MXPA00001145A - Cytokinin oxidase - Google Patents

Abstract

An isolated protein which exhibits cytokinin oxydizing activity selected from the group consisting of SEQ. ID No. 1, a protein having an amino acid sequence which includes the amino acid sequence of SEQ. ID No. 1, a protein having an amino acid sequence which includes a portion of the amino acid sequence of SEQ. ID No. 1, the included portion being at least about 20 amino acid residues in length and conferring the cytokinin oxidizing activity on the protein, and a protein including an amino acid sequence with at least about 65%sequence identity to SEQ. ID No. 1, the remainder of amino acid residues being conservatively substituted. Nucleic acids encoding proteins which exhibit cytokinin oxidizing activity and related products and methods are also disclosed.

Description

CYCKININ OXIDASE BACKGROUND OF THE INVENTION The present invention relates to a purified plant enzyme cytokinin oxidant (ckxl) obtained from Zea mays, whose complete amino acid sequence has been elucidated, and to isolated nucleotide sequences encoding the enzyme. The invention also relates to novel methods for moderating the concentration of the enzyme and similar enzymes in plants in order to affect the growth and cell death of the plant. The applications of the invention include the regulation of the production of ckxl in plant roots to affect the pathogenesis, the regulation to alter the habitat of the plant, and the bulk production of the enzyme ckxl to be used in biochemical tests in a plant. Plant cytokinins are a class of plant hormones which, when combined with auxin, control cell division, promote the development of the root from calluses, release the lateral buds of rest and regulate plant structure and growth in a diversity of forms. The active cytokinins present in nature in most higher plants are the free base of zeatin (6- (4-hydroxy-3-methylbut-fra / 7s-2-enylamino) purine) (hereinafter referred to as Z) , and its ribosides in position 9 (hereinafter referred to as ZR). Therefore, plant tissues typically contain Z, ZR, and smaller amounts of N6 - (? 2-isopentenyl) adenine (hereinafter referred to as iP) obtained from the biosynthetic precursors. Elevated levels of cytokinin are associated with the development of seeds in supepores plants, and have been shown to coincide with the maximum mitotic activity in the endosperm of developing corn grains and other cereal grains. It has been shown that the exogenous application of cytokinin (by injection into the stem) correlates directly with the increased grain yield in corn. In addition, the plant cells transformed with the ipt gene of Agrobacterium tumefaciens (coding for a dimethylallylpyrrophosphate: 5'-AMP transferase which can increase the cellular production of Z and ZR) showed increased growth corresponding to an increase in the endogenous levels of cytokinin after the induction of the enzyme. In this way, given the biological importance of cytokinins for the growth of plants, the ability to manipulate cytokinin levels in cells of higher plants is of great commercial and scientific interest. The action of cytokinin oxidase is an important method of effective catabolism of cytokinin in plant cells. This inactivation of cytokinin is achieved by the oxidative removal of the lateral chain of the cytokinin-free bases (or their ribosides) in the presence of molecular oxygen. An example of this reaction with iP is shown in figure 1a. Although the exact chemical mechanism for this reaction is unknown, it is suspected that the enzyme is reduced during deprotonation of iP to N6 - (? 2- isopentenylimino) purine. Then the purine is hydrolyzed in adenine and the intermediate 3-methyl-2-butenal (figure 1 b). Although the electron acceptor responsible for the reoxidation of the reduced enzyme in plant cells is not yet known, molecular oxygen can do so in vitro. Alternatively, the reduced enzyme can be oxidized in vitro by intermediates such as the Cu + 2 / imidazole complexes or the artificial electron acceptor dichlorophenolindophenol (DCPIP). It is known that cytokinin oxidases eliminate cytokinins from plant cells after cell division, and it has also been postulated that they are involved in the senescence process. It has been shown that cytokinin oxidase activities correlate positively with mitosis of endosperm cells in corn grains, along with the increase in natural cytokinin concentrations. Oxidase activity increases shortly after the increase in endogenous cytokinin levels. A similar correlation was demonstrated with artificially increased levels of cytokinin in transgenic tobacco. Thus, it is thought that the expression of cytokinin oxidases is involved in the maintenance of hormonal homeostasis in developing plant cells. Because cytokinin oxidases appear to be inducible by substrate, they act in a negative regulation mode to reduce high levels of cytokinin back to base values. This induction of cytokinin oxidase activity by substrate is a significant barrier for potential commercial applications that attempt to manipulate cytokinin levels in transgenic plants through increased production of cytokinin. The cytokinin oxidases of plant species diversity, including Vinca rosea, beans (Phaseolus vulgaris and lunatus), wheat (Triticum aestivum), tobacco (Nicotiana tabacum), Dianthus caryophyllus, soybean (Glycine max), and corn (Zea mays), have been analyzed. ). All these plant cytokinin oxidases have a similar substrate preference for iP and Z, but show limited reactivity or show no reactivity with aromatic, or reduced, bulky side chain cytokinins. All also exhibit increased activity in the presence of copper plus imidazole. However, these enzymes show substantial variation in both specific activity and molecular weight. It is thought that this is related to the presence of glycosylated and non-glycosylated variants of the protein, both between species and within species. In the case of glycosylated cytosine oxidase, the highly glycosylated protein may have a surface rich in carbohydrates, which prevents the formation of antibodies against the peptide epitopes. The glucoepitopes to which the antibodies are created under these conditions are non-specific and can prevent the isolation of the protein, or of the clones containing the gene encoding it, by means of immunochromatography or other means based on immunology. A previously reported attempt to isolate the corn cytokinin oxidase (ckxl) gene by immunoselecting expression products from the corn cDNA library (Burch, 1992) was unsuccessful. As demonstrated, the complete amino acid sequence and the DNA encoding a cytokinin oxidase have been a long sought after objective in modern plant physiology.

BRIEF DESCRIPTION OF THE INVENTION It is therefore an object of the present invention to provide means by which recombinant cytokinin oxidase can be produced in quantity so that the effects of cytokinin oxidase on plant growth and metabolism can be studied. It is also an object of the present invention to provide means to modify the production of cytokinin oxidase in plant cells, in vivo, in order to modulate the endogenous level of cytokinin in plant cells to affect the properties of altered resistance to pathogens and growth vegetable. Therefore, the present invention is directed to a novel, isolated and substantially purified plant enzyme, cytokinin oxidant (ckxl), which preferably has a molecular weight of about 60 kD, a sequence length of about 505 to 565 residues of amino acid, preferably from 525 to 545 amino acid residues, and more preferred from 534 amino acid residues, and having cytokinin inactivation activity. The present invention is also directed to a protein having an amino acid sequence that includes the amino acid sequence of ckxl (SEQ ID NO: 1). The invention is likewise directed to a protein which has cytokinin inactivating activity and which includes a portion of the amino acid sequence of ckxl of at least about 20 amino acid residues in length, in which the included portion of the sequence of ckxl confers the inactivation activity of cytokinin to the protein. The invention is directed to proteins having cytokinin inactivation activity and having at least about 65% sequence identity with ckxl and more preferred at least about 95% sequence identity with ckxl, substituting the remaining amino acids conservatively. In addition, the invention is directed to substantially isolated nucleic acid polymers that code for ckxl or for a cytokinin oxidizing homologue thereof. The nucleic acid polymer preferably has a nucleic acid sequence of SEQ. ID. DO NOT. 3 o. the predictable variants thereof described in SEQ. ID. DO NOT. 10. The invention is also directed to a substantially isolated nucleic acid polymer containing a portion of SEQ. ID. DO NOT. 2, SEQ. ID. DO NOT. 3, or a polymer of nucleic acids described by SEQ. ID. DO NOT. 10, the portion being at least 60 bp in length. In addition, the invention is directed to nucleic acid polymers that are capable of hybridizing with SEQ. ID. DO NOT. 2, SEQ. ID. DO NOT. 3, or a polymer of nucleic acids described by SEQ. ID. DO NOT. 10, under conditions of 0.5X to 2X of SSC buffer solution, 0.1% SDS and at a temperature of 55-65 ° C. The nucleic acid polymers that code for cytokinin oxidases and meet the above requirements code for proteins of sufficient similarity to ckxl that they are generally recognized as ckxl equivalents by those skilled in the biochemistry arts. The invention is also directed to a host cell that incorporates a vector containing the aforementioned DNA and to a method for producing ckxl or a homologue thereof using such a host cell. The preferred method comprises the first binding DNA encoding the aforementioned ckxl or a segment or homologous thereof and an appropriate promoter (such as the root specific RB7 promoter, Conkling, MA, et al., US Patent No. 5,459,252, or the CaMV35S promoter, Odell, 1985), or a combination of promoters (Hoffman, Patent No. 5,106,739) 3) in an appropriate DNA vector (e.g., pBIN19 for use in Agrobacterium tumefaciens). The vector construction can then be transformed directly into a host cell, such as Pichia pastoris (described in example 2). This can also be incorporated into a secondary vector to transform it into a host cell, such as Agrobacterium tumefaciens, and transformed into a host plant cell (described in example 4 with Nicotinana tabacum). Alternatively, to produce large amounts of the enzyme, the DNA encoding ckxl, or a portion thereof, can be transformed into Pichia, according to the methods described in Example 2, or Su, et al. , 1996 and Skory, et al., 1996. When transformed into Pichia spp., Ckxl is secreted into the culture medium due to the presence of a secretion signal peptide at the N-terminus of the coding region for ckxl. Therefore, the active enzyme can be easily purified from bulk Pichia cultures without a lysis step. The ckxl produced in such a manner can be used in a biochemical test to determine unknown concentrations of cytokinin in biological samples, in accordance with the method of example 3. A host plant cell generated by the above method can be regenerated in a whole plant. Depending on the promoter used in the construction of the vector, ckxl can be produced constitutively or by induction by means of natural or artificial environmental factors. Plants transformed with vectors containing tissue-specific or trauma-specific promoters and a sequence coding for ckxl may exhibit altered resistance to certain plant pathologies related to cytokinin, such as infection by certain nematode or fungal species. The findings described herein provide an important analytical tool for, and a critical link in, the development of methods by which manipulation of cytokinin oxidase activity can be used to either inhibit or augment a variety of growth functions. Cellular in vegetables in a desired way. Possible uses include the development of commercial plants with increased grain production, with increased resistance to disease or with more desirable secondary growth characteristics. The enzyme and its nucleic acids that encode it have important uses in the study of the growth and senescence cycles of plant cells. In addition, many other pharmaceutical and agricultural uses for ckxl and its gene could be discovered. The enzyme, the methods for expressing the enzyme, and methods for using it are described below in greater detail. Other features and objects of the present invention will be apparent in part to those skilled in the art and in part will be set forth hereinbelow.

BRIEF DESCRIPTION OF THE FIGURES, SEQUENCE IDENTIFICATIONS AND DEFINITIONS The invention is described and illustrated further by the accompanying figures. Figures 1a and b show an example of a reaction catalyzed by cytokinin oxidase (Brownlee, 1975), and its putative mechanism as described above, based on Hare, 1994. Figure 2 shows agarose gel electrophoresis of DNA fragments RT- PCR demonstrating that the introns of the ckxl gene have been correctly identified.

Figure 3 shows the normal curve of spectrophotometric absorbance (590 nm) that is obtained when ckxl is used to evaluate the concentrations of cytokinin in solution. Figure 4 is a diagram of plasmid pJL7 of DNA. Figure 5 is a diagram of plasmid pBI121 of DNA. Figure 6 is a diagram of the pROMd plasmid of DNA. Figure 7 is a diagram of plasmid pROM9 of DNA. Figure 8 is a diagram of plasmid pROM22 of DNA. Figure 9 is a diagram of plasmid pROM24 of DNA. Figure 10 is a diagram of plasmid pROM26 of DNA. Figure 11 is a diagram of plasmid pROM28 of DNA. Figure 12 is a diagram of plasmid pROM29 of DNA. Figure 13 is a diagram of plasmid pROM30 of DNA. Figure 14 is a diagram of plasmid pROM32 of DNA. Figure 15 is a diagram of plasmid pROM43 of DNA. All abbreviations of amino acid and nucleotide sequence identification are in accordance with the USPTO and WIPO standards. I KNOW THAT. ID NO. 1 lists the amino acid sequence of ckxl present in nature obtained from Zea mays. These sequence was predicted from the nucleotide sequence obtained from the genomic DNA encoding ckxl.

