MXPA00000687A - Genes controlling phytate metabolism in plants and uses thereof - Google Patents

Abstract

This invention relates to newly identified polynucleotides and polypeptides, variants and derivatives of same;methods for making the polynucleotides, polypeptides, variants, derivatives and antagonists. In particular the invention relates to polynucleotides and polypeptides of the phytate metabolic pathway.

Description

GENES CONTROLLING FITATE METABOLISM IN PLANTS AND USES THEREOF DESCRIPTION OF THE INVENTION The present invention relates to the field of animal nutrition. Specifically, the present invention relates to the identification and use of genes encoding various enzymes involved in the metabolism of phytate eru plants and the use of these genes and mutants thereof to reduce phytate levels, and / or increase levels. phosphorus without phytate in foods or foods. The role of phosphorus in animal nutrition is well recognized. Eighty percent of the phosphorus in the body of animals is found in the skeleton, providing structure to the animal. Twenty percent of the phosphorus in animals can be found in soft tissues, where it is a constituent compound and therefore involved in a wide range of biochemical reactions. For example, phosphorus is required for the synthesis and activity of DNA, RNA, phospholipids, and some B vitamins. Resistant phosphorus is essential for healthy animals, it will also be recognized that not all phosphorus is bioavailable in food. Acidic salts (ie, phytates) are the main storage form of phosphorus in plants. See for example, "Chemistry and Application of Phytic Acid: an Overvie," Phytic Acid: Chemistry and Application; ^ Graf, Ed .; Pilatus Press. Minneapolis, MN, pp. 1-21; (1986). Phytates are the main form of phosphorus in seeds, typically representing 50% to 80% of the total phosphorus in the seed. In corn and soybeans, for example, phytate represents approximately 60% to 80% of total phosphorus. When the seed-based diets are consumed by non-ruminants, the phytic acid consumed forms salts with several nutritionally important minerals in the intestinal tract. The excretion of these salts reduces the retention and utilization, that is to say, the bioavailability of the contents in the diet of phosphorus and mineral. Consequently, this can result in mineral deficiencies in humans and animals fed on the previous seed. See for example., McCance, et al. , BiocThem. J. 29: 4269 (1935); Edman, Cereal Chem., 58:21 (1981). Phytate, a large source of phosphorus, is not metabolized by monogastric animals. Phytic acid, in fact, is considered to be an anti-nutritional factor because it reduces the bioavailability of proteins and minerals by chelation; see for example., Cheryan, "Phytic Acid Interactions in Food Systems", CRC Crit. Rev. Food Sci. Nutr., 13: 297-335 (1980). Phytates do not simply cause a reduction in nutrient availability. Phosphorus of "fitatp binding in discarded animal contributes to the surface and growth of groundwater pollution. See for example., Jonglboed, et al. , Nether. J. Aq. Sci. 38: 567 (1990). ^ _ ~ ~~ Due to the phytate content the seed has an impact on the diet, phosphorus and mineral retention, and the environment, several approaches have been proposed to reduce. this impact. Approaches include removing phytate from the diet by intervention after harvesting and reducing the genetically phytate content in the seed. Post-harvesting food processing methods that remove phytic acid either physically or via fermentation are described, for example, by Indumadhavi, et al. Int. J. Food Sci. Tech. 27: 221 (1992). Hydrolyzed fatty acid is a useful approach to increase the nutritional value of many plant supplies. Phytases, as discussed more fully in the following, catalyze the conversion of phytic acid to inositol "and inorganic phosphate. The microorganisms that produce phytase include bacteria and yeasts. See for example, Power, et al. , J. Bacterio !. 151: 1102-1108 (1982); Segullha, _ "et al. , Biotechnol. Lett. 15 (4): 399-404 (1993) and Ñayini et al. / Lebensm. Wiss. Technolo. 17: 24-26 (1984). The use of phytases, phosphohydrolases of specific phytic acid, typically of microbial origin, as dietary supplements, is described by Nelson, et al. , J.

Nutr. 101: 1289 (1971). All currently known post-harvest technologies involve adding procedures and expenditures in order to avoid the problems associated with phytate.The genetic approach involves the development of germinal plasma from crops that have hereditary reductions in phytic acid from seeds. the hereditary amount in the phytic acid of seeds has been observed between the lines of several crop species See Raboy, In: Inositol Metabolism in Plants, Moore DJ, et al., (eds.) Alan R. Liss, New York, pp 52-73; (1990) .- However, ^ this variation has been found to be high and positively correlated with variation in less desirable characteristics, therefore, reproduction to reduce phytic acid of the seed, using methods of traditional reproduction, could result in germinated plasma with undesirable correlated characteristics.To date, there have been no reports of germinated plasma from lower phytic acid commercially available by such an approach. In the generally altered phytate, the natural variability for phytate and free phosphorus has been examined.

See Raboy, V. and D. B. Dickinson Crop Scí. 33: 1300-1305 (1993), and Raboy, V. et al. , Maydica 35: 383-390 (1990). While some variability for phytic acid was observed, there is no corresponding change in phosphorus without phytate. In addition, the diverse variability represents only two_ percent of the variation observed, while ninety-eight percent of the variation in phytate was attributed to environmental factors. As mentioned above, soybean studies and other crops have indicated that altered phytate gene expression through the recurrent selection of breeding methods could have undesirable correlated results. See Raboy, V., D.B. Dickinson, and F.E. Below; Crop Sci. 24: 431-434 (1984); Raboy, V., F.E. Below, and D.B. Dickinson; J. Hered. 80: 311-315 (1989); Raboy, V., M.M. Noaman, G.A. Taylor, and S.G. Pickett; Crop Sci. 31: 631-635; (1991). While it has been proposed that a block in phytic acid accumulation could be valuable in the production of germ plasm of lower phytic acid without the introduction of undesired correlated responses, (See Raboy, et al., Crop Sci. 33: 1300 ( 1993)) employing such a traditional mutant selection approach, has revealed, in certain cases that homozygosity for mutants associated with substantial reductions in phytic acid is also provided to be lethal. Myo-inositol is produced from glucose in three stages involving the enzymes hexokinase (EC 2.7.1.1), L-myo-inositol 1-phosphatasynthase (EC 5.5.1.4) and L-myo-inssital 1-phosphataphosphatase (EC 3.1. 3.25). The biosynthetic path that leads to phytate is complex and not completely understood. Without wishing to be bound by any particular theory of phytate formation, it is believed that the synthesis can be mediated by a series of one or more ADP-phosphotransferases, ATP-dependent kinases and isomerases. A number of intermediates have been isolated including, for example, 2 and 3-monophosphates, 1,3 and 2,6-di-phosphates, 1,3,5"and 2,5,6-triphosphates, 1,3,5,6 and 2,3,5,6 tetra-phosphates, and 1,2,4,5, and 1,2,3,4,6 penta-phosphates Several useless cycles of dephosphorylation and phosphorylation of the P5 and Pe forms have been reported as well as a cycle involving G6P-myoinositol-l-phosphate- »myo-inositol, the last stage is completely reversible, indicating that the control of metabolic flux through this pathway can be important.This invention differs from previous approaches _in which tools and reagents are provided that allow the specialized technician, for the application of, inter alia, transgenic methods to influence the metabolic flux with respect to the pathway of phytic acid.This influence can be either anabolic or catabolic, so which is mediated the influence can act to decrease the flow resulting from the biosynthesis of phytic acid or and / or increase the_degradation_ (ie, phytic acid catabolism). A combination of both approaches is also contemplated by this invention. As mentioned above, once formed the phytate can be dephosphorylated by phosphohydrolases, particularly 3-phytases typically found in microorganisms and 6-phytases, the dominant form in plants. After the initial case, both enzymes are capable of successive desfoforilación of phytate for free inositol. Accordingly, it has also been reported that plants can be transformed with constructs comprising a phytase encoding the gene. See Pen, et al. , PCT Publication WO 91/14782, incorporated herein by reference in its entirety. Transgenic seeds or plant tissues that express phytases can then be used as dietary supplements. However, this request has not been made to reduce phytic acid in seeds. Based on the foregoing, there is a need to improve the nutritional content of plants, particularly corn and soy by increasing phosphorus without phyla and by reducing the phytate of the seed with other non-obvious or substantially adverse effects. It is therefore an object of the present invention to provide plants, particularly transgenic corn, which has improved levels of phosphate without phytate without corresponding perceptual effects. It is a further object of the present invention to provide plants, particularly transgenic corn having reduced levels of phosphorus in the form of-phytate without corresponding detrimental effects. It is a further object of the present invention to provide transgenic plant lines with dominant, hereditary phenotypes that are useful in breeding programs designed to produce commercial products with improved phosphorus availability and reduced phytate. It is a further object of the present invention to improve animal transformation by feeding animals, plants and parts thereof particularly seeds with improved nutritional value. It is a further object of the present invention to provide plant seeds, particularly corn seeds and resulting food, which results in less environmental contamination, when excreted, which does not currently use seeds. These and other objects of the invention will become readily apparent from the incoming description. An isolated polynucleotide is provided comprising a member selected from the group consisting of: (a) a polynucleotide that encodes a polypeptide comprising SEQ. FROM IDENT. US. 2, 6, 11, 17 or complements thereof; (b) a polynucleotide of at least 25 nucleotides long which selectively hybridizes under stringent conditions to a polynucleotide of SEQ. DE_ IDENT. US: 1, 5, 7, 10, 14, 15, 16 or a complement thereof, wherein the hybridization conditions include a washing step at 0. IX SSC at 60 ° C; (c) a polynucleotide having a nucleic acid sequence amplified from a Zea mays nucleic acid library using the primers of T SEC. FROM IDENT. NOS .: 3-4, 8-9, 12-13, or 18-19; (d) a polynucleotide having at least 75% of the identity sequence of the SEC. FROM IDENT. NO._: 1, at least 60% of the sequence of identity of the SEC. DE IDENT .. NO .: 5, at least 80% sequence identity to the SEC. FROM IDENT. NO .: 10, or at least 70% of the identity sequence to the SEC. FROM IDENT. NO .: 16, where the% of the identity sequence is based on the total codified region and is determined by the GAP program where the penalty of creation of space = 50 and the penalty of extension of space = 3; and (e) a polynucleotide comprising at least 20 contiguous bases of the polynucleotide of (a) to (c), or complement thereof.

According to the present invention, polypeptides that have been identified as novel phytate biosynthetic enzymes are provided. An isolated polypeptide is provided comprising an amino acid sequence having at least 80% of the identity sequence to the SEC. FROM IDENT. NO .: 2, at least 35% of the identity sequence to the SEC. FROM IDENT. DO NOT. : 6, at least 90% of the identity sequence of the SEC. FROM IDENT. NO .: 11 or in at least 80% of the sequence of identity of the SEC. FROM IDENT. NO .: 17, where the% of the sequence of identity is based on the sequence, complete and is determined by the GAP program where the penalty of creation of space = 12 and the penalty of extension of space = 4. It is a Further object of the invention, however, is to provide polynucleotides encoding maize phytate biosynthetic enzymes, particularly polynucleotides encoding phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3, myo-inositol 1,3, -triphosphate "5/6 kinase and myo-inositol 1-phosphatase synthase In a particularly preferred embodiment of this aspect of the invention, the polynucleotide comprises the regions encoding phosphatidylinositol, ir kinase, myo-inositol monophosphatase-3, myo-inositol 1, 3, 4- I typed "5/6 kinase and myo-inositoi-1-phosphate synthase.

In another particularly preferred embodiment of the present invention the polypeptides are isolated from Zea mays (corn). According to this aspect of the present invention there is provided a polynucleotide of at least 25 nucleotides long that selectively hybridize under stringent conditions to the polynucleotides set forth below, or a complement thereof. As used herein "stringent conditions" means hybridization conditions that include a washing step at 0. IX SSC at 60 ° C. In accordance with this aspect of the present invention, there is provided a polynucleotide having a nucleic acid sequence amplified from a Zea mays nucleic acid library, using the primers established in the following sequences. According to this aspect of the invention, isolated nucleic acid molecules encoding phytate biosynthetic enzymes are provided, particularly those de-Zea mays, mRNA, cDNA, genomic DNA and, in further embodiments of this aspect of the invention, biologically , useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and derivatives. Other embodiments of the invention are allelic variants that are found in the nature of the nucleic acid molecules in the provided sequences encoding phytate biosynthetic enzymes. According to another aspect of the invention, novel polypeptides comprising biosynthetic enzymes of phytate of maize origin as well as biological, or diagnostically useful fragments thereof, as well as variants, derivatives and analogues of the foregoing and fragments thereof. It is also an object of the invention to provide phytate biosynthetic polypeptides, particularly phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3, myo-inositol 1, 3, 4-triphosphate 5/6 kinase or myo-inositol 1-phosphate synthase polypeptide, which can to be employed by modulation of phytic acid synthesis. According to yet another aspect of the present invention, the use of a polypeptide of the invention, or particular fragments thereof, is provided. It is another object of the invention to provide a process for producing the polypeptides, polypeptide fragments, variants and derivatives, fragments of the variants and derivatives, and analogs of the foregoing. In a preferred embodiment of this aspect of the invention methods are provided for producing the polypeptides comprising host-expressing culture cells that incorporate therein a polynucleotide under conditions for expression of phytate biosynthetic enzymes in the host and then coating the polypeptide voiced. According to another object of the invention, products, compositions, processes and methods using the aforementioned polypeptides and polynucleotides are provided for research, biological and agricultural purposes. In accordance with yet another aspect of the present invention, inhibitors are provided to such polypeptides, useful for modulating the activity and / or expression of the polypeptides. In particular, antibodies against such polypeptides are provided. According to certain embodiments of the invention, there are assays that hybridize the phytate biosynthetic enzyme polynucleotide sequences useful as markers. molecular factors in reproduction programs. In certain preferred additional embodiments of this aspect of the invention, antibodies are provided against the phytate biosynthetic enzymes. In certain particularly preferred embodiments in this regard, the antibodies are selective for the entire class of phytate biosynthetic enzymes, independent of species of origin as well as antibodies of specific species, such as antibodies capable of specific immune reactivity with for example, biosynthetic enzymes. of phytate Zea mays.

According to yet another aspect of the present invention, phytate enzyme antagonists are provided. Among the preferred antagonists are those which bind to phytate biosynthetic enzymes as well as to inhibit the binding of bound molecules or to stabilize the complex formed between the phytate biosynthetic enzyme and the bound molecule to avoid additional biological activity as a result of the enzyme. phytate biosynthetics Also among the preferred antagonists are molecules that bind to, or interact with, phytate biosynthetic enzymes as well as to inhibit one or more effects of a particular phytate biosynthetic enzyme or that prevents the expression of the enzyme and that also preferably results in a decrease in the accumulation of phytic acid Other objects, characteristics, advantages and aspects of the present invention will become apparent to those with experience of the following description It will be understood, however, that the following description and specific examples, as they indicate preferred modalities of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become apparent to those skilled in the art of indicating the following description and indication of the other parts of the present disclosure.

This application previously claimed under 35 U.S.C. 120 to the North American Series Nos. 60 / 053,371 filed on July 18, 1997, 60 / 053,944 filed on July 28, 1997, 60 / 055,526, filed on August 8, 1997, 60 / 055,446 and 60 / 085,852. , filed May 18, "1998", the descriptions of which are incorporated herein by reference. ~ This invention relates, in part, to newly identified polynucleotides and polypeptides, variants and derivatives of these polynucleotides and polypeptides; for carrying out these polynucleotides and these polypeptides, their variants and derivatives and antagonists of the polypeptides, and uses of these polynucleotides, polypeptides, variants, derivatives and antagonists In particular, in these and other respects, the invention relates to polynucleotides and polypeptides of the metabolic pathway of phytate, more particularly with the enzymes phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3, myo-inositol 1, 3, 4-triphosphatase 5/6 kinase and ntio-inos itol 1-phosphata synthase and genes that code for it. The following illustrative explanations are "provided to facilitate the understanding of certain terms frequently used herein, particularly in the Examples." The explanations are provided as a convenience and are non-limiting of the invention.

