MXPA00002554A - Method for large scale mutagenesis in crop plants - Google Patents

Abstract

The present invention enables the rapid and large-scale production of mutants in crop plants. This is accomplished by utilizing a miniature plant which can be crossed with a commercial plant of the same species. Mutations are induced in the miniature cultivar, and the mutants subsequently identified in the resulting mutant plant population. Mutant genes of interest can be introgressed into a commercial cultivar by crossing selected mutant miniature plants with the commercial cultivar. Reverse genetics can be undertaken using a plant population of the miniature crop which contains random T-DNA or transposon insertion events and screening this population for insertions into genes of interest. Likewise, the miniature plant population is transformed with a DNA construct comprised of a promoter-less screenable marker gene within a mobile DNA. The mutants derived from this construct are rapidly screened for expression of the screenable marker gene and the promoter operably linked to the screenable marker gene in these transformants is cloned.

Description

METHOD FOR LARGE-SCALE MUTAGENESIS IN CULTIVATION PLANTS FIELD OF THE INVENTION The present invention is in the field of phytogenetics and relates to improved methods for mutagenesis, gene identification and analysis of the function of genes in crop plants. The methods are useful in any plant species, and their use in tomatoes is simplifies in the present.

BACKGROUND OF THE INVENTION It is estimated that the genomes of higher plants contain 15 30,000 to 50,000 genes. One function has been assigned to only a few hundred plant genes. The isolation of new genes and the mutation of said newly isolated genes is frequently required to determine their function. The improvement of crops through biotechnology depends on the detailed characterization of newly isolated genes. The model system of Arabidopsis has contributed greatly to the remarkable advances in molecular biology of plants during the last decade. The main reasons for the successful use of Arabidopsis are its small size, short life cycle and relatively small genome (Leutwiler et al., 1984). In addition, Arabidopsis can be easily transformed with introduced DNA (Bechtold et al., 1993). These characteristics facilitate the genetic dissection of any characteristic expressed in Arabidopsis through the selection of large populations of mutants for the different genes, which control a characteristic of interest. Plant populations mutagenized by ethyl methanesulfonate (EMS), rapid neutron bombardment, T-DNA insertions and transposon labeling have proved invaluable to plant biologists as a means to dissect genetic control of the development and characteristics of the plant genome (Koncz et al., 1992). Despite the considerable advantages of using Arabidopsis as a model for genetic selection, this is not a crop plant, and the knowledge acquired in this species can not always be applied to other species of agronomically important crops. For example, Arabidopsis has a fruit type in silicua, and therefore is a good species model for fruit development in members of the Brassicaceae, but is not useful for plants that produce a succulent berry fruit. On the other hand, the tomato (Lycopersicon esculentum) is a model suitable for crop species that produce a succulent berry-like fruit. The tomato is well known genetically. The tomato has a relatively small diploid genome (n = 12, C = 1 pg) that contains hundreds of mapped characteristics and molecular markers (Tanskley, 1993). The tomato can be transformed with introduced DNA (McCormick et al., 1986). In addition, it is one of the most important crops in the fresh vegetable market, as well as in the food processing industry (Hille et al., Rick and Yoder, 1998). A major obstacle to further advances in tomato genetics is the lack of large mutant populations required for gene identification. A population of mutants useful for tomatoes would contain at least one mutant allele for each tomato gene. Such a population would make it possible to achieve a saturated mutagenesis in this culture. Although there are techniques to produce mutant tomato plants, this is currently impractical, due to time and space constraints, to apply these techniques on a scale large enough to obtain populations in which the genome is saturated with mutations. These same restrictions limit research in other agronomic crops. Mutant tomato plants have been produced by the use of DNA-damaging agents, such as EMS (Hildering and Verkerk, 1965; Schoenmakers and others, 1991; Wisman et al., 1991), X-rays (Hildering and Verkerk, 1965), or fast neutrons (Verkerk, 1971), although to a much more limited extent compared to similar efforts in Arabidopsis. Few hundreds of mutant tomato lines, available through the Tomato Genetic Resource Center, have been described, but mutagenized M2 seed supply materials are not available.

^ Jj * i of a large population of M1 plants, for the selection of mutations in new genes. Insertion mutagenesis by T-DNA labeling is not practical in tomatoes, since the transformation procedures are still laborious. Transposon labeling, on the other hand, is a promising approach for the mutagenesis and identification of genes in tomato and other agronomic species. The family of the transposable Ac / Ds element has been shown to be active in tomato (Yoder et al., 1988), and Ac / Ds transposition patterns have been described in this species (Carroll et al., 1995; Osborne et al. 1991; Rommens et al., 1992 Yoder et al., 1988). Tomato lines have been produced that contain Ds elements that were mapped in the tomato genome (Knapp et al., 1994, Thomas et al., 1994). These lines make it possible to take advantage of the preferential insertion of Ac / Ds in nearby sites (Dooner and Belachew, 1989, Jones et al., 1990). The Ac / Ds labeling system was used to label and isolate several genes such as cf9, a locus responsible for Cladosporium resistance (Jones et al., 1994); dwarf, a gene encoding a cytochrome p450 homologue (Bishop et al., 1996); and del, which controls the development of chloroplasts (Keddie et al., 1996). Reverse genetics is an efficient strategy to determine the function of an isolated gene (Benson et al., 1995). For example, in corn, a mutation of a gene of interest can be identified by selecting a large population of plants composed of 48,000 mutagenized plants randomly. In principle, each plant in this mutant population contains a different mutation caused by the insertion of a transposable element. A plant containing the insertion of a transposable element in the gene of interest is identified by polymerase chain reaction (PCR) analysis. A first primer having a nucleotide sequence corresponding to the transposon and a second primer having a nucleotide sequence corresponding to the gene of interest, are used in the PCR reaction with DNA isolated from presumptive mutants. In principle, a PCR product only occurs if the transposon is inserted in the gene of interest. Mutant plants comprising DNA from which a PCR product is produced in the PCR reaction are analyzed to determine the effect of the mutation on the growth and development of the plant, and the function of the gene of interest is determined in this way . It is not practical to use reverse genetics in most of the crop species because they would require considerable time and effort and extensive field facilities to create and accommodate the tens of thousands of plants labeled with transposons or T-DNA that could grow to maturity to detect the mutant of interest. Consequently, an alternative strategy is required to make reverse genetics a reality in most crop species. Also, a practical method is required to select large populations of transformed culture plants with a DNA construct capable of detecting a DNA element that controls the expression of genes such as a promoter or a ^ M aim i ^^ i ^ íi? I iiÉ? ^ ßM i? i? i? t ^^ lM ncrementador.

