MX2011004154A - Derived proteins from cry genes of bacillus thuringiensis. - Google Patents

Abstract

Combinations of Bacillus thuringiensis (Bt) proteins and nucleic acids encoding these Bt proteins are disclosed. Plants transformed with nucleic acids encoding these Bt proteins are also disclosed.

Description

Proteins derived from Cry genes of Bacillus thuringiensis Field of the invention.

The field generally refers to plants and disease resistance, and more specifically, to insecticidal treatments, compositions or formulations of insecticides, insecticidal proteins and transgenic plants that produce insecticidal proteins.

BACKGROUND OF THE INVENTION Insects and pests cost farmers billions of dollars a year in crop losses and costs to keep these pests under control. The losses caused by pests in agricultural production environments include the decrease in crop yields, the reduction of crop quality and the increase in collection costs.

The coffee berry borer (Hyphotenemus hampei Ferrari) is the most economically important pest in coffee plantations and is located in all coffee growing areas of the world. The insect attacks the fruits during its life cycle, which results in a significant loss in the quality and volume of the harvest. No sources of resistance to H. hampei are known in coffee germplasm (neither in the Coffea arabica nor in the Coffea canephora). The synthetic insecticide endosulfan can be used for the control of H. hampei, but is banned in many countries because it is very toxic to humans and non-target animals, including insects, birds, fish and amphibians. On the other hand, insects can develop resistance to insecticides.

Cotton has great global economic interest. It is grown in more than 60 countries around the world. Five countries - China, India, Pakistan, the United States and Uzbekistan - represent 75% of production, 71% of cultivated area and 70% of consumption.

The cotton plant is attacked by several arthropods, including whitefly, cotton boll and mites. Among the insect pests most damaging to cotton are the cotton weevil (Anthonomus grandis (Coleoptera: Curculionidae)) and the black worm Spodoptera frugiperda (Lepidoptera: Noctuidae). The weevil is distributed throughout the United States, Mexico, Central America, Cuba, Haiti, Venezuela, Colombia, Argentina, Paraguay, Africa, China and Brazil. Normally, the control of this insect is achieved through the massive use of chemical pesticides.

For many reasons, the use of environmentally sensitive methods for the control or eradication of insect infestation is desirable. The most widely used environmentally sensitive developed insecticide formulations in recent years have been gates of microbial pesticides derived from Bacillus thuringiensis bacteria. B. thuringiensis is a Gram-positive bacterium that produces crystal proteins or inclusion bodies that are particularly toxic to certain orders and insect species. It has been shown that many strains of B. thuringiensis produce crystal insecticide proteins, which are very toxic to a specific target insect, but harmless to plants and other non-target organisms. The identity of the primary sequence forms the basis of the crystal protein groups and also of their nomenclature.

Summary of the invention.

The present disclosure provides a composition that can be used to control an insect infestation in plants, particularly in crops of economic importance such as coffee and cotton. The composition consists of at least two crystal polypeptides selected from SEQ. ID. Nos .: 1 (cytl), 3 (cry4A), 5 (cry4B), 7 (cry10), 9 (cry1 1), 1 1 (cyt2) and 13 (cry3), polypeptides having at least 90% identity with SEQ. ID. Nos .: 1 (cytl), 3 (cry4A), 5 (cry4B), 7 (cry10), 9 (cry11), 1 1 (cyt2) and 13 (cry3), or processed crystal proteins. Particularly disclosed are compositions comprising SEQ. ID. Nos .: 3 (cry 4A) and 5 (cry4B); I KNOW THAT. ID. Nos. 1 (cytl) and 7 (cry10), or SEQ. ID. Nos. 1 (cytl), 3 (cry 4A) and 5 (cry4B). In addition, the compositions may comprise polypeptides with at least 90% amino acid identity with SEQ. ID. DO NOT. 3 (cry4A) and with SEQ. ID. DO NOT. 5 (cry4B), or at least 90% amino acid identity with the SEQ. ID. DO NOT. 1 (cytl) and with the SEQ. ID. DO NOT. 7 (cry10), or at least 90% amino acid identity with the SEQ. ID. DO NOT. 1 (cytl), with SEQ. ID. DO NOT. 3 (cry4A) and with SEQ. ID. DO NOT. 5 (cry4B). The compositions may further comprise an insect attractant. The compositions can be used to kill insects, such as Coleoptera and Diptera, and to control insect infestations in plants. Some plants of interest include Coffea arabica, Coffea robusta, Coffea canephora, Saccharum officinarum, Elaeis guineensis, Gossypium hirsutum, Gossypium barbadense, Gossypium arboretum and Gossypium herbaceum. Insects of interest include Hyphotenemus hampei (coffee borer), Metamasius hemipterus (sugarcane borer), Aedes aegypti (mosquito), Rhynchophorus palmarum (American weevil), Ips sexdentatus (six-tooth borer), Tomicus piniperda ( barrenillo of the shoots of the pine), Orthotomicus erosus.

The present disclosure also details host cells comprising an expression vector comprising the nucleic acid sequence encoding at least two of the aforementioned crystal polypeptides (which include polypeptides with 90% sequence identity and processed polypeptides). Host cells may have two or more expression vectors, each composed of a sequence encoding a crystal polypeptide or a vector of unique expression that encodes two or more crystal polypeptides. Among the suitable host cells are B. thuringiensis, Spodoptera frugiperda, or plant cells.

Also described are transgenic plants comprising nucleotide sequences encoding at least two crystal polypeptides. Some types of transgenic plants include Coffea arábica, Coffea robust, Coffea canephora, Saccharum officinarum, Elaeis guineensis, Gossypium hirsutum, Gossypium barbadense, Gossypium arboretum and Gossypium herbaceum.

Brief description of the drawings.

Figure 1 is a photograph of a polyacrylamide gel (10%) showing the proteins expressed by Bt pS -CAyíO, solubilized in 50mM NaOH, 25mm DTT and 50mM CAPS pH 1.5 (lane 1) and the molecular weight marker ( lane 2). The 68 and 56 kDa bands (arrowheads) correspond to ORF 1 and ORF 2, respectively, of the cry10 operon, cloned in Bt-pS -oym Figure 2 is a diagram summarizing the data presented in the examples.

Figure 3 shows the strategy for obtaining the recombinant virus containing the cry 10Aa gene (vSyncr / 10). Plasmid pGemcry 10 was processed with the Eco Rl enzyme, the cryW gene fragment was cloned into the transfer vector pSynXIVVI + X3, which was previously processed with Eco R1 generating plasmids pSyncry 10 (A). The plasmid pSyncry 10 that was co-transfected (B) with the vSynGalVI virus DNA in Tn5 insect cells, and the recombinant virus vSyncryI O, were purified.

Figure 4 is a graph of the mortality of A. grandis exposed to crystal proteins. The bars represent 95% confidence levels.

Detailed description of the invention.

The description is directed to methods and compositions for the treatment of plants to prevent, reduce or eliminate Coleoptera infestations. A family of coleoptera of interest is the family Curculionidae, which includes the coffee berry borer and the cotton weevil. Plants can be treated with Bacillus thuringiensis crystal proteins, host cells such as 6. thuringiensis or Spodoptera frugiperda that express crystal proteins, or transformed with nucleic acids that encode crystal proteins.

Nucleic acids that encode crystal proteins and crystal proteins.

As used herein, "crystal proteins" refers to any of the Cry and Cyt proteins, including the pro-toxin and toxin forms of the proteins.

In some examples, the nucleic acids encoding the crystal proteins and the crystal proteins are isolated from B. thuringiensis var. Israelensis, a well-known variety. B. thuringiensis serovar israelensis produces an array of active proteins against insects. These crystal proteins are encoded in a single large plasmid, pBtoxis. The main para-spore crystal components of this variety are: Cry4Aa, Cry4Ba, Cry1 1Aa and CytlAa (Crickmore, N, et al., Revision of the nomenclature for Bacillus thuringiensis, crystal pesticide proteins, Microbiology and Molecular Biology Review. : 807-813, 1998), while small amounts of CryI OAa are also present (Guarduno, et al., Applied and Environmental Microbiology, 277-279, 1988) and Cyt2Ba (Guerchicoff, A. et al., Identification and characterization. of a previously undescribed cyt gene in Bacillus thuringiensis subsp. israelensis, Applied and Environmental Microbiology 63 (7): 2716-2721, 1997) are also present. The production of proteins encoded by the cytICa gene has not yet been detected in the crystals, although this gene seems to have been transcribed (Stein, C, et al., Transcriptional Analysis of the Toxin-Coding Plasmid pBtoxis from Bacillus thuringiensis subsp. Israelensis Applied and Environmental Microbiology 72 (3): 1771-1776, 2006).

Other varieties of B. thuringiensis that express toxins of the israelensis type may also be used. These toxins would have amino acid sequences and activities similar to the toxins produced by B. thuringiensis var. Israelensis For example, it has been reported that isolates of B. thuringiensis from var. morrisoni serotype 8a, 8b express toxins type B. thuringiensis var. Israelensis As used herein, the term "B. thuringiensis var. Israelensis toxin" includes toxins that are similar or that are related to toxins expressed by B. thuringiensis var. israelensis, but they happen to be expressed by a different variety of Bacillus thuringiensis.

Equivalent crystal proteins and / or nucleic acid sequences encoding these proteins can be derived from other B. thuringiensis isolates and / or DNA libraries by the teachings provided herein. There are a number of methods for obtaining the pesticidal toxins of the present invention. For example, antibodies against pesticidal toxins can be used to identify and isolate other toxins from a protein mixture. Specifically, the antibodies can reach portions of the toxins that are the most constant and distinctive of other B. thuringiensis toxins. These antibodies can then be used to identify equivalent toxins with the characteristic activity by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), or by Western blot. Antibodies to toxins or to equivalent toxins, or fragments of these toxins, can be easily prepared by conventional methods in this art. The genes that code for these toxins can then be obtained from the microorganism.

