MXPA00001591A - Neisseria lactoferrin binding protein - Google Patents

Abstract

LbpB polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing LbpB polypeptides and polynucleotides in the design of protocols for the treatment of neisserial disease, among others, and diagnostic assays for such conditions.

Description

UNION PROTEIN OF LACTOFERRINA DE NEISERIA FIELD OF THE INVENTION This invention relates to newly identified polynucleotides, polypeptides encoded by them and to the use of such polynucleotides and polypeptides, and to their production. More particularly, the polynucleotides and polypeptides of the present invention refer to the family of outer membrane protein of neiseria (PME), and in particular to lactoferrin B binding protein (LbpB, for its acronym in English). In addition, the invention relates to the therapeutic use of LbpB such as for vaccination against neiseria disease. BACKGROUND OF THE INVENTION Meningitis is of both bacterial and viral origin, the bacterial form is largely the most severe. The mainly responsible bacteria are Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae. Given that the release of the conjugate vaccine against H. influenzae type B (Hib), and its integration into routine vaccination of infants, N. meningitidis is being considered as the main cause worldwide, they have been calculated 2,600 cases per year in the US alone. The species of N. meningitidis is subdivided into 13 serogroups according to the composition of the capsular polysaccharides. In addition, each serogroup is sub-classified into serotypes, subtypes, and immunotypes on the basis of other components of the bacterium. Three serogroups (A, B, and C) make up more than 90% of cases of meningitis, and in developing, industrial nations, serogroup B is responsible for 50 to 80% of cases. Effective vaccines based on capsular polysaccharides exist to prevent meningitis caused by serogroups A and C of N. meningitidis. The serogroup C polysaccharide vaccines do not produce a protective effect in children under 2 years of age (the age scale where there is the highest risk of developing meningitis), however, this problem can be overcome by conjugating these polysaccharides with a carrier protein. The conjugation has the additional advantage of inducing an immunological memory against the antigen. In contrast, the serogroup polysaccharide of N. meningitidis displays little or no immunogenicity in men, regardless of whether or not it is a conjugated form. Therefore, it would be highly convenient to obtain a vaccine against neiseria disease induced by N. meningitidis (in particular of serogroup B) different from a polysaccharide-based vaccine. A promising class of vaccine candidates are those that use the outer membrane proteins (PME) of N. meningitidis, because they can provide antigens that are immunogenic and accessible to the human immune response. The PMEs responsible for the uptake of iron in the cells are particularly promising.

Iron is an essential nutrient for most bacteria. In the extracellular compartments of the human body, iron is complex mainly for transferrin in serum and for lactoferrin on mucosal surfaces (Finkelstein et al., 1983), with negligible amounts in the free form. Therefore, the efficient acquisition of iron is an important factor of virulence for pathogenic bacteria. With respect to N. meningitidis in particular (a strict human pathogen), their iron requirements are met using receptors for iron chelation proteins in humans, such as transferrin or lactoferrin, which allows the cell to bind these proteins and then absorb the iron necessary for its growth. The synthesis of these receptor proteins is induced when the bacteria capture the iron limitation. The receptor proteins involved in the transferrin iron uptake, TbpA and TbpB (Cornelissen et al., 1992; Legrain et al., 1993; Anderson et al., 1994) and the lactoferrin A binding protein (LbpA) (Pettersson et al. , 1993; 1994b; Biswas and Sparling, 1995) have been cloned and sequenced. The transferrin binding receptor proteins form a complex in the outer membrane. In N. meningitidis, both TbpA and TbpB seem to be necessary to transport the iron (Irwin et al.). TbpA is an integral membrane protein, since TbpB is a lipoprotein and is attached to the membrane only with its lipid portion. The current model for the proposed receptor mechanism that binds iron-loaded transferrin to the receptor complex. In this complex, the TbpB protein discriminates between ferrified transferrin and apo-transferrin. Transferrin binding results in conformational change in the receptor, which releases iron from transferrin and opens a slotted pore in TbpA, and iron can be transported through the outer membrane (Cornelissen and Sparling, 1994; nineteen ninety six). It is also thought that the lactoferrin receptor is an important virulence factor of N. meningitidis. The main entry site in the human body is the nasopharynx, where lactoferrin is the main source of iron. In addition, preliminary reports show that lactoferrin is able to cross the blood-brain barrier in acute inflammation (Gschwentner et al., 1997). It is possible that lactoferrin is also an important source of iron for meningococci at a later stage of infection, when the bacteria have reached the meninges. Using an affinity isolation procedure, a single lactoferrin binding protein was originally identified (Schyvers and Morris, 1998). The structural gene of this receptor, designated TbpA, has been characterized (Pettersson et al., 1993; 1994b; Biswas and Sparling, 1995) and a topology model for the protein in the outer membrane has been proposed (Pettersson et al., 1994a). . The protein shows homology to TbpA. In addition, part of an open reading frame possible upstream of the LbpA gene was identified, and the deduced amino acid sequence showed homology to TbpB (Petterson et al., 1994a). TbpB and other purified eningococal PME have been the subject of prior patent applications with respect to their use as a vaccine against N. meningitidis (eg TbpB, WO 9307172, 22 kDa surface protein, WO 9629412, hemoglobin receptor , WO 9612020, porin protein, WO 9503413, pilin proteins, WO 9408013, 64 kDa PME, EP 474313-B1). There is a need to identify and characterize additional members of the PME family which may play a role in the prevention, improvement or correction of dysfunctions or diseases, including, but not limited to, neisseria disease (eg, meningitis). . It has not been observed that antibodies against LbpA are bactericidal and, therefore, may have limited use as a vaccine candidate (Pettersson et al., 1993). This invention identifies and characterizes another lactoferrin binding receptor protein, lactoferrin B binding protein (LbpB), its role in the use of lactoferrin iron, and its therapeutic uses. There are several advantages that LbpB has over other PME vaccine candidates. Mainly, in the lactoferrin blood emergence stage of humans in meningococcal disease, it is essential for the organism to have an affinity greater than 300 times to bind iron than human transferrin, and therefore, the use of lactoferrin as a source of iron is essential for the organism. Second, lactoferrin has a known antibacterial effect, and its concentration in the blood increases with infection. It is also therefore important for the body to bind human lactoferrin as a way to put some resistance to this effect. And finally, human lactoferrin is the main source of iron for N. meningitidis at the site of the bacterium's entrance into the human body (the nasopharynx). The importance of these advantages is that the LbpB antigens would probably tend to be expressed in the same way on the cell surface in the vast majority of meningococci in the body, that the cell surface domain of LbpB would probably be fairly conserved since it binds effectively lactoferrin, and that an immune response directed against the LbpB antigen can not only stop any meningococcal infection in the blood, but can also stop the transport of the organism in the nasopharynx. SUMMARY OF THE INVENTION In one aspect, the invention relates to LbpB polypeptides and recombinant materials and methods for their production. Another aspect of the invention relates to methods for using such LbpB polypeptides and polynucleotides. Such uses include the prevention and treatment of neiseria disease (for example, meningitis), among others. In still another aspect, the invention relates to diagnostic analysis to detect diseases associated with the presence of LbpB.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1. Analysis of Western blot of proteins of all cells developed under iron limitations. Lines 1 and 5, strain BNCV; lines 2 and 6, Ibpk mutant CE1452; lines 3 and 7, IbpB mutant CE1454; lines 4 and 8, IbpAB mutant CE 1402. The antiserum used was directed against synthetic peptides, based on the IbpB sequence. Lines 1 to 4, serum 17-3 against peptide C1. Lines 5 through 8, serum 19-1 against peptide E1. The normal molecular size positions are indicated on the right in thousands of the. The IbpB protein is marked with an arrow on the left. Fig. 2. Restriction map of the DNA fragments containing the IbpB and IbpA genes of the BNCV strain. The inserts in the different recombinant plasmids and the PCR product (RCP) are shown as open cells. Plasmids pAM23 and pAM1 contain fragments of the IbpBA site that were previously characterized (Pettersson et al., 1993, 1994a). Open reading frames are marked with highlighted arrows. The probes, used to screen the bank or Southern blot analysis, are shown above from the open reading frames. The positions of the primers used for the PCR amplifications are shown below the open reading frames. The insertion site of the kanamycin resistance box in pAM6K is shown by means of an open triangle. The erythromycin resistance box in pAM23E is shown by a closed triangle.

Fig. 3. IbpB protein alignment of strain BNCV and TbpB of strain B16B6. Identical amino acids are marked by dotted lines. The numbers on the right indicate the amino acid positions. Free spaces (-) were introduced to carry out the optimal alignment. Peptides used to immunize mice are indicated before the IbpB sequence. Two extensions, rich in negatively charged residues, are underlined. The putative signal peptidase II cleavage site is shown with an arrow above the sequence. Fig. 4. The sequence upstream of the promotion area of / £ »pB. The translation initiation site (ATG) is marked in bold. The ribosome binding site, and the putative cells 10 and 35 are underlined (thick lines and thin lines respectively), the putative Fur box is boxed. Fig. 5. Analysis of Western spots of proteins of all the cells developed in the medium of TSB (lines 1,3,5 and 7) or in TSB with EDDA (lines 2,4,6, and 8) The antibodies used were monoclonal mn98k1 and mn98k2 directed against IbpA (Panel A) or antiserum 17-3 against peptide IbpB C1 (Panel B), lines 1 and 2, strain BNCV; lines 3 and 4, IbpA mutant CE1452; lines 5 and 6, IbpB mutant CE1454; lines 7 and 8, IbpAB mutant CE1402. Fig. 6. A. Western blot analysis of outer membrane proteins of the meningococcal BNCV strain developed under iron limitation. The outer membrane proteins were electrophoresed under non-denaturing conditions and the IbpB protein was detected with the serum directed against the synthetic A1 peptide. Lines 1 and 2 show samples incubated at 0 ° C and 95 ° C, respectively prior to electrophoresis. Normal molecular size positions are indicated to the right in thousands of them. B. The analysis of lactoferrin binding on a Western blot with proteins from outer membrane complexes of the meningococcal BNCV strain developed under iron limitation. The proteins of the outer membrane complexes were electrophoresed under non-denaturing conditions and the stain was incubated with human lactoferrin coupled to peroxidase. Lines 1 to 3 show samples incubated at 0 ° C, 37 ° C, and 95 ° C, respectively, before electrophoresis. The normal positions of the molecular size are indicated to the right in thousands. Fig. 7. The binding of lactoferrin to Ibp mutants in ELISA-type analysis of whole cells. The strains, indicated on the right, were coated in the wells. Lactoferrin was added in concentrations of 200, 100, 50, 25, 12.5, 6.25, 3.125, and 0 ng / ml (rows 1-8 respectively). The binding of lactoferrin to the cells was detected with antiserum specific for lactoferrin conjugated with peroxidase. Fig. 8. Feeding analysis in plates of strains with recombinant human lactoferrin. Only the relevant part of the plate is shown. The cells of the strains indicated on the right were seeded in plaques on the plates restricted with iron. Stimulation of growth by lactoferrin drops at the indicated concentrations was monitored after development overnight. The arrows show the position of the drops in Panel B. In this experiment, 11% lactoferrin saturated with iron was used. Fig. 9. Alignment of the IbpB proteins of the meningococcal strains. The alignment was made with the CLUSTAL program (Gen PC, IntelliGenetics), and manually optimized. The numbers to the right indicate the amino acid positions. The free spaces (-) were introduced to carry out the optimal alignment. The positions where the five sequences are identical are marked with *. Fig. 10. A. Restriction maps of the relevant parts of pJP29 (Bosch et al., 1986), pAM31 and pAM32. Only the inserts are shown. The vector is pACYC184. pJP29 contains the phoE gene (in light gray) behind its own promoter. The promoter and the flanking sequences are blank. The Psfl site is at the boundary of the sequences corresponding to the signal sequence and the mature part of the PhoE protein. PAM31 contains, from left to right: the phoE promoter (blank), and a recombinant gene encoding the signal sequence of PhoE (light gray) and mature LbpB (black). The corresponding DNA fragments are also presented, the L-terminus of LbpA (dark gray), the C-terminus of PhoE (dark gray), and flanking sequences (white). pAM32 was constructed from pAm31 by inserting a linker (striped box), which encodes a His tag and a Factor Xa separation site, into the Psfl site of pAM31. see example 8 for details about the construction of pAM31 and pAM32. The restriction sites on pAM32 are in brackets, because they are lost in the cloning process. B. The amino acid sequences of the recombinant LbpB constructs (below) as compared to the wild-type LbpB sequence (on top). Only the last and the first amino acid residue of signal sequences of LbpB / PhoE and mature LbpB respectively are shown. The His tag and the Factor Xa separation site is completely shown. Peptidase I and II leader (LPasel and II, respectively) and Factor Xa separation sites are shown by arrows. Fig. 11. PAGE of the purified recombinant LbpB protein. Lines 1 and 2 show samples incubated at 0 ° C and 100 ° C, respectively, before electrophoresis. The normal molecules weight positions are indicated to the right in kDa. Fig. 12. Western blot analysis with recombinant bent LbpB (lines 1,3, 5, 7, and 9) and denatured (lines 2,4,6,8, and 10) with five convalescent human sera. Lines 1 and 2, serum 69; lines 3 and 4, serum 262439; lines 5 and 6, serum 262532; lines 7 and 8, serum 263017, lines 9 and 10, serum 330. Normal molecular size positions are indicated on the right in kilodaltons. The arrows to the left indicate the positions of denatured LbpB (dLbpB) and duplicated LbpB (fLbpB).

Fig. 13. Anti-Complete Cell and anti-LbpB ELISA results (Table 7) performed as described in Example 10. A. The anti-LbpB response in immunized mice was carried out with PBS solution. B. The anti-whole cell response (strain BNCV developed under iron-deficient conditions) in mice immunized with either LbpB or whole cells of the BNCV strain of? /. meningitidis. An immunization control was carried out with PBS solution. C. The anti-whole cell response (strain H44 / 76 developed under iron-deficient conditions) in mice immunized with either LbpB or whole cells of the BNCV strain of N. meningitidis. An immunization control was carried out with PBS solution. Fig. 14. Results of bacterial activities (Table 8) of anti-whole cell LbpB sera and anti BNCV strain were carried out as described in Example 10. A. Bactericidal titre against N H44 / 76 strain .meningitidis (developed in iron-rich conditions). B. The bactericidal titer against strain H44 / 76 of N. meningitidis (developed under depleted iron conditions). DESCRIPTION OF THE INVENTION Definitions The following definitions are provided to facilitate the understanding of certain terms frequently used herein.

"LbpB" generally refers to a polypeptide, preferably a lipoprotein, having the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, or 10, or an allelic variant thereof. "LbpB activity or LbpB polypeptide activity" or "biological activity of LbpB or LbpB polypeptide" refers to a physiological metabolic function of said LbpB that includes similar activities. Specifically, the activity of LbpB is the ability to bind lactoferrin to humans. This LbpB activity can be tested using the method described in Example 6. Also included in this definition are the antigenic and immunogenic activities of said LbpB. This antigenicity can best be tested using the spot immunoassay method described in Example 9, preferably using polyclonal serum against LbpB of meningococcal BNCV strain as described in Example 10A. Immunogenicity can best be tested by measuring antibody responses (using serum generated against the variant) in ELISA using purified LbpB from the meningococcal BNCV strain, as described in Example 10B. The "IbpB gene" refers to a polynucleotide having the nucleotide sequence 100-2274 shown in SEQ ID NO: 1, or the complete nucleotide sequence shown in SEQ ID NO: 3, 5, 7, or 9, or allelic variants of it and / or its complements. "Antibodies" as used herein, include polyclonal and monoclonal, chimeric, single chain antibodies, and humanized antibodies, as well as Fab fragments, which include the products of a Fab or other immunoglobulin expression bank. "Isolated" means altered "by the hand of man" of the natural state. If an "isolated" composition or substance is present in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide present in nature in a living animal is not "isolated", but the same polynucleotide or polypeptide separated from coexisting materials from its natural state is "isolated", as the term is used in the I presented. "Polynucleotide" generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation, single and double stranded DNA, DNA which is a mixture of single and double stranded regions, single and double stranded RNA, and RNA which is a mixture of single stranded regions. thread and double thread, hybrid molecules comprising DNA and RNA that can be single-stranded or, more usually, two-stranded or a mixture of single and double-stranded regions. In addition, "polynucleotide" refers to regions of three strands comprising RNA and DNA or both RNA and DNA. The term polynucleotide also includes DNA and RNA containing one or more modified bases and DNA and RNA with base structure modified for stability or for other reasons. "Modified" bases include, for example, titrated bases and unusual bases such as inosine. A variety of modifications have been made to DNA and RNA; thus, "polynucleotides" encompasses chemically, enzymatically or metabolically modified forms of polynucleotides as usually found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotides" also encompasses relatively short polynucleotides, often referred to as oligonucleotides. "Polypeptide" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., isoesters of peptides. "Polypeptides" refers to short chains, commonly referred to as peptides, oligopeptides or oligomers, and to long chains, generally referred to as proteins. The polypeptides may contain amino acids other than the encoded amino acids of 20 genes. "Polypeptides" include amino acid sequences modified by any of the natural processes, such as the post-translational process, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as a voluminous research literature. Modifications can occur in any part of a polypeptide, including the structure of the base of a peptide, the amino acid side chains and the carboxyl or amino termini. It will be appreciated that the same type of modification may be present to the same degree or a different one at several sites in a given polypeptide. Also a given polypeptide can contain many types of modifications. The polypeptides can be branched as a result of ubiquitination, and these can be cyclic, with or without branching. The cyclic, branched and branched cyclic polypeptides may result from natural post-translational processes or may be by synthetic methods. Modifications include acetylation, acylation, ADP ribosylation, amidation, covalent binding of flavin, covalent attachment of the heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of lipids or lipid derivative, covalent binding of phosphotidylinositol, ligation, cyclization, bisulfide binding formation, demethylation, covalent binding formation, cysteine formation, pyroglutamate formation, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic process, phosphorylation, prenylation, racemization, selenoylation, sulfation, RNA-mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for example, PROTEINS-STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T.E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, p. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed, Academic Press, New York, 1983; Seifter et al., "Analysis by protein modification and nonprotein cofactors", Meth Enzymol (1990) 182: 626-646 and Rattan et al., "Protein Synthesis: posttranslational Modifications and Anging", Ann NY Acad Sci (1992) 663: 48- 62"Variant" as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains the essential biological properties. A usual variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polypeptide. The nucleotide changes can result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A usual variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, the differences are limited in such a way that the sequences of the reference polypeptide and the variant are closely similar in total and, in many identical regions. A reference variant and polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide can be one that is present in nature such as an allelic variant (eg, SEQ ID NO: 3, 5, 7, or 9 are IbpB polynucleotide variants of SEQ ID NO: 1; and SEQ ID NO: 4, 6, 8, or 10 are variants of the IbpB polypeptides of SEQ ID NO: 2), or this may be a variant that is not known to occur naturally. The variants present in the nature of polynucleotides and polypeptides can be created by mutagenesis techniques or by direct synthesis. The variants should retain one or more of the biological activities of the LbpB polypeptide. They should be able to bind human lactoferrin (preferably as described in the test for this activity in Example 6), or have similar antigenic or immunogenic activities as LbpB. The antigenicity can best be tested using the spot immunoassay method described in Example 9, preferably using polyclonal serum against LbpB of meningococcal BNCV strain as described in Example 10A. Immunogenicity can best be tested by measuring antibody responses (using polyclonal sera generated against the variant) in ELISA using purified LbpB from the meningococcal BNCV strain, as described in Example 10B. Preferably, a variant may retain all of the above biological activities. "Identity" is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned in such a way that equalization is obtained in the highest order. "Identity" by itself, has a meaning of recognition of technique and can be calculated using published techniques. See v.gr .: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, AM, ed, Oxford University Press, New York, 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, DW, ed, Academic Press, New York, 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, AM, and Griffin, HG, eds, Human Press, New Jersey, 1994, SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heijne, G., Academic Press, 1987, and SEQUENCE ANALYSIS PRIMER, Gribskov, M and Devereux, J., eds., M Stockton Press, New York, 1991). While there are a number of methods for measuring the identity between two polynucleotide sequences or polypeptides, the term "identity" is well known to technical experts (Carrillo, H., and Lipton, D., SIAM J Applied Math (1988) 48: 1073). Methods commonly employed to determine the identity or similarity between two sequences include, but are not limited to, those described in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carrillo, H. , and Lipton, D., SIAM J Applied Math (1988) 48: 1073. Methods to determine identity and similarity are encoded in computer programs. Preferred computer program methods for determining the identity and similarity between two sequences include, but are not limited to, the GCS program package (Devereux, J, et al., Nucleics Acids Research (1984) 12 (1): 387) , BLASTP, BLASTN, FASTA (Atschul, SF et al., J. Molec Biol. (1990) 215: 403). As an illustration, for a polynucleotide having a nucleotide sequence having at least, for example, 95% "identity" to a nucleotide sequence of the reference of SEQ ID NO: 1, it is intended that the nucleotide sequence of the The polynucleotide is identical to the reference sequence except that the polynucleotide sequence can include, on average, up to five mutant sites per 100 nucleotides of the nucleotide sequence of the SEQ ID NO: 1 reference. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, above 5% of the nucleotides in the reference sequence, they can be deleted or substituted with another nucleotide , or a number of nucleotides above 5% of the total nucleotides in the reference sequence can be inserted into the reference sequence. Mutations of the reference sequence can occur occur at the 5 'or 3' end positions of the reference nucleotide sequence or anywhere between these terminal positions, intercalated individually between the nucleotides in the nucleotide sequence or in one or more contiguous groups within the reference sequence. Similarly, by a polypeptide having an amino acid sequence having at least, for example, 95% "identity" to a reference amino acid sequence of SEQ ID NO: 2, it is intended that the amino acid sequence of the The polypeptide is identical to the reference sequence except that the polypeptide sequence may include an average of above five amino acid alterations per 100 amino acids of the reference amino acid of SEQ ID NO: 2. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to the sequence of the reference amino acid, up to 5% of the amino acid residues in the reference sequence can be deleted or replaced with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence can be inserted into the reference sequence. These alterations of the reference sequence can occur at the amino or carboxy terminal positions of the reference amino acid sequence or on either side between these terminal positions, interspersed individually between residues in the reference sequence or in one or more contiguous groups within the reference sequence. Polypeptides of the Invention In one aspect, the present invention relates to LbpB polypeptides (or LbpB proteins). The LbpB polypeptides include the polypeptides of SEQ ID NO: 2, 4, 6, 8, or 10 (residues 1-18 is the natural signal peptide of each of the proteins, and the residue Cis 19 is the amino acid of N- terminal which is formed with lipids in the natural mature protein); as well as polypeptides comprising the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, or 10; and polypeptides comprising the amino acid sequence which has at least 65% identity for SEQ ID NO: 2, 4, 6, 8 or 10 over its entire length, and even more preferably at least 70% identity, and even more preferably at least 80% identity, and even more preferably at least 90% identity to SEQ ID NO: 2, 4, 6, 8 or 10. In addition, those with 95-99% are highly preferred. Also included within LbpB polypeptides are polypeptides having the amino acid sequence which has at least 65% identity to the polypeptide having the amino acid sequence of SEQ ID NO: 2, 4, 6, 8 or 10 over all its length, and even more preferably at least 70% identity, and even more preferably at least 80% identity, and even more preferably at least 90% identity to SEQ ID NO: 2, 4, 6, 8 or 10. In addition, those with at least 95-99% are highly preferred. The LbpB polypeptides provided in SEQ ID NO: 2, 4, 6, 8, or 10 are the LbpB polypeptides of the BNCV strain of Neisseria meningitidis, M981, H44 / 76, M990, and 881607, respectively. The LbpB polypeptides can be in the protein form "mature" or it can be a part of a long protein such as a fusion protein. It may be advantageous to include an additional amino acid sequence which contains secretory or leader sequences (such as the native LbpB leader sequence, residues 1-18 in SEQ ID NO: 2, 4, 6, 8, or 10), per-sequences, sequences which aid purification such as multiple histidine residues, or an additional sequence for stability during recombinant production. Fragments of LbpB polypeptides are also included in the invention. A fragment is a polypeptide having an amino acid sequence that is completely the same as part, but not all, of the amino acid sequence of the LbpB polypeptides mentioned above. As with the LbpB polypeptides, the fragments can be "free" or be comprised within a longer polypeptide of which they form a part or region, more preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments of about a number of amino acids 1-20, 21-40, 41-60, 61-80, 81-100, and 101 through the end of the LbpB polypeptide. In this context "around" includes recited scales particularly longer or smaller or several, 5, 4, 3, 2 or 1 amino acid at either end or at both ends. Preferred fragments include, for example, truncation polypeptides having the amino acid sequence of LbpB polypeptides, except for the deletion of a continuous series of residues that include the amino terminus, or a continuous series of residues that includes the carboxyl terminus. and / or transmembrane region or deletion of two continuous series of residues, one that includes the amino terminus and one that includes the carboxyl terminus. Also preferred are fragments characterized by structural or functional attributes such as fragments comprising alpha helix and alpha helix formation regions, beta sheet and beta sheet formation regions, turning and spinning regions, cycle regions and cycle formation, hydrophilic regions, hydrophobic regions, alpha antipatic regions, beta antipatic regions, flexible regions, surface formation regions, substrate binding region, and regions of high antigenic index. Other preferred fragments are biologically active fragments. The biologically active fragments are those that mediate the activity of LbpB, which include those with similar activity or an improved activity, or with decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal, especially in a human being. The fragments should retain one or more of the biological activities of the LbpB polypeptide. Preferably, fragments of the polypeptide should be coupled continuously (over 16 amino acids) of amino acid sequence derived from SEQ ID NO: 2, 4, 6, 8, or 10 having an antigenic or immunogenic biological activity that also has the full length of LbpB polypeptide from which it was derived. The variants of the defined sequence and fragments are also part of the present invention. Preferred variants are those that vary from the referents for conservative amino acid substitutions, that is, those that substitute one residue with another of similar characteristics. Such usual substitutions are between Ala, Val, Leu e Me; between Ser and Thr; between acid residues Asp and Glu; between Asn and Gln; and between the basic waste Lis and Arg; or aromatic residues Phe and Thr. Particularly preferred are variants in which several 5-10, 1-5, or 1-2 amino acids are substituted, deleted or added in any combination. The most preferred variants are those that vary from the referents for amino acid substitutions that are in structurally equivalent positions (as shown by a homology alignment) in other LbpB sequences (eg, homology alignment of 5 LbpB sequences shown in Fig. 9). Especially preferred variants comprising the amino acid sequence which has at least 65% identity to that of the reference sequence (for example SEQ ID NO: 2, 4, 6, 8, or 10) over its entire length, and even more preferably at least 70% identity, and even more preferably at least 80% identity, and even more preferably at least 90% identity . In addition, those with at least 95-99% are highly preferred, For example, in Figure 9 if LbpB of BNCV is the reference sequence, a variant could splice residues 300-308 that are replaced with any of the residues in the equivalent positions in the LbpB sequences of strain H44 / 76 (residues 305-313 respectively), strain M990 (residues 307-315 respectively), strain M981 (residues 302-310 respectively), or strain 881607 (residues 303-311 respectively). The amino acid sequence NPDLAKSHA could therefore be replaced by STDVATNLA [ST (from m981 residues 302-303), D (from BNCV residue 302), V (from 881607 residue 306), A (from M990 residue 311), T (from H44 / 76 residue 310), NLA (of M990 residues 313-315)] and the resulting protein can classify a variant, and a polypeptide of the invention. Such substitutions may also include deletions, for example, if residues 357-366 of LbpB from strain M981 is deleted (as there are no amino acid positions equivalent to LbpB of strain BNCV- see Figure 9) such a protein may constitute a variant, and a polypeptide of the invention. In addition, it is well known that the genomes of Neisseria meningitidis and other neiseria strains (eg, Neisseria gonorrhoeae) are genomically very homologous to each other. The genomes of Neisseria meningitidis and Moraxella catarrhalis (initially called Neisseria catarrhalis) are also sufficiently homologous to allow gene exchange to take place. Equivalent proteins LbpB (or allelic variants of LbpB) of neiseria strains and strains of Moxarella catarrhalis also constitute polypeptides of the invention if they comply with the% identity sequence criterion described above, and still further, such equivalent proteins would also constitute polypeptides of the invention if they preferably share at least 65% sequence similarity with one of the reference sequences (SEQ ID NO: 2, 4, 6, 8, or 10) over their entire length as measured by the program BLAST (Altschul, SF et al. (1997) Nucleic Acids Res., 25: 3389-3402; Karlin, S. and Altschul, SF (1990) Proc. Natl. Acad. Sci, USA 87: 2264-68; Karlin, S and Altschul, SF (1993) Proc. Nati, Acad. Sci USA 90: 5873-7), and more preferably at least 70% similarity, and even more preferably at least 80% similarity, and even more preferably at least minus 90% In addition, those with at least 95-99% are highly preferred. Such proteins should bind human lactoferrin (by definition), and should also be able to react through with polyclonal serum against LbpB from meningococcal strains. The precise amino acid sequences of such variants can easily be determined using information from meningococcal polynucleotide sequences and polypeptide of SEQ ID NO: 1-10. The LbpB polypeptides of the invention can be prepared in any suitable manner. Such polypeptides include lipopolypeptides present in nature, produced recombinantly polypeptides or lipopolypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art. Polynucleotides of the Invention Another aspect of the invention relates to polynucleotides LbpB.

