MXPA00002278A - Genetically engineered cell culture adapted infectious bursal diseases virus (ibdv) mutants - Google Patents

Abstract

The present invention relates to a method for the adaptation of infectious bursal disease viruses (IBDV) to growth in CEF cell culture. Changing the codons for amino acid residues 253 (Gln) and 284 (Ala) to 253 (His) and 284 (Thr) allowed bursa adapted Classical and Variant-E IBDV to grow in CEF cell culture. For GLS IBDV only a change of the codon for amino acid residue 284 was necessary.

Description

MUTANTS OF THE INFECTIOUS BURSAL DISEASE VIRUS (IBDV) ADAPTED IN GENETICALLY TREATED CELLULAR CROPS The present invention relates to a method for the preparation of an infectious IBDV mutant capable of replicating in CEF cell culture, a genetically treated IBDV mutant, as well as a vaccine comprising said IBDV mutant. The infectious bursal disease virus (IBDV) is a member of the Birnaviridae family. Viruses in this family have a very similar genomic organization and a similar replication cycle. The genomes of these viruses consist of 2 segments (A and B) of double-stranded RNA (dh). The longer segment encodes a polyprotein that is divided by autoproteolysis to form mature viral proteins, VP2, VP3 and VP4. VP2 and VP3 are the main structural proteins of the virion. VP2 is the main host immunogen of birnavirus, and contains the antigenic regions responsible for the induction of neutralizing antibodies. The VP4 protein appears to be a protein of the encoded virus that is involved in the processing of a polyprotein precursor of the VP2, VP3 and VP4 proteins. The larger segment A also has a second open reading frame (ORF), preceding and partially overlapping the polyprotein gene. This second open reading frame encodes a VP5 protein of the unknown function that is present in cells infected with IBDV. The smallest segment B encodes VP1, a 90-kDa multifunctional protein with polymerase and blocking the activities of the enzyme. For IBDV, two existing serotypes, serotypes 1 and 2. The two serotypes can be differentiated by virus neutralization (NV) tests. In addition, subtypes of serotype 1 have been isolated. These viruses are called "variant" of serotype 1 that can be identified by cross-neutralization samples, a panel of monoclonal antibodies or RCP-RT. These subtypes of IBDV serotype 1 have also been described in the literature, for example; classic strains, of the variant-E-GLS, RS593 and DS326 (Van Loon, and others, Proceedings of the International symposium on infectious bursal disease and chicken infectious anemia, Rauischholzhausen, Germany, 179-187, 1994). Infectious Bursal Disease (IBD), also called Gumboro disease, is an acute, highly contagious viral infection in chickens that have lymphoid tissue as their primary target with a selective tropism for Burial Fabricius cells. The morbidity regimen in susceptible flocks is high, with rapid weight loss and moderate mortality regimes. Small chickens that recover from the disease may have immune deficiencies due to the destruction of the Fabricius bursa that is essential for the chicken defense mechanism. The IBD virus causes severe immunosuppression in chickens younger than 3 weeks of age and induces bursal lesions in small chickens up to 3 months of age. For many years, the disease can be prevented by inducing high levels of antibody in the flocks, by the application of an inactive vaccine, to chickens that have been sensitized with live attenuated IBDV vaccine. This can help reduce the economic losses caused by IBD to a minimum. Maternal antibodies in chickens derived from vaccinated broods prevent early infection with IBDV and decrease the problems associated with immunosuppression. In addition, live attenuated vaccines have been used successively in flocks of commercial chickens after they have declined maternal antibodies. Currently, very virulent strains of IBDV have caused outbreaks of disease with high mortality in Europe. Current vaccination programs do not protect chickens enough. The failures of the vaccines were mainly due to the inability of the live vaccines to infect the birds before the exchange with the virulent field virus. Thus, there is a constant need to improve existing vaccines and to develop new types of vaccines. For the development of IBD viruses, live vaccines are required in attenuated form. Conventionally, this can be achieved by serially passing the isolated IBDV field onto an appropriate substrate. For the development of inactivated IBDV vaccines, an appropriate substrate is necessary for the generation of high amounts of the mass of the IBDV antigen resulting from the spread of the IBD viruses on the substrate. It will be known that field IBDVs can be easily propagated in vivo in the bursa of infected birds or in embryonated eggs. However, although successive adaptation in the propagation of some strains of IBDV has been reported for the in vitro cell culture of chicken embryo origin, it should generally be recognized that the majority of strains of IBDV isolated from the infected bursa in the field, in particular the virulent or very virulent IBDV strains, so-called, can not be adapted to the cells of the origin of chicken embryos, such as chicken embryo fibroblasts (CEFs) or cells of other organs such as kidney or liver (Brown et al., J. Gen. Virology 75, 675-680, 1994; van Loon, et al., 1994, supra). The disadvantages of substrates of the culture in vivo, will be obvious. These farming methods are not pleasant for animals, a lot of animals is needed, they are delayed and can not be carried out under normalized or strict conditions. In addition, the limited number of IBDV strains that are not resistant to adaptation in cell culture substrates [n. In vitro, they suffer the disadvantage that as a result of the serial step process leading to the adaptation of the IBDV strains, the random mutations are introduced into the virus genome in an uncontrolled manner. Such mutations may influence the properties of the virus other than those associated with the adaptation of the virus to the cell culture eg, properties related to the immunogenicity of the virus. No such additional random mutations are desired. Adaptation of IBDVs from in vitro virus in CEF cell cultures has been associated with the attenuation of virulence as demonstrated by a reduction in the virus's ability to induce lesions in the bursa of infected birds. Yamaguchi et al. (Virology 223, 219-223, 1996) investigated the molecular basis for the virulence of IBD viruses and the attenuation of these viruses as a result of the adaptation of bursa IBDVs in the cell culture of IBD. It has been concluded from the studies carried out by Yamaguchi and others, that the precise mutations involved in the attenuation of wild-type IBDV could not be identified. We have suggested that the amino acid residues at position 279 (Asp / Asn) and 284 (Ala / Thr) of the polyprotein encoded by the open reading frame along segment A, are important for the virulence or spread of IBDV in CEF cells. The latter was confirmed by Lim, B-L (Proceedings of the 4th Asia Pacific Poultry Health Conference, November 22-25, 1998, Melbourne, Australia, Abst. 79). It is disclosed herein that the substitution of amino acid residues 279 (Asp? Asn) and 284 (Ala? Thr) in the VP2 protein of IBDV results in an IBDV mutant that can be propagated in the cell culture of CEF.

However, the prior art does not teach an alternative of the type and minimum number of amino acid mutations that are required and are sufficient to allow the adaptation of IBDV from the bursa to the CEF cell culture. It is an object of the invention to provide an applicable method for the adaptation of IBDV isolates that only develop in vivo in the bursa of infected birds, to develop in cell culture. It is a further object of the present invention to provide a method for the preparation of attenuated IBDV mutants by introducing the mutations into the IBDV genome in a controlled manner. Furthermore, it is an object of the present invention to provide a genetically-treated IBDV mutant comprising the appropriate amino acid residues that allow the mutant to grow in the cell culture. It has been found that this objective has been met by a method for the preparation of an infectious IBDV mutant capable of replicating in CEF cell culture comprising the steps of, (i) separately preparing a DNA construct comprising cDNA from the segments of the A and B genome of an IBDV that is not capable of replicating in the CEF cell culture, (ii) introducing a mutation in: a. one or more codons of amino acid residues 253 and 284 of the VP2 gene of Alternative E or the classical IBDV strains, or in b. a codon of the residue of amino acid 284 of the VP2 gene of a GLS IBDV strain, on the DNA comprising segment A, such that the codons for amino acid residues 253 and 284 of the mutated VP2 gene encode a histidine and a threonine residue, respectively, in the case of an E-Variant or the Classic IBDV strain, or so that the codon of the amino acid residue 284 of the mutated VP2 gene encodes a threonine residue in the case of an IBDV strain of GLS (iii) allow RNA transcripts from the cDNA comprising segment A and segment B to initiate replication of the IBDV mutant in the host cells in a culture medium, and (iv) isolate the IBDV mutant from the culture.