BRIEF DESCRIPTION OF THE INVENTION An object of the present invention is to provide improved methods for the identification and characterization of mutants using a miniature culture plant. Another objective of the present invention is to provide improved methods for the characterization of cloned nucleotide sequences. A further objective of the present invention is to provide improved methods for the cloning of nucleotide sequences. These and other objects are achieved by providing a method for selecting a mutant miniature plant having a desired characteristic, comprising the steps of: (a) Providing a population of miniature plants, wherein said miniature plants have the following characteristics : (i) reduced size compared to a commercial variety of the same species; (ii) ripening to produce viable seeds or tubers at a density per plant of at least ten times greater than the standard growth conditions used for a commercial plant of the same species; and (iii) capable of being crossed with a commercial plant of the same species; (b) Generate mutant miniature plants in said population of miniature plants, treating said miniature plants with an agent mutation inducer, to produce a population of mutant plants; and (c) Selecting a mutant miniature plant having said desired characteristic within said population of mutagenized miniature plants. In all aspects and embodiments of the present invention as described herein, the population of miniature plants can be generated by natural or induced mutations, by genetic engineering, or by treatment with plant growth factors. Examples of miniature plants that can be used in accordance with the invention include, but are not limited to, miniature tomato varieties such as 'Micro-Tom' and 'Micro-Peach'. The mutation inducing agent used in step b) above, can be a chemical mutagen such as ethyl methanesulfonate (EMS), methyl methanesulfonate (MMS), methyl N-nitrosourea (MNU), and bleomycins. Alternatively, the mutagenic agent can be irradiation such as UV light, irradiation?, X-rays and fast neutrons. Finally, the mutant-inducing agent may be a mobile DNA sequence that is a T-DNA or a transposable element that is selected from the group consisting of an autonomous transposon, non-autonomous transposon, and an autonomous / non-autonomous transposon system such as, but not limited to, the transposable element Ac / Ds of corn. The commercial plant of the same species is a plant used to produce food, fibers or flowers that includes, but is limited to, plants that produce a berry-type fruit such as tomato, grape, plum, eggplant, citrus and apple, or a plant of the Solanaceae family, for example, potato. In another embodiment, the present invention provides a mutant miniature population in which a miniature plant of said population has the following characteristics: (i) reduced size compared to a commercial plant of the same species; (ii) mature to produce viable seeds or tubers at a density of at least ten times greater than the standard growth conditions used for a commercial variety of the same species; (iii) capable of being crossed with a commercial plant of the same species; and (iv) possesses a mutation induced by an agent that is a chemical mutagen, irradiation or a mobile DNA sequence. In another embodiment of the present invention, there is provided a method for identifying a miniature plant containing a mobile DNA sequence inserted into a gene of interest, comprising the steps of: (a) Providing a population of miniature plants, in where said miniature plants have the following characteristics: (i) reduced size compared to a commercial plant of the same species; (ii) ripening to produce viable seeds or tubers at a density per plant of at least ten times greater than the standard growth conditions used for a commercial plant of the same species; and (iii) capable of being crossed with a commercial plant of the same species; (b) Generating mutant plants in said miniature plant population by treating said plants with a mobile DNA sequence; - ^ t ^^^ ss (c) Selecting DNA extracted from said mutant plants by PCR using a first primer for a nucleotide sequence corresponding to said mobile DNA sequence, and a second primer corresponding to a nucleotide sequence of said gene of interest; and (d) Identifying a miniature plant comprising DNA that produces a PCR product in the presence of said first and second primers. Yet another embodiment of the present invention provides a method for producing a mutant population of miniature plants, comprising the steps of: a) Providing a population of miniature plants, wherein said miniature plants have the following characteristics: (i) small size compared to a commercial plant of the same species; (ii) maturation to produce viable seeds or tubers at a density per plant of at least ten times greater than the standard growth conditions used for a commercial plant of the same species, and (iii) capable of being cross-bred with a commercial variety of the same species; and b) generating said mutant plants in said population of miniature plants, treating said miniature plants with a mutant inducing agent. When said mutant-inducing agent of step b) is a T-DNA, the miniature plants are infected with Agrobacterium, thereby producing multiple transformants in which each - *** - WMMM- * »^ m *, ~ ^ -. _ .... * .. .. * ~ * ~ transformant contains a T-DNA insert in a different genomic position. When said mutation-inducing agent of step b) is a transposon, the population of plants in mutant miniatures is obtained from the progeny of miniature plants that contain an active transposition system. This active transposition system can be a native transposon of plants or a transposon introduced into the plant by genetic engineering techniques well known to the person skilled in the art, such as an autonomous transposon or a transposable element obtained by crossing a plant containing a transposon Non-autonomous with either a transposase source or a plant that contains an autonomous transposon. The transposable element is, for example, the Ac / Ds transposon system of corn. Yet another embodiment of the present invention provides a method for identifying a nucleotide sequence that controls the expression of genes in plants, comprising the steps of: a) transforming a miniature plant from a culture plant with a DNA construct to produce a population of randomly mutagenized plants, wherein said DNA construct comprises a gene sequence encoding a selectable marker that lacks a promoter or that contains a minimal promoter, wherein said miniature plant has the following characteristics: (i) small size compared to a commercial plant of the same species; (ii) maturation to provide viable seeds or tubers at a density per plant of at least ten times greater than the conditions of libifeltfflMi ^ ItliihHM standard growth used for a commercial plant of the same species; and (iii) capable of being crossed with a commercial variety of the same species to produce a population of randomly mutagenized plants; b) identifying a miniature plant within said population of plants that is transformed with said DNA construct and expresses said selectable marker; and c) cloning the nucleotide sequence that is operably linked to said gene encoding said selectable marker of the total DNA isolated from said transformed miniature plant identified in step b). The selectable marker can be GUS or luciferase, the mobile DNA sequence can be a T-DNA or a transposable element, and the nucleotide sequence that controls the expression of genes in plants can be a promoter or an enhancer. In a further embodiment, the invention provides a method for producing a mutant population of a commercial plant with a desired characteristic, comprising the steps of: a) crossing a mutant miniature plant having said desired characteristic selected according to the method of selection of the present invention, with a commercial plant of the same species; and b) selecting progeny that resembles the commercial progenitor plant and expresses said desired characteristic. According to this embodiment, the invention also encompasses - * "- '*"' * '^ ¡^ g? Á? S? m mutant populations of commercial plants obtained by the above method.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the response of "Micro-Tom" at different growth conditions. Figure 2 shows mutant and wild-type "Micro-Tom" phenotypes. Figure 3 shows a schematic representation of constructions transformed into "Micro-Tom". Figure 4 shows the results of selecting plants containing markers used for transposition selection. Figure 5 shows the results of the Southern blot selection of plants resistant to chlorosulfuron (Ch1) and resistant to hygromycin (Hygr). Figure 6 shows a schematic representation of the plasmid Ds-Luciferase (Ds-LUC). Figure 7 shows the result of the insertion of Ds-Luciferase (Ds-LUC) in genes expressed in various plant organs.

DETAILED DESCRIPTION OF THE INVENTION The present invention makes possible the rapid and large-scale production and efficient selection of mutagenized plants. This is achieved by using a miniature cultivation plant that can be crossed with a commercial variety of the same species. Mutations are induced in the miniature plant, and mutants are subsequently identified in the population of miniature mutant plants that have grown efficiently to maturity at a high density. The main disadvantage of using reverse genetics in most crop plants such as tomatoes is the considerable time, effort and space to produce and manage very large populations of mutant plants. The present invention makes possible, for example, the rapid and large-scale production and efficient selection of mutagenized plants with transposons, which is otherwise impractical with current production techniques. It is estimated that 100,000 plants mutagenized by different transposons are needed to produce a representative plant population for reverse genetics of most agronomically interesting species, such as tomato. The production of said library of mutants in a culture plant can be achieved with the present invention by the use of a miniature plant. The invention makes it possible to inactivate almost any desired gene by identifying a line carrying a transposon inserted in the target gene of interest in a large population of plants grown in a manageable growing area. The identification of the transposon insertion in a target gene is done by selecting groups of transposon carrier plants by PCR using an initiator having a nucleotide sequence corresponding to the target gene, and a second primer having a nucleotide sequence corresponding to the transposon. A PCR product is produced solely from a DNA substrate isolated from a mutant plant having the transposon inserted into the gene of interest. The methods of the present invention are suitable for any plant of agronomic interest, including plants used to produce food, fiber or flowers. These agronomic crop plants include, but are not limited to, plants that produce berry-type fruits such as tomato, grape, citrus, plum, apple, eggplant; plants of the Solanaceae family, for example, potatoes; and corn, as well as fruit tree species and species that produce flowers. The methods of the invention will also facilitate the identification of commercially valuable genes, the isolation of new genes, the introduction of novel genes into classical breeding programs and the isolation of tissue-specific promoters and enhancers. Genes of commercial value include genes that affect the maturation of the fruit and genes that improve the yield and / or quality of the plant. New genes, which are possible isolation targets, include genes related to sugar content in the fruit, mineral consumption and so on. The promoters Tissue-specific proteins can be isolated using a "gene capture" methodology designed within the transposon. The inactivation of almost any desired gene is achieved by random mutagenesis in the miniature plant by inserting a mobile DNA sequence such as a transposable element into the plant genome, and identifying a plant carrying a transposon inserted into the gene objective. The identification of the mutant by insertion of interest is carried out by selecting groups of carrier plants of the transposon by PCR, using an initiator having a nucleotide sequence corresponding to the target gene and a second initiator corresponding to the transposon. The population of miniature crop plants is also used for efficient selection and identification of promoters in plants. The terms used in the specification are defined as follows: Miniature plant, variety or crop It has a general size or biomass that is significantly reduced compared to the wild-type cultivation of the corresponding plant, variety or plant. The miniature plant, variety or culture can be grown to maturity to produce viable reproductive organs such as fruits, seeds, tubers, etc., at a density per plant that is not practical with the corresponding wild-type plant. For example, the miniature plant, variety or crop can be grown to maturity at a density per plant at least once, preferably 5 times, 10 times, 50 times, 100 times, 150 times, 200 times, 250 times, 300 times or more, than the standard growth conditions used for a commercial plant of the same species. It is possible to grow a wild type plant at high density, but only until the seedling or young plant stage, and not the fruits, seeds or tubers are produced. In contrast, the miniature cultures of the present invention can be grown at high density per plant to maturity with the development of mature fruits, seeds, tubers, etc.

Transposon A natural DNA sequence capable of moving or "jumping" to different positions in the genome. Through insertion into a gene and disorganization of the resulting gene, the transposon causes a mutation in the gene. Transposons have been found in bacteria, Drosophila, yeasts, nematodes, plants and mammals.

Transposable element Corresponds to a transposon.

Transposase Protein expressed by an autonomous transposon that binds to the terminal regions of a transposon and mediates excision and transposition of the transposon to another location in the genome. - i mu r ir? iiir .-, ^^^ - jMü ^ gÜ? ^ ,,, ^^^^^^^^^^^ Autonomous transposon An element that codes for a transposase and has terminal regions recognized by the transposase due to its high catalytic activity, and in this way it is transposed in an autonomous way. Mutations caused by autonomous transposons are unstable. Examples of autonomous transposons are the activating transposons (Ac) of corn.

Non-autonomous transposon An element that contains the terminal regions recognized by a transposase, but does not code for it, and thus requires a transposase delivered in the trans position to cut and transpose to another location in the genome. Examples of non-autonomous transposons are the Ds (dissociation) transposons of maize that can be used together with an autonomous transposon, eg, Ac. The variety of the miniature cultivation plant can be developed from natural or induced mutations, by genetic engineering or by treatment of the crop plant of interest with plant growth factors. Dwarf mutants (dwarfs) are ubiquitous in the plant kingdom, and have been found in a large number of species. One of the most significant groups of dwarf genes are the rht genes (reduced height) of wheat (Gale and Youssefian, 1985). These genes are largely responsible for the Green Revolution. The stem more -i ^ ma-. ^ üftti áUdÉ.