The complete sequence of pBtoxis is in GenBank (access number AL731825). The amino acids and the nucleotide sequences of the crystal proteins and the gene sequences of this plasmid can be found in the sequence list: cytl (SEQ ID NOS .: 1 and 2); cry4A (SEQ ID NOS .: 3 and 4); cry4B (SEQ ID NOS .: 5 and 6); cry10 (SEQ ID NOS .: 7 and 8); and cry 1 1 (SEQ ID NOS .: 9 and 10). Links to the crystal protein sequences of other strains of Bacillus thuringiensis can be found at http://www.lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/ (table 1).

Table 1 In summary, the nucleotide sequences include isolated genomic sequences that encode the pro-toxin form of a crystal protein, as well as the sequences encoding the toxic form of a crystal protein. On the other hand, the sequences can be optimized in their codons for expression in a particular host cell. The amino acids and the nucleic acid sequences may also include additional residues or nucleotides, such as N- or C- termini of amino acids or 5 'or 3' sequences, as long as the protein maintains the biological activity. The addition of extreme sequences is particularly applicable to nucleic acid sequences which may, for example, include several non-coding sequences flanking one of the 5 'or 3' portions of the coding region or may include several internal sequences, i.e. introns .

The nucleotide sequences encoding the crystal proteins can be obtained by a variety of methods. In one method, the nucleotide sequences presented in the Sequence List can be used to design amplification primers. To amplify the entire coding region, the amplification primers will be derived from flanking sequences. Sub-regions of the coding region, for example, the region encoding the mature toxic form of a crystal protein, can also be amplified. The DNA isolated from B. thuringiensis var. israelensis or other B. thuringiensis strains that encode one or more of the same crystal proteins, is then amplified using the desired set of amplification primers. In another method, the cDNA is generated by conventional methodologies and then amplified using sets of primers that hybridize with the transcribed sequences. In yet another method, the DNA of B. thuringiensis is digested with restriction enzyme (s) and fragments cloned in plasmid or phage vectors. Clones containing sequences encoding crystal proteins can be identified, for example, by hybridizing nucleic acids with a probe or a fragment having a complementary sequence. These probes are easily synthesized in automatic synthesizers. The sequences of these probes can be determined from the Sequence List or from GenBank sequences or the like. In yet another method, the nucleotide sequences encoding the crystal proteins can be synthesized, for example, by an automated gene synthesizer.

In addition to the native nucleotides and protein sequences, in certain circumstances, sequence variants may be desirable. With respect to the nucleotide sequences, it will be appreciated that a nucleotide sequence encoding a crystal protein may differ from the wild type sequence, due to codon degenerations, nucleotide polymorphisms or differences in the amino acid. For example, nucleic acid sequences can be prepared to encode the sequence of the peptide described in SEQ. ID. DO NOT. 1 (cytl), SEQ. ID. DO NOT. 3 (cry4A), SEQ. ID. DO NOT. 5 (cry4B), SEQ. ID. DO NOT. 7 (cry10), SEQ. ID. DO NOT. 9 (cry1 1), SEQ. ID. DO NOT. 1 1 (cyt2), SEQ. ID. DO NOT. 13 (cry3). For its application in plants, the use of codons can be optimized for expression. Sometimes, the nucleotide sequences can hybridize to a wild-type nucleotide sequence under normal stringency conditions, which constitutes hybridization and washing conditions of about 25-30 ° C below the Tm of the native duplex (e.g. M Na + at 65 ° C; 5X SSPE, 0.5% SDS, 5X Denhardt's solution, at 65 ° C or equivalent conditions (see, in general, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press , 1987, Ausubel et al., Current Protocole in Molecular Biology, Greene Publishing, 1987.) The Tm for different short oligonucleotides can be calculated by the formula Tm = 81.5 + 0.41% (G + C) - log (Na +). Low stringency hybridizations are carried out under conditions of approximately 40 ° C below the Tm and high stringency hybridizations are performed under conditions of approximately 10 ° C below the Tm In conditions of normal stringency, the nucleic acids that hybridizethey will have approximately at least 75% identity with the wild-type nucleotide sequences. Accordingly, the polynucleotide sequences having at least 75%, 80%, 85%, 90%, 95% or 99% identity with the polynucleotide sequence of SEQ. ID. DO NOT. 2 (cytl), SEQ. ID. DO NOT. 4 (cry4A), SEQ. ID. DO NOT. 6 (cry4B), SEQ. ID. DO NOT. 8 (cry10), SEQ. ID. DO NOT. 10 (cry1 1), SEQ. ID. DO NOT. 12 (cyt2), SEQ. ID. DO NOT. 14 (cry3) and that encode a protein with similar functional activity are useful.

For the expression of a crystal protein, it would be desirable to have nucleic acid sequences that use codons that are preferred in the organism expressing the protein. For example, a nucleic acid sequence expressing CryI OA in plants would have codons that are most likely used in plants. A codon usage database (Nakamura et al., Nucí Acids Res. 28: 292, 2000) is available online at www.kazusa.or.jp/codon/. At the time of this request, your data source is NCBI-GenBank Fiat File Reléase 160.0 (June 15, 2007). Alterations of the nucleic acid sequence to achieve codon optimization can be performed by any of a variety of methods, including site-directed mutagenesis, ligation of overlapping synthetic oligonucleotides and the like.

With respect to the amino acid sequences, the variants may differ from the native sequences by amino acid deletions (at the ends or inside the sequence), additions (at the ends or internally), or alterations of one or more amino acids. The polypeptide sequences that are at least 80%, 85%, 90%, 95% or 99% identical in their coincident length (using a tool such as BLAST) to SEQ. ID. DO NOT. 1 (cytl), SEQ. ID. DO NOT. 3 (cry4A), SEQ. ID. DO NOT. 5 (cry4B), SEQ. ID. DO NOT. 7 (cry10), SEQ. ID. DO NOT. 9 (cry11), SEQ. ID. DO NOT. 1 1 (cyt2), SEQ. ID. DO NOT. 13 (cry3) and have a similar functional activity are useful.

With respect to crystal protein sequences, the protein is initially produced as a protoxin, which is cleaved in vivo to produce an active fragment (i.e., a processed crystal protein, sometimes called delta-endotoxin). Activation involves the proteolytic removal of the N-terminal peptide (approximately 25-30 Cry1 protein residues, approximately 49 residues for Cry2A, approximately 58 residues for Cry3A and CryI OA, approximately 43 for Cry4A and Cry4B, and approximately 28 for Cry1 1A) and approximately half of the remaining C-terminal protein in the case of long Cry proteins (CryIA, Cry4A, Cry4B). On the other hand, internal disruption may occur for some Cry proteins (for example, CryIA, Cry4A, Cry4B, and Cry1 1), but the fragments remain associated and retain toxicity. The Cyt proteins undergo a proteolytic cleavage of small portions of their N-terminal (around 30 amino acids) and C-terminal (around 15 amino acids) to activate the toxin (table 2). The active parts of the crystal proteins and the nucleic acids encoding them could be desirable. The nucleic acid segments, regardless of the length of the coding sequence itself, can be combined with other nucleic acid sequences, such as promoters, Shine-Dalgarno sequences, initiation codons, polyadenylation signals, additional sites for restriction enzymes, sites of multiple cloning, other coding segments and the like. If desired, peptides and fusion proteins can also be prepared, for example, where the coding regions of the peptide are aligned within the same expression unit with other proteins or peptides having the desired functions, such as purification or for purposes of immunodetection (for example, proteins that can be purified by affinity chromatography and enzyme-labeled coding regions, respectively) or for increased expression.

Often a number of marker sequences are used for these purposes; these sequences include: His-tag (e.g., His6); T7-tag, S-tag, FLAG peptide, thioredoxin, lacZ, glutathione S-transferase, and the like (RC Stevens, "Design of high-throughput methods of protein production for structural biology Structure", 8, R177-R185, incorporated in its entirety to this document).

Table 2 Mature protein Amino acids Protein Size important for Cutting sites approximate biological activity Gly58-Lys695 60 KDa Cry4Aa Two fragments: Tyr-202 Gly58-Gln236- 20 KDa and Lys695 45 KDa Arg-158, Asn-166, Tyr-170, Pro389, Ser410, Cry4Ba Asn36 and Gln677 Glu417, Tyr455, Asn456 Ser10 and Lys643 70 KDa 36 KDa (First Ser259 and Glu266, sites Ser10-Arg 360 fragment) important for Cry1 1Aa 32 KDa synergy with CytlAa.

Asp361-Lys643 (Second From Gly257 to Arg360 fragment) Lys45- Lys643 CryI OAa 58 KDa (Prediction) Variations in nucleotide sequences can be easily constructed using conventional techniques, such as methods for generating point mutations or by synthesis. In addition, fragments of these genes can be obtained using commercially available exonucleases or endonucleases. For example, enzymes such as Bal31 can be used to systematically remove the nucleotides at the ends of these nucleic acids. In addition, sequences encoding active fragments can be obtained using a variety of restriction enzymes. Proteases can be used to directly obtain active fragments of these toxins.

In addition to its use for directing the expression of crystal proteins or peptides, the nucleic acid sequences described herein have a variety of other uses. For example, they can be used as probes or primers in nucleic acid hybridizations and amplifications. Oligonucleotides for the amplification of the long-chain cDNA are usually derived from sequences at the 5 'and 3' ends of the coding region. Amplification of genomic sequences will use primers that expand alternative intron / extron sequences and can use conditions that favor long amplification products (see Promega's catalog). Briefly, the oligonucleotides used as amplification primers preferably do not have self-complementary sequences, nor do they have complementary sequences at their 3 'end (to prevent the formation of primer dimers). Preferably, the primers have a GC content of about 50% and contain restriction sites to facilitate cloning. In general, the primers are between 15 and 50 nucleotides long and more generally between 20 and 35 nucleotides long. The primers are aligned to the cDNA or genomic DNA and sufficient amplification cycles are performed to generate a detectable product, preferably one that is easily visualized by gel electrophoresis and staining. The amplified fragment is purified and inserted into a vector (e.g., a viral, phagemid or plasmid vector) and propagated.