The present invention first identifies the amino acid residues that are required and sufficient to allow an IBDV to replicate in the CEF cell culture. While most isolates of the IBDV bursa comprise the amino acid residues 253 (Gln), 284 (Ala) and 330 (Ser) of the VP2 protein, Variant-E or classical IBDV mutants whose codons at positions 253 and 284 have been changed so that they now code for amino acid residues 243 (His) and 284 (Thr) that are capable of developing in the CEF cell culture. For the GLS IBDV mutants, it has been found that it is sufficient to change the codon at position 284 so that it now encodes the amino acid residue 284 (Thr). It has also been found that position 330 of amino acids is not critical for the replication of the IBDV Clásica or E-Variant mutant in CEF. However, in the present invention residues of serine, arginine or lysine are more favored in that position. Additionally, it has been found that for the GLS IBDV amino acid, position 253 is not critical for replication, and is usually a glutamine residue. Therefore, in a preferred method, an IBDV mutant comprising any of these three amino acid residues, in particular 330 (Arg), is prepared in this position in the VP2 protein. For the GLS IBDV mutants the preferred amino acid residue at position 253 is a glutamine.

Table 1 We have found that in the genome of an IBDV of the E-variant (chimeric) that is capable of replicating only in the bursa of infected chickens (D78 / Variant-E), two changes are necessary to adapt the IBDV isolates for the cell culture of CEF. These positions involve the amino acid residue 253 and 284. The amino acid residues of histidine and threonine at these positions, respectively, allow the IBDV mutant to replicate in CEF cell culture. (Table 1 and Example 1). In addition, we have found that IBDV mutants adapted for cell culture of CEF according to the method of the invention are also attenuated (Example 2).

To further prove that the adaptation of bursa in the CEF cells for the classical IBDV strains was also determined by the two amino acids, the codons of the IBDV strain D78 that is capable of replicating in the CEF cell culture were changed in the positions 253, 284 and 330. The results are shown in Table 2A. Table 2A The isolated European "very virulent" (MV) UK661 (Brown et al., J. Gen. Virology 75, 675-680, 1994; Brown and Skinner, Virus Res. 40., 1-15, 196) can not be propagated in vitro, and therefore should be propagated in vivo in chickens. Chickens that have been infected with the MV strain and birds that survived a few days after infection died and the bursa was removed. The virus was then extracted from the bursal homogenate for further use. The underlying experiments of the present invention demonstrate that the amino acid changes at position 253 and 284 defined above allow the UK661 MV strain to develop in the cell culture. The results of mutagenesis and transfection experiments with this classical IBDV strain are summarized in Table 2B. Table 2B 'replicated very slowly These data further prove that the amino acid changes at positions 253 and 284 are sufficient to allow classical bursa IBDV strains to develop in cell culture. The other mutations result in mutants that can not replicate in the cell culture that replicate very poorly (see also Lim et al, J. Virol 73., 2854-62, 1999). Additionally, it was determined that in GLS IBDV the exchange of a single amino acid residue at position 284 was sufficient to allow an IBDV adapted from the bursa to be replicated in the CEF cells (Table 3).