I KNOW THAT. ID NO. 2 lists the genomic DNA sequence encoding ckxl, including introns. I KNOW THAT. ID NO. 3 lists the DNA sequence that codes for ckxl, excluding the introns. This sequence has been reconstructed in pROM22 of example 2. SEQ. ID NO. 4 lists the amino acid sequence of an internal fragment from the tryptic digestion of ckxl. I KNOW THAT. ID NO. 5 lists the amino acid sequence of an internal fragment from the tryptic digestion of ckxl. I KNOW THAT. ID NO. 6 lists the nucleic acid sequence of a degenerate DNA probe used to isolate the genomic DNA encoding ckxl, as described in Example 1. Note that residues designated "n" in the sequence are the artificial base inosine (I) Normal conventions have been followed to indicate degenerations in the sequence. I KNOW THAT. ID NO. 7 lists the nucleic acid sequence of a degenerate DNA probe used to isolate the genomic DNA encoding ckxl, as described in Example 1. Note that residues designated "n" in the sequences are the artificial base inosine (I) Normal conventions have been followed to indicate degenerations in the sequence. I KNOW THAT. ID NO. 8 lists the nucleic acid sequence of a degenerate DNA probe used to isolate the genomic DNA encoding ckxl, as described in Example 1. Note that residues designated "n" in the sequences are the artificial base inosine (I) Normal conventions have been followed to indicate degenerations in the sequence. I KNOW THAT. ID NO. 9 lists the nucleic acid sequence of a degenerate DNA probe used to isolate the genomic DNA encoding ckxl, as described in Example 1. Note that residues designated "n" in the sequence are the artificial base inosine (I) Normal conventions have been followed to indicate degenerations in the sequence. I KNOW THAT. ID NO. 10 lists the degenerate DNA sequence that codes for ckxl. As is well known in the art, the various DNA molecules indicated by this group encode a protein with the amino acid sequence of SEQ. ID NO. 1, also known as ckxl. This group follows the conventional rules of degeneration in the genetic code. An individual with ordinary skill in the art can make the special modifications necessary for expression in certain organisms that do not follow these conventions. I KNOW THAT. ID NO. 11 lists the sequence of a synthetic primer used in the PCR removal of the introns in Example 2. SEQ. ID NO. 12 lists the sequence of a synthetic primer used in the PCR removal of the introns in Example 2.

I KNOW THAT. ID NO. 13 lists the sequence of a synthetic primer used in the PCR removal of the introns in Example 2. SEQ. ID NO. 14 lists the sequence of a synthetic primer used in the PCR removal of the introns in Example 2. SEQ. ID NO. 15 lists the sequence of a synthetic primer used in the PCR removal of the templates in Example 2. SEQ. ID NO. 16 lists the sequence of a synthetic primer used in the PCR removal of the introns in Example 2. SEQ. ID NO. 17 lists the sequence of a synthetic linker construct used in example 2. SEQ. ID NO. 18 lists the sequence of a synthetic linker construct used in example 2. SEQ. ID. DO NOT. 19 lists the sequence of a synthetic primer used in PCR to obtain the tobacco RB7 promoter in Example 4. SEQ. ID. DO NOT. 20 lists the sequence of a synthetic primer used in PCR to obtain the tobacco RB7 promoter in Example 4. As used herein, a "substantially purified protein" means that the protein is separated from a majority of the the host cell normally associated therewith or that the protein is synthesized in substantially pure form, such synthesis including expression of the protein in a host cell from a nucleic acid polymer exogenously introduced into the cell by any appropriate means of delivery of gene therapy.

A "substantially isolated nucleic acid polymer" means that the mixture containing the nucleic acid polymer of interest is essentially free of a majority of other nucleic acid polymers normally associated therewith. A "nucleic acid polymer" includes a polymer of nucleotides or nucleotide derivatives or analogs, including, for example, deoxyribonocleotides, ribonucleotides, etc. Genomic DNA, cDNA and mRNA are examples of nucleic acid polymers. The terms "regulate transcription", "modify transcription", "regulate production" and "modify production" are designed to include the promotion and / or repression of transcription or mRNA or production / translation of a protein. The term "expression regulatory sequence" means a nucleic acid polymer sequence linked to a protein encoding a sequence which, when introduced into a host cell, induces or prevents the expression of that protein. These sequences may or may not also encode the proteins used in their regulatory mechanisms. Examples of expression regulatory sequences include the CaMV promoter, the oes terminator and the tet operator sequences. The term "gene" is designed to include both endogenous and heterologous genes, and specifically, both genomic DNA molecules that encode a target protein in a cell present in nature and in addition to the cDNA encoding the target protein, e.g. , wherein the cDNA is a part of a nucleic acid construct such as a plasmid vector or virus that has been introduced into a cell or a cDNA produced by RT-PCR. The term "vector" is designed to include any physical or biochemical vehicle containing the nucleic acid polymers of interest, by which those nucleic acid polymers are transferred to a host cell, thereby transforming that cell with the polymers of introduced nucleic acids. Examples of vectors include DNA plasmids, viruses, particle gun pellets and bacteria such as Agrobacterium tumefaciens. The term "primary vector" is designed to refer to the first vector used in a transformation series, either in a single step (for example a plasmid used to transform a yeast cell), or with a "secondary vector" (e.g. a plasmid used to transform Agrobacterium tumefaciens, which is subsequently used to transform a plant cell). The term "host cell" is designed to refer to the target cell that is to be transformed with the vector, in which the transferred nucleic acid polymer is to be replicated and / or expressed. The term "conservative substitution", in the context of amino acid sequences, means substituting one amino acid in the sequence with another having a side chain of similar size and charge. An example of a conservative substitution could be to replace asparagine with glutamine. A person with ordinary skill in biochemical techniques can easily plan for conservative substitutions in a protein sequence that are expected to have minimal or no impact on the structure or function of the protein. The term "plant products" means any cellular material produced by a plant, especially those that could be used to propagate the plant. Plant products include seeds, rhizomes, leaves, meristem, roots and buds. The term "SSC buffer" means a solution of 8.765 g of NaCl and 4.41 g of sodium citrate in one liter of water, pH adjusted to 7.0 by volumetric addition of 10N NaOH solution. The contents of each of the references cited herein are incorporated for reference in their entirety.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to freshly sequenced cytokinin oxidase isolated from the maize plant, Zea mays, called ckxl, which has a specific substrate-specific cytokinin oxidant activity. The enzyme has been related to the development and maturation of grains in corn, as well as to the senescence of plant tissues. It seems that the control of these plant functions is achieved by the degradation of endogenous and exogenous cytokinin concentrations. Because ckxl efficiently oxidizes unsaturated side chain free cytokinins and their ribosides, such as iP, Z and ZR (which also induces the production of the enzyme when exogenously or endogenously applied), it is thought that ckxl controls in a rigorous way the availability of these active cytokinins as part of the regulation of the growth of the plant. During the development of the claimed invention, the applicant encountered several difficulties that could explain why the search for a gene for cytokinin oxidase na has been successful until nowadays. The protein is expressed at very low levels, and only at certain periods of the silver growth cycle. Therefore, the selection of a DNA library of cDNA? in E. coli it might not produce ckxl simply because the gene was not expressed, or was not expressed in detectable amounts when the library was taken. In addition, the isolation of the protein could have been a problem for some researchers, since its active form does not tolerate gel filtration. Only by developing its own selection procedure, described in the example, the applicant was able to isolate the protein with sufficient purity for tryptic digestion and for the subsequent determination of the sequence. Obtaining the gene sequence for ckxl proved to be quite difficult, even after the protein was purified. Apparently, the N-terminal end of ckxl is blocked, so that it was impossible to determine its N-terminal sequence by complete Edman degradation. Only small internal sequences could be determined after tryptic digestion of the protein, SEQ. ID. DO NOT. 4 & 5.

Because the location of these fragments in the amino acid sequence of the protein was not known, several problems had to be overcome in order to successfully probe the Zea mays genome for the ckxl gene, as described in the example 1. The small size of the sequenced peptides required the use of a "subject books" criterion (a probe at either end of the replicated DNA) in order to eliminate the non-ckxl DNA from either side of the ckxl gene. It could be reasonably certain that the DNA between two probes would be part of the ckxl gene. A 300 bp hybridization / amplification product size criterion was also necessary in order to be able to distinguish between dimerized degenerate primers and PCR products. It is likely that a simple degenerate strategy does not work due to the high degeneracy inherent in the particular amino acid sequences available from the tryptic peptides. Initially, when a standard degenerate nucleotide strategy was used, using all possible oligonucleotides coding for the interior amino acid sequences, the low concentration of specific binding primer was not sufficient for the initiation of PCR amplification. The applicant was able to overcome this problem only by using degenerate probes containing inosine with a broader specificity. In addition, several of the degenerate probes were very close to producing products of the objective size, or were not in the correct order in the gene to produce "subject books" products. Only the SEQ probes. ID. DO NOT. 6, 7, 8, & 9 proved to be useful for isolating the ckxl gene. The identity of the isolated gene was verified by two independent methods. First, this was verified by testing the affinity of goat antiserum towards a SEQ translation. ID. DO NOT. 3 for ckxl produced by Escherichia coli in corn grain extracts, according to example 1. Second, this was confirmed by the expression of SEQ. ID. DO NOT. 3 in Pichia pastoris that resulted in the secretion of active cytokinin oxidase according to example 2. I KNOW THAT. ID. DO NOT. 2 lists the complete genomic DNA sequence for ckxl, which provides the glycosylated form of the protein when expressed in Zea mays. The predicted location of the neutrons in the genomic sequence was verified using the polymerase-reverse transcriptase chain reaction to find the actual transcribed length of RNA, according to example 1. SEQ. ID. DO NOT. 3 lists the DNA sequence encoding ckxl, which provides the amino acid sequence indicated in SEQ. ID. DO NOT. 1. The level of advancement of molecular biology is currently sufficiently advanced so that minor alterations can be made to a DNA sequence with relative ease and precision. A lab technician with moderate skills can follow the instructions of one of the commercially available site-directed mutagenesis kits (eg, the GeneEditor ™ offered by Promega Corp., Madison, Wisconsin) to effect any number of changes to a sequence of DNA nucleotides. In addition, the general rules governing the genetic code are well known, by which the triplet nucleotide codons are translated into an amino acid sequence by standard biochemical methods. Therefore, the applicant considers that the group of DNA sequences indicated by the consensus sequence of SEQ ID NO. 10, which codes for the amino acid sequence of ckxl in the sequence SEQ ID NO. 1, is within the present invention. Although there is some variation in the genetic code and the percentage of GC content among some phyla, the rules that govern these variations have also been well documented, and are within the reasonable skill of an expert in genetics techniques. molecular. Therefore, the applicant also considers any other nucleic acid sequence that codes for the amino acid sequence SEQ ID NO. 1 is within the scope of the present invention. Furthermore, although knowledge in the field of protein biochemistry is not as complete as that of molecular genetics, one skilled in the biochemistry art can predict, with reasonable certainty, when certain substitutions to the structure of the amino acid sequence primary protein will not result in any appreciable modification of the function or structure of the protein. Such conservative substitutions are made by replacing in the sequence an amino acid with another containing a side chain with charge, size and other similar characteristics. For example, the amino acid alanine, which has a small non-polar methyl side chain, can generally be replaced by glycine, an amino acid having a small non-polar hydrogen side chain, without any noticeable effect. Similarly, the amino acid asparagine, with a voluminous polar etamide side chain, can usually be replaced with glutamine, which has a voluminous polar propane side chain, with no noticeable effects. To the extent that such conservative substitutions can be made preserving 65%, preferably 80% or more identity with SEQ ID NO. 1 and the cytokinin oxidizing activity, such altered proteins are within the scope of the present invention. It is known that cytokinin oxidases exist in a variety of non-glycosylated and glycosylated forms in various species of higher plants including corn. It is believed that this modification is involved in the storage of cytokinin oxidases in compartments for various uses inside and outside the cell. The degree of glycosylation of the enzyme can also explain the wide variety of molecular weights observed among the cytokinin oxidases of various species. Nevertheless, due to the specificity towards the substrate, to a molecular oxygen requirement for the activity, and to the effects of the reaction rate dependent on the copper concentration in vitro are highly conserved, among all the cytokinin oxidases of higher plants, a common domain and an active site structure that is believed to be responsible for the cytokinin oxidizing activity of all enzymes. Therefore, the present invention is also directed to a protein showing cytokinin oxidizing activity and which contains an amino acid sequence of at least 20 amino acids in length which is 90% identical (or could be identical with the conservative amino acid substitutions) to a similarly sized portion of SEQ ID NO. 1. Another objective of the current invention is the regulated production of ckxl in various host cells, either to bulk isolate subsequently, or regulated intracellular production. For example, ckxl can be produced in non-glycosylated form in prokaryotes such as E. coli, as illustrated in example 1. Preferably, the protein can be produced in eukaryotes, as illustrated by the Pichia production of the example 2. An additional benefit of producing the protein in Pichia is that the protein is secreted in the culture medium where it can be easily purified. Alternatively, the protein can be produced in higher eukaryotes, preferably plants, such as the Nicotiana constructs of Example 4, either in glycosylated form or in non-glycosylated form. Other examples of suitable host plant cells include Zea mays, Arabidopsis thaliana, Brassica spp, and Oryza sativa. As illustrated, ckxl can be produced in plants either in an unregulated manner, as shown here under the CaMV promoter, regulated by an artificial stimulus, as shown herein under a tet operator combined with a CaMV promoter, and regulated by an environmental stimulus, as shown here under the RB7 promoter, which induces specific root production of a protein in response to attack by nematodes. The various aspects of the present invention, including the ckxl protein and the nucleic acid polymers that encode it, the cytokinin oxidizing activity of enzymes such as the ckxl enzyme and the regulation of cytokinin levels in plant cells by ckxl, allow collectively, several practical applications, including agricultural and research uses. The Applicant has contemplated an application for bulk cytokinin oxidase that greatly facilitates research in plant physiology. Cytokinin oxidase can be reoxidized after oxidizing cytokinins by the synthetic oxidizing agent dichlorophenolindophenol (DCPIP). The DCPIP demonstrates a reduced absorbance at 590 nm after reduction, which can be quantified spectrophotometrically. The concentration of cytokinin in a sample can be determined indirectly by measuring the decrease in oxidized DCPIP as ckxl oxidizes the cytokinins present in the sample. More sensitive redox dyes are also available to increase the sensitivity of the test. Therefore, it is another object of the present invention to provide a simple, rapid and effective means for evaluating cytokinin concentrations in a sample. The applicant has also planned an application for the modified production of ckxl in plants. Cytokinins are associated with various types of plant pathogenesis, including the formation of nematode feeder cells, and the invasion of plant tissues by fungi. Therefore, the regulated production of ckxl by exposure to pathogens can modify the efficacy of pathogenesis through mechanisms that utilize cytokinins such as those used by the root knot nematode, Meloidogyne spp. (Bird, et al., 1980), or fungal species such as Ustilago maydis. Therefore, it is an object of the present invention to provide a method for moderating cytokinin-mediated pathogenesis by transforming a plant with a DNA construct that produces ckxl. The following examples illustrate the principles and advantages of the invention.