Oligonucleotides for hybridization analysis (eg, Southern, Northern, library selection) can be designed based on the DNA sequence of the crystal proteins described herein. Oligonucleotides for selection are typically at least 1 1 bases in length and more generally at least 20 or 25 bases in length or 20-30 bases in length. This oligonucleotide can be synthesized in an automated manner.

Alternatively, the DNA fragments encoding a crystal protein can be used. The fragments can be any size, but usually they are from a couple of hundred to a thousand base pairs. Fragments can be obtained by a variety of methods, including restriction or amplification enzymatic digestion and isolation of a suitable fragment. To facilitate detection, the oligonucleotide or fragment can be conveniently labeled, in general, at the 5 'end, with a reporter molecule, such as a radionuclide (eg, 32P), an enzymatic tag, a protein tag, a fluorescent tag or biotin. Hybridization conditions are adapted to the length and GC content of the oligonucleotide or fragment. After denaturation, neutralization and DNA fixation to the membrane, the membranes are hybridized with the labeled probe. Suitable hybridization conditions can be found in Sambrook et al., Supra, Ausubel et al., Supra, and, in addition, the hybridization solutions may contain additives such as tetramethylammonium chloride or other chaotropic reagents or hibotropic reagents to increase specificity of hybridization (see, for example, PCT / US97 / 17413). After hybridization, suitable detection methods reveal the hybridization of DNA or colonies or phages that are isolated and propagated. The candidate clones or amplified fragments can be verified as containing the DNA encoding the crystal protein by any of the various means. For example, candidate clones can be hybridized with a second non-overlapping probe or subjected to DNA sequence analysis. In this manner, clones containing a gene or crystal gene fragment, which are suitable for use in the present invention, are isolated.

Recombinant expression of crystal proteins.

Nucleotide sequences that encode crystal proteins, including protoxin forms, toxin forms and other variants, can be used to transform a host. The expression of recombinant crystal proteins can be in plants, for example, cotton or coffee, in bacteria, for example, Bacillus, bacteria that associate with plants, bacteria used for high-level expression in insects or in other organisms. Microorganisms can express an individual crystal protein or multiple crystal proteins. When an organism expresses multiple crystal proteins, the coding sequences can be located in a single vector or the coding sequences can be located in separate vectors. In some cases, more than one crystal protein coding sequence will be incorporated into the genome of the transformed host cell. In certain circumstances, it may be desirable to have one, two, three, four or even more crystal proteins of B. thuringiensis expressed in the transformed transgenic organism. Of particular interest is the expression of crystal protein combinations Cry4A plus Cry4B, Cyt1 plus Cry10, and Cyt1 plus Cry4A plus Cry4b. Optionally, other transgenes can be introduced into the host cell to confer additional phenotypic traits to the host. As examples, but not limited thereto, said transgenes may confer resistance to one or more insects, bacteria, fungi, viruses, nematodes or other pathogens, may metabolize a chemical or may increase yield.

Regardless of the organism, the architecture of the vector is similar. A region encoding a crystal protein (either the protoxin, toxin or other variant form) is operably linked to a promoter. Depending on the profile of the desired expression, the promoter can be constitutively active, inducible, temporarily activated, or activated in specific cell types. Generally, the promoter will be heterologous, which is one not normally associated with a crystal protein gene. Promoters can include promoters who they are usually associated with other genes and may be isolated from any bacteria, viruses, eukaryotes, or plant cells. Naturally, it is important to employ a promoter that effectively directs the expression of the DNA segment in the cell, organism or even animals, chosen for expression.

Other common elements that can be part of the vector architecture include a transcription terminator region, selection markers, origin of replication, enhancers, polylinkers, introns, or even sequences of genes that have a positive or negative regulatory activity on the sequence cloned that encodes a crystal protein.

The proteins thus produced can be used in situ which are used by the host which expresses the proteins or can be isolated. The crystal proteins can be isolated by standard protein purification techniques such as size separation, affinity chromatography, other chromatography techniques or by methods for enriching and isolating the crystals, such as those described in the Examples.

Expression in plants.

Various production methods of transgenic plants are well known in the art. In common with these methods, an appropriate host cell of the plant is transformed with a vector comprising a promoter operably linked to a region encoding one or more crystal proteins. For agricultural applications, the vectors must be functional in plant cells. Suitable plants are those susceptible to Coleoptera infestation and include, but are not limited to, coffee, cotton, wheat, rice, corn, soybeans, lupins, vegetables, potatoes, cañola, walnuts, cassava, yams, alfalfa and other plants. forages, cereals, legumes, etc. In some circumstances, the hosts are coffee and cotton, and the main problems of coleoptera are the coffee berry borer and the cotton weevil.

Vectors that are functional in plants include binary plasmids derived from Agrobacterium plasmids, other plasmids, cosmids, phages, phagemids, baculoviruses, viruses, virions, BACs (bacterial artificial chromosomes) and YACs (yeast artificial chromosomes). These vectors are capable of transforming plant cells. The binary vectors contain left and right border sequences that are required for integration into the host chromosome (plant). The vectors also usually contain a bacterial origin of replication for propagation in bacteria.

A nucleotide sequence encoding a crystal protein must be operably linked to a promoter that is functional in a plant cell. Normally, the promoter is derived from a gene of the host plant, but promoters of other plant species and other organisms, such as insects, fungi, viruses, mammals, etc., may also be suitable and, sometimes, preferred. The promoter can be constitutive or inducible, or it can be active in a specific tissue or tissues (tissue-specific promoter), in a specific cell or in cells (cell-specific type promoter), or in a certain stage or stages of development (development-specific promoter). The choice of a promoter depends, at least in part, on the application. Many promoters have been identified and isolated. Examples of constitutive promoters include the CaMV 35S promoter (US5352605), opine promoters (e.g., US5955646), plant ubiquitin promoters (e.g., US5510474), the rice actin 1 promoter (e.g., US5641876). Examples of inducible promoters are: the alcohol dehydrogenase promoter (e.g., US6605754), tetracycline-regulated promoters (e.g., US5851796), spheroidal-regulated promoters (e.g., mammalian glucocorticoid receptor promoters - US5512483; ecdysone receptors -US6379945), metal-regulated promoters (e.g., metallothionein promoter -US4940661), protein promoters related to pathogenesis (e.g., US5654414, US5689044), temperature regulated promoters (e.g. heat -US5447858, cold-inducible promoters - US6479260), the light-inducible promoter (US5750385). Some examples of the many types of tissue-specific promoters include root promoters (e.g., US2001 / 047525), fruit promoter (e.g., US4943674), and seed-specific promoters (e.g., EP255378B2, US5420034). Other promoters can be found in gene databases (see, in general, the GenBank and EMBL databases) or can be isolated by well-known methods. For example, a genomic clone of a particular gene can be isolated by hybridization with probes and its identified and isolated promoter region.

For expression in plants or other eukaryotic cells, an intron sequence will improve expression. The introns can be from genes of the host cell type or synthetic. Some introns enhance the expression levels of genes (e.g. WO06 / 094976). Many different introns are used in art. Some of them include introns of catalase from castor, corn tubA 1, Adh1, Sh1, UbH, and petunia rbcS.

In general, the vector contains a selection marker for the identification of transformants. It is often desirable that the selection marker confers a growth advantage under suitable conditions. Often, selection markers are drug resistance genes, such as neomycin phosphotransferase. Other drug resistance genes are known to those who work in the art and can be easily replaced. Selection markers include resistance to ampicillin, resistance to tetracycline, resistance to kanamycin, resistance to chloramphenicol and the like. The preferential selection marker also has a constitutive or inducible promoter and a terminator sequence attached, including a polyadenylation signal sequence. Other selection systems, such as positive selection can be used alternatively.

A general vector suitable for use in the present invention is based on pCAMBIA 1305.2. Other vectors have been described (US4536475, US5733744, US4940838, US5464763, US5501967, US5731 179) or can be constructed based on the orientations presented herein. The plasmid contains a left and a right border sequence for integration into the chromosome of the host plant and also contains a bacterial origin of replication and selection markers. These edge sequences flank two genes. One is a kanamycin resistance gene (neomycin phosphotransferase), controlled by a nopaline synthase promoter and utilizes a polyadenylation site nopaline synthase. The second one is the E. coli gus gene (reporter gene) under the control of the CaMV 35S promoter and polyadenylated using the polyadenylation site of nopaline synthase. The E. coli gus gene is replaced by a gene that encodes a gus fungoid gene, particularly one that breaks cellobiuronic acid. If appropriate, the CaMV 35S promoter is replaced by a different promoter. Any of the expression units described is, in addition, inserted or inserted instead of the CaMV promoter and the gus gene.

Plants can be transformed by any of several methods. For example, plasmid DNA can be introduced by Agrobacterium co-culture (e.g., US5591616, US440838) or bombardment (e.g., US4945050, US5036006, US5100792, US5371015). Other transformation methods are electroporation (US5629183), CaP04 mediated transfection, gene transfer to protoplasts (AU B600221), microinjection and the like (see, Gene Transfer to Plants, Ed. Potrykus and Spangenberg, Springer, 1995, for procedures). In part, the choice of transformation methods will depend on the plant to be transformed. The tissues can be efficiently infected alternatively by Agrobacterium using a projectile or bombardment method. Bombardment is often used when bare DNA, usually Agrobacterium binary plasmids or pUC-based plasmids, are used for transformation or transient expression.

Other transformation methods are applicable such as the transformation of the pollen tube, which method is incorporated by reference herein (US2006 / 0294619). For example, the methods of Sano et al., As shown in US6392125, incorporated herein by reference, teaches the method for producing stable transformants of coffee plants; the transformants of coffee plants that are produced from embryogenic calluses, using the Agrobacterium method. In addition, US6392125 (Sano et al.) Describes the method of modifying the characteristics of a plant, in particular tolerance or resistance to diseases. In addition, the invention can be applied to a variety of alternative H. hampei hosts.

The presence and expression of the crystal protein are conveniently assayed in whole plants or in tissues selected by a biochemical method such as amplification, Western blot, identification of crystals by microscope, Northerns, Southems, etc. Bioassays can be used alternatively or additionally.