Table 3 Therefore, the method according to the invention allows the adaptation of IBDV bursa isolates to be developed in the cell culture by means of recombinant DNA techniques. The advantage of the present method is that, as a result of the adaptation process, only the mutations in the IBDV genome are introduced into one or more of the codons at positions 253 and 284. The numbers indicate the positions of the amino acids and the codon of the polyprotein and the large open reading frame on segment A of the IBDV genome, respectively (Mundt and Müller, J. Gen. Virol. 77., 437-443, 1995; NCBI accession number X 84034). Most, but not all strains of IBDV that fail to grow on the cell culture of CEF, contain codons 253 (Gln), 284 (Ala) and 330 (Ser) in the VP2 gene. Some IBDV strains of the E-Classical variant that fail to develop on the cell culture of CEF, may already have one of the required codons 253 (His) and 284 (Thr). Therefore, the method according to the invention comprises the introduction of a mutation into one or two of the required codons mentioned above, so that the resulting IBDV mutant comprises the codons of the VP2 gene encoding amino acid residues 253 (His) and 284 (Thr). More preferably, the method of the invention is applied to an IBDV that is not capable of replicating in the CEF cells and that comprises the codons for amino acid residues 253 (Gln) and 284 (Ala), and even more preferably 330 ( Be). In the case of the Classic strains and the E-Variant, the mutations are introduced in two or three of the codons of the VP2 gene which results in codons 253 (His) and 284 (Thr), and optionally 330 (Arg). The new codons for amino acids in these positions can be: for His (CAT or CAC), for Thr (ACT, ACC, ACA, ACG) and for Arg (CGT, CGC, CGA, CGG, AGA, AGG). Even more preferably, the method of the invention is applied to an IBDV that is not capable of replicating in the CEF cells and which comprises the Gln 253 codons (CAA); Wing 284 (GCC) and optionally Ser 330 (AGT) or any combination thereof. In particular, the method of the invention is applied to an IBDV that is not capable of replicating in CEF cells and that comprises codons 253 (CAA), 284 (GCC) and 330 (AGT). The method for the preparation of an IBDV mutant according to the present invention comprises the "reverse genetic" site currently established for birnavirus (Mundt and Vakharia, Proc. Nati Acad. Sci. USA 93, 11131-11136, 1996 and WO 98/09646). This reverse genetics system opens up the possibility of introducing mutations in the RNA genome of an IBD virus. The principle of the reverse genetics method, according to the invention, is that segments A and B of genomic RNA are isolated from the virus, followed by reverse transcription of the RNAs in the cDNA, after which the cDNAs are transcribed in the RNA The introduction of the required mutations in the A segment (or B) of the virus takes place at the level of the cDNA. An important step in this reverse genetics system is to separately provide the DNA constructs comprising a DNA vector molecule (e.g., a plasmid) and full-length cDNA clones of segments A or B of the IBDV. The DNA constructs of both of these segments can be generated according to the method described by Mundt and Vakharia (1996, supra). The subsequent step in the reverse genetics method is the transfection of the appropriate host cells with the appropriate A and B segment genetic material so that RNA transcripts from transfected host cells from cDNA segment A and B can initiate replication of the virus, resulting in infectious IBDV that can be isolated from the medium in which the host cells are grown. Several methods can be used for the last step of the reverse genetics system. Preferably, the method according to the invention comprises the preparation of the synthetic RNA transcripts of the cDNAs of segment A and B in vitro. In this case, the DNA constructs comprise an RNA polymerase promoter operably linked to any of the segments. The promoter may be the promoter for T7, SP6 or T3 polymerase, with the T7 promoter being preferred. The synthetic transcripts of segment A and B are isolated using the appropriate transfected host cells. Alternatively, a method is provided in which a cell line comprising the host cells capable of expressing the polymerase of segment B cDNA and an RNA polymerase promoter is provided, so that transcripts of segment B RNA are constitutively expressed . After transfection of said cells with a synthetic RNA transcript of the cDNA comprising the mutated segment A, replication of the IBDV mutant is initiated in the host cells. In particular, host cells, which are capable of expressing the RNA polymerase dependent on the bacteriophage T7 DNA, expressed, for example, cytoplasmically of the recombinant vaccinia virus, can be used. The desired mutations can be introduced into the VP2 gene by methods generally known in the art for this purpose. In particular, mutations are introduced through site-directed mutagenesis. Methods for introducing a mutation into the IBDV genome are described herein, but are generally used in the art (Mundt and Vakharia, 1996, supra, Yao et al., J. Virology 72., 2647-2654; Mundt et al. , European Patent Application No. 0887,412 and Current Protocols in Molecular Biology, eds .: FM Ausubel et al., Wiley NY, 1995 edition, pages 8.5.1.-8.5.9.). The method according to the invention can be applied in all strains of IBDV that are not capable of replicating in the CEF cell culture, and which are of the classical antigenic subtypes of the Endo-variant or GLS of IBDV. In addition, the method according to the invention can be applied to all strains of IBDV that are not capable of replication in CEF cell culture, regardless of the virulence of the strains, and including very virulent strains (such as CS89 and UK661), virulent strains (such as F52 / 70 and STC) and vaccine strains (such as 228E and 2513). IBDV mutants that adapt to cell culture replication derived from highly virulent or virulent strains may be less virulent and may be used as live vaccine strains. Alternatively, said IBDV mutants can conveniently be propagated in the cell culture and formulated as inactivated vaccines. The method according to the invention can also be advantageously applied to attenuated strains of IBDV which are not capable of replicating the CEF cell culture. Mutants derived from said attenuated viruses can be used in a cell culture system for vaccine production instead of an in vivo production system. According to a further aspect, the present invention provides a method for the preparation of a "chimeric" IBDV mutant capable of replicating in a CEF cell culture. The method comprises the additional step of introducing a mutation in a segment A gene, preferably the VP2 gene, of a first IBDV, as a result of which, the protein expressed by said gene comprises an epitopic determinant of a second IBDV. A chimeric IBDV is a virus comprising a genetic structure of segment A or the VP2 gene of a first antigenic sub-type, and additionally comprises genetic information encoding an epitope determinant of a second antigenic sub-type of IBDV. In particular, said chimeric IBDVs express one or more additional epitope determinants on the VP2 protein of the IBDV of the first antigenic sub-types. The advantage of said chimeric IBDVs is that it can be used as a simple immunogen that induces immunity against at least two antigenic sub-types of IBDV. In particular, IBDV mutants are prepared which comprise a segment A structure or VP2 gene of IBDV Classic, GLS or E-Variant. The cDNA clones containing the total coding region of segment A of various strains of IBDV can be prepared using normal cloning methods and methods described in the prior art (Vakharia et al., Avian Diseases 36, 736-742, 1992; J. Gen. Virology 74. 1201-1206, 1993). The amino acid sequences and nucleotide sequences of segment A of various strains of IBDV are described in the prior art (e.g., WO 95/26196 and Vakharia et al., Avian Diseases 36., 736-742, 1992). In addition, WO 95/261296 describes the amino acid sequence of various epitope determinants of the antigenic sub-types of IBDV that are characteristic for each antigenic sub-type. In addition, WO 95/26196 describes the antigenic characterization of several strains of IBDV by their reactivity with a panel of neutralizing monoclonal antibodies. Importantly, the reactive epitope determinants with said neutralizing Moabs are the epitope determinants B69 (classical sub-type), R63 and 67 (Variant-E) and 57 (GLS). The region of the VP2 protein comprising the amino acid sequences for these epitope determinants are described in Vakharia et al. (Virus Res. 3_1_, 265-273, 1994). Preferably, in the method according to the present invention, a chimeric IBDV mutant capable of replicating in the CEF cell culture was prepared which comprises a classical A-segment structure and the nucleotide sequence encoding the epitopic determinant of the Variant E 67, or the epitope determinant of GLS 67. Alternatively, the chimeric IBDV mutant comprises a GLS structure and nucleotide sequences encoding the epitope determinants B69, R63 or 67. In particular, the method according to the invention, comprises the preparation of a chimeric IBDV strain (D78 / Variant-E) derived from strain D78 (commercially available from Intervet International BV, the Netherlands) in which (i) the VP2 gene is replaced by the VP2 gene of a strain of the E-Variant, and (ii) the codons at positions 263, 284 and 330 are altered as defined above (Example 1). Basically, the steps for the introduction of nucleotide sequences encoding the epitope determinants in the structure of segment A of a first IBDV are essentially the same as those for the introduction of the mutations defined above. This is most easily done by providing the cDNA of the genome segments A and B and (i) replacing the coding sequence for the epitope determinant of the first IBDV by the same as the second IBDV, or (ii) altering a specific codon in the first IBDV by site-directed mutagenesis. Such methods are also described in WO 95/26196. Finally, the RNA transcripts of these cDNA molecules make it possible to initiate the replication of a transfected host cell to obtain infectious chimeric IBDV. In another embodiment of the invention, a method is provided for the preparation of an IBDV mutant as defined above, wherein the resulting IBDV mutant also comprises other mutations that attenuate the virus. An example of such a mutation is a mutation in the VP5 gene of segment A of the IBDV genome resulting in an IBDV mutant that is not capable of expressing a native VP5 protein. The preparation of an IBDV VP5 mutant is described in European Patent Application No. 887,412. According to a further aspect, the present invention provides a mutant of infectious IBDV genetically treated capable of replicating in the cell culture of CEF, which comprises codons 253 (His) and 284 (Thr), and optionally 330 (Arg) in the cell culture. VP2 gene of the Classic strains or of the E-Variant, or codon 284 (Thr) of a GLS strain. These IBDV mutants can still understand the genetic information of the IBDVs of the bursa that are not capable of replicating in the cell culture of CEF, with the exception of new codons mentioned before they have been introduced in a controlled way by means of engineering techniques. genetics. In particular, the IBDV mutant of Variant-E, as defined above, is provided which has no glycine and / or varies at positions 318 and 315, respectively. More preferred are genetically-treated Variant-E mutants having aspartic acid and / or methionine in these positions, respectively. In a preferred embodiment, the genetically treated IBDV mutant according to the invention is a chimeric IBDV mutant, in particular a chimeric IBDV mutant derived from strain D78, which comprises the nucleotide sequence encoding the VP2 gene of a strain of the E-Variant and that it has the three new codons specified above.

The present invention provides the possibility to easily prepare IBDV vaccines from IBDV strains that were previously resistant to replication in cell culture in vitro. A further advantage of the present invention is that the IBDV can (in addition) be attenuated in a controlled manner by the method described above. Said attenuated IBDV mutants can be used as the active components in the live IBDV vaccines. Therefore, another aspect of the invention is a vaccine for use in the protection of poultry against the disease resulting from IBDV infection. The vaccine comprises a genetically-treated IBDV mutant as prepared above, together with a pharmaceutically acceptable carrier or diluent. The IBDV mutant can be incorporated into the vaccine as live attenuated or inactivated virus. A vaccine according to the invention can be prepared by conventional methods such as, for example, those commonly used for commercially available live and inactivated IBDV vaccines. In summary, a susceptible substrate is inoculated with an IBDV mutant according to the invention and propagated until the virus replicates into a desired infection after which the IBDV containing the material is cultured. Each substrate that is capable of supporting the replication of the IBDV mutants can be used to prepare the vaccine according to the present invention, including primary cell cultures (birds), such as chicken embryo fibroblast (CEF) cells or cells of chicken embryo liver (CHE), mammalian cell lines such as the VERO cell line or the BGM-70 cell line, or the bird cell lines as QT-35, QM-7 or LMH. Usually, after inoculation of the cells, the virus propagates for 3-10 days, after which the supernatant of the cell culture is recovered, and if desired, filtered or centrifuged in order to remove cellular debris. Alternatively, the IBDV mutant was propagated in embryonic chicken eggs. In particular, the substrate on which these IBDVs were propagated are embryonated eggs with SPF. The embryonated eggs can be inoculated with, for example 0.2 ml of the IBDV mutant containing the suspension or homogenate comprising at least 102 TCID50 per egg, and subsequently incubated at 37 ° C. After about 2-5 days the IBD virus product was cultured and recovered in embryos and / or membranes and / or allantoic fluid followed by proper homogenization of this material. The homogenate can be centrifuged for 10 minutes at 2500 x g followed by filtration of the supernatant through a filter (100 μm). The vaccine according to the invention containing the live virus can be prepared and marketed in the form of a suspension or in a lyophilized form and additionally contains a pharmaceutically acceptable carrier or diluent commonly used for said compositions. The vehicles include stabilizers, preservatives and regulatory solutions. Said stabilizers are, for example SPGA, carbohydrates (such as sorbitol, mannitol, starch, sucrose, dextran, glutamate or glucose), proteins (such as dry whey, albumin or casein) or degradation products thereof. Suitable regulatory solutions are for example alkali metal phosphates. Suitable preservatives are trimerosal, mertiolate or gentamicin. Diluents include water, aqueous buffer solution (such as buffered saline), alcohols and polyols (such as glycerol). If desired, live vaccines according to the invention may contain an adjuvant. Examples of suitable compounds and compositions with adjuvant activity are the same as mentioned below. Although administration by injection, eg, intramuscular, subcutaneous, of the live vaccine according to the present invention is possible, the vaccine is preferably administered by the non-expensive mass application techniques commonly used for IBDV vaccination. For IBDV vaccination, these techniques include water for drinking and aspersion vaccination. Alternative methods for the administration of the live vaccine include in ovo administration, in eye drops and in the peak. In another aspect of the present invention, a vaccine comprising the IBDV mutant in an inactive form is provided.