EXAMPLES EXAMPLE 1 Isolation of ckxl and characterization of the sequence encoding it Corn grains were chosen as raw material for purification due to the relatively high concentrations of cytokinin oxidase present approximately one week after pollination. Using the procedure indicated below, a yield of approximately 1.66 μg of protein per kilogram of corn can be obtained. Corn grown in one field (Pioneer 3180 or 3379) was manually pollinated, and immature ears were harvested between 5 and 8 days later (Dietrich, 1995). The grains were harvested immediately, and were frozen at -80 ° C until they were subjected to extraction. After being pulverized in liquid nitrogen, the grains were mixed in batches of one kilogram with 1700 ml of buffer A (50 mM Tris, 5 mM EDTA, 0.4% w / v ascorbic acid, 10 mM β-mercaptoethanol, pH 8.5 ). PVPP washed with acid (200 g wet weight, equilibrated with buffer A) was added with stirring. The suspension was filtered through Miracloth and centrifuged at 23,500 x g for 15 minutes to remove the waste. Polyethylenimine solution (5% v / v, pH 8.5) was added dropwise to the centrifuged supernatant, to a final concentration of 0.05%. After centrifugation again at 23,500 x g for 10 minutes, the supernatant was filtered through a pad of 600 g of PVPP (prepared as indicated above). Fractionation with ammonium sulfate was performed, and the protein that precipitated between 40% and 65% saturation was collected by centrifugation and dissolved in a minimum volume of buffer B (10 mM Tris, 1 mM EDTA, β-mercaptoethanol 1 mM, pH 8.5). The insoluble material was removed by centrifugation at 35,000 x g for 20 minutes. At this point, glycerol can be added to the supernatant to a concentration of 10% v / v, which allows the protein to be stored at -80 ° C indefinitely without losing activity. After dialyzing the supernatant from the ammonium sulfate fractionation against buffer B, the fraction was applied to a DEAE-cellulose column (Whatman DE-52, 500 ml, available from the Whatman Group, Clifton, New Jersey) to the speed of 10 ml / minute. After washing with buffer B, the column was eluted with a linearly increased concentration of KCl in buffer B, at 200 mM to 600 ml. The protein content was measured using the Bradford dye binding test (Bradford, 1976). The fractions were analyzed for oxidase activity as described below. Two tests were used to select the purification steps for cytokinin oxidase activity. The first was the Schiff base formation test measuring the production of dimethylalipldehyde from iP, as described by Liberos-Minotta (1995), which was used until the DEAE column step. A second test, developed by the applicant, was used in the remaining purification steps. In this test, the transfer of reducing equivalents from isopentenyladenine to dichlorophenolindrophenol (DCPIP), catalyzed by ckxl, allows to observe the reactivity by measuring the change in absorbance at 590 nm. In a final volume of 250 μl, the test contains: 100 mM phosphate buffer, pH 7.0; EDTA 1.0 mM; 0.05 mM DCPIP; iP 0.1 mM; BSA 100 μg / ml and the sample tested. After the addition of the enzyme, the change in absorbance at 590 nm is read for 10 minutes. After purification on the DEAE column, the main active material collected was dialyzed against regulatory solution C (20 mM Tris, 0.5 M NaCl, 1.0 mM CaC, pH 7.4), and applied to an agarose-concanavalin A column (100 ml, from Sigma Aldrich, St. Louis, Missouri) and washed with buffer C (270 ml). The glycosylated proteins were eluted with a gradient in steps of buffer C containing α-D-methylmannoside at 1 M to 400 ml. The relatively long retention time when eluted under these conditions indicates that the glycosylated form of ckxl was isolated. Active fractions from affinity-lectin chromatography were then dialyzed against regulatory solution D (10 mM Tris), 1 mM EDTA, pH 8.5) and applied to a high resolution anion exchange column (FPLC MonoQ, 1 ml from Amersham Pharmacia Biotech, Ltd., San Francisco, California), and eluted with a linear gradient of KCl to a concentration of 0.12 M in a period of 24 minutes at one ml / minute. The active fractions from the ion exchange column were then concentrated, dialyzed against buffer B, taken up in 1.5 M ammonium sulfate and applied to a hydrophobic interaction column (FPLC phenylsuperose, 1 ml, Pharmacia) equilibrated in buffer solution B containing 0.6 M ammonium sulfate. After washing with 0.6 M ammonium sulfate for 25 minutes, the concentration of ammonium sulfate was successively reduced to 0.45 M in a period of 15 minutes and then to zero in a period of 60 minutes. Native gel electrophoresis was performed as illustrated in Ornstein (1964) and Davis (1964). The gels were then stained to determine the activity of cytokinin oxidase by the DCPIP procedure described above. The activity of the enzyme was revealed as a transparent band against a blue background. Next, denaturing SDS polyacrylamide gel electrophoresis was performed as illustrated in Laemmli (1970). When the fractions were tested for homogenity, the gel was treated as described by Miller (1995). In the final step of purification, the enzyme was stained with Coomassie blue R250. The purified protein was analyzed by tryptic digestion, HPLC separation of the digested material, and sequencing of the tryptic polypeptides by Edman degradation. Several polypeptide sequences were obtained from this analysis, including SEQ. ID NOS: 4 and 5. From these sequences, reverse translational initiator probes SEQ were planned. ID NOS. 6, 7, 8, and 9, with inosine substituted at highly degenerative positions. The initiators SEQ. ID NOS. 6 and 9 were then combined with corn genomic DNA, and hot-start touchdown PCR (PCR with hot start and decrease in temperature) was performed (Ault, 1994) for 40 cycles. The PCR products were separated on an agarose gel, and an approximately 440 bp fragment was chosen to be used as a hybridization probe. The identity of the fragment was confirmed by demonstrating that it could be amplified by PCR with the nested internal primers SEQ. ID NOS. 7 and 8. The fragment amplified by the SEQ primers. ID NOS. 6 and 9 was then ligated into linearized pCRI1 DNA and transformed into E. coli (Inv F ', Invitrogen Corp., Carlsbad, California). After cloning and re-isolating the DNA, the sequences of the plasmid inserts were determined using the Prism dideoxy terminator method from Applied Biosystems, Foster City, CA, to verify that the polypeptides from the tryptic digestion to which they were determined the sequence were encoded by the fragment. Once the large fragment was verified, it was labeled with 32P by primer extension using the Klenow fragment of polymeric DNA and the SEQ primers. ID NOS. 6 and 9. Phage from the corn genomic library (in? -FIXII, from Sgtratagene, La Jolla, California) was diluted in SM buffer and appropriate numbers were added to freshly prepared E. coli (XL1-Blue MRA (P2), Stratagene) in 10 mM MgSO4 and incubated at 37 ° C for 15 minutes. NZY agar higher than 48 ° C was added and the mixture was seeded on NZY agar plates. After incubating for approximately 8 hours at 37 ° C, the plates were cooled at 4 ° C for 2 hours and the phages were absorbed into Hybond N membrane sheets (Amersham Pharmacia Biotech, San Francisco, California). The membranes were air dried for 10 minutes and incubated successively with 0.5 M NaOH plus 1.5 M NaCl, 500 ml, 5 minutes; 0.5 Tris-CI pH 8.0 plus 1.5 NaCl, 500 ml, 5 minutes; and 2 x SSC, 500 ml, 5 minutes. These were blotted and baked at 80 ° C until dry (approximately 15 minutes). The membranes were pre-hybridized at 45 ° C for less than one hour in 50% formamide, 5 x SSPE, 2 x Denhardt's solution, 0.2% SDS, 100-200μg / ml denatured herring sperm or DNA from calf thymus (Maniatis, 1990). The labeled DNA fragment was then denatured at 100 ° C for 5 minutes, and added to the pre-hybridization solution, and hybridized for 16 hours at 45 ° C. For primary selection, the phage were seeded at a density of 500 pfu / cm2 and the membranes were washed with high stringency. For the subsequent purification of the plate, the candidate phages were seeded at a density of 70 and pfu / cm 2 and 2 pfu / cm 2 and the membranes were washed with intermediate astringency. After three rounds of purification, the subfragments of the insert were removed from the positive phage DNA by restriction and subcloned into pBluescript (Stratagene) to characterize them by restriction digestion and sequence analysis. Two overlapping plasmid subclones, pROM2 (one Hindlll insert) and pROM3 (one Xho-BamHI insert) each contained part of the ckxl gene. These overlapping sections had been fused in the plasmid pROM10 clone. Plasmids pROM2, pROM3, and pROM10 have been deposited in the American Type Culture Deposit as ATCC Nos. 209573, 209572 and 209571, respectively. The DNA sequence cloned into pROM2 and pROM3 supplied the genomic sequence of ckxl, SEQ. ID NO. 2, which was verified by the inclusion of the sequences coding for the fragments of the tryptic digestion obtained previously. The location of the introns in the ckxl gene was verified, and the coding sequence for ckxl (SEQ ID No. 3) was verified using the polymerase chain reaction-reverse transcriptase (RT-PCR) according to the following process. Total RNA (2-4 μg, treated with DNAse I) from grains harvested five days after pollination (5 DAP) was primed for RT-PCR using oligonucleotides that group the intron sites. The primers 2031f (genomic sequences 2031-2050 for ckxl) and XBH1 (reverse complement of the genomic sequences 2553-2570 for ckxl) covered the first intron site. Initiators 3160f (genomic sequences 3160-3179 for ckxl) and 3484r (reverse complement of genomic sequences 3465-3484 for ckxl) covered the second intron site. Reverse transcription was performed at 50 ° C for 50 minutes with 200U of Superscript II (Gibco-BRL) in a total volume of 20 μL with 25 mM Tris-CI, pH 8.3, 37.5 mM KCl, 1.5 mM MgCl 2, 0.5 mM dNTPs , 5 mM dithiothreitol, 40 U RNAin (Promega, Madison, Wisconsin). PCR was performed with 4-10% of the reaction product of RT as the template and 1 U of Taq polymer in 1x buffer for PCR (Roche Diagnostics, Basel, Switzerland), 200 μM of dNTPs and 0.5 μM of each primer . The reaction conditions were: an initial denaturation at 95 ° C for four minutes followed by 35 cycles of denaturation at 95 ° C for one minute, annealing at 60 ° for one minute and extension at 72 ° for one minute. A final extension of four minutes was performed at 72 °. The PCR products were resolved on 1.5% agarose gels. The PCR products were separated from the gels and sequenced to determine the junctions of the splice sites.