The LbpB polynucleotides include isolated polynucleotides which encode the LbpB polypeptides and fragments, and polypeptides closely related thereto. More specifically, the LbpB polynucleotide of the invention includes a polynucleotide comprising the nucleotide sequence contained in SEQ ID NO: 1.3.5.7, or 9 encoding the LbpB polypeptide of SEQ ID NO: 2. 4.6.8, or 10 respectively, and polynucleotide having the particular sequence of SEQ ID NO: 1,3,5,7, or 9. The LbpB polynucleotides further include a polynucleotide comprising a nucleotide sequence that is at least 65 % identity over its entire length to a nucleotide sequence encoding the LbpB polypeptide of SEQ ID NO: 2,4,6,8, or 10, and a polynucleotide comprising a nucleotide sequence that is at least 65 % identical to that of SEQ ID NO: 1 from nucleotide 100 to nucleotide 2274, and a polynucleotide comprising a nucleotide sequence that is at least 65% identical to that of SEQ ID NO: 3.5.7, or 9. In this regard, at least 70% identical polynucleotides are more preferred, at least 80% identical polynucleotides are particularly preferred, and those with at least 90% are especially preferred. In addition those with at least 95% are highly preferred in those with at least 98-99% are even more highly preferred, with at least 99% being most preferred. Also included under polynucleotides LbpB are a nucleotide sequence which has sufficient identity to a nucleotide sequence contained in SEQ ID NO: 1,3,5,7, or to hybridize under conditions useful for amplification or for use with a test or brand. This invention also provides polynucleotides which are complementary to such LbpB polynucleotides.

The LbpB polynucleotides provided in SEQ ID NO: 1,3,5,7, and 9 are the LbpB polynucleotides of BNCV strains of Neisseria meningitidis, M981, H44 / 76, M990, and 881607 respectively. The nucleotide sequence encoding the polypeptide of LbpB of SEQ ID NO: 2, 4, 6, 8, or 10 can be identical to the polypeptide encoding the sequence contained in SEQ ID NO: 3.5.7, or 9 respectively, or it can be a sequence, which as a result of the redundancy (degeneracy) of the genetic code, it also encodes the polypeptide of SEQ ID NO: 2, 4, 6, 8 or 10. When the polynucleotides of the invention are used for the recombinant production of the LbpB polypeptide, the polynucleotide may include the coding sequence for the mature polypeptide (residue 19 at the C-terminus of SEQ ID NO: 2, 4, 6, 8, or 10) or a fragment thereof, per se; the coding sequence for the mature polypeptide of the fragment in the reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a sequence of pre-, or pro- or prepro-proteins, or other portions of the fusion peptide (eg residues 1 to 18 of SEQ ID NO: 2, the natural signal sequence of LbpB). For example, a tag sequence with purification facilities of the fused polypeptide can be encoded. In certain preferred embodiments of this aspect of the invention, the labeling sequence is a hexa-histidine peptide, as provided in the POE vector (Qiagen, Inc.) and described in Gentz et al., Proc Natl Acad Sci USA ( 1989) 86: 821-824, or is an HA tag, or is glutathione-s-transferase. Also preferred is LbpB fused is its natural signal sequence (residues 1 to 18 of SEQ ID NO: 2). The polynucleotide may also contain non-encoded 5 'and 3' sequences, such as transcribed, non-translated sequences, cleavage and polyadenylation signals, ribosome binding sites and sequences that stabilize the mRNA. Additional preferred embodiments are polynucleotides that encode closely described LbpB polypeptide variants. More preferably these comprise the amino acid sequence of the LbpB polypeptide of SEQ ID NO: 2, 4, 6, 8, or 10 in which several, 10-25, 5-10, 5-10, 1-5, 1- 3, 1-2 or 1 amino acid residue are substituted, deleted or added, in any combination, and these retain at least one of the biological activities of the LbpB polypeptide. The present invention further relates to polynucleotides that hybridize to the sequences described hereinabove. In this aspect, the present invention especially relates to polynucleotides which hybridize under stringent conditions to the polynucleotides described hereinbefore. As used herein, the term "stringent conditions" means that hybridization will occur only if there is at least 80%, and preferably at least 90%, and more preferably at least 95%, still more preferably 97-99. % identity between the sequences. The polynucleotides of the invention, which are identical or sufficiently identical to a nucleotide sequence contained in SEQ ID NO: 1,3,5,7, or 9 or a fragment thereof, can be used as hybridization tests by cDNA and DNA genomic, to isolate full-length cDNA and genomic clones encoding LbpB polypeptide and to isolate cDNA and genomic clones from other genes 8 that include genes encoding homologs and orthologs from different species of Neisseria meningitidis) that have high sequence similarity to the LbpB gene. Such hybridization techniques are known to those skilled in the art. Usually these nucleotide sequences are 80% identical, preferably 90% identical, more preferably 95% identical to the referents. The tests will generally comprise at least 15 nucleotides. Preferably, such tests will have at least 30 nucleotides and can have at least 50 nucleotides. Particularly preferred tests vary between 30 and 50 nucleotides. In a modality, to obtain a polynucleotide encoding the LbpB polypeptide, which includes homologs and orthologs of different species of Neisseria meningitidis, comprises the steps of screening an appropriate library under stringent hybridization conditions with a labeled probe having a nucleotide sequence contained in SEQ. ID NO: 1, 3, 5, 7, or 9 or a fragment thereof; and that isolates the entire length of cDNA and genomic clones containing said polynucleotide sequence. Therefore, in another aspect, the LbpB polynucleotides of the present invention further include a nucleotide sequence comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence having a nucleotide sequence contained in SEQ ID NO: 1 , 3,5,7, or 9 or a fragment thereof. Also included with the LbpB polypeptides are polypeptides comprising amino acid sequences encoded by nucleotide sequences obtained by the above hybridization conditions. Such hybridization techniques are well known to those skilled in the art. The conditions of stringent hybridization are as defined above or, alternatively, conditions under incubation overnight at 42 ° C in a solution comprising: 50% formamide, 5xSSC (150mM NaCl, 15mM trisodium citrate), 50mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 micrograms / ml denatured, cut salmon sperm DNA, followed by washing strains in 0.1x SSC at about 65 ° C. The polynucleotides and polypeptides of the present invention can be used as research reagents and materials to discover treatments and diagnostics for diseases of animals and humans. Vectors, Host Cells, Expression The present invention also relates to vectors which comprise a polynucleotide or polynucleotides of the present invention, and host cells which are genetically treated with vectors of the invention and for the production of polypeptides of the invention by techniques recombinants. Free cell translation systems can also be used to produce such proteins using RNAs derived from DNA constructs of the present invention. For recombinant production, the host cells can be genetically treated to incorporate the expression systems or portions of the same polynucleotides of the present invention. The introduction of polynucleotides into host cells can be effected by methods described in many normal laboratory manuals, such as Davis et al., BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) such as calcium phosphate transfection, dextran-mediated transfection of DEAE, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scraping charge, introduction or ballistic infection. Representative examples of suitable hosts include bacterial cells, such as meningococci, streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as, yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells; and plant cells. A wide variety of expression systems can be used. Such systems include, among others, chromosomal, episomal and viral derived systems, eg, vectors derived from bacterial plasmids, bacteriophage, transposons, yeast episomes, insertion elements, yeast chromosomal elements, viruses such as baculovirus, papova virus, such as SV40, vaccinia virus, adenovirus, pox poultry virus, virus and seudorabies retrovirus, and vectors derived from combinations thereof, such as those derived from genetic elements of plasmids and bacteriophages, such as cosmids and phagemids. The expression systems may contain control regions that also regulate the expression of the breeder. Generally, any system or vector suitable to maintain, propagating or expressing polynucleotides to produce a polypeptide in a host can be used. The appropriate nucleotide sequence can be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those shown in Sambrook et al. MOLECULAR CLONING, A LABORATORY MANUAL (supra). For the secretion of the translated protein in the lumen of the endoplasmic reticulum, in the periplasmic space or in the extracellular environment, appropriate secretion signals can be incorporated into the desired peptide. These signals may be endogenous to the polypeptide (residues 1 to 18 of SEQ ID NO: 2, 4, 6, 8, or 10) or may be heterologous signals. To express lipidated recombinant LbpB, preferably the endogenous signal peptide is encoded in the gene construct, and the preferred host system would be a bacterial host. If the LbpB polypeptide is to be expressed for use in screening assays, it is generally preferred that the polypeptide be produced on the surface of the cell. In this case, the cells can be collected before use in the sieving analysis. If the LbpB polypeptide is secreted into the medium, the medium can be recovered in order to recover and purify the polypeptide; if it is produced intracellularly, the cells must first be dissolved in lysine before the polypeptide is recovered. LbpB polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography , hydroxylapatite chromatography and lecithin chromatography. More preferably, high performance liquid chromatography is used for purification. Well-known techniques for redoubling proteins can be employed to regenerate active conformation when the polypeptide is denatured during isolation and purification. Diagnostic Analysis This invention also relates to the use of LbpB, antibodies against LbpB, and phage display antibodies against LbpB for use as diagnostic reagents. The detection of LbpB will provide a diagnostic tool that can add to or define a diagnosis of sickness by neiseria, among others. The materials for diagnosis can be obtained from a subject cells, such as blood, urine, saliva, tissue biopsy. Therefore, in another aspect, the present invention relates to a diagnostic equipment or suspected disease, particularly neiseria disease, which comprises: (a) an LbpB polynucleotide, preferably the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, or 9, or a fragment thereof; (b) a nucleotide sequence complementary to that of (a); (c) a LbpB polypeptide, preferably the polypeptide of SEQ ID NO: 2, 4, 6, 8, or 10, or a fragment thereof; or (d) an antibody to a LbpB polypeptide, preferably to the polypeptide of SEQ ID NO: 2, 4, 6, 8 or 10 (and more preferably to residue 19 to the C terminus of the polypeptide of SEQ ID NO: 2, 4, 6, 8, or 10). (e) a phage displaying an antibody to a LbpB polypeptide, preferably to the polypeptide of SEQ ID NO: 2, 4, 6, 8, or 10 (and more preferably to residue 19 to the C terminus of the polypeptide of SEQ ID NO: 2, 4, 6, 8, or 10). It will be appreciated that in any such group, (a), (b), (c), (d) or (e) may comprise a substantial component. Antibodies The polypeptides of the invention or their fragments or analogs thereof, or cells expressing them can also be used as immunogens to produce antibodies immunospecific for the LbpB polypeptides. The term "nonspecific" means that the antibodies have substantially greater affinity for the polypeptides of the invention than their affinity to other related polypeptides in the prior art. The antibodies generated against the LbpB polypeptides can be obtained by administering the polypeptides or transport fragments of the epitope, analogs or cells to an animal, preferably a non-human, using routine protocols. For the preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. Y Milstein, C, Nature (1975) 256: 495-497), the Trioma Technique, the human B-cell hybridoma techniques (Kozbor et al., Immunology Today (1983). ) 4:72) and the EBV hybridoma technique (Colé et al., MONOCLONAL ANTIBODIES AND CANCER THERAPHY, pp. 77-96, Alan R. Liss, Inc., 1985).

Techniques for the production of single chain antibodies (U.S. Patent No. 4,946,778) can also be adapted to produce single chain antibodies for polypeptides of this invention. Also, transgenic mice, or other organisms that include other mammals, can be used to express humanized antibodies. The antibodies described above can be used to isolate or identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography. Antibodies to LbpB polypeptides can also be used to treat neiseria disease (eg, meningitis), among others. These can also be used to diagnose the disease. Vaccines Another aspect of the invention relates to a method for inducing an immune response in a mammal (preferably a human) which comprises inoculating the mammal with LbpB polypeptide or epitope transport fragments, analogs, vesicles or membrane cells external (attenuated in another way), suitable to produce the immune response to antibodies and / or immune T cell to protect said animal from neiseria disease, among others. Yet another aspect of the invention relates to a method for inducing immune response in a mammal (preferably a human being) which comprises delivering the LbpB polypeptide via a vector that directs the expression of the LbpB polynucleotide in vivo in order to induce such immune response to produce antibody to protect said animal from diseases. A further aspect of the invention relates to an immunological composition or vaccine formulation which, when introduced into a mammalian host (preferably a human being), induces an immunological response in this mammal to an LbpB polypeptide wherein the composition comprises an LbpB gene, or LbpB polypeptide or transport fragments of epitope, analogs, vesicles or outer membrane cells (attenuated in another way). The vaccine formulation may further comprise a suitable carrier. The LbpB vaccine composition is preferably administered orally or parenterally (including subcutaneous, intramuscular, intravenous, intradermal injection, etc.). Formulations suitable for parenteral administration include sterile aqueous and non-aqueous injection solutions which may contain antioxidants, pH regulators, bacteriostats and solutes which produce the isotonic formulation with the recipient's blood; and sterile and non-sterile aqueous suspensions which may include suspending agents or thickening agents. The formulations may be presented in multi-dose or multi-dose containers, for example, sealed ampoules and flasks and may be stored in dry, cool conditions requiring only the addition of the sterile liquid carrier immediately prior to use. The vaccine formulation may also include adjuvant systems for increasing the immunogenicity of the formulation, such as oil-in-water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be easily determined by means of routine experimentation. Yet another aspect relates to an immunological formulation / vaccine which comprises the polynucleotide of the invention. Such techniques are known in the art, see for example Wolff et al. Science (1990) 247: 1465-8. Screening Analysis The polypeptide of the present invention can be employed in a screening process for compounds which antagonize (antagonists, or otherwise called inhibitors) the LbpB polypeptide of the present invention. Therefore, the polypeptides of the invention can also be used to identify antagonists of, for example, cells, cell-free preparations, chemical banks, and mixtures of natural products. These antagonists can be natural or encoded substrates, ligands, receptors, enzymes, etc., as it may be the case, of the polypeptide of the present invention; or may be structural or functional mimetics of the polypeptide of the present invention. See Coligan et al., Current Protocols in Immunology 1 (2): Chapter 5 (1991). The polypeptides are responsible for many biological functions, including many pathologies. Accordingly, it is desirable to find compounds and drugs that can inhibit the function of the LbpB polypeptide. In general, antagonists can be used for a variety of therapeutic and prophylactic purposes for such conditions as neiseria disease. In general, such screening procedures may involve the use of appropriate cells which express the LbpB polypeptide or respond to the LbpB polypeptide of the present invention. Such cells include mammalian cells, yeast, Drosophila or E. coli. Cells expressing the LbpB polypeptide (or cell membranes containing the expressed polypeptide) or responding to LbpB polypeptide are then contacted with a test compound to observe binding, or inhibition of a functional response. The ability of the cells which are contacted with the candidate compounds are compared to the same cells which were not contacted for the activity of LbpB. Analyzes can simply join the test of a candidate compound wherein adhesion to the cells carrying the LbpB polypeptide is detected by means of a label directly or indirectly associated with the candidate compound or in an analysis involving competition with a competitor labeled. In addition, the analyzes may simply comprise the steps of mixing a candidate compound with a solution containing a LbpB polypeptide to form a mixture, measuring the activity of LbpB in the mixture, and comparing the LbpB activity of the mixture to a normal . In the antibodies and cDNA protein of LbpB to the protein can also be used to configure analyzes to detect the effect of aggregated compounds on the production of mRNA and protein in cells. For example, an ELISA can be constructed to measure the levels secreted or associated with the LbpB protein cell using monoclonal and polyclonal antibodies by means of standard methods in the art, and this can be used to discover agents which can inhibit the production of LbpB (also called antagonist) of cells or tissues properly manipulated. Examples of potential LbpB polypeptide antagonists include antibodies or, in some cases, oligonucleotides or proteins which are closely related to the ligands or substrates of the LbpB polypeptide, e.g., a fragment of the ligands or substrates.; or small molecules which bind to the polypeptide of the present invention but do not produce a response, such that the activity of the polypeptide is prevented. Therefore in another aspect, the present invention relates to screening kits for identifying antagonists, ligands, or substrates for LbpB, which comprises: (a) an LbpB polypeptide, preferably that of SEQ ID NO: 2.4, 6.8, or 10; (b) a recombinant cell expressing a LbpB polypeptide, preferably that of SEQ ID NO: 2,4,6,8, or 10; (c) a cell membrane that expresses a LbpB polypeptide; preferably that of SEQ ID NO: 2,4,6,8, or 10; or (d) antibody to a LbpB polypeptide, preferably that of SEQ ID NO: 2,4,6,8, or 10. It will be appreciated that in any combination, (a), (b), (c) or (d) ) may comprise a substantial component. Formulation and Administration Peptides, such as the soluble form of polypeptides LbpB, and antagonist peptides or small molecules, can be formulated in combination with a suitable pharmaceutical carrier. Such formulations comprise a therapeutically effective amount of the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, saline buffer, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation must adapt the mode of administration, and is within the experience of the technique. The invention further relates to pharmaceutical packages and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention. The polypeptides and other compounds of the present invention may be employed alone or together with other compounds, such as therapeutic compounds.

Preferred forms of administration of the pharmaceutical compositions include injection, usually by intravenous injection. Other injection lines may be used, such as subcutaneous, intramuscular, or intraperitoneal. Alternative means for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acids or other detergents. In addition, if properly formulated in enteric or encapsulated formulations, oral administration may also be possible. The administration of these compounds can also be topical and / or localized, in the form of ointments, pastes, gels and the like. The dosage scale required depends on the choice of peptide, the route of administration, the nature of the administration, the nature of the condition of the individual, and the judgment of the attending physician. The appropriate dosages, however, are in the range of 0.1-100 μg / kg of the individual. However, wide variations to the necessary dose are expected in view of the variety of compounds available and the difference efficiencies of several administration lines. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art.

