phosphorothioate, a phosphorodithioate, or a phosphoramidate, or those other portions of the molecule has been modified, to make the oligonucleotide more stable in vivo. Phosphodiester bonds that occur naturally in oligonucleotides are susceptible to degradation by cellular nucleases that occur endogenously, while many analogue bonds are highly resistant to nuclease degradation. See Milligan et al., And Cohen, J. S., supra. The use of a "3-end cap" strategy by which the nuclease-resistant bonds are substituted by phosphodiester bonds at the 3 'end of the oligonucleotide protects the oligonucleotides from degradation. See, Tidd, D. M. and Warenius, H.M., Br. J. Cancer 60, 343-350 (1989); Shaw, J.P. et al., Nucleic Acids Res. 19, 747-750 (1991). The phosphoramidate, phosphorothioate and methylphosphonate linkages are suitable for use in this invention. In addition, extensive modification of the phosphodiester structure has been shown to impart stability and may allow for improved affinity and increased cell permeation of the oligonucleotides. See Milligan, et al., Supra. Many different chemical strategies have been employed to replace the complete structure of the phosphodiester with new bonds. Id. Analogs of the oligonucleotides of the invention include phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, boranophosphate, phosphotriester, formacetal, 2'-0-methyl, 3'-thioformacetal, 5'-thioformacetal, 5-thioether, carbonate linkages. , 5'-N-carbamate, sulfate, sulfonate, sulphamate, sulfonamide, sulfone, sulfite, sulfoxide, sulfide, hydroxylamine, methylene (methylimino) (MMI) and methyleneoxy (methylimino) (MOMI) among others. Oligonucleotides of the invention can also be modified by the addition of a terminal 1,3-propanediol or a terminal dodecanol, among others, or can be conjugated to a polyethylene glycol, cholesterol, cholesteryl, dehydroepiandrosterone, dehydroepiandrosterone-sulfate, dehydroepiandrosterone-sulfatide, ubiquinone, dolichol, poly-L-lysine, sulfatidic acid and fatty acid, among others. The oligos of the invention can also be modified by 2'-O-methoxyeti, C-5'-propynyl-pyrimidine, C-5-methyl-cytidine, C-5-ethynylpyrimidine, 2'-propoxy, C-18-amine , N3 '-P5' -phosphoramidates, 3 '-alkylamino, 2' -fluor; 5-fluoropyrimidine, 5-iodo-pyrimidine, 5-bromo-pyrimidine, 2'-borane, C-5-hexinyl-pyrimidine, 2 '-O- (2-methoxy) ethyl, 2'-O-aminopropyl, 5- (phenylethyl) and interbase links of peptide nucleic acids. Methylphosphonate phosphorothioate-modified oligonucleotides are particularly preferred because of their availability and suitability for automated oligonucleotide synthesis. Id. The anti-sense oligonucleotides containing modifications to the nucleotide base itself (for example a C-5 tip) or to sugar (for example, a modification of carbohydrates), are also aspects of the present invention. When appropriate, the anti-sense nucleotide can be administered in the form of its pharmaceutically acceptable salts or as a mixture. The anti-sense oligonucleotides can be of any suitable length, for example, of about 7 or 60 nucleotides in length, depending on the particular target that binds and their mode of distribution. Preferably, the anti-sense oligonucleotide is directed to a gene or region of mRNA that contains the intron-exon junction. Where the anti-sense oligonucleotide is directed to an intron / exon junction, it may be either completely on the junction or may be sufficiently close to the junction to inhibit splicing of the intervening exon during processing of the precursor mRNA or mature mRNA, for example, with the 3 'or 5' terminus of the antisense oligonucleotide that is positioned within, for example, 10, 5, 3, or 2 nucleotides of the intron / exdn binding. Antisense oligonucleotides that overlap the initiation codon are also preferred. When practicing the present invention, the anti-sense oligonucleotides administered can be related at the origin to the species to which they are administered. When it comes to humans, anti-sense can be derived from human sequences. However, sequences obtained from one species for administration to a second species are also suitable. The pharmaceutical compositions provided herein comprise the anti-sense oligos given above. Optionally, the pharmaceutical compositions may also comprise one or more surfactants. Suitable surfactants or surfactant components for enhancing the uptake of the anti-sense oligonucleotides of the invention include synthetic and natural as well as complete and truncated forms of surfactant protein A, protein B of surfactant, protein C of agent surfactant, protein D of surfactant and Protein E of surfactant, phosphatidylcholine disaturated (different from dipalmitoyl), dipalmitoylphosphatidylcholine, phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol, phosphatidylethanolamine, phosphatidylserine; phosphatidic acid, uriquinones, diphosphatidylethanolamino, isophosphatidylcholine, palmitoyl-isophosphatidylcholine, dehydroepiandrosterone, dolicholes, sulfatidic acid, glycerol-3-phosphate, dihydroxyacetone phosphate, and glycerol, glycero-3-phosphocholine, dihydroxyacetone, palmitate, cytidine diphosphate (CDP) diacylglycerol , CDP-choline, choline phosphate; as well as natural and artificial lamellar bodies which are the natural carrier vehicles for the components of the surfactant, omega-3 fatty acids - polyesters, polyenic acid, polyenoic acid, licithine, palmitinic acid, non-ionic block copolymers of ethylene or propylene oxides, polyoxypropylene, monomeric and polymeric, polyoxyethylene, monomeric and polymeric, poly (vinyl-amine) with dextran and / or alkanoyl side chains, Brij 35, Triton X-100 and synthetic surfactants ALEC, Exosurf, Survan and Atovaquone, among others. These surfactants can be used either alone or as part of a multi-component surfactant in a formulation, as covalently bound additions to the 5 * and / or 3 'ends of the oligonucleotides (oligo) antisense. These compositions are administered in effective amounts to reduce the expression of an adenosine receptor, such as the A ^ A2b or ^ adenosine receptor by passing through a cell membrane and specifically binding with the mRNA encoding a receptor i, A ^ or A3 of adenosine and prevent its translation. In addition, the present oligos and other agents in general can be directed to the adenosine A_a receptor to activate its receptor or increase the amount present (agonist activity). These compositions may contain a suitable pharmaceutically acceptable carrier, for example, saline, pyrogen-free, sterile, and the like. Anti-sense oligonucleotides can be formulated as topical and systemic formulations, in a variety of types, including oral, buccal, nasal, otic, rectal, inhalable, slow release, enteric coated, dermal, intradermal, injectable and many more as sec known in the technique. The formulation of the invention may also comprise a hydrophobic carrier capable of passing through a cell membrane, for example, in a liposome with the liposomes carried in a pharmaceutically acceptable aqueous carrier. Oligonucleotides can also be coupled to a substance that inactivates mRNA, such as a ribosome. The present oligonucleotides can be administered to a subject afflicted with any disease or condition associated with lung adenosine receptors to inhibit the activation of adenosine A3 or A3 receptors. The pharmaceutical formulation may also contain chimeric molecules comprising antisense oligonucleotides attached to molecules that are known to be internalized by the cells. These oligonucleotide conjugates use the cellular uptake pathways to increase the cellular concentrations of the oligonucleotides. Examples of macromolecules used in this manner include transferrin, asialoglycoprotein (linked to oligonucleotides via polylysine or other chemical bonds) and streptavidin. In the pharmaceutical formulation, the anti-sense compound may be contained within a lipid particle or vesicle, such as a liposome or microcrystal. The lipid particles can be of any suitable structure, such as unilamellar or plurilamellar, as long as the antisense oligonucleotide is contained therein.