MOLECULES LINKING THE BIOSINTETIC ENZYME OF FITATE, as used herein, refers to molecules or ions that specifically bind or interact with polypeptides or polynucleotides of the phytate biosynthetic enzyme of the present invention, including, for example, enzyme substrates, cellular membrane components and classical receptors. The linkage between the polypeptides of the invention and such molecules, including linkage or interaction of molecules and may be unique to polypeptides of the invention, which is preferred, or may be highly specific for polypeptides of the invention, which is also preferred, or may be be highly specific for a group of proteins that includes polypeptides of the invention, which is preferred, or may be specific for several groups of proteins to at least one of which includes a polypeptide of the invention. The linked molecules also include reagents derived from antibodies that specifically bind polypeptides of the invention. "GENETIC ELEMENT," as used herein, generally means a polynucleotide comprising a region encoding a polypeptide or polynucleotide region that regulates replication, transcription or translation or other important processes of expression of the polypeptide in host cells, or a polynucleotide that it comprises both of the regions encoding a polypeptide and a region operably linked thereto which regulates expression. Generic elements can be understood within a vector that replicates as an episomal element; which is, as a molecule physically independent of the host cell genome. They can be included within the plasmids. Genetic elements can also be understood within a host cell genome; not in its natural state but, instead, following the manipulation such as isolation, cloning and introduction into a host cell in the form of purified DNA or in a vector, among others. HOST CELL, as used herein, is a cell that has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence. The exogenous polynucleotide sequence is defined to mean a non-natural sequence in the cell. This includes transformation to "incorporate additional copies of an endogenous polynucleotide IDENTITY and SIMILARITY, as used herein, and as known in the art, are relationships between two polypeptide sequences or two polynucleotide sequences, as determined by compare the sequences In the art, identity also means the relevant sequence degree between two polypeptides or two polynucleotide sequences as determined by the comparison between two lists of such sequences.The identity and similarity can be easily calculated (Computa tional Molecular Biology, Lesk, AM, Ed., Oxford University Press, New York, 1988, Biocomputing: Informatics and Genome Proj ects, Smith, DW, Ed., Academic Press, New York, 1993; Computer Analysis of Sequence Da tTa, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994, Sequence Analyzes in Molecular Biology, von Heinje, G., Academic Press, 1987, and Sequeüc and Analys ~ is Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Methods commonly employed to determine the identity or similarity between two sequences include, but are not limited to those described in Carillo, H., and Lipman, D., SI M J. Applied Math., 48: 1073 __ (198_8) _ . Preferred methods to determine identity are designed to give the largest comparison between the two "tested sequences. The methods to determine the identity and similarity are codified in computer programs. Typical computer program methods for determining identity and similarity between two sequences include, GCG program package (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BLASTP, BLASTN, _ FASTA and TFASTA (Atschul, S.F. et al., J. Mol. Biol. 215: 403 U.990). For purposes of defining the present invention, the Gap program is used. The algorithm used for the Gap program is that of Needleman and Wuncsch (J. Mol. Biol. 48: 443-453 [1970]). The parameters used are as follows: for comparison of nucleotides, the penalty of creation of space = 50, the penalty of extension of space = 3; for amino acid comparisons the penalty of creation of space = 12, the penalty of extension of space = 4. ISOLATED, as used in the present, means to alter "by the hand of man" its natural state; that is, if this occurs in nature, it has been charged or removed from its original environment, or both. For example, a polynucleotide that is found in nature or a polypeptide naturally present in a living organism in its natural state is not "isolated", but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", when the term is used in the present. For example, with respect to polynucleotides, the term "isolated" means that it is separated from the chromosome and the cell in which it is found in nature. As part of, or following isolation, such polynucleotides can be linked. to other polynucleotides, such as DNA, for mutagenesis, to form fused proteins, and for propagation or expression in host, for example. Proteins isolated, alone or linked to other polynucleotides such as vectors, can be introduced into host cells, in cultures or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNA would still be isolated, as the term is used in the present, because they would not be in their form as it occurs naturally or in the environment. Similarly, polynucleotides and polypeptides can occur in a composition, such as medium formulations, solutions for introducing polynucleotides or polypeptides, for example, into cells, composites or solutions for chemical or chemical reactions, for example, which are not natural compositions, and, therefore, isolated polynucleotides or polypeptides remain within the meaning of that term as used herein. LIGATION, as used herein, refers to the process of forming phosphodiester bonds between two or more polynucleotides, which are more often double-stranded DNA. Techniques for ligation are well known in the art and protocols for ligation are described in standard laboratory manuals and references, such as, for example, Sambrook et al. , MOLECULAR CLONING, A LABORATORY MANUAL, 2nd. Ed .; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989) and Maniatis et al. , pg. 146, as cited later. OLIGONUCLEOTIDE (S), as used herein, refers to short polynucleotides. Often the term refers to single-stranded deoxyribonucleotides, but it can also refer to single- or double-stranded ribonucleotides, RNA: DNA and double-stranded DNA hybrids, among others. Oligonucleotides, such as oligonucleotides of. Double-stranded DNA assays are often synthesized by chemical methods, such as those oligonucleotide synthesizers implemented or automated. However, oligonucleotides can be made from a variety of other methods, including _d = techniques. DNA-mediated recombinants in vitro and by DNA expression in cells and organisms. Initially, chemically synthesized DNAs are typically obtained without a phosphate. The 5 'ends of such oligonucleotides are not substrates for phosphodiester bond formation by ligation reactions employing DNA ligases typically used to form recombinant DNA molecules. When ligation of such oligonucleotides is desired, a phosphate can be added by standard techniques, such as those that employ a kinase and ATP. The 3 'end of a chemically synthesized oligonucleotide generally has a free hydroxyl group and, in the presence of a ligase, such as T4 DNA ligase, will readily be to form a phosphodiester linkage with a 5' phosphate of another polynucleotide, such as another oligonucleotide. As is well known, this reaction can be selectively avoided, when desired, by removing the 5 'phosphates from the other polynucleotides before ligation. PLASMIDS, as used herein, are generally designated herein by a lower case p that proceeds and / or followed by capital letters and / or numbers, in accordance with standard named conventions that are familiar to those skilled in the art. The starting plasmids described herein are either commercially available, publicly available, or can be constructed from plasmids available by routine application of well-known published methods. Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those skilled in the art. In addition, those with experience can easily build any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent to those skilled in the present disclosure. POLYUCLEOTIDE (S), as used herein, generally refer to any polyribonucleotide or polydeoxyribonucleotide which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for example, the polynucleotides as used herein refer to, among others, single and double stranded DNA, DNA which is a mixture of single and double stranded regions or single, double and triple regions. strands, single- and double-stranded RNA and RNA which is a mixture of single and double-stranded regions, hybrid molecules comprising DNA and RNA which can be single-stranded or, more typically, double-stranded or triple-stranded, or a mixture of single and double-stranded regions. In addition, the polynucleotide as used herein refers to triple strand regions comprising RNA or DNA or both RNA and DNA. The strands in such regions can be from the same molecule or from different molecules. Regions can include all of one or more molecules, but more typically they involve only one. region of some of the molecules. One of the molecules of a triple helical region is often an oligonucleotide. As used herein, the term "polynucleotide" includes DNA or RNA as described above containing one or more modified bases. Thus, DNA and RNA with spinal columns modified for stability, or for other reasons are "polynucleotides" as that term intended herein. In addition, the DNAs or RNAs comprise unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, they are polynucleotides as the term is used herein. It will be appreciated that a wide variety of modifications have been made to the DNA and RNA that report many useful purposes known to those skilled in the art. The term "polynucleotide" as used herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristics of viruses and cells, including, inter alia, simple and complex cells. POLIPEPTIDES, as used herein, include all polypeptides as described below. The basic structure of polypeptides is well known and has been described in innumerable texts and other publications in the art. In this context, the term is used herein to refer to any peptide or protein comprising two or more amino acids joined to each other in a linear chain by peptide bonds. As used in this, the term refers to both short chains, which also commonly refer to, in the art as peptides, oligopeptides and oligomers for example, and to elongated chains, which are generally referred to, in the art as "proteins, from which there are many It will be appreciated that polypeptides often contain amino acids other than the 20 amino acids commonly referred to IOJS 20 amino acids found in nature, and that many amino acids, including terminal amino acids, can be modified in a given polypeptide, either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques that are well known in the art.Such common modifications that are naturally found in polypeptides are very numerous to be exhaustively listed herein, but are well described in basic texts and in more detailed monographs as well as in voluminous research literature, and are well known to those with experience in the art. Among the known modifications that may be present in polypeptides of the present to name few illustrations, acetylation, acylation, ADP-ribosylation, amidation, covalent binding of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, binding covalent of a lipid or lipid derivative, covalent binding of fos-fatidilinositol, cross-linking, cyclization, disulfide bond formation, demethylation, covalent "cross-linking" formation, cystine formation, pyroglutamate formation, formylation, gamma-carboxylation, glycosylation , formation of wide GPI, hydroxylation, iodination, methylation, myristoylation, oxidation, processing. proteolytic, phosphorylation, prenylation, racemization, selenoylation, sulfation, RNA-mediated addition of amino acids to proteins such as arginylation, and ubiquitination. Such modifications are well known to those with experience and have been described in greater detail in the scientific literature. Several particularly common modifications, glycosylation, lipid binding, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for example, are described in more basic texts, such as, for example, PROTEINS STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., TE Creighton, W.H. Freeman and Company, New York (1993). Many detailed reviews are available on this object, such as, for example, those provided by Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B.C. Johnson, De., Academic Press, New York (1983); Seifter et al. , Meth. Enzymol. 182: 626-646 (1990) and Rattan et al. , Protein Syn thesis: Post transla tional Modifications and Aging, Ann. N.Y. Acad. Sci. 663: 48-62 (1992). It will be appreciated, as is well known and as noted above, that the polypeptides are not always entirely linear. For example, the polypeptides can be branched as a ubiquitating effect, and can be circular, with or without branching, generally as a result of post-translational cases including a case of natural processing and cases presented approximately by human manipulation that are not find in nature. The circular, branched and branched circular polypeptides can be synthesized by natural processes without translation and by completely synthetic methods, too. Modifications can occur at any site in a polypeptide, including the peptide backbone, the side chains of the amino acid and the amino or carboxyl terminus. In fact, blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification, is common in natural and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well. For example, the amino terminal residue of polypeptides made in E. coli or other cells, before proteolytic processing, "at least invariably it will be N-formylmethionine." During the post-translational modification of the peptide, a methionine residue at the NH.sub.2 terminus can be deleted.Therefore, this invention contemplates the use of both variants of Amino terminal containing minor methionine and metlsnin of the protein of the invention Modifications that occur in a polypeptide will often be a function of how they are performed. For polypeptides made to express a cloned gene in a host, for example, the nature and extent of the modifications will largely be determined by the ability of post-translational modification of the host cell and the modification signals present in the sequence of polypeptide amino acid. For example, as is well known, glycosylation often does not occur in bacterial hosts such as, for example, E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylation host, generally a eukaryotic cell. Similar considerations apply to other modifications. It will be appreciated that the same type of modification may be present therein or the degree varied to several sites in a given polypeptide. Also, a given polypeptide can contain many types of modifications. In general, as used herein, the term polypeptide encompasses all such modifications, particularly those that "are." present in the polypeptides, synthesized by expressing a polynucleotide in a host cell. TRANSFORMATION, as used herein, is the process by which a cell is "transformed" by exogenous DNA when such exogenous DNA has been introduced into the cell membrane. The exogenous DNA may or may not be integrated (covalently linked) into the chromosomal DNA by performing the genome of the cell. In prokaryotes and yeasts, for example, exogenous DNA can be maintained in an episomal element, such as a plasmid. With respect to the higher eukaryotic cells, a stably transformed or transfected cell is one in which the exogenous DNA has been integrated into the chromosome since it is carried by daughter cells through the replication of the chromosome. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA. VARIANT (S), as used herein, of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from. a polynucleotide or polypeptide reference, respectively. Variants in the sense as described below and elsewhere in the present description in greater detail. With reference to the "polynucleotides, the differences are generally limited in such a way that the nucleotide sequences of the reference and the variant are closely similar and, in many regions, identical, as mentioned in the following, the changes In the nucleotide sequence of the variant they can be silent, that is, they can not alter the amino acids encoded by the polynucleotide When the alterations are limited to silent changes of the type, a variant will encode a polypeptide with the same sequence. amino acid as the reference.Also as subsequently observed, changes in the nucleotide sequence of the variant can alter the amino acid sequence of a polypeptide encoded by the polynucleotide reference.Such nucleotide changes can result in amino acid substitutions, additions, deletions , fusions and truncations in the polypeptide encoded by the sequence of r eference, as discussed later. With reference to the polypeptides generally, the differences are limited whether the sequences of the reference and variants are closely similar completely and, in many regions, identical. A variant and reference polypeptide may differ in an amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination. GERMINATE PLASMIDE, as used in the term, means a fixation of genetic entities that can be used in a conventional breeding program to develop new varieties of plants. ~ ~ ELEVATED TRANSGENIC PHOSPHORUS, as used in the present, means an entity that, as a result of recombinant genetic manipulation, produces seeds with a hereditary decrease in phytic acid percentage and / or increases in percentage of phosphate without phytate. FICIOTIC ACID, as used herein, means myo-inositol tetraphosphoric acid, myo-inositol pentaphosphoric acid, and myo-inositol hexaphosphoric acid. As a salt-with cations, phytic acid is "phytate". PHOSPHORUS WITHOUT FITATE, as used herein, means total phosphorus minus phosphorus phytate ANIMAL NO RUMINANT means an animal with a single stomach divided into the esophagus, carids, fundus and pyloric regions. A non-ruminant animal additionally implies a species of animal without a functional rumen. A rumen is one. section of the digestive system where the forage / food is soaked and subjected to digestion by micro-organisms before passing through the digestive tract. This phenomenon does not occur in a non-ruminant animal. The term non-ruminant animal includes, but is not limited to humans, pigs, poultry, cats and dogs. As mentioned above, the present invention relates to novel metabolic polypeptides and polynucleotides of phytic acid which encode therein, inter alia, as described in greater detail below. Particularly useful polypeptides of the practice of this invention include, but are not limited to, D-myo-inositol-3-phosphate synthase, myo-lnositol-1-phosphate synthase (otherwise referred to as INO1), phosphatidylinositol-4. -phosphatase-5-kinase, signaling inositol polyphosphate-5-phosphatase (SIP-110), myo-inositol monophosphatase-3, myo-inositol 1,3,4-triphosphate 5/6 kinase, lD-myo-inositol triphosphate 3-kinase B, myo-inositol monophosphatase-1, inositol polyphosphate 5-phosphatase, lD-myo-inositol triphosphate 3-kinase, phosphatidylinositol '3-kinase, phosph "atidilinositol 4-kinase, phosphatidylinositol synthase, phosphatidylinositol transfer protein, phosphatidylinositol, 4 , 5-bisphosphate 5-phosphatase, myo-inositol transporter, phosphatidylinositol-specific phospholipase C and corn phytase. The nucleic acids and fragments thereof encoding the enzymes mentioned above are useful for generating deficient transgenic enzymes. For example, a single gene or gene fragment (or pools of several genes) can be incorporated into an appropriate expression cassette (using for example, the globulin-1 promoter by "" preferred embryo expression or the native promoter associated with the enzyme encoding the gene) and transformed into corn along with an appropriate selectable marker (such as the PAT herbicide) in such a manner as to quench the expression of the endogenous genes. The relevant literature describing the. Application of the off gene of dependent homology that includes: Jorgensen, Trends Biotechnol 8 (12): 340-344 (19907; Flavell, Proc. Nat'l. Acad. Sci. (USA) 91: 3490-3496 19947; Finnegan et al. , Bio / Technology 12: 883-888 (1994); Neuhuber et al. Mol. Gen. Genet. 244: 230-241 (1994). Alternatively, another approach to the quenched gene may be with the use of antisense technology (Rohstein et al., In Osf Surv, Plant Mol. Cell, Biol. 6: 221-246., 1989). In particular, the invention relates to polypeptides and polynucleotides of novel phytate biosynthetic enzyme genes. The invention relates especially to biosynthetic enzymes of phylate Zea mays having the nucleotide and amino acid sequences set forth in the following respectively. Polynucleotides According to one aspect of the present invention, there are provided isolated polynucleotides encoding the phytate biosynthetic enzymes having the amino acid sequence subsequently deduced. Using the information provided herein, such as the polynucleotide sequences set forth below, a polynucleotide of the present invention encoding phytate biosynthetic enzyme polypeptides can be obtained using standard cloning and screening methods. To obtain the polynucleotide encoding the protein using the DNA sequences which follow thereafter, the oligonucleotide primers can be. synthesized which are complementary to the known polynucleotide sequence. These primers can then be used in PCR to amplify the template polynucleotide derived from mRNA or genomic DNA isolated from the plant material. The resulting amplified products can then be cloned into vectors of. commercially available cloning, such as the TA series of Invitrogen vectors. By sequencing, individual clones thus identified with designed sequencing primers of the original sequence, it is then possible to extend the sequence in both directions to determine the full gene sequence. Such sequencing is performed using double-stranded denatured DNA prepared from a plasmid clone. Appropriate techniques are described by Maniatis, T., Fritsch., E.F. and Sambrook, J. in MOLECULAR CLONING, A Laboratory Manual (2nd edition 1989 Cold Spring Harbor Laboratory, see Sequencing Denatured Double-Stranded DNA Templates 13.70). Illustrative of the invention, the polynucleotide subsequently expressed was assembled from a cDNA library derived, for example, from the germination of corn seeds. The myo-inositol 1-phosphate synthase of the present invention is structurally related to other proteins of the myo-inositol 1-phosphate synthase family, as known by comparing the present sequence encoding myo-inositol 1-phosphate synthase with sequences reported in the literature A preferred DNA sequence is subsequently expressed.This contains an open reading frame encoding a protein of approximately 510 amino acid residues with a deduced molecular weight of about 59.7 (Calculated as the number of amino acid residues. X 117) kDa The protein exhibits more homology to myo-inositol-1-phosphate synthase The present myo-inositol 1-phosphate synthase has approximately 88% identity and approximately 92% similarity to the amino acid sequence of myo-inositol Mesembryan therm-1 phosphate synthase crys such lium and 78.7% identity at the level of nucleic acid (These percentages are based on comparison of the secuence ncia that encodes the detailed length only that is, ATG through the stopped codon). The myo-inositol monophosphatase-3 of the invention is structurally related to other proteins of the family of myo-inositol monophosphatase-3, chromium is shown by "comparing the present sequence encoding myo-inositol monophosphatase-3 with that of the ~ sequence reported in the literature A preferred DNA sequence is subsequently arranged, it contains an open reading frame that encodes a protein of approximately 267 amino acid residues with a deduced molecular weight of approximately 31.2 kDa (calculated as the number of amino acid residues X 117). The novel myo-inositol monophosphatase-3 identified by the homology between the subsequently arranged amino acid sequence and known amino acid sequences of other proteins such as myo-inositol monophosphatase-3 from Lycopersicum esulen tum with 76.1% identity / 81.1% similarity in the amino acid level and 67.9% identity at the nucleic acid level (These percentages are based on comparison of the detailed coding sequence only, is "say, ATG through the arrested codon.) The myo-inositol 1,3,4-triphosphate 5/6 kinase of the invention is structurally related to other proteins of the myo-inositol family 1, 3, 4- triphosphate 5/6-kinase, as is known from comparison of the sequence encoding the present inositol 1, 3, 4-triphosphate 5/6-kinase with that of the sequence reported in the literature.A preferred DNA sequence is subsequently arranged This contains an open reading frame that encodes a protein of approximately 353 amino acid residues with a deduced molecular weight of approximately 41.3 kDa (calculated as the number of amino acid residues X 117) .The protein exhibits greater homology to myo-inositol 1 , 3, 4-triphosphate 5/6"-" Homo sapiens kinase. "The myo-inositol 1,3,4-triphosphate 5/6 back kinase has approximately 34% identity and approximately 43.4% similarity with the sequence of myo-inositol amino acid 1, 3, 4-triphos fato 5/6"Homo sapiens kinase. (The percentages described above are based on comparison of the detailed coding sequence ie, ATG through the stopped codon). A preferred phosphatidylinositol-3-kinase sequence is subsequently arranged. It contains an open reading frame that encodes a protein of approximately 803 amino acid residues with a deduced molecular weight of approximately 94.1 kDa (calculated as the number of amino acid residues X 117). The protein exhibits greater homology to the phosphatidylinositol-3-kinase of Glycine max. The homology between the amino acid sequences arranged in the following sequences and known amino acid sequences of other proteins such as phosphatidylinositol 3-kinase from Glycine max with 78% identity / 84% similarity to the amino acid level and 73% identity to the nucleic acid level (these percentages are based on comparison of the detailed coding sequence only ie, ATG through the stopped codon) based on the Gap program defined later. The polynucleotides of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including for example, cDNA and genomic DNA obtained by cloning or produced by synthetic chemical techniques or by combination thereof. DNA can be double-stranded or single-stranded. The single-stranded DNA can be the encoded strand, also known as the sensitive strand, or it can be the non-coding strand, also referred to as the antisense strand. The coding sequence, which encodes the polypeptide may be identical to the sequence encoding the polynucleotides shown below. This may also be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptides shown below. As discussed more fully in the following, these sequences encoding alternatives are an important source of sequences for codon optimization. The polynucleotides of the present invention that encode the polypeptides listed below may include, but not be limited to, the coding sequence for the mature polypeptide, itself; the coding sequence for the mature polypeptide and additional coding sequence, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro-protein sequence; the coding sequence of the mature polypeptide, with or without the additional coding sequences mentioned above, together with the additional sequences, without coding, including for example, but not limited to 5 'and 3' sequences without coding, such as transcribed, sequences untranslated that play a role in transcription (including signal termination, for example), ribosome binding, mRNA stability elements, and additional coding sequence with additional encoded amino acids, such as those that provide additional functionalities. The DNA may also comprise promoter regions that function to direct the transcription of the mRNA encoding the phytate biosynthetic enzymes of this invention. Such promoters can be independently useful for directing the transcription of heterologous genes in recombinant expression systems. The heterologous is defined as a sequence that is not natural with the promoter sequence. While the nucleotide sequence is heterologous to the promoter sequence, it can be homologous, or native, or heterologous, or foreign to the host plant. In addition, the polypeptide can be fused to a labeled sequence, such as a peptide, which facilitates the purification of the fused polypeptide. In certain embodiments of this aspect of the invention, the tagged sequence is a hexa-histidine peptide, such as the tag provided in the vector pQE (Qiagen, Inc.) and the "pET series of vectors (Novagen), among others, many of which are commercially available As described in Gentz et al., Proc. Nat'l. Acad. Sci., (USA) 86: 821-8.24 (1989), _ for example, hexa-histidine provides for convenient purification of this fusion protein The HA tag can also be used to create fusion proteins and corresponds to an epitope derived from an influenza hemagglutinin protein, which has been described by Wilson et al., Cell 37: 767 (1984), by In accordance with the foregoing, the term "polynucleotide encoding a polypeptide" as used herein encompasses polynucleotides that include a sequence encoding a polypeptide of the present invention, particularly plant, and more particularly phytate enzyme biosynthetic Zea m ays having the amino acid sequence arranged later. The term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (eg, interrupted by integrated phage or insertion or editing sequence) together with additional regions, which may also contain coding sequence and / or without coding. The present invention further relates to variants of the present polynucleotides that encode fragments, analogs and derivatives of the polypeptides having the amino acid sequence subsequently deduced. A variant of the polynucleotide can be a natural variant such as a natural allelic variant, or it can be a variant that is not known to be found in nature. Such unnatural variants of the polynucleotide can be made from mutagenesis techniques, including those applied to polynucleotides, cells or organisms. Among the variants in this regard are variants that differ from the polynucleotides mentioned above by "substitutions, deletions or additions of the nucleotide" The substitutions may involve one or more -rrcrcleotides The variants may be altered in coding regions or without coding or both. Alterations in the coding regions may result in conservative or non-conservative amino acid substitutions, deletions or additions, Among the particularly preferred embodiments of the invention in this regard are polynucleotides encoding polypeptides having the amino acid sequences subsequently arranged; variants, analogs, derivatives and fragments thereof. ~~ Particularly preferred further in this regard are polynucleotides which encode phytate biosynthetic enzyme variants, analogs, derivatives and fragments, and variants, analogs and derivatives. of "the" fragments, which have the amino acid sequences subsequently, in which several, a few, "1 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted, or aggregated In any combination, especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the phytate biosynthetic enzymes.Also especially preferred in this respect are conservative substitutions. ~ Most highly preferred are polynucleotides encoding polypeptides having the following amino acid sequence, without substitutions Further preferred embodiments of the invention are polynucleotides that are greater than 79%, preferably at least 80%, more preferably at least 85% identical to the polynucleotide that encodes the myogenic polypeptide. inositol 1-phosphate synthase that has the amino acid sequence subsequently arranged and the polynucleons tidos that are complementary to such polynucleotides. Among these particularly preferred polynucleotides, those with at least 90%, 95%, 98% or at least 99% are especially preferred. Further preferred embodiments of the invention are polynucleotides that are greater than 70%, preferably at least 75%, more preferably at least 80% identical to the polynucleotide encoding a myo-inositol monophosphatase-3 polypeptide having the amino acid sequence subsequently arranged , and polynucleotides that are ~ complementary to such polynucleotides. Among these particularly preferred penucleotides, those with at least 85%, 90%, 95%, 98% or at least 99% are especially preferred. Additional preferred embodiments of the invention are polynucleotides that are greater than 45%, preferably at least 50%, more preferably at least 55%, even more preferably at least 60%, identical to the polynucleotide encoding the myo-inositol polypeptide 1 , 3, 4-triphosphate 5/6 kinase having the amino acid sequence arranged later, and polynucleotides that are complementary to such polynucleotides. Among these particularly preferred polynucleotides, those with at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or at least 99% are especially preferred. Further preferred embodiments of the invention are polynucleotides that are greater than 73%, preferably at least 75%, more preferably at least 80% identical to a polynucleotide encoding the phosphatidylinositol 3-kinase polypeptide having the amino acid sequence subsequently arranged, and polynucleotides that are complementary to such polynucleotides. Among these particularly preferred polynucleotides, those with at least 85%, 90%, 95%, 98% or at least 99% are especially preferred. Particularly preferred embodiments in this regard, furthermore, are polynucleotides that encode polypeptides that retain substantially the same or even "exhibit a reduction in biological function or activated as the mature polypeptide encoding the polynucleotides subsequently arranged." The present invention also relates to polynucleotides that hybridize in the present sequences described above In this regard, the present invention especially relates to polynucleotides that hybridize under stringent conditions in the present polynucleotides described above As used herein, the term "stringent conditions" means hybridization that will occur only if there is at least 95% and preferably at least 97% identity between the sequences The terms "stringent conditions" or "stringent hybridization conditions" include references to conditions under which a probe will hybridize to its sequence. to objective, for a degree detectably greater than other sequences (for example, at least 2 times on the background). The stringent conditions are dependent sequences and will be different in different circumstances. By controlling the austerity of the hybridization and / or washing conditions, the target sequences can be identified that are 100% complementary to the probe (homologous probe). Alternatively, austerity conditions can be adjusted to allow some imbalance in sequences since lower degrees of similarity are detected (heterologous polling). Generally, a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length. Typically, stringent conditions will be those in which the salt concentration is less than about an ion concentration of 1.5 M Na, typically about 0.01 to 1.0 M Na ion (or other salts) at pH 7.0 a 8.3 and the temperature is at least "about 30 ° C for short probes (for example, 10 to 50 nucleotides) and at least about 60 ° C for long probes (for example, greater than 50 nucleotides) .The stringent conditions may also be achieved with the addition of destabilizing agent such as formamide Exemplary low austerity conditions include hybridization with buffered solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate), at 37 ° C , and a wash in IX to 2X SSC (20X SSC = 3.0 M "NaCl / 0.3 M trisodium citrate) of 50 to 55 ° C. Exemplary moderate austerity conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37 ° C and washing in 0.5X to IX SSC_ from 55 to 60 ° C. Exemplary high austerity conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 ° C, and a wash at 0. IX SSC at 60 ° to 65 ° C.