Short of dwarf varieties can be brought to higher yields (heavier peaks) per plant, and allow plants to grow at a higher density than is possible with high crops, leading to an increase in yields of wheat at world. The height of a type of wild wheat is approximately 120-140 cm; it is reduced to 90-100 cm by the presence of a dwarf gene, at 40-60 cm by the presence of two dwarf genes. Currently, standard wheat varieties contain one or two genes of dwarfism. In these plants, the reduced height is not associated with the miniaturization of other plant organs (eg, leaves or spikes), and therefore is not useful for large-scale mutagenesis. However, wheat plants of extreme dwarfism could be used to facilitate large-scale mutagenesis in this species. Similarly, dwarf genes have been found in other cereals such as corn and rice; in legumes such as peas; in vegetables such as pepper, eggplant and tomatoes; in ornamental plants such as roses; and in trees such as orange and other citrus. The mode of action of these genes varies. Several examples of dwarf plants, the genes responsible, and their mode of action, are described in a recent publication (Hedden and Kamiya, 1997). For example, some dwarfs are defective in the synthesis of one of the phytohormones (for example, gibberellin), while other dwarves synthesize gibberellin, but are insensitive to it (for example, GAI = gibberellin-insensitive mutants). However, for most dwarf plants, it is not known the mode of action. Said dwarf plants, or cloned genes that can be manipulated and considerably reduce the size of the plant, can be exploited for a subsequent large-scale mutagenesis in any culture by the claimed invention. General methods for isolating and characterizing dwarf plants in numerous crops are available. Plants can be transformed with isolated genes that affect the overall size. For example, the gene for plants apleta isolated from Arabidopsis was used to modify the size of transformed poplar plants. Miniature crops can be constructed through traditional breeding methods. In the case of the variety "Micro-Tom", two main genes designated miniature and dwarf, are responsible for the phenotype in miniature. Plants of a dwarf or miniature variety are grown to a density at least 10 times higher than under normal field conditions because the size of the miniature plants is significantly reduced. This facilitates the analysis of large populations of plants in small areas. In the case of the 'Micro-Tom' miniature tomato variety, as described in the examples below, the plants are grown at a density approximately 200 times higher than can be achieved with commercial crops under standard field conditions. New mutants that include insertion mutants obtained in the miniature variety can be transferred to a commercial background by standard crossings with the culture by segregating the gene or transgene for size in 'i? llÉÉ? liÜÜI i I »- ~ - ^ ~ - ~ • - ** > - ** miniature. Any mutagenesis technique can be used to obtain miniature varieties according to the invention including, but not limited to, chemical treatment, irradiation or by insertion of T-DNA or transposon DNA from the host plant or from a heterologous origin, using techniques well known to the person skilled in the art. Inactivation by insertion that leads to dwarfism can be achieved by selecting large populations of plants. In chemical treatment for the production of mutants of the miniature variety, it can be carried out by known techniques with mutagens such as ethyl methanesulfonate (EMS), methyl methanesulfonate (MMS), methyl N-nitrosourea (MNU), bleomycin and Similar. The mutation can also be carried out by known techniques by irradiation with UV rays, X-rays and fast neutrons (see, for example, Poehlman, 1987 or Malmbery, 1993). Inactivation by insertion of genes with a mobile DNA sequence can also be carried out. The mobile DNA sequence can be T-DNA or a transposon. Mutagenesis with DNA T can be carried out by known methods by means of Agrobacterium (Hoekema et al. 1983, U.S. Patent No. 5,149,645). Transposon insertion mutagenesis can be done by well-known methods (Fedoroff et al 1984; U.S. Patent Nos. 4,732,856 and 5,013,658). The transposable element can be an autonomous transposon, a transposon can not autonomous or an autonomous / non-autonomous transposon system, for example, the Ac / Ds transposon system of maize. Large populations of plants are selected for mutants, preferably at least thousands of plants. The identification of the mutants can be done visually, for example, to identify miniature selections. Additional strategies can be used to identify other types of mutants; for example, testing various characteristics including, but not limited to, response to hormones, to minerals, to pathogens, to herbicides, and the like, by known techniques used in plant biology. The identification of events by insertions in a specific gene of interest is achieved by methods that include the selection of PCR with a first primer that corresponds to a nucleotide sequence of the transposon or DNA T, and a second primer corresponding to a nucleotide sequence of the gene of interest. The gene of interest may be an isolated gene, which has been partially sequenced, or as a whole. Alternatively, the gene of interest may be an expressed sequence tag (EST). The PCR methodology is well known in the art. A general description of PCR appears in Delidow et al. 1993. The design of primer oligonucleotide sequences suitable for the PCR method is described by Rychlick et al. (1993). Methods for the detection of PCR products are described by Alien et al. (1993). The identified plant from which the DNA was isolated produces a ----- t - MMttt £ lIiIIiIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII This plant is analyzed to determine the effect of transposon insertion on the plant phenotype. The methods of the present invention can be used to identify and characterize any gene of interest that includes genes for disease resistance or development. A sufficient nucleotide sequence of the gene of interest is required to design an initiator for PCR analysis. Once the genes of particular interest have been identified, they can be transferred to adequate commercial funds through well known techniques in plant breeding (see, for example, Poehlman, J M, Breedinq Field Crops, New York, 1987). The particular strategy used will depend on the crop plant. The present invention was used to develop a library of mutants in tomato plants. This library greatly increases the study of tomato genetics and the ability to isolate important genes. This library of mutant tomatoes is based on the determination of miniature and dwarf varieties of Lycopersicon esculentum, designated as 'Micro-Tom' (micro tomato), a variety originally produced for gardening purposes (Scott and Harbaugh, 1989). This The variety is particularly useful in the present invention because it can grow at high density, up to 1357 plants per square meter, and fructifies when it grows at such high densities. In addition, the variety has a short life cycle, producing mature fruits 70-90 days after planting, which It facilitates your selection of up to four gg prayers per year. These attributes make it an efficient system for the selection of large populations of mutagenized plants, and makes possible the mutagenesis saturated in the tomato. In addition, the variety can be transformed easily and 5 efficiently. Transformation frequencies of up to 80% are obtained with the transformation of cotyledons mediated by Agrobacterium, and approximately 100 days are required from the inoculation of the cotyledons to harvest the transgenic fruit. In addition, the variety differs from standard tomato varieties only by two main genes. Since the two genes that control the size of 'Micro-Tom' are recessive, dominant characteristics can be analyzed in a standard background in the F1 generation. One more generation is required to transfer recessive genes to a standard background. Therefore, any mutation or transgene can be conveniently studied in a genetic background of 'Micro-Tom' and, when required, transferred to a standard background using traditional culture techniques well known to the person skilled in the art. It has also been determined that the Ac / Ds transposon marking system can be used in other miniature tomatoes designated as 'Micro-Peach'. 'Micro-Peach' is similar in size to 'Micro-Tom'. However, 'Micro-Peach' has the color of the peach fruit instead of the color of the 'Micro-Tom' red fruit. The Ac / Ds transposon system is very active in 'Micro-Peach', allowing large-scale mutagenesis and reverse genetics. - »- - • -" '. «~ - .... ... aM * ° ji" - • • - * "• *' ut -----. - tí-». -. - ats,, .- > «^ -. ^^ '.-fc- - .--;,.

To evaluate 'Micro-Tom' as a model system for mutagenesis and inverse genetics, the growth conditions and transformation conditions of this variety were optimized. Subsequently, the selection of 20,000 M2 plants mutagenized by EMS derived from 9,000 M1 individuals was carried out. Mutants with altered pigmentation or modified form of leaves, flowers or fruits were found. An Ac / DS transposable element enhancer trap system (Fedoroff and Smith, 1993) and a gene trap system (Sunadaresan et al. 1995) were introduced in 'Micro-Tom', and were determined as active. In this way, the use of the 'Micro-Tom' culture can achieve the goals of saturated mutagenesis in tomato, or the labeling or inactivation by insertion of any gene. The methods of the present invention can be used in any miniature selection of a plant species of interest to facilitate the rapid and efficient characterization of genes. The advantages of the present invention are underlined by the observation that a population of M2 plants derived from 'Micro-Tom' mutagenized by EMS consisting of 14,000 individuals, was grown on only 100 m2 of space. In addition, the work of only one person over a short period of 6 months (M1 was cultivated in spring and M2 in the summer of the same year) was necessary to produce this population. A large number of mutants were recovered, even though the EMS-induced mutagenesis employed was relatively moderate, as evidenced by the fact that less than 1% of albino plants were found. Is It is possible that many additional mutant genes are present in the resulting M2 population, which compares favorably with the few hundred mutant tomatoes reported to date by other researchers. All M2 families that were derived from individual M1 plants that showed a mutant phenotype were segregated at a 3: 1 ratio (dominant: recessive). This suggests that in 'Micro-Tom', under the experimental conditions used in the present, the gametes are derived from a single cell present in the mature seed embryo at the time of mutagenesis. These data are in agreement with previous reports (Hildering and Verkerk, 1965; Verkerk, 1971), which suggest that between one and three cells give origin to the sporozoite in mutated tomato plants. Although transposon labeling systems have previously been described in tomato (Carroll and others 1995, Knapp and others 1994, Rommens and others 1992, Yoder and others 1988), there is no previous report in the literature of an increment and a system. of gene capture for this plant. However, also in accordance with the present invention, two systems for the selection of unlinked transpositions were introduced into the tomato; a system based on NAM sensitivity and kanamycin resistance (Sundaresan and others 1995), and a second system based on the selection of insertion by excision (Fedoroff and Smith, 1993), which takes advantage of the efficient detection of resistance to hygromycin contained in Ds. In addition, using chlorosulfuron resistance as an excision marker coupled to other agronomic characteristics of 'Micro-Tom', a large population of probable mutants can be selected for enhancers and promoters, and used for the isolation of genes. In addition, the recently described approach for selected site insertions in tomato somatic tissues (Cooley and others 1996), can also be applied in 'Micro-Tom' for stable germinal transposition events. In this regard, the Ac / Ds system that was shown to be active in 'Micro-Tom', can also contribute to reverse genetics through gene inactivation or insertion inactivation. In this way, by means of the present invention, a 'Micro-Tom' to develop a model system for genetic studies in plants. It accelerates the characterization of transgenic plants and facilitates the isolation of mutants, promoters and genes. 'Micro-Tom' can be used as a general model system for other commercially important crops (eg, citrus, grapes, etc.) that produce berry-like fruits. Any fruit gene, promoter and mutant found in 'Micro-Tom', can facilitate the study of the genetics, physiology and metabolism of other botanically similar fruits. Also, 'Micro-Tom' can be used as a general model system for the study of mutants and genes for plant development, as well as other important agronomic loci. The methods of identification and characterization of genes used efficiently with the cultivation of miniature tomatoes 'Micro-Tom', can be easily used with other dwarf mutants in other plants that include species • • - f l-ii.il nu il? Ll.íH¡r-t1l |||| M ^ -MMjayMj | ¡¡^ g | ¡¡¡¡MÉÉ - M * ^ ------ a- -M- ^ of agronomically important crops. The following examples are provided by way of illustration, and should not be construed as limiting the claims. It will be apparent to those skilled in the art that various modifications may be made to the embodiments described, and that all these modifications are designed to be within the scope of the present invention. All publications and patent applications mentioned in this description are indicative of the level of experience of those skilled in the art to which this invention pertains. All publications and patent applications are hereby incorporated by reference, to the same extent as if each individual publication or patent was specifically and individually indicated in its entirety as a reference.