The main advantage of an inactive vaccine is that higher levels of long-acting protective antibodies can be achieved. The goal of inactivating the viruses grown after the propagation step is to eliminate the reproduction of the viruses. In general, this can be achieved by chemical or physical means. Chemical activation can be affected by the treatment of viruses with, for example, enzymes, formaldehyde, β-propiolactone, ethylene imine or a derivative thereof. If necessary, the inactivating compound is then neutralized. The material inactivated with formaldehyde can be, for example, neutralized with thiosulfate. The physical activation can preferably be carried out by subjecting the viruses to energy-rich radiation, such as UV light or? -rays. If desired, after treatment the pH may be adjusted to a value of about 7. A vaccine containing the inactive IBDV mutant may comprise, for example, one or more of the pharmaceutically acceptable carriers or diluents mentioned above suitable for this purpose . Preferably, an inactivated vaccine according to the invention comprises one or more compounds with the adjuvant activity. Compounds or compositions suitable for this purpose include aluminum hydroxide or oxide, phosphate, oil in water or oil in oil emulsion based on, for example, a mineral oil, such as Bayo F® or Marcol 52® or a vegetable oil such as Vitamin E acetate or saponins. The vaccine according to the invention comprises an effective dose of the IBDV mutant as the active component, i.e. the amount of IBDV immunization material that can induce immunity in birds vaccinated against exchange for a virulent virus. Immunity is defined herein as the induction of an important higher level of protection in a population of birds after vaccination compared in an unvaccinated group. Normally, the live vaccine according to the invention can be administered in a dose of 102-109 TCID50, infectious dose50 (TCID50) per animal, preferably in a dose varying from 1050-1070 TCID50 and certain inactivated vaccines can contain the antigenic equivalent of 105-109 TCID50 per animal. Inactivated vaccines are usually administered parenterally, e.g., intramuscularly or subcutaneously. Although, the IBDV vaccine according to the present invention can be effectively used in chickens, also other poultry such as turkey, guinea fowl and partridges can be vaccinated successively with the vaccine. Chickens include chickens, breeding material and preparation material. The age of the animals receiving the live or inactive vaccine according to the invention is the same as that of the animals receiving the conventional live or inactivated IBDV vaccines. For example, chickens (free of maternally derived antibody-MDA) can be vaccinated at 1 year of age, while chickens with high levels of MDA are preferably vaccinated at 2-3 weeks of age. The preparation reserve or breeding reserve with low levels of MDA can be vaccinated on days 1-10 of age followed by vaccination of chickens with inactivated vaccine for 6-8 and 16-20 weeks of age. The invention also includes the vaccine combination comprising, in addition to the IBDV mutant described above, one or more immunogens derived from other pathogen infections in poultry or fish, respectively. Preferably, the vaccine combination additionally comprises one or more infectious bronchitis virus (IBD) vaccine strains, Newcastle disease virus (NDV), egg drop syndrome (SGH), turkey trinotracheitis virus.