Specifically, the function of post-hybridization washes is normal, the critical factors being the resistance and ionic temperature of the final washed solution. For DNA-DNA hybrids, the Tm can be approximated by the Meinkoth and Wahl equation, Anal. Biochem. , 138: 267-284 fl984): Tm = 81.5 ° C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% form) - 500 / L; where M is the molarity of the monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs . The Tm is the temperature (defined under ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly coupled probe. Tm is reduced by approximately 1 ° C for every 1% imbalance; thus, Tm, the hybridization and / or washing conditions can be adjusted to hybridize the sequences of the desired identity. For example, if the sequences with > 90% identity "are sought, the Tm can be decreased by 10 ° C. Generally, stringent conditions are selected to be approximately 5 ° C lower than the thermal melting point (Tm) for the specific sequence and its complement in a defined ionic strength and pH However, severe stringent conditions may use hybridization and / or washing at 1, 2, 3 or 4 ° C lower than the thermal melting point (Tm), moderately stringent conditions may use hybridization and / or washing at 6, 7, 8, 9 or 10 ° C lower than the thermal melting point (Tm), low austerity conditions can use hybridization and / or washing at 11, 12, 13, 14, 15 or 20 ° C lower than the thermal fusion point (Tm) Using the equation, the hybridization and washing compositions, and desired Tm, those with ordinary experience will understand that variations in the hybridization austerity and / or wash solutions are inherently described, if the degree Desired imbalance results in a Tm less than 45 ° C (aqueous solution) or 32sC (formamide solution) is preferred to increase the concentration of SSC in such a way that a high temperature can be used. An extensive guide for nucleic acid hybridization is found in Tijssen, Labora tory Techniques in Biochemistry and Molecular Biology-Hybridization, Nucleic Acid Probes, Part I, Chapter 2"Overview of principles of hybridization and the strategy of nucleic acid probé assays ", Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al. , Eds., Greene Publishing and Wiley-Interscience, New York (1995). As further discussed herein with respect to the polynucleotide assays of the invention, for example, the polynucleotides of the invention as discussed above, can be used as a hybridization probe for RNA, cDNA and genomic DNA to isolate detailed cDNAs and genomic clones that encode phytate biosynthetic enzymes and to isolate cDNA and genomic clones from other genes that have a high sequence similarity to genes. Such probes will generally comprise at least 15 bases. Preferably, such probes will have at least 30 bases and can have at least 50 bases. Particularly preferred probes will have at least 30 bases and will have 50 bases or less. The polynucleotides and polypeptides of the present invention can be used as co-reactants for research and materials for the discovery of transgenic corn plants with high phosphorus. The polynucleotides of the invention which are olinucleotides, derived from the subsequent sequences, can be used in primers _PCR, in the process described herein to determine whether the genes identified herein are completely or partially transcribed or not in phytic acid tissues. accumulated The polynucleotides can encode a polypeptide that is the mature protein plus the amino or additional carboxyl-terminal amino acids, or interior amino acids for the mature polypeptide (when the mature form has more than one polypeptide chain, for example). Such sequences may play a role in the process of a protein from the precursor to a mature form, may allow the transport of. the protein may lengthen or shorten the half-life of the protein or may facilitate the manipulation of a protein for testing or production, among other things. As is generally the case in vivo, additional amino acids can be processed outside the mature protein by cellular enzymes. A precursor protein, having the mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide. When the prosequences are removed such inactive precursors are generally activated. Some or all of the prosequences can be removed before activation. Generally, such precursors are called proproteins. In summary, a polynucleotide of the present invention can encode a mature protein, a mature protein plus a leader sequence (which can be referred to as a preprotein), a precursor of a mature protein having one or more prosequences that are not the leader sequences of a preprotein, or a preproprotein, which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which are generally removed during the processing steps that produce active and mature forms of the polypeptide. Polypeptides The present invention further relates to polypeptides having the amino acid sequences deduced subsequently. The invention also relates to fragments, analogs and derivatives of these polypeptides. The terms "fragment", "derivative" and "analogue" when referring to polypeptides, mean a polypeptide that retains essentially the same function or biological activity such as polypeptide. Derivatives and analogs of fragments that retain at least 90% of the activity of native phytate biosynthetic enzymes are preferred. Fragments, derivatives and analogs that retain at least 95% of the activity of the native polypeptides are preferred. Thus, an analog includes a proprotein that can be activated by cleavage of the proprotein portion to produce a mature polypeptide. The polypeptide of the present invention can be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In certain preferred embodiments this is a recombinant polypeptide. The fragment, derivative or analog of the following polypeptides can be (i) one in which one or more amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such a substituted amino acid residue can be or can not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound for increasing the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence that is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are considered to be obtained by those of ordinary skill in the art from the techniques herein. Among the particularly preferred embodiments of the invention in this regard are polypeptides having the amino acid sequence of phytate biosynthetic enzymes subsequently arranged, variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments. Among the preferred variants are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide for another amino acid of similar characteristics. Typically seen as conservative substitutions are those replaced, one by another, between the aliphatic amino acids Ala, Val, Leu and lie; exchange of hydroxyl residues Ser and Thr, exchange of acidic residues Asp and Glu, substitution between the amide residues Asn and Gln, exchange of the basic residues Lys and Arg and replaced between the aromatic residues Phe, Tyr. Particularly preferred further in this regard are variants, analogs, derivatives and fragments, variants, analogs and derivatives of the fragments, having the following amino acid sequence, in which some, a few 1 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added in any combination. Specifically preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activity of phytate biosynthetic enzymes. Also especially preferred in this respect are conservative substitutions. More highly preferred are polypeptides having amino acid sequences that remain without substitutions. The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity. The polypeptides of the present invention include the myo-inositol 1-phosphate synthase polypeptide (in particular the mature polypeptide) as well as polypeptides that have greater than 88% identity (92% similarity) to the polypeptide, as described above in Needleman and Wunsch, and more preferably at least 90% identity (95% similarity), even more preferably at least 95% identity (98% similarity) and most preferably at least 98% identity and also includes portions of such polypeptides with such a portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids. The polypeptides of the present invention include the myo-inositol monophosphatase-3 polypeptide (in particular the mature polypeptide) as well as polypeptides having more than 77% identity (82% similarity) to the polypeptide, as described above in Needleman and Wunsch, more preferably at least 80% identity (85% similarity), even more preferably at least 85% identity (90% similarity), even more preferably at least 90% identity (95% of similarity), even more preferably at least 95% identity (98% similarity) and more preferably at least 98% identity and also includes portions of such polypeptides with such a portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.

The polypeptides of the present invention include the myo-inositol 1,3-trisphosphate 5/6 kinase polypeptide (in particular the mature polypeptide) as well as polypeptides having greater than 35% identity (45% similarity) to the polypeptide as described above in Needleman and Wunsch, more preferably at least 50% identity (60% similarity), even more preferably at least 60% identity (70% similarity), more preferably at least 80% identity (85% similarity), even more preferably at least 70% identity (80% similarity), more preferably at least 80% identity (85% similarity), even more preferably at least 85% identity identity (90% similarity), even more preferably at least 90% identity (95% similarity), even more preferably at least 95% identity (98% similarity) and most preferably at least 98% identity identity and also includes p orions of such polypeptides with such a portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids. The polypeptides of the present invention include the phosphatidylinositol 3-kinase polypeptide (in particular the mature polypeptide) as well as the polypeptide having more than 78% identity (84% similarity) to the polypeptide, as described above in Needleman and Wunsch , more preferably at least 80% identity (85% similarity), even more preferably at least 85% identity (90% similarity), even more preferably at least 90% identity (95% similarity) ), even more preferably at least 95% identity (98% similarity) and more preferably at least 98% identity and also includes portions of such polypeptides with such a portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids. Vectors, Host Cells, Expression The present invention also relates to vectors comprising the polynucleotides of the present invention, host cells that incorporate the vectors of the invention and the production of polypeptides of the invention by recombinant techniques. The host cells can be genetically engineered to incorporate the polynucleotides and express polypeptides of the present invention. For example, polynucleotides can be introduced into host cells using well known techniques of infection, transduction, transfection, transvection and transformation. The polynucleotides can be introduced alone or with other polynucleotides. Such polynucleotides can be introduced independently, co-introduced or introduced together with the polynucleotides of the invention. Thus, for example, the polynucleotides of the invention can be transfected into host cells with another separate polynucleotide encoding a selectable marker, using standard techniques for co-transfection and selection in, for example, plant cells. In this case the polynucleotides will generally be stably incorporated into the host cell genome. Alternatively, the polynucleotides can be attached to a vector that contains a selectable marker for propagation in a host. The construction vector can also be introduced into host cells by the aforementioned techniques. Generally, a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. Electroporation can also be used to introduce polynucleotides into a host. If the vector is a virus, it can be packaged in vi tro or introduced into a packed cell and the packaged virus can be transduced into cells. A wide variety of suitable techniques for making polynucleotides and for introducing polynucleotides into cells according to this aspect of the invention are well known and routine for those skilled in the art. Such techniques are reviewed throughout in Sambrook et al, cited above, which is illustrative of the many laboratory manuals that detail these techniques. Vectors According to this aspect of the invention, the vector can be, for example, a plasmid vector, a single or double strand phage vector, a single or double strand RNA or DNA viral vector. Such vectors can be introduced into cells as polynucleotides, preferably DNA, by well-known techniques for introducing DNA and RNA into cells. The vectors, in the case of phage and viral vectors, can also be and preferably are introduced into cells as packaged or encapsulated viruses by well-known techniques for infection and transduction. The viral vectors may be of competent replication or defective replication. In the latter case, propagation will generally only occur in complementary host cells. Among the preferred vectors, in certain aspects, are those for expression of polynucleotides and polypeptides of the present invention. Generally, such vectors comprise control regions that act cis, effective for expression in a host operably linked to the polynucleotide to be expressed. Appropriate trans-acting factors are either supplied by the host, supplied by a complementary vector or supplied by the vector itself until introduction into the host. In certain preferred embodiments in this regard, the vectors provided for preferred expression. Such a preferred expression may be inducible expression or expression predominantly in certain types of cells or both inducible and preferred cells. Particularly preferred among the inducible vectors are vectors that can be induced by expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives. A variety of vectors suitable for this aspect of the invention, including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and routinely employed by those skilled in the art. Such vectors include, but are not limited to, chromosomal, episomal and virus derivatives, for example, vectors derived from bacterial plasmids, bacteriophages, transposons, yeast episomes, insertion elements, yeast chromosomal elements, virus such as baculoviruses, papovaviruses, such as SV40, bovine virus, adenovirus, avian virus, poultrypox virus and retroviruses, and vectors derived from combinations thereof, such as those derived from the plasmid and genetic bacteriophage elements, such as cosmids and phagemids and binaries used for transformations mediated by Agrobacterium. All may be used for expression in accordance with this aspect of the present invention. Generally, any vector suitable for maintaining, propagating or expressing polynucleotides to express a polypeptide in a host can be used for expression in this regard. The following vectors, which are commercially available, are provided by way of example. Among the preferred vectors for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Binary vectors of useful plants include BIN19 and its available Clontech derivatives. These vectors are listed only to form an illustration of the many commercially available and well-known vectors that are available from those skilled in the art to be used in accordance with this aspect of the present invention. It will be appreciated that any other plasmid or vector suitable for, for example, introduction, maintenance, propagation or expression of a polynucleotide or polypeptide of the invention in a host can be used in this aspect of the invention. In general, the constructed expression will contain sites for transcription initiation and termination, and, in the transcribed region, a ribosome that links the site for translation. The coding portion of the mature transcripts expressed by the constructs will include a translation that initiates AUG at the beginning and an appropriately positioned stop codon at the end of the polypeptide to be translated. In addition, constructions may contain controlling regions that regulate as well as engender expression. Generally, according to many commonly practiced procedures, such regions will operate by controlling transcription, such as transcription factors, repressor binding sites and termination, among others. For the secretion of the translated protein in the reticulum lumen, endoplasmic, in the periplasmic space or in the extracellular environment, the appropriate secretion signals can be incorporated into the expressed polypeptide. These signals may be endogenous to the polypeptide or may be heterologous signals. Generally, recombinant expression vectors will include origins of replication, a promoter derived from a gene highly expressed to direct transcription of a downstream structural sequence, and a selectable marker to allow isolation of the cell-containing vector after exposure to the vector. The transcription of the DNA encoding the polypeptides of the present invention by elevated eukaryotes can be increased by inserting an improved sequence into the vector. Enhancers are cis-acting DNA elements, usually from about 10 to 300 bp which acts to increase the transcriptional activity of a promoter in a given host cell type. Examples of enhancers include the SV40 enhancer, which is located on the last side of the replication source at 100 to 270 bp, the initial promoter enhancer of cytomegalovirus, the polyoma enhancer on the last side of the replication source, and adenovirus enhancers. Additional enhancers useful in the invention for increasing the transcription of the introduced DNA segment include, inter alia, virtual enhancers similar to those with the 35S promoter, as shown by Odell et al, Plant Mol. Biol. 10: 263-72 (1988), ~ and _ an enhancer of an opinion gene as described by Fromm et al. , Plant Cell L: _? 77 (1989). Among the known eukaryotic promoters suitable in this regard are the immediate early promoters of CMV, the HSV thymidine kinase promoter, the SV40 early and late promoters, the retroviral LTR promoters, such as those of sarcoma virus. Rous ("RSV"), promoters of metallothionein, such as the promoter of metallothionein-I in mouse and various plant promoters, such as globulin-1 When available, the native promoters of the biosynthetic enzyme genes of phytate can be used As mentioned above, the DNA sequence in the expression vector is operably linked to an appropriate expression control sequence, including, for example, a promoter to direct mRNA transcription. Representatives of the prokaryotic promoters include the PL phage lambda promoter, the promoters. col i lac, trp and tac to name just a few of the well-known promoters. - With respect to plants, examples of specific seed promoters include protein promoters stored in seeds that express baskets of proteins in seeds in a highly regulated manner (Thompson, et al., BioEssays; 10: 108; (1989), incorporated herein by reference in its entirety), such as by dicotyledonous plants, a β-phaseolin bean promoter, a napin promoter, a β-conglycine promoter, and a soy lecithin promoter. For monocotyledonous plants, promoters useful in the practice of the invention include, but are not limited to, a 15 kD corn zein promoter, a 22 kD zein promoter, a? -zein promoter, a waxy promoter, a contracted promoter 1, a globulin 1 promoter, and a contracted promoter 2. However, other promoters useful in the practice of the invention are known to those skilled in the art. Other examples of suitable promoters are the promoter for the small subunit of ribulose-1, 5-bis-phosphate carboxylase, promoters of plasmids that induce the tumor of Agrobacterium tumefaciens, such as promoters of nopaline synthase and octopine synthase, and viral promoters such as Cauliflower mosaic virus (CaMV), 19S and 35S promoters or the 35S promoter of the esoterofularia mosaic virus. It will be understood that numerous promoters not mentioned are suitable for use in this aspect of the invention are well known and can easily be employed by those with experience in the manner illustrated for discussion and examples herein. For example, this invention contemplates using the biosynthetic enzyme promoters of native phytate to drain the expression of the enzyme in a recombinant environment. Vectors for propagation and expression will generally include selected markers. Such markers may also be suitable for amplification or the vectors may contain additional markers for this purpose. In this regard, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for the selection of transformed host cells. Preferred markers include dihydrofolate reductase or a-nene resistance, omicin for eukaryotic cell culture, and tretracycline or ampicillin resistance genes for cultivating E. coli and other prokaryotes. The kanamycin and herbicide resistance genes (PAT and BAR) are generally useful in plant systems. Suitable marker genes, in physical proximity to the introduced DNA segment, are useful to allow transformed cells to be recovered either by genetic screening or positive screening. Selective marker genes are also allowed to maintain selection pressure in a transgenic plant population, to ensure that the introduced DNA segment, and its control promoters and enhancers, are retained by the transgenic plant. Many of the selected marker genes, commonly used positive, for plant transformation have been isolated from bacteria and encoded for enzymes that metabolically detoxify a selective chemical agent that can be an antibiotic or a herbicide. Another selection of positive marker genes encode an altered target that is insensitive to the inhibitor. A selection of the preferred marker gene for transformation of the plant is the BAR or PAT gene, which is used with the selection of the bialaphos agent. Spencer et al. , T. Thero. Appl'd Genetics 79, 625-631 (1990). Another selection of useful marker gene is the neomycin phosphotransferase II (nptll) gene, isolated from Tn5, which confers resistance to kanamycin when placed under the control of plant regulatory signals. Fraley et al. , Proc. Nati Acad. Sci. (USA) 80: 4803 (1983). The hygromycin phosphotransferase gene, which confers resistance to the hygromycin antibiotic, is an additional example of a useful selectable marker. Vanden Elzen et al. , Plant Mol. Biol. 5: Z99 (1985) _._ Additional selective positive markers of bacterial origin conferring resistance to antibiotics include gentamicin acetyl transferase, streptomycin phosphotransferase, aminoglycoside-3"-adenyl transferase and the determinant resistance to bleomycin. Hayford, et al., Plant Physiol. 86: 1216 (1988); Jones et al. Mol. Gen. Genet. 210: 86 (1987); Svab et al. , Plant Mol. Biol. 14: 197 (1990); Hille et al. , Plant Mol. Biol. 7: 171 (1986). _ Other positive marker genes for plant transformation are not of bacterial origin. These genes include dihydrofolate reductase. Of mouse, 5-enopiruv lshikimate-3-plant phosphate, and plant acetolactate synthase. Eichholtz et al. , Soma tic Cell Mol. Genet 13:67 (1987); Shah et al. , Science 233: 478 (1986); Charest et al. , Plant Cell Rep. 8: 643 (1990). Another class of marker genes useful for transforming the plant with the DNA sequence requires screening of presumably transformed plant cells in place of the direct genetic selection of transformed cells for resistance to a toxic substance such as an antibiotic. These genes are particularly useful for quantifying or visualizing the spatial pattern of expression of the DNA sequence in specific tissues and are frequently referred to as reporter genes because they can be fused to a gene or a gene regulatory sequence for expression research of the _gen. Genes commonly used to presumably screen transformed cells include β-glucuronidase (_GUS), β-galactosidase, luciferase, and chloramphenicol acetyltransferase.

Jefferson, Plant. Mol. Biol. Rep. 5: 387 (1987); Teeri et al. , EMBO J. 8: 343 (1989); Koncz et al. , Proc. Nat'l Acad. Sci. (USA) 84: 131 £ 1987); De Block et al. , EMBO J. 3: 1681 (1984).

Another approach to the identification of relatively rare cases of transformation has been the use of a gene encoding a dominant constitutive regulator of the antrocyanin pigmentation pathway of Zea mays (Luddwing, et al., Science 247: 449 (1990)). The appropriate DNA sequence can be inserted into the vector by any of a variety of good techniques. known and routine. In general, a DNA sequence for expression is linked to an expression vector by separating the DNA sequence and the expression vector with ~ one or more restriction endonucleases and then bound to the restriction fragments together using T4 DNA ligase. The sequence can be inserted in a forward or inverse orientation. The procedures for restriction and ligation that can be used for this purpose are well known and routine for those with experience. Appropriate procedures in this regard, and for the construction of expression vectors using alternative techniques, which are also well known and routine for those skilled in the art, are set forth in greater detail in Sambrook et al. , MOLECULAR CLONING, A LABORATORY MANUAL, 2nd. Ed .; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). The polynucleotides of the invention, which encode the heterologous structural sequence of a polypeptide of the invention will generally be inserted into the vector using standard techniques so that it is operably linked to the promoter for expression. The polynucleotide will be positioned so that the transcription start site is properly located 5 'to a ribosome binding site. The ribosome binding site will be 5 'to the AUG which initiates the translation of the polypeptide to be. voiced. Generally, there will be no other open reading frames that are with an initiation codon, usually.-AUG, and lie between the ribosome binding site and the initiation codon. Also, generally, there will be a translation stop codon at the end of the polypeptide _ and they will be a polyadenylation signal under construction for use in eukaryotic hosts. The transcription of termination signal appropriately disposed at the 3 'end of the transcribed region can also be included in the. polynucleotide construction. The vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, can be introduced into an appropriate host using a variety of well-known techniques suitable for the expression of a desired polypeptide herein. The present invention also relates to host cells containing the discussed constructs described above. The host cell can be a high eukaryotic cell, such as a mammalian cell or. plant, or a lower eukaryotic cell, such as a yeast cell, or the host cell may be a prokaryotic cell, such as a bacterial cell. The introduction of the construction into the host cell can be effected by calcium-phosphate transfection, DEAE-dextran-mediated transfection, microinjection, cationic mediated lipid transfection, electroporation, transduction, drag-laden loading, ballistic introduction, infection or other methods Such methods are described in many standard laboratory manuals, such as Davis et al. , _ BASIC METHODB JN. MOLECULAR BIOLOGY, (1986) and Sambrook et al. , MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed. , Cold. Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). Representative examples of appropriate hosts include bacterial cells, such as streptococcus, staphylococcus, E. coli streptomyces and Salmonella typhimuri um cells.; fungal cells, such as yee cells. and Aspergillus cells, insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Hosts for a wide variety of expression constructs are well known, and those with experience will be readily allowed for the present description to select a host to express a polypeptide according to this aspect of the present invention.