The RT-PCR analysis of corn grain RNA (5 days after pollination) with primers designed to encompass the locations of the first and second nucleons demonstrated PCR product sizes consistent with the unwinding of these introns into the mRNA. of mature oxidase. The primers that group the first intron must give a product of 539 bp if the intron is present and a product of 127 bp if it has been unpacked. Similarly, the primers that group the second intron must yield a 324 bp product if the second intron is present and a 232 bp product if it has been unpacked. As shown in Figure 2, the PCR products were 127 bp and 232 bp respectively, indicating that the introns had indeed been de-patched. The analysis of the sequence of the fragments confirmed that the splice was presented as predicted. The identity of the protein and the ckxl gene were further verified by the following immunological technique. Polyclonal antibodies were created in goats for the peptide produced by the expression of a fragment of ckxl gene in E. coli. This prevented the occurrence of a glycosylated surface when the antibodies were created for the gene product and the problems encountered by Burch, et al., When antibodies were created for ckxl present in nature. Goat antibodies from immunized and non-immunized animals were partially purified by sodium sulfate precipitation (Williams, et al., 1967). Affinity columns were prepared by coupling these purified antibodies (2 mg) with Aminolink Plus gels (1 ml, Pierce) at pH 10, following the manufacturer's protocol. Activity depletion tests were performed by adding 0.2 ml (27 μg) of a fractionated corn oxidase preparation with ConA plus 0.8 ml of phosphate buffered solution (PBS) to each column. The columns were capped and incubated for 1 hour at room temperature. The eluted material was collected and evaluated for cytokinin oxidase activity. Antibodies to ckxl recognize the main enzyme cytokinin maize oxidase. A column containing immobilized anti-ckxl fragment antibody was able to deplete the cytokinin oxidase activity from a corn extract fractionated with ConA. A control column of non-immunized goat antibodies could not do so.

EXAMPLE 2 Expression of ckxl in Pichia pastoris The ckxl protein can be produced in bulk by the following procedure to be used in applications such as the cytokinin tests of example 3, or for application to plant materials. The expression of ckxl in Pichia pastoris was carried out in four stages: Step 1. Removal of ckxl introns Step 2. Removal of the corn promoter and construction of the appropriate expression cassette using the intron-free construction. Step 3. Transformation of the final construction in Pichia and Step 4. Expression of ckxl in Pichia Removal of the intron more to the right was achieved by splicing by extension of overlap (Horton et al., 1989) and for the intron more towards the left by ligating the appropriate restriction fragments. The resulting intron-free cassette was inserted into the pPICZ-A expression vector in Pichia to give the expression construct pROM24 (Figure 9). This construction was introduced into the Pichia host of the requirement and was developed in the presence of methanol to induce the expression of ckxl. Appropriate lines of Pichia control (containing the vector alone or a recombinant expressing human serum albumin) were developed in parallel. Cytokinin oxidase activity was not observed in the Pichia cell lysates containing ckxl or in the controls at any time during the development curve. However, the Pichia line containing ckxl expressed and secreted high levels of cytokinin oxidase activity in the growth medium. No activity was observed in the control supernatants. This provided additional verification that ckxl does indeed code for a cytokinin oxidase.

Step 1. Removal of the intron The second intron (SEQ ID No. 2 residues 3219-3312) was removed by splicing by overlapping extension with ckxl restriction fragments selected as templates to limit artifactual priming. The following table lists the initiators and molds used.

The PCR products from reactions # 1 and # 2 were gel purified and used in the final PCR step. The final product from reaction # 3 was cloned and the sequence was determined and subfragment Pf1M1 / Xbal of pROM7 containing the intron was replaced by subfragment Pf1M1 / Xbal. The construction was called pROM19. The first intron (SEQ ID No. 2 residues 2113-2524) of pROM19 was then removed by replacing the DNA between the restriction sites PinA1 and Ncol with a linker constructed from the oligonucleotides CCGGTTTTGGTACCGGT (SEQ ID No. 17) and CATGACCGGTACCAAAA (SEQ ID NO.18). The product was named pROM20. The foreign bases associated with the linker were removed by digestion with PinA1 and then ligated again. The product, designated pROM22 (Fig. 8), contained the three fused exons of ckxl and the promoter for corn ckxl.

Step 2. The Pichia expression cassette The corn promoter was removed by partial digestion of pROM22 (Figure 8) with Aatll, filling the sticky ends with T4 DNA polymerase, and re-digesting with BglII. The exon fusion (containing ckxl and including its putative signal peptide) was ligated into the Pml1 / BsmB1 restriction sites of pPICZ-A (Pichia Easy-Select version B expression kit, Invitrogen Corp.). The resulting plasmid was designated pROM24 (Figure 9).

Step 3. Transformation in Pichia strain X33 as described in the Invitroqen protocol Plasmid pROM24 (Fig. 9) (10 μg) was digested with Dra1 and subjected to electroporation in competent X33 cells in a cuvette. mM at 1.75 kV (GenePulser, Bio-Rad Laboratories, Hercules, California). Selection on YPDS with 100 μg / ml zeocin resulted in many colonies.

One (PPckxl) was selected for the expression studies.

Step 4. Expression of the oxidase The transformant PPckxl colony was inoculated in BMGY medium (50 ml) and developed overnight. The cells were transformed into pellets, resuspended in BMMY (containing 0.5% v / v of methanol), diluted to an A6oo = 1 and developed at 30 ° C with vigorous agitation. Additional methanol was added up to 0.5% v / v at 24, 48 and 72 hours after inoculation. Samples were harvested to test the activity of cytokinin oxidase in cell lysates or in culture supernatants. Strains X33 of Pichia (WT, non-insert) and GS115, (insert that secreted sero human albumin) served as control.

EXAMPLE 3 Use of recombinant cytokinin oxidase in a rapid test method for cytokinin The cytokinins were measured by mixing 100 μL of a mixture of buffer solution containing phosphate buffer (250 mM, pH 7.0), EDTA (2.5 mM) and DCPIP (0.125 mM), and an excess of recombinant cytokinin oxidase with solutions (150 μL) of zeatin at various concentrations. The net change in absorbance was measured at 590 nm. Figure 3 illustrates the change in absorbance when the test is used to measure cytokinin zeatin. The method is capable of measuring quantities as small as 2 nmol of zeatin but, the main advantage of the test over the prior art is its speed. Tests can be performed in as little as five minutes, significantly faster than radioimmunoassays (MacDonald and Morris, 1985). In addition, the method can be integrated into cytokinin production systems by coupling the ckxl gene to genes such as the cytokinin-producing genes ipt or tzs, in order to evaluate the production of cytokinin in vitro EXAMPLE 4 Regulated and unregulated expression of ckxl constitutively and in the roots of Nicotiana tabacum The following procedure, which produces tobacco plants altered to express ckxl constitutively and at their roots is a slight modification of the standard protocols described in Draper et al., 1988. Nicotiana tabacum cultivar Xanthi is a standard tobacco line. Disarmed strains of Agrobacterium tumefaciens are used such as LBA4404 (Hoekema, et al., 1985). The salts of Murashige and Skoog, phytagar, sucrose, etc. are reactive grade or tissue culture grade. Three separate constructions were made with the sequence coding for ckxl (SEQ, ID No. 3) to effect three different patterns of ckxl expression in transformed tobacco plants. Constructs were based on the primary vector of plasmid BIN19 (which includes a compatible replication origin of Agrobacterium and selection markers for kanamycin, Bevan, et al., 1984). The following constructions were made: CaMV-ckxl-nos: The promoter of cauliflower mosaic virus with a booster (US Patent No. 5,530,196), are present in pBI121 (FIG 5) (available from Clonetech, Palo Alto, California ). The β-glucuronidase gene from pBI121 was separated with a BamHI / Ecolcrl digest. The coding sequence for ckxl (SEQ ID No. 3) was obtained by digestion with BglII of pROM26 (FIG 10) (pROM24 (FIG 9) altered by site-directed mutagenesis to contain another restriction site BglII and a Xhol). The final construction pROM30 (FIG.13), which induces a strong constitutive expression of ckxl, was created by digesting pBI121 altered with BamHl and ligating it in the sequence coding for ckxl. CaMV-tet-ckx1-ocs: the coding region for ckxl of pROM26 (FIG 10) was isolated by digestion with Bgl II and ligated into the BamH1 site of pUCA7-TX (Gátz, et al., 1992) to form pROM32 (FIG 14). The tetracycline-regulated operating element (US Patent No. 5,464,758) from pUCA7-TX and the inserted coding region were separated from pROM32 (FIG.14) by Pvull digestion. The final construct pROM29 (FIG.12) was produced by ligating the separated part at site Sa 77 of pJL7 (FIG.4) (a plasmid of type BIN19). When this construct is introduced into tobacco previously transformed to express the tet repressor protein, no ckxl activity will be expressed until the repression is released by the addition of tetracycline. This construction may be of particular utility in host organisms in which the strong constitutive expression of ckxl results in patterns of abnormal growth. RB7-ckx1-nos: the RB7 promoter specific for tobacco root (U.S. Patent No. 5,750,386), was obtained by the following method. A fragment containing the promoter was amplified by PCR from tobacco genomic DNA using GACACCATTCCAAGCATACCCC (SEQ ID NO.19) and GTTCTCACTAGAAAAATGCCCC (SEQ ID NO. initiators. This 1400 bp product was ligated into the pCRI1 plasmid (Invitrogen) to produce pROMd (FIG 6). The HindIII-EcoRI region of the insert, which contains the promoter portion specific for nematode, was then separated and ligated into the HindIII-EcoRI site of pBluescriptlI KS + (Stratagene) to produce pROM9 (FIG 7). The EcoRI-Nsil fragment of pROM24 (FIG.9), which contains the sequence coding for ckx1, was separated and ligated into the EcoRI-Pstl site of pROM9, to make pROM28 (FIG 11). The final construct pROM43 (FIG.15), which induces the expression of ckxl in roots when the roots of the transformed plants are attacked by nematodes, was produced by ligating a HindIII-SacI fragment of pROM28 in the HindIII-SacI site of pBI121 (FIG. FIG 5).

Components of medium MSS PC SI MSSK Sales MS (g / l) 4.3 4.3 4.3 4.3 Sucrose (g / l) 30.0 30.0 30.0 30.0 Phytagar (g / l) 7.5 5.0 5.0 7.5 NAA (mg / l) 0 1.0 1.0 0 BAP (mg / l) 0 0.1 0.1 0 Timethin (mg / l) 0 0 200 200 Kanamycin (mg / l) 0 0 50.0 50.0 pH 5.7 5.7 5.7 5.7 Nicotiana was continuously maintained by axenic culture of sprout apices in MSS and subcultured at 4 week intervals. Three binary plasmid constructs described above were subjected to electroporation in the unarmoured A. tumefaciens host and the transformants were developed under appropriate selection (An, et al. 1985). Subsequent logarithmic phase cultures were used for the transformation. Young leaves of axenic tobacco were dissected (3 to 4 weeks after apex culture in 4 to 6 segments, excluding the larger vasculature) The segments were grown in PC, with the abaxial side up, for 48 hours. Then they were immersed in culture of transformed A. tumefaciens diluted with water (1: 1), for 1 hour, then the pieces were placed in the original PC medium for 48 hours, then the leaves were completely washed with water and placed in medium. YES and were changed to new SI medium every 7 to 10 days.Although there were no adverse effects of development with Nicotiana transformants, it could be necessary to use a non-substrate dependent cytokinin such as benzylaminopurine, or repression with tetracycline, for cultivate some host plants The shoots were removed in MSSK medium when they were 1 cm long The successive crop of apices was carried out during 2 to 3 transfers, after and which the transgenic plants were kept in MSS medium. In light of the detailed description of the invention and the examples presented above, it can be seen that the various objects of the invention are achieved. The explanations and illustrations presented herein are designed to inform other experts in the art, its principles and its practical application. Those skilled in the art can adapt and apply the invention in its many forms, as best suited to the requirements of a particular use. Accordingly, the specific embodiments of the present invention as indicated are not designed to be exhaustive or limiting of the invention.