(TRTV, for its acronym in English) or reovirus. EXAMPLES Example 1 Construction of IBDV mutants and their replication properties in CEF cell cultures Materials and Methods Construction of IBDV plasmids (intergeneric) comprising the variable region of VP2 of the classical strains, Variant-E or GLS of IBDV (i) VP2 of the classical IBDV strain D78 A prerequisite for the next site-directed mutagenesis was the modification of the pUC 18 plasmid. For this purpose pUC 18 was divided with Nde I and BamH I, electroeluted, returned with a blunt end by the Klenow enzyme and was re-ligated to obtain pCU18 ?? / ce I-BamH I (pUC18 /? NB). Plasmid pAD78 / EK (Mundt et al., J. Virology 71_, 5647-51, 1997) was split with EcoR I and Kpn I to obtain the full length sequence of segment a of strain D78 of serotype I including the promoter site of T7 RNA polymerase. This fragment was ligated into strain D78 including the T7 RNA polymerase promoter site. This fragment was ligated into EcoR I and Kpn I divided into pUC18 /? NB to obtain pD78A /? NB (Figure 1A). Plasmid pD78A /? NB was used as a structure for the cloning of site-directed mutagenesis methods. UK661 Plasmid pD78-E / DEL (see below) was used for the construction of chimeric plasmids containing the sequences of segment a of strain UK 661. After the precipitation of reverse transcription of viral RNA is carried out and PCR following normal procedures using the oligonucleotides UK661AFor1 and UK661ARev1 (Brown and Skinner, Virus Res. 40, 1-15, 1996, nucleotide No. 621-644-Sense, and 1201-1223-contrasense, respectively). The resulting PCR fragments were cloned blunt-ended into the divided vector of Sma-I pUC 18 (Pharmacia, Sweden) to obtain p661Apart. After sequencing p661Apart was divided with the restriction enzymes Nde I and Spe I at nucleotides 647 and 1182, respectively (the numbering of the following sequence of full length of strain P2: NCBI accession number X 84034), for obtain a 535 bp fragment encompassing the coding sequences of the variable region of VP2 of the strain UK661. After binding in pD78-E / DEL divided from Nde \ -Spe I, a full-length plasmid pD78A-E-661 containing the sequence of segment A of strain D78, E / Del, and UK661 was stabilized (Figure 4). (ii) VP2 of IBDV of the Variant-E. For the substitution of the specific IBDV sequences, a plasmid containing the complete coding region of the variant E-Del strain (pEDEL22Bacll, Vakharia, Biotechnology annual review 3, 151-168, 1997) was used. pEDEL22Bacll (Figure 1A) was divided with restriction enzymes Nde I and Sal I, nucleotides 647 and 1725, respectively, according to the full length sequence of strain P2 (NCBI accession number X 84034) to obtain a fragment of 1078 bp spanning the coding sequences of the variable region of VP2 and the VP4 sequences of the E / Del strain. After ligation in pD78A /? NB divided from Nde I - Sal I, a chimeric full length pD78A /? NB-E / Del plasmid (FIG. 1A) containing the sequences of segment A of strain D78 was fixed as well as E / Del. Plasmids pD78A /? NB and pD78A /? NB-E / Del were used for site-directed mutagenesis. (iii) VP2 of GLS IBDV In addition, a pair of plasmids containing the variable region of GLS-B and GLS-TC, respectively, were constructed. For the cloning of the hypervariable region, GLS-TC was propagated in CEF and purified by ultracentrifugation. The GLS-B bursal homogenate was purified by low speed centrifugation and the supernatant was used for the following procedures. After the digestion of the K proteins (0.5 mg / ml) / sodium dodecylsulfate (SDS, 0.5%) of viral RNA was purified, it was subjected to reverse transcription of cDNA, and amplified by the polymerase chain reaction ( RCP) following normal procedures using oligonucleotides A14 and A44 (Table 4). The amplification product was cloned blunt-ended and the plasmids containing the appropriate PCR fragments containing the plasmids were sequenced. The plasmids containing each insert of their GLS-TC (pGLS-TC) or GLS-B (pGLS-B) were used in the following experiment. For the construction of the intergeneric segment, the full-length clone pD78A /? NB-E / Del was used. pGLS-TC and PGLS-B, respectively, were digested with Sac I-Spe I digested pD78A /? NB-E / Del to obtain pD78A /? NB-E / Del-GLS-TC and pD78A /? NB-E / Del - GLS- B, respectively. The plasmid maps of both plasmids are described in Figure 1b. Site-directed mutagenesis Site-directed mutagenesis was carried out by PCR. The oligonucleotides contained loading mutations in the amino acid exchanges and the cleavage sites of the additional restriction enzyme (Table 4). After PCR amplification using the plasmids pD78A /? NB, pD78A /? NB-E / Del and pD78A-E-661, respectively, the fragments were cloned blunt-ended and sequenced (pfrag). Clones containing the mutated codons were ligated into the previously cut plasmids in the following manner: (i) Variant-E IBDV For the establishment of the full length clones of segment A of the plasmid pD78A /? NB-E / Del containing the mutated codons of the following PCR fragments were obtained: E / Del-MutQH and A14 initiator (pfragQH), E / Del-MutAT and A14 (pfragAT), E / Del-MutSR and p21F (pfragSR) were used for obtain the fragments with the appropriate single amino acid exchanges Q253H, A284T, and S33OR, respectively, of the E-Del sequence. PfragQH and pfragSR were the divisions of Sac I and Spe I and were ligated into Sac I -Spe I previously digested pD78A /? NB-E / Del to obtain pD78A /? NB-E / DelQH (Figure 1C) and pD78A /? NB -E / DelSR (Figure 1C), respectively. For the construction of pD78A /? NB-E / DelAT (Figure 1C) pfragAT was Nar I -Spe I divided and subsequently ligated into pD78A /? NB-E / Del previously defined. To obtain the plasmids containing two mutated codons of the following PCR, the E / Del-MutQH and E / Del-MutSR and E / Del-MutAT and E / Del-MutSR primers were used for the amplification of fragQH-SR and fragAT-SR on pD78A /? NB-E / Del, respectively. After cloning and sequencing of pfragQH-SR divided with Sac I-Spe I and subsequently ligated into pD78A /? NB-E / Del it was previously cut to obtain pD78A /? NB-E / DelQH-SR (Figure 1D). For the construction of pD78A /? NB-E / DelAT-SR (Figure 1D) the plasmid pfragAT-SR was divided with Nar I and Spe I and ligated into pD78A /? NB-E / Del identically divided. For the construction of a plasmid containing the mutated codons for two amino acid exchanges (Q253H; A284T) PCR was carried out using the pD78A /? NB-E / DelAT plasmid and E / Del-MutQH primers; A14. Plasmid pfragQH-AT obtained was Sac I-Spe I divided and ligated into pD78A /? NB-E / Del to obtain pD78A /? NB-E / DelQH-AT (Figure 1D). The cloning of a plasmid containing the mutated codons for the three amino acid exchanges (Q253H, A284T and S330R) the E / Del-MutQH and E / Del-MutSR primers were used for the amplification of fraQH-AT-SR on pD78A / ? NB-E / Del-AT. After cleavage of pfragQH-AT-SR with sac I and Spe I the eluted fragment was ligated into Sac I and Spe I divided pD78A /? NB-E / Del to obtain pD78A /? NB-E / DelQH-AT-SR (Figure 1E). (ii) Classical IBDV D78 For the establishment of length clones competes segment A of plasmid pD78A /? NB containing the mutated clones of an Nde I-HindIII fragment of pD78A /? NB was subcloned into Nde I - HindIII previously divided pUC19 to obtain the single restriction enzyme sites to follow the procedures (pUC19 / NH-D78A). Oligonucleotides D78-MutHQ and A14 (pfragHQ), D78-MutTA and A14 (pfragTA), D78-MutRS and P21F (pfragRS) were used for PCR amplification to obtain the fragments with the single amino acid exchanges H253Q, T284A, and R330S, respectively, of sequence D78. The fragment, PfragQH divided with Sac I and Sty I, pFRAGTA divided with Nar I and Sty I, pfragRS divided with Sac I and Sty I, and re-ligated into an appropriately divided pUC19 / NH-D784. Plasmid pUC19 / NH-D78A containing the mutated codon was divided with Nde I and Sac II, the appropriate fragments were electroeluted and ligated into PD78A /? NB, previously divided with Nde I and Sac II, to obtain PD78A /? NB -HQ, pD78A /? NB-TA, and pD78A /? NB-RS, respectively. For the construction of a full-length clone containing the nucleotide substituents that condition the exchange of the three amino acids (H253Q, A284T, R330S) RCP using the oligonucleotides D78-MutHQ, D78-MutRS, and the plasmid pD78A /? NB- TA was carried out. The obtained PCR fragment was cloned blunt-ended to obtain pfragHQ-TA-RS. After dividing pfragHQ-TA-RS with Sac I and Sty I the electroeluted fragment was cloned into pUC19 / NH-D78A divided with Sac I and Sty I. The obtained plasmid was divided with Nde I and Sac II, the appropriate fragment it was electroeluted and finally ligated into pD78A /? NB, previously divided with Nde I and Sac II, to obtain pD78A /? NB-HQ-TA-RS. The nucleotide sequences of the obtained mutated plasmids were confirmed by sequencing them. The sequences were analyzed with the Wisconsin Package, version 8 (Genetics Computer Group, Madison, Wis.). The plasmids pD78A /? NB-HQ, pD78A /? NB-TA, pD78A /? NB-RS, and pD78A /? NB-HQ-TA-RS are described in Figure 2. UK661 The site-directed mutagenesis plasmid pD78A -E-UK661 was EcoR \ IKpn I divided and full length sequence of segment A containing the fragment subsequently ligated into EcoR \ IKpn I divided with the plasmid vector pBS "(Stratagene) .The resulting plasmid pBSD78A-E-661 used for site-directed mutagenesis experiments following the method as described above (Kunkel et al., Methods Enzymol, 154, 37-382, 1987.) Based on the results of Lim et al. (1999, supra) the nucleotide sequence for amino acids 279 and 284 of the plasmid pBSD78A-E-661 was exchanged (D279N, A284T) using the mutl-oriented oligonucleotide Mut1 (Brown and Skinner, supra; nucleotide No. 947-1001, 946-966 is AAC and 979-981 is ACG resulting from the substitution D279N and A284T of the amino acids.) The appropriate part of the plasmid PBSD78A-E-661-DN-A The resulting T was sequenced. After division of Nde l / Spe I of pBSD78A-E-661-DN-AT fragment of 535 bp was ligated into pD78A-E-661 appropriately divided to obtain pD78A-E-661-DN-AT. In addition, the nucleotide sequence of amino acids Q253 was exchanged into a nucleotide sequence encoding H253 using the oriented-sense Mut 2 oligonucleotide (Brown and Skinner, supra, nucleotide No. 874-900, 886-888 is CAT resulting in the amino acid exchange Q253H The amino acid exchange 284 (A284T) was carried out using the Mut3 oligonucleotide oriented in opposite sense (Brown et al., supra, nucleotide No. 966-993, 979-981 is ACC resulting from amino acid substitution A284T ) which results in the plasmid pD78A-E-661-AT The fourth plasmid pD78A-E-661-QH-AT contained in the exchange of both amino acids (Q253H, A284T) using both oligonucleotides (Mut 2, Mut3) is a Site-directed mutagenesis reaction Plasmids p661Apart, pD78A-E-61, pD78A-E-661-DN-AT, pD78A-E-661-QH, pD78A-E-661 -AT, and PD78A-E-661-QH -AT are described in Figure 4.