The engineered host cells can be cultured in a conventional nutrient medium, which can be modified as appropriate for inter alia, activating promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, previously used with the host cell selected for expression will generally be suitable for expression of polypeptides of the present invention as will be apparent to those with experience in the art. can be used in a conventional manner to produce the gene product encoded by the recombinant sequence Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.The mature proteins can be expressed in mammalian cells, yeast, bacteria or other low cells, control of appropriate promoters Free cell translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention, following the transformation of a host strain adequate and the growth of the host strain for an appropriate cell density, wherein the selected promoter is inducible, this is induced by appropriate means (eg, alternating temperature or exposure to chemical inducer) and cells are cultured for an additional period. The cells are typically harvested by centrifugation, destroyed by physical or chemical means, and the resulting unpurified extract is retained by further purification. The microbial cells employed in the expression of proteins can be destroyed by any convenient method, including freezing and thawing cyclization, sonification, mechanical destruction, or use of cell lysate agents, such methods are well known to those skilled in the art. As mentioned above, the present invention provides vectors capable of expressing phytate biosynthetic enzymes under the control of suitable promoters.In general, vectors should be functional in plant cells.Sometimes, these may be preferable to have vectors that are functions in E. coli (for example, production of protein for elevation antibodies, analysis of DNA sequence, construction of inserts, obtaining quantities of nucleic acids and proteins.) Vectors and procedures for cloning and expression in E .coli are discussed above and, for example, in Sambrook et al. (supra) and in Ausubel et al. (Supra).

Vectors that are functional in plants are preferably binary plasmids derived from Agrobacterium plasmids. Such vectors are capable of transforming plant cells. These vectors contain the left and right border sequences that are required for integration into the host (plant) chromosome. A minimum, between these border sequences is the gene to be expressed under the control of a promoter. In preferred embodiments, a select marker and a reporter gene are also included. For ease of obtaining sufficient quantities of the vector, a bacterial origin that allows replication in E. Coli is preferred. In certain preferred embodiments, the vector contains a reporter gene and the structural genes of. this invention. The reporter gene will allow the easy determination of transformation and expression. The GUS gene (β-glucuronidase) is preferred (US Patent No. 5,268,463). Other reporter genes, such as β-galactosidase, luciferase, GFP and the like, are also suitable in the context of this invention. Methods and substrates for test expression of each of these genes are. well known in the art. The reporter gene should be under the control of a promoter that is functional in plants. Such promoters include the CaMV 35S promoter, mannopine synthase promoter, ubiquitin promoter and DNA promoter J. Preferably, the vector contains a select marker to identify transformants. The select marker can confer advantageous growth under appropriate conditions. Generally, suitable markers are drug-resistant genes, such as neomycin phosphotransferase. "Other drug-resistant genes are known to those in the tennics and can be readily substituted.The selectable marker has a constitutive or inducible linked promoter and a terminator sequence. In addition, a bacterial origin of xeplication and a selector marker for bacteria are preferably included in the vector.Of the various origins (eg, CoIEI, fd phage), a CoIEI origin of replication is More preferred is the origin of the pUC plasmids, which allow high copy number - A general vector suitable for use in the present invention is based on pBI121 (US Patent No. 5,432,081), a derivative of pBIN19. Other vectors have been described (US Patent No. 4,536,475) or can be constructed based on the pr guides. present in the present. Plasmid pBI121 contains a right and left border sequence for integration into a host plant chromosome. These edge sequences flank two genes. One is a kanamycin-resistant gene (neomycin phosphotransferase) driven by a nopalin synthase promoter and using a polyadenylation site of nopalin synthase. The second one is the GUS E gene. coli under the control of the CaMV 35S promoter and polyadenylation using the polyadenylation site of nopalin synthase. Plasmid pBI121 also contains a bacterial origin of replication and a select marker. _ __. In certain embodiments, the vector may contain the structural genes identified herein under the control of a promoter. The promoter may be the native promoters associated with the structural genes. of themselves, or a strong, constitutive promoter, such as CaMV 35S promoter. Other elements that are preferred for optimal expression (e.g., transcription termination site, enhancer, splice site) may also be included. Genes can alternatively be expressed as fusion proteins with a reporter gene, for example. Plant Transformation Methods As discussed above, the present invention also provides methods for producing a plant expressing a foreign gene, comprising the steps of (a) introducing a vector as described above into an embryogenic plant cell, wherein the vector contains a foreign gene in an expressible form, and (b) produces an embryogenic plant cell plant, where the plant expresses the foreign gene. Vectors can be introduced into plant cells by any of several methods. For example, DNA can be introduced as a plasmid by Agrobacterium in co-cultivation or bombardment. Other methods of transformation include electroporation, CaP04 mediated transfection, and the like. Preferably, the DNA is first transfected into Agrobacterium and subsequently introduced into plant cells. More preferably, the infection is achieved by co-cultivation. In particular, the choice of methods of. transformation depends on the plant to be transformed. Phytate biosynthetic polypeptides can be coated and purified from recombinant cell cultures by well known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, chromatography of affinity, hydroxylapatite chromatography and lectin chromatography. More preferably, high performance liquid chromatography ("HPLC") is employed for purification. The polypeptides of the present invention naturally include purified products, products of synthetic chemical processes, and products produced by recombinant techniques of a prokaryotic or eukaryotic host, including for example, bacterial cells, yeasts, higher plants, insects and mammals. Depending on the host employed in a recombinant production method, the polypeptides of the present invention can be glycosylated or can be non-glycosylated. In addition, the polypeptides of the invention may also include a modified methionine residue, in some cases as a result of the host-mediated process. It will be appreciated that the gene expressing the polypeptide of interest may be to be an "optimized codon" to affect the efficient expression of a particular host. Thus, this invention contemplates selecting from the following sequences, the optimized sequence of the particular codon for the host cell of interest. Other genes of interest can be "stacked" during the same transformation cases. For example, other genes of interest may impart resistance to disease, pest or herbicide, or improve the quality of foods and meals of the plant or seed, such increased or altered oil expression or altered protein or carbohydrate expression. Regeneration of Transformed Plants Following the transformation, regeneration is implied to obtain a total plant of transformed cells. Techniques for regenerating tissue culture plants such as protoplasts or cell lines ^, from woody tissue, are well known in the art. For example, see Phillips, et al., Plant Cell Tissue Organ Culture; Vol. 1: p 123; (1981); Patterson, et al .; Plant Sci.,: Vol. 42, p. 125; (1985); Wright, et al .; Plant Cell Reports; Vol. 6; p. 83; (1987); and Barwale, et al., Plant; Vol. 167; p. 473 (1986); each incorporated herein in its entirety for reference. The selection of an appropriate method is within the expert of the tea. ___ _ _ It is expected that the transformed plants will be used in traditional breeding programs, including TOPCROSS pollination systems as described in US 5,706,603, and US 5,704,160, the description of each is incorporated herein for reference. Polynucleotide Assays This invention is also related to the use of β-phytate biosynthetic enzyme polynucleotides in the. marker to assist in reproduction programs, as described for example in PCT publication US89 / 00709. The DNA can be used directly by detection or can be enlarged enzymatically using PCR before analysis. PCR (Saiki et al., Nature 324: 163-166 (1986)). The RNA or cDNA can also be used in the same forms. As an example, the PCR primers complementary to the nucleic acid encoding the biosynthetic enzymes. of phytate can be used to identify and analyze the presence and expression of the .fitato biosynthetic enzyme. Using PCR, the characterization of the gene present in a particular tissue or variety of plant can be done by an analysis of the genotype of the tissue or variety. . For example, deletions or insertions can be detected by a change in the size of the expanded product compared to the genotype of a reference sequence. The indicated mutations can be identified by hybridizing the amplified DNA to radiolabelled phytate biosynthetic RNA enzyme or alternatively, antisense DNA sequences of radiolabeled phytate biosynthetic enzyme. The perfectly coupled sequences can be distinguished from the double unbalance of RNase A_digestion or by differences in melting temperatures. The sequence differences between a reference gene that has mutations can also be revealed, by direct DNA sequencing. In addition, the cloned DNA segments can be used as probes for specific DNA segments detected. The sensitivity of such methods can be greatly improved by the appropriate use of PCR or other amplification method. For example, a sequence primer is used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The determination of the sequence is carried out by conventional procedures with radiolabelled nucleotide or by procedures. of automatic sequencing with fluorescent labels. The genetic introduction of various varieties of plants based on sequence differences can be achieved by detecting alteration in electrophoretic mobility of DNA fragments in angels, with or without denatured agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. .The. fragments of. DNA from different sequences can be distinguished in denatured formamide gradient gels, in which the mobilities of different DNA fragments are delayed in the gel at different positions according to their fusion, specific or partial melting temperatures. (see, for example, Myers et al., Science, 230: 1242 (1385)). Sequence changes to specific locations can be revealed by nuclease protection assays, such as RNase and Si protection or the __method method. chemical cleavage (for example, Cotton et al., Proc. Nat'l Acad. Sci. (USA), 85: 4397-4401 (1985)).

Thus, the detection of a specific DNA sequence can be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes (eg, large polymorphisms of the restriction fragment). ("RFLP") and Southern genomic DNA assay In addition to higher standard .gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis A mutation can be identified, for example, by a sequencing assay DNA Samples are processed by methods known in the art to capture RNA.The first strand of cDNA is synthesized from the RNA samples by adding an oligonucleotide primer consisting of sequences that hybridize to a region in the mRNA. and deoxynucleotides are aggregated to allow synthesis of the first strand of cDNA The primer sequences are synthesized in e to the DNA sequences of the phytate biosynthetic enzymes of the invention. The first sequence is usually comprised of at least 15 consecutive bases, and may contain at least 30 or even 50 consecutive bases. Mutations carrying cells or polymorphisms in the gene of the present invention can also be detected at the DNA level by a variety of techniques. The DNA can be used directly by detection can be amplified enzymatically using PCR (Saiki et al., Nature, 324: 163-166 (1986)) before analysis. RTrPCR can also be used to detect mutations. It is particularly preferred to use RT-PCR in conjunction with automatic detection systems, such as, for example, GeneScan. The RNA or cDNA can also be used for the same purpose, PCR or RT-PCR. As an example, PCR primers complementary to the nucleic acid encoding phytate biosynthetic enzymes can be used to identify and analyze mutations. Examples of representative primers are shown as follows in Table 1. For example, deletions and insertions can be detected by a change in the size of the expanded product compared to the normal genotype. Point mutations can be identified by hybridization of the amplified DNA to radiolabelled RNA or alternatively, radiolabelled antisense DNA sequences. As long as the perfectly coupled sequences can be distinguished from the. double imbalance by digestion of RNAase _ A or by differences in melting temperatures, preferably point mutations are identified by sequence analysis. The primers used for detection. _of mutations or. polymorphisms in the mio-mositol l-fas-a-synthase gene.

'CTCGCTACCTCGCTtCGCATTCCATT 3 '5'ACGCCACTTGGCTCACTTGTACTCCA3' The primers used for the detection of mutations or polymorphisms in the gene "of myo-inositol monophosphatase-3 5? CGAGGTGGCGGGCGAACCGAAAAT 3 '5TAGG 3ACCGTTGCCTCAACCTAT 3' The primers used for the detection of mutations or polymorphisms in the myo-inositol 1,3,4-triphosphate 5/6 kinase gene 5'TTCTCTCGGTCGCCGCTACTGG 3 '5'AGCATGAACAGTTAGCACCT3' The primers used for the detection. from. mutations or polymorphisms in the 5-kinase phosphidyl tidylinositol gene 5 'CCGCTTCTCC TCACCTTCCT CT 3' 5 'TGGCTTGTGACAGTCAGCAT GT3' The above primers can be used to amplify the cDNA of the biosynthetic enzyme of phytate or genomic clones isolated from a sample derived from a single plant. The invention also provides the above primers with 1, 2, 3 or 4 nucleotides removed from the 5 'and / or 3' end. The primers can be used to amplify the isolated gene of the individual such that the gene can then be subjected to various techniques for elucidation of the DNA sequence. In this way, mutations in the DNA sequence can be identified. _ Polypeptide Assays The present invention is also related to. Diagnostic assays such as quantitative and diagnostic assays to detect levels of phytate biosynthetic enzymes in cells and tissues, including the determination of normal and abnormal levels. Thus, for example, a diagnostic test according to the invention. for detecting expression of phytate biosynthetic enzymes compared to normal control tissue samples can be used to detect unacceptable levels of expression. The assay techniques that can be used to determine levels of polypeptides of the present invention in a sample derived from a plant source are well known to those skilled in the art. Such assay methods include radioimmunoassays, competitive binding assays, Western Blot analysis and ELISA assays. Among these ELISAs are often preferred. An ELISA assay initially comprises preparing an antibody specific for the polypeptide, preferably a monoclonal antibody. In addition, a reporter antibody is usually prepared which binds to the monoclonal antibody. The reporter antibody is bound to a detectable reagent such as radioactive, fluorescent or enzymatic reagent, in this example of horseradish peroxidase enzyme. To perform an ELISA, a sample is removed from a host and incubated on a solid support, for example, a polystyrene disk, which binds the proteins in the sample. Any free protein binding sites in the disk are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated on the disk during which time the monoclonal antibodies are bound to any biosynthetic phytate enzymes attached to the polystyrene disk. The unbound monoclonal antibody is washed with buffer. The reporter antibody bound to horseradish peroxidase is placed on the disk resulting in the binding of the reporter antibody to any monoclonal antibody bound to the phytate biosynthetic enzyme. The unbound reporter antibody is then washed. Reagents for peroxidase activity, including a colorimetric substrate are then added to the disk. The immobilized peroxidase, bound to the biosynthetic enzyme of phytate through the primary and secondary antibodies, produces a colored reaction product. The amount of color developed in a given period indicates the amount of biosynthetic enzyme of phytate present in the sample. Quantitative results. Typically, they are obtained by reference to a standard curve. A competition assay can be employed where antibodies specific for biosynthetic enzymes of phytates bound to a solid support and labeled enzymes derived from the host are passed on the solid support and the amount of detected label bound to the solid support can be correlated to a amount of phytate biosynthetic enzyme in the sample. Antibodies Polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as immunogens to produce antibodies thereof. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various methods known in the art can be used for the production of such antibodies and fragments. The antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides in an animal or by administering the polypeptides to an "animal, preferably a non-human. Thus, even a sequence encoding only a fragment of the polypeptide can be used to generate binding antibodies of the native complete polypeptide Such antibodies can then be used to isolate the polypeptide from the tissue expressing that polypeptide. monoclonal, any technique that provides antibodies produced by linear cultures of continuous cells can be used. Examples include the hybridoma technique (Kohier, G. and Milstein, C, Nature 256: 495-497 (1975)), the trioma technique, the B-cell hybridoma technique (Kozbor, et al., Immunology Today 4 : 72 _ (1983) and EBV__ hybridoma technique to produce human monoclonal antibodies (Colé et al., P.77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985)). " "The hybridoma cell lines secreting the monoclonal antibody are another aspect of this invention." The techniques described for the production of single chain antibodies (US Pat. No. 4,946,778) can be adapted to produce single chain antibodies for Immunogenic polypeptide products of this invention Also, transgenic mice, or other organisms such as other mammals, can be used to express humanized antibodies to immunogenic polypeptide products of this invention. previously they can be used to isolate or. to identify clones expressing the polypeptide or purifying the polypeptide of the present invention by binding the antibody to a solid support for isolation and / or purification by affinity chromatography. The polypeptide derivatives include antigenically or immunologically equivalent derivatives that form a particular aspect of this invention. The term "antigenically equivalent derivative" as used herein encompasses a polypeptide or its equivalent that will be specifically recognized by certain antibodies that, when raised to the protein or. polypeptides according to the present invention, interfere with the immte physical interaction between the antibody and its antigen-like. The term "immunologically equivalent derivative" as used herein encompasses a peptide or its equivalent which when used in a suitable formulation for constructing antibodies in a vertebrate, the antibodies act to interfere with the immte physical interaction between the antibody and its similar antigen. The polypeptide, such as an antigenic or immunologically equivalent derivative or a fusion protein thereof is used as an antigen to immunize a mouse or other animal such as a rat, guinea pig, goat, rabbit, sheep, cattle or chicken. The fusion protein can provide "stability to the polypeptide." The antigen can be associated, for example by conjugation, with an immunogenic carrier protein for example bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH). Multiple antigenic peptide comprises multiple copies of the protein or polypeptide, or an antigenic or immunologically equivalent polypeptide thereof may be sufficiently antigenic to improve immunogenicity as well as to obviate the use of a carrier. ~~~ Alternatively, the technology deploying the phage could be used to select antibody genes by linking activities to the polypeptide from either amplified PCR and gene repertoires of human screening lymphocytes to possess anti-Fbp or from native libraries (McCafferty, J. et al., (1990), "Nature 348: 552-554; Marks, J. et al. , (1992) Biotechnology, 10: 77_9-783). The affinity of these antibodies can also be improved by chain redistribution (Clackson, T. et al., (1991) Nature 352: 624-628). The antibody could be screened again for high affinity to the polypeptide and / or fusion protein.

As mentioned above, a fragment of the final antibody can be prepared. The antibody can be either intact antibody, Mr about 150,000 or a derivative thereof, for example a Fab fragment or an Fv fragment as described in Sierra, A and Puckthun, A., Science 240 _: _ 1038-1040 (1988 ). If two linked dominant antigens are present, each domain can be directed against a different epitope - "bispecific" finished antibodies. The antibody of the invention, as mentioned above, can be prepared by conventional means for example by established monoclonal antibody technology (Kohier, G. and Milstein, C, Nature, 256: 495-497 (1975)) or by using recombinant means, for example, combinatorial libraries, for example as described in Huse, WD et al. , Science 246: 1275-1281 (JL989). Preferably, the antibody is prepared by expression of a DNA polymer encoding such antibody in an appropriate expression system as described above by the expression of polypeptides of the invention. The choice of vector for the expression system will be determined in part by the host, which may be a prokaryotic cell, such as E. coli (preferably strain B) or Streptomyces sp. or a eukaryotic cell, such as a mouse C127, mouse myeloma, human HeLa, Chinese hamster ovary, filamentous or unicellular fungal or insect cell. The host may also be a transgenic animal or a transgenic plant for example as described by Hiatt, A. et al. , Nature 340: 76-78 (1989). Suitable vectors include plasmids, bacteriophages, cosmids and recombinant viruses, derived from, for example, baculoviruses and vaccines. The Fab fragment can also be prepared from its original monoclonal antibody by treatment of the enzyme, for example using papain to separate the Fab portion of the Fc portion. Molecules and Assays Linking Fitato Biosynthetic Enzyme This invention also provides a method for the identification of molecules, such as binding molecules, that bind J_.itato biosynthetic enzymes. The. Genes that encode proteins that bind enzymes, such as binding proteins, can be identified by numerous methods known to those skilled in the art, for example, panning. ligand and FACS classification. Such methods are described in many laboratory manuals. such as, for example, Coligan et al. Current Protocols in Immunology 1 (2): Chapter 5 (1991). For example, expression cloning can be used for this purpose. For this purpose the polyadenylated RNA is prepared from a cell that expresses the biosynthetic enzymes of phytate, a cDNA library is created from this RNA, the library is divided into deposits and the deposits are transfected individually into cells that do not express the enzyme. . The cells are transfused. then exposed to labeled enzyme. The enzyme can be labeled by a variety of well-known techniques, including standard radioiodination methods or inclusion of a recognition site for a site-specific kinase protein. Following the exposure, the cells are fixed and the binding of the enzyme is determined. These procedures are conveniently carried out in glass slides. The deposits are identified from cDNA which produces cells that bind phytostetic biosynthetic enzyme. The sub-. deposits are prepared from these positives, transfected into. host cells and screened as described above. Using an iterative sub-deposit and a re-screening process, one or more unique clones that encode the putative link molecule can be isolated. Alternatively a labeled ligand can be attached to a cell extract, such as a membrane or "membrane extract, prepared from cells that express a molecule that binds, such as a binding molecule. The crosslinked material is resolved by polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film. The labeled complex containing the bound ligand may be excessive, resolved into peptide fragments, and subjected to microsequencing protein. The amino acid sequence obtained from microsequencing can be used for single design or degenerate the oligonucleotide probes for cDNA libraries screened to identify, genes encoding the putative linker molecule. The polypeptides of the invention can also be used to assess the binding capacity of the phytate biosynthetic enzyme of the binding, enzyme, molecules. biosynthetic phytate, such as molecules of. binding, in cells or cell-free preparations. The polypeptides of the invention can also be used to titrate the bond or small molecule substrates and ligands in, for example, cells, free preparations. cell, chemical _ libraries and mixtures of natural products. These substrates and ligands can be natural substrates and ligands or they can be structural or functional mimetics. Anti-phytate biosynthetic enzyme antibodies represent a useful class of binding molecules contemplated by this invention. Antagonists - Assays and Molecules The invention also provides a method for screening compounds to identify those that "improve" or block the action of phytate biosynthetic enzymes on cells, such as their interaction with molecules of the substrate. An antagonist is a compound that decreases the natural biological functions of enzymes. Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and therefore inhibit or extinguish its activity. Antagonists, potentials can also be small organic molecules, a peptide, a polypeptide such as a narrow related protein or an antibody that binds the same sites in a binding molecule, such as a binding molecule without induction of biosin-induced enzyme activities ± ethics, I think that they prevent the action of the enzyme by excluding the binding enzyme. Potential antagonists include a small molecule that binds to, and occupies the binding site of the polypeptide so it avoids binding to cell binding molecules, such as binding molecules, such that biological activity is avoided. Examples of small molecules include, but are not limited to, small organic molecules, peptides or peptide-like molecules. Other major antagonists include molecules that affect the expression of the gene encoding phytate biosynthetic enzymes (e.g., transactivation inhibitors). Other potential antagonists include antisense molecules. Antisense technology can be used to control the expression of the gene through antisense DNA or RNA or through double or triple helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 5760 * (1991); OLIGODEOXINUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for example, Lee et al. , Nucleic Acids Research 6: 3073 (1979); Cooney et al ._____, Science 241: 456 (1988); and Dervan et al. ^ Science 251: 1360 __ (JL991) _ ._ The methods are based on the binding of a polynucleotide to a complementary DNA or RNA. For example, the 5 'coding portion of a polynucleotide encoding the mature polypeptide of the present invention can be used to design an antisense RNA oligonucleotide of about 10 to 40 base pairs long. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription by preventing the transcription and production of phytate biosynthetic enzymes. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo in block translation of the mRNA molecule into phytate biosynthetic enzymes. The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA can be expressed in vivo to inhibit the production of phytate biosynthetic enzymes. Antagonists can be used for example to reduce phytate levels and / or increase the available phosphorus in plant cells. EXAMPLES The present invention is further described by the following examples. The examples are provided solely to illustrate the invention by reference to specific embodiments. These exemplifications, in "both illustrate certain specific aspects of the invention, do not represent the limitations or circumscribe the scope of the invention described." Certain terms used herein are explained in the above glossary All the examples were carried out using standard techniques , which are well known and routine to those skilled in the art, except "when otherwise" are described in detail.The molecular biology routine techniques of the following examples can be carried out as described in the manuals of laboratory standards, such as Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2ND, Ed., Cold Spring Harbor Labsratory Press, Cold Spring Harbor, NY (1989).