BIBLIOGRAPHY An, G., et al., 1985: "New cloning vehicles for transformation of higher plants," EMBO J. 4: 277-84 Ault, G., 1994: "Type-specific amplification of viral DNA using touchdown and hot start PCR, "J. Virol. Meth. 46: 145-56. Bechtold, N., et al., 1993: "In plant Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants," CR Acad. Sci. Paris Sciences of la vie / life sciences 316: 1194-99. Bevan, M., 1984: "Binary Agrobacterium vectors for plant transformation," Nuc. Acids Rsrch. 12: 8711-21. Bird, A.F., et al., 1980: "The involvement of cytokinins in a host-parasite relationship between tomato (Lycopersicon esculentum) and nematode (Meloidogyne javanica)," Parasitoloqy 80: 497-505. Bradford, M., 1976: "A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding, "Analvtical Biochem. 72: 248-54, Brownlee, BG, et al., 1975:" 3-Methyl-2-butenal: An Enzymatic Degradation Product of the Cytokinin, N6 - (? 2- isopentenyl) adenine, "Can. J. Biochem 53: 37-41.Burch, LR, et al., 1992:" Cytokinin Oxidase and the Degradative Metabolism of Cytokinins, "in Kaminek, et. Physioloqy and Biochemistry of Cvtokinins in Plants, pp. 229-32, STP Academic Publishing, The Hague, Netherlands, Chen, H., et al., 1996: "Novel methods of generating specific oligonucleotide inhibitors of viral polymerases." in Enzymoloqy 275: 503-20. Davis, B., 1964: "Disk Electrophoresis II. Mmethod and application to human serum proteins, "Ann. NY Acad. Sci. 121: 404. Dietrich, JT, et al., 1995:" Changes in cytokinins and cytokinin oxidase activity in developing maize kernels and the effects of exogenous cytokinin on kernel development, "Plant Physiol., Biochem 33: 327-36, Draper, J., et al., 1988: Plant Genetic Transformation and Expression: A Laboratory Manual, Blackwell Scientific Publications, Gátz, C, et al., 1992:" Stringent repression and homogenous de-repression by tetracycline of a modified CaMV 35 S promoter in intact tobáceo plants. "Plant J. 2 (3): 397-404, Haré, PD, et al., 1994:" Cytokinin oxidase: Biochemical features and physiological significance, "Phvsioloqia Plantarum 91: 128-35, Hoekema A., et al., 1985:" Non-oncogenic plant vectors for use n Agrobacterium binary systems, "Plant, Mol. Biol. 5: 85-89, Horton, RM, et al., 1989:" Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension, "Gene 77: 61- 8 Koziel, et al., 1993: "Field performance of elite transgenic maize plants expressing an insecticidal protein form Bacillus thuringiensis, Bio / Techonoloqy 11: 194. Laemmli, UK, 1970: Cleavage of structural proteins during the assembly of the head of bacteriophage. T4, "Nature 227: 680-685. Liberos-Minotta, C, et al., 1995:" A colorimetric Assay for Cytokinin Oxidase, "Analvtical Biochem 231: 339-341, MacDonald, EMS, et al., 1985: "Isolation of cytolinins by immunoaffinity chromatography and isolation by HPLC-radioimmunoassay," Methods in Enzymoloqy 110: 347. Maniatis, T., et al., 1990: Molecular Cloning, A Laboratory Manual 2nd Ed. Cold Spring Harbor Laboratory Press. HJ, et al., 1995: "Improved method for Silver Staining of Glycoproteins in Thin Sodium Dodecyl Sulfate Polyacrylamide Gels," Analvtical Biochem 226: 371-74, Odell, et al., 1985: "Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter, "Nature 313: 810. Ooms, G., et al., 1987: "Genetic transformation in two potato cultivars with T-DNA from disarmed Agrobacterium," Theor. Appl. Genet 73: 744-50. Ornstein, L., 1964: "Disk Electrophoresis I. Background and theorv." Ann. N.Y. Acad. Sci. 121: 321.