Examples The following examples are carried out using standard techniques, which are well known and routine to those skilled in the art, except where it is described in detail in another way. The examples illustrate but do not limit the invention. Example 1: Bacterial strains and growth conditions. The bacterial strains used are listed in the Table. The meningococcus was grown overnight on GC agar plates (Difco), supplemented with Vitox (Oxoid) in a humidity of 5% CO2 atmosphere at 37 ° C. Optimal expression of iron-regulated protein was carried out by adding 5 μg / ml di-o-hydroxyphenylacetic acid to ethylenediamine iron chelators (ADED, Sigma). For the preparation of the samples for PAGE-SDS, spot immunoassay, and for the isolation of chromosomal DNA, the cells were grown as described previously (Pettersson et al., 1993). The strain of E. coli Y1090 (Young and Davis, 1983), which was used to propagate the phage? Gt11, grew in Luria Bertoldi (LB) medium supplemented with ampicillin (100 μg / ml), 0.2% maltose and 10 mM MgCl2. The strain DH5a, used for cloning, was developed in LB medium, supplemented with 100 μg / ml ampicillin, 25 μg / ml kanamycin, or 100 μg / ml erythromycin, when needed for the selection of recombinants. After transformation with pEMBL 19 derivatives, the cells were plated on LB plates supplemented with the appropriate antibiotic, and with 5-bromo-4-chloro-3-indonyl-β-D galactosidase (40 μg / ml), and 0.5 mM isopropyl-β-D-thiogalactopyranosidase for sieving of plasmids with inserts. The strain PC2494, used to prepare DNA from a single strand, was kept in plates of minimal medium, supplemented with 5 μg / ml of thiamin and 0.2% of glucose. Example 2: 2A: Preparation of mouse antiserum against peptides The peptides (Fig. 3) were synthesized using an automated multiple peptide synthesizer and coupled to tetanus toxoids (van der Ley et al., 1991). BALB / c mice were immunized with 50 μg of peptide and 20 μg of Quil A as an adjuvant. Two reinforcement injections were given. The serum was collected 54 days after the first injection. 2B: Identification of IbpB gene product To investigate whether the putative IbpB gene encodes a protein or not, the antiserum was rinsed against synthetic peptides (indicated as A1-E1 in Fig. 3) that were based on the amino acid sequence of the frame. partial open reading. The antiserum was tested in Western blot analysis against all cells of the BNCV strain developed under iron limitation. Serum against peptide B1 showed no reaction (daros not shown). The antiserum against other peptides that were reacted with a band of approximately 95 kD (Fig. 1). Since this band lacked the LbpB mutant (constructed as described below) (Fig. 1, lines 3 and 7), it was concluded that the LbpB gene is expressed in the non-cultured type strain, and that it encodes a protein with an apparent molecular weight (Mr) of 95,000. Some of the sera against the D1 and E1 peptides showed an additional reaction with a band with a Mr of 60,000 (Fig.1). Both of these peptides contain the sequence VVFGAK, which is also present in TbpB (Fig. 3). Therefore, the 68K band could be TbpB. To test this possibility, a mutant TbpB, N91, and its parental strain B16B6, was tested in Western blot analysis. Serum 19-1 (against peptide E1) were reacted with two bands of 95 K and 68 K respectively, in strain B16B6, but not only with the band 95 K in strain N91. This result indicates that the 68 K band really is TbpB (data not shown). Example 3: SDS-PAGE and spot immunoassay. SDS-PAGE of all cell proteins was performed as previously described (Pettersson et al., 1990, 1993). In the experiments where LbpB denaturing had to be avoided, the following modifications were included. The sample of the pH buffer did not contain β-mercaptoethanol. The outer membrane complexes were not heated to 95 ° C in the sample of buffer solutions before electrophoresis, but incubated on ice or at 37 ° C for 10 minutes. In the lactoferrin binding experiment, the polyacrylamide gel was composed of 5% (w / v) stacking gel and 8% (w / v) gel resolution containing 0.05% (w / v) SDS . The pH regulator electrode contained only 0.05% instead of 0.1% SDS. Electrophoresis was carried out at a constant voltage of 100 V for 2 hr. at 4 ° C. The normal pH buffer solution was used with 2% SDS. The electrophoresis of outer membrane proteins to detect bent forms of LbpB was performed with the PhastSystem (Pharmacia) according to the manufacturer's instructions, using 7.5% (w / v) of homogeneous polyacrylamide gels with SDS strips of buffer solution. pH. The spot immunoassay performed as previously described (Pettersson et al., 1990, 1993). In the case of PhastSystem gels, spot pH regulator contained 0.05% (w / v) SDS and peroxide activity was detected with ECL system according to the manufacturer's instructions (Amersham). The mouse antiserum was used in a solution of 1: 500. The monoclonal antibodies specific for LbpA mn98K1 and mn98K2 (Pettersson et al., 1993) were used as a mixture in a solution of 1: 200 each. Example 4: 4A: Cloning and sequencing strategies. The gene bank? Gt 11 of the BNCV strain originally provided by E.C. Gotschlich (The Rockefeller University, New York, E.U.A). The bank was propagated in E. coli strain Y1090 and screened with DNA tests BE1 and AP6 (Fig.2). BE1 was prepared by means of phage fragment isolation from 355 bp PIS plasmid Eli EcoRI (Pettersson et al., 1993). AP6 fuel fragment prepared from plasmid pAM6 of 417 bp EcoRI-EcoRV. Test labeling, plate blots, and detections performed as described (Pettersson et al., 1993), using the DIG DNA Labeling and Detection set (Boehringer Mannheim). The DNA ? it was isolated (Sambrook et al., 1989) and the inserts were subcloned into the phagemid pEMBL19. Plasmid DNA was isolated on mini columns of Jetstar (Genomado) as described by the manufacturer. Single-stranded DNA was propagated using phage-helper VCSM13 (Stratagene). Chromosomal DNA was isolated and described (Ausubel et al., 1989). The DNA was digested with Accl and Dral, and separated on a 1% agarose gel. Southern blot analysis was performed as described (Pettersson et al., 1993). The ES1 probe (Fig. 2) was prepared by isolating the pAM13 320 bp Eco RI-Sa / I fragment and labeled as above. The probe was reacted with a 1.5 kb fragment in the digested chromosomal DNA of Acc \ IDra on a Southern blot. The 1.5 kb fragments were isolated from the gel and ligated into pEMBL19. The ligation mixture was PCR amplified with the M13 universal primer (Pharmacia) and the LB11 primer (Table 2). The Goldstar polymerase, a Taq polymerase derivative (Eurogentec) was used for the PCR amplification according to the manufacturer's instructions. The 1.3 kb PCR product was purified with agarose gel.

DNA sequencing was performed manually using deaza G / A T7 sequencing mixtures (Pharmacia) or automatically using the Genetic Analyzer 310 ABI Prism (Perkin Elmer). For automatic sequencing, the marking was done with the sequencing set of Cycle Tape Terminator (Perkin Elmer). Internal primers (synthesized by Pharmacia or Gibco BRL) and universal and reverse M13 primers (Pharmacia) were used for the sequencing of single stranded DNA, double filament DNA plasmid or the PCR product. Similar strategies were used to sequence the LbpB gene of strains H44 / 76 and M981 of N. meningitidis. 4B: Cloning and sequencing of the LbpB gene To clone the missing part of the LbpB gene, a gene bank of gt11 of BNCV strain was screened with DNA tests. Two different lambda clones were found. The inserts were subcloned into pEMBL19, resulting in plasmids pAM6 and pAM13 (Fig. 2), and sequenced. The promoter and the principle of the LbpB gene was not found in this way. Several other attempts to clone the 5 'end of the gene failed, suggesting that its expression is toxic to E. Coli. To obtain the rest of the sequence, a rich bank was prepared from Accl- and Dral digested chromosomal DNA. Fragments of chromosomal DNA of approximately 1.5 kb were ligated into pEMBL19, and a PCR amplification was performed directly on the ligation mixture, using an initiator (LB11, see Fig. 2) based on the known part of the LbpB sequence and an initiator M13. The resulting PCR product (Fig. 2) was used directly for sequencing. This strategy avoids the cloning of the possibly toxic gene in E. coli. Sequencing of the various fragments revealed an open reading structure of 2.175 bp. It encodes a protein of 725 amino acid residues (Fig. 3) with a molecular mass of 79.4 kDa. Analysis of the N-terminal sequence revealed the characteristics of a signal sequence recognized by signal peptide II (von Heijne, 1989). Such signal sequences are present in the lipoprotein precursors, which acylate in the N-terminal cysteine residue of the mature protein. A similar signal sequence was found in the LbpB protein, which was proved to be actually modified by lipids (Anderson et al., 1994). The mature LbpB protein has a calculated molecular mass of 77.5 kDa, which is considerably lower than the molecular mass of 95 kDa observed in sodium dodecyl sulfate polyacrylamide electrophoresis (SDS-PAGE) (Fig. 1). Screening of the Swiss Prot database for similarities of other proteins revealed homology to TbpB of Neisseriae and Actinobacillus pleuropneumoniane. The largest homology, 33% identity (using the PALIGN program), was found in the TbpB of N. meningitidis of strain B16B6 (Legrain et al., 1993) (Fig. 3). In the TbpB protein, some internal repeats were found, and it has been proposed that the molecule has a two-lobed structure that develops after an internal duplication (Fuller et al., 1996, Renauld-Mongenie et al., 1996). When the D terminus of 354 amino acids of the mature LbpB protein was aligned with the C-terminus of 353 amino acids, 30% identity and 10% similarity were found (data not shown). This result suggests that also LbpB can exist in a two-lobed structure. The isoelectric point of the protein is 4.5. Two large extensions, rich in acid residues, could be discerned in the sequence (Fig. 3). Since these couplings lack LbpB, these could be important for the binding of lactoferrin, which is, in contrast to transferrin, a positively charged molecule. In the promoter area, a usual Shine-Dalgamo sequence could be discerned. In addition, putative cells 10 and 35 were found. (Fig. 4). A sequence reminiscent of a Fur binding site overlaps in box 10. Fur acts, along with Fe2 +, as a repressor of iron-regulated genes, joining a 19 bp sequence in the promoter region (Bagg and Neilands, 1987). The consensual sequence of such Fur box is GATAATGATAATCATTATC, and 16 of the 19 bp of this sequence are conserved in this element in the IbpB promoter. In addition upstream of the promoter, a direct repeat of 131 bp was found (data not shown). This sequence is present at least twice in this position. The same direct repeat was found under the current of the Ibpk gene (Prinz et al., Unpublished observation). A FASTA homology investigation revealed homology in this repeat to a number of neiseria sequences, most flanking open reading frames (Data not shown). The homology of the sequence between the LbpB proteins of BNCV and the M981 strains of N. meningitidis, and between the LbpB proteins of BNCV and strains H44 / 76 of N. meningitidis, is 72.7% and 78.5% respectively. Example 5: 5A: Construction of isogenic mutants. Plasmids pAM23 and pAM6 were used for the deactivation of insertion of IbpA and IbpB, respectively. The erythromycin resistance tape (Ermr) of pER2 (Jennings et al., 1993) was excised with C / al and Hind \\. The fragment was treated with T4 DNA polymerase and ligated to pAM23 digested with EcoRV, resulting in pAM23E.

The kanamycin (Kmr) resistance tape of pUC4K (Pharmacia) was excised with HindW. Plasmid pAM6 was linearized with bg / ll and treated with T4 DNA polymerase. The Km 'tape was ligated into this site, resulting in the pAM6K plasmid. An interleaver composed of oligonucleotides worm 1 and worm 2. (Table 2), which contains the neiseria uptake sequence (GCCGTCTGAA) and ends of a single thread compatible with Kpn \, was cloned at the site of Kpn \ of ppAM6K, resulting in pAM6K-nus plasmid. The antibiotic resistant genes were in the same directions as Ibpk and IbpB in the pAM23 and pAM6K (-ñus) plasmids, respectively. Plasmid pAM23, linearized with knp \ was used to transform strain H44 / 76 as previously described (van der Ley and Poolman, 1992). The transformants were selected on GC plates containing 5 μg of erythromycin per ml. The replacement of the correct gene in one of the transformants, designated CE1449, was verified by PCR, using FW5 and DVAS2 primers (Table 2), and by Southern blot analysis using AP23 test (Fig. 2, isolated as the pAM23 fragment). 184 bp Sspll-H ind 111). By analyzing Southern blots, the chromosomal DNA was digested with Clal and Sali. Isogenic mutants in strains of BNCV were prepared by electroporation (Genco et al., 1991) since this strain appears not to be transformable. The chromosomal DNA of the IbpA mutant CE1449 was used to form the IbpA mutant. Transformants were selected on GC plates with erythromycin and verified as mentioned above. Plasmid pAM6K-nus was used to form the IbpB mutant. Transformants were selected on GC plates containing 100 μg / ml kanamycin. Correct replacement of genes was validated by means of PCR, using SDA1 and PR1 primers (Table 1), and by Southern blot analysis using the AP23 probe. 5B: Construction of Isogenic Mutants To verify the identity of the 94 kDa protein and to investigate the role of individual lactoferrin proteins in the binding and use of lactoferrin, a set of isogenic BNCV derivatives lacking IbpA or IbpB was constructed as described in Example 5A. Correct gene replacements were verified in PCR reactions and by Southern blot analysis (data not shown). The expression of Ibpk and IbpB in the mutants was checked in Western blot analysis (Fig. 5). The Ibpk mutant CE1452 did not express LbpA (Fig. 5A, line 4), and the IbpB mutant CE1454 did not express the 94 kDa protein (Fig. 5B, line 6). This result confirms that the IbpB gene is actually expressed in the uncultivated type strain, and that it encodes a protein with a Mr of 94,000, which is considerably greater than its calculated molecular mass of 77.5 kDa. In addition, the results of Fig. 4 show that inactivation of IbpB does not have a polar effect on LbpA expression (Fig. 5A, line 6). This was anticipated, since the kanamycin resistance tape that was inserted into IbpB does not contain a transcriptional terminator. The mutant LbpA spontaneous CE1402 previously described (Pettersson et al. 1994b), appeared to lack expression of LbpB as well (Fig. 5B, line 8). Since both of these mutants and BNCV are derived from the M986 strain, their genetic background is the same as the other mutants. The expression of both LbpA and LbpB appeared to be regulated by iron (Fig. 5). A weak expression of LbpA was observed in strain CE1454 even though the cells were developed with an iron chelator (Fig. 5A, line 5). This expression is most likely due to the transcription of the promoter of the kanamycin resistance gene in IbpB. However, also in this case, the expression of LbpA was increased several times when the strain was developed in the presence of an iron chelator (Fig. 5A, line 6). Example 6: 6A: Lactoferrin binding assay Lactoferrin binding to all cells was assessed in an ELISA-type assay. Recombinant human lactoferrin, produced in Aspergillus avamori, was kindly provided by Agennix Inc., Houston, Texas, E.U.A. Lactoferrin was saturated with iron as described (van Berkel et al., 1995) with the following modifications. FeCl3 was used in place of Fe (NO3) 3, and dialysis was done against pH buffer Na2HPO / NaH2PO45mM, pH 7.7 for 4 h. The plate colonies were suspended in Tris pH regulating saline, pH 7.5 (TBS) and killed by heating for 30 min at 56 ° C. Samples (100 μl) with an optical density of 620 nm of 0.05 were dispensed into the wells of a microtiter plate. The samples were allowed to dry overnight at 37 ° C. The analysis was carried out at 37 ° C. The non-specific binding is difficult with 100 μl of blocking solution containing 0.5% Protifar (Nutricia) and 0.1% Tween 20 in TBS for 1 h. After blocking, the wells were filled with various concentrations of lactoferrin in blocking solution. The concentration of lactoferrin in the wells ranged from 3,125 to 200 ng / ml. After incubation for 1 h, and three washes with tap water, a rabbit polyclonal antiserum coupled with peroxide against human lactoferrin (ICN Biomedicals) was added to the wells. The antibody was used in a 1: 5000 solution in blocking buffer. After incubation for 1 h and three washes with tap water, the amount of peroxidase was detected (Abdillahi and Poolman, 1987). The binding of lactoferrin in a spot analysis was performed as follows. Non-specific binding was blocked by incubating the membrane in Na2HPO4 / 0.2 M NaH2PO pH buffer, pH 5.7 containing 0.1% Tween-20 and 0.5% Profitar (Nutricia) for 2 h. The stain was incubated with 1.2 μgml "1 of human lactoferrin conjugated with peroxidase (Pettersson and others 1993) in blocking pH buffer for 1 h and washed three times with blocking buffer.The activity of the peroxidase was detected with the ECL system according to the manufacturer's instructions (Amersham) 6B: Plate feeding analysis The meningococcus grew overnight in TSB supplemented with Vitox, as described in Example 1. From overnight culture , 300 μl were suspended in 3 ml of upper agar (1% CG agar with 20 μg ADED per ml, cooled at 42 ° C) and immediately seeded on GC agar plates with Vitox and 20 μg ADED per ml. (10 μl) of recombinant human lactoferrin (11% saturated iron, or saturated as described above) was stung on the plates.The concentration of lactoferrin in the drops was 10 and 20 mg / ml, respectively. the night 6C: A Ion of lactoferrin to LbpB duplicated in spots.

To investigate whether lactoferrin can bind to LbpB on the spots, SDS-PAGE conditions were sought under which LbpB is not denatured (see Example 6A). When the samples were not heated in the sample pH buffer prior to electrophoresis, a more rapid form of migration of the LbpB protein, probably the duplicated form of the native protein, could be detected (Fig. 6A). This form had a Mr of approximately 80kDa. After heating for 10 min at 95 ° C, the LbpB protein was completely denatured and migrated to the 94 kDa position (Fig. 6A, lane 2). Interestingly, only serum against peptide A1 (Fig. 2) was reacted with the fastest form of migration of the protein. This peptide contains one of two traps, rich in negatively charged amino acids and possibly involved in lactoferrin binding. The binding of antibodies to the protein suggests that this part of the protein is exposed, since all the other epitope peptides are hidden in the bent structure of LbpB. The binding of lactoferrin to the duplicated LbpB protein was assessed substantially. The outer membrane proteins of the BNCV strain were graphed for a nitrocellulose membrane, and incubated with human lactoferrin coupled to the peroxidase. The specificity of the lactoferrin binding appeared to be extremely sensitive to the incubation conditions, most importantly, the pH. Under the optimized conditions, lactoferrin specifically bound to a protein band with a Mr of 80kDa (Fig. 6B, lines 1 and 2). No binding was observed when the samples were heated for 10 minutes at 95 ° C before SDS-PAGE (Fig. 6B, line 3). The band was not detected in samples of LbpB mutants CE1454 (data not shown). Therefore, it was concluded that the fastest migration form of the LbpB protein, probably representing the duplicated form of the protein, is capable of binding lactoferrin. 6D: Lactoferrin binding and use of whole cells The binding of lactoferrin to whole cells was investigated in an ELISA-type analysis. The ELISA plates were coated with whole cells of the BNCV strain of the isogenic mutants, and lactoferrin, at various concentrations, was added to the wells. The binding of lactoferrin to the cells was tested with a peroxidase conjugated antibody against human lactoferrin (Fig. 7). The LbpB mutant was slightly reduced in its ability to bind to lactoferrin. The LbpA mutant linked lactoferrin less effectively than the mutant LbpB, since the duplicated mutant virtually did not completely bind lactoferrin (Fig. 7). The ability to use lactoferrin as a single source of iron was investigated in the plaque feed analysis. Meningococci were developed under iron limitation on the plates. Drops of recombinant human lactoferrin were seeded onto the plates, and growth stimulation monitored. The IbpB mutant was able to grow on lactoferrin. The same experiment was performed with lactoferrin loaded with iron essentially with the same results (data not shown). These data demonstrate that the LbpA protein is necessary for the uptake of iron via lactoferrin, since it is not observed that LbpB is essential. Example 7: To study the capacity of variation of the meningococal LbpB protein, the LbpB genes of four additional strains were sequenced: H44 / 76, M990, M981, 881607 (see Table 1). 7A: LbpB sequencing of four additional meningococcal strains - Methods. The bacteria were cultured in the same manner as described in Example 1. The chromosomal DNA was isolated from the bacteria grown on the plates. After growth during the night. The bacterium was scraped off the plates and suspended in 1.5 ml 10 mM Tris-HCl, 10 mM EDTA, pH 8 and 10 μl of lysozyme (10 mg / ml) were added. The suspension was incubated for 15 min at room temperature, before adding 1.5 ml of 2% Triton X-100, 50 mM Tris-HCl, 10 mM EDTA, pH 8. After 15 min of incubation, 10 μl of proteinase was added. K (10 mg / ml). The tubes were incubated for 30 min at room temperature. The mixture was extracted once with phenol, chloroform, isoamyl alcohol (mixed in a ratio of 24: 24: 1), and once with chloroform saturated with water. The chromosomal DNA was precipitated with ethanol. Chromosomal DNA was used to amplify the PCR of the LbpB genes. Initiators LB20 and REV2 (Table 3) were used on strains H44 / 76, M990, and 881607. Initiators LB20 and LB23 were used on strain M981. The primers are based on the LbpB sequence of the BNCV strain. LB20 binds upstream of the LbpB gene, and LB23 and REV2 at the beginning of the gene / £ »pA. LB23 has an extra BamHI site at the 5 'end. The Goldstar polymerase, a Taq polymerase derivative (Eurogentec) was used for PCR amplifications according to the manufacturer's instructions. The annealing temperature was in all cases 50 ° C, and 30 cycles were performed. The PCR products were purified from agarose gels, using β-agarose (New England Biolabs) according to the manufacturer's instructions. DNA sequencing was carried out by means of a gene pathway using primers designated for the IbpB genes. The primers were synthesized by Gibco BRL. The sequencing was done automatically using the ABI Prism 310 gene analyzer (Perkin-Elmer). The marking was done with the Colorant Finisher Cycle Sequencing Team (Perkin-Elmer). The TRANSL computer programs, PALIGN and CLUSTAL from the PC Gene Software package 6.70 (IntelliGenetics) were used to translate the nucleotide sequence into the amino acid sequence, by aligning sequence pairs and by multiple alignment, respectively. 7B: IbpB sequencing of four additional meningococcal strains - Results The nucleotide sequencing of IbpB genes from four strains is shown in SEQ ID NO: 3, 5, 7, or 9. The nucleotide sequences were translated into amino acid sequences and an alignment of five known sequences of the LbpB proteins is presented in Fig. 9. At the amino acid level, the identity between the LbpB proteins of the different strains was 70-80%. A comparison of identity pairs is summarized in Table 4. Example 8: The level of expression of LbpB in Neisseria meningitidis is very low; the protein could not be detected could not be detected when external membrane patterns were analyzed for SDS-PAGE. For immunological and structural / functional studies of the LbpB protein, a construct was formed for the expression of the protein in Escherichia coli. To facilitate the purification of the recombinant protein, the protein encoded by the construct contained a His tag, and lipid modification of the N-terminus was avoided by replacing the native signal sequence and the first two amino acid residues of the mature domain. 8A: Expression of recombinant LbpB - bacterial strains and growth conditions The meningococcal strain BNCV (-: 2a: P1.2) was grown overnight on GC agar plates (Difco), supplemented with Vitox (Oxoid) in a humid atmosphere with 5% CO2 at 37 ° C. The construct encoding the recombinant LbpB protein was expressed in E. coli strain CE1448 (generously provided by C. Jansen). Which is a derivative of htrk ompT of strain CE1224 (Tommassen et al., 1983). The strain was developed at 37 ° C in a synthetic medium Hepes-regulated by pH (Tommassen and Lugtenberg, 1980) supplemented with growth requirement due to auxotrophic mutations and with 1.32 mM K2HPO4 (conditions with phosphate). After overnight growth, the culture was diluted 1: 13.5 in the same medium, but without K2HPO4 (phosphate depleted conditions) and developed for 6 h at 37 ° C. 8B: Expression of recombinant LbpB- Cloning in E. coli. Chromosomal DNA was isolated from meningococcal cells that developed overnight on the plates. The bacteria were scraped off the plates, suspended in 1.5 ml 10 mM Tris-HCl, 10 mM EDTA, pH 8, and 10 μl of lysozyme (10 mg / ml) was added. The suspension was incubated for 15 minutes at room temperature, before 1.5 ml of 2% Triton X-100, 50 mM Tris-HCl, 10 mM EDTA, pH8 was added. After 15 min. of incubation, 10 μl of proteinase K (10mg / ml) was added. The tubes were incubated for 30 min at room temperature. The DNA was extracted from the mixture by adding phenol / chloroform / isoamyl alcohol (24: 24: 1 by volume), and further purified by extraction with chloroform saturated with water. The chromosomal DNA was precipitated with ethanol. Chromosomal DNA was used as a standard to amplify the part of the IbpB gene corresponding to the mature LbpB using PCR initiators LB22 and LB23 (Table 5). The LB22 primers in a site corresponding to the N-terminal part of LbpB and introduce a Pstl site in the PCR product. LB23 starts just downstream of IbpB at the beginning of the Ibpk gene and introduces a BamHI site. Pwo polymerase (Boehringer Mannheim), a test reading enzyme, was used in the PCR reaction, according to the instructions provided by the manufacturer. The annealing temperature was 60 ° C and they created 30 cycles. The PCR product was isolated from a gel, using β-agarose (New England Biolabs) according to the manufacturer's instructions. The PCR product was digested with PstI and BamHI and ligated into pJP29 (Fig. 10A), which has also been digested with PstI and BglII. In the resulting construction pAM31, the bamHI and BglII sites are lost. The LbpB protein is expressed in this construction of the phoE promoter and contains the PhoE signal sequence in place of the authentic signal sequence. In addition, the first two residues of the N terminus were changed from Cis e Me to Ala and Val, respectively. To facilitate the purification of the protein, a His tag was inserted between the signal sequence and the mature part of LbpB. PAm31 was digested with Psfl and ligated to an interleaver composed of oligonucleotides VGO12a and VGO13a (Table 5), resulting in pAM32 plasmids (Fig. 10A). The Pstl site is lost after the union. The interleaver is encoded by six His residues and a separation site factor Xa (Fig. 10B). 8C: Purification of recombinant LbpB Recombinant LbpB was produced in strain CE1448 containing pAM32. Phosphate-restricted cells from a 5 liter culture were harvested after 6 h of growth. The cells were washed once with 500 ml of physiological salt solution and resuspended in 150 ml of 10 mM Tris-HCl, 5 mM EDTA, pH 8. The suspension was frozen at -20 ° C overnight. The cells were dissolved and three protease inhibitor mixture tablets (Complete ™, Boehringer Mannheim) were added. The cells were pressed twice through a French pressure at a pressure of 562.4 kg / cm2. The cells that did not break were removed by centrifugation in a Sorvall GSA rotor at 5000 rpm for 20 min. The supernatant was centrifuged in a Beckman Ti60 rotor at 40,000 rpm for 90 min. The cell covers were dissolved in pH regulating solution of Na2HPO-NaH2PO 5mM, pH 7.6. The cell envelopes were extracted twice with 2% n-octyl-oligo-oxyethylene (octyl-POE) at 37 ° C. The first extraction was done during 1 h, and the second during 3 h. Between the extractions and after these, the non-soluble proteins were formed into pellets by means of centrifugation in a Beckman TLA100.2 rotor at 100,000 rpm for 1 h. The supernatants, which contain the LbpB protein, were combined and added to Ni-NTA agarose. The purification of the protein was done in the form of batches under original conditions, according to the instructions provided by the manufacturer (Qiagen). The concentrations of imidazole and NaCl were 20 mM and 300 mM, respectively, during binding and washing. In total, 2 ml of Ni-NTA agarose was used, divided into 10 tubes. The elution was performed in steps with 3 ml of 100 mM, 200 mM, and 250 mM imidazole, respectively. After elution, the protein was dialyzed twice in a Spectra / Por 2 dialysis bag (Spectrum) against 2.51 phosphate pH buffer. The protein was concentrated in the Maxi Fugisept Centrifuge Concentrator (Intersept) with a 10kDa cut. The centrifugation was performed in a Sorvall GSA rotor at 5000 rpm, until the total volume was 1-1.5 ml. Polyacrylamide gel electrophoresis (PAGE) was performed as described by Lutenberg et al. (1975) with some modifications. The polyacrylamide gel was composed of a 5% stacking gel and an 11% resolution gel, which does not contain SDS. When the denaturation of LbpB had to be avoided, the pH regulator of the sample (Lutenberg et al. 1975) did not contain β-mercaptoethanol, and the samples were kept at 0 ° C before PAGE. To denature LbpB, the pH regulator of the sample was supplemented with β-mercaptoethanol, and the samples were boiled for 5 min. Electrophoresis was carried out at a constant current of 20 mA at 4 ° C. The gel was stained with Coomassie Brilliant Blue. 8D: Expression and purification of recombinant LbpB-results A recombinant form of LbpB from N. meningitidis strain BNCV was expressed in strain CE1448 of £. coli One construct, pAM32, was made by coding a recombinant protein consisting of the signal sequence of PhoE, Histag and the mature LbpB protein (Fig. 10A). The protein is expressed from the phoE promoter under phosphate limitation. The authentic type II signal sequence of LbpB is replaced by a type I signal sequence, and a His tag followed by a factor Xa separation site is inserted between the signal sequence and the mature LbpB. In addition, the first of two amino acids of the mature LbpB, Cis and Me were changed to Ala and Val (Fig. 10B). Consequently, the recombinant protein can not be modified by the lipids in an N Cis terminus. The recombinant LbpB protein was fractionated with the membranes, and not with the soluble proteins (data not shown). Therefore, it had to be extracted from the membrane with a detergent. Octyl-POE was used because it solubilized about 50% of the total amount of recombinant LbpB from the membrane. In addition, when the extracted protein is not denatured by boiling it in sample pH buffer, it migrates faster in PAGE than the denatured protein (data not shown), suggesting that the protein is correctly duplicated. After extraction, the His-tagged protein was purified by means of Ni affinity chromatography. Most of the protein was eluted in the 10 mM and 200 mM imidazole fractions. However, all fractions were combined before dialysis. The protein was pure as evaluated on a gel stained with Coomassie Brilliant Blue (Fig. 11), and most were present in the duplicated form, which migrates faster during PAGE than the denatured form. The duplicated form of LbpB, but not the denatured form, was shown in Example 6 to join the lactoferrin in a graph. Example 9: To study the immunogenicity of the LbpB protein in man, the presence of antibodies recognizing the LbpB protein of the BNCV strain in human convalescent serum was tested in spot immunoassay. 9A: Immunogenicity of LbpB in man - Methods Ten human convalescent sera were obtained from Smithkline Beecham Biologicals SA, Belgium, and seven sera from the National Institute of Public Health and the Environment, The Netherlands (Table 6). Individuals have been infected with strains of several sero- and subtypes. Recombinant LbpB was isolated using the procedure described in Example 8. Polyacrylamide gel electrophoresis (PAGE) was performed as described by Lutenberg et al. (1975) with some modifications. The polyacrylamide gel was composed of a 5% stacking gel and an 11% resolution gel, which does not contain SDS. When the denaturing of LbpB had to be avoided, the sample pH buffer (Lutenberg et al., 1975) which does not contain β-mercaptoethanol, and the samples were kept at 0 ° C before electrophoresis. To denature the LbpB, the sample pH buffer was supplemented with β-mercaptoethanol, and the samples were boiled for 5 min. The electrophoresis was carried out at a constant current of 20mA at 4 ° C. A spot immunoassay was performed as described by Pettersson et al. (1993). The human serum was diluted to 1: 500.