EXAMPLES EXAMPLE 1 Habit of growth and genetic constitution a) Methods Seeds of "Micro-Tom" plants were sown and grown to maturity in trays or nursery containers. For the plant density experiment, each treatment corresponded to growth in a different root volume. For this purpose, plants were grown in ** sr? m ^, .. «^ .. commercial nursery trays with compartments of 13, 33, 90 or 200 ml, or in containers with a capacity of 465 ml. There were two replicates in each treatment, each consisting of 84 (treatment of 13 ml), 72 (33 ml), 63 (90 ml), 50 (200 ml) and 15 (465 ml) plants that were analyzed for each characteristic. b) Results "Micro-Tom" plants were grown from seeds through fruit ripening in nursery trays with root compartments of various sizes, to determine the effect of density on the growth of the plants, as well as on the maturation of the fruit and the seed. Densities of 100 to 1357 plants per m2, equivalent to root volumes ranging from 465 to 13 ml, were tested. The response of "Micro-Tom" to different growth conditions, is shown in figure 1. The growth characteristics examined are indicated in each box with the scale of values (minimum - maximum) given in parentheses. Each characteristic, given as a percentage of the maximum value for this characteristic, is expressed as a function of the volume of the root (lower scale), or of the density of plants (upper scale). The following characteristics were measured: days for anthesis (the average number of days from sowing to anthesis); days to mature (the average number of days from sowing to fruit color change); height of the plant (the height (in centimeters) of the soil surface at the first inflorescence); number of m ^ ^ - ^^ - "*** leaves (the number of leaves on the main stem), yield of the plant (the total weight of fruits (in grams) per plant), number of fruits (number of fruits per plant), height of the fruit (the average (in grams) of a fruit), and number of seeds (the average number of seeds per plant) The errors were too small to be indicated. Plant density For example, the number of days from sowing to anthesis varied from 37 to 40, and the number of days from sowing to ripening varied from 75 to 82 days When a tomato variety determined as a control standard (v. UC82) was grown under similar conditions, it could not form the fruit at high densities (412-1357 plants / m2), and developed fruits only in some of the plants lower densities (100-226 plants / m2) Other features, such as ren of the plants, the number of fruits or the number of seeds per plant, responded linearly to changes in the density of plants with a difference of plus or minus 10 times between the minimum and maximum values obtained in the experiment. The characteristics of fruit weight and height of the average plant showed a lower response to density with a double difference between the minimum and maximum values. Mature plants grown under various density levels are shown in Figures 2A and 2B. Figure 2A illustrates "Micro-Tom" plants grown on nursery trays with a root compartment of 13 ml (top left), 33 ml (top right), 90 ml (left bottom) and 200 ml * "- - -. - ^ ----- e." - ^ ^^^ s ^^ n r, -Ülfiiii "- ---, (right below). Figure 2B illustrates a mature wild type "Micro-Tom" plant, grown in a 90 ml compartment, with a scale bar. The plant is 5-6 cm tall (not including roots), and the fruits have a diameter of 1.5 to 2 cm. "Micro-Tom" plants were grown at a density of 226 plants / m2 in a nursery. Note that in "Micro-Tom", all the organs of the plant are reduced in size in a well proportioned way (with the exception of the seeds, which are almost in their normal size). This contrasts with other dwarf tomato mutants that are compact in appearance and have large leaves compared to the size of the plant in general. These results demonstrate that the "Micro-Tom" dwarf variety can be routinely grown at densities of up to 1357 plants / m2 for use according to the invention. "Micro-Tom" crossed with UC82, a certain variety, and with VF86, an indeterminate crop. The F1 plants of both crosses were very similar in height to the original "high" plant, indicating that the genes responsible for the "Micro-Tom" type are recessive. In the F2 progeny of the cross with UC82, there was a wide range of growth habit phenotypes. Six of the 176 F2 plants analyzed were clearly out of the "Micro-Tom" type, suggesting that this is controlled by two major recessive genes with the possible additional effect of modifiers. Based on the pedigree of "Micro-Tom" (Scott and Harbaugh, 1989), it seems that dwarf and miniature are the two genes that intervene in the "Micro- - ^ - ^ Tom. "These results indicate that the" Micro-Tom "dwarf variety can easily cross with a commercial tomato variety.

EXAMPLE 2 Mutagenesis with EMS a) Methods For the experiment with EMS, plants were cultivated as described in example 1, except that the plants were grown in an insect-proof house at the Weizmann Institute of Science, Rehovot, Israel, instead of a greenhouse. Mutagenesis with EMS was carried out in 15,000 seeds of "Micro-Tom". The seeds subjected to mutagenesis and the germinated plants of the mutagenized seeds are designated as M1 generation. Seeds were imbibed for 9 hours on moist Whatman paper in Petri dishes, transferred to an Erlenmeyer flask containing 150 ml of a 0.7% EMS solution without regulated pH, and incubated overnight for 16 hours at room temperature. (22 ° C) with gentle agitation. The mutagenized seeds were extensively washed, dried with fans and planted the same day in trays for seedlings. Compared with the control group, the mutagenized seedlings were retarded in their growth, and the percentage of germination was reduced in «- ^ ----- HÜ ------! tt? ^? I¿¡¡¡ ^^ t ?? ? t iM i ^ mit .- ^ aa approximately 25%. Approximately 10% of the Ml plants were sterile. The M2 seeds were harvested from 9000 plants Ml. From 70 M1 plants, M2 seeds were harvested individually from each plant and 10-12 M2 plants were grown for each M1 plant in progeny rows. The rest of the M2 seeds were harvested in bulk, grouping one fruit of each M1 plant. Approximately 20,000 M2 seeds of the bulk crop were sown and gave rise to 14,000 M2 fruit-producing plants. The M3 seeds were harvested in bulk. b) Results In the M1 population (the treated generation), approximately 1% of the plants showed chlorophyll variegation. In the M2 population, a total of 14,000 plants were grown on nursery trays and selected for mutant phenotypes, as shown in Figure 2C. Figures 2 D-H illustrate M2 plants generated by EMS with a mutant phenotype. From this population, 111 chlorophyll mutants were found, including albinos, yellows (xanthophyll type) and light green leaves; Figure 2G illustrates an M2 plant with a mutant chlorophyll phenotype (yellow leaves). Plants with a leaf shape, flower (petals) and fruit pigmentation, modified, were also observed. In comparison with the round-shaped wild-type fruit, six plants showed an altered fruit shape in all their fruits, including phenotypes such as the persimmon shape (figure 2D) and pear shape (figure 2E). The plants with fruits , »» ^ * ^ I? > *to. oblong also had narrow, long leaves (Figure 2F). Seventy M2 families derived from individual M1 plants were also selected for mutations. In five families, a mutant phenotype was observed that invariably segregated at a 3: 1 ratio. Said family segregated for pigmentation of anthocyanin (purple) in the leaves; this family, which is illustrated in Figure 2H, is derived from a single M2 plant, and segregated at a ratio of 3: 1 for anthocyanin.