Positively charged lipids such as N- [1- (2,3-dioleoyloxy) propyl] -N, N, N-trimethyl-ammonium methyl sulfate, or "DOTAP", are particularly preferred for these particles and vesicles. The preparation of these lipid particles is well known. See, for example, U.S. Patent Nos. 4,880,635 to Janoff et al .; 4,906,477 to Kurono et al .; 4,911,928 from Wallach; 4,917,951 of Wallach; 4,920,016 to Alien et al .; 4,921,757 of Wheatley et al.; etc . The composition of the invention can be administered by any means that transports the antisense nucleotide composition to the lung. The antisense compounds described herein may be administered to the lungs of a patient by any suitable means, but are preferably administered by inhalation of an aerosol comprised of respirable particles comprising the anti-sense compound. The respirable particles may be liquid or solid, and may additionally contain other therapeutic or diagnostic ingredients as well as other typical ingredients for a particular formulation. Examples of other agents are analgesics such as acetaminophen, anilerdin, aspirin, buprenorphine, butabital, butorphanol, Choline Salicylate, Codeine, Dozocine, Dilcoferiac, Diflunisal, Dihydrocodeine, Elcatoninin, Etodolac, Fenoprofen, Hydrocodone, Hydromorphone, Ibuprofen Ketoprofen Ketorolac, Levorphanol , Magnesium Saclilate, Meclofenamate, Mefenamic Acid, Meperidine, Methadone, Methotrimeprazine, Morphine, Nalbuphine, Naproxen, Opium, Oxycodone, Oxymorphone, Pentazocine, Phenobarbital, Propoxyphene, Salsalate, Sodium Salicylate, Tramadol and Narcotic Analgesics in addition to those listed above . See, Mosby's Physician's GenRx. Anti-anxiety agents are also useful including Alprazolam, Bromazepam, Buspirone, Chlordiazepoxide, Clormezanone, Clorazepate, Diazepam, Halazepam, Hydroxyzine, Ketazolam, Lorazepam, Meprobamate, Oxazepam and Prazepam, among others. Anti-anxiety agents associated with mental depression, such as Chlordiazepoxide, Amitriptyline, Loxapine-Maprotiline, and Perphenazine, among others. Anti-inflammatory agents such as non-rheumatic Aspirin, Choline Salicylate, Diclofenac, Diflunisal, Etodolac, Fenoprofen, Floctafenin, Flurbiprofen, Ibuprofen, Indomethacin, Ketoprofen, Magnesium Salicylate, Meclofenamate, Mefenamic Acid, Nebumetone, Naproxen, Oxaprozin, Phenylbutazone, Piroxicam, Salsalato , Sodium Salicylate, Sulindac, Tenoxicam, Tiaprofenic acid, Tometin, anti-inflammatories for ocular treatment such as Diclofenac, Flurbiprofen, Indomethacin, Ketorolac Rimexolone (in general for the post-operative treatment) anti-inflammatory for non-infectious nasal applications such as Beclometaxone , Budesonide, Dexamethasone, Flunisolide, Triamcinolone, and the like. The soporific (agents that induce sleep / anti-insomnia) such as those used for the treatment of insomnia, include Alprazolam, Bromazepam, Diazepam, Diphenhydramine, Doxylamine, Estazolam, Flurazepam, Lalazepam, Ketazolam, Lorazepam, Nitrazepam, Prazepam, Cuazepam, Temazepam , Trizolam, Zolpidem and Sopkcona, among others. Sedatives include diphenhydranin, Hydroxyzine, Methotrimeprazine, Promethazine, Propofol, Melatonin, Trimeprazine, and the like. The sedatives and agents used to treat tremors and small ailments, among other conditions, such as Amitriptyline HCl; Chlordiazepoxide, Amobarbital; Secobarbital; Approvebital; Butabarbital; Etquiorvinol, Glutethimide, L-Tryptophan, Mephobarbital, Na MethoHexital, Midazolam Hcl, Oxazepam, Pentobarbital Na, Phenobarbital, Secobarbital Na, Tiamilal Na and many others. Losa agents used in the treatment of head trauma (injury / cerebral schema), such as Enadolina HCl (for example, for the treatment of severe head injury, orphan status, Warner Lambert), cytoprotective agents and agents for the treatment of menopause, Menopausal symptoms (treatment), for example, Ergotamine, Belladonna, Alkaloids and Phenobarbital, for the treatment of menopausal vasomotor symptoms, for example, Clonidine, Conjugated estrogens and Medroxyprogesterone, Estradiol, Estradiol-Cypionate, Estradiol valerate, Estrogens, Estrogens conjugates, esterified Estrone, Estropipate, and Etinil-Estradio. Examples of the agents for the treatment of pre-menstrual syndrome (PMS) are Progesterone, Progestin, Gonadotropic Release Hormone, Oral contraceptives, Danazol, Luprolide Acetate, Vitamin B6. Examples of agents for the treatment of emotional / psychiatric treatments such as tricyclic antidepressants, including Amitriptyline HCl (Elavil), Amitriptyline HCl, Perphenazine (Triavil) and Doxepin-HCl (Sinecuan). Examples of tranquilizers, anti-depressants and anti-anxiety agents are Diazepam (Valium), Lorazepam (Ativan), Alprazolam (Xanax), SSRI 's (Ssrotonin reuptake inhibitors, selective), Fluoxetine HCl (Prozac), Sertalin HCl (Zoloft), Paraxetine HCl (Paxil), Fluvoxamine Maleate (Luvox), Venlafaxine HCl (Effexor), Serotonin, Serotonin Agonists (Fenfluramine) and other medications available without a prescription (OTC). Cardiac drugs, renal agents and the like, which are known in the art, are also suitable. The anti-sense compound can be administered in an anti-damage effective amount or heart, cardiopulmonary and / or renal failure, which depends on the disease being treated, the condition of the subject, the particular condition, the route of administration, the synchronization of administration to a subject, etc. In general, intracellular concentrations of the oligonucleotides from about 0.05 to about 50 μm, or more particularly from about 0.2 to about 5 μm, are desirable. For administration to a subject such as a human, a dose of about 0.01, 0.1, or 1 mg / Kg to about 50, 100, or 150 mg / Kg or more is typically employed, however, other doses are also contemplated in this patent, particularly when the administration route is varied. Depending on the solubility of the active compound a particular formulation, the daily doses may be divided among one or more unit dose administrations. The administration of the anti-sense compound can be carried out therapeutically, i.e., as a rescue treatment, or prophylactically, alone or in conjunction with other therapeutic or diagnostic agents as described above. The anti-sense compound of the present invention is preferably administered to the respiratory system, for example, by inhalation, nasal spray or in general to the lungs, as a formulation including particles of respirable size, for example, particles of a size small enough to pass through the nose, mouth and larynx in the inhalation and through the bronchi and alveoli of the lungs. In general, respirable particles vary from about 0.5 to 10 microns in size. Particles of non-respirable size that are included for example, in an aerosol tend to deposit in the throat and swallow, and the amount of non-respirable particles in the aerosol is minimized in this way. For nasal administration, a particle size in the range of about 10-500 μm is preferred to ensure retention in the nasal cavity. However, other sizes are also suitable as are other administration routes. The pharmaceutical, liquid compositions of the active compound for producing an aerosol can be prepared by combining the anti-sense compound with a suitable vehicle, such as sterile, pyrogen-free water. Other therapeutic compounds may be optionally included. Compositions of particulate material, solid, containing dry, breathable particles of the micronized anti-sense compound, can be prepared by grinding the dry anti-felt compound with a mortar and pestle, and then passing micronized composition through the a 400 mesh screen to break or separate the large agglomerates. A solid particulate material composition comprising the anti-sense compound may optionally contain a dispersant which serves to facilitate the formation of an aerosol as well as other therapeutic compounds. A suitable dispersant is lactose, which can be mixed with the anti-sense compound in any suitable ratio, for example, a one-to-one weight ratio. The aerosols of liquid particles comprising the anti-sense compound can be produced by any suitable means, just like with a nebulizer. See, for example, U.S. Patent No. 4,501,729. Nebulizers are commercially available devices that transform solutions into suspensions of the active ingredient in a therapeutic aerosol mist either by accelerating a compressed gas, typically air or oxygen, through a narrow venturi orifice or by means of ultrasonic agitation. The formulations suitable for use. in the nebulizers comprise the active ingredient in a liquid carrier in an amount of up to 40% w / w, preferably less than 20% w / w of the formulation. The carrier is typically water or an alcoholic, aqueous, diluted, preferably isotonic ax solution with bodily fluids by the addition of, for example, sodium fluid. Optional additives include preservatives if the formulation is not prepared in a sterile manner, for example, methyl hydroxybenzoate, antioxidants, flavoring agents, volatile oils, buffering agents and surfactants. The aerosols of solid particles comprising the active compound can also be produced with any aerosol generator, aerosol of medicament in the form of particles, solid. Aerosol generators for administering the medicaments in the form of particles, solids to a subject produce particles that are respirable, as explained above, and generate an aerosol volume containing a predetermined, measured dose of a medicament at a rate suitable for the human administration. An illustrative type of particle aerosol generator, solid is an insufflator. These formulations suitable for administration by insufflation include finely ground powders which can be distributed by means of an insufflator or taken into the nasal cavity in the manner of a tobacco. In the insufflator, the powder, for example, a metered dose thereof effective to carry out the treatments described herein, is contained in capsules or cartridges, made, typically made of gelatin or plastic, which are either perforated or they open in situ and the powder is distributed by air entrainment through the device in the inhalation or by means of a manually operated pump. The powder employed in the insufflator consists either of only the active ingredient or of a powder mixture comprising the active ingredient, a suitable powder diluent, such as lactose, the optional surfactant. The active ingredient typically comprises from 0.1 to 100 w / w of the formulation. A second type of illustrative aerosol inhaler comprises a metered dose inhaler. Metered dose inhalers are pressurized aerosol dispensers, typically containing a suspension or solution formulation of the active ingredient in a liquefied propellant. During the use of these devices, the discharge of the formulation through a valve adapted to distribute a measured volume, typically from 10 to 150 μm, to produce a spray of fine particles containing the active ingredient. Suitable propellants include certain chlorofluorocarbon compounds, for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane and mixtures thereof. The formulation may additionally contain one or more co-solvents, for example, ethane, surfactants, such as oleic acid or sorbitan triolate, antioxidants and suitable flavoring agents. The aerosol, whether formed of solid or liquid particles, can be produced by the aerosol generator at a rate of about 10 to 150 liters per minute, more preferably about 30 to 150 liters per minute, and more preferably of approximately 60 liters per minute. Aerosols that contain larger amounts of the medication can be administered more quickly. The following examples are provided to illustrate the present invention, and should not be considered as limiting it. In these examples, μM means micromolar, mL means milliliters, μm means micrometers, mm means millimeters, cm means centimeters ° C means degrees Celsius, μg means "* i micrograms, mg means milligrams, g means grams, kg means kilograms, M means molar, and h means hours.

EXAMPLES Element 1: Design and synthesis of Oliaonucleotides Antisense __ controls The design of anti-sense oligonucleotides against adenosine receptors is based on the primary and secondary structure of the mRNA of the target receptor. The anti-sense oligonucleotide is optionally selected and modified to target regions of the mRNA that confer functional activity or stability to the mRNA and that preferably can overlap the initiation codon. For example, regions that give a particularly strong binding, such as CG chains are preferred, ie, runs of G and / or C preferably at the 5 'end of the target region within the target gene or mRNA. However, other target sites within the molecule are also suitable, particularly those that have low sequence overlap with other gene sequences, thereby increasing the specificity of the treatment. Other oligonucleotides totally non-complementary to the target mRNA, but containing identical nucleotide compositions on the basis of w / w (controls) are included as controls in the anti-sense experiments to demonstrate the specificity of the activity of the agents of this invention. The primary and secondary structure of human adenosine A ^ receptor mRNA was analyzed and used as described above to design antisense oligonucleotides, including ones, whose sequences are provided. An anti-sense oligonucleotide (oligo I) was synthesized as a phosphorothioate, designated HAdAlAS, and has the following sequence: '-GAT GGA GGG CGG CAT GGC GGG-3' (SEQ ID N0: 1) As a control, a mismatched phosphorothioate anti-sense nucleotide designated HAdAlMM was synthesized using the following sequence: * -GTA GCA GGC GGG GAT GGG GGC-3 '(SEQ ID NO: 2) The oligonucleotides of SEQ ID NOS: 1 and 2 shown above have identical contents of bases and general sequence structures. Homology searches in GENBANK (edition 85.0) and EMBL (edition 40.0) indicated that the anti-sense oligonucleotide was specific for the adenosine, human, and rabbit receptor genes and that the mismatched control was not a candidate for the Hybridization with no known gene sequence. In the same way, the primary and secondary structure of human adenosine A3 receptor mRNA was analyzed and several oligos were selected, and the next two were synthesized as anti-sense phosphorothioate oligonucleotides. The first anti-sense oligonucleotide (HadA3ASl) synthesized has the following sequence: 5 'GTT GTT GGG CAT CTT GCC-3' (SEQ ID NO: 3). As a control, a mismatched phosphorothioate anti-sense oligonucleotide (HadA3MMl) was synthesized, which has the following sequence: '-GTA CTT GCG GAT CTA GGC-3' (SEQ ID NO: 4). The second anti-sense phosphorothioate oligonucleotide (HadA3AS2) has the following sequence: 5 '-GTG GGC CTA GCT CTC GCC-3' (SEQ ID NO: 5). As a control, its mismatched oligonucleotide (HadA3MM2) has the following sequence 5'-GTC GGG GTA CCT GTC GGC-3 '(SEQ ID NO: 6). All phosphorothioate oligonucleotides were synthesized in a synthesized oligonucleotide model 396 from Applied Biosystems Model Oligonucleotide Synthesizer, and purified using NENSORB chromatography (DuPont, MD).

Example 2: In Vitro Test of the Antisense Olians of the Adenosine Receptor A. The anti-sense oligonucleotide against the human A ^ receptor (SEQ ID NO: 1) described above was tested for efficiency in an in vitro model using lung adenocarcinoma cells HTB-54. The lung adenocarcinoma cells HTB-54 were demonstrated by expressing the adenosine Ax receptor using normal, Northern blotting procedures, and the receptor waves were designed and synthesized in the laboratory. Lung adenocarcinoma cells, human HTB-54 (10S / 100 mm tissue cre box) were exposed to 5.0 μM HAdAlAS or HAdAlMM for 24 hours, with a fresh change of media and oligonucleotides after 12 hours of incubation. After 24 hours of exposure to the oligonucleotides, the cells were harvested and their mRNA was extracted by normal procedures. A 21-mer probe corresponding to the region of the mRNA selected as target by the anti-sense_ (and therefore having the same sequence as the anti-sense, but not phosphorothiated) was synthesized and used to probe Northern blots of the mRNA from HTB-54 cells not treated and treated with HAdAlAS, treated with HAdAlMM. These transfers clearly showed that the HAdAlAS but not the HAdAlMM effectively residues the mRNA of the adenosine receptor, human by >;fifty%. This result showed that HAdAlAS is a good candidate for an anti-asthma drug since it exhausts the intracellular mRNA for the adenosine Ax receptor that is included in the asthma.