In addition, transgenic plants can be reproduced or used for breeding introgression. The offspring and seeds of the plants will have a transgene encoding the crystal protein stably incorporated in their genome and said plants of the progeny will inherit the characteristics provided by the introduction of a stable transgene.

Expression in bacteria.

The genes encoding the toxin hosted by the isolates described herein can be introduced into a wide variety of microbial hosts. With suitable microbial hosts, for example, Pseudomonas, the microbes can be applied to a niche of the pest where the microbes proliferate and be ingested by the pest, resulting in the control of the pest. Alternatively, the microbe that hosts the sequence encoding a crystal protein can be treated under conditions that prolong the activity of the toxin and stabilize the cell. The treated cell that maintains the toxic activity can then be applied to the environment of the target pest.

When the B. thuringiensis toxin gene is introduced through a suitable vector in a microbial host and said host is applied to the environment in a live state, it is convenient to use certain host microbes. For example, host microorganisms that are known to occupy the habitat of the pest may be selected. The host microorganisms can also live in symbiosis with a certain species of the coffee berry borer.

These microorganisms are selected to be able to successfully compete in the particular environment with wild-type microorganisms, providing stable maintenance and expression of the gene expressing the pesticidal polypeptide and, ideally, to provide greater protection to the pesticide from degradation. and environmental inactivation.

There is a wide variety of ways available to introduce a B. thuringiensis gene that encodes a toxin in host microorganisms under conditions that allow stable maintenance and expression of the genes. These methods are well known to those skilled in the art and are described, for example, in US5135867, which is incorporated herein by reference.

In one method, plasmids are used. For the expression of a crystal protein, a promoter is used that is designed for the expression of the proteins in the bacterial host. Suitable promoters are widely available and are well known in the art. They are Preferred are inducible or constitutive promoters. Such promoters for expression in bacteria include the T7 phage promoters and other phages, such as T3, T5 and SP6, and the trp, Ipp and lac operons. Hybrid promoters (see US4551433) such as tac and trc, may also be used. For the expression of the protein, a promoter is inserted in the operative link with the coding region. On the other hand, the promoter can be controlled by a repressor. In some systems, the promoter can be de-repressed by altering the physiological conditions of the cell, for example, by adding a molecule that binds competitively to the repressor, or by altering the temperature of the growth medium. Preferred protein repressors include, but are not limited to, the LACI repressor of E. coli that responds to the induction of IPTG, the repressor? Icl857 sensitive to temperature, and the like. The LACI repressor of E. coli is preferred.

Other elements of the vectors include a transcription termination sequence and an origin of replication. Thus, for bacterial hosts, the vector generally contains a bacterial origin of replication. Such origins of replication include the origins of replication f1 and col E1, particularly the origin derived from pUC plasmids.

The plasmids also preferably include at least one selection gene that is functional in the host. A selection gene includes any gene that confers a phenotype to the host that allows the transformed cells to be identified and grown selectively. Suitable genes as selection markers for bacterial hosts include the ampicillin resistance gene (Ampr), the tetracycline resistance gene (Tcr) and the kanamycin resistance gene (Kanr). Suitable markers for eukaryotes usually complement a deficiency in the host (eg, thymidine kinase (tk) in hosts). However, drug markers are also available (eg, resistance to G418 and resistance to hygromycin).

A skilled artisan recognizes that there is a wide variety of vectors suitable for expression in bacterial cells and that they are readily obtainable. Vectors such as the pET series (Novagen, Madison, Wl) and the tac and trc series (Pharmacia, Uppsala, Sweden) are suitable for the expression of β-glucuronidase. A suitable plasmid conferring resistance to ampicillin has a coli origin of replication, a laclq gene, a hybrid lac / trp promoter against the lac Shine-Dalgamo sequence, a hexa-his coding sequence that binds to the 3 'end of the inserted gene and a termination sequence rrnB.

The choice of an expression vector is determined in part by the bacteria. Commercially available vectors are paired with suitable hosts. The vector is introduced to the bacterial cells by conventional methodology. Normally, bacterial cells are treated to allow DNA uptake (for protocols, see generally, Ausubel et al., Supra; Sambrook et al., Supra.). Alternatively, the vector can be introduced by electroporation, phage infection or other suitable method.

S. thuringiensis cells can be cultured using means and fermentation techniques common in the art. To complete the fermentation cycle, the bacteria are harvested by previous separation of the B. thuringiensis spores and crystals from the fermentation broth by tests known in the art. Spores and crystals recovered from B. thuringiensis can be formulated in wettable powder, liquid concentrate, granules or other forms by the addition of surfactants, dispersants, inert carriers and other components to facilitate handling and application to particular target pests. These formulas and methods of application are well known in the art.

As mentioned above, B. thurigiensis or recombinant cells expressing a crystal protein of B. thurigiensis can be treated to prolong the activity of the toxin and stabilize the cell by forming a cellular microcapsule. The pesticidal microcapsule that is formed comprises the B. thurigiensis toxin within a cellular structure that has been stabilized and will protect the toxin when the microcapsule is applied in the environment of the target pest. Suitable host cells can include prokaryotes or eukaryotes, typically being limited to those cells that do not produce substances toxic to higher organisms, such as mammals. However, organisms that produce substances toxic to higher organisms may be used when the toxic substances are unstable or the level of application is low enough to prevent any possibility of intoxication for a mammalian host. As hosts, prokaryotes and lower eukaryotes, such as fungi, will be of particular interest. The cell will normally be intact and substantially proliferative rather than spore-like when it is treated, although in some cases spores may be used.

The treatment of the microbial cell, for example, a microbe containing the B. thuringiensis toxin gene, can be by chemical or physical tests, or by a combination of chemical and / or physical tests, as long as the technique does not affect in a deleterious way the properties of the toxin neither diminish the cellular ability to protect the toxin. Some examples of chemical reagents are halogenating agents, in particular halogens of atomic number 17-80. More particularly, iodine can be used under mild conditions for a sufficient time to achieve the desired results. Other suitable techniques include a treatment with aldehydes, such as glutaraldehyde; anti-infectives such as ceffaran chloride and cetylpyridine chloride; alcohols, such as sopropyl and ethanol; some histological fixatives such as Lugol's reagent, Bouin's fixative, various acids and Helly's fixative or a combination of physical agents (heat) and chemicals that preserve and prolong the activity of the toxin produced in the cell when the cell is administered to the host animal . Some examples of physical tests are radiation with short wavelengths, such as gamma radiation and X radiation, freezing, UV radiation, lyophilization and the like. Methods for the treatment of microbial cells are described in US4695455 and US4695462 which are incorporated by reference herein. asporóqenos utantes.

The asporogenic mutants of Bacillus thuringiensis produce high yields of crystal proteins. Some asporogenic mutants of B. thuringiensis have been generated (e.g., US5827515; US5279962, both incorporated in their entirety). The mutants of the strains described herein can be made by methods well known in the art. For example, an asporogenous mutant can be obtained through mutagenesis with ethylmethane sulfonate (EMS) from a novel isolate. Alternatively, the mutants can be obtained using ultraviolet light and nitrosoguanidine by methods well known in the art.

A smaller percentage of asporogenic mutants will remain intact and will not lyse for long fermentation periods; these strains are designated as lysis minus (-). The less lysis strains can be identified by selection of asporogenic mutants in a shake flask medium and selecting those mutants that are still intact and which contain toxin crystals at the end of the fermentation. The less lysis strains are suitable for cell treatment processes that will produce a protected encapsulated toxic protein.

To prepare a phage-resistant variant of an asporogenous mutant, an aliquot of the phage lysate is spread on nutrient agar and allowed to dry. A strain of bacteria sensitive to the phage aliquot is inoculated directly onto the dried lysate and allowed to dry. The plates are incubated at 30 ° C. The plates are incubated for 2 days and during that time, numerous colonies will be seen growing on the agar. Some of these colonies are harvested and subcultured on nutrient agar plates. These seemingly resistant cultures are tested for resistance by crossings with the phage lysate. A line of phage lysate is crossed over the plate and allowed to dry. The presumed resistant cultures are then crossed through the phage line. Cultures of resistant bacteria do not show lysis anywhere in the crossing through the phage line after incubating overnight at 30 ° C. Phage resistance is reconfirmed by placing a bed of the resistant culture on a nutrient agar plate. The resistant strain is grown in the same way so as to serve as a positive control. After drying, a drop of the phage lysate is placed in the center of the plate and allowed to dry. Resistant cultures do not show lysis in the area where the phage lysate was placed after incubation at 30 ° C for 24 hours.

Expression in baculovirus.

Expression in insect cells can offer significant advantages, including high expression levels, ease of scaling, protein production with post-translational modifications and simplified cell growth. A variety of methods, vectors and cell lines have been developed to express proteins in baculovirus. One of these methods is described in the Examples. Other methods and materials can be obtained from commercial suppliers, such as Invitrogen (CA), BD Biosciences (NJ), Clontech (CA) and Protein Sciences (CT) (see also O'Reilly et al., 1992, Baculovirus expression vectors. laboratory manual, WH Freeman and Company, NY).

The principles that guide the construction of the vector for bacteria and plants, as discussed herein, are applicable to baculovirus vectors. In general, vectors are well known and readily available. In summary, the vector must have at least one functional promoter in the host operably linked to the transgene. In general, the vector will also have one or more selection markers, an origin of replication, a polyadenylation signal and a transcription terminator.

Expression in other organisms.

A variety of other organisms are suitable for expressing crystal proteins. For example, various fungi such as yeasts, molds and mushrooms, insects, especially disease vectors and pathogens, and other animals such as cows, mice, goats, birds, aquatic animals (eg, shrimp, turtles, fish, lobsters and others) crustaceans), amphibians and reptiles, and the like can be transformed with a coding sequence and express crystal proteins.

The principles that guide the construction of the vector for bacteria and plants, as indicated above, are applicable to the vectors of these organisms. In general, vectors are well known and readily available. In summary, the vector must have at least one functional promoter in the host operably linked to the transgene. In general, the vector will also have one or more selection markers, an origin of replication, a polyadenylation signal and a transcription terminator.