Potrykus, 1991: "Gene transfer to plants: assessment of published approaches and results," Annu. Rev. Plant Physiol., Plant Mmol. Biol., 42: 205. Singer, B.S., et al., 1996: "Libraries for genomic SELEX," Nucleic Acids Resrch. 25: 781-86. Skory, C.D., et al., 1996: "Expression and secretion of the Candida wickerhamii extracellular beta-glucosidase gene, bgls, in Saccharomyces cerevisiae" Current Genetics 30: 417-422. Smith, C.T.S., et al., 1988: "Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes," Nature 334: 724-26. Su, W., st al., 1996; "Identification in vitro of a post-translational regulatory site in the hinge 1 region of Arabidopsis nítrate reducíase," Plant Cell 8: 519-27. Van der Krol, A.R., et al., 1990: "Inhibition of flower pigmentation by antisense CHS genes: promoter and minimal sequence requirements for the antisense effect," Plant Molec. Biol. 14: 457-66. Williams, C. A, et al., 1967: Methods in Immunoloqy and Immunohistochemistry I p. 319 LIST OF SEQUENCES < 110 > Morís Ph.D., Roy O. < 120 > AN OXIDASE CYTOKININ < 130 > UMO 1491 < 140 > < 141 > < 150 > 06 / 054,268 < 151 > 1997-07-30 < 160 > 20 < 170 > Patentln Ver. 2.0 -i < 210 > 1 < 211 > 534 < 212 > PRT < 213 > Zea mays < 400 > 1 Met Ala Val Val Tyr Tyr Leu Leu Leu Ala Gly Leu lie Ala Cys Ser 1 5 10 15 His Ala Leu Ala Ala Gly Thr Pro Ala Leu Gly Asp Asp Arg Gly Arg 20 25 30 Pro Trp Pro Ala Ser Leu Ala Ala Leu Ala Leu Asp Gly Lys Leu Arg 35 40 45 Thr Asp Ser Asn Wing Thr Wing Wing Wing Thr Asp Phe Gly Asn lie 50 55 60 Thr Ser Ala Leu Pro Ala Ala Val Leu Tyr Pro Ser Ser Thr Gly Asp 65 70 75 80 Leu Val Ala Leu Leu Ser Ala Ala Asn Ser Thr Pro Gly Trp Pro Tyr 85 90 95 Thr lie Wing Phe Arg Gly Arg Gly His Ser Leu Met Gly Gln Wing Phe 100 105 110 Wing Pro Gly Gly Val Val Val Asn Met Wing Ser Leu Gly Asp Wing Ala 115 120 125 Wing Pro Pro Gly lie Asn Val Ser Wing Asp Gly Arg Tyr Val Asp Wing 130 135 140 oo Gly Gly Glu Gln Val Trp He Asp Val Leu Arg Wing Ser Leu Wing Arg 145 150 155 160 Gly Val Wing Pro Arg Ser Trp Asn Asp Tyr Leu Tyr Leu Thr Val Gly 165 170 175 Gly Thr Leu Ser Asn Wing Gly He Ser Gly Gln Wing Phe Arg His Gly 180 185 190 Pro Gln He Ser Asn Val Leu Glu Met Asp Val He Thr Gly His Gly 195 200 205 Glu Met Val Thr Cys Ser Lys Gln Leu Asn Wing Asp Leu Phe Asp Wing 210 215 220 Val Leu Gly Gly Leu Gly Gln Phe Gly Val He Thr Arg Wing Arg He 225 230 235 240 Wing Val Glu Pro Wing Pro Wing Arg Wing Arg Trp Val Arg Phe Val Tyr 245 250 255 Thr Asp Phe Wing Wing Phe Ser Wing Asp Gln Glu Arg Leu Thr Wing Pro 260 265 270 Arg Pro Gly Gly Gly Gly Wing Being Phe Gly Pro Met Being Tyr Val Glu 275 280 285 Gly Ser Val 'Phe Val Asn Gln Ser Leu Wing Thr Asp Leu Wing Asn Thr 290 295 300 Gly Phe Phe Thr Asp Ala Asp Val Ala Arg He Val Ala Leu Ala Gly 305 310 315 320 CD Glu Arg Asn Wing Thr Thr Val Tyr Ser He Glu Wing Thr Leu Asn Tyr 325 330. 335 Asp Asn Wing Thr Wing Wing Wing Wing Wing Val Asp Gln Glu Leu Wing Ser 340 345 350 Val Leu Gly Thr Leu Ser Tyr Val Glu Gly Phe Wing Phe Gln Arg Asp 355 360 365 Val Wing Tyr Wing Wing Phe Leu Asp Arg Val His Gly Glu Glu Val Wing 370 375 380 Leu Asn Lys Leu Gly Leu Trp Arg Val Pro His Pro Trp Leu Asn Met 385 390 395 400 Phe Val Pro Arg Ser Arg He Wing Asp Phe Asp Arg Gly Val Phe Lys 405 410 415 Gly He Leu Gln Gly Thr Asp He Val Gly Pro Leu He Val Tyr Pro 420 425 430 Leu Asn Lys Ser Met Trp Asp Asp Gly Met Ser Wing Wing Thr Pro Ser 435 440 445 Glu Asp Val Phe Tyr Wing Val Ser Leu Leu Phe Ser Ser Val Wing Pro 450 455 460 Asn Asp Leu Wing Arg Leu Gln Glu Gln Asn Arg Arg He Leu Arg Phe 465 470 475 480 Cys Asp Leu Wing Gly He Gln Tyr Lys Thr Tyr Leu Wing Arg His Thr 485 490 495 in o Asp Arg Ser Asp Trp Val Arg His Phe Gly Wing Wing Lys Trp Asn Arg 500 505 510 Phe Val Glu Met Lys Asn Lys Tyr Asp Pro Lys Arg Leu Leu Ser Pro 515 520 525 Gly Gln Asp He Phe Asn 530 < 210 > 2 < 211 > 6733 < 212 > DNA < 213 > Zea mays < 220 > < 221 > gene < 222 > (1) .. (6733) < 223 > genomic sequence for a cytokinin oxidase from Zea mays < 220 > < 221 > CDS < 222 > (1497) .. (2111) < 220 > < 221 > CDS < 222 > (2524) .. (3216) < 220 > < 221 > CDS < 222 > (3311) .. (3607) < 220 > < 221 > uncertain in < 222 > (5697) < 400 > 2 ctcgagactc cgacgagagg aggctgcgca tgcttgagtc atatcttgga aaaaaaaact 60 gtaacttaaa gtatgatcta tatatggatt atttggatgg gatgtcattt tcgtatcacc 120 aaccaaaatt acagtttggt cgtgcgtaga aattctacct actagctgaa acaacggctg 180 ctatgtataa ctactggtac tggaaagaat attagtcatt gactcaaaat tagaatgcat 240 tgcgtgctaa gtgtaagtca tttgttctat cagcattcgg cgaattccga agtccgtacg 300 tgttgttcgt ggaggagagg aaaacatcag aaatgacaaa actagacggt gtgtgcttct 360 acactgaatt cctcaacatt tgttttactt ttactagaga atggcatcaa atggaaaacc 420 gctggaaaaa aaacaacaaa acaattggac cccaaatatg tatacagacg ctagctatag 480 ccagccacac tgaagttgac atgcggcagc tagctagcca ccttctctga aacactaaca 540 tttgtacctt ggtcgtgtaa gtgtagtagt aacgtatgtt gacgcgactt accgaacaaa 600 aatataattg tcccaatcaa gctagggacg attgtttgtt tccaaaatgt tgccatttgc 660 ttaatcaatc ctatattaat tcatggctgt taaggtgaga taaagcgaca agaaatctat 720 atatatgtat ataagatccc gaaggctagc gacatttttg atagcaaaat atgagaagtt 780 tggcagattg ttctggtagc aaatcaaata atatggccag aataatcgtg gctagcttga 840 ttaaaccttc atcagcttgg tgtattttgg aagtcgacca accagctggg ggtcgtcgta 900 cgtagtacca aaattacagc ctgctttcct tcgtcctgta cgtaatgcag tacagctgtc 960 ro tagtagagac cattttgagg aggcacacac acattaagtg ataacataaa agacggcctg 1020 attttatttc ataaccaaac gatatggtca atagctacca acacacacct aatttgtaca 1080 actatttagt gcgaaaacta tttcattctc aagaattgat cgcttatatt tattattaca 1140 tgtataaata gctttttaaa cgctatattg catggcaaca gggggtaata attaggcagg 1200 actatatata taatagtttt ttcttcttct gtaaattctt gggaggatgg taaagttggt 1260 aactaggcac cttacttgcg cgcatatttt tctgtggtca aacagaataa aactagacgg 1320 gatgcagaat atttttttcc ttggaaagca gctcatcttt gtgttcgagt aattgaagaa 1380 gtatgtaatc gcactacacc tacacctata tatatacggg gtgcaatcac ctagttacca 1440 aacactcaca cataacgtat agctctctct ctctcccgtg aacgacgacg tcgcta atg 1499 Met 1 gcg gtg gtt tat tac ctg ctg ctg gcc ggg ctg ate gcc tgc tet cat 1547 Wing Val Val Tyr Tyr Leu Leu Leu Wing Gly Leu He Wing Cys Ser His 5 10 15 gca cta gcg gca ggc acg ect gcg etc gga gac gat cgc ggc cgt ccc 1595 Wing Leu Wing Wing Gly Thr Pro Wing Leu Gly Asp Asp Arg Gly Arg Pro 20 25 30 tgg cea gcc tec etc gcc gcg ctg gcc ttg gac ggc aag etc cgg acc 1643 Trp Pro Ala Ser Leu Ala Ala Leu Ala Leu Asp Gly Lys Leu Arg Thr 35 40 45 in gac age aac gcg acg gcg gcg gcc tcg acg gac tcc ggc aac ate acg 1691 eo Asp Ser Asn Wing Thr Wing Wing Wing Being Thr Asp Phe Gly Asn He Thr 50 55 60 65 tcg gcg etc cec gcg gcg gtc ctg tac ceg tcg tec acg ggc gac ctg 1739 Ser Ala Leu Pro Ala Ala Val Leu Tyr Pro Ser Ser Thr Gly Asp Leu 70 75 80 gtg gcg ctg ctg age gcg gcc aac tec acc ggg tgg ccc tac acc 1787 Val Ala Leu Leu Ser Ala Ala Asn Ser Thr Pro Gly Trp Pro Tyr Thr 85 90 95 ate gcg ttc cgc ggc cgc ggc cae tec etc atg ggc cag gcc tcc gcc 1835 He Wing Phe Arg Gly Arg Gly His Ser Leu Met Gly Gln Wing Phe Wing 100 105 110 ccc ggc ggc gtc gtc gtc aac atg gcg tec ctg ggc gac gcc gcc gcg 1883 Pro Gly Gly Val Val Val Asn Met Ala Ser Leu Gly Asp Ala Ala Ala 115 120 125 ceg ceg cgc ate aac gtg gcg gcg gac cgc tac gtg gac gcc ggc 1931 Pro Pro Arg He Asn Val Ser Wing Asp Gly Arg Tyr Val Asp Wing Gly 130 135 140 145 ggc gag cag gtg tgg ate gac gtg ttg cgc gcg tcg ctg gcg cgc ggc 1979 Gly Glu Gln Val Trp He Asp Val Leu Arg Wing Be Leu Wing Arg Gly 150 155 160 gtg gcg ceg cgc tec tgg aac gac tac etc tac etc acc gtc ggc ggc 2027 Val Wing Pro Arg Ser Trp Asn Asp Tyr Leu Tyr Leu Thr Val Gly Gly 165 170 175 acg ctg tec aac gca ggc ate age ggc cag gcg ttc cgc falls ggc cea 2075 in Thr Leu Ser Asn Wing Gly He Ser Gly Gln Wing Phe Arg His Gly Pro 180 185 190 cag ata tet aac gtg ctg gag atg gac gtt ate acc ggtacgtgtg 2121 Gln He Ser Asn Val Leu Glu Met Asp Val He Thr 195 200 205 cacctactac tactttttcc ctcccttgca caagtgeaca accacaccac agcaagcgag 2181 caaaagcttg tttttttttt acgtgccagt acacctgcat cgacttctgt tgcttgccac 2241 gg ggcaacac cgtgttcaat cagccggatt gaaattcgtt aectacattg cgaatcatat 2301 atttattttt ttagtattat tagtggtgca tggtggttaa tgtccgcgct gcaccggccg 2361 gccgcccgcc cggccggcga ggggcggcga cgtctttaat aactagtcat aaatcagcat 2421 gcatgctggc tctcgcagct ggtgegttga cattgtgcct ttgttcgttt cggetaatag 2481 aattatattg ctggggtgtt gactttgtgg tgatcgaacg ca ggc cat ggg gag 2535 Gly His Gly Glu atg gtg acg tgc tec aag cag ctg aac gcg gac ctg ttc gac gcc gtc 2583 Met Val Thr Cys Ser Lys Gln Leu Asn Ala Asp Leu Phe Asp Wing Val 210 215 220 225 ctg ggc ggg ctg ggg cag ttc gga gtg ate acc cgg gcc cgg ate gcg 2631 Leu Gly Gly Leu Gly Gln Phe Gly Val He Thr Arg Wing Arg He Wing 230 235 240 gtg gag ceg gcg ceg gcg cgg gcg cgg tgg gtg cgg ttc gtg tac acc 2679 Val Glu Pro Wing Pro Wing Arg Wing Arg Trp Val Arg Phe Val Tyr Thr 245 250 255 in gac tcc gcg gcg tcc age gcc gac cag gag cgg ctg acc gcc ceg cgg 2727 in Asp Phe Wing Wing Phe Wing Wing Asp Gln Glu Arg Leu Thr Wing Pro Arg 260 265 270 ccc ggc ggc ggc ggc gcg tcg ttc ggc ceg atg age tac gtg gaa ggg 2775 Pro Gly Gly Gly Gly Wing Ser Phe Gly Pro Met Ser Tyr Val Glu Gly 275 280 285 tcg gtg ttc gtg aac cag age ctg gcg acc gac ctg gcg aac acg ggg 2823 Ser Val Phe Val Asn Gln Ser Leu Wing Thr Asp Leu Wing Asn Thr Gly 290 295 300 305 ttc ttc acc gac gcc gac gtc gcc cgg ate gtc gcg etc gcc ggg gag 2871 Phe Phe Thr Asp Ala Asp Val Ala Arg He Val Ala Leu Ala Gly Glu 310 315 320 cgg aac gcc ac acc gtg gtg tac age ate gag gcc acg etc aac tac gac 2919 Arg Asn Wing Thr Thr Val Tyr Ser He Glu Wing Thr Leu Asn Tyr Asp 325 330 335 aac gcc acg gcg gcg gcg gcg gcg gtg gac cag gag etc gcg tec gtg 2967 Asn Ala Thr Wing Wing Wing Wing Wing Val Asp Gln Glu Leu Wing Ser Val 340 345 350 ctg ggc acg ctg age tac gtg gag ggg ttc gcg ttc cag cgc gac gtg 3015 Leu Gly Thr Leu Ser Tyr Val Glu Gly Phe Ala Phe Gln Arg Asp Val 355 360 365 gcc tac gcg gcg ttc ctt gac cgg gtg drops ggc gag gag gtg gcg etc 3063 Ala Tyr Ala Ala Phe Leu Asp Arg Val His Gly Glu Glu Val Ala Leu 370 375 380 385 aac aag ctg ggg ctg tgg cgg gtg ceg falls ceg tgg etc aac atg ttc 3111 Asn Lys Leu Gly Leu Trp Arg Val Pro His Pro Trp Leu Asn Met Phe c. 390 395 400 gtg ceg cgc tcg cgc ate gcc gac tcc gac cgc ggc gtg ttc aag ggc 3159 Val Pro Arg Ser Arg He Wing Asp Phe Asp Arg Gly Val Phe Lys Gly 405 410 415 ate ctg cag ggc acc gac ate gtc ggc ceg etc ate gtc tac ccc etc 3207 He Leu Gln Gly Thr Asp He Val Gly Pro Leu He Val Tyr Pro Leu 420 425 430 aac aaa tec atgtacgtgt tgaategate ggctagctag ctagctaggc 3256 Asn Lys Ser 435 acgccccggc cggcctctga cgactcgacc ggtctttctg gggtttggtt ttte atg 3313 Met tgg gac gac ggc atg tcg gcg gcg acg ceg tet gag gac gtg ttc tac 3361 Trp Asp Asp Gly Met Ser Ala Ala Thr Pro Ser Glu Asp Val Phe Tyr 440 445 450 gcg gtg tcg ctg etc ttc tcg tcg gtg gcg ccc aac gac ctg GCG agg 3409 Ala Val Ser Leu Leu Phe Ser Ser Val Ala Pro Asn Asp Leu Ala Arg 455 460 465 CTG cag gag cag aac agg agg tie CTG CGC ttc TGC gac etc gcc ggg 3457 Leu Gln Glu Gln Asn Arg Arg I Leu Arg Phe Cys Asp Leu Ala Gly 470 475 480 485 ate cag tac aag acc tac ctg gcg cgg falls acg gac cgc agt gac tgg 3505 He Gln Tyr Lys Thr Tyr Leu Ala Arg His Thr Asp Arg Ser Asp Trp 490 495 500 one gtc cgc falls ttc ggc gcc gcc aag tgg aat cgc ttc gtg gag atg aag 3553 - * Val Arg His Phe Gly Ala Ala Lys Trp Asn Arg Phe Val Glu Met Lys 505 510 515 aac aag tac gac ccc aag agg ctg etc tec ccc ggc cag gac ate ttc 3601 Asn Lys Tyr Asp Pro Lys Arg Leu Leu Ser Pro Gly Gln Asp I Phe 520 525 530 aac tga tgatgatagc ecatgeatgt tttagtttct tgggacaata 3657 atgtgaataa Asn ttcccagcta gcggctatta attaatctgt atatagattg atcactgcac tgatgtatgt 3717 atttacgtta caaggtcatt tggtaaaaaa aaaagtaccc tcgtcgtata ttctcgtttc 3777 atctgcccaa cccccagagt tttaaaaatg cacgttgaga gcaaaatttc cacaccgttt 3837 atccatgtag tagattgggt gtatattgaa tccgtataaa tatatagcaa gacaaaattt 3897 attgcaatct gatcccgtac accataattc acatgaaatt agaataaccg aacaaaagga 3957 cttgttagta tgggttgccg ttgcactttt tttgtgtgcc tatttaggta tgatatagtt 4017 ttatttgaca ctgccaaaca gtcaaataca tccctgtcgt cctaataggc gtccaaaatc 4077 aaacgtgtgt ttagccagcc cccatccaaa cacgcccata tccctatttt ctttgccttc 4137 ccttttaatt tttgtttttt tttcctcttc aaataataac tggtcctcaa ctagtcactt 4197 aagagtgtga aaaaaaaagg aggagaagga aaaagacacc gtcacttgtg aaacaaatta 4257 aaaagtttct tggatcgagg cgcgtgatac tctctcaccc tgcacgtttt gcttcgatct 4317 ccgacggcac cgtccgtcat tttctacaaa atacgaaacc ttgttccgtg cttgttgatc 4377 in 00 agacagctga cgtcgacaag ttcaggtaaa gggtcatttg cgcgaccagc aggtcggctg 4437 gattctttta gtgttgaact aacttaatga taaccagtag agtagacacc attgattett 4497 accgctagtc ttaaacttta ttattcaaaa tatttattta ttttaaatca aaatgtataa 4557 ageacagact acatcaagtg ataaaacaaa tcataataaa attaatgata acttattatt 4617 agaegaaega gttttgaata tcaaagtttt aaaaataaac ggtgtcatat acggagggag 4677 tactagetta gtaccccggt tgaccagaag tgcggtgtgc ettaattega tcgttttctc 4737 ttgtttcctc agcgttcacc acatgeactg cacttgcaag ccgtacacgt tgactagtgg 4797 ggcaatgcta gettggtgag gttttttgat tgattcccag cttttagacg aggtcactcc 4857 acasfaaaaag ctaagcaacg gtgctgacct gaataaataa aggtggtcgt agattattgg 4917 ttatagccgt cgtcacaggt cacacacacg caacaagcct atagcaggat tacaccgatt 4977 aatagaaaaa atcatcggga agggaaatga acgaagtaac caggagacag acgacgagaa 5037 agtattgtct atccttaaga cccccttgag caagctacac ggataattag gctcccatcg 5097 gacgtcattt ctggacacgt acgctattgt gatttgtaag ggtgtttggt ttctaaatac 5157 taatttttag ccactcttta ttattatatt ctagtcacta aattatcaaa tacgaaaatt 5217 aaaatagatt tttaatttta agtattttgt aatttatgta ctagaatgga ataaaatggt 5277 gtgattaaaa attagtccct aaaaatcaaa tgtcattccc cctttattag aagacctctt 5337 gageaageta agctgcacgt attattaggc ctcaacatgc ctatgtgtgt ataacaggac 5397 ^ CD aaccaggccc cccaaacttc agttgtacgt atgtgtaaca ggacaatega tgtactgtga 5457 tctcaaacgt cagctgtagg tacgtatgaa tgtatatatg tgtatttact cctcctgttt 5517 taaatcagtt gtcgcgatgg tatttatgtc catcaaagtt tgttagagta gactagettt 5577 ttagaaaatg ttagtcacat ttatatcetc aaataaactt acttataaaa ataaattcaa 5637 tgatctattt aataatataa cgatactaat catgtaatat gaatataaat attttcttgn 5697 acatatttga tgaagtttaa aatagttagt ttttaaaaaa ataaaaacac cgactatttt 5757 aaaatagata gagtacatat acaagaaaat gagaaattat tactaatgtt tacaacgtat 5817 aataaataat atataaatta tgaaatatat ttttataata aatctgttta gagaagataa 5877 tattttctac gactccttgt tcaaatctag aatgacatta tttttgggac ggaggcagtt 5937 cgtactacgt acgtaacatg tattcctaac acggacaatc aaaacatggg aacttcactc 5997 catttgtaaa gccgggggcg gaatcggtgg amgtgtttgt ttcttggcgc acggtgaytc 6057 gatgaggatt cgtgcaaacc ttaamaggct tggtcatctg tctgcattca ytccacacgg 6117 ccatacgcac gtgtttttct ggatgggcat gaacacggac tctcaagtca acggcacgca 6177 gggcagttaa agggagacgc gtgggaacat gataccaggg ttgcatcttc acaaaattgg 6237 tacatcatca ccgtatgtgc gggggagcag ccataattta catggaaacg aatacaatga 6297 tggagcacgt cagtggctat tattcttcaa tgaggctaca gctacactat ttgatgcaca 6357 tcagctactg cctcctagtc cttgggcgcc cacctccaca ctttcagctc 6417 <gccggagcag; - > or tctccggtga agagcagccc accagccgca agctcgatgg tcctaacttc cttcgtggac 6477 aacagtgttc caatcccgtc gaacctgaaa gatggtaacc aggcaaatgc agagctcctt 6537 tcagtaagga accactgagc gagcggtttg tctatctgat gatgaaactg ataaaaaaaa 6597 cacgatggca attatgcact agtcgagcaa gcggacgcga ggagggagca ttgctgttgt 6657 caagagaact ggcgtcttcc caactcggtg catgccgaag agtgtgcgca aaccctgcaa cataatcgga AAGCTT 6717 6733 < 210 > 3 < 211 > 1605 < 212 > DNA < 213 > Zea mays < 220 > < 221 > CDS < 222 > (1) .. (1605) < 400 > 3 atg gcg gtg gtt tat tac ctg ctg ctg gcc ggg ctg ate gcc tgc tet 48 Met Wing Val Val Tyr Tyr Leu Leu Leu Wing Gly Leu He Wing Cys Ser 1 5 10 15 cat gca cta gcg gca ggc acg ect gcg etc gga gac gat cgc ggc cgt 96 His wing Leu wing wing wing Gly Thr Pro wing Leu Gly Asp Asp Arg Gly Arg 20 25 30 ccc tgg cea gcc tec etc gcc gcg ctg gcc ttg gac ggc aag etc cgg 144 Pro Trp Pro Ala Ser Leu Ala Ala Leu Ala Leu Asp Gly Lys Leu Arg 35 40 45 acc gac age aac gcg acg gcg gcg gcc tcg acg gac tcc ggc aac ate 192 - »• Thr Asp Ser Asn Wing Thr Wing Wing Wing Thr Asp Phe Gly Asn He 50 55 60 acg tcg gcg etc cec gcg gcg gtc ctg tac ceg tcg tec acg ggc gac 240 Thr Ser Ala Leu Pro Ala Ala Val Leu Tyr Pro Ser Ser Thr Gly Asp 65 70 75 80 ctg gtg gcg ctg age gcg gcc aac tec ctg acc ggg tgg ccc tac 288 Leu Val Wing Leu Leu Ser Wing Wing Asn Ser Thr Pro Gly Trp Pro Tyr 85 90 95 acc ate gcg ttc cgc ggc cgc ggc falls tec etc atg ggc cag gcc ttc 336 Thr He Wing Phe Arg Gly Arg Gly His Ser Leu Met Gly Gln Wing Phe 100 105 110 gcc ccc ggc ggc gtc gtc gtc gtc aac gcg gcc tec ctg gcc gac gcc gcc 384 Wing Pro Gly Gly Val Val Val Asn Met Wing Ser Leu Gly Asp Ala Wing 115 120 125 gcg ceg ceg cgc ate aac gtg tec gcg gac ggc cgc tac gtg gac gcc 432 Wing Pro Pro Arg He Asn Val Ser Wing Asp Gly Arg Tyr Val Asp Wing 130 135 140 ggc ggc gag cag gtg tgg ate gac gtg tgc gcg gcg gcg gcg cgc 480 Gly Gly Glu Gln Val Trp He Asp Val Leu Arg Wing Ser Leu Wing Arg 145 150 155 160 gg gg gg gg gg gg gg ggc ggc 528 Gly Val Wg Pro Arg Ser Trp Asn Asp Tyr Leu Tyr Leu Thr Val Gly 165 170 175 ggc acg ctg tec aac gca ggc ate age ggc cag gcg ttc cgc falls ggc 576 Gly Thr Leu Ser Asn Wing Gly He Ser Gly Gln Wing Phe Arg His Gly ro 180 185 190 cea cag ata tet aac gtg ctg gag atg gac gtt ate acc ggc cat ggg 624 Pro Gln He Ser Asn Val Leu Glu Met Asp Val He Thr Gly His Gly 195 200 205 gag atg gtg acg tgc tec aag cag ctg aac gcg gac ctg tcc gac gcc 672 Glu Met Val Thr Cys Ser Lys Gln Leu Asn Ala Asp Leu Phe Asp Wing 210 215 220 gtc ctg ggc ggg ctg ggg cag ttc gga gtg ate acc cgg gcc cgg ate 720 Val Leu Gly Gly Leu Gly Gln Phe Gly Val He Thr Arg Ala Arg He 225 230 235 240 gcg gtg gag ceg gcg ceg gcg cgg gcg cgg tgg gtg cgg ttc gtg tac 768 Wing Val Glu Pro Wing Pro Wing Arg Wing Arg Trp Val Arg Phe Val Tyr 245 250 255 acc gac ttc gcg gcg ttc age gcc gac cag gag cgg ctg acc gcc ceg 816 Thr Asp Phe Wing Wing Phe Wing Asp Gln Glu Arg Leu Thr Wing Pro 260 265 270 cgg cgc ggc ggc ggc ggc gcg tcg ttc ggc ceg atg age tac gtg gaa 864 Arg Pro Gly Gly Gly Gly Ala Ser Phe Gly Pro Met Ser Tyr Val Glu 275 280 285 ggg tcg gtg ttc gtg aac cag age ctg gcg acc gac ctg gcg aac acg 912 Gly Ser Val Phe Val Asn Gln Ser Leu Wing Thr Asp Leu Wing Asn Thr 290 295 300 ggg ttc ttc acc gac gcc gac gtc gcc cgg ate gtc gcg etc gcc ggg 960 Gly Phe Phe Thr Asp Wing Asp Val Wing Arg He Val Wing Leu Wing Gly S 305 -. 305 - 310 315 320 gag cgg aac gcc acc acc gtg tac age ate gag gcc acg etc aac tac 1008 Glu Arg Asn Wing Thr Thr Val Tyr Ser He Glu Wing Thr Leu Asn Tyr 325 330 335 gac aac gcc acg gcg gcg gcg gcg gcg gtg gac cag gag etc gcg tec 1056 Asp Asn Wing Thr Wing Wing Wing Wing Wing Val Asp Gln Glu Leu Wing Ser 340 345 350 gtg ctg ggc acg ctg age tac gtg gag ggg ttc gcg ttc cag cgc gac 1104 Val Leu Gly Thr Leu Ser Tyr Val Glu Gly Phe Wing Phe Gln Arg Asp 355 360 365 gtg gcc tac gcg gcg ttc ctt gac cgg gtg drops ggc gag gag gtg gcg 1152 Val Wing Tyr Wing Wing Phe Leu Asp Arg Val His Gly Glu Glu Val Wing 370 375 380 etc aac aag ctg ggg ctg tgg cgg gtg ceg falls ceg tgg etc aac atg 1200 Leu Asn Lys Leu Gly Leu Trp Arg Val Pro His Pro Trp Leu Asn Met 385 390 395 400 ttc gtg ceg cgc tcg cgc ate gcc gac tcc gac cgc ggc gtg ttc aag 1248 Phe Val Pro Arg Ser Arg He Wing Asp Phe Asp Arg Gly Val Phe Lys 405 410 415 ggc ate ctg cag ggc acc gac ate gtc ggc ceg etc ate gtc tac ccc 1296 Gly He Leu Gln Gly Thr Asp He Val Gly Pro Leu He Val Tyr Pro 420 425 430 etc aac aaa tec atg tgg gac gac ggc atg tcg gcg gcg acg ceg tet 1344 ^ Leu Asn Lys Ser Met Trp Asp Asp Gly Met Be Wing Wing Thr Pro Ser -fc- 435 440 445 gag gac gtg ttc tac gcg gtg tcg ctg etc ttc tcg tcg gtg gcg ccc 1392 Glu Asp Val Phe Tyr Ala Val Ser Leu Leu Phe Ser Ser Val Wing Pro 450 455 460 aac gac ctg gcg agg ctg cag gag cag aac agg agg ate ctg cgc ttc 1440 Asn Asp Leu Ala Arg Leu Gln Glu Gln Asn Arg Arg He Leu Arg Phe 465 470 475 480 tgc gac etc gcc ggg ate cag tac aag acc tac ctg gcg cgg falls acg 1488 Cys Asp Leu Wing Gly He Gln Tyr Lys Thr Tyr Leu Wing Arg His Thr 485 490 495 gac cgc agt gac tgg gtc cgc falls ttc ggc gcc gcc aag tgg aat cgc 1536 Asp Arg Ser Asp Trp Val Arg His Phe Gly Wing Wing Lys Trp Asn Arg 500 505 '510 ttc gtg gag atg aag aac aac tac gac ccc aag agg ctg etc tec ccc 1584 Phe Val Glu Met Lys Asn Lys Tyr Asp Pro Lys Arg Leu Leu Ser Pro 515 520 525 ggc cag gac ate ttc aac tga 1605 Gly Gln Asp He Phe Asn 530 < 210 > 4 < 211 > 21 < 212 > PRT < 213 > Zea mays < 220 > c. < 221 > VARIANT ^ < 222 > (9) < 400 > 4 Tyr Val Glu Gly Ser Val Phe Val Xaa Gln Ser Leu Ala Thr Asp Leu 1 5 10 15 Wing Asn Thr Gly Phe 20 < 210 > 5 < 211 > 15 < 212 > PRT < 213 > Zea mays < 400 > 5 Gly He Leu Gln Gly Thr Asp He Val Gly Pro Leu He Val Tyr 1 5 10 15 c. < 210 > 6 < 211 > 23 < 212 > DNA < 213 > Zea mays < 220 > < 221 > modified base < 222 > (6) < 223 > i < 220 > < 221 > modified base < 222 > (12) < 223 > i < 220 > < 221 > modified base < 222 > (15) < 223 > i < 220 > < 221 > modified base < 222 > (18) < 223 > i < 400 > 6 tacgtngayg gnwsngtntt cgt 23 < 210 > 7 < 211 > 23 < 212 > DNA < 213 > Zea mays < 220 > < 221 > modified base < 222 > (3) < 223 > i < 220 > < 221 > modified base < 222 > (9) < 223 > i < 220 > < 221 > modified base < 222 > (12) < 223 > i < 220 > < 221 > modified base < 222 > (18) < 223 > i < 220 > < 221 > modified base < 222 > (21) < 223 > i < 400 > 7 acngayctng cnaacacngg ntt 23 < 210 > 8 < 211 > 23 < 212 > DNA < 213 > Zea mays < 220 > < 221 > modified base < 222 > (3) < 223 > i < 220 > < 221 > modified base < 222 > (9) < 223 > i < 220 > < 221 > modified base < 222 > (15) < 223 > i < 220 > < 221 > modified base < 222 > (18) < 223 > i < 400 > 8 ccntargang tcccntgnct rta 23 < 210 > 9 < 211 > 23 < 212 > DNA < 213 > Zea mays < 220 > < 221 > modified base < 222 > (6) < 223 > i < 220 > < 221 > modified base < 222 > (9) < 223 > i < 220 > < 221 > modified base < 222 > (12) < 223 > i < 220 > < 221 > modified base < 222 > (15) < 223 > i < 220 > < 221 > modified base < 222 > (21) < 223 > i < 400 > 9 targanccng gngantarca nat 23 < 21O > 10 < 211 > 1602 < 212 > DNA < 213 > Zea mays < 220 > < 221 > variation < 222 > (6) < 223 > a, g, cot < 221 > variation < 222 > (9) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (12) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (21) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (24) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (27) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (30) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (33) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (36) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (42) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (48) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (54) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (57) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (60) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (63) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (66) < 223 > a, g, cot < 220 > < 221 variation < 222 > (69) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (72) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (75) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (78) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (81) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (90) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (93) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (96) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (99) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (105) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (108) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (111) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (114) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (117) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (120) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (123) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (126) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (129) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (135) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (141) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (144) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (147) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (153) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (159) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (162) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (165) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (168) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (171) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (174) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (177) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (186) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (195) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (198) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (201) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (204) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (207) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (210) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (213) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (216) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (219) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (225) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (228) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (231) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (2. 