Example 3: In Vivo Efficiency of the anti-sense oliaonucleotides of the adenosine Ax receptor. A fortuitous homology between the rabbit and human DNA sequences with the Aj gene. of adenosine that overlaps the initiation codon, allowed the use of phosphorothioate anti-sense oligonucleotides, initially designed for use against the adenosine Ax receptor, human in a rabbit model. White, New Zealand, neonatal, free Pasteurella rabbits were immunized intraperitoneally in the space of 24 hours from birth with 312 units of antigen / mL of homemade dust tick extract (D. farinae) (Berkeley Biologicals, Berkeley, CA), mixed with 10% kaolin. The immunizations were repeated weekly during the first month and then biweekly for the next 2 months. At 3-4 months of age, eight sensitized rabbits were anesthetized and relaxed with a mixture of acetamine hydrochloride (44 mg / kg) and acepromazine maleate (0.4 mg / kg) administered intramuscularly. The rabbits were then rendered indolent in a comfortable position on a small, molded, pad, animal board and were tubed with a 4.0 mm intratracheal tube (Mallinkrodt, Inc., Glens Falls, NY). A 2.4 mm outer diameter polyethylene catheter with a bound latex balloon was passed into the esophagus and kept at the same distance (approximately 16 cm) from the mouth throughout the experiments. The intratracheal tube was attached to a heated Fleisch pneumotophagus (size 00, DOM Medical, Richmond, VA), and flow was measured using a Validyne differential pressure transducer (Model DP-45161927; Validyne Engineering Corp., Northridge, CA), operated by a Gould pressure amplifier (Model 11-4113; Gould Electronic, Cleveland, OH). The esophageal balloon was attached to one side of the differential pressure transducer and the intratracheal tube outlet was connected to the opposite side of the pressure transducer to allow recording of transpulmonary pressure. The flow was integrated to give a continuous gretric volume, and measurements of the total lung resistance (RL) and dynamic compliance (Cdyn) were calculated at zero flow and isovolumic points, respectively, using a respiratory analyzer, automated (Model 6; Buxco, Sharon, CT). The animals were randomized and on day 1 pre-treatment values were obtained for PC50 for aerosolized adenosine. The mismatched anti-sense (HAdAlAS) or control oligonucleotides (HAdAlMM) were dissolved in sterile, physiological saline at a concentration of 5000 μg (5 mg) per 1.0 mg. The animals were subsequently anaesthetized, the anti-sense or mismatched oligonucleotide was aerosolized via an intratracheal tube (approximately 5000 μg in a volume of 1.0 ml) twice daily for two days. Aerosols of either saline, adenosine, or anti-sense or mismatch oligonucleotides were generated by an ultrasonic nebulizer (DeVilbiss, Somerset, PA), producing aerosol droplets, 80% of which was smaller than 5 μm. diameter. In the first arm of the experiment, four randomly selected allergic rabbits were administered the anti-sense oligonucleotide and four the mismatched control oligonucleotide. On the morning of the third day, the PC50 values (the concentration of adenosine delivered in aerosol in mg / ml required to reduce the dynamic compliance of the bronchial airway to 50% of the baseline) were obtained and compared. to the PC50 values obtained for these animals before exposure to the oligonucleotide. After a one-week interval, the animals were crossed, with those previously administered with the mismatch control oligonucleotide, now administered with the anti-sense oligonucleotide, and those previously treated with the anti-sense oligonucleotide were now administered with the oligonucleotide of control of malapareamiento. The treatment methods and measurements were identical to those used in the first arm of the experiment. It should be noted that in 6 of the 8 animals treated with anti-sense oligonucleotide, adenosine-mediated bronchoconstriction could not be obtained up to the solubility limit of 20 mg / ml adenosine. For the purpose of calculation, the PC50 values for these animals were adjusted to 20 mg / ml. The given values, therefore, represent a minimum figure for anti-sense effectiveness. The real effectiveness is higher. The results of this experiment are illustrated in both Figure 1 and Table 1.

Table 1: Effect of the antisense oligonucleotide of the adenosine Ax receptor on the PC50 values in asthmatic rabbits The results are presented as the average (n = 8) "SEM." Meaning was determined by repeated measures analysis of variance (ANOVA) and Tukey's protected t test. ** Significantly different from all other groups, P < 0.01.

In both arms of the experiment, the animals that received the anti-sense oligonucleotide showed an order of magnitude increase in the dose of adenosine administered in aerosol required to reduce the dynamic compliance of the lung by 50%. No effect of the mismatched control oligonucleotide on the PC50 values was observed. No toxicity was observed in any animal receiving either the anti-sense or the inhaled control oligonucleotide. These results clearly show that the lung has an exceptional potential as a target for therapeutic intervention based on the anti-sense oligonucleotide in lung disease. They are further shown, in a model system that closely resembles human asthma, that the lentifying regulation of the adenosine Ax receptor largely eliminates adenosine-mediated bronchoconstriction in the asthmatic airways. Bronchial hyperresponsiveness in the allergic rabbit model of human asthma is a final point, excellent for anti-sense intervention since the wounds included in the response are close to the point of contact with the oligonucleotides delivered in aerosol, and the The model closely simulates a major human disease.

Example 4: Specificity of the antisense oligonucleotide of the A-adenosine receptor. At the conclusion of the crossover experiment of Example 3, the airway smooth muscle of all rabbits was analyzed quantitatively for the number of A ^ adenosine receptors. As a control for the specificity of the anti-sense oligonucleotide, the A_ adenosine receptors, which should not have been affected, were also quantified. The smooth muscle tissue of the airways of each rabbit was cut and a membrane fraction was prepared according to the methods described (Kleinstein, J., and Glossmann, H., Naunyn-Shcmiedeberg's Arch. Pharmacol. 191-200 (1978), with slight modifications.The raw plasma membrane preparations were stored at -70 ° C until the time of the assay.The protein content was determined by the method of Bradford (M. Bradford, Anal. Biochem. 72, 240-254 (1976)) Frozen plasma membranes were thawed at room temperature and incubated with 0.2 U / ml adenosine deaminase for 30 minutes at 37 ° C to remove the endogenous adenosine - The binding of [3H] ] DPCPX (specific for receptor A-.) Or [3H] CGS-21680 (specific for receptor A) was measured as previously described See, Ali, S., et al., J. Pharmacol. Exp. Ther 268, 1328-1334 (1994), S. Alis et al., Am. J. Physiol. 266, L271-277 (1994) .As illustrated in both Figure 2 and Ta 2, the animals treated with the anti-sense oligonucleotide A ^ of adenosine in the crossover experiment had a decrease of almost 75% in the number of Ax receptors compared to the controls, as assessed by the specific binding of the DPCPX specific antagonist of A ^. There was no change in the number of A_ adenosine receptors as assessed by the specific binding of the specific receptor agonist A_, 2- [p- (2-carboxyethyl) -phenethylamino] -5 '- (N-ethylcarboxamido) adenosine (CGS -21680).

Table 2: Specificity or action of the antisense oligonucleotide of adenosine A receptor. Oligonucleotide oligonucleotide control of anti-sense of - - ^ malapareamiento (Average + SD) (Average + SD) n = 8 n = 8 The significance was determined by analysis of the variance of repeated measurements (ANOVA), and Tukey's protected t-test. ** Significantly different from the mating control, p < 0.01.

Example 5: In vivo response to adenosine stimulation with y. without pre-treatment with Oliso I Two hypersensitive monkeys (sensitive to ascaris) were stimulated with inhaled adenosine, with or without pre-treatment with the anti-sense oligo I (SEQ ID NO: 1). PC40 adenosine was calculated from the data collected • since it is equivalent to that amount of adenosine in mg that causes a 40% decrease in dynamic compliance in the hyper-sensitive airways. Oligo I (SEQ: ID: NO: 1; EPI 2010) was subsequently administered at 10 mg / day for 2 days by inhalation. On the third day, PC adenosine was measured again. The results are shown in Figure 3 that accompany this patent. The left column shows the value of PC40 adenosine before treatment with oligo I, while the right bar shows the PC40 of adenosine taken after the administration of oligo I. As can be seen in Figure 3, any adenosine sensitivity was completely eliminated by the administration of the oligo of this invention in an animal, and was substantially reduced in the second.

Example 6: Anti-sense oligonucleotides targeting other nucleic acid targets This work was carried out to demonstrate that the present invention can be broadly applied to antisense oligonucleotides ("oligo") specific to nucleic acid target, broadly. The following experimental studies were carried out to show that the method of the invention is broadly suitable for use with anti-sense oligos designed as taught by this application and targeted to any and all adenosine receptor mRNAs. For this purpose, several anti-sense oligos were prepared to the adenosine receptor mRNAs, exemplified by mRNAs of the A ^, A_b, and A3 adenosine receptor. The anti-sense oligo I was described above (SEQ ID NO: 1). Five additional anti-sense phosphorothioate oligos were designed and synthesized as indicated below. 1. Oligo II (SEQ ID NO: 997) also targeted to the adenosine receptor Ax, but to a different region than oligo I. 2. Oligo V (SEQ ID NO: 1000) directed to the A ^ adenosine receptor. 3. Oligos III (SEQ ID NO: 998) and IV (SEQ ID NO: 999) directed to different regions of the A3 adenosine receptor. 4. Oligo I-PD (SEQ ID NO: 1) (a phosphodiester oligo of the same sequence as oligo I).

Nt- These antisense oligos were designed for therapy in a selected species as described above and are generally specific for those species unless the target mRNA segment of another species comes to contain a similar sequence. All anti-sense oligos were prepared as described below, and were tested in vivo in a rabbit model for brococonstriction, inflammation and allergy, which have respiratory difficulties and impaired pulmonary areas, as is the case in ailments such as asthma, as described in the previously identified request.

Example 7: Design __ sequences from other anti-sense oligos Six oligos and their effects on the rabbit model Sa were studied and the results of these studies will be reported and discussed later. Five of these oligos were selected for this study to complement the data in oligo I (SEQ ID NO: 1) provided in the Examples 1 to 4 above. This oligo is anti-sense to a region of adenosine Ax receptor mRNA. The oligos tested were identified as the anti-sense oligos I (SEQ ID NO: 1) and II (SEQ ID NO: 997) directed to a different region of the mRNA of the A- receptor. of adenosine, oligo V (SEQ ID NO: 998) directed to adenosine A_b receptor mRNA, and antisense oligos III and IV (SEQ ID NO: 99 and 1000) directed to two different regions of the A ^ receptor mRNA of adenosine The sixth oligo (oligo I-PD) is a phosphodiester version of oligo I (SEQ ID NO: 1). The design and synthesis of these anti-sense oligos was performed according to Example 1 above.

(I) Anti-sense Oligo I The anti-sense oligonucleotide I referred to in Examples 1-5 above was directed to the mRNA of the adenosine receptor (EPI 2010). The anti-sense oligo I is 21 nucleotides long, overlaps the initiation codon and has the following sequence: 5 '-GAT GGA GGG CGG CAT GGC GGG-3' (SEQ ID NO: 1) Oligo I was previously shown which abolishes adenosine-induced bronchoconstriction in allergic rabbits, and reduces airway obstruction induced by allergen and bronchial hypersensitivity (BHR), as discussed above and shown by Nyce, JW & Metzger, W. J., Nature, 385: 721 (1977), the relevant portions of this reference are hereby incorporated by reference in their entirety.

(II) Anti-sense Oligo II A phosphorothioate anti-sense oligo (SEQ ID NO: 997) according to the invention was designed to target the + 936 to + 956 region of the adenosine A 2 receptor mRNA of rabbit in relation to the initiation codon (start site). The anti-sense oligo II is 21 nucleotides long and has the following sequence: 5 '-CTC GTC GCC GTC GCC GGC GGG-3' (SEQ ID NO: 997) (III) Anti-sense Oligo III A phosphorothioate anti-sense oligo different from that provided in Example 1 above (SEQ.ID.

NO: 998) was designed according to the invention to target the + 3 to + 22 region of mRNA of the anti-sense A3 receptor relative to the start site of the initiation codon. The anti-sense oligo III is 20 nucleotides long and has the following sequence: 5'-GGG TGG TGC TAT TGT CGG GC-3 '(SEQ ID NO: 998) (IV) Anti-sense oligo IV Yet another anti-sense phosphorothioate oligo (SEQ ID NO: 999) was designed according to the invention to target the +386 to +401 region of adenosine A3 receptor mRNA with relation to the initiation codon (start site). The anti-sense oligo IV is 15 nucleotides long, and has the following sequence: 5'-GGC CCA GGG CCA GCC-3 '(SEQ ID NO: 999) (V) Anti-sense Oligo V An anti-sense phosphorothioate oligo (SEQ ID NO: 1000) was designed according to the invention to select, target the -21 to -1 region of adenosine A 2 receptor mRNA with relation to the initiation codon (start site). Oligonucleotide V is 21 nucleotides long and has the following sequence: 5 '-GGC CGG GCC AGC CGG GCC CGG-3' (SEQ ID NO: 1000) (VI) Ax Mismatch Oligos Two mismatched, different oligonucleotides having the following sequences were used as controls for the anti-sense oligo I (SEQ ID NO: 1) described in FIG.