Someone with basic knowledge in the field will appreciate that there is a variety of techniques for the production of transgenic animals. In this sense, US patents do not. 5166215, 5545808, 5741957, 4873191, 5780009, 4736866, 5567067 and 5633076 teach such methodologies and are therefore incorporated herein by reference.

Promoters for expression in eukaryotic cells include P10 or the baculovirus polyhedrin gene promoter / insect cell expression systems (see, for example, US5423041, US5242687, US5226317, US4745051 and US5169784), MMTV LTR, RSV LTR, SV40 , promoter of metallothionein (see, for example, US4870009) and other inducible promoters. Promoter systems suitable for the intended use in high level expression include, but are not limited to, the Pichia expression vector system (Pharmacia LKB Biotechnology).

Insecticidal compositions and methods of use.

The polypeptide compositions described herein have particular utility as insecticides for topical and / or systemic applications of crops, grasses, fruits and vegetables, turf, trees and / or ornamental plants. Alternatively, the polypeptides disclosed herein can be formulated as a spray, particles, powder or some other aqueous, atomized or aerosol to kill an insect or control a population of insects. The polypeptide composition described herein can be used prophylactically or, alternatively, can be administered to an environment once the target insects, such as the coffee berry borer, have been identified in the particular environment to be treated.

Regardless of the method of application, the amount of the active component (s) of the polypeptide is applied to an insecticidal effective amount, which will vary depending on factors such as, for example, the specific insects to be controlled, the medium specific environment, location, plants, crops or agricultural site to be treated, environmental conditions and / or frequency of application, and / or the severity of insect infestation.

The insecticidal compositions described can be made by the formulation of the bacterial cell, suspension of the crystal and / or spores, or the protein component isolated with the desirable agronomically acceptable vehicle. The compositions may be formulated prior to administration in an appropriate medium such as a lyophilized vehicle, dried by lyophilization or in an aqueous vehicle, medium or suitable solvent such as saline or other buffer. The compositions can be formulated in the form of powder or granular material, or in suspension of oil (vegetable or mineral), or water or oil / water emulsions, or in the form of a wettable powder, or in combination with any other suitable support material of agricultural application. Suitable agricultural vehicles can be solid or liquid and are well known in the art. The term "suitable agricultural vehicle" covers all adjuvants, inert ingredients, dispersants, surfactants, tackfiers, binders, etc. which are commonly used in the technology of formulation of insecticides and which are well known to technicians who formulate insecticides. The formulations can be mixed with one or more solids or liquids and adjuvants and be prepared by various means, for example, by homogeneous mixing, mixing and / or grinding of the insecticidal composition with suitable adjuvants using conventional formulation techniques.

The formulation of bait granules containing an attractant and spores and crystals of the B. thuringiensis isolates or recombinant microbes containing the genes obtainable from the isolates of B. thurigiensis described herein, can be applied to the environment of the insect, such as Coleoptera. The bait can be applied generously if the toxin does not affect animals or humans. The product can also be formulated as a vaporizer or powder. The isolate B. thurigiensis or the recombinant host that expresses the B. thurigiensis gene can also be incorporated into a bait or food source for the coffee or mosquito borer.

As one skilled in the art will appreciate, the concentration of the pesticide will vary widely depending on the nature of the particular formulation, particularly if it is a concentrate or if it is to be used directly. The pesticide will be present in at least 1% by weight and may reach 100% by weight. The dry formulations will have from about 1 to 95% by weight of the pesticide, while the liquid formulations will generally have from about 102 to 10 4 cells / mg. These formulations will be administered in approximately 50 mg (liquid or solid) up to 1 kg or more per hectare. The formulations can be applied to the environment of the insects, for example, in the foliage of the plants.

The bioinsecticide composition of the invention may include a fluid suspension of bacterial cells expressing one or more of the crystal proteins described herein. Alternatively, the bioinsecticide composition comprises water dispersible granules. This granule includes bacterial cells that express one or more of the crystal proteins described herein. In yet another alternative the bioinsecticide composition contains wettable powder, powder, crystal spore formulation, cell pellet or colloidal concentrate comprising transformed bacterial cells.

The dry forms of the insecticide compositions can be formulated to dissolve immediately upon wetting or, alternatively, they are dissolved by controlled release, sustained release or any other time dependent manner. Said compositions can be applied or ingested by the target insect and as such, can be used to control the number of insects or the spread of these insects in a given environment.

In another alternative, the bioinsecticide composition comprises an aqueous suspension of bacterial cells or an aqueous suspension of parasporal crystals, or an aqueous suspension of lysates of bacterial or filtered cells, etc., such as those described above and expressing the crystal protein. These aqueous suspensions can be provided as a concentrated stock solution that is diluted before application or, alternatively, as a ready-to-apply diluted solution.

For these methods involving the application of transformed bacterial cells, suitable bacterial cells include Bacillus thuringiensis serotype israelensis cells 4Q1, other strains of B. thuringiensis, B. megaterium, B. subtilis, B. cereus, E. coli, Mullet spp. , Agrobacterium spp. or Pseudomonas spp. The cell host containing the gene (s) of the crystal protein can be cultured in any convenient nutrient medium. These cells can be harvested according to conventional forms.

When the insecticidal compositions comprise intact B. thuringiensis cells expressing the protein (s) of interest, said bacteria can be formulated in a variety of ways. They can be used in wettable form, granules or powder by mixing with various inert materials, such as inorganic minerals (phyllosilicates, carbonates, sulphates, phosphates etc.) or botanical materials (powdered corn cobs, rice husk, walnut shell and Similar). The formulations may include binding diffusers, stabilizers, other pesticidal additives or surfactants. The liquid formulations may be water-based or non-aqueous and be used as foams, suspensions, emulsifiable concentrates or the like. The ingredients may include Theological agents, surfactants, emulsifiers, dispersants or polymers.

Alternatively, the insecticidal polypeptides of the invention can be prepared by native or recombinant systems of bacterial expression in vitro and isolated for later field applications. These proteins can be both used in raw cellular, suspensions, colloids etc., or they can be purified, refined, buffereated and / or processed later before formulating an active biocide formulation. Likewise, in certain circumstances, it may be desirable to isolate the crystals and / or spores from cultures of bacteria expressing the crystal protein and to apply solutions, suspensions or colloidal preparations of said crystals and / or spores as bioinsecticide active compounds (eg, with alcohol / methanol). In certain circumstances, when control of several insect species is desired, the insecticide formulations described herein may also include one or more chemical pesticides (such as chemical pesticides, nematicides, fungicides, virucides, microbicides, amoebicides, insecticides, etc.) and / or one or more crystal proteins having the same or different insecticidal activities or insecticidal specificities, such as the insecticidal polypeptide. The insecticidal polypeptides of the invention can also be used in combination with other treatments, such as herbicidal fertilizers, alcohol and methanol-based attractants, cryoprotectants, surfactants, detergents, insecticidal soaps, latent oils, polymers and / or formulations. biodegradable as a prolonged release vehicle that allows long-term administration of a target area after a single application of the formulation. Likewise, the formulations can be prepared in edible "baits" or modeled as insect traps to allow the feeding or ingestion of a target insect of the insecticidal formulation.

The insecticidal compositions of the invention can also be used in consecutive or simultaneous application to a site in the environment separately or in combination with one or more insecticides, pesticides, chemicals, fertilizers or other additional compounds.

In a specific example, one or more B. thuringiensis crystal proteins are administered to coffee drills to control this pest in coffee crops. B. thuringiensis is administered in such a way that the coffee berry borer ingests the toxin. As one skilled in the art will appreciate, the exact method for administration is not critical. For example, B. thuringiensis can be administered as foliar spray on coffee crops. This method of administration is effective for controlling adult coffee drills that feed on the berries of coffee plants. Another method of administration is done by transforming a coffee plant that expresses one or more crystal proteins. Both adults and larvae that are in the transgenic plant will thus ingest the crystal protein. Advantageously, tissue-specific promoters can be used to drive the expression of the B. thuringiensis gene in such a way that the toxin is present in the tissue that is more likely to be eaten by the coffee berry borer. For example, specific promoters of the root can be used to provide control of larvae and specific promoters can be used to control the adult coffee bit.

The insecticidal compositions of the invention are applied to the environment of the target insect, usually in the foliage of the plant or crop to be protected, by conventional methods, preferably by spraying. The strength and duration of the insecticide application will be established with respect to the specific conditions of the pest (s), harvest (s), to be treated and particular environmental conditions. The proportional ratio of the active ingredient to the vehicle will naturally depend on the chemical nature, solubility and stability of the insecticide composition as well as the particular formulation envisaged.

Other application techniques, including spraying, watering, soil soaking, plant and soil injection, seed coating, seedling coating, foliar spraying, aeration, fogging, spraying, spraying, aerosol application, etc. are also feasible and may be necessary under certain circumstances such as, for example, insects that cause root or stem infestation, or for application to delicate vegetation or ornamental plants. These application methods are also well known to those skilled in the art.

The insecticidal compositions of the present invention may also be formulated for preventive or prophylactic application to an area and, in certain circumstances, may be applied to domestic animals, livestock, animal beds or in and around agricultural machinery, barns, homes or agricultural or industrial facilities and the like.

The concentration of the insecticidal composition that is used for environmental, systemic, topical or foliar application will vary widely depending on the nature of the particular formulation, the means of application, the environmental conditions and the degree of biocidal activity. Normally, the bioinsecticide composition will be present in the formulation applied at a concentration of approx. 1% by weight and can be and include up to approx. 99% by weight. Dry formulations of the polypeptide compositions can be approx. 1% to approx. 99% or more by weight of the protein composition, while liquid formulations in general can comprise of approx. 1% up to approx. 99% or more of the active ingredient by weight. As such, it is possible to prepare a variety of formulations, including those formulations comprising from approx. 5% to approx. 95% or more by weight of the insecticidal polypeptide, including those formulations comprising ca. 10% to approx. 90% or more by weight of the insecticidal polypeptide. Naturally, compositions comprising from approx. 15% to approx. 85% or more by weight of the insecticidal polypeptide and the formulations comprising from approx. 20% to approx. 80% or more by weight of insecticidal polypeptide are also included within the scope of the present disclosure.