EXAMPLE 3 Transposon marking and increment capture in "Micro-Tom" a) Methods "Micro-Tom" plants were transformed as described with the following constructions; the transgenic plants were then cultured as described in Example 1 in greenhouses. (1) Constructions Constructions Bam35S-Ac and Ds378-GUS, which were used to capture the increment (Fedoroff and Smith, 1993), were obtained from Nina Fedoroff. The DsG and DsE constructs (Sundaresan and others 1995), which were used for gene capture and increment capture, respectively, (Sundaresan et al. 1995), were obtained from Venkatesan Sundaresan. These constructions are illustrated in Figure 3 and described d-t-fc »» - A. -JM --- ^^ - - ^^^^^^^^^^^. as follows. Sequences similar to Ac are shown in gray, with the terminal inverted repeats shown as gray arrows. The constructions are flanked by the right (RB) and left (LB) edges of their respective T-DNA. The beta-glucuronidase (GUS) gene is fused to a weak Ac promoter in Ds378-GUS, either at the minimum region of 1 to 46 promoters (black box) of 35S in DsE, or to an Arabidopsis intron followed by three acceptor splice sites (black box) in DSG (Sundaresan et al., 1995). Resistance to kanamycin (Kanr) or hygromycin (Hygr) is conferred by genes of the neomycin phosphotransferase or aminociclitol phosphotransferase, respectively. Sensitivity to naphthalene acetamide (NAMS) is conferred by the indoleacetic acid hydrolase gene. The mobility of Ds is achieved by crossing the plants containing Ds (DsG, DsE and Ds378-GUS) with a transposase producing plant transformed with Bam35S-Ac. In this construct, Ac transposase is produced under the control of the 35S promoter fused to an Ac element whose 5 'terminal region, up to the unique BamHI site, has been eliminated. The chlorosulfuron resistance (Chl ') is obtained after the excision of the Ds element of the construction containing Ds378-GUS and the activation of a mutated acetolactate synthetase gene from a construct containing GUS and the activation of an acetolactate gene Arabidopsis synthetase (Fedoroff and Smith, 1993). The excision traces (Ex1 and Ex2) were obtained after the excision of Ds378-GUS in the F1 of crosses between Bam35S-Ac and Ds378-GUS and ^ "" ^ "** -" - - «^ ..- ^ MJt-a ^^. . rm * - amplified with primers pr1 and pr2. The sequence flank Ds378-GUS is shown above in Ex1 and Ex2. The underlined sequence indicates the insertion site Ac of host duplication flanking on the allele of the original maize wx-m7 from which Ds378-GUS was derived. (2) Transformation It was transformed into "Micro-Tom" with constructions Ds378-GUS, Bam35S-Ac, DsE, and DsG using the following optimized protocol. Plates containing KCMS medium (Fillati et al. 1987) supplemented with 0.2 μg / ml 2,4-D and a layer of nude tobacco cells (Horsch et al. 1985), were incubated at 95 ° C under low light conditions for 24 hours. The cotyledons were cut from seven-day-old seedlings near the petiole and at the apex, placed on a plate, and preincubated for 24 hours at 25 ° C under low light conditions. The concentration of the LBA 4404 strain of Agrobacterium used for cocultivation ranged from 5x107 to 9x107 cfu / ml, which corresponded to an OD that ranged from 0.4 to 0.5. The co-culture was carried out under the same conditions as the pre-incubation, and lasted 48 hours. Subsequently, cotyledons were transferred to 2Z medium (Fillati et al. 1987) containing 100 μg / ml kanamycin and 400 μg / ml carbenicillin for 3-4 weeks, and then transferred back to IZ medium with 200 μg / ml of carbenicillin for 2-3 weeks. The buds of the cotyledons were then cut and transferred to a rooting medium (MSSV) (Fillati et al. 1987) supplemented with 2 μg / ml of IBA, 50 μg / ml of - • - "" ^ * '- ^ l ^ m ^ t m kanamycin and 100 μg / ml carbenicillin. Seedlings with roots appeared 1-3 weeks, and then transferred to the greenhouse. (3) Selection markers and GUS 5 reporter In addition to the selection of kanamycin needed for the transformation, and the GUS reporter used in the capture systems, a number of markers were used to select the transposition events (Fedoroff and Smith , 1993, Sundaresan and others 1995). To that end, sterilized seeds were germinated and grown in a medium of Nitsh containing 0.8% agar supplemented with one or a combination of the following compounds: 20 μg / ml hygromycin (Calbiochem); 0.25 μg / ml naphthalene acetamide (NAM, Sigma) and 100 p.p.b or 2 p.m. of chlorosulfuron (DuPont). GUS staining was carried out according to Jefferson (1987) and the tissue clearance was carried out in accordance with Beeckman and Engler (1994). (4) DNA analysis DNA was extracted from young leaves by the Dellaporta method (Dellaporta et al. 1983), with an additional extraction of chloroform and phenol. The PCR reactions were carried out using Promega Taq polymerase according to the conditions recommended by the manufacturers, with 2.5 mM MgCl2, and 200 μM dNTPs in an MJ thermocycler. The following program was used: 2 minutes of denaturation at 94 ° C and 30 minutes cycles of 1 min at 94 ° C, 45 min at 55 ° C, 1 min at 72 ° C, and a final step of 5 min at 72 ° C. The primers used to amplify the Ds excision products were: pr2, 5 'GGATAGTGGGATTGTGCGTC 3' (SEQ ID NO: 1), which is complementary to sequences in the 35S promoter and prl, 5 '5 GGATGATTTGTTGGGGTTTA 3' (SEQ ID NO: 2), which is complementary to sequences in the ALS gene (figure 3). The bands of the expected size for the excision products (approximately 322 bp) were extracted from the agarose gene, and the DNA was purified using GenClean according to the manufacturer's instructions. These PCR products were cloned into a vector pGEM-T (Promega), and sequenced using the T7 or SP6 primers. For Southern analysis, 2 μg of genomic DNA was digested with Hind \\\, fractionated on 0.8% agarose gels, and transferred to a nitrocellulose membrane purchased from MSI. Hybridization was carried out according to the manufacturer's instructions. A fragment of internal 1 kb GUS by PCR, was radioactively labeled by the random priming method (Feinberg and Vogelstein, 1983), and was used as a probe for the detection of Ds. b) Results 20 The constructions Ds378-GUS, Bam35S-Ac, DsE and DsG, were transformed into 'Micro-Tom' as described. These constructs contain the NPTII gene that confers resistance to kanamycin. NPTII can be used as a marker for transformation to detect the presence of T DNA and to map Ds elements in relation to their donor site in Ds378-GUS, or for the selection of transposition events not linked with DsE and DsG. An advantage of this gene is its use as a non-destructive reporter in whole tomato plants. The spraying of 'Micro-Tom' plants in the stages of greater development with 300 μg / ml of kanamycin in three successive days as previously described (Weide and others 1989), allows the identification of plants sensitive to kanamycin without their destruction. In these plants, the young leaves near the apex of the shoot turn white just after the spray, as shown in Figure 4. Figure 4A illustrates 'Micro-Tom' plants three weeks after three spray treatments (one per day) with 300 μg / l of kanamycin. The plants resistant to kanamycin, transformed with Bam35S-Ac (upper panel), were compared with sensitive plants of wild type of the same age (lower panel). White leaves develop at the apex of the shoot in sensitive plants. Finally, these leaves die, but the subsequent emergent leaves are green, and the plant survives. The hygromycin resistance gene indicates the presence of Ds378-GUS, as shown in Figure 4. Plants transformed with Ds378-GUS are resistant to 20 μg / ml hygromycin (Figure 4B, left) while 'Micro-Tom * Wild type is sensitive (Figure 4B, right below). The indoleacetic acid hydrolase (iaaH) gene confers sensitivity to NAM. Sensitive plants develop a callus-like tissue in the . *, ^. ^ ^ ** - aAt ^ t "» - »^ ** ~ ***** -" base of the root, and they die approximately three weeks after germinating, as shown in figure 4C. with Bam35S-Ac are sensitive to 0.25 μg / ml of naphthalene acetamide (figure 4C, left), whereas the wild type is resistant (figure 4C, right) The sensitivity to NAM can be used as a negative selection marker to select against Bam35S-Ac, thus stabilizing new inserts, and / or to select against the donor site in DsE and DsG. The ALS gene confers low resistance to 100 ppb of chlorosulfuron in plants bearing a non-excised Ds element, and confers 2 ppm of chlorosulfuron in plants in which Ds is extruded, as shown in Figure 4D. The wild-type plants that grew in 100 ppb of chlorosulfuron are sensitive (Figure 4D, left), whereas the plants transformed with Ds378-GUS have low resistance (Figure 4D, in the middle). The results of selecting the markers used for the transposition selection are shown in Figure 4. The X-Gluc staining of F1 (Ds X transposase) shows blue sectors (Figure 4E-F). The GUS reporter gene without promoter in DsG was activated as observed by the blue color in the root of a 10-day F1 seedling (figure 4E). Young fruits, two weeks after the anthesis and 1 cm in diameter, were stained for GUS activity (figure 4F). No GUS activity was obtained in negative control plants such as the wild type or the Bam35S-Ac progenitor (Figure 4F, above). GUS was activated in some of the F1 fruits (Figure 4F, - - * - - Igl ^^ H ^^ ^ m ^^ below). In this way, all the selection characteristics previously described for Arabidopsis (Fedoroff and Smith, 1993; Sundaresan and others 1995), are also applicable to 'Micro-Tom' and, therefore, 5 can be used for a dialing system. transposon. The strategy to generate the unbound and stabilized transposition of Ds, and the strategy for the selection of excision and reinsertion, were very commonly recovered transposition events, and have been previously described and compared (Sundaresan, 1996). 10 Using the constructions Ds378-GUS and Bam35S-Ac, a new characteristic of the excision / reinsertion system originates from its capacity to identify and rescue plants sensitive to kanamycin (Figure 4A). After crosses between parents carrying Ds378-GUS and Bam35S-Ac, the selection of F2 plants for hygromycin resistance and sensitivity to kanamycin, makes possible the selection of stabilized and non-linked transposition events, as shown in Figure 4D. The F2 plants (Bam35S-Ac X Ds378-GUS), in which a germinal Ds excision event occurred, are completely resistant to chlorosulfuron (Figure 4D, right). This characteristic makes the system developed by Fedoroff and Smith (1993) applicable to tomatoes. This double system is suitable for the selection of a linked and unlinked transposition. The use of this system in the tomato first includes the selection of Hygr and Kans plants, which allows the identification of events of transposition not linked and stable. For this group of plants, selection with NAM is not necessary and chlorosulfuron should not be used, since the T-DNA containing the empty donor site is segregated. Second, the selection for chlorosulfuron resistant plants between the Hygr and Kanr 5 plants allows the identification of linked transposition events. This group of plants is enriched in such events due to the natural tendency of Ac to transpose nearby, and because some of the linked transposition events described above (Hygr and Kans and Chl5 plants) are eliminated. The activity of the Ac / Ds system introduced in 'Micro-Tom', is confirmed in F1 plants of a cross between transgenic plants transformed separately with Ds378-GUS and Bam35S-Ac sequencing fingerprints Ds. These tracks, shown in Figure 3 below the Ds378-GUS construction, are typical of what is expected for Ac / Dc. Of four clones analyzed, three had the same preferred footprint (GC inversion) generated for Ac in the wx-m7 allele of corn, or in Arabidopsis (C. Weil, personal communication) and tobacco (Gorbunova and Levy, 1997; Shalev and Levy, 1997). These results suggest that the formation of a preferential footprint, as previously described by Scott and others 1996, is independent of the species. In addition, the GUS staining patterns in F1 plants found in roots of DsG X Bam35S-Ac (figure 4E), in leaves (not shown) or in young fruits of Ds378-GUS X Bam35S-Ac (figure 4F), indicated the reintregration of Ds in or near genes in the course of development of the plant. In the Ds378-GUS progenitor, which has the weak Ac promoter, an activity of Disappeared GUS was detected only in the immature seeds of young fruits. Finally, the transposition was confirmed in the Southern blot analysis of F2 plants resistant to chlorosulfuron and hygromycin, which are the progeny of the cross Ds378-GUS X Bam35S-Ac, as illustrated in figure 5. Genomic DNA was extracted from: a homozygous transgenic plant for the Ds378-GUS construction (band a); a homozygous plant for the Bam 35S-GUS construction (band b); the F1 plant crosses between these two plants (line c); and the derived F2 plants that are resistant to 2 ppm chlorosulfuron and hygromycin (bands d-1). DNA was digested with Hindlll, run on an 8% agarose gel, was transferred to a nylon membrane and hybridized with a 1 kb internal GUS probe. The arrow points to the 8 kb band of the Bam 35S-GUS progenitor. Treatment of the DNA of the Ds378-GUS parent containing Ds digested with HindIII, cuts the junction between the 5 'end of Ds and the 5' end of the GUS gene, and does not cut the T-DNA towards the left border (figure 3) . The GUS probe, present within Ds, revealed a single 8 kb band for the progenitor of Ds (band a), indicating that a single copy of T DNA was grafted into the genome. No hybridization was obtained, as expected, with the progenitor of transposase (band b). The F2 plants showed variable hybridization patterns (figure 5, d-l bands) indicating the excision and reinsertion of elements in new places. The analysis of F2 plants of a cross between Ds378-GUS and Bam35S-Ac, indicated that of 22 plants tested for .- ^ -. ^^. ^^ t ^ J. ,. , ^ - .. - á- - > »Dfc ^. ,. ^ -, < to * - resistance to chlorosulfuron, 11 were resistant to hygromycin, as evidenced by the vigorous development of the root when incubated in a medium containing hygromycin. This means that the percentage of Ac removed is about 5%, which is similar to the figures previously reported for corn (Dooner and Belachew, 1989, Greenblatt, 1984, McClintock, 1956), tobacco (Jones and others 1990). ), and Arabidopsis (Altmann et al. 1992).