Table 4. Oligonucleotides used for the construction of the full-length cDNA clones of segment A of IBDV containing the amino acid substitutions3 Designation Nucleotide Sequence Orientation Substitution Nucleotide No. of amino acids P21 F CGTCCTAGTAGGGGAAGGGTC Sense none 601-622 Sac l E / Del-MutQH GAGAGCTCGTGTTCAAAACAAGCGTCCAtAG 253 H Q sense Nar 861-891 IE / Del-mutat GGGCGCCACCATCTACCTTATAGGCTTTGATGGGACTGCGGTAATCACCAG sense A 284 T 901-999 AGCTGTGGCCGCAAACAATGGGCTGACCGACCGGCATCGACAATCTTAT Spe IE / Del-MutSR CGTAGGCTACTAGTGTGACGGGACGGAGGGCTCCTGGATAGTTGCCACCAT contrasentido S 330 R 1094-1193 GGATCGTCACTGCTAGGCTCCCcCgTGCCGACCATGACATCTGTTCCCC? Sac I cn D78-MUÍHQ GAGAGCTCGTGTTTCAAACAAGCGTCCAaGG Sense H 861-891 243 Q Nar I D78-MUTTA GGGCGCCACCATCTACCTCATAGGCTTTGATGGGACAACGGTAATCACCAG sense T 284 A 901-1000 GGCTGTGGCCGCAAACAATGGGCTGACGgCCGGCACCGACAACCTTATG Sty I D78Mut-RS CGGAGGGCCCCTGGATAGTTGCCACCATGGATCGTCACTGCTAGGCTCCCaC contrasentido R 330 S 1115-1170 TTGC CAAGCCTCAGCGTTGGGGGAGAGC A44 Sense any 833-866 A14 GATCAGCTCGAAGTTGCTCACCCCA contrasentido no 1228-1252 a Composition and location of the oligonucleotide primers used for site-directed mutagenesis and cloning. The restriction sites used are underlined and the appropriate restriction enzymes are named. The mutated nucleotides for mutagenesis are the smallest final code and the coding for the nucleotide triplet is marked in the bold type. The positions are the binding of the primers (nucleotide number) and the numbering of the amino acids are according to the published sequence of strain P2 (Mundt and Müller, 1995, supra, NCBI accession numbers X 84034).

Construction of full-length cDNA clone of segment B Strain d78 For cloning of full-length cDNAs from segment B of strain D78 of serotype I, the virus was propagated in CEF and purified by ultracentrifugation. The genomic viral RNA of strain D78 was purified, reverse transcribed into cDNA, and amplified by the polymerase chain reaction (PCR) followed by normal procedures using the oligonucleotides as described in (Mundt and Vakharia, 1996) . The amplification product was cloned with the blunt tip and the plasmids containing the appropriate PCR fragments were sequenced. The cloning procedure to obtain a plasmid containing the full-length cDNA of segment B (pUC18BD78) under the control of the T7 RNA polymerase promoter corresponding to the procedure described by Mundt and Vakharia (1996, supra) for segment B of layer P2 (Figure 3). Strain UK661 Three pairs of oligonucleotides derived from the sequence information in Brown and Skinner (1996, supra) were used: i) UK661BFor1 (sequence according to oligonucleotide B5'-P2, Mundt and Vakharia, 1996, supra), UK661BRev1 oriented of contradiction (nucleotide No. 708-736). The 5 'end of the oligonucleotide UK661BRev1 additionally contains the sequence of segment B of the strain UK-661 of the divided site of restriction enzyme Xba I which does not contain the sequence 5'-CTCTAGAGG. lii) UK661BFor3 (nucleotide No. 2011-2035), UK661BRev3 oriented to the contrary (Mundt and Müller, 1995, supra, nucleotide No. 2804-2827). The 5 'end of the oligonucleotide UK661BRev3 which additionally contains the sequence segment B of the strain UK-661 of the divided sites of the restriction enzyme Xba I which does not contain does not contain the sequence 5'-TCTAGAGCCC. There is the CCC triplet created in the divided site Sma I together with at least three nucleotides of the viral genomic sequence of segment B (nucleotide number 2825-2827). Using these three parts of oligonucleotides UK661BFor1; UK661BRev1, UK661BFor2; UK661BRev2, and UK661BFor3; UK661BRev3 during RT-PCR of the three cDNA fragments were amplified and cloned with the blunt tip in the pUC18 vector divided from Sma I to obtain pUK661B1, pUK661B2; and PUK661B3, respectively. After sequencing the three inserted fragments pUK661B2 was divided with Age I and Xba I to obtain the 1441 bp fragment which was subsequently ligated into pUK661B1 divided with Age IXba I to obtain pUK661B12. For the construction of the full-length cDNA clone of segment B pUK661B3 was pUK661B12 divided with Bst I / Xba I. The resulting plasmid pB661 containing the full-length cDNA sequence of segment B of strain UK661 under control of the T7 promoter. pB661 is described in Figure 5 (numbering is according to the sequence of strain P2 in Mundt and Müller, 1995, supra). Recovery of the cRNA virus in tissue cultures For the in vitro transcription of the PD78A /? NB RNA plasmids, pD78A /? NB-QH, pD78A /? NB-TA, pD78A /? NB-RS, PD78A /? NB- HQ-TA-RS, pD78A /? NB-E / del, pD78A /? NB-E / Del-QH, pD78A /? NB-E / Del-AT, pD78A /? NB-E / Del-SR, pD78A / ? NB-E / Del-QH-AT, pD78A /? NB-E / Del-AT-SR, pD78A /? NB-E / Del-QH-SR, pD78A /? NB-E / Del-QH-AT- SR and pD78B were linearized by dividing with SsrGI or Pst I. In addition, the linearized DNA treatment and transcription were carried out as described by Mundt and Vakharia (1996), with two exceptions: i) the transcript mixtures were not purified with phenol / chloroform, and i) the QM-7 cells were used for the transfection experiments. Two days after transfection of cells they were frozen / melted, centrifuged at 700 x g to remove cellular debris, and the resulting supernatants were clarified by filtration through 0.45 μm filters and stored at -70 ° C. For immunofluorescence studies, QM-7 cells were grown on sterile cover slip. For in vitro transcription of the RNA plasmids containing segment A of UK661 (Figure 5), they were linearized by dividing with ßsrGI. Segment B of strain D78 was linearized with Pst I while segment B of strain UK661 was linearized with Sma I. In addition, the linearized DNA treatment and transcription were carried out as described above. Detection of IBDV antigen The IBDV antigen was detected by indirect immunofluorescence (All) and Western blots using rabbit anti-IBDV antiserum. For the growth of CEF by All on the cover sheaths were incubated with the supernatants of transfected QM-7, CEF and CAM, respectively, used to pass. After an incubation time of 16 hours CEF was acetone fixed and processed by All. For the examination of IBDV replication after transfection of the QM-7 cells developed on the cover slip, they were incubated for 24 hours or 48 hours, fixed acetone and processed for All. Results Transgenic experiments with intergenic cRNA For the transfection experiments of a full-length cDNA clone of segment a of strain D78 (pD78A /? NB) and the intergeneric segment A of pD78A /? NB-E / Del was transcribed in the synthetic cRNA was co-transfected with the B segment (pD78B) of the full-length cRNA in the QM-7 cells, as well as the CEF in parallel. Two days after the transfection cells were frozen / melted and the resulting supernatants were passed twice over CEF. The CEF was incubated up to five days after infection in each step. After freezing / melting each transfection supernatant as well as each step of each transfection were tested for the IBDV antigen by All using CEF. The transfection experiments were repeated three times. The virus was generated after transfection of a cDNA of plasmid pD78B in combination with pD78A /? NB leading to the generation of strain D78r. In contrast, after transfection experiments using cDNA of pD78A /? NB-E / Del and pD78B without tissue culture of virus infections could be isolated. In order to analyze the transfection followed by the replication, the transfection was carried out using QM-7 cells develop on cover sheaths. Given that in both cases the virus antigen was detected 24 hours after transfection using All. Therefore, it is provided that the viral replication present in both cases but only in the case of D78r was it possible to generate the tissue culture that affects IBDV. Transfection experiments with mutated cRNA Based on the results of sequence comparison a number of different mutated full-length DNA clones were established by site-directed mutagenesis. (i) IBDV of the E-Variant The mutated plasmids of pD78A /? NB-E / Del were generated containing aa substitutions at positions 253, 284 and 330 in the seven possible combinations (Table 5). The transfection and step experiments were carried out in three stages in parallel with CEF and the QM-7 cells. The supernatants obtained were analyzed for the infectivity of All. After transfection of the plasmids of pD78A /? NB-E / Del, pD78A /? NB-E / Del-QH, pD78A /? NB-E / Del-AT, pD78A /? NB-E / Del-SR , pD78A /? NB-E / Del-AT-SR, and pD78A /? NB-E / Del-QH-SR in combination with pD78B cRNA, QM-7 or CEF cells that infect viruses that may not be isolated . Transfection of cRNA obtained from pD78A /? NB-E / Del-QH-AT or pD78A /? NB-E / Del-QH-AT-SR leads to the generation of infectious viruses (D78A-E / Del-QH-AT and D78A-E / Del-QH-AT-SR). The specificity was confirmed by HA on CEF as well as the QM-7 cells. This indicated that VP2 of IBDV plays a critical role in the infection of tissue cultures. The aa (BU) Q-253-H- (TC) and (BU) A-284-T (TC) substitutions were necessary and sufficient to generate IBDV infections for adapted tissue cultures. The IBDV mutant having three aa substitutions (CEF of D78 / Adapted-E variant) was used for the additional examination (Example 2). (li) Classical D78 IBDV To confirm these results a second group of plasmids were constructed using pD78A /? NB for site-directed mutagenesis to obtain plasmids with a single aa substitution (pD78A /? NB-HQ, pD78A /? NB- TA, pD78A /? NB-RS) or of the three aa (pD78A /? NB-HQ-TA-RS). These four plasmids were used for the transfection experiments in combination with pD78B as described above. Infectious IBDV could be generated after transfection of the pD78A /? NB-RS cRNA as detected by All. Again, aa 330 have no influence on the capacity of the virus generated to infect the tissue culture. All constructs were tested for replication after transfection for All. The IBDV antigen could detect specificity 24 hours and 48 hours after transfection, showing widely stained extensively large aggregates within the cytoplasm. UK661 For the transfection experiments of the full-length cDNA clone of the chimeric segments A pD78A-E-661, pD78A-E-661-DN-AT, pD78A-E-661-QH, pD78A-E-661 -AT and pD78A-E-661-QH-AT were transcribed into the synthetic cRNA and co-transfected with segment b of strain D78 or segment B of strain UK661 of full-length cRNA in QM-7 cells as well as in CEC in parallel. Two days after transfection the cells were frozen / melted and the resulting supernatants were passed once on CEC. CEC was incubated 24 or 48 hours after infection, fixed and processed for immunofluorescence. CEC virus infections were generated after transfection of plasmid cRNA pD78A-E-661-QH-AT in combination with pD78B and pB661 leading to the chimeric IBDV D78A-E-661-QH-AT. In contrast, after the transfection experiments using pD78A-E-661 cRNA, pD78A-E-661-DN-AT, pD78A-E-661-QH, pD78A-E-661-AT in combination with pBD78 cRNA or pB661 without tissue culture that infects the virus that could be isolated. Incubation of transfection of the supernatant 72 hours after the infection of single infected CEF was detected in the case of D78-E-661-DN-AT. (iii) GLS IBDV To confirm the results of the transfection experiments using intergeneric as well as mutated plasmids took advantage of a naturally occurring pair of IBDV strains. The variable VP2 region of the bursa derived from the GLS strain (GLS-B) and the adapted tissue culture of the GLS-TC variant was amplified. It was cloned and analyzed. Comparison of the amino acid sequences of the two GLS strains obtained from pGLS-B and pGLS-TC, respectively, revealed an amino acid exchange at position 284 [(GLS-B) A- »T (GLS-TC)] between both sequences (Figure 1B). Aa 253 (Q) and 330 (S) were identical in aa of the BU group as described above. To analyze whether the exchange at position 284 (A- >; T) were sufficient for the generation of infectious viruses of two plasmids (pD78A /? NB-E / Del-GLS-TC and pD78A /? NB-E / Del-GLS-B) containing the hypervariable region of VP2 of both GLS variants were built. The cRNA of pD78A /? NB-E / Del-GLS-TC and pD78A /? NB-E / Del-GLS-B, respectively, were transfected in parallel in combination with pD78B cRNA in QM7 cells as well as CEF. After passage of the supernatants the infectious virus from the tissue culture can be detected by All as well as CEF after transfection of pD78A /? NB-E / Del-GLS-TC cRNA. In several transfection attempts of cDNA of pD78A /? NB-E / Del-GLS-B fail in the production of supernatant containing infectious tissue culture IBDV. The in vitro transcription / translation of both plasmids pD78A /? NB-E / Del-GLS-TC and pD78A /? NB-E / Del-GLSB show complete processing of the polyproteins. After transfection of cRNA from both plasmids together with the viral antigen cRNA from pD78B was detected by All. Therefore both chimeras provided for the replication component. Taken together with the exchange of the hypervariable region of VP2 leading to the exchange of aa single at position 284 was sufficient to generate infectious intergeneric IBDV.