In the case of compositions that include intact bacterial cells containing the insecticidal polypeptide, the preparations will generally contain ca. 104 to approx. 108 cells / mg, although in certain embodiments it may be convenient to use formulations comprising approx. 102 up to approx. 104 cells / mg, or when more concentrated formulations are desired, compositions of approx. 108 to approx. 1010 or 1011 cells / mg. Alternatively, cell pastes, spore concentrates or crystal protein suspension concentrates can be prepared to contain the equivalent of ca. 1012 to 1013 cells / mg of the active polypeptide and said concentrates can be diluted prior to application.

The insecticidal formulation described above can be administered to a particular plant or area of destination in one or more applications as needed, with a typical application rate per hectare ranging in the order of about ca. 50 g / hectare to approx. 500 g / hectare of active ingredient or, alternatively, around 500 g / hectare can be used up to approx. 1000 g / hectare. In certain circumstances, it may even be desirable to apply the insecticidal formulation to a target area at an application rate of approx. 1000 g / hectare to approx. 5000 g / hectare or more of the active ingredient.

The following examples are offered by way of illustration and not by way of limitation.

Example 1. Cloning of the cry10 gene.

The cryIOAa gene was cloned from the DNA plasmid of B. thuringiensis serovar israelensis S-1806 (Genetic and Biotechnology Resources, EMBRAPA, Brazil).

This gene was amplified from 50 ng of total bacterial DNA in a reaction mixture containing oligonucleotides (0.4 pM each) forward and reverse (table 3), 10 μ? of each dNTP, 2.5 pL of Taq DNA polymerase, 2 mM MgCl2 and 1 U of Taq polymerase (Invitrogen) in a total volume of 25 pL. The amplification conditions were: a cycle of 94 ° C for 5 min, 35 cycles of 95 ° C for 30 seconds, 52 ° C for 1.3 min, 72 ° C for 4 min followed by an incubation at 72 ° C for 8 min . The forward oligonucleotides contain a BamVW restriction site and the ATG initiation codon; the reverse oligonucleotide is complementary to nucleotides 2015-2042 and also contains a BamVW restriction site. The amplified fragment was cloned into the plasmid pGEM®-T easy (Promega, Wl, U.S.) and designated pGemcry 10Aa. The plasmid was introduced into competent E. coli DH5-a cells (Invitrogen, CA, USA). The DNA plasmid was purified with the Wizard®Plus SV Minipreps DNA Purification Kit (Promega) and sequenced using an MEGA BACE® 1000 automatic sequencer (Amersham Bioscience, U.K.). In addition to the oligonucleotides SP6 and T7 flanking the insert, oligonucleotides F-496 and R-1324, which are specific for the cryWAa gene, were also used to confirm the presence of the gene sequence (Table 3). The sequences were analyzed by the Open Reading Frame (ORF) and BLAST search engines, both available through the National Center for Biotechnological Information (NCBI).

BLAST analysis of the sequence revealed high identity with the cryWAa gene (GenBank, accession number M 12662, also SEQ ID NO: 8), but with differences in two nucleotide positions. These differences result in amino acid changes of T589A and T624S.

Table 3 Oligonucleotide Sequence of the oligonucleotide (5 '-> 3') NO. I KNOW THAT. ID.

Front (F) GGGATCCGGGAGGAATAGAT A TGAATC 15 Reverse (R) ATAGTGAATGATTTATTTGTAAGGATCCTTTCC 16 F-496 GCACGTACACACGCTAATGC 17 R-1324 GATATTCATCCAATTCAACAATA 18 Restriction sites for Bam Hl (GGATCC) are indicated with bold type; the initiation codon (ATG) in the front is underlined; The Reverso is complementary to the nucleotides 2015-2042.

Example 2. Clonof the first open readframe of the cryIOA gene into the pSTAB expression vector.

The first open readframe of cryWAa was cloned into the pSTAB expression vector (Park et al., 1999, FEMS Microbiology Letters 181, 319-327, 199). The gene was first introduced into the pCR2.1 TOPO vector (Invitrogen, CA) and was subsequently subcloned into pS . The sequence of the cryW gene as reported from Bacillus thurensis serotype israelensis plasmid pBtoxis (GenBank, Accession No. AL731825) reveals two open readframes and one intervensequence. The primers designed to amplify the entire gene were developed usthe Primer3 program of the Massachusetts Institute of Technology. Restriction sites for Sa / I and Sph, which were used for cloninto pS , were added to the primer sequences. The forward (10d) and reverse (10r) sequences of the primer were: 10d 5'-AATGTCGACTTGCAACAGAAAAGAGTTGTGTC-3 '(SEQ ID NO: 19) 10r 5'-CGAGCATGCACATTTCCCCACAATTTTCA-3 '(SEQ ID NO: 20).

The restriction sites of Sa / I and Sph \ are underlined.

The DNA of B. thurensis israelensis strain IPS 82 (Institut Pasteur) was extracted and 500 ng of DNA were amplified in a reaction mixture contain2.5 ml of buffer 10x, 2.5 μ? of MgCl2 225 mM, 0.5 μ? of dNTP, 20 μ? of each primer and 2.5 U of Taq polymerase. The amplification conditions were: an initial step at 95 ° C for 1 minute and 30 cycles of one min at 95 ° C, 1.5 min at 50 ° C and three min at 72 ° C, followed by a final step of 10 min at 72 ° C. The amplification reaction was subjected to electrophoresis in 1% agarose gel.

The amplified product correspondto the cry10 gene was cloned into the vector pCR2.1 TOPO (Invitrogen, CA), which was used to transform competent E. coli DH5a cells. The transformants were selected in a medium with carbenicillin, X-Gal and IPTG and were subsequently cultured. The DNA plasmid was digested with Sa / I and Sph \, subjected to agarose gel electrophoresis, and the DNA fragment correspondto the gene was purified with the QIAquick Gel Extraction kit kit (Qiagen).

Similarly, the expression vector pSTAB from B. thurensis was digested with Sa / I and Sph, and purified with the QIAquick Gel Extraction kit. The purified cry10 gene fragment and the vector were analyzed by agarose gel electrophoresis to determine the relative amount of each DNA. The ligation was carried out usa vector / insert ratio of 1: 3. After incubation overnight at 16 ° C, the reaction was used to transform competent cells of E. coli DH5. Verification of the plasmids was performed by restriction enzyme analysis. The colonies with the expected restriction pattern were cultured in LB liquid medium and the DNA was extracted by the alkaline maxiprep procedure (Sambrook and Russell Molecular Clon A Laboratory Manual, Cold SprHarbor Laboratory, NY 2001). The DNA plasmid was transfected into the acrycrystalline Bt strain 4Q7 (Lereclus et al., FEMS Microbiology Letters 60, 21 1-218, 1989) by electroporation. The expected recombinant transformant Bt-cry10 was obtained.

Similarly, the first ORF of the cryWAa gene was also cloned into the pSTAB vector.

The primers for amplifythe first ORF have the sequences AATGTCGACTTGCAACAGAAAAGAGTTGTGTC (10d; SEQ ID NO: 19) and the reverse primer TCTAATAATGCATGAGTGATTGGAATAAATTCGA (SEQ ID NO: 21). The restriction sites for Sa / I and Nsi \ respectively, are underlined. An acrycrystalline Bt 4Q7 strain was also transformed with this construction.

Example 3. Construction of baculovirus expresscry 10 A.

The scheme for obtainthe recombinant virus containthe cryIOAa gene (vSyncryI O) is illustrated in figure 3. In short, the plasmid pGemcry 10Aa DNA was digested with Eco Rl and the fragment containthe cry 10Aa gene was isolated after the agarose gel electrophoresis. The fragment containthe cry 10Aa gene was purified from the gel usa GFX® kit and ligated to the pSynXIVVI + X3 Eco RI-digested transfer vector (Wang et al., Gene 100: 131-137, 1991). The ligated vector was used to transform competent E. coli DH5-a cells. The colonies were selected in a selective medium.

The presence and orientation of cryWAa was verified by amplification reactions. Oligonucleotides for the amplification of pSynXIVVI + X3 are: oligonucleotides ORF 603: 5'-ACAGCCATTGTAATGAGACG (SEQ ID NO: 22), which is derived from nucleotides +8 and -11 relative to the initiation codon of ORF 603 and polhR: 5'-CTAGATTCTGTGCGTTGTTG-3 '(SEQ ID NO: 23), which is derived from nucleotides 34 to 54 after the stop codon of the polyhedrin gene. These amplification primers allow to verify the orientation of the insert.

Trichoplusia ni cells (BTI-Tn5B1 -4) were maintained at 27 ° C in TC100 medium with 10% fetal bovine serum. These cells serve as host for the in vitro propagation of AcMNPV baculovirus and its recombinants. The recombinant virus vSyngalVI-containing the gene of β-galactosidase in the locus of the polyhedrin gene (Wang et al., 1991), was used for the construction of the recombinant AcMNPV containing the cryIOAa gene.

One pg of DNA from the recombinant plasmid (pSycryI OAa) and 0.5 pg of vSyngalVI virus DNA-previously linearized with the restriction enzyme Bsu 361, were used in the co-transfection of BTI-TN5B1 -4 cells (106 cells), using liposomes and following the manufacturer's instructions (Cellfectin®, Invitrogen). The plate was incubated for seven days at 27 ° C, until the organs of viral occlusion (OB) appeared; the floating layer of the plate was collected and used in the purification of the recombinant viruses in serial dilutions in 96-well plates. The only site of Bsu 361 in the bSynGalVI- virus is located in the ß-galactosidase gene and the linear virus is not infectious, which facilitates the purification of recombinant viruses. In addition, the plasmid pSyncrylOAa has, in addition to the cryIOAa gene, the polyhedrin gene (absent in vSyngalVI-). After homologous recombination between the plasmid DNA pSyncryl OAa and the viral DNA, in which the cryIOAa gene replaced lac-Z, the recombinant virus vSyncryI OAa was isolated. The virus was purified in three serial dilutions in 96-well plates (O'Reilly et al., Bacoluvirus expression vectors, A Laboratory Manual, Freeman, 1992. P. 345. 1992).