3. 4) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (237) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (243) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (246) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (249) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (252) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (255) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (258) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (261) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (264) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (270) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (273) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (276) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (279) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (285) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (291) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (297) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (303) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (306) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (309) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (312) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (318) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (321) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (327) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (333) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (339) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (342) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (3. 4. 5) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (348) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (351) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (354) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (357) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (366) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (369) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (372) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (375) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (381) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (384) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (387) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (390) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (393) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (396) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (405) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (408) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (411) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (417) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (420) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (426) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (432) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (435) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (438) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (447) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (459) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (462) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (465) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (468) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (471) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (474) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (477) < 223 > a, c, g or t < 220 > < 221 > variation, < 222 > (480) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (483) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (486) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (489) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (492) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (495) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (498) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (513) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (519) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (522) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (525) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (528) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (531) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (534) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (537) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (540) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (546) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (549) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (555) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (558) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (564) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (570) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (576) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (579) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (588) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (594) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (597) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (609) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (615) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (618) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (624) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (633) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (637) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (642) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (651) < 223 > a, g | c or t < 220 > < 221 > variation < 222 > (657) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (663) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (672) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (675) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (678) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (681) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (684) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (687) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (690) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (699) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (702) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (708) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (711) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (717) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (723) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (726) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (732) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (735) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (738) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (741) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (744) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (747) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (750) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (756) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (759) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (765) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (771) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (780) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (783) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (789) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (792) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (804) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (807) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (810) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (813) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (816) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (819) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (822) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (825) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (828) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (831) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (834) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (837) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (840) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (846) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (849) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (855) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (861) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (867) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (870) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (873) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (879) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (888) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (891) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (894) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (897) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (903) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (906) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (912) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 915 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (924) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (930) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (936) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (939) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (942) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (948). < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (951) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (954) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (957) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (960) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (966) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (972) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (975) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 978 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (987) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (996) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (999) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1002) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1017) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1020) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1023) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1026) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1029 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1032) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1035) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1038) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1050) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1053) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1056) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1059) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1062) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > 1065 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1068) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1071) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1074) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1080) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1086) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1092 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1101) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1107) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1110) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1116) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1119) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1125) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1131) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1134) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1140) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1149) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1152) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1155) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1164) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1167) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1170 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1176) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1182) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1188 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1194) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > 1206 < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1209) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1212 < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1215 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1218) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1224) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1236) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1239) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1242) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1251) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1257) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1263) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1266 < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1275) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1278 < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1281) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1284 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1290) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1296) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1299) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1308) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1323) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1329 < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1332 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1335) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1338 < 223 > a, c, g or t < 220 > < 221 > variation < 222 > 1341 < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1344 < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1353 < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1362) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1365 < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1368 < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1371 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1374) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1380) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1383) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1386 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1389) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1392) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > 1401 < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1404 < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1410) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1425) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1428) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1434) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1437) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1449) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1452) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1455) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1470) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1476) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1479) < 223 > a, c, g or t < 220 > < 221 > variation < 222 > (1482) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1488) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1494) < 223 > a, g, cot < 220 > < 221 > variation < 222 > 1497 < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1506) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1509) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1518) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1521) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1524) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1536) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1542) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1566) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1572) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1575) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1578) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1581) < 223 > a, g, cot < 220 > < 221 > variation < 222 > (1584) < 223 > a, g, c or t < 220 > < 221 > variation < 222 > (1587) < 223 > a, g, c or t < 400 > 10 atggcngtng tntaytayyt nytnytngcn ggnytnathg cntgywsnca ygcnytngcn 60 gcnggnacnc cngcnytngg ngaygaymgn ggnmgnccnt ggccngcnws nytngcngcn 120 ytngcnytng ayggnaaryt nmgnacngay snaaygcna cngcngcngc nwsnacngay 180 s > ttyggnaaya thacnwsngc nytnccngcn gcngtnytnt ayccnwsnws nacnggngay 240 ytngtngcny tnytnwsngc ngcnaay sn acnccnggnt ggccntayac nathgcntty 300 mgnggnmgng gncaywsnyt natgggncar gcnttygcnc cnggnggngt ngtngtnaay 360 atggcn sny tnggngaygc ngcngcnccn ccnmgnatha aygtnwsngc ngayggnmgn 420 taygtngayg cnggnggnga rcargtntgg athgaygtny tnmgngcnws nytngcnmgn 480 ggngtngcnc cnmgnwsntg gaaygaytay ytntayytna cngtnggngg nacnytn sn 540 aaygcnggna th snggnca rgcnttymgn cayggnccnc arathwsnaa ygtnytngar 600 atggaygtna thacnggnca yggngaratg gtnacntgyw snaarcaryt naaygcngay 660 ytnttygayg cngtnytngg nggnytnggn carttyggng tnathacnmg ngcnmgnath 720 gcngtngarc cngcnccngc nmgngcnmgn tgggtnmgnt tygtntayac ngayttygcn 780 gcnttywsng cngaycarga rmgnytnacn gcnccnmgnc cnggnggngg nggngcnwsn 840 tgwsntaygt ttyggnccna gtnttygtna ngarggnwsn aycar snyt ngcnacngay 900 ytngcnaaya cnggnttytt yacngaygcn gaygtngcnm gnathgtngc nytngcnggn 960 garmgnaayg cnacnacngt ntaywsnath gargcnacny tnaaytayga yaaygcnacn 1020 gcngcngcng cngcngtnga ycargarytn gcnwsngtny tnggnacnyt nwsntaygtn 1080 garggnttyg cnttycarmg ngaygtngcn taygcngcnt tyytngaymg ngtncayggn 1140 gargargtng cnytnaayaa rytnggnytn tggmgngtnc cncayccntg gytnaayatg 1200"^ ttygtnccnm gnwsnmgnat hgcngaytty gaymgnggng tnttyaargg nathytncar 1260 ggnacngaya thgtnggncc nytnathgtn tayccnytna ayaarwsnat gtgggaygay 1320 ggnatgwsng cngcnacncc nwsngargay gtnttytayg cngtnwsnyt nytnttywsn 1380 wsngtngcnc cnaaygayyt ngcnmgnytn cargarcara aymgnmgnat hytnmgntty 1440 tgygayytng cnggnathca rtayaaracn tayytngcnm gncayacnga ymgnwsngay 1500 tgggtnmg nc ayttyggngc ngcnaartgg aaymgnttyg tngaratgaa raayaartay 1560 gayccnaarm gnytnytnws nccnggncar gayathttya ay 1602 < 210 > 11 < 211 > 32 < 212 > DNA < 213 > Zea mays < 400 > 11 tgggaattcc atggggagat ggtgacgtgc te 32 < 210 > 12 < 211 > 33 < 212 > DNA < 213 > Zea mays < 400 > 12 gccgtcccac atggatttgt tgagggggta gac 33 oo < 210 > 13 < 211 > 37 < 212 > DNA < 213 > Zea mays < 400 > 13 ctcaacaaat ccatgtggga cgacggcatg tcggcgg 37 < 210 > 14 < 211 > 39 < 212 > DNA < 213 > Zea mays < 400 > 14 gcggtctaga tctaactaaa acatgcatgg gctatcatc 39 < 210 > 15 < 211 > 33 < 212 > DNA < 213 > Zea mays < 400 > 15 atgggaattc catggggaga tggtgacgtg etc. 33 < 210 > 16 < 211 > 39 < 212 > DNA < 213 > Zea mays CD < 400 > 16 gcggtctaga tctaactaaa acatgcatgg gctatcatc 39 < 210 > 17 < 211 > 17 < 212 > DNA < 213 > Zea mays < 400 > 17 ccggttttgg taccggt 17 < 210 > 18 < 211 > 17 < 212 > DNA < 213 > Zea mays < 400 > 18 catcaccggt accaaaa 17 < 210 > 19 < 211 > 22 < 212 > DNA < 213 > Zea mays in o < 400 > 19 gacaccattc caagcatacc cc 22 < 210 > 20 < 211 > 22 < 212 > DNA < 213 > Zea mays < 400 > 20 gttctcacta gaaaaatgcc cc 22