All parts or quantities set forth in the following examples are by weight, unless specified otherwise. Unless stated otherwise, fragment size separation in the following examples was carried out using standard techniques of agarose and polyacrylamide gel electrophoresis ("PAGE"), in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold, Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) and numerous other references such as, for example, Goeddel et al., Nucleic Acids Res. 8: 4057 (19-8D) Unless otherwise described, ligations were achieved using standard buffers, temperatures and incubation times, approximately equimolar amounts of the DNA fragments to be ligands and approximately 10 units of T4 DNA ligase ("ligase") per 0.5. micrograms of DNA Example 1: Isolation of DNA encoding Novel Proteins of Zea mays The polynucleotide having the DNA sequence myo-inositol 1-phosphate synthase was obtained from the sequencing of a bi library of cDNA clones prepared from maize embryos isolated 15 days after pollination. The polynucleotide having the DNA sequence of myo-inositol monophosphatase-3 was obtained by sequencing a library of cDNA clones prepared from immature corn projections. The polynucleotide having the myo-inositol 1, 3, 4-tr? Phosphate 5,6-kinase DNA sequence was obtained from the sequencing of a cDNA clone library prepared from corn spike shoots. The polynucleotide having the phosphatidylinositol-3-kinase DNA sequence was obtained from the sequencing of a library of cDNA clones prepared from the germination of corn seeds. Total RNA was isolated from its tissue using standard and enriched mRNA protocols by oligo dT selection, again with standard protocols. This mRNA was then used to make a template for synthesizing complementary DNA (cDNA) using the enzyme reverse transcriptase by conventional methods. The resulting strand of cDNA was then converted to double-stranded pieces of cDNA and ligated into the cloning vector pSPORT using conventional ligation / transformation methods. The individual colonies were then selected and the plasmid DNA prepared from each. This plasmid DNA was then denatured and used as a template in dideoxynucleotide sequencing reactions. By sequencing the individual clones thus identified with sequencing primers designed from the original sequence is then possible to extend the sequence in both directions to determine the complete gene sequence. Suitable techniques are described by Maniatis, T., Fritsch, E.F. and Sambrook, et al. , MOLECULAR CLONING - A -LABORATORY MANUAL. 2nd. Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). (See Sieving by Hybridization 1.90 and Sequencing of Double DNA Templates.Hebra Denatured 13.70). The sequences were compared for those sequences available in public databases (ie, Genbank) to determine the homologies / identification of the gene. In some cases the data. of sequencing of two or more clones containing DNA coating segments were used to construct the next contiguous DNA sequence. Example 2: Construction of Expression Cassettes for Gene-dependent Homology Off of Fitato Biosynthetic Enzyme Expression To facilitate manipulations of this trait in conventional breeding programs, the expression cassette described above is used in an off-homologous gene ( that is, deleted) of the biosynthetic enzyme polynucleotides of endogenous phytate using the preferred embryo promoter globulin 1 to drive the expression of the genes. The expression cassettes of the plant are made using the preferred embryo promoter globulin 1 to drive the expression of the phytate biosynthetic enzyme polynucleotides. The "globulin-1" termination sequences are also included in this cassette.The entire expression cassette is cloned into a pUC-based plasmid vector for easy manipulation in E. picol.This construction is used for the transformation of corn particle bombardment together with another expression construct that includes a selectable marker (eg, Pat, PHP8092? -Ubi:: mo-PAT:: ubi). For the agrobacterium-mediated transformation, a plasmid is moved in an appropriate binary vector containing both Left and right border sequences to facilitate the transfer of DNA into the target genome This polynucleotide, which encodes the inventive polypeptides, when made to be non-functional in plants, results in a reduction in phytic acid and an increase in phosphate levels without phytate This can be demonstrated using the transposed element Mu. Maize lines are confirmed to have a Mu element inserted in the region encoding the phytate biosynthetic enzyme polynucleotides. Extensive genetics are carried out in this phenotype, proving to be transmitted to progeny as a homozygous recessive trait. Example 3: Corn Transformation The inventive polynucleotides contained within a vector are transformed into embryogenic corn callus by particular bombardment. Transgenic corn plants are produced by bombardment of immature embryos. responsive with tungsten particles associated with DNA plasmids. Plasmids consist of a selectable marker gene and a non-selectable marker gene. _ Particle Preparation Fifteen mg of tungsten particles (General Electric), 0.5 to 1.8 μ, preferably 1 to 1.8 μ, and more preferably 1 μ, are added to 2 ml of concentrated nitric acid. This suspension was sonic at 0 ° C for 20 minutes (Branson Sonifier Model 450, 40% yield, constant duty cycle). The tungsten particles are granulated by centrifugation at 10000 rpm (Biofuge) for one minute, and the supernatant is removed. Two milliliters of sterile distilled water are added to the granule, and brief sonification is used to resuspend the particles. The suspension is granulated, one milliliter of absolute ethanol is added to the granules, and brief sonification is used to resuspend the particles. The rinsing, granulation, and resuspending of the particles is done twice more with sterile distilled water, and finally the particles are "resuspended in two milliliters of sterile distilled water.

The particles are subdivided into 250 ml aliquots and stored frozen. Preparation of the Particle-DNA Plasmid Association The tungsten particle store is briefly sonicated in a sonic water bath (Branson Sonifier Model 450, 20% yield, constant duty cycle) and 50 ml is transferred to a tube of microfuge Equimolar amounts of selected and unselected DNA plasmid are added to the particles for a final DNA amount of 0.1 to 10 mg in 10 ml of total volume, and sonicated briefly. Preferably, 1 mg of total DNA is used. Specifically, 4.9 ml of PHP 8092 (Ubiquitin:: ubiquitin intron:: mo-PAT:: 35S CaMV, .6.329 kbp)) plus 5.1 ml of (globulin l :: mi 1 ps :: globulin 1), where any polynucleotide of phytate biosynthetic enzyme can replace my 1 ps, both at 0.1 mg / ml in TE buffer, are added to the particle suspension. Fifty microliters of 2.5M sterile aqueous CaCl are added, and the mixture is briefly sonicated and vortexed. Twenty microliters of 0.1M sterile aqueous spermidine are added and the mixture is briefly sonicated and vortexed. The mixture is incubated at room temperature for 20 minutes with brief intermittent sonification. The particle suspension is centrifuged, and the supernatant is removed. Two hundred and fifty microliters of asbolute ethanol are. agergados to the granules, followed by brief sonification. The suspension is granulated, the supernatant is removed and 60 ml of absolute ethanol are added. The suspension is briefly sonicated before loading the particle agglomeration of DNA into macrocarriers. Tissue Preparation The immature embryos of the High Type II corn variety are the target for particle-mediated transformation. This genotype is the F_ of two purebred genetic lines, A and B parents, derived from the crossbreeding of two known maternal consanguines, A188 and B73. Both parents are selected for high competence in somatic embryogenesis, according to Armstrong et al. , Maize Genetics Coop. News 65:92 (1991). . Spikes of Fx plants are pure or related and the embryos are aseptically dissected developing caryopses when the skeleton first became opaque. This stage occurs approximately 9-13 days post-pollination, and more generally around 10 days post-pollination, depending on growth conditions. The embryos are approximately 0.75 to 1.5 millimeters long. "The spikes are surfaces sterilized with 20-50% Clorox for 30 minutes, followed by three rinses with sterile distilled water. _ The immature embryos are grown with upturned guillotine. , in the middle of embryogenic induction composed of N6 basal salts, Eriksson vitamins, 0.5 mg / 1 of thiamine HCl, 30 g / 1 of sucrose, 2.88 g / 1 of L-proline, 1 mg / 1 of 2,4-dichlorophenoxyacetic acid , 2 g / 1 of Gelrite, and 8.5 mg / 1 of AgN03, Chu et al., Sci. Sin. 18: 659 (1975); Eriksspn ,, Physiol. Plant 18: 976 (1965). The medium is sterilized by autoclaving at 121 ° C for 16 minutes and dispensed in 100 X 25 mm Petri dishes. AgN03 is filtered-sterilized and added to the medium after the autoclave. The tissues are cultivated in. complete darkness at 28 ° C. After approximately 3 to 7 days, more usually about 4 days, the sputum of the embryo protuberances to approximately twice its original size and the protrusions to the surface, coleorheal of the scaphoid indicates the conception of embryogenic tissue. Above 100% of the embryos supply this response but more commonly, the frequency of embryogenic response is approximately 80%. When the embryogenic response is observed, the embryos are transferred to a medium composed of the modified induction medium to contain 120 g / 1 of sucrose. The embryos are oriented with the coleorisal pole, the embryogenically responsible tissue, superiors of the culture medium. Ten embryos per Petri dish are located in the center of a Petri dish in an area approximately 2 cm in diameter. The embryos are maintained in this medium for 3-16 hours, preferably 4 hours, in complete darkness at 28 ° C just before bombardment with particles associated with plasmid DNA containing the selected and non-selected marker genes. To effect the bombardment of embryo particles, the DNA particle agglomerates are accelerated using a DuPont PDS-1000 particle acceleration device. The DNA particle agglomeration is "briefly sonified and 10 ml were deposited in macrocarriers and the ethanol is allowed to evaporate." The macrocarrier is accelerated in a stainless steel stop sieve by the rupture of a polymer diaphragm (rupture disc). The rupture is effected by pressurized helium.The acceleration speed of the DNA particle is determined based on the rupture pressure of the rupture disc.The rupture disc pressures of 200 to 1800 psi are used, with 650 at 110 psi being preferred, and approximately 900 psi being more highly preferred. The multiple discs are used to make a range of rupture pressures. The shelf containing the embryo plate is placed 5.1 cm below the bottom of the macrocarrier platform (shelf # 3). To effect the bombardment of the cultured immature embryo particle, a rupture disk and a macrocarrier with dried DNA particle agglomerates are installed in the device. The pressure I have supplied to the device is adjusted to 200 psi before the breaking pressure of the rupture disc. A Petri dish with the target embryos is placed in the vacuum chamber and located in the projected path of accelerated particles. A vacuum is created in the chamber, preferably approximately 28 in Hg. After the operation of the device, the vacuum is released and the Petri dish is removed. The bombarded embryos remaining in the osmotically adjusted medium during the bombardment, and 1 to 4 days subsequently. The embryos are transferred to a selection medium comprised of basal N6 salts, Eriksson vitamins, 0.5 mg / 1 thiamine HCl, 30 gm / 1 saccharose, 1 mg / 1 2,4-dichlorophenoxyacetic acid, 2 gm / 1 Gelrite, 0.85 mg / 1 Ag N03 and 3 mg / 1 bialaphos (Herbiace, Meiji). The bialaphos is filtrate-sterilized aggregate. The embryos are subcultured for fresh selection medium of 10 to 14 days intervals. After approximately 7 weeks, the embryogenic tissue, putatively transformed by both select and non-selected marker genes, proliferated from approximately 7% of the bombarded embryos. The putative transgenic tissue is rescued, and that tissue derived from individual embryos is considered to be a case and is "propagated independently in the middle of selection." Two cycles of clonal propagation are achieved by visual selection for the contiguous fragments more. small of organized embryogenic tissue. A tissue sample from each case is processed to recover DNA. The DNA is restricted with a restriction endonuclease and probed with primer sequences designed to amplify the DNA sequences by crosslinking the biosynthetic enzymes of phytate and portion of the biosynthetic enzyme without phytate of the plasmid. The embryogenic tissue with amplifiable sequence is advanced to the regeneration of the plant. For the regeneration of transgenic plants, embryogenic tissue is subcultured to a medium comprising MS salts and vitamins (Murashing & amp;; Skoog, Physiol. Plant 15: 473 (1962)), 100 mg / 1 of mis-inositol, 60 gm / 1 of sucrose, 3 gm / 1 of Gelrite, 0.5 mg / 1 of zeatin, 1 mg / 1 of indole-3 acid acetic, 26.4 ng / 1 of cis-trans-abscisic acid, and 3 mg / 1 of bialaphos in 100 X 25 mm of Petri dishes, and incubated in darkness at 28 ° C until development, well-formed, somatic embryos mature can be seen. This requires approximately 14 days. The well-formed somatic embryos are opaque and creamy in color, and are "composed of an identifiable coletelium and coleoptile." The embryos are individually subcultured to a germination medium comprising salts of MS and vitamins, 100 mg / 1 of myo-inositol, gm / 1 of sucrose and 1.5 gm / 1 of Gelrite in 100. X. 25 mm of Petri dishes e_ incubated under a photoperiod of 16 hours of light: 8 hours of darkness and 40 meinsteinsm "sec" 1 of fluorescent tubes cooled- After approximately 7 days, the somatic embryos have germinated and produced a shoot and a bulb.The individual plants are subcultured for a germination medium in 125 X 25 mm glass tubes to allow the development of the additional plant. they are kept under a photoperiod of 16 hours of light: 8 hours of darkness and 40 minutes of bright white fluorescent tubes, after about 7 days, the plants are well stabilized and then transplanted. to horticultural soil, harvested, and enmacetadas in mixture and development of commercial greenhouse soil, for sexual maturity in a greenhouse. A consanguineous line of selection is used as a male to pollinate regenerating transgenic plants. Example 4: Identification of High-Phosphorus Transgenic Maize Lines The resulting transformants are screened for high levels of inorganic phosphorus using a simple colorimetric assay. The individual transgenic seeds are crushed in the well of a megatiter reproduction path using hydraulic pressure at 2000 psi. The crushed seeds are then soaked in 2 ml of 1 N H2SO4 for 2 hours at room temperature. The development of color is then initiated by the addition of 4 ml of. developed solution (1 part 10% ascorbic acid, 6 parts, 0.42% ammonium molybdate in H2SO4 IN) for each crushed seed. The seeds are classified after 30 minutes of incubation at room temperature either as positive (blue) or negative (transparent). The positive in this case refers to the high level of inorganic phosphorus, .. This protocol is a modified version of that described in Chen et al. , Anal. Chem. 28: 1756 (1956). Those transformants that are screened as positive with the colorimetric assay will then be subjected to more rigorous analysis to include assay and Southern, Northern and Western quantification of phytic acid levels. Confirmation of Phosphorus Levels Without Elevated Phytate The present transgenics preferably have phosphate levels without phytate in excess of the natural levels of phosphorus available for the "plant species" of interest. With respect to corn, it is preferred to have phosphate levels without phytate of about 0.175%, more preferably about 0.2% and more preferably "about 0.225% or more." These percentages being based on% weight / weight at 13% of Moisture bases for both corn seeds With respect to soybeans, it is preferred to have phosphate levels without phytate of about 0.47%, more preferably about 0.49% "and more preferably about 0.51%. This last percentage is based on the weight of the phosphate without phytate / (P without phytate / gram of food on a moisture base at 13%). Each plant identified as a high potential phosphorus transgenic is tested again to confirm the original high phosphorus reading. Some putative transgenics can not confirm for the high phosphorus trait. Those that confirm are selected on the basis of uniformity for the high phosphorus trait. Confirmation of Reduced Phytate Levels To determine if phosphate-free transcripts of phytate are also characterized by reduced levels of phytate, the following method is used to quantify the level of phytic acid in a tested sample. The sample is founded, placed in a conical plastic centrifugal tube and treated with hydrochloric acid. This is homogenized with polytomron and extracted at room temperature with vortex. The extracted sample is placed in a clinical centrifuge at 2500 RPM for 15 minutes. 2.5 ml of the supernatant is removed and added to 25 ml of water. The sample is washed through the SAX® column. The column is washed with HCl, eluted and evaporated to dryness. The dried sample is resuspended in water and filtered through a 0.45 micron syringe tip filter in a jar. 10 to 20 microliters of samples are prepared for injection into an HPLC column. The elution solvent is prepared by mixing 515 ml of methanol, 485 ml of double distilled water, 8 ml of 40% tetrabutyl ammonium hydroxide (TBAH), 200 microliters of 10 N, (5 m) of sulfuric acid, 0.5 ml of acid formic acid and 1-3 mg of phytic acid. Phytic acid is prepared by placing 16 mg of sodium phytate in 5 ml of = water. This solution is placed in a Dowex ion exchange resin (1 ml of Dowex-50 acid forms a glass wool in 5 ml of pipette tip). This is rinsed with 1-2 ml of water, and the filtrate placed in 10 ml with water. The "concentration is 1 mg / ml phytic acid, 2 ml is used for 1 liter of solvent.The pH of the solvent is adjusted to 4.10 +/- 0.05 with 10 N sulfuric acid. Chromatography is achieved by pumping the sample through the a HPLC column of Hamilton PRP-1 inverse ff.se heated to 40 degrees centigrade at a rate of 1 ml per minute.The detection of inositol is achieved with an indian-refractive detector (Waters), which is self-zeroed at least (2) minutes before each run.

High confirmed phosphorus transgenic are tested in this way. Some, but not all, of the mutants evaluated in this way are confirmed to be lower in the phytate.