Example 6 above. x MM2 5 '-GTA GGT GGC GGG CAA GGC GGG-3' (SEQ ID NO: 1002) A2 MM3 5 '-GAT GGA GGC GGG CAT GGC GGG-3' (SEQ ID NO: 1003) Oligo I anti -felt and the two oligos anti? g sense of malapareamiento have an identical content of bases and a general structure of sequence. The homology searches in GENBANK (edition 85.0) and EMBL (edition 40.0) indicated that the anti-sense oligo I was specific, not only for the A ^ adenosine receptor, human genes, but also for the rabbit, and that the controls malapareados were not candidates for hybridization with any known human or animal gene sequence.

(VII) Anti-sense oligo AL-PD (oligo VI) A phosphodiester anti-sense oligo (oligo VI; SEQ ID NO: 1004) has the same nucleotide sequence as oligo I was designed as described in the application previously identified. The anti-sense oligo I-PD is 21 nucleotides long, overlaps the initiation codon, and has the following sequence: 5 '-GAT GGA GGG CGG CAT GGC GGG-3' (SEQ ID NO: 1004) (VIII) Controls To each rabbit 5.0 ml of sterile saline spray was administered following the same program as for the anti-sense oligos in (II), (III), and (IV) above.

Example 8: Synthesis of anti-sense oligos The phosphorothioate anti-sense oligos having the sequences described in (a) above were synthesized in an oligonucleotide synthesizer model. 396 from Applied Biosystems, and purified using NENSORB chromatography (DuPont, DE). TETD was used (tetraethylthiuran disulfide) as the sulfurizing agent during the synthesis. Anti-sense oligonucleotide II (SEQ ID NO: 997), oligonucleotide III (SEQ ID NO: 998) and anti-sense oligonucleotide IV (SEQ ID NO: 999) were each synthesized and purified in this way . Example 9: Preparation of allergic rabbits Immunized intraperitoneally in the space of 24 hours of birth free rabbits Pasturella, whites, from New Zealand, neonatal, with 0.5 ml of 312 units of antigen / mL of home dust mite extract (D. farinae) (Berkeley Biologicais, Berkeley, CA), mixed with 10% kaolin as previously described (Metzger, W. J., in Late Phase Allergic Reactions, Dorsch, W., Ed., CRC Handbook, pp. 347-362, CRC Press, Boca Ratón (1990); Ali, S., Metzger, W: J. and Mustafa, S. J., Am. J. Resp. Crit. Care Med. 149: 908 (1994)), the pertinent portions of which are incorporated herein by reference in their entirety. The immunizations were repeated weekly during the first month and then biweekly until the age of four months. These rabbits preferentially produce allergen-specific IgE antibody, typically respond to aeroallergen stimulation with both early and late phase asthmatic response, and exhibit bronchial hypersensitivity (BHR). Monthly, intraperitoneal administration of the allergen (312 units of powder mite allergen, as above) continues to stimulate and maintain the allergen-specific IgE antibody and BHR. At 4 months of age, sensitized rabbits were prepared for aerosol administration as described by Ali et al. (Ali, S. Metzger, W. J. and Mustafa, S. J., Am. J. Resp. Crit. Care Med. 149 (1994)), the relevant section which is incorporated herein in its entirety as a reference.

DOSAGE RESPONSE STUDIES Example 10: Experimental setting Adenosine aerosols (0-20 mg / ml), or anti-sense or one of two mismatch oligonucleotides (5 mg / ml) were prepared separately with an ultrasonic nebulizer (Model 646, DeVilb ± ss, Somerset, PA), which produced aerosol droplets, 80% of which were smaller than 5 μm in diameter. Equal volumes of aerosol were delivered directly to the lungs via an intratracheal tube. The animals were randomized and administered aerosolized adenosine. The pretreatment values of day 1 for the sensitivity to adenosine were calculated as the dose of adenosine that causes a 50% loss of compliance (PC50 of adenosine). The animals were then administered either an anti-sense spray or one of the anti-sense oligos of mismatch via the intratracheal tube (5 mg / lO ml, for 2 minutes, twice daily for 2 days (total dose, 20 'mg.) Post-treatment PC50 values (post-treatment stimulation) were recorded on the morning of the third day.The results of these studies were given in Example 21 below.

Example 11: Cross-over experiments For some experiments using the oligo I anti-sense (SEQ ID NO: 1) and an oligonucleotide A1 M2, of control, of corresponding mating, following an interval of two weeks, the animals were crossed, with those previously administered with the AXMM2 mismatch control, which now receive the oligo I antisense, and those previously treated with the oligo I antisense, which now receive the oligo AXMM2 control of mismatch. The number of animals per group was as follows. For the A4MM2 of malapareamiento (control 1), n = 7, since an animal was lost in the second control arm of the experiment due to technical difficulties, for the AXMM3 of malapareamiento n = 4 (control 2) and for the oligo I AjAS antisense, n = 8. The animals treated with the oligo of AjMM3 were analyzed separately and were not part of the crossing experiment. The treatment methods and the measurements used after crossing were identical to those used in the first arm of the experiment. In 6 of the 8 animals treated with the oligo I anti-sense (SEQ ID NO: 1), no PCS0 value could be obtained for adenosine doses of up to 20 mg / ml, which is the solubility limit of adenosine. Accordingly, the PC50 values for these animals assumed that they are 20 mg / ml for calculation purposes. Therefore, the given values represent a minimum figure for the effectiveness of the anti-sense oligonucleotides of the invention. Other groups of allergic rabbits (n = 4 for each group) were administered with doses of 0.5 to 0.05 mg of the oligo I anti-sense (SEQ ID NO: 1), or the oligo AXMM2 in the manner and according to the program described previously (total doses that are 2.0 or 0.2 mg). The results of these studies are given in Example 23 below.

Example 12: Formulation of the anti-sense oligo Each of the anti-sense oligos was solubilized separately in an aqueous solution and administered as described for the anti-sense oligo I (SEQ ID NO: 1) in (e) ) above, in four aliquots of 5 mg (20 mg of total dose) by means of a nebulizer via an endotracheal tube, as described above. The results obtained for the anti-sense oligo I and its mating controls confirmed that the mating controls are equivalent to the saline solution, as described in Example 20 below and in Table 1 of Nyce & Metzger, Nature 385, 721-725 (1997). Due to this finding, saline was used as a control for pulmonary function studies using oligos II, III and IV anti-sense (SEQ ID NOS: 997,998 and 999).

Example 13: Specificity for Oliqo I for the AA Receptor of Adenosine (Receptor Binding Studies) A smooth muscle tissue was cut from the airways to the primary, secondary and tertiary bronchi of the rabbits that had been administered to them. mg of oligo I (SEQ ID N0: 1) in 4 divided doses over a period of 48 hours as described above. A membrane fraction was prepared according to the method of Ali et al. (Ali, S., et al., Am. J. Resp. Crit. Care Med. 149: 908 (1994), the pertinent section pertaining to the preparation of the membrane fraction is incorporated herein in its entirety. as reference) . The protein content was determined by the Bradford method and the plasma membranes were incubated with 0.2 U / ml of adenosine deaminase for 30 minutes at 37 ° C to remove the endogenous adenosine. See, Bradford, M. M. Anal. Biochem. 72, 240-254 (1976), the relevant portion of which is thus incorporated in its entirety as a reference. The binding of [3H] DPCPX, [3H] NPC17731, or [3H] CGS-21680 was measured as described by Jarvis et al. See, Jarvis, M.F., et al., Pharmacol. Exptl. Ther. 251, 888-893 (1989), the relevant portion of which is fully incorporated herein by reference. The results of this study are shown in Table 8 and are discussed in Example 21 below.

Example 14: Measurements of Pulmonary Function (Compliance and Resistance) At 4 months of age, the immunized animals were anesthetized and relaxed with 1.5 ml of a mixture of ketamine HCl (35 mg / kg) and maleate. acepromazine (1.5 mg / kg) administered intramuscularly. After the induction of anesthesia, the allergic rabbits were placed comfortably indolently on a gently molded animal board. Ointment was applied to the eyes to prevent drying, and then they were closed. The animals were then intubated with a Murphy I endotracheal tube, widened, high-low, intermediate 4.0 mm (Mallinckrodt, Glen Falls, NY), as previously described by Zavala and Rhodes. See, Zavala and Rhodes, Proc. Soc. Exp. Biol. Med. 144: 509-512 (1973), the relevant portion of which is incorporated herein by reference in its entirety. A polyethylene catheter with an external diameter of 2.4 mm (Becton Dickinson, Clay Adams, Parsippany NJ) with a thin-walled, attached latex balloon was passed into the esophagus and kept at the same distance (approximately 16 cm) from the mouth throughout the experiment. The endotracheal tube was attached to a heated Fleisch pneumotachograph (size 00; DEM Medical, Richmod, VA), and the flow (v) measured using a Validyne differential pressure transducer (Model DP-45-16-1927, Validyne Engineering, Northridge , CA), driven by a Gould carrier amplifier (Model 11-4113, Gould Electronics, Cleveland, OH). One esophageal balloon was attached to one side of the Validyne differential pressure transducer, and the other side was attached to the endotracheal tube outlet to obtain transpulmonary pressure (Ptp). • The flow was integrated to produce a gravimetric volume, continuous, and measurements of total lung resistance (Rt) and dynamic compliance (Cdyn) were made at isovolumic and zero flow points. The flow, volume and pressure were recorded in a Gould 2000 W high frequency recorder of eight channels and the Cdyn was calculated using the total volume and the difference in Ptp at zero flow, and Rt was calculated as the ratio of Ptp and V to volumes of medium-gravimetric lung. These calculations were done automatically with the respiratory, mechanical, pulmonary, automated Buxco analyzer (Model 6, Buxco Electronics, Sharon, CT), as previously described by Giles et al. See, Giles et al., Arch. Int. Pharmacodyn. Ther. 194: 213-232 (1971), the relevant portion of which which describes these calculations is hereby incorporated in its entirety as a reference. The results obtained in the administration of oligo II in allergic rabbits are shown and discussed in Example 27 below.

Example 15: Measurement of Bronchial Hypersensitivity (BHR) Each allergic rabbit was administered histamine by aerosol to determine its baseline hypersensitivity. Aerosols of either saline or histamine were generated using DeVilbiss nebulizer (DeVilbiss, Somerset, PA) for 30 seconds and then for 2 minutes at each dose used. The ultrasonic nebulizer produced aerosol droplets of which 80% were of a diameter < 5 microns. The histamine aerosol was administered in increasing concentrations (0.156 to 80 mg / ml) and pulmonary function measurements were made after each dose. B4R was then determined by calculating the histamine concentration (mg / ml) required to reduce Cdyn to 50% from the baseline (PC50 Histamine). Example 16: Cardiovascular effect of Oliqo I Antisense Measurement of cardiac output and other parameters Cardiovascular uses CardiomaxRM uses the principles of thermal dilution in which the change in the temperature of the blood leaving the heart after a venous injection of a known volume of cold saline, is monitored. A rapid, individual injection of cold saline into the right atrium via cannulation of the right jugular vein is made, and the corresponding changes in the temperature of the injected compound, mixed and the blood in the aortic arch via the cannulation of the carotid artery by a 158 mini probe sensitive to temperature. Twelve hours after the allergic rabbits were treated with oligo I aerosols (EPI 2010; SEQ ID NO: 1) as described in (d) above, the animals were anesthetized with 0.3 mg / kg of 80% Cetamine and 20% Xylazine. This time point coincides with the previous data showing efficacy for SEQ. ID NO: 1, as clearly shown by Nyce & Metzger, (1997), supra, the pertinent description that is incorporated herein in its entirety as a reference. Then a thermocouple was inserted in. the left carotid artery of each rabbit, and then 6.5 cm was advanced and secured with a silk ligature. The right jugular vein was then cannulated and inserted and secured a length of polyethylene tubing. A thermodilution curve was then established on a Cardiomax * 01 II (Columbus Instruments, Ohio) by injecting sterile saline at 20 ° C to determine the accuracy of the thermocouple probe placement. After establishing the accuracy of the thermocouple position, the femoral artery and vein were isolated. The femoral vein was used as a portal for drug injections, and the femoral artery for measurements of blood pressure and heart rate. Once the constant cardiovascular parameters of the baseline were established, measurements were made with Cardiomax "11 for blood pressure, heart rate, cardiac output, total peripheral resistance and cardiac contractility.