IgG (Dako A / S) anti-human rabbit conjugated with peroxidase was used as the secondary antibody in a working solution of 1: 5000. The activity of the peroxidase was detected with the ECL system according to the instructions provided by the manufacturer (Amersham). 9B: Immunogenicity of LbpB in man-Results The presence of LbpB-specific antibodies in human serum was tested against recombinant LbpB protein, purified from strain BNCV (-: 2a: P1.2) in spot immunoassay. The reactivity was tested against the duplicated LbpB and against the denatured protein (see Fig. 12 for examples). The results are summarized in Table 6. Four of the sera were strongly reacted with the denatured form and the duplicate form of LbpB. Five sera were reacted weakly with both forms, two sera only weakly with the duplicated form, two sera weakly only with the denatured form, and four sera did not react at all with LbpB. These results demonstrate that meningococcal LbpB is immunogenic in man and suggests a considerable degree of cross-immunological reactivity between LbpB proteins of several strains. Example 10: Bacterial ELISA tests using serum obtained from mice immunized with meningococal or LbpB 10A cells: Immunization protocol Immunization with LbpB from the BNCV strain of N. meningitidis: Groups of 10 mice (6-week old Balb / C ) were immunized (100 μl intraperitoneally or 100 μl subcutaneously) three times with 5 x 10 CFU of BNCV whole cells inactivated with heat in SBAS2 adjuvant. The three immunizations were carried out 21 separate days, and the blood was extracted at day 56 by intracardiac puncture. The serum was combined by group. The immunization with LbpB of the BNCV strain of N. meningitidis: This was done by the same method as before, except that the first 2 immunizations were made with 10 μg of immunization was carried out with 2.5 μg of pure LbpB (prepared in the same way as described in Example 8). 10B: Measurement of response in Complete Cell ELISA (TCE) and Purified LbpB ELISA Nunc 96 well flat bottom immunoplates were used. 100 μl of a heat inactivated Neisseria meningitidis strain [which was run under conditions of iron depletion conditions (fe-) using EDDA as described in Example 1] (20 μg / ml total protein) suspension in PBS was Aliquots were placed in individual wells of plates and allowed to evaporate overnight at 37 ° C. The coated plates were washed four times with 0.9% NaCl, 0.05% Tween 20 and saturated with 0.3% Casein PBS (Merck) for 30 minutes at room temperature with stirring, and washed in the same manner. 100 μl of filled serum was diluted 100 times in PBS with 0.05% Tween 20, 0.1% Casein, added to the first well, subsequently diluted twice to 12 dilutions and the plates were then incubated for 30 minutes at 37 ° C with agitation. After washing, 100 μl of a 2000-fold solution of biotin from rabbit anti-mouse immunoglobulins (Dakopatts E0413) in PBS 0.05% Tween 20, 0.3% Casein, was added and the plates were incubated in the same way than before. Plates were washed and then 100 μl of a 4000-fold solution in PBS of 0.05% Tween 20 biotinylated streptavidin horseradish peroxidase complex was added and the plates were incubated in the same manner. After washing, 100 μl of a freshly prepared solution of 4 mg of O-phenyldiamine tinsion (OFDA) (sigma P8787) in 0.1 M of pH 4.5 citrate buffer was added and the plates were incubated for 15 minutes at room temperature in a dark room. The reaction was stopped by adding 50 μl of 1N HCl. The absorbances were read at 490 nm. ELISA Anti-LbpB works in the same way as TCE except that the coating is different. The wells were coated with 100 μl of a 0.5 μg / ml solution of pure LbpB in 0.05 M carbonate / bicarbonate pH buffer at pH 9.6 and incubated overnight at 37 ° C (not evaporated). 10C: Analysis of bactericide A culture of meningococcus of group B (strain h44 / 76) [developed under conditions of iron depletion (fe-) as described in Example 1, or under iron-rich conditions (fe +) omitting the addition of ADED] in the growth phase log (OD ~ 0.3) was suspended in Hanks medium sterile with 0.3% BSA in order to obtain a working cell suspension adjusted to 20,000 CFU / ml. A primary reaction mixture (75μl) containing 50μl / well of duplicate solutions of test serum samples (Example 10A) (which have been inactivated by heat at 56 ° C for 30 min) and 25 μl / well of 2000 CFU / ml of group B meningococci in the log phase . The reaction vials were incubated at 37 ° C for 15 minutes and shaken at 210 rpm. The final reaction mixture (100 μl) additionally contained 25% serum from previously tested newborn rabbits as a source of complement, and was incubated under the same conditions for 60 min. A 96-well microtiter plate with a sterile, polystyrene U-shaped bottom was used for this analysis. A 10 μl aliquot was taken from each well using a multichannel pipette, and dripped onto Mueller-Hinton agar plates containing 1% Isovitalex and 1% heat-inactivated horse serum and incubated for 18 hours at 37 ° C at 5% CO2, Individual colonies can be counted above 80 CFU per aliquot. The following three test samples were used as controls: buffer solution for pH + bacteria + complement; buffer solution pH + bacteria + inactivated complement; serum + bacteria + inactivated complement.

Titrations were calculated using a procedure with the Excel program (Microsoft). This procedure gives an accurate measurement of the solution which corresponds to 50% of cell death by means of a regressive calculation. Example 10D: Results Table 7 and Fig. 13 show that immunization with LbpB induces a good response against LbpB (Fig. 13A), as well as all cell samples from the BNCV strain (the source of recombinant LbpB) strain AND H44 / 76 (the LbpB having only 78.5% sequence identity with that of BNCV) (Fig. 13B and C). Serum obtained using an immunization program that involves only recombinant LbpB gave a similar result (data not shown). Clearly, anti-whole cell immunization with the BNCV strain leads to complete upper cell antigens ELISA for BNCV cells and H44 / 76 cells (Figs 13B and C, respectively).

In addition, immunization with recombinant LbpB from N. meningitidis strain BNCV induces antibodies that bind to a protein of similar molecular weight in the samples of all cells of Moxarella catarrhalis run in a spot immunoassay carried out substantially as described in he Example 9 (data not shown). Table 8 and Fig. 14 show that the antibodies produced in the serum after immunization with recombinant LbpB (strain BNCV) are bactericidal against a heterologous strain (H44 / 76), the LbpB having only 78.5% identity. sequence with BNCV. This was also the case when using serum obtained after an immunization program involving only recombinant LbpB (data not shown). This is true when H44 / 76 has been developed under conditions containing iron (Fig. 14A) and iron depletion (Fig. 14B). There seems to be a greater effect in iron depletion conditions as can be expected if LbpB is expressed in greater amounts when the bacteria is under these conditions. Therefore, LbpB is an immunoprotective antigen, and therefore, there is evidence that it provides cross immunoprotection against heterologous strains of N. meningitidis.

Table 1. Bacterial filters and plasmids used Organism Description0 Reference / Source N. meningitidis H44 / 76 B: 15: P1.7,16 E. Holten CE1449 H44 / 76 / bpA :: Ermr This application BNCV -: 2a: P1.2 derived not E.C. Gotschlich encapsulated of M986 CE1452 BNCV / opp :: Ermr This request CE1452 BNCV / bpB :: Kmr This request CE1402 M986 IbpA, IbpB Petterson and others 1994a M990 B: 6: P1.6 881607 B: nt: P1.12 B16B6 B: 2a: P1.2 A. Schryvers N91 B16B6 tbpB A. Schryvers M981 B: 4: nt E.coli DH5a Laboratory stock Y1090 Ampr Young and Davis, 1983 PC2494 hsdR derived from Phabagen Collection JM101 Plasmids pEMBL19 Ampr Laboratory stock PUC4K Kmr-box, Ampr Pharmacia Biotech pER2 Ermr-box in Jennings and others, 1993 pBluescript, Ampr pAM6 pEMBL19 having this request parts of IbpA and IpbB pAM6K pAM6 with a box This request of Kmr from pUC4K inserted in the BglW instead of IpbB pAM6K -nus pAM6K with a This request sequence of neiseria absorption inserted into the Kpnl site of the multiple cloning site of the pAM13 vector pEMBL19 having this request parts of IbpA and IbpB pAM 1 pUC 1 9 bearing Petterson and other 1993 portions of IbpA and IbpB pAM23 pUC 1 9 taking IbpA and Petterson and others 1994b part of IpbB pAM23E pAM23 with an Ermr- This request box inserted into the site EcoRV-IbpA aSerogroup, serotype and subtype, nt: not typable are mentioned. Table 2. Initiators used for PCR or cloning interleaver Name Sequence Notes DVAS2 AGACCGACCCTTCGACGACTTCGG FW5 GAAGAAGAAGCGATGGTGCGG SDA1 CCTCTTTAGTATCTTTCTTCGCAC LB1 1 CTTAATTTCATCTTTTCCC PR 1 GAGCGAGTCCGCGTTAGTGCT Mixtures in Kmr nusl ribbons TTCAGACGGCTGTAC Neisseria absorption sequence complementary to nusl nus2 AGCCGTCTGAAGTAC Table 3. Primers used to amplify by PCR the four additional IbpB genes Sequence Name LB210 GGAGGAAAAGTAGGGATG LB23 CGGGATCCAGCCAAGGCAGTCAGGGTAAGC REV2 GCACGGACGGTAACCTCTTTCAGG Table 4. Identities in pairs of the LbpB sequences, in% H44 / 76 M990 M981 881607 BNCV 78.5 73.8 72.7 71.4 H44 / 76 72.5 74.1 78.5 M990 70.5 71.3 M981 80.6 Table 5. Initiators used to express recombinant LbpB Name Sequence LB22 AACTGCAGTCGGCGGCAATTTCGGCGTGCA LB23 CGGGATCCAGCCAAGGCAGTCAGGGTAAGC VGO12a CACCACCACCACCACCACGTGATCGAGGGGCGTGCA VGO13a CGCCCCTCGATCACGTGGTGGTGGTGGTGGTGTGCA Table 6. Immunoassay results of human serum spots against purified LbpB Serum Characteristics8 Native Denatured Source 262439 B: NT: P1.4 + + SKB 262532 B: 15: P1.7.16 + + SKB 262658 B: NT: P1.15 - - SKB 262716 B: 15: P1.7.16 - + SKB 262892 B : 2b: P1.10 ++ ++ SKB 262917 B: 4: NT ++ ++ SKB 262941 B: 1: P1.15 + + SKB 262987 B: 2a: P1.15 + + SKB 263017 B: 4: NT _ _ SKB 263021 B: 4: P1.4 - - SKB 69 B: 15: P1.16 + - RIVM 322 B: 15: P1.5 + - RIVM 329 B 1: P1.4 - - RIVM 330 B: 1 : P1.4 ++ ++ RIVM 187 - - + RIVM 195 - ++ ++ RIVM 118. + + RIVM a Sero- and subtypes of the filter are indicated with which the patient became infected, when NT is known: non-typeable b ++ indicates strong reaction, + weak reaction and- without reaction with the native or denatured form of the protein. c SKB: SmithKIine Beecham Biologicals, RIVM: National Institute of Public Health and the Enviroment. Table 7 Results of anti-whole cell and anti-LbpB ELISA performed as described in Example 10 Anti-LbpB response 100a 200 400 800 1600 3200 6400 12800 25600 51200 102400 204800 BNCV 0341"0196 0107 0063 0033 0018 0014 0011 0013 0012 0009 0012 LbpB 2772 2918 2794 2867 2687 2487 2046 1504 1043 0668 0405 0202 PBS 014 0079 0044 0028 0016 0018 0012 001 001 0008 0012 001 Response to? -BNCV (Fe-) 100 200 400 800 1600 3200 6400 12800 25600 51200 102400 204800 BNCV 2476 309 304 3154 3034 3112 3111 2905 2745 2436 1659 1056 LbpB 1783 1856 1292 0914 0622 0385 0257 0185 0122 0106 0096 0089 PBS 0687 055 0358 0243 0154 0123 0099 0088 0083 0081 0031 0081 Anti-H44 / 76 (Fe-) answer 100 200 400 800 1600 3200 6400 12800 25600 51200 102400 204800 BNCV 2814 3003 2966 2976 2873 266 2371 1862 1312 0873 0591 0452 LbpB 2653 2287 1683 1123 0748 0536 0409 035 0309 0598 0289 0295 PBS 1,645 1,049 0.695 0.47 0.338 0.271 0.238 0.226 0.226 0.251 0.284 0.285 8 Serum Dilution. b Optical density at 490 nm. Table 8. Results of bactericidal anti-whole cell and anti-serum LbpB activities carried out as described in Example 10 Titration of Bactericide against N44 / 76 (Fe-) 200.0a 400.0 800.0 1600.0 3200.0 6400.0 12800.0 25600.0 H44 / 76 100.0 100.0 100.0 100.0 100.0 100.0 100.0 97.2 BNCV 100.0 94.4 93.0 83.2 81 .8 63.7 48.3 34.4 LbpB 10.6 -0.5 -0.5 -0.5 -0.5 -0.5 -0.5 -0.5 PBS -0.5 -0.5 -0.5 -0.5 -0.5 -0.5 -0.5 -0.5 Titration of bacillus against H44 / 76 (Fe-) 200.0 400.0 800.0 1600.0 3200.0 6400.0 12800.0 25600.0 H44 / 76 100 98 100 100 100 100 100 98 BNCV 100 98 96 85 83 70 64 32 LbpB 34 25 0 0 0 0 0 0 PBS 0 0 0 0 0 0 0 0 aDilution of serum. All publications, including but not limited to patents and patent applications, cited in this specification are incorporated herein by reference as if each individual publication was specifically and individually indicated to be incorporated by reference herein as fully exhibited.

Bibliography Abdillahi, H., and Poolman, J.T. (1987) Whole-cell ELISA for typing of Neisseria meningitidis with monoclonal antibodies. FEMS Microbiol. Lett 48: 367-371. Anderson, J.E., Sparling, P.F., and Cornelissen, C.N. (1994) Gonococcal transferrinbinding protein 2 facilitates but is not essential for transferrin utilization. J Bacteriol 176: 3162-3170.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.M., Seidman, J.G., Smith, J.A., and Struhl, K. (1989) Current protocols in molecular biology. Brooklyn, NY: Greene Publishing Associates. Bagg, A., and Neilands, J.B. (1987) Ferric uptake regulation protein acts as a repressor, employing iron (II) as a cofactor to bind the operator of an iron transport operon in Escherichia coli. Biochemistry 26: 5471-5477. Biswas, G.D., and Sparling, P.F., (1995) Characterization of IbpA, the structural gene for a lactoferrin receptor in Neisseria gonorrhoeae. Infect Immun 63: 2958-2967. Bosch, D., Leunissen, J., Verbakel, J., de Jong, M., van Erp, H., and Tommassen, J. (1986) Periplasmic accumulation of truncated forms of outer membrane Phoe protein of Escherichia coli K-12.

J. Mol. Biol. 189: 449-455. Cornelissen, C.N., Biswas, G.D., Tsai, J., Paruchuri, D.K., Thompson, S.A., and Sparling, P.F. (1992) Gonnococcal transferrin-binding protein 1 is required for transferrin utilization and is homologous to TonB-dependent outer membrane receptors. J Bacteriol 174: 5788-5797. Finkelstein, R.A., Sciortino, C.V., and Mclntosh, M.A. (1983) Role of iron in microbehost interactions. Rev Infect Dis 5: 5788-5797. Fuller, C.A., Retzer, M.D., Jacobs, E., and Schryvers, A.B. (1996) Evidence for a bi-lobeb structure for meningococcal transferrin binding protein B. In Pathogenic Neisseria. Zollinger, W.D., Frasch, CE., And Deal, C.D. (eds) Abstract book from the 10th Pathogenic Neisseria Conference. Pp 572-573. Genco, C.A., Chen, C.Y., Arko, R.J., Kapczynski, D.R., and Morse, S.A. (1991) Isolation and characterization of a mutant of Neisseria gonorrhoeae that is detective in the uptake of iron from transferrin and hemoglobin and is avirulent in mouse subcutaneous chambers. J Gen Microbiol 137: 1313-1321. Gschwentner, C, Lassman, H., and Huettinger, M. (1997) Lactoferrin and its receptor (s): modulators of inflammation? Abstracts of Third International Conference on Lactoferrin. p. 68. Irwin, S.W., Averil, N.A., Cheng, C.Y., and Schryvers, A.B., (1993) Preparation and analysis of isogenic mutants in the transferrin receptor protein genes, tbpA and tbpB, from Neisseria meningitidis. Mol Microbiol 8: 1125-1133. Jennings, M.P., van der Ley, P., Wilks, K.E., Maskell, D.J., Poolman, J.T., and Moxon, E.R. (1993) Cloning and molecular analysis of the galE gene of Neisseria meningitidis and its role in lipopolysaccharide biosynthesis. Mol Microbiol 10: 361-369.

Legrain, M., Marazin, V., Irwin, S.W., Bouchon, B., Quentin-Millet, M.-J., Jacobs, E., and Schryvers, A.B. (1993) Cloning and characterization of Neisseria meningitidis genes encoding the transferrin-binding proteins Tbp1 and Tbp2. Gene 130: 73-80. Lugtenberg, B., Meyers, J., Peters, R., van der Hoek, P., and van Alphen, L. (1975) Electrophoretic resolution of the "major outer membrane protein" of Escherichia coli K-12 into four bands . FEBS Lett. 58: 254-258. Petterson, A., Kuipers, B., Pelzer, M., Verhagen, E., Tiesjema, RH, Tommasen, J., and Poolman, JT, (1990) Monoclonal antibodies against the 70-Kilodalton iron-regulated protein of neisseria meningitidis are bacterial and strain specific. Infect Immun 58: 3036-3041. Petterson, A., van der Ley, P., Poolman, J.T., and Tommassen, J., (1993) Molecular characterization of the 98-Kilodalton iron-regulated outer membrane protein of Neisseria meningitidis. Infect Immun 61: 4724-4733. Petterson, A., Klarenbeek, V., van Deurzen, J., Poolman, J.T., and Tommassen, J., (1994a) Molecular characterization of the structural gene for the lactoferrin receptor of the meningococcal strain H44 / 76. Microbial Pathogen 17: 395/408. Petterson A., Maas, A., and Tommassen, J., (1994b) Identification of the gene product of Neisseria meningitidis as a lactoferrin receptor. J Bacteriol 176: 1764-1766.