One hundred third instar larvae of S. frugiperda were infected by intra-haemoceral injection with 5 to 10 μl of a BV bank (1.17 x 107 pfu / ml_) of the recombinant virus vSyncryI OAa. 120 hours after the post infection (h.p.i.), the dead larvae were collected and the OBs with possible recombinant protein crystals were purified (O'Reilly et al., 1992). After purification, the crystals of the recombinant protein and the viral polyhedra were analyzed with a light microscope (Axiophot 100, Zeiss), photographed and then stored at -80 ° C.

Cryl OA analysis. For analysis in SDS-PAGE, both the wild-type polyhedra and the recombinant protein crystals were resuspended in 100 μl PBS (136 mM NaCl, 1.4 mM KH2P04, 2.6 mM KCI, 8 mM Na2HP04.2H20, pH 7.4 ) and samples of 10 pL were analyzed in 12% SDS-PAGE (Laemmi, 1970) using the Mini-Protean II device, according to the manufacturer's instructions (Bio-Rad). The presence of a 74 kDa polypeptide corresponding to the recombinant protein CryI OAa was detected in the extract of cells infected with the recombinant virus vSyncryI OAa. Confirmation of the 74kDa protein as CryI OAa was performed using a specific antiserum against this protein.

In addition, the crystals and polyhedra obtained from larvae of S. frugiperda infected with the vSyncryI OAa virus were purified and processed and then analyzed by scanning electron microscopy that revealed their cube shape. The crystals observed are formed by the recombinant protein CryI OAa.

For the transcription analysis of the recombinant vSyncryIOAa virus, 5 x 106 cells (BTI-Tn5B1-4) were plated in two 100 mm diameter plates (TPP) and incubated for one hour at room temperature. The medium was removed and the cells were infected with the recombinant virus at a multiplicity of infection (MOI) of 20. After one hour, the virus inocula were removed and 10% fetal bovine serum was added. After 96 h.p.i., the cells were harvested and the total RNA was extracted by reactive Trizol (Invitrogen).

Total RNA was used to obtain cDNA, using an oligonucleotide specific for the poly-A tail of the messenger RNA (T1: 5'CCTGCAGGATCCTTAGGTTTTTTTTTTTTTTTTTT 3 '(SEQ ID NO: 24) and the reverse transcriptase enzyme Mu-MLV (Invitrogen The cDNA was synthesized in the following manner: A mixture of 2 μl of total RNA, 9 μl of Milli-Q water "RNase free", and 1 μl of oligonucleotide T1 were incubated at 65 ° C for five minutes. and placed on ice To this reaction mixture was added 1 μ? of dNTPs (10 mM each), 1 μ? of DTT (0.1 M), 28 units of RNase inhibitor (RNA guard®, Gibco), 5 μ Taq 5X, 1 μ? of the reverse transcriptase enzyme M-MLV RT (Gibco BRL), and Mili-Q® water to a total volume of 20 μ ?, and incubated at 37 ° C for 50 minutes for cDNA synthesis The cDNA was amplified with the T2 oligonucleotides (5 'CCTGCAGGATCCTTAGGTT 3' (SEQ ID NO: 25) and oligo F-496, which is specific for the cryIOAa gene and maps for nucleotides +496 a +516 The presence of the cryIOAa gene transcript was confirmed by the detection of a 1600 bp fragment and by the digestion of the fragment with Xho I, which cuts the gene at position +1064. The digestion produced the expected fragment of 1 100 bp and another of around 548 bp, which confirms the specificity of the amplification.

Example 4. Preparation of solubilized and purified crystal proteins.

The sources of the cytl, cry3, cry4A, cry4B, cry10, and cry1 1 proteins were from recombinant or native strains of B. thuringiensis. The strains mentioned in Table 4 express individual toxins B. thuringiensis subsp. Israelensis Table 4 Gen (is) expressed Strain (s) Bf-pS - CryIOAa * CryI OAa pWF45 ** CytlAa pHT4A + 4B *** Cry4A and Cry4B pHT4B *** Cry4B LBÍT704 *** Cry1 1A * Cloned and expressed by Hernández, 2006.

** Cepa donated by B. Federici, University of California, Riverside.

*** Strains donated by A. Delecluse, Pasteur Institute, Paris.

The Cry3Aa toxin was isolated from the type B. thuringiensis subsp. tenebrionis, obtained from the German Crop Collection. All strains were cultured in sporulation medium (8 g / l of nutrient broth, 1 g / L of yeast extract, 1 g / L KH2P04, 1 mg / L CaCO3, 1 mg / L MgSO4.7H20, 0.1 mg / l L FeS04.7H20, 0.1 mg / L MnS04.7H20, 0.1 mg / L ZnS04.7H20: pH adjusted to 7.0 by the addition of NaOH), supplemented with 10 pg / ml erythromycin for the maintenance of the plasmids in the recombinant strains , for 72 hours, 200 rpm, 30 ° C. At this time, the crops sporulated completely. The cultures (600 ml) were centrifuged at 12,800 xg for 30 minutes at 4 ° C, the cell pellets were frozen for 16 h and lyophilized for 18 h in a lyophilizer model Labconco Lyploc 18. Subsequently, the material was weighed for use in the bioassay. Alternatively, the supernatant of each culture was discarded and the suspension of spores, cell debris and crystals were subjected to centrifugation through gradients of NaBr, sucrose or Renografin-60 (Squibb Diagnostics, New Brunswick, NJ) to produce purified crystals. .

The purified crystals of Cry10A were washed three times in sterile deionized water and collected by centrifugation (17,000 x g for 10 min.). The washed crystals were resuspended in 100 μ? of sterile deionized water. 20 μ? The crystals are resuspended in an equal volume of buffer (50mM NaOH, 25mM DTT, 50mM CAPS pH 1.5) for one hour at 37 ° C. Then, 10 μ? of a 4X buffer (2% SDS, 40% glycerol, 5% mercaptoethanol, 0.001% bromophenol blue, 0.0625 M Tris-HCl, pH 8) was added and incubated for 3 minutes in a hot water bath. A total of 15 μ? of the sample was analyzed in a 10% polyacrylamide gel; 68 and 56 kDa bands corresponding to ORF 1 and ORF 2, respectively, were observed from the cry10 operon, cloned in Bt-pS -cryyO (Figure 1).

Example 5. Bioassay of crystal proteins on H. hampei and A. aegypti.

In this example, the activities of crystal proteins against insects are determined.

Cultivation of H. hampei. For the establishment and maintenance of a colony of H. hampei, only the females were inoculated. The insects were disinfected with 2.5% benzalkonium chloride, rinsed with sterile distilled water and finally sprayed with 0.1% benomyl (methyl [1 - [(butylamino) carbonyl] -1H-benzimidazol-2-yl] carbamate). Then they were dried on a paper towel disinfected with 0.1% benomyl. Once the insects were dry, they were placed in a cylinder with a perforated lid, which was used to distribute H. hampei in 24-well plates containing the diet. The inoculated plates were covered and placed in an incubator in total darkness, at 27 ° C and a relative humidity of 85%.

To prepare 1 L of the diet, 150 g of unroasted coffee was sprayed into particles approximately 2 mm in diameter and sterilized for 15 minutes at 120 ° C and 15 pounds of pressure. A sterile 2% agar solution (750 ml) was mixed with 150 g of sterile coffee particles, 1.5 g of benomyl, 15 g of yeast, 15 g of casein, 2 g of benzoic acid, 0.5 g of vitamins Vanderzant, 0.8 g of Wesson's salts, 10 ml of 95% alcohol and 1 ml of formaldehyde. The mixture is homogenized in a blender for about 2 minutes. Approximately 1 ml of this diet is dispersed per well in 24-well plates.

Demographic parameters. For the evaluations of the demographic parameters, 30 active H. hampei females were individually placed in a well of 24-well plates containing the diet of H. hampei. Each week, at random, 30 diet samples were evaluated by the number of individuals present, by state within the life cycle and the number of dead individuals.

The following formulas were used to measure the different demographic parameters: Net maternity function (fx): lxmx Net reproduction rate (R0): mx Intrinsic rate of growth Average generation time Where ?? is the probability that an individual reaches a certain age x and mx is the average number of states of a progeny produced by a female of a certain age, x. The mx values were determined by multiplying the average number of eggs produced by a female of a certain age x. The number of eggs recorded per female was calculated from the number of eggs obtained per sample. The number of eggs counted in the second sample was subtracted from the number of eggs in the previous sample, the difference was assumed as mx (Portilla, Colombian Journal of Entomology 26 (1-2): 31 -37, 2000).

Amount of moisture in the diet. The amount of moisture in the diet samples was determined by the difference in weight of the data collected per week over a period of 10 weeks from five samples of the uninoculated diet.

Oviposition. Five samples of the diet inoculated with active females were dissected every two days for a total of 10 days and the presence of eggs was determined. Also, on a daily basis, the development of 20 H. hampei fertile eggs that reached the adult stage was observed as well as what was the number of days in each previous phase.

Evaluation of natural mortality. The evaluations were carried out for (i) Eggs: 10 dozens of H. hampei fertile eggs from colonies established in the diet; (ii) Larvae (L1): 70 freshly hatched H. hampei larvae were selected from the diet; (Ni) Pupa: 60 H. hampei pupae were selected from the diet and placed in groups of 15 individuals; (V) Adults: 60 adults H. hampei of "light brown" color of an established colony on a diet were placed in groups of 15 individuals. All the evaluated individuals (eggs, larvae, pupae and adults) were placed in granules of the H. hampei diet and covered. The evaluation of mortality was carried out every two days for a period of 10 days.