EXAMPLE 4 Reverse Genetics in a Miniature Cultivation Variety The miniature tomato variety 'Micro-Tom' was selected to produce a population of plants that contained transposons. 'Micro-Tom' was transformed with the plasmid Bam35S-Ac, illustrated in figure 3, by the transformation method described in example 3. The transformants were self-fertilized producing the first parent plant (line R2-1-1) which is homozygous for plasmid Bam35S-Ac and expresses transposase activity. The plasmids Ds378-GUS, illustrated in figure 3, and Ds-LUC, illustrated in figure 6, were transformed into 'Micro-Tom' as described in example 3. The transformants were self-fertilized to give rise to a series of plants that contained a Ds donor in DNA T. The transposase and Ds plants were crossed to produce F1 seeds. The F1 plants grew without selection and were self-fertilized to produce F2 seeds. ^ g ^ ^ H ^ g ^ l-jl fciA-H * - »^"., - F2 seeds were selected for a stable transposition event by growing F2 seedlings in an agar-based medium containing chlorosulfuron, hygromycin, and NAM, as described in Example 3. The F2 plants, which corresponded to independent transposition events, were cultured and selected for dominant mutations. The F2 plants were self-fertilized and F3 families, each family consisting of 12 F3 plants derived from a single F2 plant, were selected for recessive mutations. A mutant miniature plant containing a Ds insert in a known nucleotide sequence (the target) was identified. The DNA was extracted from leaves of F2 plants. These DNA samples were subjected to PCR by selecting with a first primer that corresponded to a nucleotide sequence of the transposon Ds, and a second primer corresponding to the nucleotide sequence of the target nucleotide sequence. The plant that produced a PCR product with the first and second primers was identified and analyzed to determine the effect of transposon insertion on the nucleotide sequence of interest of the plant phenotype.

EXAMPLE 5 Ds-Luciferase The DNA construct for the capture of genes designated Ds-luciferase is shown in Figure 6. The Ac-like sequences are shown in gray with the inverted terminal repeats shown as gray arrows. The constructions are flaked by the right (RB) and left (LB) edges of their respective T-DNA. The luciferase gene (LUC) is fused to the left end of Ac, from nucleotide 1 to 252. This region contains the terminal inverted repeat, but lacks a promoter. The resistance to kanamycin (Kanr) or hygromycin is conferred by the gene for neomycin phosphotransferase or aminociclitol phosphotransferase. Resistance to chlorosulfuron (chlorosulfuron1) is obtained after the excision of the Ds element of the construction containing Ds378-GUS and the activation of a mutated acetolactate synthetase gene from Arabidopsis (Federoff and Smith, 1993) by the 35S promoter. The BAR gene confers resistance to the Basta herbicide. Plasmid Ds-luciferase was constructed as follows: the Ds element in Ds 378-GUS (figure 3) was replaced by the element Ds described above and illustrated in figure 6, which contains both the luciferase resistance gene and kanamycin between the edges Ac. After, the fragment promoter 35S-Ds-ALS Asp718 was cloned into the binary vector SLJ525 (obtained from Dr. Jonathan Jones, Norwich, United Kingdom). The plasmid Ds-luciferase was transformed into the miniature tomato variety 'Micro-Tom' as described in Example 3. A total of 1, 000 plants containing transposition were cultured. independent of Ds-luciferase. Plant organs such as the seedling, flowers and fruits were selected for the expression of luciferase. The selection was made by spraying the plant tissue with 1 mM luciferin, and by subsequent imaging in total darkness. The formation of Images were taken with a Princeton Instrument CCD cooled camera that could detect ultra low light signals. 100 plants that glowed in the dark, ie, which expressed luciferase in various tissues, were detected as illustrated in Figure 7. Of the 1,000 plants selected, one plant expressed luciferase in seedlings under normal conditions, but was repressed by treatment with cold (figure 7, lower panel). To detect very specific types of promoters or enhancers, it is necessary to select larger populations of mutants.

REFERENCES Alien went to. (1993) "The Use of the Polymerase Chain Reaction and the Detection of Amplified Products" in Methods in Molecular Bioloqv. Vol 15: PCR Protocols: Current Methods and Applications, B.A. White (ed.), P. 113-128, Humana Press, Totowa, NJ. Altmann, T., Schmidt, R., and Willmitzer, L. (1992) Establishment of gene tagging system in arabidopsis thaliana based on the maize trandible element Ac. Theor. Appl. Genet 84,371-383. Bechtold, N., Ellis, J., and Pelletier, G. (1993) In plant Agrobacterium Mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C.R. Acad. Sci. Paris, Sciences de la Vie / Life Sciences, 316.1194-99. Beeckman, T., and Engler (1994) An easy technique for the clearing "-J-Aj of histochemically stained plant tissue." Plant Mol. Biol. Rep. 12.37-42, Benson, Robert J., Johal, Gurmukh, Crane, Virginia C, Tossberg, John T. , Schnable, Patrick S., Meeley, Robert B. and Briggs, Steven P., (1995) Cloning and characterization of the maize an1 gene The plant Cell 7: 75-84 Bishop, GJ, Harrison, K., and Jones, JDG (1996) The tomato Dwarf gene isolated by heterologous trason tagging encodes the firts member of a new cytochrome P450 family Plant Cell 8,959-969 Carroll, BJ, VI, K., Thomas, CM, Bishop, GJ, Harrison , K., Scofield, SR, and Jones, JDG (1995) Germinal trasition of the maize element Dissociation from T-DNA loci n tomato Genetics 139,407-420 Cooley, MB, Goldsbrough, AP, Still, DW, and Yoder , Jl (1996) Site-selected Insertional mutagenesis of tomato with maize Ac and Ds elements, Gen. Genet 252,184-194, Delidow et al., 1993"Polymerase Chain Reaction: Basic Protocols" in Methods in Molecular Bi oloqy, Vol 15: PCR Protocols: Current Methods and Applications, B.A. White (ed.), P. 1-29. Humana Press, Totowa, NJ. Dellaporta, S.L., Wood, J. and Hicks. J.B. (1983) A plant DNA minipreparation: Version II. Pl. Mol. Biol. Rep. 1, 19-21. Dooner, H.K. and Belachew, A. (1989) Trasition pattern of the maize element Ac from the bz-m2 (Ac) aliele. Genetics 122,447-458. Fedoroff, NV. et al. (1984) Proc. Nati Acad. Sci. USA, 81, 3825-3829.