Renauld-Mongénie, G., Poncet, D., and Quentin-Millet, M.J. (1996) Study of human transferrin binding sites within the transferrin binding protein Tbp2 from N. meningitidis M982 using the pMAL expression system. In Pathogenic Neisseria. Zollinger, W.D., Frasch, CE., And Deal, C.D. (eds) Abstract book from the 10th Pathogenic Neisseria Conference. Pp 585-586. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual. 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Schryvers, A.B., and Morris, L.J. (1988) Identification and characterization of the human lactoferrin-binding protein from Neisseria meningitidis. Infect Immun 56: 1144-1149. Tommasen, J., and Lugtenberg, B. (1980) Outer membrene protein e of Escherichia coli K-12 is co-regulated with alkaline phosphatase. J. Bacteriol. 143: 151-157. Tommassen, J., van Tol, H., and Lugtenberg, B. (1983) The ultímate localization of an outer membrane protein of Escherichia coli K-12 is not determined by the signal sequence. EMBO J. 2: 1275-1279. van Berkel, P.H.C, Geerts, M.E.J., van Veen, H.A., Kooiman, P.M., Pieper, F.R., de Boer, H.A., and Nijens, J.H. (1995) Glycosylated and unglycosylated human lactoferrins both bind iron and show dentical affinities towards human lysozyme and bacterial polysaccharide, but differ in their susceptibilities towards tryptic proteolysis. Biochem J 312: 107-114. van der Ley, P., Heckels J.E., Virji, M., Hoogerhout, P., and Poolman, J.T. (1991) Topology of outer membrane porins in pathogenic Neisseria ssp. Infecí Immun 59: 2963-2971. van der Ley, P., and Poolman, J.T. (1992) Constuction of a multivalent meningococcal strain based on the class 1 outer membrane protein. Infecí Immun 60: 3156-3161. von Heijne, G. (1989) The structure of signal peptides from bacterial lipoproteins. Prot Eng 2: 531-534. Young, R.A., and Davis, R.W. (1983) Yeast RNA polymerase II genes: isolation and antibody probes. Science 222: 778-782.