Example 17: Duration of Oliqo I Action (SEQ ID N0: 1) Eight allergic rabbits initially received increasing logarithmic doses of adenosine by means of a nebulizer via an intra-tracheal tube, as described in (f) above, starting with 0.156 mg / ml until conformance was reduced by 50% (PC50 Aenosine) to establish a baseline or baseline. Six of the rabbits then received four aerosol doses of 5 mg of (SEQ ID N0: 1) as described above. Two rabbits received equivalent amounts of saline vehicle as controls. Starting 18 hours after the last treatment, the PC50 Adenosia values were tested again. After this point, measurements were continued for all animals every day, for up to 10 days. The results of this study are discussed in Example 26 below.

Example 18: Reduction in the number of Adenosine A ^ receptors by the Oliqo V Anti-sense Sprague Dawley rats were given 2.0 mg of the breathable anti-sense oligo V (SEQ ID NO: 1000) three # times for two days using an inhalation chamber as described above. Twelve hours after the last administration, the parenchymal tissue of the lung was cut and assessed for the binding of the A_b adenosine receptor using [311] -ÑECA as described by Nyce & Metzger (1997), supra. The controls were carried out by administration of equal volumes of saline. The results were significant at p < 0.05 using the Student's paired t test and discussed in Example 29 below.

Example 19: Comparison of the Oliqo JE and the Oliqo VI of Phosphodiester, Corresponding (SEQ ID NO: 1004) The oligo I (SEQ ID NO: l) counteracted the effects of adenosine and eliminated the sensitivity to it for an amount of adenosine up to 20 mg of adenosine / 5.0 ml (the solubility limit of adenosine). Oligo VI (SEQ ID NO: 1004), the phosphodiester version of the oligonucleotide sequence, was completely ineffective when tested in the same manner. Both compounds have an allergic sequence, differing only from the presence of the phosphorothioate residues in oligo I (SEQ ID NO: 1) and were distributed as an aerosol as described above and in Nyce & Metzger (1997), supra.

Significantly different from p < 0.001, Student's paired t test. The results are discussed in Example 30 below.

Results Obtained for the Oliqo I Anti-sense (SEQ ID NO: l) Example 20: Previous work results The nucleotide sequence and other data for the anti-sense oligo I (SEQ ID NO: l), which is specific for the A ^ - adenosine receptor, were previously provided. Experimental data showing the effectiveness of oligo I in the lentifying regulation of the number of receptors and their activity was also provided in an earlier manner. Additional information on the characteristics and activities of oligo I anti-sense are provided in Nyce, J.W. and Metzger, W.J., Nature 385: 721 (1997), the pertinent parts of which relating to the following results are incorporated into wholes herein as a reference. The publication of Nyce & Metzger (1997) provide data showing that the antisense oligo I (SEQ ID NO: 1): (1) The anti-sense oligo I reduces the number of A ^ - adenosine receptors in the bronchial smooth muscle of allergic rabbits of a dose-dependent manner as can be seen in Table 3 below. (2) The anti-sense oligo I attenuates the bronchoconstriction induced by adenosine and the bronchoconstriction induced by allergy. (3) Oligo I attenuates bronchial hypersensitivity as measured by histamine PC50, a normal measurement to assess bronchial hypersensitivity. This result clearly demonstrates the anti-inflammatory activity of the anti-sense oligo I as shown in Table 2 above. (4) As expected, because it was sealed to target it, the anti-sense oligo I is totally specific for the adenosine Ax receptor, and has no effect at all in any dose at any A-adenosine receptor very closely related or bradykinin B2 receptor, related. This is seen in Table 3 below. (5) In contradistinction to the above effects of oligo I, the mismatch control molecules MM2 and MM3 (SEQ ID NO: 1002 and SEQ ID NO: 1003) which have more identical composition and identical molecular weight but differ from the oligo I anti-sense (SEQ ID N0: 1) for 6 and 2 mismatches, respectively. These mismatches, which are the minimum possible as long as the identical base composition still remains, did not have any effect on any of the target recipients (A-., A_ or B2). These results, together with a complete lack of prior art in the use of anti-sense oligonucleotides, such as oligo I, directed to the adenosine Ax receptor, are unexpected results. The samples presented in this patent clearly enable and demonstrate the effectiveness, for their proposed use, of the claimed agents and method for treating a disease or condition associated with pulmonary airways, such as bronchoconstriction, inflammation, allergy (s) and the like. .

Example 21: Oliqo 1 Significantly Reduces Response to Adenosine Stimulation The receptor binding experiment is described in Example 13 above, and the results shown in Table 3 below show the binding characteristics of selective A adenosine ligand [3H ] DPCPX and the B3-selective ligand of bradykinin [3H] NPC 17731 in membranes isolated from airway smooth muscle of allergic rabbits treated with the receptor and the anti-sense and the mating of the adenosine A ^ receptor and the bradykinin B2 receptor. TABLE 3 UNION CHARACTERISTICS OF THE THREE QLIGQS ANT - SENSE Treatment1 Receptor Ax Receiver B2 M B_ Kd Bmax Adenosine Receptor 20 mg 0.36 + 0.029 19 + 1.52 0.39 + 0.031 14.8 + 0.99 nM fmoles * nM fmoles 2 mg 0.38 ± 0.030 32.2.56 0.41 + 0.028 15.5 + 1.08 nmoles nM fmoles nM 0.2 mg 0.37 ± 0.030 49 + 3.43 0.34 ± 0.024 15.0 ± 1.06 nM fmoles nM fmoles AjM l (Control) 20 mg 0.34 + 0.027 52.0 + 3.64 0.35 ± 0.024 14.0 ± 1.0 fmoles nM fmoles nM 2 mg 0.37 + 0.033 51.8 + 3.88 0.38 ± 0.028 14.6 + 1.02 fmoles fmoles nM fmoles BA ( Bradykinin Receptor) 20 mg 0.36 ± 0.028 45.0 + 3.15 0.38 ± 0.027 8.7 + 0.62 nM fmoles nM fmoles * 2 mg 0.39 + 0.035 44.3 + 2.90 0.34 ± 0.024 11.9 ± 0.76 nM fmoles nM fmoles ** 0.2 mg 0.40 ± 0.028 47.0 ± 3.76 0.35 + 0.028 15.1 + 1.05 nM fmoles nM fmoles B-MM (Control) 20 mg 0.39 ± 0.031 42.0 ± 2.9 0.41 + 0.029 14.0 ± 0.98 nM 4 fmoles nM fmoles mg 0.41 ± 0.035 40.0 + 3.20 0.37 ± 0.030 14.8 ± 0.99 nM fmoles nM fmoles 0.2 mg 0.37 ± 0.029 43.0 + 3.14 0.36 ± 0.025 15.1 + 1.35 nM fmoles nM fmoles Control 0.37 + 0.041 46.0 ± 5.21 0.39 ± 0.047 14.2 ± 1.35f solution nM moles Saline It refers to the total oligo administered in four doses equivalently divided during a period of 48 hours. The treatments and analyzes were performed as described in the methods. The significance was determined by analysis of the variance of repeated measurements (ANOVA), and the Tukeys protected t-test. N = 4-6 for all groups. * Significantly different from the mating control groups and treated with saline, p < 0.001; ** Significantly different from groups treated with mating control and treated with saline, p < 0.05.

Example 22: Effects of Response to Oliqo I Dose The anti-sense oligo I (SEQ ID NO: l) was found to reduce the effect of adenosine administration to the animal in a dose-dependent manner over the dose range tested as shown in Table 4 below.

TABLE 4 EFFECT OF THE RAESPÜESTA TO THE DOSAGE TO THE QLIGQ I ANTI-SENSE Total dose * ^ »50 Adenosine (mg) (g of Adenosine) Oligo I Anti-sense 0. 2 8.32 ± 7.2 2 . 0 14.0 ± 7.2 19.5 + 0.34 Oligo AXMM2 (Control) 0.2 2.51 ± 0.46 2.0 3.13 + 0.71 20 3.25 ± 0.34 The previous results were studied with Student's paired t test and found to be statistically different, p = 0.05 Oligo I (SEQ ID N0: 1), an anti-Ai adenosine receptor oligo, acts specifically on the A- receptor. of adenosine, but not A2 receptors of adenosine.

These results result from the treatment of the rabbits with the normal anti-sense oligo (SEQ ID NO: 1) or the mating control oligo (SEQ ID NO: 1002; AWT2) as described in Example 9 above and in Nyce & Metzger (1997), supra (four doses of 5 mg spaced 8 or 12 hours via a nebulizer via an endotracheal tube), the bronchial smooth muscle tube was joined and the number of A ± adenosine and A_ adenosine receptors was determined as reported by Nyce & Meetzger (1997), supra.

Example 23: Specificity of Oliqo I (SEQ ID NO: l) for the white chemical product Oligo I (SEQ ID No: l) is specific for the A ± adenosine receptor, while its mismatch controls have no activity . Figure 1 depicts the results acquired through the crossover experiment described in Example 10 above and in Nyce & Metzger (1997), supra. The two mating controls (SEQ ID NO: 1002 and SEQ ID NO: 1003) there is no evidence or effect on the value of PC50 Aeosine - On the contrary, administration of oligo I anti-sense (SEQ ID N0: 1) showed an increase of seven times the value of pC5D Adenosine. The results clearly indicate that the anti-sense oligo I (SEQ ID NO: 1) reduces the response (attenuates sensitivity) to exogenously administered adenosine compared to a saline control. The results provided in Table 2 above clearly establish that the anti-sense oligo I effect is dose-dependent (see, column 3 of Table 1). Oligo I was also shown to be totally specific for the A- receptor. of adenosine (see, 3 upper rows of the Table) not inducing activity in either the adenosine A2 receptor closely related to the bradykinin B2 receptor (see lines 8-10 of Table 2 above). In addition, the results shown in Table 2 establish that anti-sense oligo I (SEQ ID NO: 1) decreases sensitivity to adenosine in a dose-dependent manner, and that it does this in a manner dependent on oligo I anti -felt, since neither of the two oligouparotides control the mating (A-MM2; I KNOW THAT. ID NO: 1002 and A1MM3; I KNOW THAT. ID NO: 1003) show no effect on the PC 50 Adenosine values in attenuating the number of adenosine receptors ±.

Example 24: Effect on Bronchoconstriction and Aeroallergic-induced Inflammation Oligo I (SEQ ID NO: 1) showed that it significantly reduces the effect induced by histamine in the rabbit model compared to the oligos of malapareamiento. The effect of the anti-sense oligo I (SEQ ID N0: 1) and the mismatch oligos (AVIM2, SEQ ID NO: 1002 and A-MM3, SEQ ID NO: 1003) in the induced airway obstruction due to allergen and bronchial hypersensitivity was evaluated in allergic rabbits.

The effect of the anti-sense oligo I (SEQ ID NO: 1) on airway obstruction induced by allergen was assessed. As calculated from the area under the plotted curve, the anti-sense oligo I significantly inhibited the airway obstruction induced by allergen compared to the mismatched control (55%, p <0.05; repeated measures ANOVA , and Tukey's t test). A complete lack of effect was induced by the AXMM2 (Control) mismatch oligo in airway obstruction induced by allergen. The effect of the anti-sense oligo I (SEQ ID NO: 1) on the allergen-induced BHR was determined as before. As calculated from the His50 'PC50 value the anti-sense oligo I (SEQ ID NO: 1) the allergen-induced BHR was significantly inhibited in allergic rabbits compared to the unrequited control (61%, p < 0.05; repeated ANOVA measurements, Tukey t test). A complete lack of the effect of AjMM malaparment control on the BHR induced by allergen was observed. The results indicated that the anti-sense oligo I (SEQ ID NO: 1) is effective to protect against airborne allergen-induced bronchoconstriction (home dust mite). In addition, the oligo I anti-sense (SEQ ID.