Fedoroff, NV. and Smitt # t8t. (1993) A versatile system for detecting trasition in Arabidopsis, Plant J. 3,273-289. Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132.6-13. Fillati, J.J., Kiser, J., Rose, R. and Comai, L. (1987) Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefactens vector. Biotechnology 5,726-730. Gde and Youssetian, Genes in Wheat. in Proqress in Plant Breedinq (Russel, GE, ed: Butterworth, 2, Co. London) pp 1-35. Gorbunova, V. and Levy, A.A. (1997) Circularized Ac / Ds trasons: formation, structure and fate, Genetics 145,1161-1169. Greenblatt, I.M. 81984) A chomosome replication pattern deduced from pericarp phenotypes resulting from movements of the trandible element, Modulator, in maize. Genetics 108,471-485. Hedde and Kamiya, Gibberellin biosynthesis: Enzymes, genes and their regulation. Ann. Rev. Plant Physiol. Plant Mol. Biol. 48,431-460. Hildering, G.J. and Verkerk, K. (1965) Chimeric structure of the tomato plant after seed treatment with Ems and X-rays. In, The use of induced mutations in plant breeding. Pergamon press, pp 317-320. Hille, J., Koormneef, M., Ramanna, M.S. and Zabel, P. (1989) Tomato: a crop species amenable to improvement by cellular and molecular methods. Euphytica 42.1-3.

Hoekema et al. 81983) * ature, 303,179-180. Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholtz, D., Rogers, S.G., and Fraley, R.T. (1985) A general and simple method for transferring genes into plants. Science 277, 1229-1231. R.T. (1985) A general and simple method for transferring genes Nto plants. Science 277, 1229-1231. Jefferson, R.A. (1987) Assayling chimeric genes in plants: The GUS gene fusion system. Plant Mol. Biol. Rep. 5,387-405. Jones, D.A., Thomas, C.M., Hammond-Kosack, K.E., Balint-Kurti, P.J., and Jones, J.D.G. (1994) Isolation of the tomato c -9 gene for resistance to Cladosporium fulvum by transposon tagging. Science 266,789-792. Jones, J.D.G., Carland, F.C., Lim, E., Ralston, E., and Dooner, H.K. (1990) Preferential transposition of the maize element Activator to linked chromosomal locations n tobáceo. Plant Cell 2,701-707. Keddie, J.S., Carroll, B., Jones, J.D.G., and Gruissem, W. (1996) The DCL gene of tomato is required for chloroplast development and palisade cell morphogenesis in leaves. EMBO J. 15.4208-4217. Knapp, S., Larondelle, Y., Robberg, M., Furtek, D., and Theres, K. (1994) Transgenic tomato lines containing Ds elements at defined ganomic positions as tools for targeted transposon raggin. Mol. Gen. Genet. 243,666-673. Koncz, C, Chua, N.H. and Schell, J. (1992) Methods in arabidopsis research. Eds. Singapore, New Jersey, London, Hong Kong: World Scientific • -a-n-S- ^ -. «**» ^ "^^ ^^ g ^^^ g ^ ^^^ w Pub. Co. Leutwiler, L.S., Houngh-Evans, B.R. and Meyerowitz, E.M. (1984) The DNA of Arabidopssi thaliana. Mol. Gen. Genet. 194,15-23. Mamberg, R.L. (1993) Production and Analysis of the Plant Mutants, Emphasizing arabipdosis thalama in METHODS IN PKANT MOKLECULAR BIOLOGY AND BIOTECHNOLOGY, CRC Press (Boca Ratón) pp11-28. Mandel, M.A. and Yanofsky, M.F. (1995) Nature 377,522-524. McCIintonck, B. (1956) Mutations in maize. Camegie Institution, Washintong Yearbook 55,323-332. Mccormick, S., Niedmeyer, J., Fry, J., Bamason, A., Horsch, K., and Fraley, R. (1986) Leaf disc transformation of cultivated tomato (. Esculenium) using Agrobacterium tumefaciens. Plant Cell Reports 5.81-84. Osborne, BI, Corr, CA, Prince, JP, Hehl, R., Tanksley, SD, McCormick, S., and Baker, B. (1991) Ac transposition from to T-DNA can genérate linked and unlinked clusters of insertions n tomato genome. Genetics 129,833-844. Poehlman, J.M., BREEDING FIELD CROPS (1987) Van Nostrand Reinhold, New York (3rd ed.). Rick, C.M. and Yoder, J.L. (1988) Classical and molecular genetics of tomato: highlights and perspectives. Ann Rev. Genet. 22,281-300. Rommens, C.M.T., Rudenko, G.N., Dijkwel, P.P., Vanhaaren, M.J.J., Ouwerkerk, P.B.F., Blok, K.M., Nijkamp, H.J.J. and Hille, J. (1992) - ^ ^^ ^ á ^ ^ Üguu Characterization of the Ac / Ds behavior transgenic tomato plants using plasmid rescue. Plant Mol Biol 20.61-70. Rychlick et al. "Selection of Primers for Polymerase Charin Reaction", in Methods in molecular Bioloqy. Vol 15: Protocols: Current Methods and Applications. B.A. White (ed.), P. 31-40, Humana Press, Totowa, NJ. Schoenmakers, HCH, Koomeef, M., Alefs, SJHM, Gerrits, WFM, van der Kop, D., Cherel, I. and Caboche, M. (1991) Isolation and characterization of nitrate reductase-deficient mutants in tomato (Lycopersicon esculenium Milli.). Mol. Gen. Genet. 227,458-464. Scott, J.W., and Harbaugh, B.K., (1989) Micro-Tom - a miniature dwarf tomato. Florida Agr. Expt. Sta. Circ. 370.1-6. Scott, L., LaFoe, D. and Well, C, (1996) Adjacent squences influence DNA repair accompanying transposon excision in maize. Genetics 142,237-246. Shaley, G. and Levy, A.A. (1997) The maize transpondible element Ac induces recombination between the donor site and an homologous ectopic sequence. Genetics, 146.1143-1151. Sundaresan, V. (1996) horizontal spread of transposal mutagenesis: new uses for oíd elements. Treds in Plant Science 1, 184-190. Sundaresan, V., Springer, P., Volpe, P., Haward, S., Dean, C, Jones, JDG, Ma, H. and Martienssen, R. (1995) Patterns of gene activation in plant development revealed by enhancer trap gene trap transpondible É i albm iJMUm? elements. Genes Dev. 9,1797-1810. Tanksley, S.D. (1993) Linkage map of tomato (Lycopersicon esculenium) (2N = 24). In Genetic maps: Locus Maps of Complex Genomes. (J. O'Brien, Eds) Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, pp. 6.39-6.60. Thomas, C.M., Jones, D., English, J.J., Carrol, B.J., Bennetzen, J.L., Harrison, K., Burbidge, A., Bishop, G. and Jones, J.D.G. (1994) Analysis of the chromosomal distribution of transposon-carryng T-DNAs in tomato using the inverse polymerase chain reaction. Mol Gen Genet 242,573-585. Verkerk, K. (1971) Chimerism of the tomato plant after seed irradiation with fast neutrons. Neth. J. Agrie. Sci.19,197-203. Weide, R., Koornneef, M. and Zabel, P. (1989) A simple, nondestructive spraying assay for the detection of an active kanamycin resistance gene transgenic tomato plants. Theor. Appl. Genet 78.169-172. Weigel, D. and Nilsson, O. (1995) Nature 377,495-500. Wisman, E., Koornneef, M., Chase, T., Lifshytz, E., Ramanna, M.S. and Zabel, P. (1991) Genetic and molecular characterization of Adh-1 nuil mutant in tomato. Mol. Gen. Genet, 226, 120-128. Yoder, J., Palys, J., Albert, K. and Lassner, M. (1988) Ac transposition in transgenic tomato plants. Mol. Gen. Genet. 213,291-296.

LISTING DS SEQUENCES (1. GENERAL INFORMATION: (i) APPLICANT: (A) NAME: JEDDA Research and Development Co. Ltd. et al. (B) STREET: P.O. Box 95 (C) CITY: Rehovot 76100 (D) STATE: none (E) COUNTRY: Israel (F) POSTAL CODE: 76100 (I) TITLE OF THE INVENTION: Method for large-scale mutagenesis in crop plants (Ii) NUMBER OF SEQUENCES: 4 (iv) COMPUTER READABLE FORM: (A) TYPE OF MEDIUM: Flexible disk (B) COMPUTER: compatible with IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: Patentln Relay # 1.0, Version # 1.30 (EPO) Mm (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: Sl (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GGATAGTGGG ATTGTGCGTC 20 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid - • **** • '- - ^ - «-'- - - -HBr • my i (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" 5 (iii) HYPOTHETICAL: Sl (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GGATGATTTG TTGGGGTTTA 20 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear 20 (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: Sl ---------------------------- -li »- ..« ^ - ^ - t- ,,,. i JMJÉfhíi? i i ni iMiiii ni jjtti iij? i iip) l ll end (i it ~ "? ip'i n ^ - ^ - ^^^ - (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 3: GCGTGACGCC GTGACC 16 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: Sl (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: GCGTGACGGC GTGACC 16 ? t -s ..