SEQUENCE LIST (1) GENERAL INFORMATION (i) APPLICANT: University of Utrecht, Technology Foundation (ii) TITLE OF INVENTION: Vaccine (iii) NUMBER OF SEQUENCES: 10 (iv) CORRESPONDING ADDRESS: (A) RECIPIENT: SmithKine Beecham, Corporate IP Department (B) STREET: Two, New Horizons Court, (C) CITY: Brentford (D) STATUS: Middlesex (E) COUNTRY: United Kingdom (F) CP TW89EP (v) COMPUTER LEADABLE FORM: (A) TYPE OF MEDIA: Disk (B) COMPUTER: Compatible with IBM (D) OPERATING SYSTEM: DOS (D) SOFTWARE: FastSEQ for Windows Version 2.0 (vi) APPLICATION DATA CURRENT: (A) NUMBER OF APPLICATION: (B) DATE OF SUBMISSION: (C) CLASSIFICATION: (vii) PRIORITY DATA OF THE APPLICATION: (A) NUMBER OF THE APPLICATION: (B) DATE OF PRESENTATION: (viii) INFORMATION APPORTER / AGENT: (A) NAME: DALTON, Marcus Jonathan William (B) REGISTRATION NUMBER: XXXXXX (C) REFERENCE NUMBER / CASE: B45106 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (0181) 9756348 ( B) TELEFAX: (0181) 9756177 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2277 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (B) CEPA: BNCV strain of Neisseria meningitidis (ix) CHARACTERISTICS: (A) NAME / KEY: Sec Code uence (B) POSITION: 100 ... 2274 (D) OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: TCCTGATTTT TGTTAATTCA CTATAAAAAC GGGTTGATAT TATCTGTACA TATTAATATA 60 ATGATAATTA TTATTAATCA AATAGGAGGA AAAGTAGGG ATG TGT AAA CCG AAT 114 Met Cys Lys Pro Asn 1 5 TAT GGC GGC ATT GTC TTG TTG CCC TTA CTT TTG GCA TCT TGT ATC GGC 162 Tyr Gly Gly lie Val Leu Leu Pro Leu Leu Leu Wing Ser Cys He Gly 10 15 20 GGC AAT TTC GGC GTG CAG CCT GTT GTC GAA TCA ACG CCG ACC GCG TAC 210 Gly Asn Phe Gly Val Gln Pro Val Val Glu Ser Thr Pro Thr Ala Tyr 25 30 35 CCC GTC ACT TTC AAG TCT AAG GAC GTT CCC ACT CCG CCC CCT GCC AAA 258 Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr Pro Pro Pro Wing Lys 40 45 50 CCT TCT ATA GAA ATC ACG CCG GTC AAC CGG CCC GCC GTC GGT GCG GCA 306 Pro Ser He Glu He Thr Pro Val Asn Arg Pro Wing Val Gly Ala Wing 55 60 65 ATG CGG CTG CCA AGG CGG AAT ACT GCT TTT CAT CGT GAA GAT GGC ACG 354 Met Arg Leu Pro Arg Arg Asn Thr Wing Phe His Arg Glu Asp Gly Thr 70 75 80 85 GAA ATT CCA AAT AGC AAA CAA GCA GAA GAA AAG CTG TCG TTT CAA GAA 402 Glu He Pro Asn Ser Lys Gln Wing Glu Glu Lys Leu Ser Phe Gln Glu 90 95 100 GGT GAT GTT CTG TTT TTA TAC GGT TCA AAA GGA AAT AAA CTT CAA CAA 450 Gly Asp Val Leu Phe Leu Tyr Gly Ser Lys Gly Asn Lys Leu Gln Gln 105 110 115 CTT AAA AGC GAA ATT CAT AAA CGT GAT TCC GAT GTA GAA ATT AGG ACA 498 Leu Lys Ser Glu He His Lys Arg Asp Ser Asp Val Glu He Arg Thr 120 125 130 TCA GAA AAG GAA AAT AAA AAA TAT GAT TAT AAA TTT GTA GAT GGT 546 Ser Glu Lys Glu Asn Lys Lys Tyr Asp Tyr Lys Phe Val Asp Wing Gly 135 140 145 TAT GTA TAT GTA AAG GGA AAA GAT GAA ATT AAG TGG ACT TCA GAT TAC 594 Tyr Val Tyr Val Lys Gly Lys Asp Glu He Lys Trp Thr Ser Asp Tyr 150 155 160 165 AAG CAG TTT TCC AAC CGC TTA GGT TAT GAC GGT TTT GTA TAT TAT TCC 642 Lys Gln Phe Ser Asn Arg Leu Gly Tyr Asp Gly Phe Val Tyr Tyr Ser 170 175 180 GGA GAA CGT CCT TCC CAA TCT TTA CCG AGT GCG GGA ACG GTG GAA TAT 690 Gly Glu Arg Pro Ser Gln Ser Leu Pro Ser Ala Gly Thr Val Glu Tyr 185 190 195 TCT GGT AAC TGG CAA TAT ATG ACC GAT GCC AAA CGT CAT CGA GCA GGT 738 Ser Gly Asn Trp Gln Tyr Met Thr Asp Ala Lys Arg His Arg Ala Gly 200 205 210 AAG GCG GTT GGC ATT GAC AAT TTG GGT TAT TAC ACA TTT TAT GGT AAC 786 Lys Wing Val Gly He Asp Asn Leu Gly Tyr Tyr Thr Phe Tyr Gly Asn 215 220 225 GAT GTT GGT GCA ACT TCT TAT GCG GCT AAG GAT GAC GAA AGG GAA 834 Asp Val Gly Ala Thr Ser Tyr Ala Ala Lys Asp Val Asp Glu Arg Glu 230 235 240 245 AAA CAT CCT GCT AAA TAT ACG GTA GAT TTC GGT AAC AAA ACC CTG ACG 882 Lys His Pro Wing Lys Tyr Thr Val Asp Phe Gly Asn Lys Thr Leu Thr 250 255 260 GGC GAG CTG ATT AAA AAC CAA TAT GTC AAA CCC AGT GAG AAG CAA AAA 930 Gly Glu Leu He Lys Asn Gln Tyr Val Lys Pro Ser Glu Lys Glr. Lys 265 270 275 CCG CTG ACC ATT TAC AAC ATC ACT GCC GAT TTA AAC GGC AAC CGC TTT 978 Pro Leu Thr He Tyr Asn He Thx Wing Asp Leu Asn Gly Asn Arg Phe 280 285 290 ACC GGC AGT GCC AAG GTC AAT CCT GAT TTA GCG AAA AGC CAT GCC AAT 1026 Thr Gly Ser Wing Lys Vai Asn Pro Asp Leu Wing Lys Ser His Wing Asn 295 300 305 AAG GAG CAT TTG TTT TTC CAT GCC GAT GCC GAT CAG CGG CTT GAG GGC 1074 Lys Glu His Leu Phe Phe His Wing Aep Wing Asp Gln Arg Leu Glu Gly 310 315 320 325 GGT TTT TTC GGC GAT AAG GGG GAA GAG CTT GCC GGA CGG TTT ATC AGC 1122 Gly Phe Phe Gly Asp Lys Gly Glu Glu Leu Wing Gly Arg Phe He Ser 330 335 340 AAC GAC AAC AGC GTA TTC GGT GTA TTC GCA GGC AAA CAA AAT AGC CCC 1170 Asn Asp Asn Ser Val Phe Gly Val Phe Ala Gly Lys Gln Asn Ser Pro 345 350 355 GTG CCG TCT GGA AAA CAC ACC AAA ATC TTG GAT TCT CTG AAA ATT TCC 1218 Val Pro Ser Gly Lys His Thr Ly = He Leu Asp Ser Leu Lys He Ser 360 365 370 GTT GAT GAG GCA AGT GGT GAA AAT CCC CGA CCG TTT GCC ATT TCT CCT 1266 Val Asp Glu Wing Ser Gly Glu Asn Pro Arg Pro Phe Wing He Ser Pro 375 380 385 ATG CCC GAT TTT GGT CAT CCC GAC AAA CTT CTT GTC GAA GGG CAT GAA - 1314 Met Pro Asp Phe Gly His Pro Asp Lys Leu Leu Val Glu Gly His Glu 390 395 400 405 ATT CCT TTG GTT AGC CAA GAG AAA ACC ATC GAG CTT GCC GAC GGC AGG 1362 He Pro Leu Val Ser Gln Glu Lys Thr He Glu Leu Wing Asp Gly Arg 410 415 420 AAA ATG ACC GTC AGT GCT TGT TGC GAC TTT TTG ACC TAT GTG AAA CTC 1410 Lys Met Thr Val Ser Wing Cys Cys Asp Phe Leu Thr Tyr Val Lys Leu 425 430 435 GGA CGG ATA AAA ACC GAA CGC CCC GCC GCC AAA CCG AAG GCG CAG GAC 1458 Gly Arg He Lys Thr Glu Arg Pro Wing Wing Lys Pro Lys Wing Gln Asp 440 445 450 GAA GAG GAT GAT ATC GAT AAT GGC GAA GAA AGC GAA GAC GAA ATC 1506 Glu Glu Asp As Asp He Asp Asn Gly Glu Glu Ser Glu Asp Glu He 455 460 465 GGC GAT GAA GAA GAA GGC ACC GAA GAT GCC GCC GCA GGA GAT GAA GGC 1554 Gly Asp Glu Glu Glu Gly Thr Glu Asp Wing Wing Gly Wing Asp Glu Gly 470 475 480 485 AGC GAA GAA GAC GAA GCC ACA GAA AAC GAA GAC GGC GAA GAA GAC GAA 1602 Ser Glu Glu Asp Glu Wing Thr Glu Asn Glu Asp Gly Glu Glu Asp Glu 490 495 500 GCT GAA GAA CCT GAA GAA GAA TCG TCG GCA GAA GGC AAC GGC AGT TCA 1650 Wing Glu Glu Pro Glu Glu Glu Ser Glu Being Gly Gly Asn Gly Being Ser 505 510 515 AAC GCC ATC CTG CCT GTC CCG GAA GCC TCT AAA GGC AGG GAT ATC GAC 1698 Asr. Ala He Leu Pro Val Pro Glu Ala Ser Lys Gly Arg Asp He Asp 520 525 530 CTT CTG AAA GGT ATC CGC ACG GCA GAA ACG AAT ATT CCG CAA ACT 1746 Leu Phe Leu Lys Gly lie Arg Thr Wing Glu Thr Asn He Pro Gln Thr 535 540 545 GGA GAA GCA CGC TAT ACC GGC ACT TGG GAA GCG CGT ATC GGC AAA CCC 1794 Gly Glu Wing Arg Tyr Thr Gly Thr Trp Glu Wing Arg He Gly Lys Pro 550 555 560 565 ATT CAA TGG GAC AAT CAT GCG GAT AAA GAA GCG GCA AAA GCA GTA TTT 1842 He Gln Trp Asp Asn His Wing Asp Lys Glu Wing Wing Lys Wing Val Phe 570 575 580 ACC GTT GAT TTC GGC AAG AAA TCG ATT TCC GGA ACG CTG ACG GAG AAA 1890 Thr Val Asp Phe Gly Lys Lys Ser Be Gly Thr Leu Thr Glu Lys 585 590 595 AAC GGT GTA GAA CCT GCT TTC CGT ATT GAA AAC GGC GTG ATT GAG GGC 1938 Asn Gly Val Glu Pro Ala Phe Arg He Glu Asn Gly Val He Glu Gly 600 605 610 AAC GGT TTC CAT GCG ACA GCG CGC ACT CGG GAT GAC GGC ATC GAC CTT 1986 Asn Gly Phe His Wing Thr Wing Arg Thr Arg Asp Asp Gly He Asp Leu 615 620 625 TCC GGG CAG GGT TCG ACC AAA CCG CAG ATC TTC AAA GCT AAT GAT CTT 2034 Ser Gly Gln Gly Ser Thr Lys Pro Gln He Phe Lys Wing Asn Asp Leu 630 635 640 645 CGT GTA GAA GGA GGA TTT TAC GGC CCG AAG GCG GAG GAA TTG GGC GGT 2082 Arg Val Glu Gly Gly Phe Tyr Gly Pro Lys Wing Glu Glu Glu Leu Gly 650 655 660 ATT ATT TTC AA? AAT GAT GGG AAA CT CTT GGT ATA ACT GAA GGT ACT 2130 He He Phe A = n Asn Asp Gly Lys Ser Leu Gly He Thr Glu Gly Thr 6G5 670 675 GAA AAT AAA GTT GAA GCT GAT GTT GAT GTT GAT GTT GAT GTT GAT GTT 2178 Glu Asn Lys Val Glu Wing A = p Val Asp to As Val Asp Val Asp Val 660 605 690 GAT GCT GAT GAT GTAT GAA CAG TTA AAA CCT GAA GTT AAA CCC CAA 2226 Asp Wing Asp Wing Asp Val Glu Gln Leu Lys Pro Glu Val Lys Pro Gln 695 700 705 TTC GGC GTG GTA TTC GGT GCG AAG AAA GAT AAT AAA GAG GTG GAA AAA T 2275 Phe Gly Val Val Phe Gly Ala Lys Lys Asp Asn Lys Glu Val Glu Lys 710 715 720 725 GA 2277 (2) IN TRAINING FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 725 amino acids (B) TI PO: amino acid (C) FORM OF HI LO: simple (D) TOPOLOGY: linear (ii) TI PO DE MOLÉCU LA: protein (v) TI PO DE FRAGMENTO: internal (vi) ORIGINAL ENTITY: (B) CEPA: strain of BNCV of Neisseria meningitidis (xi) DESCRI PTION OF SEQUENCE: SEQ ID NO : 2: Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 Wing Being Cys He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Being 25 30 Thr Pro Thr Wing Tyr Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr 40 45 Pro Pro Pro Aia Lys Pro Ser He Glu He Thr Pro Val Asn Arg Pro 50 55 60 Wing Val Giy Wing Wing Met Arg Leu Pro Arg Arg Asn Thr Wing Phe His 65 70 75 80 Arg Glu Asp Gly Thr Glu He Pro Asn Ser Lys Gln Wing Glu Glu Lys 85 90 95 Leu Ser Phe Gln Glu Gly Asp Val Leu Phe Leu Tyr Gly Ser Lys Gly 100 105 110 Asn Lys Leu Gln Gln Leu Lys Ser Glu He His Lys Arg Asp Ser Asp 115 120 125 Val Glu He Arg Thr Ser Glu Lys Glu Asn Lys Lys Tyr Asp Tyr Lys 130 135 140 Phe Val Asp Wing Gly Tyr Val Tyr Val Lys Gly Lys Asp Glu He Lys 145 150 155 160 Trp Thr Ser Asp Tyr Lys Gln Phe Ser Asn Arg Leu Gly Tyr Asp Gly 165 170 175 Phe Val Tyr Tyr Ser Gly Glu Arg Pro Ser Gln Ser Leu Pro Ser Ala 180 185 190 Gly Thr Val Glu Tyr Ser Gly Asn Trp Gln Tyr Met Thr Asp Ala Lys 195 200 205 Arg His Arg Wing Gly Lys Wing Val Gly He Asp Asn Leu Gly Tyr Tyr 210 215 220 Thr Phe Tyr Gly Asn Asp Val Gly Ala Thr Ser Tyr Ala Ala Lys Asp 225 230 235 240 Vai Asp Glu Arg Glu Lys His Pro Wing Lys Tyr Thr Val Asp Phe Gly 245 250 255 Asn Lys Thr Leu Thr Gly Glu Leu He Lys Asn Gln Tyr Val Lys Pro 260 265 270 Sex Glu Lys Gln Lys Pro Leu Thr He Tyr Asn He Thr Wing Asp Leu 275 280 285 Asn Gly Asn Arg Phe Thr Gly Ser Wing Lys Val Asn Pro Asp Leu Wing 290 295 300 Ly = Ser His Wing Asn Lys Glu Hrs Leu Phe Phe His Wing Asp Wing Asp 305 310 315 320 Gin Arg Leu Glu Gly Gly Phe Phe Gly Asp Lys Gly Glu Glu Glu Leu Wing 325 330 335 Gly Arg Phe He Being Asn Asp Asn Ser Val Phe Gly Val Phe Wing Gly 340 345 350 Lys Gln A = n Ser Pro Val Pro Ser Gly Lys His Thr Lys He Leu Asp 355 360 365 Ser Leu Lys He Ser Val Asp Giu Wing Ser Gly Glu Asn Pro Arg Pro 370 375 380 Phe Ala He Ser Pro Pro Pro Asp Phe Gly His Pro Asp Lys Leu Leu 385 390 395 400 Val Glu Gly His Glu He Pro Leu Val Ser Gln Glu Lys Thr He Glu 405 410 415 Leu Wing Asp Gly Arg Lys Met Thr Val Wing Wing Cys Cys Asp Phe Leu 420 425 430 Thr Tyr Val Lys Leu Gly Arg He Lys Thr Glu Arg Pro Wing Wing Lys 435 440 445 Pro Lys Wing Gln Asp Glu Glu Asp Ser Asp He A = p Asn Gly Glu Glu 450 455 460 Ser Glu Asp Glu He Gly Asp Glu Glu Glu Gly Thr Glu Asp Ala Ala 465 470 475 480 Wing Gly Asp Glu Gly Ser Glu Glu Asp Glu Wing Thr Glu Asn Glu Asp 485 490 495 Gly Glu Glu Asp Glu Glu Wing Glu Pro Glu Glu Glu Glu Being Glu Wing 500 505 510 Gly Asn Gly Ser Ser Asn Ala He Leu Pro Val Pro Glu Ala Ser Lys 515 520 525 Gly Arg Asp He Asp Leu Phe Leu Lys Gly He Arg Thr Wing Glu Thr 530 535 540 Asn He Pro Gln Thr Gly Glu Wing Arg Tyr Thr Gly Thr Trp Glu Wing 545 550 555 560 Arg He Gly Lys Pro He Gln Trp Asp Asn His Wing Asp Lys Glu Wing 565 570 575 Ala Lys Ala Val Phe Thr Val Asp Phe Gly Lys Lys Ser He Ser Gly 580 585 590 Thr Leu Thr Glu Lys Asn Gly Val Glu Pro Ala Phe Arg He Glu Asn 595 600 605 Gly Val He Glu Gly Asn Gly Phe His Wing Thr Wing Arg Thr Arg Asp 610 615 620 Asp Gly He Asp Leu Ser Gly Gln Gly Ser Thr Lys Pro Gln He Phe 625 630 635 640 Lys Wing A = n Asp Leu Arg Val Glu Gly Gly Phe Tyr Gly Pro Lys Wing 645 650 655 Glu Glu Leu Gly Gly He lie Phe Asn Asn Asp Gly Lys Ser Leu Gly 660 665 670 He Thr Glu Gly Thr Glu Asn Lys Val Glu Wing Asp Val Asp Val Asp 675 680 685 Val Asp Val Asp Val Asp Wing Asp Aia Asp Val Glu Gln Leu Lys Pro 690 695 700 Glu Val Lys Pro Gln Phe Gly Val Val Phe Gly Ala Lys Lys Asp Asn 705 710 715 720 Lys Glu Val Glu Lys 725 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2169 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (B) CEPA: M981 strain of Neisseria meningitidis (ix) CHARACTERISTICS: (A) NAME / KEY: Sequence Code (B) POSITION: 1 ... 2166 (D) OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: ATG TGT AAA CCG AAT TAT GGC GGC ATT GTC TTG TTG CCC TTA CTT T G 48 Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 GCA TCT TGC ATC GGC GGC AAT TTC GGC GTG CAG CCT GTT GTC GAA TCA 96 Wing Ser Cys He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Ser 20 25 30 ACG CCG ACC GCG TAC CCC GTC ACT TTC AAG TCT AAG GAC GTT CCC ACT 144 Thr Pro Thr Wing Tyr Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr 35 40 45 TCG CCC CCT GCC GGG TCT TCG GTA GAA ACC ACG CCG GTC AAC CAG CCC 192 Ser Pro Pro Wing Gly Ser Ser Val Glu Thr Thr Pro Val Asn Gln Pro 50 55 60 GCC GTC GGT GCG GCA ATG CGG CTG TTG AGA CGG AAT ACT GCT TTT CAT 240 Wing Val Gly Wing Wing Met Arg Leu Leu Arg Arg Asn Thr Wing Phe His 65 70 75 80 CGT GAA GAT GGC ACG GCA ATT CCC GAT AGC AAA CAA GCA GAA GAA AAG 288 Arg Glu Asp Gly Thr Ala He Pro Asp Ser Lys Gln Ala Glu Glu Lys CTG TCG TTT AAA GAA GGT GAT GTT CTG TTT TTA TAC GGT TCA AAA GAA 336 Leu Ser Phe Lys Glu Gly Asp Val Leu Phe Leu Tyr Gly Ser Lys Glu 100 105 110 AAT AAA CTT CAA CAA CTT AAA AGC GAA ATT CAT AAA CGT AAT CCT GAG 384 Asn Lys Leu Gln Gln Leu Lys Ser Glu He His Lys Arg Asn Pro Glu 115 120 125 GCA AGC ATT ACC ACA TCG GAA AAT GAA AAT AAA AAA TAT AAT TAT CGG 432 Wing Ser He Thr Thr Ser Glu Asn Glu Asn Lys Lys Tyr Asn Tyr Arg 130 135 140 TTT GTC AGT GCC GGT TAT GTG TTT ACT AAA AAC GGA AAA GAT GAA ATT 480 Phe Val Ser Wing Gly Tyr Val Phe Tnr Lys Asn Gly Lys Asp Glu He 145 150 155 160 GAG AAA ACA TCG GAT GAA AAG CAG TTT TCT AAT CGT TTA GGC TAT GAC 52B Glu Lys Thr Ser Asp Glu Lys Gln Phe Ser Asn Arg Leu Gly Tyr Asp 165 170 175 GGT TTT GTA TAT TAT CTC GGA GAA CAT CCT TCC CAA TCT TTA CCG AGC 576 Gly Phe "Val Tyr Tyr Leu Gly Glu His Pro Ser Gln Ser Leu Pro Ser 180 185 190 GCG GGA ACG GTG AAA TAT TCC GGC AAC TGG CAA TAT ATG ACC GAT GCC 624 Wing Gly Thr Val Lys Tyr Ser Gly Asn Trp Gln Tyr Met Thr Asp Ala 195 200 205 ATA CGT CAT CGG AGA GGT AAG GGG GTT TCC AGT GTG GAT TTG GGT TAT 672 He Arg His Arg Arg Gly Lys Gly Val Ser Ser Val Asp Leu Gly Tyr 210 215 220 ACC ACA TAT TAT GGT AAT GAA ATT GGG GCA GCT TCT TAT GAG GCT AGG 720 Thr Thr Tyr Tyr Gly Asn Glu He Gly Wing Wing Ser Tyr Glu Wing Arg 225 230 235 240 GAT GCC GAT GGC CGG GAA AAA CAT CCT GCC GAA TAT ACG GTT AAT TTC 768 Asp Wing Asp Gly Arg Glu Lys His Pro Wing Glu Tyr Thr Val Asn Phe 245 250 255 GAC AAA AAA AAC CTG GAA GGT AAG TTG ATT AAA AAT CAG TAT GTG CAA 816 Asp Lys Lys Asn Leu Glu Gly Lys Leu He Lys Asn Gln Tyr Val Gln 260 265 270 AAG AGA GAT GAT CCT AAA AAT CCA CTG ACC ATT TAC AAC ATT ACC GCA 864 Lys Arg Asp Asp Pro Lys Asn Pro Leu Thr He Tyr Asn He Thr Wing 275 280 285 ACA TTG GAC GGC AAC CGC TTT ACC GGC AGT GCC AAA GTT AGC ACC GAG 912 Thr Leu Asp Gly Asn Arg Phe Thr Gly Ser Ala Lys Val Ser Thr Glu 290 295 300 GTG AAG ACG CAA CAC GCT GAT AAA GAA TAT TTG TTT TTC CAT ACC GAT 960 Val Lys Thr Gln His Wing Asp Lys Glu Tyr Leu Phe Phe His Thr Asp 305 310 315 320 GCC GAT CAG CGG CTT GAG GGC GGT TTT TTC GGC GAT AAC GGA GAA GAG 1008 Wing Asp Gln Arg Leu Glu Gly Gly Phe Ghe Asp Asn Gly Glu Glu 325 330 335 CTT GCC GGG CGG TTT ATC AGT AAC GAC AAC AGC GTA TTC GGC GTG TTC 1056 Leu Wing Gly Arg Phe He Ser As Asp Asn Ser Val Phe Gly Val Phe 340 345 350 GCA GGC AAA CAA AAA ACA GAG ACA GCA AAC GCA TCA GAT ACA AAT CCT 1104 Wing Gly Lys Gln Lys Thr Glu Thr Wing Asn Wing Being Asp Thr Asn Pro 355 360 365 GCC CTG CCG TCT GGA AAA CAC ACC AAA ATC TTG GAT TCT CTA AAA ATT 1152 Wing Leu Pro Ser Gly Lys His Thr Lys He Leu Asp Ser Leu Lys He 370 375 380 TCC GTT GAC GAG GCG ACT GAT GAC CAT GCC CGT AAG TTT GCC ATT TCC 1200 Ser Val Asp Glu Wing Thr Asp Asp His Wing Arg Lys Phe Wing He Ser 385 390 395 400 ACT ATG CCC GAT TTT GGT CAT CCC GAC AAA CTT CTT GTC GAA GGG CGT 1248 Thr Met Pro Asp Phe Gly His Pro Asp Lys Leu Leu Val Glu Gly Arg 405 410 415 GAA ATT CCT TTG GTT AGC CAA GAG AAA ACC ATC GAG CTT GCC GAC GGC 1296 Glu He Pro Leu Val Ser Gln Glu Lys Thr He Glu Leu Wing Asp Gly 420 425 430 AGG AAA ATG ACC ATC CGT GCT TGT TGC GAT TTT CTG ACC TAT GTG AAA 1344 Arg Lys Met Thr He Arg Ala cys cys Asp Phe Leu Thr Tyr Val Lys 435 440 445 CTC GGA CGG ATA AAA ACC GAC CGC CCC GCC GTC AAA CCG AAG GCG CAG 1392 Leu Gly Arg He Lys Thr Asp Arg Pro Wing to Lys Pro Lys Wing Gln 450 455 460 GAT GAA GAG GAT GAT ATC GAT AAT GGC GAA GAA AGC GAA GAC GAA 1440 Asp Glu Glu Asp Ser Asp He Asp Asn Gly Glu Glu Ser Glu Asp Glu 465 470 475 480 ATT CBT GAA GAT GAT AAC GGC GAA GAT GAA GTC ACC GAA GAA GAG GAA 1488 He Ser Glu Asp Asp Asn Gly Glu Asp Glu Val Thr Glu Glu Glu Glu 485 490 495 GCT GAA GAA ACC GAA GAA GAA ACT GAT GAA GAC GAA GAG GAA GAA CCC 1536 Glu Glu Glu Thr Glu Glu Glu Thr Asp Glu Asp Glu Glu Glu Glu Pro 500 505 510 GAA GAA ACT GAA GAA GAA ACT GAA GAA ACT GAA GAA GAA ACT GAA 1584 Glu Glu Thlu Glu Glu Thlu Glu Thlu Glu Thlu Glu Thlu Glu Thlu Glu 515 520- 525 GAA ACT GAA GAA AAA TCG CCG ACA GAA GAA GGC AAC GGC GGT TCA GGC 1632 Glu Thr Glu Glu Lys Ser Pro Thr Glu Glu Gly Asn Gly Gly Ser Gly 530 535 540 AGC ATC CTG CCC ACT CCG GAA GCC TCT AAA GGC AGG GAC ATC GAC CTT 1580 Ser He Leu Pro Thr Pro Glu Wing Ser Lys Gly Arg Asp He Asp Leu 545 550 555 560 TTC CTG AAA GGT ATC CGC ACG GCG GAA GCC GAC ATT CCG CAA ATT GGA 1728 Phe Leu Lys Gly He Arg Thr Wing Glu Wing Asp He Pro Gln He Gly 565 570 575 AAA GCA CGC TAT ACC GGC ACT TGG GAA GCG CGT ATC GGC GTG CCG GAT 1776 Lys Wing Arg Tyr Thr Gly Thr Trp Glu Wing Arg He Gly Val Pro Asp 580 585 590 AAG AAA GGC GAA CAG CTA GAT GGC ACT ACG TCC ATT CAA AAG GAT AGC 1824 Lys Lys Gly Glu Gln Leu Asp Gly Thr Thr be He Gln Lys Asp Ser 595 600 £ 05 TAT GCG AAT CAA GCG GCA AAA GCA GAA TTT GAC GTT GAT TTT GGT GCG 1872 Tyr Wing Asn Gln Wing Wing Lys Wing Glu Phe Asp Val Asp Phe Gly Wing 610 615 620 AAG TCG CTT TCA GGT AAG TTG ACA GAA AAA AAT GAT ACA CAC CCC GCT 1920 Lys Ser Leu Ser Gly Lys Leu Thr Glu Lys Asn Asp Thr His Pro Wing 625 630 635 640 TTT TAT ATT GAA AAA GGT GTG ATT GAT GGC AAC GGT TTC CAC GCT TTG 1968 Phe Tyr He Glu Lys Gly Val He Asp Gly Asn Gly Phe His Ala Leu 645 650 655 GCG CGT ACT CGT GAA AAT GGT GTT GAT TTG TCT GGG CAA GGT TCG ACT 2016 Wing Arg Thr Arg Glu Asn Gly Val Asp Leu Ser Gly Gln Gly Ser Thr 660 665 670 AAT CCC CAA AGT TTT AAA GCC AGT AAT CTT CTC GTA GAA GGA GGA TTT 2064 Asn Pro Gln Ser Phe Lys Ala Ser Asn Leu Leu Val Glu Gly Gly Phe 675 680 685 TAT GGT CCG CAG GCG GCA GAG TTG GGT GGT AAT ATT ATC GAC AGT GAC 2112 Tyr Gly Pro Gln Wing Wing Glu Leu Gly Gly Asn He He Asp Ser Asp 690 695 700 CGG AAA Ai GGC GTG GTA TTC GGT GCG AAG AAA GAT ATG CAG GAG GTG 2160 Arg Lys He Gly Val Val Phe Gly Ala Lys Lys Asp Met Gln Glu Val 705 710 715 720 GAA AAA TGA 2169 Glu Lys (2) I NFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 722 amino acids (B) TI PO: amino acid (C) FORM OF HI LO: simple (D) TOPOLOGY: linear (ii) TI PO DE MOLÉCU LA: protein (v) TI PO DE FRAGMENTO: internal (vi) ORIGINAL SOURCE: (B) CEPA: M981 strain of Neisseria meningitidis (xi) DESCRI PTION OF SEQUENCE: SEQ ID NO : 4: Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 Wing Being Cys He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Being 25 30 Thr Pro Thr Wing Tyr Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr 40 45 Ser Pro Pro Wing Gly Ser Val Glu Thr Pro Pro Val Asn Gln Pro 50 55 60 Wing Val Gly Wing Wing Met Arg Leu Leu Arg Arg Asn Thr Wing Phe His 65 70 75 80 Arg Glu Asp Gly Thr Ala He Pro Asp Ser Lys Gln Ala Glu Glu Lys 85 90 95 Leu Ser Phe Lys Glu Gly Asp Val Leu Phe Leu Tyr Gly Ser Lys Glu 100 105 110 Asn Lys Leu Gln Gln Leu Lys Ser Glu He His Lys Arg Asn Pro Glu 115 120 125 Wing Ser He Thr Thr Ser Glu Asn Glu Asn Lys Lys Tyr Asn Tyr Arg 130 135 140 Phe Val Ser Wing Gly Tyr Val Phe Thr Lys Asn Gly Lys Asp Glu He 145 150 155 160 Glu Lys Thr Ser Asp Glu Lys Gln Phe Ser Asn Arg Leu Gly Tyr Asp 165 170 175 Gly Phe Val Tyr Tyr Leu Gly Glu His Pro Ser Gln Ser Leu Pro Ser 80 185 190 Wing Gly Thr Val Lys Tyr Ser Gly Asn Trp Gln Tyr Met Thr Asp Ala 195 200 205 He Arg His Arg Arg Gly Lys Gly Val Ser Ser Val Asp Leu Gly Tyr 210 215 220 Thr Thr Tyr Tyr Gly Asn Glu He Gly Wing Wing Ser Tyr Glu Wing Arg 225 230 235 240 Asp Wing Asp Gly Arg Glu Lys His Pro Wing Glu Tyr Thr Val Asn Phe 245 250 255 Asp Lye Lys Asn Leu Glu Gly Lys Leu He Lys Asn Gln Tyr Val Gln 260 265 270 Lys Arg Asp Asp Pro Lys Asn Pro Leu Thr He Tyr Asn He Thr Ala 275 280 285 Thr Leu Asp Gly Asn Arg Phe Thr Gly Ser Ala Lys Val Ser Thr Glu 290 295 300 Val Lys Thr Gln His Wing Asp Lys Glu Tyr Leu Phe Phe His Thr Asp 305 310 315 320 Wing Asp Gln Arg Leu Glu Gly Gly Phe Phe Gly Asp Asn Gly Glu Glu 325 330 335 Leu Wing Gly Arg Phe He Being Asn Asp Asn Being Val Phe Gly Val Phe 340 345 350 Wing Gly Lys Gln Lys Thr Glu Thr Wing Asn Wing Being Asp Thr Asn Pro 355 360 365 Ala Leu Pro Ser Gly Lys His Thr Lys He Leu Asp Ser Leu Lys He 370 375 380 Ser Val Asp Glu Wing Thr Asp Asp His Wing Arg Lys Phe Wing He Ser 385 390 395 400 Thr Met Pro Asp Phe Gly His Pro Asp Lys Leu Leu Val Glu Gly Arg 405 410 415 Glu He Pro Leu Val Ser Gln Glu Lys Thr He Glu Leu Wing Asp Gly 420 425 430 Arg Lys Met Thr He Arg Aia Cys Cys Asp Phe Leu Thr Tyr Val Lys 435 440 445 Leu Gly Arg He Lys Thr Asp Arg Pro Wing Val Lys Pro Lys Wing Gln 450 455 460 Asp Glu Glu Asp Ser Asp He Asp Asn Gly Glu Glu Ser Glu Asp Glu 465 470 475 480 He Ser Glu Asp Asp Asn Gly Glu Asp Glu Val Thr Glu Glu Glu Glu 485 490 495 Wing Glu Glu Thr Glu Glu Glu Thr Asp Glu Asp Glu Glu Glu Glu Pro 500 505 510 Glu Glu Thr Glu Glu Thr Glu Glu Thr Glu Glu Thr Glu Glu Thr Glu 515 520 525 Glu Thr Glu Glu Lys Ser Pro Thr Glu Glu Gly Asn Gly Gly Ser Gly 530 535 540 Ser He Leu Pro Thr Pro Glu Wing Ser Lys Gly Arg Asp He Asp Leu 545 550 555 560 Phe Leu Lys Gly He Arg Thr Wing Glu Wing Asp He Pro Gln He Gly 565 570 575 Lys Ala Arg Tyr Thr Gly Thr Trp Glu Ala Arg He Gly Val Pro Asp 580 585 590 Lys Lys Gly Glu Gln Leu Asp Gly Thr Thr Ser He Gln Lys Asp Ser 595 600 605 Tyr Ala Asn Gln Ala Ala Lys Ala Glu Phe Asp Val Asp Phe Gly Ala 610 615 620 Lys Ser Leu Ser Gly Lys Leu Thr Glu Lys Asn Asp Thr His Pro Wing 625 630 635 640 Phe Tyr He Glu Lys Gly Val He Asp Gly Asn Gly Phe His Ala Leu 645 650 655 Wing Arg Thr Arg Glu Asn Gly Val Asp Leu Ser Gly Gln Gly Ser Thr 660 665 670 Asn Pro Gln Ser Phe Lys Wing Ser Asn Leu Leu Val Glu Gly Gly Phe 675 680 685 Tyr Gly Pro Gln Wing Wing Glu Leu Gly Gly Asn He He Asp Being Asp 690 695 700 Arg Lys He Gly Val Val Phe Gly Ala Lys Lys Asp Met Gln Glu Val 705 710 715 720 Glu Lys (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 2226 base pairs (B) TI PO: nucleic acid (C) HI LO FORM: double (D) ) TOPOLOGY: linear (ii) TI PO DE MOLÉCU LA: cDNA (vi) SOURCE ORIGINAL: (B) CEPA: H44 / 76 strain of Neisseria meningitidis (ix) CHARACTERISTICS: (A) NAME / KEY: Sequence Code (B) POSITION: 1 ... 2223 (D) OTHER FORMATION: (xi) SEQUENCE DESCRITION: SEQ ID NO: 5: ATG TGT AAA CCG AAT TAT GGC GGC ATT GTC TTG TTG CCC TTA CTT TTG 48 Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 GCA TCT TGT ATT GGC GGC AAT TTC GGC GTG CAG CCT GTT GTC GAA TCA 96 Wing Ser Cye He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Ser 20 25 30 ACG CCG ACC GCG TAC CCC GTC ACT TTC AAG TCT AAG GAC GTT CCC ACT 144 Thr Pro Thr Wing Tyr Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr 35 40 45 CCG CCC CCT GCC AAA CCT TCT ATA GAA ACC ACG CCG GTG CCG TCA ACC 192 Pro Pro Pro Wing Lys Pro Ser He Glu Thr Thr Pro Val Pro Ser Thr 50 55 60 GGG CCT GCC GTC GGT GCG GCA ATG CGG CTG TTG AGG CGG ATT TTC GCA 240 Gly Pro Wing Val Gly Wing Wing Met Arg Leu Leu Arg Arg He Phe Wing 65 70 75 80 ACT TCT GAT AAG GTT GGC AAT GAT TTT CCA AAT AGC AAA CAA GCA GAA 288 Thr Ser Asp Lys Val Gly Asn Asp he Pro Asn Ser Lys Gln Ala Glu 85 90 95 GAA AAG CTG TCG TTT AAA GAA GGT GAT GTT CTG TTT TTA TAC GGT TCA 336 Glu Lys Leu Ser Phe Lys Glu Gly Asp Val Leu Phe Leu Tyr Gly Ser 100 105 110 AAA AAA GAT AAA CTT CAG TGG CTT AAG GAT AAA ATT CAT CAA CGC AAT 384 Lys Lys Asp Lys Leu Gln Trp Leu Lys Asp Lys He His Gln Arg Asn 115 120 125 CCT AAT GTA GAA ATT AGG ACA TCA GAA AAT GAA AAT AAA AAA TAT GGT 432 Pro Asn Val Glu He Arg Thr Ser Glu Asn Glu Asn Lys Lys Tyr Gly 130 135 140 TAT GAA TTT GTG GAT GCC GGT TAT GTA TAT ACT AAA AAC GGA ACA GAT 480 Tyr Glu Phe Val Asp Wing Gly Tyr Val Tyr Thr Lys Asn Gly Thr Asp 145 150 155 160 GAA ATT GAG TGG ACT TCA AAT CGC AAG CAG TTT TCT AAT CGT TTT GGC 526 Glu He Glu Trp Thr Ser Asn Arg Lys Gln Phe Ser Asn Arg Phe Gly 165 170 175 TAC GAC GGT TTT GTA TAT TAT TCC GGA GAA CAT CCT TCC CAA TCT TTA 576 Tyr Asp Gly Phe Val Tyr Tyr Ser Gly Glu His Pro Ser Gln Ser Leu 180 185 190 CCG AGC GCG GGA ACG GTG CAA TAT TCC GGT AAC TGG CAA TAT ATG ACC 624 Pro Be Wing Gly Thr Val Gln Tyr Ser Gly Asn Trp Gln Tyr Met Tfar 195 200 205 GAT GCC ATA CGT CAT CGA ACA GGA AAA GCA GGA GAT CCT AGC GAA GAT 672 Asp Ala He Arg His Arg Thr Gly Lys Ala Gly Asp Pro Ser Glu Asp 210 215 220 TTG GGT TAT CTC GTT TAT TAC GGT FAC AAT GTC GGA GCA ACT TCT TAT 720 Leu Gly Tyr Leu Val Tyr Tyr Gly Gln Asn Val Gly Wing Thr Ser Tyr 225 230 235 240 GCT GCG ACT GCC GAC GAC CGG GAG GGA AAA CAT CCT GCC GAA TAT ACG 768 Wing Wing Thr Wing Asp Asp Arg Glu Gly Lys His Pro Wing Glu Tyr Thr 245 250 255 GTT GAT TTC GAT AAG AAA ACT TTG ACG GGT CAA TTA ATT AAA AAT CAG 816 Val Asp Phe Asp Lys Thr Leu Thr Gly Gln Leu He Lys Asn Gln 260 265 270 TAT GTG CAA AAG AAA ACC GAT GAA AAG AAA CCA CTG ACC ATT TAC GAC 864 Tyr Val Gln Lys Lys Thr Asp Glu Lys Lys Pro Leu Thr He Tyr Asp 275 280 285 ATT ACC GCA ACA TTG GAC GGC AAC CGC TTT ACC GGC AGT GCC AAA GTT 912 He Thr Wing Thr Leu Asp Gly Asn Arg Phe Thr Gly Ser Wing Lys Val 290 295 300 AAC ACC GAG TTG AAG ACG AGC CAC GCT GAT AAA GAG CAT TTG TTT TTC 960 Asn Thr Glu Leu Lys Thr Ser His Wing Asp Lys Glu His Leu Phe Phe 305 310 315 320 CAT ACC GAT GCC GAT CAG CGG CTT GAG GGC GGT TTT TTC GGC GAT AAG 1008 His Thr Asp Wing Asp Gln Arg Leu Glu Gly Gly Phe Phe Gly Asp Lys 325 330 335 GGG GAA GAG CTT GCC GGA CGG TTT ATC AGC AAC GAC AAC AGC GTA TTC 1056 Gly Glu Glu Glu Leu Gly Arg Phe He As As Asp Asn Ser Val Phe 345 345 350 GGC GTC TTC GCA GGC AAA AAA ACA AAC GCA TCA AAC GCA GAC GAT ACA 1104 Gly Val Phe Wing Gly Lys Lys Thr Asn Wing Ser Asn Wing Wing Asp Thr 355 360 365 AAT CCT GCT ATG CCG TCT GAA AAA CAC ACC AAA ATC TTG GAT TCT CTG 1152 Asn Pro Wing Met Pro Ser Glu Lys His Thr Lys He Leu Asp Ser Leu 370 375 380 AAA ATT TCC GTT GAC GAG GCG ACG GAT AAA AAT GCC CGC CCG TTT GCC 1200 Lye He Ser Val Asp Glu Wing Thr Asp Lys Asn Wing Arg Pro Phe Wing 385 390 395 400 ATT TCC CCT CTG CCC GAT TTT GGC CAT CCC GAC AAA CTC CTT GTC GAA 1248 He Ser Pro Leu Pro Asp Phe Gly His Pro Asp Lys Leu Leu Val Glu 405 410 415 GGG CGT GAA ATT CCT TTG GTT AGC CAA GAG AAA ACC ATC GAG CTT GCC 1296 Gly Arg Glu He Pro Leu Val Ser Gln Glu Lys Thr He Glu Leu Wing 420 425 430 GAC GGC AGG AAA ATG ACC GTC CGT GCT TGT TGC GAT TTT CTG ACC TAT 1344 Asp Gly Arg Lys Met Thr Val Arg Wing Cys Cys Asp Phe Leu Thr Tyr 435 440 445 GTG AAA CTC GGA CGG ATA AAA ACT GAC CGC CCA GCA AGT AAA CCA AAG 1392 Val Lys lie Gly Arg Xle ys Tnx Asp Arg Pro Wing Ser Lys Pro Lys 450 455 460 GCG GAA GAT AAA GGG AAG GAT GAA GAG GAT ACA GGC GTT GGT AAC GAC 1440 Wing Glu Asp Lys Gly Lys Asp Glu Glu Asp Thr Gly Val Gly Asn Asp 465 470 475 480 GAA GAA GGC ACG GAA GAT GAA GCC GCA GAA GGC AGC GAA GGA GGC GAA 1488 Glu Glu Gly Thr Glu Asp Glu Ala Glu Wing Gly Glu Gly Gly Glu 485 490 495 GAC GAA ATC GGC GAT GAA GGA GGA GGT GCG GAA GAC GAA GCC GCA GAA 1536 Asp Glu He Gly Asp Glu Gly Gly Gly Wing Glu Asp Glu Ala Glu Wing 500 505 510 AAC GAA GGC GGC GAA GAA GAC GAA GCT GAA GAA CCT GAA GAA CCC GAA 1584 Asn Glu Gly