NO: 1) it was also found to be a potent inhibitor of bronchial hypersensitivity induced by the dust mite, as shown by its effects on histamine sensitivity indicating anti-inflammatory activity for the anti-sense oligo I (SEQ. ID N0: 1).

Example 25: Oliqo I Anti-sense is Free of Side Effects. Harmful oligo I (SEQ ID N0: 1) was shown to be free of side effects that could be toxic to the recipient. No change in arterial blood pressure, cardiac output, pulse volume, cardiac pulse, total peripheral resistance or cardiac contractility (dPdT) were observed after administration of 2.0 or 20 mg oligo I (SEQ ID NO: 1). In addition, the results of the measurement of cardiac output (CO), pulse volume (SV), mean arterial pressure (MAP), heart rate (HR), total peripheral resistance were evaluated.

(TPR), and contractility (dPdT) with the Cardiomax ™ device (Columbus Instruments, Ohio). These results show that oligo I (SEQ ID NO: 1) has no detrimental effect on the critical cardiovascular parameters. More particularly, this oligo does not cause hypotension. This finding is of particular importance because other anti-sense phosphorothioate oligonucleotides have been shown in the past to induce hypotension in some model systems. Additionally, receiver A? Adenosine plays an important role in sinoatrial conduction within the heart. The attenuation of the Ai adenosine receptor by the anti-sense oligo I (SEQ ID NO: 1) could be expected to result, therefore, in detrimental extra-pulmonary activity in response to the receptor-identifying regulation. This is not the case. The anti-sense oligo I (SEQ ID NO: 1) does not produce any harmful intra-pulmonary effect and returns to the administration of the low doses of the present anti-sense oligo free of undesirable, unexpected side effects. This shows that when the oligo I (SEQ ID N0: 1) is administered directly to the lung, does not reach the heart in significant amounts to cause harmful effects. This is in contrast to traditional adenosine receptor agonists such as theophylline that does not escape from the lung and can cause harmful, even life-threatening, effects outside the lung.

Example 26: Durable effect of Oliqo I, Oligo I (S? Q. ID NO: l) evidences a lasting effect as evidenced by the PC50 values and resistance obtained in its administration before the stimulation with adenosine. The duration of the effect was measured with respect to the PC50 of oligo I anti-sense adenosine when administered in four equal doses of 5 mg each by means of a nebulizer via an endotracheal tube, as described above. The effect of the agent is significant during days 1 to 8 after administration. When the effect of the anti-sense oligo I (SEQ ID NO: 1) disappeared, the animals were administered with saline aerosols (controls), and the PC50 Aenosine values for all animals were again measured. Animals treated with saline showed values of PC50 Aenosine & amp; baseline (n = 6). The duration of the effect (with respect to Resistance) was measured for six allergic rabbits that had been administered 20 mg of the anti-sense oligo I (SEQ ID NO: 1) as described above, in the resistance of the pathways. Measure also as described above. The calculated duration, average effect was 8.3 days for both the PC50 of adenosine (p <0.05) and resistance (p <0.05). These results show that the anti-sense oligo I (SEQ ID NO: 1) has an extremely long direction of action, which is completely unexpected.

Example 27: Oliqo II Anti-sense The anti-sense oligo II, directed in the different region of adenosine Ax receptor mRNA, was found to be highly active against the mid-effects of A ^ adenosine. The experiment measured the effect of the administration of the anti-sense oligo II (SEQ ID NO: 997) on the values of compliance and resistance when 20 mg oligo II anti-sense or saline (control) was administered to two groups of allergic rabbits as described above. Conformance and resistance values were measured after administration of adenosine or saline as described above in Example 13. The effect of the anti-sense oligo of the invention was different from the control in a statistically significant manner, p < 0.05 using the paired t test, compliance; p < 0.01 for the resistance. The results showed that the oligo II anti-sense (S? Q. ID NO: 997), which selects A ^ receptor as a target effectively maintains compliance and reduces resistance in adenosine stimulation.

Example 28: Oils III and IV Anti-sense Los oligos III (SEQ ID NO: 998) and IV (SEQ ID NO: 999) were shown to actually target the A ^ adenosine receptor specifically for its effect in reducing inflammation and the number of inflammatory cells present in the separate administration of 20 mg in the anti-sense oligo III (SEQ ID NO: 998) and IV (SEQ ID NO: 999) to allergic rabbits as described "above." The number of inflammatory cells was determined in their bronchial lavage fluid 3 hours later by counting at least 100 viable cells The effect of oligos III (SEQ ID NO: 998) and IV (SEQ ID NO: 999) anti-sense on the granules and on the total cells in the bronchial lavage was assessed after exposure to the allergen The results showed that the anti-sense oligo IV (SEQ ID NO: 999) and the anti-sense oligo III (SEQ ID NO: 998) are very potent anti-inflammatory agents in the asthmatic lung after of exposure to dust-mite allergen. n the technique, the granules, especially the eosinophils, are the main inflammatory cells of asthma, and the administration of oligos III (SEQ. ID NO: 998) and IV (SEQ ID NO: 999) antisense reduced their numbers by 40% and 66%, respectively. Additionally, oligos IV (SEQ ID NO: 999) and III (SEQ.

ID NO: 998) anti-sense also reduced the total number of cells in the bronchial wash polishing by 40% and 80%, respectively. This is also an important indicator of the anti-inflammatory activity for the present anti-A3 adenosine agents of the invention. Inflammation is known to be a basis of bronchial hypersensitivity and allergen-induced bronchoconstriction in asthma. Both oligonucleotides III (SEQ ID NO: 998) and IV (SEQ ID NO: 999) anti-sense targeting the A3 adenosine receptor are representative of a new important class of anti-inflammatory agents that can be designed to specifically target the lung receptors of each species.

Example 29: Oliqo V An i-sense The anti-sense oligo V (SEQ ID NO: 1000), directed to the adenosine A ^ receptor mRNA, was shown to be highly effective in counteracting the effects mediated by A_b of adenosine and by reducing the number of A ^ adenosine receptors present to less than half.

Example 30: Unexpected Superiority of the Replaced I-DS Oliqo on the Phosphodiester Residue I-DS (SEQ ID NO: 1681) Oligos I (SEQ ID NO: 1) and I-DS (SEQ ID NO: 1) ) are administered separately to allergic rabbits as described above, the rabbits were then stimulated with adenosine. The phosphodiester oligo I-DS (SEQ.ID.NO.:1) was statistically less effective in counteracting the effect of adenosine, while oligo I (SEQ.ID.NO: l) showed high effectiveness, evidencing a PC50 of 20 mg adenosine Example 31: Oliqo VI Anti-sense For the present work, an additional anti-sense phosphorothioate oligo was designed for the Ai adenosine receptor (oligo VI). This anti-sense oligo was designed for therapy in a selected species as described in the above patent application and is generally specific for that species, unless the segment of the adenosine receptor mRNA of another chosen species came to have a similar sequence. The antisense oligos were prepared as described below, and were tested in vivo in a rabbit model for bronchoconstriction, inflammation, and pulmonary allergy, which has impaired respiratory and airway respiratory difficulties, as is the case in ailments such as asthma, as described in the previously identified request. An additional oligo and its effect on a rabbit model was studied and the results of the study are reported and discussed later. The present oligo (oligo VI anti-sense) was selected for this study to complement the data in the SEQ. ID N0: 1 (oligo I), which is anti-sense to the adenosine A receptor mRNA provided in the patent application identified above. This additional oligo is identified as the anti-sense oligo VI, and is directed to a different region of the adenosine Ax receptor mRNA than oligo I. The design and synthesis of this anti-sense oligo was carried out in accordance with the teaching, particularly Example 1, in the patent application identified above. The anti-sense oligo VI is a phosphorothioate designed to target the coding region of the +964 to +984 region of the rabbit adenosine receptor mRNA relative to the initiation codon (start site). Oligo VI was prepared as described in the above indicated application, and is 20 nucleotides long. Oligo VI is directed to the adenosine At receptor gene and has the following sequence: 5 '-CGC CGG CGG CTG CGG GCC GG-3' (SEQ ID NO: 1004) The oligo VI anti-sense phosphorothioate that has the sequence described (5) above, was synthesized in an oligonucleotide synthesizer Model 396 from Applied Biosystems, and purified using NENSORB chromatography (DuPont, DE) TETD (tetraethylthiuram disulfide) was used as the sulfurizing agent during the synthesis.

Example 32: Preparation of Allergic Rabbits Pasturella, New Zealand white, neonatal rabbits were immunized intraperitoneally within 24 hours of birth with 0.05 ml of 312 units of antigen / ml home dust mite extract (D .farinae) (Berkeley Biologicals, Berkeley, CA) mixed with 10% kaolin as previously described (Metzger, W. J., in Late Phase Allergic Reactions, Dorsch, W., Ed., CRC Handbook, pp 347-362, CRC Press, Boca Raton, 1990; Ali, S. Et al., Am, J. Resp. Crit. Care Med. 149: 908 (1994). Immunizations were repeated weekly during the first month and then bi-weekly until the animals were 4 months old. These rabbits preferentially produce allergen-specific IgE antibody, typically respond to airborne allergen stimulation with both early and late phase asthmatic response, and exhibit bronchial hyperresponsiveness (BHR). The intraperitoneal, monthly allergen administration (312 units of powder mite allergen, as before) continues to stimulate and maintain the antigen-specific IgE body of the allergen and the BHR. At 4 months of age, sensitized rabbits were prepared for aerosol administration as described by Ali et al. (1994), supra.

Example 33: Preparation of Adenosine Spray The adenosine aerosol (20 mg / ml) was prepared with an ultrasonic nebulizer (Model 646, DeVilbiss, Somerset, PA), which produces aerosol droplets, 80% of which was smaller than 5 μm in diameter. Equal volumes of the aerosols were delivered directly to the lungs via the intratracheal tube to the three rabbits. The animals were then administered aerosolized adenosine and the pre-treatment values of day 1 for adenosine sensitivity were calculated as the adenosine dose which causes a 50% loss of compliance (PC50 Adenosine). The animals were then administered the anti-sense aerosol via the intratracheal tube (5 mg / l .0 ml), for 2 minutes, twice daily for 2 days (total dose, 20 mg). The post-treatment PC50 values (post-treatment stimulation) were recorded on the morning of the third day. The results of these studies are provided in (9) below.

Example 34: Formulation of the Anti-sense Oliq Each of the anti-sense oligos was separately solubilized in an aqueous solution and administered as described for oligo I anti-sense in (e) above, in four aliquots of mg (20 mg of total dose) by means of a nebulizer via endotracheal tube, as described above.

Example 35: Oliqo VI Reduces Response to Stimulation with Adenosine Also or Better Than Oliqo X Oligo VI was tested on three allergic rabbits of the characteristics and enrolled as described in (7) above and in the patent application indicated above. Oligo VI was directed to a section of the coding region of the receptor Ax that is different from oligo I. Both of these target sequences were randomly selected from the many possible coding region target sequences. The three rabbits were treated identically as previously indicated for oligo I. Briefly, 5 mg of oligo VI was nebulized to the rabbits twice per day at 8-hour intervals, for two days. Subsequently, PC50 studies of adenosine were performed on the morning of the third day and compared to the PC50 values of pre-treatment. This protocol is described in more detail in Nyce and Metzger (Nyce &Metzger, Nature 385: 721-725 (1997)). The results obtained for the three rabbits are shown in Table 5 below.