N) N > ? or cn ÜI Table 5. Summary of the full length cDNA intergenic clones of the IBDV A segment of the continuation of the amino acid substitutions Plasmid3 aab253 aa-284 aa-330 Tissue culture Transfection0 Passage pD78A /? ANB-E / Del QAS + - pD78A /? ANB-E / Del-QH HAS + - pD78A /? ANB-E / Del-AT QTS + - pD78A /? ANB-E / Del-SR QAR + - pD78A /? ANB-E / Del-QH-AT HTS + + 3 Plasmids are based on the full-length cDNA clone of segment a of the tissue culture adapted to serotype I of the strain D78 The sequences of the bursa derived from the strain GLS-BU of serotype I, Delaware E (E / Del) and culture of tissue adapted to the strain GLS-TC of serotype I was replaced with sequences D78. b The numbering of amino acids (aa) according to the published sequence of strain P2 (Mundt and Müller, 1995, supra, NCBI accession number X 84034). Naturally according to the amino acids they are of the cursive type and the changed amino acids are marked in bold type. c Chick embryo cells (CEF) as well as QM-7 cells were used for transfection experiments. The IBDV antigen was detected by direct immunofluorescence using rabbit anti-IBDV serum (Mundt et al., 1995) 24 hours after transfection, positive antigen (+), negative antigen (-) d The CEFs were used to pass the supernatants from transfection The IBDV antigen was detected by indirect immunofluorescence using rabbit anti-IBDV serum (Mundt et al., 1995; Supra) after psar in the CEF. Positive antigen (+), negative antigen (-) Example 2 Biological properties of IBDV mutant of E-variant adapted to CEF Materials and Methods Preparation of chimeric IBDV D78 vaccines / E-variant (adapted bursa). SPF eggs 9-12 days old were infected with chimeric D78 / Variant-E / D78 (D78 / Variant-E / D78 without 3 amino acid exchanges to Q253H, A284T and S330R) via the membrane drip route Allantoica de Corion (CAM for its acronym in English). Five days after CAM infection and the embryos were cultured and homogenized. The homogenate was crushed on CAM. The supernatants were diluted to result in a vaccine dose of 102 0 EID50 / animal for application via the eye drop route. Chimeric D78 / Variant-E (adapted CEF). Fibroblast cells from primary chicken embryos (CEF) were prepared at a final concentration of 2 x 106 / ml. The cells were cultured in Eagle's minimal essential medium containing 5% fetal calf serum. 15 ml of this cellular suspension was added 0.1 ml of IBDV (D78 / Variant-E / D78 on 3 amino acid exchanges in Q253H, A284T, and S330R) the virus was dissolved in 1 ml. After incubation for 3-6 days in a high humidity incubator at 37 ° C, the supernatant was diluted to result in a 1053 or 1035 dose of TCID50 / animal vaccine for the eye drops application routes in the intramuscular injection, respectively.