Description of Sequence SEC. DE1DENT.N0: 1 FOSPHATIDYLINOSOLTOL-3-KINASE SECEFA.DOC: 2 FOSPHATIDYLINOSITOL-3-KINASE SECOND PHASE POLYPEPTIDE SEC. FROM IDENT. NO: 3 FOSFATIDYLINOSITOL-3-KINASE SEALANT SEC. FROM IDENT. NO: 4 PRIMER OF FOSPHATIDYLINOSITOL-3-KINASE SEC.DEIDENT.N0: 5 MiO-INOSITOL 1,3,4-TRIFOSPHATE 5/6-KINASE SEC.DEIDENT.N0: 6 MIO-INOSiTOL 1,3, POLYPEPTIDE 4- TRIFOSPHATE 5/6-KINASE SEC. FROM IDENT. NO: 7 MIO-INOSITOL 1,3,4- TRIFOSFATO 5/6-QUINASA GENERIC SEC. FROM IDENT. O: 8 PRIMER OF MIO-INOSITOL 1,3,4- TRIFOSPHATE 5/6-KINASE SEC, DEIDENT.N0: 9 PRIMER OF MIO ^ -INOSITOL 1,3,4- TRIFOSPHATE 5/6-QUINASE SEC.DEIDENT.NOHO CDNA OF MIO-INOSITOL 1-PHOSPHATE SYNTHETASE SEC.DEIDENT.N0: 11 POLYPEPTIDE OF MIO-INOSITOL 1-PHOSPHATE SYNTHETASE SEC.DEIDENT.N0: 12 PRIMER OF MIO-INOSITOL 1-PHOSPHATE SYNTHETASE SEC.DEIDENT.N0: 13 CEBADOR DE MIO-INOSITOL 1- PHOSPHATE SYNTHETASE SEC.DEIDENT.N0: 14 MIO-INOS1TOL 1-PHOSPHATE SYNTHETASE GENOMIC SEC.DEIDENT.N0: 15 MIO-INOSITOL 1-PHOSPHATE SYNTHETASE GENOMIC SEC. FROM IDENT. NO: 16 MIO-INOSITOL cDNA MONOPHOSPHATE-3 SEC. FROM IDENT. NO: 17 IO-iNOSITOL MONOPROPHOSPHATE-3 SEC.DEIDENT.N0 POLYPEPTIDE: 18 MICRO-INOSITOLMONOPHOSPHATE-3 PRIMER SEC.DEIDENT.N0: 19 MICRO-INOSITOL MONOPHOSPHATE-3 PRIMER LIST OF SEQUENCES < 110 > Pioneer Hi-Bred International, Inc. < 120 > Genes that Control the Metabolism of Phytate in Plants and Uses of the Same < 130 > 0706"< 150 > 60 / 055,446 < 151 > 1997-08-11 < 150 > 60/055, 526 < 151 > 1997-08-08. < 150 > 60 / 053,944 < 151> 1997-07-28 <160> 19 <170> FastSEQ for Windows Version 3.0 _ <210> <1> <211> 3252 <212> DNA <213> Zea mays < 220 > < 221 > CDS _ < 222 > (258) ... (2666) < 400 > 1 gtcgacccac gcgtccgctc gccgcgggag tcacgcaacc gccgtctcct cgccggcacg 60 cttcgccgcc gccgcctctc tcctcctcgt ctcaaccgcc gcctgcacac gcagaaaagg 120 agaggatcag agggagaata caaaccccaa gccctccact cgtcgccccc tgctgcaatc 180 gccccacccg cctccgcccg ccgccgcttc tcctcacctt cctctcccgc gacatctcag 240 ttcttcatca ccaaaag atg gtc ggc ggc ggc aac gag ttc cgt ttc__ttc 290 Met Val Gly Gly Gly Asn Glu Phe Arg Phe Phe 5 January 10 ttg aka tgc gac ate age falls ceg ctt gee ttc cgt gtt etc falls gca 338 Leu Ser Cys Asp lie Ser His Pro Leu Wing Phe Arg Val Leu His Wing 15 20 25 gaa cat ate ttg ttg acc gac aaa gtc cea gag etc ttt gtt gag 386 Glu His lie Leu Leu Thr Asp Gln Lys Val Pro Glu Leu Phe Val Glu 30 35 40 tgc He Asp Gly He Gln Phe Gly Leu Pro Val Lys Thr 45 50 55 agg ttg gaa ect tet gga ceg aaa tac tgt tgg aat gag etc tying here 482 Arg Leu Glu Pro Ser Gly Pro Lys Tyr Cys Trp Asn Glu Leu He Thr 60 65 70 75 tta agt acc aaa tac agg gac cta here tcc etc teg cag ctt gca ttt 530 Leu Ser Thr Lys Tyr Arg Asp Leu Thr Ser Leu Ser Gln Leu Wing Phe 80 85 90 acg ~ gtg tgg gat gtc tca tet ggt gag aac ect gag gtt gtc ggt gga 578 Thr Val Trp Asp Val Ser Ser Gly Glu Asn Pro Glu Val Val Gly Gly 95 10Q 105 gee acc ata ttt ctt ttt aac age aaa agg cag ctt aaa__aca gga aga 626_ Wing Thr He Phe Leu Phe Asn Ser Lys Arg Gln Leu Lys Thr Gly Arg 110 115 120 cag aag ctg cgg cg tgg ecg aga gga gca gga gga ggac ccc 674 Gln Lys Leu Arg Leu Trp Pro Thr Lys Glu Wing Asp Gly Gly Val Pro 125 130 135 action acct act g gc aag gtt ect agg aat gag agg ggt_gag_ ata_ gaa 722 Thr Thr Thr Pro Gly Lys Val Pro Arg Asn Glu Arg Gly Glu He Glu 140 145 150 1155 cgt ttg gaa agg ctt gtt aac aag tat gag aga ggg cag_ ata_ca cat 770 Arg Leu Glu Arg Leu Val Asn Lys Tyr Glu Arg Gly Gln He Gln His 160 165 170 gtt gat tgg ctt gat cgt ctt gee ttc agt gct atg gac aaa gat atg 818 Val Asp Trp Leu Asp Arg Leu Wing Phe Ser Wing Met Asp Lys Wing Met 175 180 185 gaa aaa gag tgt gag agg aag gee aat ttg tac ect agt ctg gtt gtt 866 Glu lys Glu Cys Glu Arg Lys Wing Asn Leu Tyr Pro Ser Leu Val Val 190 195 200"gaa ttg tgc agt ttc gaa cat aga att gtc ttc cag gaa tet gga gca 914 Glu Leu Cys Ser Phe Glu His Arg He Val Phe Gln Glu Ser Gly Wing 205 210 215 aat ttt tat here cag gee cea gta tca tfa tca aat gaa ctg gtt act 962 Asn Phe Tyr Thr Pro Wing Pro Val Ser Leu Ser Asn Glu Leu Val Thr 22Q 225 230 .. _ .. ._235 gta tgg gac ect gaa ctt gga aga acc aat cea tet gag cae aag cag 1010 Val Trp Asp Pro Glu Leu Gly Arg Thr Asn Pro Ser Glu His Lys Gln 240 245 _ 250 tta _aag ctt got aag age ttg act cgt ggg ata gtt gat aga gat cta __ 1058 Leu Lys Leu Ala Lys Ser Leu Thr Arg Gly He Val Asp Arg Asp "Leu 255 260 265 aaa cea age tca aat gag aga aag tta cta ca a here att att aag ttt 1106 Lys Pro Ser Ser Asn Glu Arg Lys Leu Leu Gln Thr He He Lys Phe 270 275 280 cot ect here cgc acc ttg gaa gtg gat gag aag caa ttg gtg tgg aag 1154 Pro Pro Thr Arg Thr Leu Glu Val Asp Glu Lys Gln Leu Val Trp Lys 285 290 295 ttt cgt ttc tet ttg atg tet gag aag aaa gct cta acg aaa ttt gtc 1202 _ Phe Arg Phe Ser Leu Met Ser Glu Lys Lys Wing Leu Thr Lys Phe Val 300 305 310 315 cgc tca gtg gat tgg agt gat aac caa gaa gat aag ca gct gtt gag 1250 Arg Ser Val Asp Trp Ser Asp Asn Gln Glu Wing Lys Gln Wing Val Glu 320 325 330 ttg att gga aag tgg gaa atg att gat gtg gat gat gca cta gag ctt 1298 Leu He Gly Lys Trp Glu Met He Asp Val Wing Asp Wing Leu Glu Leu 335 340 345: etc tca ect gat ttt gaa age gac gaa gtt cgt ggt tat gct gtc age 1346 Leu Ser Pro Asp Phe Glu Be Asp Glu Val Arg Gly Tyr Ala Val Ser 350 355 360 -ta ctt gaa agg gct gat gat gaa gata tta cag tgc tat tta etc cag 1394 Val Leu Glu Arg Wing Asp Asp Glu Glu Leu Gln Cys Tyr Leu Leu Gln 365 370 375 tta gtg ca gct ctt cgg ttt gaa aga tat gac aag tcc cgt cta gca 1442 Leu Val Gln-Ala Leu Arg Phe Glu Arg Ser Asp Lys Ser Arg Leu Wing 380 385 390 395 etc ttt ctt gta aac cgt gct ttg tcc aac ate gaa att gct age ttc 1490 Leu Phe Leu Val Asn Arg Ala Leu Ser Asn He Glu He Wing Being Phe 400 405 410 etc cgg tgg tat ata tta gtt gag ctt falls agt ect gca tat gca aga 1538 Leu Arg Trp Tyr He Leu Val Glu Leu His Ser Pro Ala Tyr Ala Arg 415 420 425 cga tat tat ggc here tat gac atg ctt gaa aac agt atg atg aaa ttg 1586 Arg Tyr Tyr Gly Thr Tyr Asp Met Leu Glu Asn Ser Met.Met Lys Leu 430 435 440 gtt ggt agg gag gat ggg gat gaa gat gga ttt cga ctg tgg cag agt 1634 Val Gly Arg Glu Asp Gly Asp Glu Asp Gly Phe Arg Leu Trp Gln Ser 445 450 455 tta acc cgg cag here gac etc act gct ca t tg tgt tat att atg aag 1682 Leu Thr Arg Gln Thr Asp Leu Thr Wing Gln Leu Cys Ser He Met Lys 460 465 470 _ - 475 gat gta aga ast gta aga ggt age gca caa aag aaa att gaa aaa ttg 1730 Asp Val Arg Asn Val Arg Gly Ser Wing Gln Lys Lys He Glu Lys Leu 480 485 490 agg cag tta tta tca gga ttt ct agt gag ctt here aac ttt gat gag 1778 Arg Gln Leu Leu Ser Gly Val Phe Ser Glu Leu Thr Asn Phe Asp Glu 495 500 505 cea att cgt tca cea tta gca cea act ctt etc cta here gga gtt gtg 1826 Pro He Arg Pro Pro Leu Wing Pro Thr Leu Leu Leu Thr Gly Val Val 510 515 520 ect caa gaa teg tet ata ttt aag agt gee ttg aac ect ttg cgc ctg 1874 Pro Gln Glu Be Ser He Phe Lys Ser Ala Leu Asn Pro. Leu Arg Leu 525 530 535 _ here ttt aaa here gca aat ggc gga here tcc aag att att aaa aag 1922 Thr Phe Lys Thr Wing Asn Gly Gly Thr Ser Lys He He Tyr Lys Lys 540 _ 545 550. _-. Ü555 _ ggt gat gac etc cgg ca gt gat cag ttg gtt att caa aeg gtt tet ttg 1970_ _ Gly Asp Asp Leu Arg Gln Asp Gln Leu Val He Gln Thr Val Ser Leu 560 565 570 atg gac cga cta etc aaa tta gaa aat cta gat ttg falls ctt act cea 2018 _ Met Asp Arg Leu Leu Lys Leu Glu Asn Leu Asp Leu His Leu Thr Pro 575 580 585 _ ~ tac cga gtt ctt goa act gga ca ga gat ggg atg ctt gaa ttt att "2066 ^ Tyr Arg Val Leu Wing Thr Gly Gln Asp Glu Gly Met Leu Glu Phe He 590 595 600 agt tcc agt tet ctt gca cag att cta tca gaa cat cgc agt att here _ 2114 Being Ser Be Leu Wing Gln He Leu Ser Glu His Arg Ser He Thr 605 610 615 agt tac cta cag aag ttc cat cnt gat gag gat ggt ect ttt ggt ata 2162 Be Tyr Leu Gln Lys Phe His Xaa Asp Glu Asp Gly Pro Phe Gly He 620"625. 630" 635 acg gct cag tgt ttg gag here ttc ata aaa age tgc gee ggt tac tet _ 2210 _ Thr Ala Gln Cys Leu Glu Thr Phe He Lys Ser Cys Wing Gly Tyr Ser 640 645 650 gtc att here tac ata ttg ggg gtt gga gac agg cat ctg gat aat ctt __ 2258 Val He Thr Tyr He Leu Gly Val Gly Asp Arg His Leu Asp Asn Leu _ 655 660 665 ctt cta _act gat gat gga cgc ctt ttt cat gtt gac ttt gct ttt ate 2306 Leu Leu Thr Asp Asp Gly Arg Leu Phe His Val Asp Phe Wing Phe He 670 675 680 ctt ggg cga gac cea aag cea ttt ceg cea cog atg aag ttg tgt_ aag 2354 Leu TGly Arg Asp Pro Lys Pro Phe Pro Pro Pro Met Lys Leu Cys Lys 685 690 695 -gaa atg gtt gag gee atg ggt ggt gca gaa age ca ta tat tac aca_ agg 2402 Glu Met Val Glu Wing Met Gly Gly Wing Glu Ser Gln Tyr Tyr Thr Arg 700 705 710 715 ttc aag tcc tac tgc tgc gaa goa tac aac att ctg agg aag tcc age 2450 Phe Lys Ser Tyr Cys Cys Glu Wing Tyr Asn He Leu Arg Lys Ser Ser 720 725 730 agt etc att ttg aat cta ttc aag ctg atg gag cga tca ggc att ceg 2498 Being Leu lie Leu Asn Leu Phe Lys Leu Met Glu Arg Being Gly He. Pro 735 740 745 gac ate tet gee gat gaa age gga ggt etc aag etc cag gag aaa ttc 2546 1 Asp He Ser Wing Asp Glu Be Gly Gly Leu Lys Leu Gln Glu Lys Phe 750 755 760 cgg ttg gat ctg gac gac gag gag gct ata cat ttc ttc cag gat ctt 2594 Arg Leu Asp Leu Asp Asp Glu Glu Wing He His Phe Phe Gln Asp Leu 765 770 775 ate aac gat age gtg agt gct ctg ttc ect caa atg gtt gag acc ate 2642 He Asn Asp Ser Val Be Wing Leu Phe Pro Gln Met Val Glu Thx He 780 785 790 795 cat aga tgg gct ca g tat cagg tgg cgg taacacaagc taatgtcgta gaagcaagtg 2696 His Arg Trp Wing Gln Tyr Trp Arg 800 tgaatatgta catgctgact gtcacaagcc acggtattaa gcgagaaacg acacttgatg 2756 gatggaagct taggcgctta gcatttgggg ttcaagctgc nccgcatctg cgaattgatt 2816 gggctgatgc agggcatggg caatcttctt cgtgcaggtg acacccagga attcgggttg _ 2876 tcagttgtca cttgtgatag tagaattccg tcacgcactg ctgtagacct atgggcattc 2936 tatatgcgtt gtcagatgta aatgtataaa atcaacttca gtagcaaatt tgtgaatacc 2996"ggaatacgtg atggtttagg gcctgtttgt ttaccccatg gattatataa tctggattat 3056 ttttggagga ttatataatc tggattatat aatctgagta gttctgtttg tttacccaga 3116 ttatttgagt tgttaatagg attcttttgt atgaggaaga caagaatgcc ctctatattt 3176 gtactaggtt gaaactcata tatgagatga acaatgtaac aaaaaaaaaa aaaaaaaaaa ~ 3236. aaaaaaaggg cggccg 3252 < 210 > 2 < 211 > 803 < 212 > PRT < 213 > Zea mays < 400 > 2 Met Val Gly Gly Gly Asn Glu Phe Arg Phe Phe Leu Ser Cys Asp He _ 1 5 10 15 Sex His Pro Leu Wing Phe Arg Val Leu His Wing Glu His lie Leu Leu _ 25 30 Thr Asp Gln Lys Val Pro Glu Leu Phe Val Glu Cys Lys Leu Tyr He 35 40 45 Asp Gly He Gln Phe Gly Leu Pro Val Lys Thr Arg Leu Glu Pro Ser 50 55 60 Gly Pro Lys Tyr Cys Trp Asn Glu Leu He Thr Leu Ser Thr Lys Tyr 65 70 75 80 Arg Asp Leu Thr Ser Leu Ser Gln Leu Ala Phe Thr Val Trp Asp Val 85 90 95 Being Ser Gly Glu Asn Pro Glu Val Val Gly Gly Ala Thr He Phe Leu 100 105 110 Phe Asn Ser Lys Arg Gln Leu Lys Thr Gly Arg Gln Lys Leu Arg Leu 115 120 125 Trp Pro Thr Lys Glu Wing Asp Gly Gly Val Pro Thr Thr Thr Pro. Gly 130 135 140 Lys Val Pro Arg Asn Glu Arg Gly Glu He Glu Arg Leu Glu Arg Leu 145 150 155 160 Val Asn Lys Tyr Glu Arg Gly Gln He Gln His Val Asp Trp Leu Asp 165 170 _ 175 Arg Leu Ala Phe Ser Ala Met Asp Lys Ala Met Glu Lys "Glu Cys Glu 180 185 190 Arg Lys Wing Asn Leu Tyr Pro Ser Leu Val Val Glu Leu Cys Ser Phe 195 200 205 Glu His Arg He Val Phe Gln Glu Ser Gly Wing Asn Phe Tyr Thr Pro 210 215 220. Ala Pro Val Ser Leu Ser Asn Glu Leu Val Thr Val Trp Asp Pro Glu 225 230 235 _ __ _ 240 Leu Gly Arg Thr Asn Pro Ser Glu His Lys Gln Leu Lys Leu Wing Lys 245 250 255 Ser Leu Thr Arg Gly He Val Asp Arg Asp Leu Lys Pro Ser Ser Asn 260 265 270 Glu Arg Lys Leu Leu Gln Thr He He Lys Phe Pro Pro Thr Arg Thr 275 280 285 Leu Glu Val Asp Glu Lys Gln Leu Val Trp Lys Phe Arg Phe Ser Leu 290 295 300 Met Ser Glu Lys Lys Ala Leu Thr Lys Phe Val Arg Ser Val Asp Trp 305 310 315", ~ 320 Being Asp Asn Gln Glu Ala Lys Gln Ala Val Glu Leu He Gly Lys Trp 325 330 _., 335 Glu Met He Asp Val Wing Asp Wing Leu Glu Leu Leu Ser Pro Asp Phe 340 345 350 Glu Ser Asp Glu Val Arg Gly Tyr Wing Val Ser Val Leu Glu Arg Wing 355 360 365 Asp Asp Glu Glu Leu Gln Cys Tyr Leu Leu Gln Leu Val Gln Wing Leu 370 375 380 Arg Phe Glu Arg Ser Asp Lys Ser Arg Leu Ala Leu Phe Leu Val Asn 385 390 395 _ _ __ áOO Arg Ala Leu Ser Asn He Glu He Wing Being Phe Leu Arg Trp Tyr He 405 410 415 Leu Val Glu Leu His Ser Pro Ala Tyr Ala Arg Arg Tyr Tyr Gly Thr 420 425 430 Tyr Asp Met Leu Glu Asn Ser Met Met Lys Leu Val Gly Arg Glu Asp 435 440 445 Gly Asp Glu Asp Gly Phe Arg Leu Trp Gln Ser Leu Thr Arg Gln Thr 450 455 460 Asp Leu Thr Wing Gln Leu Cys Ser He Met Lys Asp Val Arg Asn Val 465 470 475 480 Arg Gly Ser Ala Gln Lys Lys He Glu Lys Leu Arg Glnleu Leu Ser 485 490 495 Gly Val Phe Ser Glu Leu Thr Asn Phe Asp Glu Pro He Arg Ser. Pro 500 505 510 Leu Ala Pro Thr Leu Leu Leu Thr Gly Val Val Pro Gln Glu Ser Ser 515 520 525 He Phe Lys Ser Ala Leu Asn Pro Leu Arg Leu Thr Phe Lys Thr Ala 530 535 540 Asn Gly Gly Thr Ser Lys He He Tyr Lys Lys Gly Asp Asp Leu Arg 545 550 555 560 Gln Asp Gln Leu Val He Gln Thr Val Ser Leu Met Asp Arg Leu Leu 565 570 575 Lys Leu Glu Asn Leu Asp Leu Hls Leu Thr Pro Tyr Arg Val Leu Ala 580 585 590 Thr Gly Gln Asp Glu Gly Met Leu Glu Phe He Ser Ser Ser Ser Leu 595 600 605 Wing Gln He Leu Ser Glu His Arg Ser He Thr Ser Tyr Leu Gln Lys 610 615 620 Phe His Xaa Asp Glu Asp Gly Pro Phe Gly He Thr Ala Gln Cys Leu 625 630 635 640 Glu Thr Phe He Lys Ser Cys Wing Gly Tyr Ser Val He Thr Tyr He 645 650 655 Leu Gly Val Gly Asp Arg His Leu Asp Asn Leu Leu Leu Thr Asp Asp 660 665 670 Gly Arg Leu Phe His Val Asp Phe Wing Phe He Leu Gly Arg Asp Pro 675 680 685 Lys Pro Phe Pro Pro Pro Met Lys Leu Cys Lys Glu Met Val Glu Wing 690 695 700 Met Gly Gly Wing Glu Ser Gln Tyr Tyr Thr Arg Phe Lys Ser Tyr Cys 705 710 715 _ 720 Cys Glu Ala Tyr Asn He Leu Arg Lys Ser Ser Ser Leu He Leu Asn 725 730 735 Leu TEhe Lys Leu Met Glu Arg Ser Gly He Pro Asp He Ser Wing Asp 740 745 750 Glu Be Gly Gly Leu Lys Leu Gln Glu Lys Phe Arg Leu Asp Leu Asp 755 760 765 Asp Glu Glu Wing He His Phe Phe Gln Asp Leu He Asn "Asp Ser Val 770 775 780 Be Ala Leu Phe Pro Gln Met Val Glu Thr He His Arg Trp Wing Gln 785 790 795 800 Tyr Trp Arg. < 210 > 3 < 211 > 22 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > starter < 400 > 3 ccgcttctcc tcaccttcat ct _ 2 < 210 > 4 < 211 > 22 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > primer ___ < 400 > 4 tggcttgtga cagtcagcat gt < 210 > 5 < 211 > 1428 < 212 > DNA < 213 > Zea mays < 220 > < 221 > CDS < 222 > (US) ... (1176) < 400 > 5 cccgggtcga cccacgcgtc cgggtgcccg cccgcacaca ccacctgtcc ccgctccgct 60 ccgctccgcg ttcccttctc tcggtcgccg ctactggcct tcgctcggtc cgccgcg atg 120 Met 1 gtg tet ggc ggg tgc gtg ggg acg gag ggg gag gcg gac cgc gcg gcg 168_ Val Ser Gly Gly Cys Val Gly Thr Glu Gly Glu Ala Asp Arg Ala Wing 5 10 15 gcg ect ceg gag gee gcg gag gag ceg gtg gtg ceg gcg ect CCC gcg 216 Wing Pro Pro Glu Wing Wing Glu Glu Pro Val Val Pro Wing Pro Pro Wing 20 25 30 cgg gag gtg gtg gtg ggg tac gcg etc acg acg aag aag gee aag age 264 Arg Glu Val Val Val Gly Tyr Ala Leu Thr Thr Lys Lys Wing "Lys" Ser 35 40 45 ttc etc cag ecc aag etc cgg ggg etc gee agg aaa ~ g gga ate ttg 312 Phe Leu Gln Pro Lys Leu Arg Gly Leu Wing Arg Lys Lys "Gly He Leu ... 50 55 60 - 65 ttt gtt gct att gat cag aaa cgt cea ttg tet gat ca ggt cea ttt 360 Phe Val Ala He Asp Gln Lys Arg Pro Leu Ser Asp Gln Gly Pro Phe 70 75 80 gac -att gtt ctt cat aag ttg act gga aag ggg tgg cag t tg ctg 408 Asp He Val Leu His Lys Leu Thr Gly Lys Gly Trp Gln Gln Leu Leu 85 90 95 gag gaa tat agg gag gct falls cea gaa gtt act gtt ctt get cea ect 456 Glu Glu Tyr Arg Glu Ala Pro His Glu Val Thr Val Leu Asp Pro Pro 100 105 110 -ggc qca ata gca aac ttg cta gat cgc caat tet atg ctt caa gaa gta 504 Gly Ala He Ala Asn Leu Leu Asp Arg Gln Ser Met Leu Gln Glu Val 115 120 125 tet gaa ttg gac tca ceg att gtc at ttc tet tetgca ggt aaa gta 552 Ser Glu Leu Asp Ser Pro He. Val Met Phe Ser Ser Ala Gly Lys Val 130 135 140 - 145 cgc. -gtg ect aaa cag cta ttc att aat act gat ecc tca. tca ata cea 600 Arg Val Pro Lys Gln Leu Phe He Asn Thr Asp Pro Ser Ser He Pro 150 155 160_ gct gca gtt agg agg gcg ggt etc tet etc cea ttg gtg gca aaa CCC 648 Wing Wing Val Arg Arg Wing Gly Leu Ser Leu Pro Leu Val Wing Lys Pro 165 170 175 ttg gtg gcg aag tcc cat gag cta tcc ctg gct tat gat cea act tca 696 Leu Val Wing Lys Ser His Glu Leu Ser Leu Wing Tyr Asp Pro Thr Ser 180 185 190 ctg acc aaa ctt gag ecc ect tta gtt ctt cag gaa ttt gtt aac cat 744 Leu Thr Lys Leu Glu Pro Pro Leu Val Leu Gln Glu Phe V l Asn His 195 200 205 gtt ggt gtc atg ttt aag gtg tac att gtt ggg gat gca ata agg gtt 792 Val Gly Val Met Phe Lys Val Tyr He Val Gly Asp Ala He Arg Val 210 215 220 225 gta cgt cgg ttt tca ctt cea aat gtt gat gaa ggt gat ctg teg aat 840 Val Arg Arg Phe Ser Leu Pro Asn Val Asp Glu Gly Asp Leu Ser Asn 230 235 240 aat gct ggg gta ttt cgg ttt cea agg gtc tet tgt gct gca gee age Asn Ala Gly Val Phe Arg Phe Pro Arg Val Ser Cys Ala Ala Ala Ser 245 250 255 gca gat gat gca gat ctt gac ect ggt gtt gct gaa ctt CCt ceg aga 936 Wing Asp Asp Wing Asp Leu Asp Pro Gly Val Wing Glu Leu Pro Pro Arg 260 265 270 cea ttg ctt gag ate ttg gca cga gag ctg cgg cga cg cg ggt ctt 984 Pro Leu Leu Glu He Leu Wing Arg Glu Leu Arg Arg Arg Leu Gly Leu 275 280 285 _ .. .. aga cta ttc aac att gat atg att agg gag falls gga here aga gac cgg 1032 Arg Leu Phe Asn He Asp Met He Arg Glu His Gly Thr Arg Asp Arg 290"295 300 _." .. _ 7777305 _ ".. ttt tat gtc ata gac atg aac tac ttt ect ggg tac ggc aaa atg_cac 1080 Phe Tyr Val He Asp Met Asn Tyr Phe Pro Gly Tyr Gly Lys Met Pro 310 315 ...... -320 ... .__ ggg tac gag falls gtg ttc acc gac ttc ctg ctg agc_ ctt gee cag aaa 1128. Gly Tyr Glu His Val Phe Thr Asp Phe Leu Leu Ser Leu, Wing GJ_n_ Lys ... 325, 330. 77733 5 ^; gag tac aag agg cga cea age tat age tcc cta ggc tea..ggc gaa. ggg 1176 Glu Tyr Arg Lys Arg Pro Ser Tyr Ser Ser Leu Gly Ser Gly Gly Glu 340 345 350 tgaaaagtga ggcagaggct actcggcggg ggtgcoctgt atatgtatag catccgcaat 1236 gcgtgcgtgc gtgcgtacag atgtgctgcg tgacgggaga ggatgggtcg tagagttggg_1296 gcatcactgc atcacatcag tggccgcgat aaaaagaagc gaggactgtt gataggctgt 1356 ttactttgca aattaaattg gttcatgctt ggtgctaact caaaaaaaaa. aaaaaaaaaa; 1416. aaagggcggc cg 1428 < 210 > 6 7. < 211 > 353 . < 212 > PRT < 213 > Zea mays < 400 > 6 Met Val Ser Gly Gly Cys Val Gly Thr Glu Gly Glu Wing Asp Arg Ala 1. 5 10 15.