Table 5 PC50 adenosine Before and After Treatment with Adenosine in Aerosol Treatment Time PCS0 of Adenosine (mg) Pre-treatment 3.0 + 2.1 Post-treatment > 20.0 * * maximum achievable due to the insolubility of adenosine in saline The three animals treated with oligo VI completely eliminated the sensitivity to adenosine from the measurable level of the agent shown in Table 1. That is, the administration of oligo VI abolished the adenosine-induced bronchoconstriction in the three allergic rabbits. The real efficiency of oligo VI is therefore greater than what could be measured in the experimental system used. when compared with the results previously presented for oligo I, it can be seen that oligo VI was found to be as effective or more effective than oligo I.

Example 36: Determining the exhaustion of the surfactant when the receptors are not yet expressed in the lung This example shows the effect of the oligos of the invention at the level of the lung phospholipid in an animal model for hypersensitivity to the adenosine Ax receptor . The column to the left of Figure 4 shows the level of the phospholipid present in the untreated allergic rabbit. When the A ± adenosine receptors in allergic rabbits were stimulated by aerosolized adenosine, there was significant depletion of the lung surfactant. See intermediate column in Figure 4. Administration of an anti-sense oligonucleotide that has been shown to block adenosine A ± receptor expression (SEQ ID NO: 1). See, Nyce, JW and Metzger, WJ, Nature (1997). When oligo I (SEQ ID NO: 1) was administered to the allergic rabbit before the administration of adenosine, this depletion of the surfactant induced by the adenosine A 2 receptor was completely prevented. See rightmost column in Figure 4. This indicates that the attenuation of adenosine A receptor by the administration of the present anti-sense oligonucleotides establishes the normal secretion of the surfactant. This is applicable to the prevention of RDS by administration during the gestation of the composition of the invention comprising a regulating oligo for the receptor ^^ or any agonist capable of stimulating the receptor A_a. This would be very beneficial because the currently available surfactant preparations used in the treatment of RDS are either incomplete or derived from animal sources.

Example 37: Effect of Oligo I. on Inflammation Rabbits were given 5 mg of Oligo I (SEQ ID N0: 1; EPI 2010) or saline (control) by nebulizer twice a day for two days and then stimulated with bacterial endotoxin administered by injection into the vein of the ear. The neutrophils, a key inflammatory cell in the ARDS, were then quantified (n = 3). The leftmost column represents a control with saline solution (saline administered to the rabbit - same volume as the treatment). The central column represents the high number of neutrophils produced by the treatment with endotoxin alone. The column to the right shows a significant decrease (statistically) in the number of neutrophils produced in the oligo I treatment. The data are shown in Figure 5. The results of the experimental test show a clear reduction in the number of neutrophils in the bronchial wash fluid obtained from animals treated with Oligo I.

Example 38: Effect of Oligo I. on Edema As in example 37, rabbits were administered 5 mg of oligo I (SEQ ID N0: 1; EPI 2010) or saline (control) by nebulizer twice a day for two days. days and then stimulated with bacterial endotoxin administered by injection into the vein of the ear. The left column represents the Edema produced by the bacterial endotoxin, and the right column shows the prevention or relief of the edema caused by the oligo of the invention. In this way, the data show that oligo I (EPI 2010) reduced lung edema caused by bacterial endotoxin.

Example 39: Effect of Oligo 1 on the Total Number of Inflammatory Cells 5 mg oligo I (SEQ ID NO: l; EPI 2010) or saline (control) were administered to rabbits, by nebulizer twice a day for two days, and then stimulated with bacterial endotoxin administered by injection into the vein of the ear. The total number of cells, an indication of inflammation, was then quantified in the bronchial wash fluid obtained from each animal (N = 3). The results show a dramatic increase in the total number of cells in the stimulation with bacterial endotoxin (intermediate bar) compared to saline solution (bar to the left). Finally, the administration of 5 mg oligo I shows a pronounced reduction in the total number of cells produced by endotoxin.

Example 40: Conclusions The work described and the results discussed in the examples clearly show that all anti-sense oligonucleotides designed according to the teachings of this patent were found to be highly effective in counteracting or reducing the effects mediated by the receptors to the who are heading That is, each and the two anti-sense oligos that target the A * - adenosine receptor mRNA, an anti-sense oligo that targets adenosine A_b receptor mRNA, and the two anti-sense oligos. who select the A3 receptor mRNA as target were able to counteract the effect of the exogenously administered adenosine mediated by the specific receptor to which they are directed. The activity of the anti-sense oligos of this inventionIn addition, it is specific to the target and does not work in substitution to inhibit another target. In addition, the results presented also show that the administration of the present agents results in side effects, noxious or toxicity, extremely low or nonexistent. This represents 100% success in providing agents that are highly effective and specific in the treatment of bronchoconstriction and / or inflammation. This invention is broadly applicable in the same manner to all or the corresponding genes and mRNAs that code for the proteins comprised in or associated with the diseases of the airways. A comparison of the phosphodiester and a version of the same oligonucleotide in which the phosphodiester linkages are replaced with phosphorothioate linkages evidenced an unexpected superiority for the phosphorothioate oligonucleotide on the phosphodiester sense oligo.

The above examples are illustrative of the present invention, but should not be considered as limiting thereof. The invention is further defined by the following claims, with equivalents of the claims included herein.

Claims (79)