Claims (44)

NOVELTY OF THE INVENTION CLAIMS

1. - A method for selecting a miniature mutant plant having a desired characteristic, which comprises the steps of: a) providing a population of miniature plants, wherein said miniature plants have the following characteristics: (i) reduced size in comparison with a commercial plant of the same species; (ii) ripening to produce viable seeds or tubers at a density per plant at least ten times higher than the standard growth conditions used for a commercial plant of the same species, and (iii) capable of being crossed with a commercial variety of the same species; b) generating miniature mutant plants in said population of miniature plants, treating said miniature plants with a mutant inducing agent to produce a population of mutagenized miniature plants and c) selecting a miniature mutant plant having said desired characteristic within said population of mutagenized miniature plants.

2. The method according to claim 1, further characterized in that said population of miniature plants is generated by natural or induced mutation, by genetic engineering or by treatment with plant growth factors.

3. The method according to claim 2, further characterized in that said miniature plant is a miniature tomato variety.

4. The method according to claim 1, further characterized in that said commercial plant of the same species is used to produce food, fibers or flowers.

5. The method according to claim 4, further characterized in that said commercial plant of the same species is a plant that produces a berry fruit or a plant of the Solanaceae family.

6. The method according to claim 5, further characterized in that said commercial plant produces a berry-like fruit selected from tomato, grape, plum, eggplant, citrus and apple.

7. The method according to claim 1, further characterized in that said mutation-inducing agent of step b) is a chemical mutagen selected from the group consisting of ethyl methanesulfonate (EMS), methyl methanesulfonate (MMS), methyl- N-nitrosourea (MNU) and bleomycins.

8. The method according to claim 1, further characterized in that said mutation-inducing agent of step b) is selected by irradiation of the group consisting of UV, irradiation?, X-rays and fast neutrons.

9. The method according to claim 1, further characterized in that said mutation-inducing agent of step b) is a mobile DNA sequence that is selected from the group consisting of a T-DNA and a transposable element.

10. The method according to claim 9, further characterized in that said transposable element is selected from the group consisting of an autonomous transposon, a non-autonomous transposon and an autonomous / non-autonomous transposon system.

11. The method according to claim 10, further characterized in that said transposable element is the transposable element Ac / Ds of corn.

12. A miniature mutant plant selected by the method according to any of claims 1 to 11.

13. The miniature mutant plant according to claim 12, further characterized in that said miniature plant is a variety of tomato in miniature.

14. A population of miniature mutant plants, characterized in that a miniature plant of said population has the following characteristics: (i) reduced size compared to a commercial variety of the same species; (ii) ripening to produce viable seeds or tubers at a density per plant at least ten times higher than the standard growth conditions used for a commercial plant of the same species; (iii) capable of being crossed with a commercial plant of the same species and (iv) possesses a mutation induced by an agent selected from the group consisting of a chemical mutagen, irradiation or a mobile DNA sequence.

15. The population of miniature mutant plants according to claim 14, further characterized in that said commercial plant of the same species is used to produce food, fibers or flowers.

16. The population of miniature mutant plants according to claim 15, further characterized in that said commercial plant of the same species is a plant that produces a berry fruit or a plant of the Solanaceae family.

17. The population of miniature mutant plants according to claim 16, further characterized in that said commercial plant produces a berry-like fruit selected from tomato, grape, plum, eggplant, citrus and apple.

18. A method for identifying a miniature plant containing a mobile DNA sequence inserted into a gene of interest, comprising the steps of: a) providing a population of miniature plants, wherein said miniature plants have the following characteristics: (i) reduced size compared to a commercial plant of the same species; (ii) ripening to produce viable seeds or tubers at a density per plant at least ten times higher than the standard growth conditions used for a commercial plant of the same species, and (iii) capable of being crossed with a commercial variety of the same species; b) generate miniature mutant plants in said population of Heimá? Imm --- MMÉHÉaüi-l-i miniature plants, treating such miniature plants with a mobile DNA sequence; c) selecting DNA extracted from said mutant plants with PCR using a first primer corresponding to a nucleotide sequence of said mobile DNA sequence and a second primer corresponding to a nucleotide sequence of said gene of interest and d) identifying a plant in miniature that comprises DNA and that produces a PCR product in the presence of said first and second primers.

19. The method according to claim 18, further characterized in that said miniature plant is a variety of miniature tomato.

20. The method according to claim 18, further characterized in that said mobile DNA sequence is selected from the group consisting of a T-DNA or a transposable element.

21. The method according to claim 20, further characterized in that said transposable element is the transposable element Ac / Ds of corn.

22. A method for producing a mutant population of a miniature plant, comprising the steps of: a) providing a population of miniature plants, wherein said miniature plants have the following characteristics: (i) reduced size in comparison with a commercial plant of the same species; (ii) maturation to produce viable seeds or tubers at a density per plant at least ten times higher than the standard growth conditions used for a plant É ~ U, ... ^. «AiA ^, ...... commercial of the same species, and (iii) capable of being crossed with a commercial variety of the same species; b) generating miniature mutant plants in said population of miniature plants, treating said plants with a mutant-inducing agent to produce said mutant population of said miniature crop plant variety.

23. The method according to claim 22, further characterized in that said population of miniature plants is generated by natural or induced mutation, by genetic engineering, or by treatment with plant growth factors.

24. The method according to claim 22, further characterized in that said mutation-inducing agent of step b) is a chemical mutagen selected from the group consisting of ethyl methanesulfonate (EMS), methyl methanesulfonate (MMS), methyl- N-nitrosourea (MNU) and bleomycins.

25. The method according to claim 22, further characterized in that said mutation-inducing agent of step b) is selected by irradiation of the group consisting of UV rays,? Irradiation, X-rays and fast neutrons.

26. The method according to claim 22, further characterized in that said mutation-inducing agent of step b) is a mobile DNA sequence selected from the group consisting of a T-DNA or a transposable element.

27. The method according to claim 26, further characterized in that said mutation-inducing elementÉÉe is a T-DNA and said miniature plants are infected with Agrobacterium, thereby producing multiple transformants wherein each transformant contains a T-DNA insert at a different genomic position.

28. The method according to claim 26, further characterized in that said mutation-inducing agent is a transposon and the population of miniature mutant plants is obtained from the progeny of miniature plants that contain an active transposition system.

29. The method according to claim 28, further characterized in that said active transposition system is a native transposon of plants or a transposon introduced into the plant by genetic engineering techniques.

30. The method according to claim 29, further characterized in that said active transposition system is selected from an autonomous transposon, and a transposable element obtained by crossing a plant that contains a non-autonomous transposon either with a transposase source or with a transposase source. a plant that contains an autonomous transposon.

31. The method according to claim 29, further characterized in that said transposable element is the transposable element Ac / Ds of corn.

32. The method according to claim 22 or 31, * - * «* - -. > -ji. -ii -? i-? al - a? - t - tte. , JM-M-ttíl- -fa ~ ^ further characterized because said miniature plant is a variety of tomato in miniature. 33.- A method for identifying a nucleotide sequence that controls the expression of genes in plants, comprising the steps of: a) transforming a miniature plant with a DNA construct to produce a population of randomly mutagenized plants, wherein said DNA construct comprises a gene sequence encoding a selectable marker that lacks a promoter or that contains a minimal promoter, said gene sequence being cloned within the edges of a mobile DNA sequence, wherein said miniature plant has the following characteristics: (i) reduced size compared to a commercial plant of the same species; (I) ripening to provide viable seeds or tubers at a density per plant at least ten times greater than the standard growth conditions used for a commercial plant of the same species; and (iii) capable of being crossed with a commercial variety of the same species to produce a population of randomly mutagenized plants; b) identifying a miniature plant within said population of plants that is transformed with said DNA construct and expressing said selectable marker and c) cloning the nucleotide sequence that is operably linked to said gene encoding said selectable marker of total DNA isolated from said transformed miniature plant identified in step b). 34.- The method according to claim 33, .. ^ fc -.-., -.-. ^. ^^ ... «MMttMwmiliíi íiiiiiilíi .j-MHfa - ..,. . ^^ J ^ e *****, further characterized in that said selectable marker is selected from GUS and luciferase. 35. The method according to claim 33 or 34, further characterized in that said mobile DNA sequence is a T-DNA or a transposable element. 36. The method according to claim 33, further characterized in that said nucleotide sequence that controls the expression of genes in plants is a promoter or enhancer. 37.- A method for producing a mutant population of a commercial plant with a desired characteristic, which comprises the steps of: a) crossing a miniature mutant plant selected according to the method of claim 1 having said desired characteristic , with a commercial plant of the same species and b) selecting progeny that resembles the commercial progenitor plant and expresses said desired characteristic. 38. The method according to claim 37, further characterized in that said commercial plant is used to produce food, fibers or flowers. 39.- The method according to claim 38, further characterized in that said commercial plant produces a berry fruit or a plant of the Solanaceae family. 40.- The method according to claim 39, further characterized in that said commercial plant produces a type fruit Selected berry of tomato, grape, plum, eggplant, citrus and apple. 41.- A commercial plant having a desired characteristic produced by the method according to claim 37. 42.- The commercial plant according to claim 41, further characterized because said commercial plant is used to produce food, fibers or flowers . 43.- The commercial plant according to claim 42, further characterized in that said commercial plant produces a berry fruit or a plant of the Solanaceae family. 44.- The commercial plant according to claim 43, further characterized in that said commercial plant produces a berry-like fruit selected from tomato, grape, plum, eggplant, citrus and apple. . "^ - .. L iii?