Gly Glu Glu Asp Glu Glu Wing Glu Pro Glu Glu Pro Glu 515 520 525 GAA GAA TCG CCG GCA GAA GGC GGC GGT GGT GGT TCA GAC GGC ATC CTG 1632 Glu Glu Ser Pro Glu Wing Gly Gly Gly Gly Gly Ser Asp Gly He Leu 530 535 540 CCC GCT CCG GAA GCT CCT AAA GGC AGG GAT ATC GAC CTT TTC CTG AAA 1680 Pro Wing Pro Glu Wing Pro Lys Gly Arg Asp He Asp Leu Phe Leu Lys 545 550 555 560 GGT ATC CGC ACG GCG GAA GCC GAC ATT CCG CAA ACT GGA AAA GCA CTC 1723 sly He Arg 7fcr Wing Glu Wing Asp He Pro Gln Thr Gly Lys Wing Ax 56S 570 575 TAT ACC GGC ACT TßG GAA GCG CGT ATC AGC SAA CCC ATT CAA TGG GAC 1776 Tyr Thr Gly Thr Trp Glu Wing Arg Jle Sar Z ys e er He Glp Trp Aep AAT CA.T GCG GAT AAA AAA GCG GCA AAA GCA GAA TTT GAC GTT GAT TTC 1B24 Aßn His Wing Asp Lys Lyp Wing Wing Lys Wing Glu Phe Asp Val Aap S at 535 600 605 GGC GAG AAA TCG ATT TCC GGA ACG CTG ACG GAG AAA AAC GGT GTA CAA 1872 Gly Glu Lys Ser Be Gly Thr Leu Thr Glu Lys Asn Gly Val Gln 610 615 620 CCT GCT TTC CAT ATT GAA AAC GGC GTG ATT GAG GGC AAT GGT TTC CAC 1920 Pro Wing Phe His He Glu Asn Gly Val He Glu Gly Asn Gly Phe His 625 630 635 640 GCG ACA GCG CGC ACT CGG GAT AAC GGC ATC AAT CTT TCG GGA AAT GAT 1968 Wing Thr Wing Arg Thr Arg Asp Asn Gly He Asn Leu Ser Gly Asn Asp 645 650 655 TCG ACT AAT CCT CCA AGT TTC AAA GCC AAT AAT CTT CTT GTA ACA GGC 2016 Ser Thr Asn Pro Pro Ser Phe Lye Wing Asn Asn Leu Leu Val Thr Gly 660 665 670 GGC TTT TAC GGC CCG CAG GCG GAG GAA TTG GGC GGT ACT ATT TTC AAT 2064 Gly Phe Tyr Gly Pro Gln Wing Glu Glu Glu Leu Gly Gly Thr He Phe Asn 675 680 685 AAT GAT GGG AAA TCT CTT GOT ATA ACT GAA GAT ACT GAA AAT GAA GCT 2112 Asn Asp Gly Lys Ser Leu Gly He Thr Glu Asp Thr Glu Asn Glu Wing 690 695 700 GAA GCT GAA GTT GAA AAT GAA GCT GGT GTT GGC GAA CAG TTA AAA CCT 2160 Glu Ala Glu Val Glu Asn Glu Ala Gly Val Gly Glu Gln Leu Lys Pro 705 710 715 720 GAA GCT AAA CCC CAA TTC GGC GTG GTC TTC GGT GCG AAG AAA GAT AAT 2208 Glu Ala Lys Pro Gln Phe Gly Val Val Phe Gly Ala Lys Lys Asp Asn 725 730 735 AAA GAG GTG GAA AAA TGA 2226 Lys Glu Val Glu Lys 740 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 741 amino acids (B) TYPE: amino acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (B) CEPA: strain of H44 / 76 of Neisseria meningitidis (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 6: Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 Wing Being Cys He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Being 25 30 Thr Pro Thr Wing Tyr Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr 40 45 Pro Pro Pro Wing Lys Pro Be He Glu Thr Thr Pro Val Pro Be Thr 50 55 60 Gly Pro Wing Val Gly Wing Wing Met Arg Leu Leu Arg Arg He Phe Wing 65 70 75 80 Thr Ser Asp Lys Val Gly Asn Asp Phe Pro Asn Ser Lys Gln Wing Glu 85 90 95 Glu Lys Leu Ser Phe Lys Glu Gly Asp Val Leu Phe Leu Tyr Gly Ser 100 105 110 Lys Lys Asp Lys Leu Gln Trp Leu Lys Asp Lys He His Gln Arg Asn 115 120 125 Pro Asn Val Glu He Arg Thr Ser Glu Asn Glu Asn Lys Lys Tyr Gly 130 135 140 Tyr Glu Phe Val Asp Wing Gly Tyr Val Tyr Thr Lys Asn Gly Thr Asp 145 150 155 160 Glu He Glu Trp Thr Ser Asn Arg Lys Gln Phe Ser Asn Arg Phe Gly 165 170 175 Tyr Asp Gly Phe Val Tyr Tyr Ser Gly Glu His Pro Ser Gln Ser Leu 180 185 190 Pro Ser Wing Gly Thr Val Gln Tyr Ser Gly Asn Trp Gln Tyr Met Thr 195 200 205 Asp Ala He Arg His Arg Thr Gly Lys Ala Gly Asp Pro Ser Glu Asp 210 215 220 Leu Gly Tyr Leu Val Tyr Tyr Gly Gln Asn Val Gly Ala Thr Ser Tyr 2 5 230 23S 240 Ala Ala Thr Ala Asp Asp Arg Glu Gly Lys His Pro Ala Glu Tyr Thr 2 5 250 255 Val Asp Phe Asp Lys Lys Thr Leu Thr Gly Gln Leu He Lys Asn Gln 260 265 270 Tyr Val Gln Lys Lys Thr Asp Glu Lys Lys Pro Leu Thr He Tyr Asp 275 280 285 He Thr Wing Thr Leu Asp Gly Asn Arg Phe Thr Gly Ser Wing Lys Val 290 295 300 Asn Thr Glu Leu Lys Thr Ser Hie Wing Asp Lys Glu His Leu Phe Phe 305 310 315 320 His Thr Asp Wing Asp Gln Arg Leu Glu Gly Gly Phe Phe Gly Asp Lys 325 330 335 Gly Glu Glu Leu Gly Wing Arg Phe He Being As Asp Asn Being Val Phe 340 345 350 Gly Val Phe Wing Gly Lys Lys Thr Asn Wing Being Asn Wing Wing Asp Thr 355 360 365 Asn Pro Wing Met Pro Ser Glu Lys His Thr Lys He Leu Asp Ser Leu 370 375 380 Lys He Ser Val Asp Glu Wing Thr Asp Lys Asn Wing Arg Pro Phe Wing 385 390 395 400 He Be Pro Pro Leu Pro Asp Phe Gly His Pro Asp Lys Leu Leu Val Glu 405 410 415 Gly Arg Glu He Pro Leu Val Ser Gln Glu Lys Thr He Glu Leu Ala 420 425 430 Asp Gly Arg Lys Met Thr Val Arg Wing Cvs Cys Asp Phe Leu Thr Tyr 435 440 445 Val Lys Leu Gly Arg He Lys Thr Asp Arg Pro Wing Ser Lys Pro Lys 450 455 460 Wing Glu Asp Lys Gly Lys Asp Glu Glu Asp Thr Gly Val Gly Asn Asp 465 470 475 480 Glu Glu Gly Thr Glu Asp Glu Wing Wing Glu Gly Ser Glu Gly Gly Glu 485 490 495 Asp Glu He Gly Asp Glu Gly Gly Gly Ala Glu Asp Glu Ala Glu Wing 500 505 S10 Asn Glu Gly Glu Glu Glu Asp Glu Glu Wing Glu Pro Glu Glu Pro Glu 515 S20 525 Glu Glu Ser Pro Glu Wing Gly Gly Gly Gly Gly Ser Asp Gly He Leu 530 535 540 Pro Wing Pro Glu Wing Pro Lys Gly Arg Asp He Asp Le-u Phe IAM.? 5 5 550 555 560 Gly He Arg Thr Wing Glu Wing Asp He Pro Gln Thr Gly Lys Wing Arg 565 570 575 Tyr Thr Gly Thr Trp Glu Wing Arg He Ser Lys Pro He Gln Trp Asp 580 585 590 Asn His Wing Asp Lys Lys Wing Wing Lys Wing Glu Phe Asp Val Asp Phe 595 600 605 Gly Glu Lys Ser Be Gly Thr Leu Thr Glu Lys Asn Gly Val Gln 610 615 620 Pro Ala Phe His He Glu Asn Gly Val He Glu Gly Asn Gly Phe His 625 630 635 640 Ala Thr Ala Arg Thr Arg Asp Asn Gly He Asn Leu Ser Gly Asn Asp 645 650 655 Ser Thr Asn Pro Pro Ser Phe Lys Wing Asn Asn Leu Leu Val Thr Gly 660 665 670 Gly Phe Tyr Gly Pro Gln Wing Glu Glu Leu Gly Gly Thr He Phe Asn 675 6B0 685 A = n Asp Gly Lys Ser Leu Gly He Thr Glu Asp Thr Glu Asn Glu Wing 690 695 700 Glu Ala Glu Val Glu Asn Glu Ala Gly Val Gly Gllu Gln Leu Lys Pro 705 710 715 720 Glu Ala Lys Pro Gln Phe Gly Val Val Phe Gly Ala Lys Lys Asp Asn 725 730 735 Lys Glu Val Glu Lys 740 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 2262 base pairs (B) TI PO: nucleic acid (C) FORM OF HI LO: double (D) TOPOLOGY : linear (ii) TI PO DE MOLÉCU LA: cDNA (vi) SOURCE ORIGINAL: (B) CEPA: M990 strain of Neisseria meningitidis (¡x) CHARACTERISTICS: (A) NAME / KEY: Sequence code (B) POSITION: 1 ... 2259 (D) OTHER TRAINING: (xi) SEQUENCE DESCRITION: SEQ ID NO: 7: ATG TGT AAA CCG AAT TAT GGC GGC ATT GTC TTG TTG CCC TTA CTT TTA 48 Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 GCA TCT TGT ATC GGC GGC AAT TTC GGC GTA CAG CCT GTT GTC GAA TCA 96 Wing Ser Cys He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Ser 20 25 30 ACG CCG ACC GCG CCA ACT CTG TCA GAT TCC AAA TCT TCC AAT CCT GCG 144 Thr Pro Thr Wing Pro Thr Leu Ser Asp Ser Lys Ser Ser Asn Pro Wing 35 40 45 GAT AAG CCT GCT CCA GCT CCT GCC GAG CCT TCG GTA GAA ATC ACG CCG 192 Asp Lys Pro Pro Wing Pro Pro Wing Glu Pro Ser Val Glu He Thr Pro SO 55 60 GTC AAG CGG CCC GCC GTC GGT GCG GCA ATG CGG CTG CCA AGG CGG AAT 240 Val Lys Arg Pro Wing Val Gly Wing Wing Met Arg Leu Pro Arg Arg Asn 65 70 75 80 ATC GCA ACT TTT GAT AAA AAT GGT AAT GAA ATT CCC AAT AGT AAG CAG 288 He Wing Thr Phe Asp Lys Asn Gly Asn Glu He Pro Asn Ser Lys Gln 85 90 95 GAG GAG GAT TAT CTG CCG CTC AAA GAG AAG GAT ATC CTG TTT TTA GAC 336 Wing Glu Glu Tyr Leu Pro Leu Lys Glu Lys Asp He Leu Phe Leu Asp 100 105 110 GGT ACG CCG AAA GAA CAG GCT GAC AAA CTT AAA AAG GAA ATC AAC GGA 384 Gly Thr Pro Lys Glu Gln Wing Asp Lys Leu Lys Lys Glu He Asn Gly 115 120 125 CGG CAT CCT AAT GCA CCA ATC TAC ACG TCC GAT TTA AAA GAT GAT GCG 432 Arg His Pro Asn Wing Pro He Tyr Thr Ser Asp Leu Lys Asp Asp Wing 130 135 140 TAT CAA TAT AAA TAT GTC CGG GCC GGA TAT GTT TAT ACT AGA TAT GGA 480 Tyr Gln Tyr Lys Tyr Val Arg Wing Gly Tyr Val Tyr Thr Arg Tyr Gly 145 150 155 160 ACA GAT GAA ATC GAA CAG AAC TCA GGC GGT AAG CGG GTT ACC CAC CGC 528 Thr Asp Glu He Glu Gln Asn Ser Gly Gly Lys Arg Val Thr His Arg 165 170 175 TTA GGT TAT GAC GGT TTT GTA TAT TAT TCC GGA GAA CGT CCT TCC CAA 576 Leu Gly Tyr Asp Gly Phe Val Tyr Tyr Ser Gly Glu Arg Pro Ser Gln 180 185 190 TCT TTA CCG AGT GCG GGA ACG GTG GAA TAT TCT GGT AAC TGG CAA TAT 624 Ser Leu Pro Ser Wing Gly Thr Val Glu Tyr Ser Gly Asn Trp Gln Tyr 195 200 205 ATG ACC GAT GCC AAA CGT CAT CGA GCA GGT CAG GCG GTT GGC ATT GAC 672 Met Thr Asp Ala Lys Arg His Arg Ala Gly Gln Ala Val Gly He Asp 210 215 220 AAT TTG GGT TAT ATC ACA TTT TAT GGT AAC GAT GTT GGT GCA ACT TCT 720 Asn Leu Gly Tyr He Thr Phe Tyr Gly Asn Asp Val Gly Wing Thr Ser 225 230 235 240 TAT GCG GCT AAG GAT GTC GAC GAA AGG GAA AAG CAT CCT GCC AAA TAT 768 Tyr Ala Ala Lys Asp Val Asp Glu Arg Glu Lys His Pro Ala Lys Tyr 245 250 255 ACG GTT GAT TTT GAT AAC AAA ACC ATG AAT GGC AAG CTG ATT AAA AAT 816 Thr Val Asp Phe Asp Asn Lys Thr Met Asn Gly Lys Leu He Lys Asn 260 265 270 CAG TAT GTG CGA AAT AAA AAA GAT GAA CCC AAA AAA CCG CTG ACC ATT 864 Gln Tyr Val Arg Asn Lys Lys Asp Glu Pro Lys Lys Pro Leu Thr He 275 280 285 TAC GAC ATT ACT GCA AAA TTG GAC GGC AAC CGC TTT ACC GGC AGT GCC 912 Tyr Asp He Tnr Wing Lys Leu Asp Gly Asn Arg Phe Thr Gly Ser Wing 290 295 300 AAG GTC AAT CCT GAT TTA GCG AAA AAC CTT GCC GGT AAT GAG CGT TTG 960 Lys Val Asn Pro Asp Leu Ala Lys Asn Leu Ala Gly Asn Glu Arg Leu 305 310 315 320 TTT TTC CAT GCC GAT GCC GAT CAG CGG CTT GAG GGC GGT TTT TTC GGC 1008 Phe Phe His Wing Asp Wing Asp Gln Arg Leu Glu Gly Gly Phe Phe Gly 325 330 335 GAT AAC GGA GAA GAG CTT GCC GGA CGG TTT ATC AGC AAC GAC AAC AGC 1056 Asp Asn Gly Glu Glu Leu Wing Gly Arg Phe He Ser As Asp Asn Ser 340 345 350 GTA GTC TTC GTC GTC TTC GCA GGC AAA AAA ACA GAG ACA GCA AAC GCA GCA 1104 Val Phe Gly Val Phe Gly Lys Lys Thr Glu Thr Ala Wing Ala Ala 355 360 365 GAT ACA AAA CCT GCC CTG CCG TCT GGA AAA CAC ACC AAA ATC TTG GAT 1152 Asp Thr Lys Pro Ala Leu Pro Ser Gly Lys His Thr Lys He Leu Asp 370 375 380 TCT CTA AAA ATT TCC GTT GAC GAG GCG ACT GAT GGC CAT GCC CGT AAG 1200 Ser Leu Lys He Ser Val Asp Glu Wing Thr Asp Gly His Wing Arg Lys 385 390 395 400 TTT GCC ATT TCC TCT ATG CCC GAT TTT GGT CAT CCC GAC AAA CTT CTT 1248 Phe Wing Be Ser Met Pro Asp Phe Gly His Pro Asp Lys Leu Leu 405 410 415 GTC GAA GGG CGT GAA ATT CCT TTG GTA AAC GAA GAA CAA ATC ATC AAG 1296 Val Glu Gly Arg Glu Pro Pro Leu Val Asn Glu Glu Gln He He Lys 420 425 430 CTT GCC GAC GGC AGG AAA ATG ACC GTC CGT GCT TGT TGC GAC TTT TTG 1344 Leu Wing Asp Gly Arg Lys Met Thr Val Arg Wing Cys Cys Asp Phe Leu 435 440 445 ACC TAT GTG AAA CTC GGA CGG ATA AAA ACC GAT CGC CCG GCA AGT AAA 1392 Thr Tyr Val Lys Leu Gly Arg He Lys Thr Asp Arg Pro Wing Ser Lys 450 455 460 CCA AAG GCG GAA GAT AAA GGG GAG GAT GAA GAG GGT GCA GGC GTT GAT 1440 Pro Lys Wing Glu Asp Lys Gly Glu Asp Glu Glu Gly Wing Gly Val Asp 465 470 475 480 AAC GAC GAA GAA AGC GAA GAC GAA GCC GTA GAA GAA GAA GGC GGC GAA 1488 Asn Asp Glu Glu Ser Glu A = p Glu Wing Val Glu Asp Glu Gly Gly Glu 485 490 495 GAA GAC GAA ACT TCC GAA GAG GAT AAT GGC GAA GAA GAA GAA GCA ACC 1536 Glu Asp Glu Thr Ser Glu Glu Asp Asn Gly Glu Asp Glu Glu Ala Thr 500 505 5io GCC GAA GAA GAA ACC GAA GAA GTT GAT GAA GCC GAA GAG GAG GAA GTT 1584 Glu Glu Glu Glu Thr Glu Glu Val Asp Glu Glu Wing Glu Glu Glu Val 515 520 525 GAA GAA CCC GAA GAA AAA TCG CCG GCA GAA GGC AAC GGC GGC TCA GGC 1632 Glu Glu Pro Glu Glu Lys Ser Pro Glu Wing Gly Gly As Gly 530 535 540 AGC ATC CTG CCT GCC CTA GAA GCC TCT AAA GGC AGG GAC ATC GAC CTT 1680 Ser He Leu Pro Ala Leu Glu Ala Ser Lys Gly Arg Asp He Asp Leu 545 550 555 560 TTC CTG AAA GGT ATC CGC ACG GCA GAA ACG GAT ATT CCG CAA AGC GGA 1728 Phe Leu Lys Gly He Arg Thr Wing Glu Thr Asp He Pro Gln Ser Gly 565 570 575 ACG GCG CAT TAT ACC GGC ACT TGG GAA GCG CGT ATC GGC AAA CCC ATT 1776 Thr Wing His Tyr Thr Gly Thr Trp Glu Wing Arg He Gly Lys Pro He 580 585 590 CAA TGG GAC AAT CAG GCG GAT GAA AAA GCG GCA AAA GCA GAA TTT ACC 1824 Gln Trp Asp Asn Gln Wing Asp Glu Lys Ala Wing Lys Wing Glu Phe Thr 595 600 605 GTT GAT TTC GAC AAG AAA TCG ATT TCC GGA AAG CTG ACG GAG CAA AAC 1872 Val Asp Phe Asp Lys Lys Ser He Ser Gly Lys Leu Thr Glu Gln Asn 610 615 620 GGC GTA GAA CCT GCT TTC CAT ATT GAA GAC GGC AAG ATT GAT GGC AAC 1920 Gly Val Glu Pro Wing Phe His He Glu Asp Gly Lys He Asp Gly Asn 625 630 635 640 GGT TTC CAC GCG ACA GCG CGC ACT CGG GAG AGC GGC ATC AAT CTT TCG 1968 Gly Phe His Wing Thr Wing Arg Thr Arg Glu Ser Gly He Asn Leu Ser 645 650 655 GGA AAT GGT TCG ACC GAC CCC AAA ACA TTC CAA GCT AGT AAT CTT CGT 2016 Gly Asn Gly Ser Thr Asp Pro Lys Thr Phe Gln Wing Ser Asn Leu Arg 660 665 670 GTA GAA GGA GGA TTT TAC GGC CCG CAG GCG GCG GAA TTG GGC GGT ACT 2064 Val Glu Gly Gly Phe Tyr Gly Pro Gln Ala Wing Glu Leu Gly Gly Thx 675 680 685 ATT TTC AAT AAT GAT GGG AAA TCT CTT AGT ATA ACT GAA AAT ATT GAA 2112 He Phe Asn Asn Asp Gly Lys Ser Leu Ser He Thr Glu Asn He Glu 690 695 700 AAT GAA GCT GAA GCT GAA GTT GAA GTT GAA GCT GAA GCT GAA GTT GAA 2160 Asn Glu Ala Glu Ala Glu Val Glu Val Glu Ala Glu Ala Glu Val Glu 705 710 715 720 GTT GAA GCT GTAT GGC AAA CAG TTA GAA CCT GAT GAA GTT AAA CAC 2208 Val Glu Wing Asp Val Gly Lys Gln Leu Glu Pro Asp Glu Val Lys His 725 730 735 AAA TTC GGC GTG GTA TTC GGT GCG AAG AAA GAT ATG CAG GAG GTG GAA 2256 Lys Phe Gly Val Val Phe Gly Ala Lys Lys Asp Met Gln Glu Val Glu 740 745 750 AAA TGA 2262 Lys (2) IN TRAINING FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 753 amino acids (B) TI PO: amino acid (C) THREAD FORM: single (D) TOPOLOGY: linear ( ii) TI PO DE MOLÉCU LA: protein (v) TI PO DE FRAGMENTO: internal (vi) ORIGINAL ENTITY: (B) CEPA: M990 strain of Neisseria meningitidis (xi) SEQUENCE DESCRITION: SEQ ID NO: 8: Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 Wing Ser Cys He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Ser 20 25 30 Thr Pro Thr Wing Pro Thr Leu Ser Asp Being Lys Ser Being Asn Pro Wing 35 40 45 Asp Lys Pro Wing Pro Wing Pro Wing Glu Pro Being Val Glu He Thr Pro 50 55 60 Val Lys Arg Pro Wing Val Gly Wing Wing Met Arg Leu Pro Arg Arg Asn 65 70 75 80 He Ala Thr Phe Asp Lys Asn Gly Asp Glu He Pro Asn Ser Lys Gln 85 90 95 Wing Glu Glu Tyr Leu Pro Leu Lys Glu Lys Asp He Leu Phe Leu Asp 100 105 110 Gly Thr Pro Lys Glu Gln Wing Asp Lys Leu Lys Lys Glu He Asn Gly 115 120 125 Arg His Pro Asn Ala Pro He Tyr Thr Ser Asp Leu Lys Asp Asp Ala 130 135 140 Tyr Gln Tyr Lys Tyr Val Arg Wing Gly Tyr Val Tyr Thr Arg Tyr Gly 145 150 155 160 Thr Asp Glu He Glu Gln Asn Ser Gly Gly Lys Arg Val Thr His Arg 165 170 175 Leu Gly Tyr Asp Gly Phe Val Tyr Tyr Ser Gly Glu Arg Pro Ser Gln 180 185 190 Ser Leu Pro Ser Wing Gly Thr Val Glu Tyr Ser Gly Asn Trp Gln Tyr 195 200 205 Met Thr Asp Ala Lys Arg His Arg Ala Gly Gln Ala Val Gly He Asp 210 215 220 Asn Leu Gly Tyr He Thr Phe Tyr Gly Asn Asp Val Gly Wing Thr Ser 225 230 235 240 Tyr Ala Ala Lys Asp Val Asp Glu Arg Glu Lys His Pro Ala Lys Tyr 245 250 255 Thr Val Asp Phe Asp Asn Lys Thr Met Asn Gly Lys Leu He Lys Asn 260 265 270 Gln Tyr Val Arg Asn Lys Lys Asp Glu Pro Lys Lys Pro Leu Thr He 275 280 285 Tyr Asp He Thr Wing Lys Leu Asp Gly Asn Arg Phe Thr Gly Ser Wing 290 295 300 Lys Val Asn Pro Asp Leu Wing Lys Asn Leu Wing Gly Asn Glu Arg Leu 305 310 315 320 Phe Phe His Wing Asp Wing Asp Gln Arg Leu Glu Gly Gly Phe Phe Gly 325 330 335 Asp Asn Gly Glu Glu Leu Wing Gly Arg Phe He As As Asn Asn Ser 340 345 350 Val Phe Gly Val Phe Wing Gly Lys Lys Thr Glu Thr Wing Asn Wing Wing 35S 360 365 Asp Thr Lys Pro Wing Leu Pro Ser Gly Lys His Thr Lys He Leu Asp 370 375 380 Ser Leu Lys He Ser Val Asp Glu Ala Thr Asp Gly His Ala Arg Lys 385 390 395 400 Phe Wing Being Ser Met Pro Asp Phe Gly His Pro Asp Lys Leu Leu 405 410 415 Val Glu Gly Arg Glu He Pro Leu Val Asn Glu Glu Gln He He Lys 420 425 430 Leu Wing Asp Gly Arg Lys Met Thr Val Arg Wing Cys Cys Asp Phe Leu 435 440 445 Thr Tyr Val Lys Leu Gly Arg He Lys Thr Asp Arg Pro Wing Ser Lys 450 455 460 Pro Lys Wing Glu Asp Lys Gly Glu Asp Glu Glu Gly Wing Gly Val Asp 465 470 475 480 Asn Asp Glu Glu Ser Glu Asp Glu Wing Val Glu Asp Glu Gly Gly Glu 485 490 495 Glu Asp Glu Thr Ser Glu Glu Asp Asn Gly Glu Asp Glu Glu Wing Thr 500 505 510 Wing Glu Glu Glu Thr Glu Glu Val Asp Glu Wing Glu Glu Glu Glu Val 515 520 525 Glu Glu Pro Glu Glu Lys Ser Pro Wing Glu Gly Asn Gly Gly Ser Gly 530 535 540 Ser He Leu Pro Wing Leu Glu Wing Ser Lys Gly Arg Asp He Asp Leu 545 550 555 560 Phe Leu Lys Gly He Arg Thr Wing Glu Thr Asp He Pro Gln Ser Gly 565 570 575 Thr Ala His Tyr Thr Gly Thr Trp Glu Wing Arg He Gly Lys Pro He 580 585 590 Gln Trp Asp Asn Gln Wing Asp Glu Lys Wing Wing Lys Wing Glu Phe Thr 595 600 605 Val Asp Phe Asp Lys Lys Ser Be Gly Lys Leu Thr Glu Gln Asn 610 615 620 Gly Val Glu Pro Wing Phe His He Glu Asp Gly Lye He Asp Gly Asn 625 630 635 640 Gly Phe His Wing Thr Wing Arg Thr Arg Glu Ser Gly He Asn Leu Ser 645 650 655 Gly Asn Gly Ser Thr Asp Pro Lys Thr Phe Gln Wing Ser Asn Leu Arg 660 665 670 Val Glu Gly Gly Phe Tyr Gly Pro Gln Wing Wing Glu Leu Gly Gly Thr 675 680 685 He Phe Asn Asn Asp Gly Lys Ser Leu Ser He Thr Glu Asn He Glu 690 695 700 Asn Glu Ala Glu Ala Glu Val Glu Val Glu Ala Glu Ala Glu Val Glu 705 710 715 720 Val Glu Ala Asp Val Gly Lys Gln Leu Glu Pro Asp Glu Val Lys His 725 730 735 Lys Phe Gly Val Val Phe Gly Ala Lys Lys Asp Met Gln Glu Val Glu 740 745 750 Lys (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 2124 base pairs (B) TI PO: nucleic acid (C) FORM OF HI LO: double (D) TOPOLOGY : linear (ii) TI PO DE MOLÉCU LA: cDNA (vi) SOURCE ORIGINAL: (B) CEPA: 881607 strain of Neisseria meningitidis (ix) FEATURE: (A) NAME / KEY: Sequence Code (B) POSITION: 1 . 2121 (D) OTHER TRAINING: (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: ATG TGT AAA CCG AAT TAT GGC GGC ATT GTC TTG TTG CCC TTA CTT TTG 48 Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 GCA TCT TGC ATC GGC GGC AAT TTC GGC GTG CAG CCT GTT GTC GAA TCA 96 Wing Ser Cys He Gly Gly Asn Phe Gly val Gln Pro Val Val Glu Ser 20 25 30 ACG CCG ACC GCG TAC CCC GTC ACT TTC AAG TCT AAG GAC GTT CCC ACT 144 Thr Pro Thr Wing Tyr Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr 35 40 45 TCG CCT CCT GCC GGG TCT TCG GTA GAA ACC ACG CCG GTC AAC CGA CCC 192 Ser Pro Pro Wing Gly Ser Ser Val Glu Thr Thr Pro Val Asn Arg Pro 50 55 60 GCC GTT GGT GCG GCA ATG CGG CTG TTG AGA CGG AAT ATT GCA ACT TCT 240 Wing Val Gly Wing Wing Met Arg Leu Leu Arg Arg Asn He Wing Thr Ser 65 70 75 80 GAT AAG GAT GAT AAT GAT TTT CCA AAT AGC AAA CAA GCA GAA GAA AAG 288 Asp Lys Asp Gly Asn Asp Phe Pro Asn Ser Lys Gln Wing Glu Glu Lys 85 90 95 CTG TCG TTT AAA GAG GAA GAT ATC CTG TTT TTA TAC GGT TCC AAA AAA 336 Leu Ser Phe Lys Glu Glu Asp He Leu Phe Leu Tyr Gly Ser Lys Lys 100 105 110 GAT CAA CGT CAG CAG CTT AAA GAT AAA ATT CGT CAA CCA AAT CCT ACG 384 Asp Gln Arg Gln Gln Leu Lys Asp Lys He Arg Gln Pro Asn Pro Thr 115 120 125 GCA AGC ATT ACC ACTION TCG GAA AAG AAA AAT AAA AAA TAT GAT TAT AAA 432 Wing Be He Thr Thr Ser Glu Lys. Lys Asn Lys Lys Tyr Asp Tyr Lys 130 135 140 TTT GTA GAT GAT GGT TAT GTA TAT ACT AAA GAC GGA AAA GAT GAA ATT 480 Phe Val Asp Wing Gly Tyr Val Tyr Thr Lys Asp Gly Lys Asp Glu He 145 150 155 160 GAG TGG ACT TCA AAT TAC AAG CAG TCT ACC AAC CGG TTT GGT TAT GAC 528 Glu Trp Thr Ser Asn Tyr Lys Gln Ser Thr Asn Arg Phe Gly Tyr Asp 165 170 175 GGT TTT GTA TAT TAT TCC GGA GAA CAT CCT TCG CAA TCT TTA CCG AGC 576 Gly Phe Val Tyr Tyr Ser Gly Glu His Pro Ser Gln Ser Leu Pro Ser 180 185 190 GCG GGA ACG GTG AAA TAT TCC GGC AAC TGG CAA TAT ATG ACC GAT GCC 624 Wing Gly Thr Val Lys Tyr Ser Gly Asn Trp Gln Tyr Met Thr Asp Wing 195 200 205 ATA CGT CAT CGA ACA GGA AAA GCA GGA GAT CCT AGC GAA GAT TTG GGT 672 He Arg His Arg Thr Gly Lys Wing Gly Asp Pro Ser Glu Asp Leu Gly 210 215 220 TAT ATC GTT TAT TAC GGT CAA AAT GTC GGA GCA ACT TCT TAT GCT GCG 720 Tyr He Val Tyr Tyr Gly Gln Asn Val Gly Ala Thr Ser Tyr Ala Ala 225 230 235 240 ACT GCC GAC GAC CGG GAG GGA AAA CAT CCT GCC GAA TAT ACG GTT AAT 768 Thr Wing Asp Asp Arg Glu Gly Lys His Pro Wing Glu Tyr Thr Val Asn 245 250 255 TTC GAC CAA AAA ACT CTG AAT GGC AAG CTG ATT AAA AAT CAG TAT GTG 816 Phe Asp Gln Lys Thr Leu Asn Gly Lys Leu He Lys Asn Gln Tyr Val 260 265 270 CAA AAG AGA GAT GAT CCT AAA AAA CCA CTG ACC ATT TAC GAC ATT ACT 864 Gln Lys Arg Asp Asp Pro Lys Lys Pro Leu Thr He Tyr Asp He Thr 275 280 285 GCA AAA TTG GAC GGC AAC CGC TTT ACC GGC AGT GCC AAA GTT AAC ACA 912 Wing Lys Leu Asp Gly Asn Arg Phe Thr Gly Ser Wing Lys Val Asn Thr 290 295 300 GAG GTG AAG ACG AAT CAC GCT GAT AAA GAA TAT TTG TTT TTC CAT ACC 960 Glu Val Lys Thr Asn His Wing Asp Lys Glu Tyr Leu Phe Phe His Thr 305 310 315 320 GAT GCC GAT CAG CGG CTT GAG GGC GGT TTT TTC GGC GAT AAG GGG GAA 1008 Asp Wing Asp Gln Arg Leu Glu Gly Gly Phe Phe Gly Asp Lys Gly Glu 325 330 335 GAG CTT GCC GGA CGG TTT ATC AGC AAC GAC AAC AGC GTA TTC GGC GTG 1056 Glu Leu Wing Gly Arg Phe He Ser As Asp Asn Ser Val Phe Gly Val 340 345 350 TTC GCA GGC AAA CAA AAA ACA GAG ACA GCA AAC GCA TCA GAT ACA AAT 1104 Phe Wing Gly Lys Glp Lys Thr Glu Thr Wing Asn Wing Being Asp Thr Asn 355 360 365 CCT GCC CTG CCG TCT GGA AAA CAC ACC AAA ATC TTG GAT TCT CTA AAA 1152 Pro Wing Leu Pro Ser Gly Lys His Thr Lys He Leu Asp Ser Leu Lys 370 375 380 ATT TCC GTT GAC GAG GCA AGT GGT GAA AAT CCC CGA CCG TTT GAG GTT 1200 He Ser Val Asp Glu Wing Ser Gly Glu Asn Pro Arg Pro Phe Glu Val 385 390 395 400 TCC ACT ATG CCC GAT TTT GGT CAT CCC GAC AAA CTT CTT GTC GAA GGG 1248 Ser Thr Met Pro Asp Phe Gly His Pro Asp Lys Leu Leu Val Glu Gly 405 410 415 CGT GAA ATT CCT TTG GTA AAC AAA GAA CAA ACC ATC GAT CTT GCC GAC 1296 Arg Glu He Pro Leu Val Asn Lys Glu Gln Thr He Asp Leu Wing Asp 420 425 430 GGC AGG AAA ATG ACC GTC CGT GCT TGT TGC GAC TTT TTG ACC TAT GTG 1344 Gly Arg Lys Met Thr Val Arg Ala Cys Cys Asp Phe Leu Thr Tyr Val 435 440 445 AAA CTC GGA CGG ATA AAA ACC GAA CGC CCC GCC GTC CAA CCG AAG GCG 1392 Lys Leu Gly Arg He Lys Thr Glu Arg Pro Wing Val Gln Pro Lys Wing 450 455 460 CAG GAT GAA GAG GGG GAC GAA GAG GGT GTA GGC GTT GAT AAC GGT AAA 1440 Gln Asp Glu Glu Gly Asp Glu Glu Gly Val Gly Val Asp Asn Gly Lys 465 470 475 480 GAA AGC GAA GAC GAA ATC GGC GAT GAA GAA AGC ACC GGA GAC GAA GTC 1488 Glu Ser Glu Asp Glu He Gly Asp Glu Glu Ser Thr Gly Asp Glu Val 485 490 495 GATA GAA GAT GAA GAC GAA GAT GAA GAA GAA GAA GAA GAA ATC GAA GAA GAA 1536 Val Glu Asp Glu Asp Glu Asp Glu Asp Glu Glu Glu He Glu Glu Glu 500 505 510 CCT GAA GAA GAA GCT GAA GAA GAA GAA CCC GAA GAA GAA TTG CCG GCA 15B4 Pro Glu Glu Glu Ala Glu Glu Glu Glu Glu Pro Glu Glu Glu Leu Pro Ala 515 520 525 GAA GAA GGC AAC GGC GGT TCA GGC AGC ATC CTG CCC ACT CCG GAA GCC 1632 Glu Glu Gly Asn Gly Ser Gly Ser He Leu Pro Thr Pro Glu Wing 530 535 540 TCT AAA GGC AGG GAC ATC GAC CTT TTC CTG AAA GGT ATC CGC ACG GCG 1680 Ser Lys Gly Arg Asp He Asp Leu Phe Leu Lys Gly He Arg Thr Ala 545 550 555 560 GAA GCC GAC ATT CCA AAA AAC GGA ACG GCG CAT TAT ACC GGC ACT TGG 1728 Glu Wing Asp He Pro Lys Asn Gly Thr Wing His Tyr Thr Gly Thr Trp 565 570 575 GAA GCG CGT ATC GGC GTA TCG GAT AGT GGT ACG TCC ATT CAA AAG GAT 1776 Glu Wing Arg He Gly Val Ser Asp Ser Gly Thr Ser He Gln Lys Asp 580 585 590 AGC TAT GCG AAT CAA GGG GCA AAA GCA GAA TTT ACC GTT GAT TTC GAA 1824 Ser Tyr Ala Asn Gln Gly Ala Lys Ala Glu Phe Thr Val Asp Phe Glu 595 600 605 GCG AAG ACG GTG TCC GGA ATG CTG ACA GAA AAA AAT GAT ACA ACC CCC 1872 Wing Lys Thr Val Ser Gly Met Leu Thr Glu Lys Asn Asp Thr Thr Pro 610 615 620 GCT TTT TAT ATT GAA AAA GGT GTG ATT GAC GGT AAC GGT TTC CAC GCT 1920 Wing Phe Tyr He Glu Lys Gly Val He Asp Gly Asn Gly Phe His Wing 625 630 635 640 TTG GCG CAT ACT CGG GAG AAC GGT ATT GAC CTT TCT GGG CAG GGT TCG 1968 Leu Wing His Thr Arg Glu Asn Gly He Asp Leu Ser Gly Gln Gly Ser 645 650- 655 ACT AAC CCG AAG AAC TTC AAA GCC GAC AAT CTT CTT GTA ACA GGC GGC 2016 Thr Asn Pro Lys Asn Phe Lye Wing Asp Asn Leu Leu Val Thr Gly Gly 660 665 670 TTT TAT GGC CCG CAG GCG GCA GAA TTG GGC GGT AAT ATT ATC GAC AGC 2064 Phe Tyr Gly Pro Gln Wing Wing Glu Leu Gly Gly Asn He He Asp Ser 675 680 685 GAC CGG AAA TTC GGT GCG GTA TTT GGG GCG AAA AAA GAT GAC AAG GAG 2112 Asp Arg Lys Phe Gly Wing Val Phe Gly Wing Lys Lys Asp Asp Lys Glu 690 695 700 GCA ACA CGA TGA 2124 Ala Thr Arg 705 (2) IN FORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LONGITU D: 707 amino acids (B) TYPE: amino acid (C) FORM OF HI LO: simple (D) TOPOLOGY : linear (ii) TYPE OF MOLÉCU LA: protein (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL ENTITY: (B) CEPA: strain of 881607 of Neisseria meningitidis (xi) DESCRI PTION OF SEQUENCE: SEQ ID NO : 10: Met Cys Lys Pro Asn Tyr Gly Gly He Val Leu Leu Pro Leu Leu Leu 1 5 10 15 Wing Being Cys He Gly Gly Asn Phe Gly Val Gln Pro Val Val Glu Being 25 30 Thr Pro Thr Wing Tyr Pro Val Thr Phe Lys Ser Lys Asp Val Pro Thr 35 40 45 Pro Pro Pro Wing Gly Ser Val Glu Thr Thr Pro Val Asn Arg Pro 50 55 60 Wing Val Gly Wing Wing Met Arg Leu Leu Arg Arg Asn He Wing Thr Ser 65 70 75 80 Asp Lys Asp Gly Asn Asp Phe Pro Asn Ser Lys Gln Wing Glu Glu Lys 85 90 95 Leu Ser Phe Lys Glu Glu Asp He Leu Phe Leu Tyr Gly Ser Lys Lys 100 105 110 Asp Gln Arg Gln Gln Leu Lys Asp Lys He Arg Gln Pro Asn Pro Thr 115 120 125 Wing Being He Thr Thr Ser Glu Lys Lys Asn Lys Lys Tyr Asp Tyr Lys 130 135 140 Phe Val Asp Wing Gly Tyr Val Tyr Thr Lys Asp Gly Lys Asp Glu He 145 150 155 160 Glu Trp Thr Ser Asn Tyr Lys Gln Ser Thr Asn Arg Phe Gly Tyr Asp 165 170 175 Gly Phe Val Tyr Tyr Ser Gly Glu His Pro Ser Gln Ser Leu Pro Ser 180 185 190 Wing Gly Thr Val Lys Tyr Ser Gly Asn Trp Gln Tyr Met Thr Asp Wing 195 200 205 He Arg His Arg Thr Gly Lys Wing Gly Asp Pro Ser Glu Asp Leu Gly 210 215 220 Tyr He Val Tyr Tyr Gly Gln Asn Val Gly Ala Thr Ser Tyr Ala Ala 225 230 235 240 Thr Ala Asp Asp Arg Glu Gly Lys His Pro Wing Glu Tyr Thr Val Asn 245 250 255 Phe Asp Gln Lys Thr Leu Asn Gly Lys Leu He Lys Asn Gln Tyr Val 260 265 270 Gln Lys Arg Asp Asp Pro Lys Lys Pro Leu Thr He Tyr Asp He Thr 275 280 285 Wing Lys Leu Asp Gly Asn Arg Phe Thr Gly Ser Wing Lys Val Asn Thr 290 295 300 Glu Val Lys Thr Asn His Wing Asp Lys Glu Tyr Leu Phe Phe His Thr 305 310 315 320 Asp Wing Asp Gln Arg Leu Glu Gly Gly Phe Phe Gly Asp Lys Gly Glu 325 330 335 Glu Leu Wing Gly Arg Phe He Being Asn Asp Asn Being Val Phe Gly Val 340 345 350 Phe Wing Gly Lys Gln Lys Thr Glu Thr Wing Asn Wing Being Asp Thr Asn 355 360 365 Pro Wing Leu Pro Ser Gly Lys His Thr Lys He Leu Asp Ser Leu Lys 370 375 380 He Ser Val Asp Glu Wing Ser Gly Glu Asn Pro Arg Pro Phe Glu Val 385 390 395 400 Be Thr Met Pro Asp Phe Gly His Pro Asp Lys Leu Leu Val Glu Gly 405 410 415 Arg Glu He Pro Leu Val Asn Lys Glu Gln Thr He Asp Leu Wing Asp 420 425 430 Gly Arg Lys Met Thr Val Arg Ala Cys Cys Asp Phe Leu Thr Tyr Val 435 440 445 Lys Leu Gly Arg He Lys Thr Glu Arg Pro Wing Val Gln Pro Lys Wing 450 455 460 Gln Asp Glu Glu Gly Asp Glu Glu Gly Val Gly Val Asp Asn Gly Lys 465 470 475 480 Glu Ser Glu Asp Glu He Gly Asp Glu Glu Ser Thr Gly Asp Glu Val 485 490 495 Val Glu Asp Glu Asp Glu Asp Glu Asp Glu Glu Glu He Glu Glu Glu 500 505 510 Pro Glu Glu Glu Glu Wing Glu Glu Glu Glu Pro Glu Glu Glu Leu Pro Wing 515 520 525 Glu Glu Gly Asn Gly Gly Ser Gly Ser He Leu Pro Thr Pro Glu Ala 530 535 540 Ser Lys Gly Arg Asp He Asp Leu Phe Leu Lys Gly He Arg Thr Ala 545 550 555 560 Glu Wing Asp He Pro Lys Asn Gly Thr Wing His Tyr Thr Gly Thr Trp 565 570 575 Glu Ala Arg He Gly Val Ser Asp Ser Gly Thr Ser He Gln Lys Asp 580 585 590 Ser Tyr Ala Asn Gln Gly Ala Lys Ala Glu Phe Thr Val Asp Phe Glu 595 600 605 Wing Lys Thr Val Ser Gly Met Leu Thr Glu Lys Asn Asp Thr Thr Pro 610 615 620 Wing Phe Tyr He Glu Lys Gly Val He Asp Gly Asn Gly Phe His Wing 625 630 635 640 Leu Ala His Thr Arg Glu Asn Gly He Asp Leu Ser Gly Gln Gly Ser 645 650 655 Thr Asn Pro Lys Asn Phe Lys Wing Asp Asn Leu Leu Val Thr Gly Gly 660 665 670 Phe Tyr Gly Pro Gln Wing Wing Glu Leu Gly Gly Asn He He Asp Ser 675 680 685 Asp Arg Lys Phe Gly Wing Val Phe Gly Wing Lys Lys Asp Asp Lys Glu 690 695 700 Thr Arg 705 wing