1. CLAIMS 1. A pharmaceutical composition, comprising: an agent that when administered to a subject is effective to prevent, alleviate and / or inhibit damage and / or cardiopulmonary and / or renal failure mediated by adenosine, the agent is selected from from the group consisting of: A2a adenosine receptor agonist agents; nucleic acids comprising one or more oligonucleotides (oligos) selected from a group consisting of oligos that are anti-sense to the target genes and the mRNAs corresponding to the target genes, to the genomic flanking regions selected from a group consisting of the intron and exon boundaries selected from a group consisting of the 5 'end, the 3' end and the juxta-section between the coding and non-coding regions, and all segments of the MRNA (s) encoding adenosine Al, A2a, A2b and A3 receptors that have adenosine Al, A2b or A3 receptor activity or that lack agonist activity or that have antagonistic activity at the A2 adenosine receptor, containing about 0 or less than about 15% adenosine (a), and mixture thereof; and optionally one or more surfactants 2. The composition according to claim 1, wherein the oligo consists of up to about 10% A. The composition according to claim 2, wherein the oligo consists of up to about 5% A 4. The composition according to claim 3, wherein the oligo is free of A. The composition according to claim 4, further comprising an agent selected from a group consisting of diagnostic and therapeutic agents, preferably selected from a group consisting of adenosine ^, A_b and A3 receptor inhibiting agents and adenosine A2a receptor stimulating agents (agonists), anti-inflammatory agents, anti-bacterial agents, anti-sepsis agents, anti-rhinitis agents allergic, agents for restoration and maintenance of renal activity and agents for the treatment of pulmonary vasoconstriction, inflammation, allergies, asthma, respiratory impaired ion, respiratory distress syndrome (RDS and ARDS), pain, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, obstructive pulmonary disease, chronic (COPD) and cancers selected from the group consisting of leukemias, lymphomas and carcinomas of colon, breast, lung, pancreas, hepatocellular carcinoma, metastatic cancer of the melanoma kidney, liver, lung, breast and prostate, radiation agents, chemotherapeutic agents, imaging agents, cardiac stress test agents, antibody, phototherapeutic agents, adenosine, and other antiarrhythmic agents. The composition according to claim 1, wherein the target gene is selected from a group that) consists of genomic flanking sections, target genes, 10 sequences comprising an initiation codon sequences comprising 2 or more G and / or C nucleotides, mRNA and flanking regions thereof of adenosine A receptor having an agonistic and A2a adenosine receptor activity having antagonistic or it lacks A2a adenosine receptor activity and optionally, one or more surfactants. The composition according to claim 1, wherein the target gene is selected from a group consisting of genomic flanking regions, target genes, Sequences comprising an initiation codon, sequences comprising two or more G and / or C nucleotides, mRNA and flanking regions thereof of the receptors - __ and A3 ^ and adenosine, which have agonistic activity of the A2b and A3 receptor of adenosine, and optionally, one or more 25 surfactants. 8. The composition according to claim 1, wherein one or more adenosines (A) is (are) substituted by a universal base selected from a group consisting of heteroaromatic bases that bind to the thymidine base, but having antagonist or agonist activity of less than about 0.5 of the agonistic or antagonist activity of the adenosine base at the Ax, • _a / -__ and A3 adenosine receptors. The composition according to claim 1, wherein the agent is an A2a agonist of adenosine, and the composition optionally comprises one or more surfactants. The composition according to claim 8, wherein the heteroaromatic bases are selected from a group consisting of pyrimidines and purines, which may be substituted by O, halo, HN2, SH, SO, S02, S03, COOH and primary amino and secondary branched and bonded, alkyl alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, alkoxy, alkenoxy, acyl, cycloacyl, arylacyl, alkyloxy, cycloalkoxy, aroyl, arylthio, arylsulfoxyl, halocycloalkyl, alkylcycloalkyl, alkenylcycloalkyl, alkynylocloalkyl, haloaryl, alkylaryl, alkenylaryl, alkynylaryl, arylalkyl, arylalkenyl, arylalkynyl, arylcycloalkyl, which may be optionally substituted by O, halo, NH2, primary, secondary and tertiary amine, SH, SO, S02, S03, cycloalkyl, heterocycloalkyl and heteroaryl. The composition according to claim 10, wherein the pyrimidines and purines are substituted at the positions selected from a group consisting of positions 1, 2, 3, 4, 7 and 8. 12. The composition according to claim 11, wherein the pyridimidines and purines are selected from a group consisting of theophylline, caffeine, difillin, etofylline, acetyline, piperazine, bamifiline, emprophylline and xanthine having the chemical formula wherein R1 and R2 are independently H, alkyl, alkenyl or alkynyl and R3 is H, aryl, dicycloalkyl, dicycloalkenyl, dicycloalkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, O-cycloalkyl, O-cycloalkenyl, O-cycloalkynyl, NH2-alkylamino-ketoxyalkyloxy -aryl and mono- and dialkylaminoalkyl-N-alkylamino-S02 aryl '13. The composition according to claim 12, wherein the universal base is selected from a group consisting of 3-nitropyrrole-2'-deoxynucleoside, 5-nitro-indole, 2-deoxyribosyl- (5-nitroindole), 2-deoxyribofuranosyl- (5-nitroindole), 2'-deoxyinosine, 2'-deoxynebularin, 6H, 8H-3,4-dihydropyrimido [4, 5 c] oxazine-7-one or 2-amino-6-methoxyminopurine. The composition according to claim 1, wherein a methylated cytosine (mC) is substituted by a non-methylated cytosine (C) if at least one CpG dinucleotide is present in the oligo (s) 15. The composition according to claim 1, wherein at least one mononucleotide residue of the anti-sense oligonecleotide (s) is a residue selected from a group consisting of methylphosphonate, phosphotriester, phosphorothioate, phosphorodithioate, boranophosphate, formacetal, thioformacetal, thioether, carbonate, carbamate , sulfate, sulfonate, sulphamate, sulfonamide, sulfone, sulfite, sulfoxide, sulfide, hydroxylamine, methylene (methylimino), (MMI), methoxymethyl (MOM), methoxyethyl (MOE), methyleneoxy (methylimino) (MOMA), methoxymethyl (MOM) , 2 * -0-methyl, phosphoramidate and substituted C-5 residues, and combinations thereof. 16. The composition according to claim 1, wherein the anti-sense oligonucleotide comprises about 7 to about 60 mononucleotides. 17. The composition according to claim 1, wherein the anti-sense oligonucleotide is selected from a group consisting of SEQ ID NOS .: 1, 3, 5, 7 and fragments 1-957 (SEQ ID NO: 8-952) of SEQ ID NO: 7 and of SEQ ID NOS: 953-999. The composition according to claim 1, wherein the anti-sense oligonucleotide is linked to an agent selected from a group consisting of internalized agent (s) or cellular uptake and cell selection agents, these agents being selected preferably from a group consisting of transferrin, asialoglycoprotein and streptavidin. 19. The composition according to claim 18, wherein the nucleic acid is linked to a vector. 20. A vector, comprising the oligo of claim 19, wherein the vector is selected from a group consisting of prokaryotic or eukaryotic vectors. 21. A cell, comprising the oligo of claim 1. 22. The composition according to claim 1, further comprising a carrier, preferably a biologically acceptable carrier, and more preferably a pharmaceutically or veterinarily acceptable carrier. 23. The composition according to claim 22, wherein the carrier is selected from the group consisting of gaseous, liquid, solid carriers and mixtures thereof. The composition according to claim 23, further comprising an agent selected from a group consisting of diagnostic and other therapeutic agents, antioxidants, flavoring and coloring agents, fillers, volatile oils, buffers, dispersants, surface active agents, RNA inactivation agents, antioxidants, flavoring agents, propellants and preservatives. 25. The composition according to claim 24, comprising the agent, a therapeutic agent and a surfactant and a pharmaceutically acceptable carrier. 26. The composition according to claim 24, wherein the diagnostic and therapeutic agents are selected from a group consisting of other adenosine A-, A ^, and A3 receptor inhibiting agents and A2a receptor stimulating agents. , of adenosine, anti-inflammatory agents, contrast imaging agents, cardiac stress test agents, antibacterial agents, anti-sepsis agents, maintenance agents and restoration of renal activity and agents for the treatment of pulmonary vasoconstriction, inflammation, allergies, asthma, impaired respiration, respiratory distress syndrome , pain, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, chronic obstructive pulmonary disease (COPD), ARDS, RDS, allergic rhinitis, hypoxia, cardiopulmonary and renal damage or failure, and cancers selected from a group consisting of leukemias, lymphomas and carcinomas of colon, breast, lung, pancreas, hepatocellular carcinoma, kidney, melanoma, hepatic, pulmonary, breast and prostate metastatic cancer, radiation agents, chemotherapeutic agents, antibody therapy agents and phototherapeutic agents. 27. The composition according to claim 24, wherein the RNA inactivating agent comprises an enzyme, preferably a ribozyme. The composition according to claim 1, wherein the agent is present in an amount of about 0.01 to about 99.99 w / w of the composition, preferably about 1 to about 40 w / w of the composition. 29. A formulation, comprising the composition according to claim 24, selected from a group consisting of systemic and topical formulations, preferably selected from a group consisting of oral, intrabuccal, intrapulmonary, rectal, intrauterine formulations , intratumoral, intracranial, nasal, intramuscular, subcutaneous, intravascular, intratracheal, inhalable, transdermal, intradermal, intracavitary, implantable, iontophoretic, ocular, vaginal, intraarticular, optic, intravenous, intramuscular, intraglandular, intraorganal, intralymphatic, implantable, slow release and enteric coating. The formulation according to claim 29, which is an oral formulation wherein the carrier is selected from a group consisting of solid and liquid carriers. The formulation according to claim 30, wherein the liquid carrier is selected from a group consisting of solutions, suspensions and emulsions, water in oil and oil in water. 32. The formulation according to claim 30, which is selected from the group consisting of a powder, dragees, tablets, capsules, sprays, aerosols, solutions, suspensions and emulsions. 33. The formulation according to claim 29, which is a topical formulation, of the carrier is selected from a group consisting of creams, gels, ointments, sprays, aerosols, solutions, suspensions and emulsions. 34. The formulation according to claim 29, which is an injectable formulation, wherein the carrier is selected from a group consisting of aqueous and alcoholic solutions, suspensions and oil solutions and suspensions and emulsions of oil in water and water in oil . 35. The formulation according to claim 29, which is a rectal formulation in the form of a suppository. 36. The formulation according to claim 29, which is a transdermal formulation, wherein the carrier is selected from a group consisting of aqueous and alcoholic solutions, oil solutions and suspensions and oil-in-water and water-in-oil emulsions. 37. The formulation according to claim 36, »which is an iontophoretic transdermal formulation wherein the carrier is selected from a group consisting of aqueous and alcoholic solutions, oil solutions and suspensions and emulsions oil in water and water in oil, and wherein the formulation further comprises a transdermal transport promoter agent. 38. An implantable cartridge capsule, comprising the formulation of claim 36. 39. The formulation according to claim 29, wherein the carrier is selected from the group consisting of aqueous and alcoholic solutions, and oil suspensions and suspensions and emulsions. oil in water and water in oil. 40. The formulation according to claim 29, wherein the carrier comprises a hydrophobic carrier, which is preferably lipid particle vesicles, more preferably comprising liposomes or microcrystals. 41. The formulation according to claim 40, wherein the vesicles comprise liposomes comprising the agent. 42. The formulation according to claim 40, wherein the vesicles comprise N- (l- [2,3-dioleoxyloxy] -propyl) -N, N, N-trimethyl-methylsulfate ammonium methylsulfate. 43. The formulation according to claim 29, comprising a respirable or inhalable formulation, preferably an aerosol. 44. The formulation according to claim 29, in the form of a single or multiple unit, or in bulk. 45. A team to prevent or treat damage or heart, lung and / or kidney failure, ARDS, and RDS that includes: a distribution team; in a separate container, the formulation of claim 29; and instructions for its use, and optionally, in a separate container, an agent selected from the group consisting of other therapeutic and diagnostic agents, surfactants, solvents, antioxidants, flavorings, fillers, volatile oils, dispersants, antioxidants, agents flavorings, preservative propellants and shock absorbers, agents. of RNA inactivation, agents internalized or captured in cells and coloring agents. 46. The equipment according to claim 45, wherein the dispensing device comprises a nebulizer that distributes individual dosed doses of the formulation. 47. The equipment according to claim 46, wherein the nebulizer comprises an insufflator; and the composition is provided in a pierceable or openable cartridge or cartridge. 48. The equipment according to claim 45, wherein the dispensing device comprises a pressurized inhaler; and the composition comprises a suspension solution or dry formulation of the agent and / or a solvent. 49. The kit according to claim 45 comprises, in separate containers, nucleic and therapeutic agents selected from a group consisting of other A? Receptor antagonists. r A_b, and A3 of adenosine stimulants of the A2a adenosine receptor (agonists), anti-inflammatory agents, antibacterial agents, maintenance agents and restoration of cardiac, pulmonary and renal activity, anti-cancer agents, adenosine, control agents blood pressure and diuretics. 50. The kit according to claim 45, wherein the solvent is selected from a group consisting of organic solvents and organic solvents mixed with one or more co-solvents. 51. The kit according to claim 45, wherein the composition is provided in a capsule or cartridge. 52. An in vivo method for distributing the pharmaceutical composition to a white polynucleotide, which comprises administering to a subject that is suspected or at risk or affected with heart, lung and / or kidney damage or failure, acute respiratory distress syndrome ( ARDS), RDS, the composition of claim 1, comprising an amount of the agent effective to prevent or treat heart, lung and / or kidney damage or failure, ARDS, RDS, or an anti-ARDS amount of the nucleic acid effective to achieve and act on the white polynucleotide. 53. A method to prevent, alleviate or counteract to prevent or treat damage or heart failure, pulmonary and / or renal-mediated adenosine receptor, respiratory distress syndrome (_ acute (ARDS), RDS, allergic rhinitis and COPD, which comprises carrying out the method of claim 52. 54. The method according to claim 52, wherein the composition is administered in the respiratory system of the subject. 55. The method according to claim 52, wherein the agent is an A2a adenosine agonist agent, the The amount of the agent administered is an anti-bronchoconstriction effective amount associated with ARDS or RDS, and the method is to prevent or treat ARDS. 56. The method according to claim 52, wherein the agent is an Al antagonist agent of Adenosine, the amount of the agent administered is an anti-bronchoconstriction effective amount associated with anti-COPD to prevent or treat COPD. 57. The method according to claim 52, wherein the agent is an anti-sense oligo to the mRNA, 20 adenosine A3 receptor, the amount of agent administered is an effective amount anti-allergic rhinitis, the method is to prevent or treat allergic rhinitis. 58. The method according to claim 52, wherein the amount of the agent administered is an effective anti-hypoxic pulmonary, cardiac or renal effect, and the method is to prevent or treat damage and / or pulmonary, cardiac and / or heart failure. or renal. 59. The method according to claim 52, wherein the amount of agent administered is effective to prevent or treat cardiopulmonary hypoxia associated with the administration of stress test agents. 60. The method according to claim 52, wherein the amount of agent administered is effective to prevent or treat damage and / or renal insufficiency associated "with the administration of imaging agents." 61. The method according to claim 52, in where the agent is effective to reduce the production or availability or to increase the degradation of the adenosine receptor mRNA or to reduce the amount of the adenosine receptor. 62. The method according to claim 52, wherein the agent is administered directly into the lung (s) of the subject. 63. The method according to claim 52, wherein the agent is administered as a respirable aerosol. 64. The method according to claim 52, wherein the disease or condition is associated with acute inflammation. 65. The method according to claim 52, wherein the therapeutic diagnostic agent is selected from a group consisting of adenosine ^, A ^ 'and A3 receptor inhibiting agents and adenosine A2a receptor stimulating agents, agents anti-inflammatory, antibacterial agents, anti-sepsis agents, maintenance agents and restoration of renal activity and agents for the treatment of pulmonary vasoconstriction, inflammation, allergies, asthma, impaired breathing, respiratory distress syndrome (RDS), acute respiratory distress syndrome (ARDS), allergic rhinitis, pain, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, chronic obstructive pulmonary disease (COPD) and cancers selected from the group consisting of leukemias, lymphomas and colon carcinomas, breast, lung, pancreas, hepatocellular carcinoma, metastatic cancer of the kidney, melamine, liver, lung, breast and prostate ata, radiation agents, chemotherapeutic agents, antibody therapy agents, phototherapeutic agents, adenosine, and other anti-arrhythmic agents. 66 The method according to claim 52, wherein the therapeutic agent is selected from a group consisting of anti-adenosine receptor agents. 67. The method according to claim 55, wherein ARDS is associated with sepsis. 68. The - method according to. Claim 52, wherein the composition is administered by a transdermal or systemic route. 69. The method according to claim 68, wherein the composition is administered orally, intracavitatively, intranasally, intraanally, intravaginally, intrauterine, intraarticular, transdermally., intrabuccal, intravenous, subcutaneous, intradural, intramuscular, intravascular, intratumoral, intraglandular, intraocular, intracranial, in an organ, intravascular, intratracheal, intralymphatic, intraoptic, intrathecal, by implantation, by inhalation, intradermal, intrapulmonary, intrortial, by slow release , by sustained release and by a pump. 70. The method according to claim 52, wherein the subject is a mammal. 71. The method according to claim 70, wherein the mammals are selected from a group consisting of humans and animals. 72. The method according to claim 71, wherein the mammal is a human. 73. The method according to claim 71, wherein the subject is an animal. 74. The method according to claim 52, wherein the anti-sense oligonucleotide is administered in an amount of about 0.005 to about 150 mg / kg of body weight. 75. The method according to claim 74, wherein the anti-sense oligonucleotide is administered in an amount of about 0.01 to about 75 mg / kg of body weight. 76. The method according to claim 75, wherein the antisense oligonucleotide is administered in an amount of about 1 to 50 mg / kg body weight. 77. The method according to claim 52, which is a preventive prophylactic method. 78. The method according to claim 52, which is a therapeutic method. 79. The method according to claim 52, wherein the oligo is maintained at n *.:. (a) selecting fragments of the target nucleic acid having at least 4 contiguous nucleic acids selected from a group consisting of G and C; (b) obtaining a first oligonucleotide of 4 to 60 nucleotides in length comprising the selected fragment and having a nucleic acid content of C and G of about 0 to and including about 0 to 15%; and (c) obtaining a second oligonucleotide of 4 to 60 nucleotides in length comprising a sequence that is anti-sense to the selected fragment, the second oligonucleotide has an A content of up to and including approximately up to 15%.