Ala Ala Pro Pro Glu Ala ALa Glu Pro Val Val Pro Pro. Ala Pro Pro 25 30 Wing Arg Glu Val Val Val Gly Tyr Ala Leu Thr Thr Lys Lys Wing Lys 35 40 45 Ser Phe Leu Gln Pro Lys Leu Arg Gly Leu Wing Arg Lys Lys Gly He 50 55 60 Leu Phe Val Wing He Asp Gln Lys Arg Pro Leu Ser Asp Gln Gly Pro 65 70 75"" 80 Phe Asp He Val Leu His Lys Leu Thr Gly Lys Gly Trp Gln Gln Leu 85 90 95 Leu Glu Glu Tyr Arg Glu Ala His Pro Glu Val Thr Val Leu Asp Pro 100 105 110 Pro Gly Wing Wing Wing Asn Leu Leu Asp Arg Gln Being Met Leu Gln Glu 115 120 125 Val Ser Glu Leu Asp Ser Pro He Val Met Phe Ser Be Wing GJ_y Lys 130 135 140 Val Arg Val Pro Lys Gln Leu Phe He Asn Thr Asp Pro Ser Ser He 145 150 155 _ ..... 1 160 Pro Wing Wing Val Arg Arg Wing Gly Leu Ser Leu Pro Leu Val Wing Wing 165 170 175 Pro Leu Val Ma Lys Ser His Glu Leu Ser Leu Ala Tyr Asp Pro Thr 180 185 190 Ser Leu Thr Lys Leu Glu Pro Pro Leu Val Leu Gln Glu Phe. Val Asn 195 200 205 His / Val Gly Val Met Phe Lys Val Tyr He Val Gly Asp Ala He Arg 210 215 220 Val Val Arg Arg Phe Ser Leu Pro Asn Val Asp Glu Gly Asp Leu Ser 225 230 235 240 Asn Asn Ala Gly Val Phe Arg Phe Pro Arg Val Ser Cys Ala Ala Ala 245 250 255 Be Ala Asp Asp Ala Asp Leu Asp Pro Gly Val Ala Glu Leu Pro Pro 260 265 270 Arg Pro Leu Leu Glu He Leu Wing Arg Glu Leu Arg Arg Arg Leu Gly 275 280 285 Leu Arg Leu Phe Asn He Asp Met He Arg Glu His G.y Thr Arg Asp 290 295 300 Arg Phe Tyr Val He Asp Met Asn Tyr Phe Pro Gly Tyr Gly Lys Met 305 310 315 320 Pro Gly Tyr Glu His Val Phe Thr Asp Phe Leu Leu Ser LeuAla Gln 325 330 335 Lys Glu Tyr Lys Arg Arg Pro Ser Tyr Ser Ser Leu Gly Ser Gly Glu 340 345 350 Gly < 210 > 7 < 211 > 1059 < 212 > DNA < 213 > Zea mays < 220 > < 221 > musc_feature < 222 > (1) ... (1059) < 223 > n = any base; n, h are as shown in WIPO Standard ST.25 (1998), Appendix 2, Table 1 < 400 > 7 atggtntcng gnggntgygt nggnacngar ggngargcng aycgngcngc ngcnccnccn 60 gargcngcng argarccngt ngtnccogcn ccnccngcnc gngargtngt ngtnggntay 120 gcnctnacna cnaaraargc naartcntty ctngarccna arctncgngg nctngcncgn 180 aaraarggna thctnttygt ngcnathgay caraarcgnc cnctntcnga ycarggnccn 240 ttygayathg tnctncayaa rctnacnggn aarggntggc arcarctnct ngargartay 300 cgngargcnc ayccngargt nacngtnctn gayccnccng gngcnathgc naayctnctn 360 cnatgctnca gaycgncart rggngtntcn garctngayt cnccnathgt natgttytcn 420 tcngcnggna nccnaarcar argtncgngt ctnttyatha ayacngaycc ntcntcnath 480 ccngcngcng tncgnagngc nggnctntcn ctnccnctng tngcnaarcc nctngtngcn 540 aartcncayg arctntcnct ngcntaygay ccnacntcnc tnacnaarct ngarccnccn 600 ctngtnctnc argarttygt naaycaygtn ggngtnatgt tyaargtnta yathgtnggn 660 gaygcnathc gngtngtncg ncgnttytcn ctnccnaayg tngaygargg ngayctntcn 720 aayaaygcng gngtnttycg nttyccncgn gtntcntgyg cngcngcntc ngcngaygay 780 gcngayctng ayccnggngt ngcngarctn ccnccncgnc cnctnctnga rathctngcn 840 cgngarctnc gncgncgn ct nggnctncgn ctnttyaaya thgayatgat hcgngarcay 900 ggnacncgng aycgnttyta ygtnathgay atgaaytayt tyccnggnta yggnaaratg 960 ccnggntayg arcaygtntt yacngaytty ctnctntcnc tngcncaraa rgartayaar 1020 cgncgnccnt cntaytcntc nctngcntcn ggngarggn 1059 < 210 > 8 < 211 > 22 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > starter < 400 > 8 ttctctcggt cgccgctact gg 22 < 210 > 9 < 211 > 20 < 212 > DNA 55 < 213 > Artificial Sequence < 220 > < 223 > starter < 400 > 9 agcatgaaca gttagcacct 20 < 210 > 10 < 211 > 1931 < 212 > DNA < 213 > Zea mays < 400 > 10 ggcacgagca gcagcctcct tcctcctctc actctcgctc gcgctgcgct cgctacctcg 60 cttcgcattc cattcgaaaa gaggggagga aaggcaagat gttcatcgag agcttccgcg 12_0_ tcgagagccc ccacgtgcgg tggagatcga tacggcccga cggtacgaca gtcggagtac 180 cgacggagct ggtacacgag ggcaaggacg gcgcctcacg ctgggtcgtc cgccccaagt 240 ccgtcaagta caacttccgg accagaaccg ccgtccccaa gctcggggtg atgcttgtgg 300 ggtggggagg caacaacggg tccacgctga cggctggggt cattgccaac agggagggga 360 tctcatgggc gaccaaggac aaggtgcagc aagccaacta ctacggctcc ctcacccacg 420 cctccaccat cagagtcggc agctacaacg gggaggagat ctatgcgccg ttcaagagcc 48Q tccttcccat agtgaaccca gacgacattg tgttcggagg ctgggacatt agcaacatga 540 acctggccga ctccatgacc agggccaagg tgctggatat tgacctgcag aagcagctca 600 ggccctacat ggagtccatg gtgccacttc ccggtatcta tgatccggac ttcatogcgg 660 ctaaccaggg ctctcgcgcc aacagtgtca tcaagggcac caagaaagaa caggtggagc 720 agatcatcaa ggatatcagg gagtttaagg agaagaacaa agtggacaag atagttgtgt 780 aaacactgaa tgtggactgc aggtatagca atgtgtgcgc tggtctcaac gacacgatgg 840 agaatctact ggcat ctgtg gacaagaacg aagcggaggt atcaccatca acactatatg 900 ccattgcctg tgtcatggaa ggggtgccgt tcatcaatgg gagcccccag aacacctttg 960 tgcctgggct gattgatctt gctataaaaa acaactgctt gattggtggt gacgacttca 1020 agagtggaca gaccaagatg aaatctgtct tggtcgattt ccttgttggt gctggaataal080 agcccacctc aatcgtgagc tacaaccact tgggaaacaa cgatggcatg aacctgtctg 1140 cccctcaaac attcaggtcc aaggagatct ccaagagcaa cgtggtggat gacatggtct 120-0 cgagcaatgc catcctctat gagcccggcg agcatcccga tcatgtcgtt gtcatcaagt 1260 atgtgccgta cgtgggagac agcaagaggg gtacacctca ctatggacga gagatcttca 1320 gaacaccatc tgggcggcaa gtgctgcaca acacctgtga ggactcgctc ctcgccgcac 1380 ctatcatcct tgatctggtg ctcttggctg agctcagcac caggatccag ctgaaagctg 1440 agggagagga caaattccac tccttccacc cggtggccac catcttgagt tacttcacca 1500 aggcacccct ggttccccct ggcacaccgg tggtgaacgc tctggccaag cagagggcga 1560 ^ tgctggagaa catcatgagg gcctgcgttg ggctggcccc agagaacaac atgatcttgg 1620 agtacaagtg agccaagtgg cgtgccctgc agcgcgaggt tagctgctgg aagggaacta 1680 gaaaggcgag attagctgtg g gattgtgtt gggcttgtcg tgttttcttt tgcgttctttH74Q cctagtcatt gctgttgcgc ttttgtattt gtcggacccg taactaccag ggctctgcta 1800 ttagcggcac ggagcctgta attgtattgt atgataatgt gatcgagggt gctacttccc ^ 1860 ctcggcattc ctagtgttgg ttaaaagtcg ttcgacagca acttatcgac ccaaaaaaaa aaaaaaaaaa 1920 to 1931 < 210 > 11 < 211 > 510 < 212 > PRT < 213 > Zea mays < 400 > 11 Met Phe He Glu Ser Phe Arg Val Glu Ser Pro His Val Arg Tyr Gly 1 5 10 15 Pro Met Glu He Glu Ser Glu Tyr Arg Tyr Asp Thr Thr Glu Leu Val 20 25 30 _ His Glu Gly Lys Asp Gly Wing Ser Arg Trp Val Val Arg Pro Lys Ser 35 40 45 Val Lys Tyr Asn Phe Arg Thr Arg Thr Wing Val Pro Lys Leu Gly Val 50 55 60 Met leu Val Gly Trp Gly Gly Asn Asn Gly Ser Thr Leu Thr Wing Gly 65 70 75 80 Val He Wing Asn Arg Glu Gly He Ser Trp Wing Thr Lys Asp Lys Val 85 90 95 Gln Gln Wing Asn Tyr Tyr Gly Ser Leu Thr His Wing Being Thr He Arg 100 105 110 Val Gly Ser Tyr Asn Gly Glu Glu He Tyr Wing Pro Phe Lys Ser Leu 115 120 125 Leu Pro He Val Asn Pro Asp Asp He Val Phe Gly Gly Trp Asp He 130 135 140 Ser Asn Met Asn Leu Wing Asp Ser Met Thr Arg Wing Lys Val Leu Asp 145 150 155 160 He Asp Leu Gln Lys Gln Leu Arg Pro Tyr Met Glu Ser Met Val Pro 165 170 175 Leu Pro Gly He Tyr Asp Pro Asp Phe He Wing Wing Asn Gln Gly Ser 180 185 190 Arg Wing Asn Ser Val He Lys Gly Thr Lys Lys Glu Gln Val GTLu Gln 195 200 205 He He Lys Asp He Arg Glu Phe Lys Glu Lys Asn Lys Val Asp Lys 210 215 220 IlelZal Val Leu Trp Thr Wing Asn Thr Glu Arg Tyr Ser Asn Val Cys 225 230 _ 235 _ 240 Wing Gly Leu Asn Asp Thr Met Glu Asn Leu Leu Wing Ser Val Asp Lys 245 250 255 Asn Glu Wing Glu Val Ser Pro Being Thr Leu Tyr Wing He Wing Cys Val 260 _ 265 270 Met Glu Gly Val Pro Phe He Asn Gly Ser Pro Gln.Asn Thr Phe Val 275 280 285 Pro Gly Leu He Asp Leu Wing He Lys Asn Asn Cys Leu He Gly Gly 290 295 300 Asp Asp Phe Lys Ser Gly Gln Thr Lys Met Lys Ser Val Leu Val Asp 305 310 315"" "320 Phe Leu Val Gly Wing Gly He Lys Pro Thr Ser He Val Ser Tyr Asn 325 330 335 His Leu Gly Asn Asn Asp Gly Met Asn Leu Ser Wing Pro _Gln Thr Phe - 340 345 350 Arg Ser Lys Glu He Ser Lys Ser Asn Val Val Asp Asp Met Val Ser 355 360 365 Ser Asn Ala He Leu Tyr Glu Pro Gly Glu His Pro Asp His Val Val 370 375 380 Val lie Lys Tyr Val Pro Tyr Val Gly Asp Ser Lys Arg Ala Met Asp 385. 390 395"_" 400 Glu Tyr Thr Ser Glu He Phe Met Gly Gly Lys Asn Thr He Val Leu 405 410 415 His Asn Thr Cys Glu Asp Ser Leu Leu Ala Pro Wing He He Leu Asp 420 425 430" Leu Val Leu Leu Wing Glu Leu Ser Thr Arg He Gln Leu Lys Wing Glu 435 440 445 Gly Glu Asp Lys Phe His Ser Phe His Pro Val Wing Thr He Leu Ser 450 455 46s Tyr Phe Thr Lys Wing Pro Leu Val Pro Pro Gly Thr Pro Val Val Asn 465 470 475 480 i Ala Leu Ala Lys Gln Arg Ala Met Leu Glu Asn He Met Arg Ala Cys 485 490 95 Val Gly Leu Ala Pro Glu Asn Asn Met He Leu Glu Tyr Lys 500 505 510 < 210 > 12 < 211 > 26 _ < 212 > DNA < 213 > Artificial Sequence _ "< 220 > < 223 > starter < 400 > 12 ctcgctacct cgcttcgcat tccatt 26 < 210 > 13 < 211 > 26 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > starter < 400 > 13 acgccacttg gctcacttgt actcca 26 < 210 > 14 < 211 > 3546 < 212 > DNA < 213 > Zea mays < 400 > 14 ctcgctacct cgcttcgcat tccattcgag gagagcggtg agaggggagg aaaggcaaga 60 tgttcatcga gagcttccgc gtcgagagcc cccacgtgcg gtacggcccg acggagatcg 120 agtcggagta ccggtacgac acgacggagc tggtacacga gggcaaggac ggcgcctcac 180 gctgggtcgt ccgccccaag tccgtcaagt acaacttccg gaccagaacc gccgtcccca 240 agctcgggta tgtacggatg cagcggccct agcctcactc tctgtgaacc ctcctcctcc 300 cgtgctcagt caaatcctcc gtcgagatca actggtcggc gttccctcct aaatcctaat 360 gaaaatctta ctgctttgcc tgaagacgaa ccgtcgtaat tgttgacagc tacgcacaca 420 cttgcccatc cggatgcgtc aaatcagctc gatttgaaat tcgattcgat ggtgcccttt 4 &0 tccatatttc gatcatccct cgcctactgt gcaatgatta cagaaacgtc cttttcctct- 5-4.0. gaactttgtc ttaggctttt tgtcctgtgc acgtgagctg gratcaattt gttcatgtaa 600 gatcaaattc cagcagggac gatgagcagc agacagaact cattacacta gcaaattgat 660 actaggatta ctggcaagtg tgcatacggc gcaatctgcc atcctggacc ccctttgttt 720 aattcctgtt cctatgcatg ttgcctacgt gcagctcgtt gtgtgttatg gtgtcaggct 780 gtcagccgct tgtctctgtc cgacggatga tgccaacttt tctgttctgg tggtgcaggg 840 tgatgcttgt ggggtgggga ggcaacaacg ggtccacgct gacggctggg gtcattgcca 900 acagggagtg agtagtactt aatttgtcct atattgcttt ccgttgtttt cagttattaa 960 gagaactgaa tggcctaaca ttttgttgtt ggttgtttca ggggatctca tggccgacca 1020 aggacaaggt gcagcaagcc aactactacg gctcctcacc caggcctcca ccatcagagt 1080 cggcagctac aacggggagg agatctatgc gccgttcaag agcctccttc ccatggtaat 1140 ctattataga cttgactaat actcttcttt ttactgaaac taacaaagca caaacataca 120Q tattccgtaa ggtgctagtt gatgttataa aatgaacctg tctttcaggc cagtggtctc 1260 aagtaaacgg aatgttaatc attgggttga aaaaacaaag gttctaattt tgtgaaagga 1320 aagttaaact tagcataatg aaaaggggaa gcactgtaag aaaggtgctg aaacaatcga 1380 ctcggtctgc catgttgtga tcctacttgc aagtcaaaag gttctgtggt tagcccaaag 1440 ctttggatta gttccagcat gtattgacga cactcgtgca tggttgoaga tggtgctaac 1500 ttcgcagact cggtgtttgt tatcttcttt tcatgaccaa gtgttaaact ggttttcagg 1560 tgaacccaga cgacattgtg ttcggaggct gggacattag caacatgaac ctggccgact 1620 ccatgaccag ggccaaggtg ctggatattg acctgcagaa gcagctcagg ccctacatgg 1680 agtccatggt gccacttc cc cggtatctat gatccggact tcatcgcggc taaccagggc 1740 tctcgcgcca acagtgtcat caagggcacc aagaaagaac aggtggagca gatcatcaag 1800 gatatcaggt atatggatat ggatgctaac gtgcattggt gctaaggtgc acccagtgca 1860 acctaaaaca aataaatact actatgaatt tggtaaatat acatacatat cagagcatat 1920 tgtttaaccg gtgcacttag gagtctgcat ggtatgttgg acaatttgac attcgatata 1980 tcacttgcat cagtgaccgc gaggactcca caaagaacta aaactactga aagcttaagc 2040 aactattcgt agctaatgat gtatttggtg gacatggttt gaagatctag attaacgtgg 2100 ttgaagaaat atggttcact atecattaca agtataagta gaagcaatgg cttatgtagc 2160 taatgaaaca gggagtttag ggagaagaac aaagtggaca agatagttgt gttgtggact 2220 _ gcaaacactg aaaggtatag caatgtgtgc gctggtctca acgacacgat ggagaateta 2280 ctggcatctg tggacaagaa cgaggcggag gtatcaccat caacactata tgccattgcc 2340 tgtgtcatgg agggggtgcc gttcatcaat gggagccccc agaacacett tgtg_cctggt_ 240 (71 _ gcgtggtttg aaaagcctca gtgtgtttgc tggtgttgca tttctgttcc aaagtttcat 2460 ggtgttgtat ttctgttcca aggcttatta tacctgttgc atgttcgtag ggctgattga 2520 tettgetata aaaaac aact gcttgattgg tggtgacgac ttcaagagtg gacagaccaa 2580 gatgaaatct gtcttggtcg atttccttgt tggtgctgga ataaaqgtgg_gaacctagta_2640 ^ tctctcttct agtgtttttt attaagatga tggcaaatga cgttattgca ataactette 2700 ^ tatattttca gcccacctca ttttcatgca atcgtgagct acaaccactt ggqaaacaac 2760 acctgtctgc gatggcatga cottcaaaca ttcaggtcca aggagatctc caaqagcaac 2820 gtggtggatg acatggtctc gageaatgee atectetatg agcccggcga gcatcccgat 2880 catgtcgttg tcatcaaggt ctgttagctg atctttcacc tcgttaaaag ttgacatatg 2940 ttacattgaa caaggcagat acttgtcact cttttgttgc agtatgtgcc gtacgtggga 3000 gggctatgga gacageaaga cgagtacacc teagagatet tcatgggcgg caagaacacc 3060 atcgtgctgc acaacacctg tgaggactcg ctcctcgccg cacctatcat_ ccttgatctg 3120 gtgctcttgg ctgagctcag caccaggatc cagctgaaag ctgagggagg ggtaagagcc 3180 ttaacctgaa ccccaagtga agcacgctgc acgctaggtg atatageact tttaatacct 3240 tctggtgtct etettatgea ggacaaattc cactccttcc acccggtggc caceatcctg 3300. agctacctca ccaaggcacc cctggtaagc cttttctcct gcatcccggc atcactgcac 3360 tgcgttttgc ttcaatcc ag ccactgatcg tctctcttga aacctgaaca acaggttccc 3420 cctggcacac cggtggtgaa cgctctggcc aagcagacgg cqatgctqga qaacatcatg_ 3480_ agggcatgcg ttgggctggc cccagagaac aacatgatcc tggagtacaa gtgagocaag 3540 tggagt 3546 < 210 > 15 < 211 > 3546 < 212 > DNA < 213 > Zea mays < 400 > 15 ctcgctacct cgcttcgcat tccattcgag gagagcggtg agaggggaqq aaaggcaaga 60 tgttcatcga gagcttccgc gtcgagagcc cccacgtgcg gtacggcccg acggagatcg_ 120 agtcggagta ccggtacgac acgacggagc tggtacacga gggcaaggac ggcgcctcac. 180 gctgggtcgt ccgccccaag tccgtcaagt acaacttccg gaccagaacc gccgtcccca ^ 240 agctcgggta tgtacggatg cagcggccct agcctcactc tctgtgaacc ctcctcctcc 300 cgtgctcagt caaatcctcc gtcgagatca actggtcggc gttccctcct aaatcctaat 360 gaaaatctta ctgctttgcc tgaagacgaa ccgtcgtaat tgttgacagc tacgcacaca 420_ cttgcccatc cggatgcgtc aaatcagctc gatttgaaat tcgattcgat ggtgcccttt 480 tccatatttc gatcatcctt cgcctactgt gcaatgatta cagaaacgtc cctttcctct 540 gaactttgtc ttaggctttt tgtcctgtgc acgtgagctg gtatcaattt gttcatgtaa 600 gatcaaattc cagcagggac gatgagcagc agacagaact cattacgcta goaaattgat 660 actaggatta ctggcaagtg tgcatacggc gcaatctgcc atcctggacc ccctttgttt 720. aattcctgtt cctatgcatg ttgcctacgt gcagctcgtt gtgtgttatg gtgtcaggct 780 gtcagacgct tgtctctgtc tgacggatga tgccaacttt tctgttctgg tggtgcaggg_ 840 tgatgcttgt ggggtgggga ggcaacaacg ggtccacgct gacggctggg gtcattgcca_ 900 gcagggagtg agtagtactt aatttgtcct atattgcttt ccgttgtttt cagttattaa.960_ tggcctgaca gagaactgaa ggctgtttca ttttgttgtt ggggatctca tggccgacca 1020 aggacaagg t gcagcaagcc aactactacg gctcctcacc caggcctcca ccatcagagt 1080 cggoagctac aacggggagg agatctatgc gccgttcaag agcctccttc ccatggtaat 1140 ctattataga cttgactaat actcttcttt ttactgaaac taacaaagca caaacataca 1200 tattccgtaa ggtgctagtt gatgttataa agtgaacatg tctttcaggc cagtggtctc 1260 aagtaaacgg aatgttaatc attgggttga aaaaacaaag gttctaattt tgtgaaagga 1320 atgttaaact tagcataatg aaaaggggaa gcattgtaag aaaggtgctg aaacaatcga 1380 ctcggtatgc catgttgtga tcatacttgc aagtcaaaag gttctgtggt tagctcaaag_ 1440 gttccagcat ctttggatta gtattgacga cactcgtgca tggtgctaac tggttgcaga_1500 ^ ttcgcagact cggtgtttgt tatcttcctt tcatgaccaa gtgttgaact ggttttcagg 1560 tgaacccaga cgacattgtg ttcggaggct gggacattag caacatgaac ctggccgact 1620 ccatgaccag ggccaaggtg ctggatattg acctgcagaa gcagctcagg ccctacatgg_ 1680__ agtccatggt gccacttccc cggtatctat gatccggact tcatcgcggc taaccagggc_1740 tctcgcgcca acagtgtcat caagggcacc aagaaagaac aggtggagca gatcatcaag 1800__ gatatcaggt atatggatat ggatgctaac gtgccttggt gctaaggtgc acccagtgca ^ 1860 acctaaa aca aataaatact actatgaatt tggtaaatat acátac tat cagaacatat 1920 tgtttaaccg gtgcacttag aagtctgcat ggtatgttgg acaatttgac attcgatata 1980 tcacttgcat cagtgaccgc gaggactcca caaagaacta aaactactga aagcttaagc 2040 aactattcgt agctaatgat gratttggtg gacatggttt gaagatctag attaacgtgg_2100 __ ttgaagaaat atggttcact atccattaca agcataagta gaagctatgg cttatgtagc 2160 gggagtttaa taatguaaca ggagaagaac aaagtggaca agatagttgt gttgtggact 2220__ gcaaacactg aaaggtatag gctggtctca caatgtgtgc acgacacgat ggagaatcta. 2280 _ ctggcatctg tggacaagaa cgaggcggag gtatcaccat caacactata tgccattgcc 2340 tgtgtcatgg agggggtgcc gttcatcaat gggagccccc agaacacctt tgtgcctggt 2400 gcgtggtttg gtgtgtttgc aaaagcttca tggtgttgca tttctgttcc aaagtttcat 2460 ggtgttgtat ttccgttcca aggcttatta tacctgttgc atgttcgtag ggctgattga_ 2520 tcttgctata aaaaacaact gcttgattgg tggtgacgac ttcaagagtg gacagaccaa 2580 gatgaaatct gtcttggtcg atttccttgt tggtgctgga ataaaggtgg gaacctagta_ 2640 ^ tctctcttct attaagatga agtgtttttt tggcaaatga cgttattgca ataactcttc 2700 ta tattttca gcccacctca ttttcatgca atcgtgagct acaaccactt gggaaacaac 2760 acctgtctgc gatggcatga ccttcaaaca ttcaggtcca aggagatctc caagagcaac 2820 gtggtggatg acatggtctc gagcaatgcc atcctctatg agcccggcga gcatcccgat_2880 catgtcgttg tcatcaaggt ctgttagctg atctttcacc tcgttaaaag ttgacatatg 2940 caaggcagat ttacattgaa acttgtcact cttttgttgc agtatqtgcc gtacgtggga 3000 gggctatgga gacagcaaga cgagtacacc tcagagatct tcatgggcgg caagaacacc 3060 atcgtgctgc acaacacctg tgaggactcg ctcctcgccg cacctatcat ccttgatctg 3120 gtgctcttgg ctgagctcag caccaggatc cagctgaaag ctgagggaga ggtaagagcc 3180 ttaacctgaa ccccaagtga agcacgctgc acgctaggtg atatagcact tttaatacct_3240 tctggtgtct ctcttatgca ggacaaattc cactccttcc acccggtggc caccatcctg 3300 agctacctca ccaaggcacc cctggtaagc cttttctcct gcatcccggc atcactgcac 3360 tgcgttttgc ttcaatccag ccactgatcg tctctctcga aacctgaaca acaggttccc 3420 cctggcacac cggtggtgaa cgctctggcc aagcagacgg cgatgctgga qaacatcatg 3480 agggactgcg ttgggctggc cccagagaac aacatgatcc tggagtacaa qtgagocaag 3540 tggcgt 3 546 < 210 > 16 < 211 > 1070 < 212 > DNA < 213 > Zea mays < 400 > 16 cggcacgagg ttgcgggcga accgaaaatc acgggcgcga gagatcggag cacggcatgt 60 cggaggagca gttcctcgcc gtggcggtgg aagccgccaa gagcgccggc gagattattc 120 gcaagggatt ctaccagacc aagaacgtcc agcacaaggg ccaggtggat ttggtgacgg 180 agacggacaa ggcctgcgag gacctcatct tcaaccacct ccggaagcac ttcccggacc 240 acaagttcat cggggaggag gagtccgcgg cgctcggggc caccgctgac ctcaccgacg 300 accccacctg gatcgtcgat cccctcgacg ggaccactaa tttcgtccat ggtttcccat 360 ttgtatgtgt ctccgttggc ctcaccattg ggaaaattcc gtcgtcttca cactgtcgga. 420 accccatcat gaacgaactt ttcacggcgg ttcgtggaaa aggggctttc ctqaatqgct 480 ctccaattaa agcatcatct caagatgagt tagtgaaggc tcttctggta acagaggctg_ 540_ gaaccaatag agacaagacc actgtggatg atacaaccaa cagaatcaac aggctactat 600 acaagattcg atccatacgg atgtgtggat cattggcttt aaacatgtgt ggajjttgcct 660 gtggtagact agatttgtgt tatgagatag gatttggtgg tccatgggat gttgctgct 720 gtgctgtaat tcttcaggaa gccggtggcc ttgtttttga cccaagcggc ggagagtttg_ 780 atttgatgtc gcgaagaatg gcaggatcaa acagcttgct gaaggataag ttcgtcaagg ^ 840 aactggggga tactaattga aacaaatgtt agtattattc gtggaacaga ttaagacaat 900. aaggttgccc cgccgcatgg tgattaactt attgtttggg caacaaaatt ccatgtaatt 960_ ctgcacctgt acaactatgt tggacgcaga acattttatt gagttttgtg attacatggg 1020 aatacatagg ttgaggcaac ggtccctact ttaaaaaaaa aaaaaaaaaa 1070 < 210 > 17 < 211 > 267 < 212 > PRT < 213 > Zea mays < 400 > 17 Met Ser Glu Glu Gln Phe Leu Wing Val Wing Val Glu Wing Wing Lys Ser 1 5 10 15 Wing Gly Glu He He Arg Lys Gly Phe Tyr Gln Thr Lys Asn Val Gln 20 25. 30 His Lys Gly Gln Val Asp Leu Val Thr Glu Thr Asp Lys Ala Cys Glu 35 40 45 Asp Leu He Phe Asn His Leu Arg Lys His Phe Pro Asp His Lys Phe 50 55 60 He Gly Glu Glu Glu Be Ala Ala Leu Gly Ala Thr Ala Asp Leu Thr 65 70 75"H 80 Asp Asp Pro Thr Trp He Val Asp Pro Leu Asp Gly Thr Thr Asn Phe 85 90 95 Val His Gly Phe Pro Phe Val Cys Val Ser Val Gly Leu Thr He Gly 100 105 110 Lys He Pro Thr Val Val Val Val Phe Asn Pro Met He Met Asn Glu Leu 115 120 125 Phe Thr Ala Val Arg Gly Lys Gly Ala Phe Leu Asn Gly Ser Pro He 130 135 140 Lys Wing Being Ser Gln Asp Glu Leu Val Lys Wing Leu Leu Val Thr Glu 145 150 155 _. 1160 Wing Gly Thr Asn Arg Asp Lys Thr Thr Val Asp Asp Thr Thr Asn Arg 165 170 _ 175 He Asn Arg Leu Leu Tyr Lys He Arg Be He Arg Met Cys Gly Ser 180 185 19Q Leu Ala Leu Asn Met Cys Gly Val Wing Cys Gly Arg Leu Asp Leu Cys 195 200 205 Tyr Glu He Gly Phe Gly Gly Pro Trp Asp Val Wing Wing Gly Wing Val 210 215 220 He Leu Gln Glu Wing Gly Gly Leu Val Phe Asp Pro Ser Gly Gly Glu 225 230 235 l- T. H ^ 240 Phe Asp Leu Met Ser Arg Arg Met Wing Gly Ser Asn Ser Leu Leu Lys 245 250 Asp Lys Phe Val Lys Glu Leu Gly Asp Thr Asn 260 265 < 210 > 18 < 211 > 25 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > starter < 400 > 18 acgaggttgc gggcgaaccg aaaat 25 < 210 > 19 < 211 > 23 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > starter < 400 > 19 tagggaccgt tgcctcaacc tat 23