Claims (27)

NOVELTY OF THE INVENTION CLAIMS

1. - A substantially purified protein showing cytokinin oxidizing activity, selected from the group consisting of: (a) SEQ. ID NO. 1, (b) a protein having an amino acid sequence that includes the amino acid sequences of SEQ. ID NO. 1, (c) a protein having an amino acid sequence which includes a portion of the amino acid sequence of SEQ. ID NO. 1, the included portion being at least about 20 amino acid residues in length and which confers the oxidative activity of cytokinin to the protein and (d) a protein that includes an amino acid sequence with at least about 65% identity of sequence with SEQ. ID NO. 1, the rest of the amino acid residues being conservatively substituted.

2. The protein according to claim 1, further characterized in that the protein is purified.

3. The protein according to claim 1, characterized in that it is SEQ. ID NO.

4. The protein according to claim 1, produced by a host cell transformed with a vector containing a nucleic acid polymer encoding the protein according to claim 1.

5. - A substantially isolated nucleic acid polymer coding for a protein according to claim 1.

6. The substantially isolated nucleic acid polymer of claim 5 which codes for SEQ. ID NO. 1.

7. A nucleic acid polymer substantially isolated which codes for a protein that shows a cytokinin oxidizing activity, further characterized in that the nucleic acid polymer is selected from the group consisting of: (a) SEQ. ID NO. 2, (b) SEQ. ID NO. 3, (c) a polymer of nucleic acids with a sequence described by SEQ. ID NO. 10, (d) a polymer of nucleic acids whose sequence contains a sequence that is selected from the group consisting of SEQ. ID NO. 2, SEQ. ID NO. 3, or a polymer of nucleic acids with a sequence described by SEQ. ID NO. 10, (e) a polymer of nucleic acids which contains at least a 60-base pair portion, which codes for an amino acid sequence that confers the cytokinin oxidizing activity to the encoded protein, of a selected nucleotide sequence of the group consisting of SEQ. ID NO. 2, SEQ. ID NO. 3, and a nucleic acid polymer with a sequence described by SEQ. ID NO. 10, (f) a nucleic acid polymer which encodes a protein that includes an amino acid sequence with at least about 65% sequence identity with SEQ. ID NO. 1, the remainder of the amino acid residues being conservatively substituted, (g) a polymer of nucleic acids which hybridizes to a nucleotide sequence selected from the group consisting of SEQ. ID NO. 2, SEQ. ID NO. 3, and a polymer of nucleic acids with a sequence described by SEQ. ID NO. 10, under an astringency wash equivalent to 0.5x to 2x of SSC regulatory solution, 0.1% SDS, at 55-65 ° C and (h) a nucleic acid polymer having a nucleotide sequence complementary to any of the sequences of nucleic acids (a) - (g).

8. - The nucleic acid polymer substantially isolated according to claim 7, further characterized in that the polymer contains a sequence described by SEQ. ID NO. 10 or a sequence complementary to a sequence described by SEQ. ID NO. 10

9. - The nucleic acid polymer substantially isolated according to claim 7, further characterized in that the polymer is SEQ. ID NO. 2 or its complementary sequence.

10. - The nucleic acid polymer substantially isolated according to claim 7, further characterized in that the polymer is SEQ. ID NO. 3 or its complementary sequence.

11. - A host cell transformed with a vector containing a polymer of deoxyribonucleic acid which codes for the protein according to claim 1.

12. - The host cell according to claim 11, further characterized in that the host cell is a plant cell.

13. - The host cell according to claim 12, further characterized in that the host plant cell is selected from the group consisting of: (a) Nicotiana tabacum, (b) Arabidopsis thaliana, (c) Zea mays, (d) Brassica spp, (e) Oryza sativa.

14. - The host cell according to claim 11, further characterized in that the host cell is selected from the group consisting of: (a) Pichia pastoris, (c) Escherichia coli.

15. - A plant regenerated from a host plant cell according to claim 12.

16. - A plant product from the regenerated plant according to claim 15.

17. - The plant product according to claim 16, further characterized in that said plant product is selected from the group consisting of seeds, leaves, stem crops, rhizomes and bulbs.

18. - A method for producing the protein according to claim 1 in a host cell, comprising essentially (a) constructing a vector containing DNA encoding the protein according to claim 1 and a regulatory sequence of the operational expression in the host cell; (b) transfecting an appropriate host cell for the production of protein with the vector; (c) expressing the protein in the host cell.

19. - The method according to claim 18, further characterized in that the vector is selected from the group consisting of: (a) a plasmid composed of DNA, (b) Agrobacterium tumefaciens.

20. - The method according to claim 18, further characterized in that the host cell is selected from the group consisting of: (a) Pichia pastoris (b) Escherichia coli.

21. The method according to claim 18, further characterized in that the host cell secretes said protein in a culture medium, and wherein the method further comprises purifying said protein from the culture medium.

22. The method according to claim 18, further characterized in that it comprises the step of reconstituting the host cell in an organism.

23. The method according to claim 18, further characterized in that the host cell is a plant cell.

24. The method according to claim 23, further characterized in that the host plant cell is selected from the group consisting of: (a) Nicotiana tabacum, (b) Arabidopsis thaliana, (c) Zea mays, (d) Brassica spp. , (e) Oryza sativa.

25. A method for moderating the pathogenesis associated with cytokinin in a plant comprising transforming a plant cell with a nucleic acid polymer construct which contains: (a) a nucleic acid polymer encoding the protein according to the invention. claim 1, and (b) a regulatory sequence of the operational expression in the host plant; and regenerating a plant from the transformed plant cell.

26. - A method according to claim 25, further characterized in that the expression regulatory sequence is selected from the group consisting of constitutive promoters, inducible, repressor and enhancer promoters.

27. A method for detecting concentrations of cytokinin in a sample essentially comprising: (a) adding to a sample with a regulated solution known amounts of dichlorophenolindophenol and an excess of quantity that produces IU of activity of the protein according to claim 1; (b) measuring the net change in absorbance of light at 590 nM; and (c) comparing this net absorbance with a standard curve generated from known concentrations of cytokinin.