Nobilis strain D78 of the commercially available classical IBDV vaccine. The vaccine was diluted to result in a vaccine dose of 103 3 TCID50 / animal for the routes of application of the eye drop route. Identification of IBDV vaccines by means of a panel test The IBDV strain was identified by ELISA using different monoclonal antibodies according to Van Loon et al. (Van Loon, A. A. W.M. D. Lüttichen and D.B. Snyder). Rapid quantification of the exchange of infectious bursal disease (IBD), field or vaccines of virus strains. The international symposium on infectious bursal disease and infectious chicken anemia, Rauischhilzhausen, Germany, 179-187, 1994). Growth in CEF Strains of IBDV were used for infected CEF. The induction of CPE (cytopathic effect) for IBDV was examined microscopically over a period of 6 days. Vaccination The effect of the different vaccines was evaluated by measuring the exchange resistance obtained from the administration of exchange virus (virulent IBDV strain of Variant-E), 14 days after vaccination. The chimeric vaccine D78 / Variant-E (adapted bursa), 10"of EID50 / Variant-E (adapted CEF), 10 5 ° .5 ° or 10, 3.5 TCID50 / animals was applied via the route of eye drops or via intramuscular injection at 2 weeks of age, The commercially available classical vaccine of the strain Nobilis D78 (Intervet International BV, the Netherlands), 1033 of TCID50 / animal was applied via the route of eye drops at 2 weeks of age The presence of IBDV in the Fabricius bursa and the microscopic lesions in the bursa of 5 animals per group were investigated, 3, 7, 10 and 13 days after the vaccination and 3 days after the exchange.The protection against the challenge was determined Results Identification of IBDV vaccines by means of of panel tests As observed in Table 6, D78 / Chimeric variant-E (adapted to the bursa) and D78 / chimeric variant-E (adapted CEF) have an identical reaction pattern with different MCA. 3 amino acid changes have no influence on the epitopes present on the virus as determined by different MCA. The classical commercial vaccine has a different reaction pattern with different MCA.

Table 6. Panel pattern of different IBDV viruses with different MCA. + epitope present on the virus, - epitope not present on the virus.

Development on CEF As can be seen in Table 7, Chimeric D78 / Variant E (bursa) is not capable of developing on CEF. The chimeric D78 / E-variant (CEF) and the Nobilis strain of the classical commercial vaccine D78 are both capable of replicating on the CPE by inducing a CPE.

Table 7. Growth capacity on CEF and inducing specific IBDV CEF. + = does not induce CPE over CEF; - = is not the cause of CPE on CEF.

Average microscopic lesion nucleus in bursa 3, 7, 10 and 3 days after the vaccination and 3 and 10 days after the exchange. The results are described in Table 8. As can be seen from Table 3, the chimeric strain D78 / Variant-E (adapted bursa without CEF is virulent and induces complete lymphocytic suppression, about 7 days after vaccination In contrast, the strain D78 / Variant-E (CEF) adapted to the tissue culture does not induce lesions after vaccination.The commercial vaccine induces mild to moderate lesions after vaccination.The individual data show that animals vaccinated with chimeric D78 / E-variant (bursa) or D78 were protected against exchange Animals vaccinated with D78 / E-variant via ocular or intramuscular route also results in protection 3 days after exchange, although less induced by the virulent stem strain.

Table 8. Average bursal injury nucleus (oc) = ocular path; (im) = intramuscular route; C = chronic injuries; A = acute injuries LIST OF SEQUENCES < 110 > AKZO Nobel N.V. < 120 > "Mutants of infectious bursal disease virus (IBDV) adapted to genetically treated cell culture" < 130 > 99463 < 150 > 99200647.8 < 151 > 1999-03-05 < 160 > 9 < 170 > Patentln Ver. 2.1 < 210 > 1 < 211 > 25 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 1 gatcagctcg aagttgctca ccca 25 < 210 > 2 < 211 > 24 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 2 caagcctcag cgttgggga gagc 24 < 210 > 3 < 211 > 99 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 3 gggcgccacc atctacctta taggctttga tgggactgcg gtaatcacca gagctgtggc 60 cgcaaacaat gggctgacga ccggcatcga caatcctta 99 < 210 > 4 < 211 > 31 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 4 gagagctcgt gtttcaaaca agcgtccaag g 31 < 210 > 5 < 211 > 22 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 5 cgtcctagta ggggaagggg te 22 < 210 > 6 < 211 > 31 < 212 > DNA < 213 > vviirruuss of infectious bursal disease < 440 > 6 gagagctcgt gttcaaaaagcgtccata g 31 < 210 > 7 < 211 > 56 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 7 cggagggccc ctggatagtt gccaccatgg atcgtcactg ctaggctccc acttgc 56 < 210 > 8 < 211 > 100 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 8 cgtaggcta tagtgtgacg ggacggaggg ctcctggata gttgccacca tggatcgtca 60 ctgctaggc cccccgtgcc gaccatgaca tctgttcccc 100 < 210 > 9 < 211 > 100 < 212 > DNA < 213 > infectious bursal disease virus < 440 > 9 gggcgccacc atctacctca taggctttga tgggacaacg gtaatcacca gggctgtgggc 60 cgcaaacaat gggctgacgg ccggcaccga caaccttatg 100

Claims (10)

1. CLAIMS 1. A method for the preparation of an infectious IBDV mutant replication layer in the CEF cell culture comprising the steps of: (i) separately preparing a DNA construct comprising cDNA from the genome segments A and B of an IBDV that is not capable of replicating in the CEF cell culture, (ii) introducing a mutation in: to one or more codons of the amino acid residues 253 and 284 of the VP2 gene of Alternative E or the strains of
2. Classical IBDVs, or in b_ a codon of the amino acid residue 284 of the VP2 gene of a GLS IBDV strain, on the DNA comprising segment A, such that the codons for amino acid residues 253 and 284 of the VP2 gene are mutated , encode a histidine and a threonine residue, respectively, in the case of an E-variant or the classical IBDV strain, or so that the codon of the amino acid residue 284 of the mutated VP2 gene encodes a threonine residue in the case of a GLS IBDV strain (iii) allow transcripts of the cDNA RNA comprising segment A and segment B to initiate replication of the IBDV mutant in host cells in a culture medium, and (iv) Isolate the IBDV mutant from the culture. A method according to claim 1, characterized in that the IBDV mutant is adapted to the CEF cell culture comprising a serine, arginine or lysine, preferably arginine, preferably an amino acid residue at position 330 of the VP2 protein.
3. 3. A method according to claim 1 or 2, characterized in that the mutation is introduced into codons 253, 284 and 330 of the VP2 gene of a Classic IBDV or of the E-Variant.
4. 4. A method according to claim 3, characterized in that the mutations are introduced into codons 253 (Gln), 284 (Ala) and 330 (Ser).
5. 5. A method according to claims 1-4, characterized in that the RNA transcripts were prepared from the cDNA comprising segment A and segment B, followed by the host cells transfected with the synthetic RNA transcripts.
6. 6. A method according to claims 1-5, characterized in that the method comprises the additional steps for the preparation of chimeric IBDV.
7. 7. The infectious IBDV mutant genetically treated capable of replicating in the CEF cell culture, comprising the codons of amino acids 253 (His) and 284 (Thr), and optionally 330 (Arg) in the VP2 gene of IBDV Classic or of the E-Alternative, or a codon for amino acid 284 (Thr) in the VP2 gene of a GLS IBDV.
8. 8. The infectious IBDV mutant, genetically treated according to claim 7, characterized in that it is a chimeric IBDV mutant.
9. 9. The infectious IBDV mutant, genetically treated according to claim 8, characterized in that the mutant is D78 / Variant-E (adapted for CEF). A vaccine for use in the protection of poultry against disease resulting from IBDV infection, comprising a genetically-treated IBDV mutant as prepared according to any of the preceding claims, together with a carrier or diluent pharmaceutically acceptable.