Claims (27)

1. CLAIMS 1. An isolated polynucleotide characterized in that it comprises a member selected from the group consisting of: (a) a polynucleotide that encodes a polypeptide comprising SEQ. FROM IDENT. NOS .: 2, 6, 11, 17 or complements thereof; (b) a polynucleotide of at least 25 nucleotides in length that selectively hybridize under stringent conditions to a polynucleotide of SEQ. FROM IDENT. US: 1, 5, 7, 10, 14, 15, 16 or a complement thereof, wherein the hybridization conditions include a washing step at 0. IX SSC at 60 ° C; (c) a polynucleotide having one. sequence of an extended nucleic acid from a library of. nucleic acid Zea mays using the primers of the SEC, DE IDENT. .NOS .:. 3-4, 8-9, 12-13, or 18-19; (d) a polynucleotide having at least 75% of the identity sequence to SEC. FROM IDENT. NO .: 1, at least 60% of the sequence of identity to the. SEC. FROM IDENT. NO .: 5, at least 80% of the sequence of identity to the SEC. FROM IDENT. NO .: 10, or at least 70% of the SEC's identity sequence. FROM IDENT. NO .: 16, where the% of the identity sequence is based on the complete coding reqión and is determined by the GAP program where the penalty of creation of space = 50 and the penalty of extension of space = 3; and (e) a polynucleotide comprising at least 20 contiguous bases of the polynucleotide of (a) to (d), or complement thereof.
2. 2. The polynucleotide according to claim 1, characterized in that the polynucleotide is DNA.
3. 3. The polynucleotide according to claim 1, characterized in that the polynucleotide is RNA
4. 4. The polynucleotide according to claim 2, characterized in that it comprises SEQ. FROM IDENT. NOS .: 1, 5, 7, 10, 14, 15, 16 or a complement thereof.
5. 5. The isolated corn polynucleotide encoding phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3, myo-inositol 1,3, 4-triphosphate 5/6 kinase or myo-inositol 1-phosphate synthase.
6. 6. The vector characterized in that it comprises the DNA according to claim 2.
7. 7. The expression cassette, characterized in that it comprises the polynucleotide according to claim 1, operably linked to a promoter.
8. 8. The expression cassette according to claim 7, characterized in that the nucleic acid is operably linked in antisense orientation to the promoter.
9. 9. The host cell characterized in that it comprises the vector according to claim 6.
10. 10. The process for the production of a polypeptide of phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3, myo-inositol 1, 3, 4-triphosphate 5/6 kinase or mlo-inositol 1-phosphate synthase characterized in that it comprises: culturing the host cell according to claim 9 under conditions sufficient for the expression of the polypeptide encoded by the host cell and recovering the polypeptide already produced.
11. 11. The process for the production of a cell that expresses a polypeptide of phosphatidylinositol 3-kinase, io- "inositiol monophosphatase-3, myo-inositol 1, 3, 4-triphosphate 5/6 kinase or myo-inositol 1-phosphate synthase characterized in that it comprises transforming or transfecting the cell with the vector according to claim 6, such as the cell expressing the polypeptide encoded by the cDNA contained in the vector
12. 12. An isolated polypeptide characterized in that it comprises an amino acid sequence that has at least an 80% identity sequence to SEQ ID NO: 2, at least 35% of the identity sequence to SEQ ID NO: 6, at least 90% of the sequence of identity to the SEQ ID NO: 11 or at least 80% of the identity sequence to SEQ ID NO: 17, wherein the% identity sequence is based on the complete sequence and is determined by the program "GAP where the penalty of creation d e space = 12 and the space extension penalty = 4.
13. 13. The isolated polypeptide according to claim 12, characterized in that it has at least 85% of the identity sequence to the SEC. FROM IDENT. NO .: 2 and a deduced molecular weight of approximately 94.1 kDa.
14. 14. The polypeptide isolated according to claim 12, characterized in that it has at least 40% of the identity sequence to SEC. FROM IDENT. DO NOT. : 6, and a deduced molecular weight of approximately 41.3 kDa.
15. 15. The isolated polypeptide according to claim 12, characterized in that it has at least 95% of the identity sequence to SEC. FROM IDENT. NO .: 11 and a deduced molecular weight of approximately 59.7 kDa.
16. 16. The isolated polypeptide according to claim 12, characterized in that it has at least 85% "" of the identity sequence to the SEC. FROM IDENT. NO .: 17 and a deduced molecular weight of approximately 31.2 kDa.
17. 17. The isolated polypeptide according to claim 12, characterized in that it comprises the sequence of SEQ. FROM IDENT. NOS .: 2, 6, 11 or 17.
18. 18. The antibody against the polypeptide according to claim 12. -
19. 19. The antagonist that inhibits the activity of the polypeptide according to claim 12.
20. 20. The transgenic plant transformed with the DNA according to claim 2.
21. 21. The plant according to the claim 20, further characterized in that it has a decreased level of phytic acid when compared to a non-transformed parental plant.
22. 22. The plant according to claim 20, further characterized in that it has an increased level of non-phytic acid phosphorus when compared to "a non-transformed parent plant."
23. 23. The seed produced by the plant according to claim 20.
24. 24. The transgenic plant cell transformed with the DNA according to claim 2.
25. 25. An isolated polynucleotide characterized in that it comprises a member selected from the group consisting of (a) a polynucleotide of at least 25 nucleotides in length that selectively hybridize under stringent conditions to a polynucleotide of SEQ ID NOS: 20-31 or a complement thereof, wherein the hybridization conditions include a washing step in 0.1X SSC at 60 ° C; polynucleotide having at least 80% of the identity sequence to SEQ ID NOS: 20-31, wherein the% identity sequence is based on the region coding mpleta and is determined by the GAP program where the penalty of creation of space = 50 and the penalty of extension of space = 3; and (c) a polynucleotide comprising at least 20 contiguous bases of the polynucleotide of (a) or (b), or complement thereof.
26. 26. The polynucleotide according to claim 2, characterized in that it comprises SEQ. FROM IDENT. NOS .: 20-31 or a complement thereof.
27. 27. A method for improving the animal performance comprising feeding plants and parts of plants to animals.