Claims (34)

1. CLAIMS 1. An isolated polynucleotide encoding LbpB from Neisseria meningitidis.
2. 2. The polynucleotide of claim 1, which is the polynucleotide of SEQ ID NO: 1 (from nucleotide 100 to nucleotide 2274), SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9.
3. 3. An isolated polynucleotide comprising a nucleotide sequence that is at least 65% identical to that of SEQ ID NO: 1 of the nucleotide 100 to nucleotide 2274.
4. 4. An isolated polynucleotide comprising a nucleotide sequence that is at least 65% identical to that of SEQ ID NO: 3
5. 5. An isolated polynucleotide comprising a nucleotide sequence that is at least 65% identical to that of SEQ ID NO: 5
6. 6. An isolated polynucleotide comprising a nucleotide sequence that is at least 65% identical to that of SEQ ID NO
7. 7. An isolated polynucleotide comprising a nucleotide sequence that is at least 65% identical to that of SEQ ID NO: 9
8. 8. The polynucleotide of claims 3-7, comprising a recombinant expression system, wherein said expression system is capable of producing an LbpB polypeptide in a compatible host cell.
9. 9. A host cell comprising the expression system of claim 8.
10. 10. A process for producing an LbpB polypeptide comprising the host culture of claim 9, under conditions sufficient for the production of said polypeptide and recovering the polypeptide. of the crop.
11. 11. A process for producing a cell which produces an LbpB polypeptide thereof comprising transforming or transfecting a host cell with the expression system of claim 8 such that the host cell, under appropriate culture conditions, produces an LbpB polypeptide.
12. 12. The LbpB polypeptide of Neisseria meningitidis.
13. 13. The polypeptide of claim 12, which is the polypeptide of SEQ ID NO: 2, 4, 6, 8, or 10.
14. 14. An isolated LbpB polypeptide comprising an amino acid sequence which is at least 65% identical to the amino acid sequence of SEQ ID NO: 2 over its entire length.
15. 15. An isolated LbpB polypeptide comprising an amino acid sequence which is at least 65% identical to the amino acid sequence of SEQ ID NO: 4 over its entire length.
16. 16. An isolated LbpB polypeptide comprising an amino acid sequence which is at least 65% identical to the amino acid sequence of SEQ ID NO: 6 throughout its length.
17. 17. An isolated LbpB polypeptide comprising an amino acid sequence which is at least 65% identical to the amino acid sequence of SEQ ID NO: 8 throughout its length.
18. 18. An isolated LbpB polypeptide comprising an amino acid sequence which is at least 65% identical to the amino acid sequence of SEQ ID NO: 10 throughout its length.
19. 19. The polypeptide of claims 14, 15, 16, 17 or 18, which comprises the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, or 10, respectively, from amino acid position 19 to termination C of the polypeptide.
20. 20. A fragment of the polypeptide of claims 14-19, wherein the fragment retains an antigenic activity of the polypeptide, provided that the fragments represented by amino acid position 650-725 of SEQ ID NO: 2 are not included. and 559-741 of SEQ ID NO: 6.
21. 21. A protein comprising a fragment of claim 20.
22. 22. An immunospecific antibody to the LbpB polypeptide of claims 14-19.
23. 23. A method for identifying compounds which inhibit the LbpB polypeptide of claims 14-19, which comprises: (a) contacting a candidate compound with cells which express the LbpB polypeptide; and (b) observing the binding, or inhibition of a functional response; or comparing the ability of the cells which are contacted with the candidate compound with the same cells which do not come into contact with the polypeptide activity of LbpB.
24. 24. A vaccine comprising an effective amount of the polypeptide of claims 14-19 and a pharmaceutically acceptable carrier.
25. 25. A vaccine comprising an effective amount of a fragment of the polypeptide of claims 14-19, and a pharmaceutically acceptable carrier, wherein the fragment retains an antigenic activity of the polypeptide.
26. 26. A vaccine comprising an effective amount of a protein comprising a fragment of the polypeptide of claims 14-19 and a pharmaceutically acceptable carrier, wherein the fragment retains an antigenic activity of the polypeptide.
27. 27. The vaccine according to claims 24-26, wherein said composition comprises at least another N. meningitidis antigen.
28. 28. A method for vaccinating a human being against neisseria disease comprising administering to said human being a composition comprising an effective amount of the polypeptide, fragment or protein of claims 14-21.
29. 29. A method for vaccinating a human being against neiseria disease comprising administering to said human being a composition comprising an effective amount of the polynucleotide of claims 3-7.
30. 30. The method according to claim 28, wherein said polypeptide, fragment or protein is administered orally, subcutaneously, rectally, intratracheally, intramuscularly or intranasally.
31. The method according to claim 29, wherein said polynucleotide is administered subcutaneously, intratracheally, intramuscularly or intranasally.
32. 32. A method for diagnosing neisseria disease in a human comprising the steps of incubating an antibody produced by administering to a suitable human or animal the polypeptide of claims 14-19, with a sample of biological fluids of a human being to which it will be diagnosed, where, in the presence of the neiseria bacterium, an antigen antibody complex is formed, and subsequently said fluid sample is analyzed for the presence of said complex.
33. 33. A therapeutic composition useful in treating humans with neiseria disease comprising at least one antibody directed against the polypeptide of claims 14-19 and a suitable pharmaceutical carrier.
34. 34. A kit for diagnosing infection by neiseria bacteria in a human being comprising a polynucleotide of claims 3-7, or a polypeptide, fragment or protein of claims 14-21, or an antibody of claim 22.