Bioassays Protocols were established for qualitative bioassays, both for adults and larvae of H. hampei. Larvae (L1): for bioassays with H. hampei larvae, the H. hampei diet was prepared at least one day before and kept refrigerated. The substrate diet was placed in a reading chamber two hours before the start of the bioassay at room temperature. Previously, 2.5 mg of lyophilizate of the selected strain of B. thuringensis was weighed and reconstituted in 50 μ? of TWEEN 20 at 0.1% and 450 μ? of sterile distilled water for 3 minutes of shaking in a vortex and 5 minutes of sonication. Then, 20 ml of this solution was added to each well with diet and allowed to dry for 30 minutes. Once the suspension was dry, 10 larvae of H. hampei were placed in the first stage (larvae obtained 1 d after hatching of eggs inoculated in the diet) in the diet of each well of the plates with the diet. The plates were sealed with self-adhesive plastic that was punctured (for example, 3 times with a dissecting needle), in order to facilitate gas exchange and placed in total darkness at 27 ° C and 85% relative humidity. The mortality of the larvae was evaluated 7 days later. The bioassays with adults were performed in the same way, except that five H. hampei adults were placed in each well with diet (the adults obtained from the pupae inoculated in the H. hampei diet).

A fine bioassay (dose-dependent assay) to determine the LC50 was performed with 1: 1 serial dilutions of 20 pg / ml spores and the crystal solution. To determine the synergistic effects of the crystal proteins - for example, the CryI OA and Cry1 1 proteins - a fine bioassay was performed with 1: 1 serial dilutions of a 100 ng / ml solution of each strain. Mortality was determined at 24 h and then subjected to Probit analysis. The synergistic potential was calculated using the Tabashnik formula (Tabashnik, Appl and Environ Microbiol 58: 3343-3346, 1992).

For the bioassays with A. aegypti, four instar larvae of the insecticide of Cinvestav Irapuato were obtained. The bioassay was carried out in plastic cups containing 100 ml of water and 20 larvae (Mclaughlin, et al., Bull, Ent. Soc. Amer. 30: 26-29, 1983). Approximately 100 g / ml of the spore and the crystal solution of the strain Bt-pSlfkB-cry10A was added to each container. A total of 200 larvae without crystal protein solution served as a negative control. Mortality was determined at 24 h by Probit analysis.

Evaluation of mortality data. Mortality was determined in qualitative bioassays with L1 larvae and adults of Hypothenemus hampei exposed to a mixture of spores and crystal complex of strains pS -cry10Aa and fif-pS -wy 10A in. 5 pg / ml dose. Mortality was evaluated on day seven. The application of either cytl or only cry10 resulted in a mortality rate of 50% and 20%, respectively. A combination of cytl and cry10 however resulted in a 100% mortality of H. hampei, demonstrating a synergistic effect (figure 2, table 5).

Mortality was observed in the L1 larvae of Hypothenemus hampei exposed to different combinations of the recombinant proteins present in the Bacillus thuringiensis israelensis strain. The combination of the Cry10 and Cytl proteins killed 100% of the H. hampei insect larvae, while the Cry10 protein killed 20% and the Cytl alone resulted in 45% mortality of the larvae (Figure 2). In addition, the combination of cytl, cry4A and cry4B killed 65% of insect larvae, while a combination of cry4A and cry4B killed 53.75% of the larvae (table 6).

Qualitative bioassays were performed with -100 pg / ml of spores and crystal complex of Yes-pS -cryWA using larvae from the fourth stage of A. aegipty. Qualitative bioassays with A. aegipty demonstrated the toxicity of the spore and crystal complex of the Bt-pS -cry10A strain against that insect. Mortality was 70% at 24 h and 90% at 48 h at a concentration of approximately 100 g / ml (Table 7).

A bioassay of the spores and the Bt-pSJAB-cry10A crystal complex was performed using Aedes aegypty larvae from the fourth stage at 24 h. This dose-dependent bioassay showed an LC5o of 2.061 pg / ml and an LC95 of 75.489 pg / ml (table 8). The dose-dependent bioassay of the spore-crystal complex of Bt-pSJAB-cry10A and CytIA crystals on larvae A. aegypti at 24h is reported in table 9. In this dose-dependent bioassay, mixtures of strains Cry10A-Cyt1Aa gave a LC50 of 40,909 ng of each component / ml; while the LC95 was 121.2 ng / ml (table 9). The LC50 of the spore and the crystal complex of the CryI OA strain was 2 μg / ml, substantially better than that reported by other investigators (Thorne, L et al., 1986. Journal of Bacteriology 166: 801-811; Delecluse, A et al., 1988. Molecular and General Genetics 214: 42-47; Wirth, M et al., 2004. Journal of Medical Entomology, 41: 935-941).

Table 5 Insect Insect% Mortality dead treaties Control (-) Control (+) Strain Abbott CryIOAa + CytlAa Rep. 1 40 40 0 100 100 100 Rep. 2 40 40 0 100 100 100 Rep. 3 40 40 10 100 100 100 X ± DS 3.33 ± 5.77 100 ± 0 100 ± 0 100 ± 0 Adults CryIOAa + CytlAa Rep. 1 40 4 0 65 10 10 Rep. 2 40 4 0 65 10 10 Rep. 3 40 4 0 65 10 10 X ± DS 0 ± 0 65 ± 0 10 ± 0 10 ± 0 Example 6. Activity of other isolates of B. thuringiensis.

The Bacillus thuringiensis subsp. Israelensis has an effective mortality rate of 100% against H. hampei. The strain B. thuringiensis subsp. israelensis LBIT315 lacks the Cry10 polypeptide (SEQ ID NO: 7); however, it maintains an effective mortality rate of 100% against H. hampei. To determine which other crystal proteins are responsible for mortality, the efficacy of cry4A and cry4B were tested independently and in combination with Cyt1 against H. hampei.

Evaluation of mortality data. With respect to figure 2, the application of Cry4A to H. hampei resulted in a mortality rate of 47%; the application of Cry1 1A resulted in a mortality of 29.3%. However, the combination of Cyt1, Cry4A and Cry4B resulted in a mortality rate of 66.25%. The application of Cry4A and Cry4B, in the absence of Cyt1, presented a mortality rate of 53.75% against H. hampei. The use of only cry4B resulted in a mortality rate of only 5%.

Table 6 % Mortality 5 Insects Insects dead treaties Control (-) Control (+) Strain Abbott CryIOAa + Cry11A Rep. 1 40 16 0 100 40 40 Rep. 2 40 15 0 100 38 38 10 Rep. 3 40 16 5 100 40 37 X ± DS 1.7 ± 2.9 100 ± 0 39.3 ± 1.2 38 ± 2 CryI OAa + Cry4A Rep. 1 40 10 0 100 25 25 Rep. 2 40 9 5 100 23 19 Rep. 3 40 10 0 100 25 25 fifteen X ± DS 1.7 ± 2.9 100 ± 0 24.3 ± 1.2 23 ± 3 CryI OAa + Cry4B Rep. 1 40 7 0 97.5 17.5 17.5 Rep. 2 40 7 0 100 17.5 17.5 Rep. 3 40 8 0 100 20 20 20 X ± DS 0 ± 0 99.2 ± 1.44 18 ± 0.87 18 ± 0.87 CryIOAa + CytlAa Rep. 1 40 40 0 100 100 100 Rep. 2 40 40 0 100 100 100 Rep. 3 40 40 10 100 100 100 25 X ± DS 3.33 + 5.77 100 + 0 100 + 0 100 ± 0 Cry11A + CytlAa Rep. 1 40 14 0 100 35 35 Rep. 2 40 15 10 100 37.5 30 Rep. 3 40 12 0 100 30 30 X ± DS 3.33 ± 5.77 100 ± 0 34.2 ± 3.8 31.9 ± 2.7 Ó TAV Cry 4A (pHT4A + AB) + CytlAa Rep. 1 40 26 0 100 65 65 Rep. 2 40 26 0 100 65 65 Rep. 3 40 27 0 100 67.5 67.5 X ± DS 0 ± 0 100 ± 0 65.811.44 65.8 ± 1 .44 35 * Dose: 5 Mg / ul, mortality was evaluated on the seventh day.

Table 7 24 hrs. 48 hrs.

Treatments Mortality Mortality Dead Treaties Dead Treaties %% Rep. 1 20 17 85 20 19 95 Rep. 2 20 14 70 20 17 85 Rep. 3 20 13 65 20 18 90 Rep. 4 20 14 70 20 18 90 Rep. 5 20 15 75 20 19 95 Rep. 6 20 13 65 20 18 90 Total 120 86 71.66 ± 3.07 90.8 ± 3.7 Negative control Rep. 1 20 0 0 20 0 0 Rep. 2 20 0 0 20 0 0 Rep. 3 20 0 0 20 0 0 Total 60 0 0 60 0 0 Example 7. Activity against A. grandis.

In this example, the activity of the crystal proteins using Cry10A isolated from the recombinant virus (example 3) or from the recombinant plasmid (example 1 and 2) was determined.

Larvae of S. frugiperda of third phase were infected with 10 pL of the recombinant viruses (example 3) and after five days, the larvae were homogenized in 1 mL of MiliQ® water for each cadaver of insects. The homogenate was filtered in glass wool and the suspension was centrifuged at 10,000 g for 10 min. The floating layer was discarded and the pellets were resuspended in a solution of 100 mM EDTA, 40 mM EGTA and 1.0 mM PMSF. CryI OAa was quantified in polyacrylamide gel, using the Image phoretix 2D® program (Pharmacia). The program performs calculations of the ratio between the band of the recombinant protein and a band of known concentration of bovine serum albumin protein (100 mg).

The bioassays with neonatal larvae of A. grandis were carried out according to Martins (Martins, expressao and analise of the pathology of Cry proteins, derived from B. Thuringiensis, em insetos-praga, Brasilia UNB, 2005. 130 p Dissertacao mestrado, 2005 ) that are briefly described below: the artificial diet was poured into a Petri dish (15 mm x 20 mm), and after solidification, 25 holes were made. A neonatal larva of A. grandis was placed in each hole, with a total of 25 larvae per dose of CryI OAa protein. With a total of 75 larvae per dose, five doses of the recombinant protein CryI OAa were evaluated (10.4, 8.32, 6.24, 4.16, 2.08 pg / ml), in addition to a control with the addition of the diet only. All bioassays were carried out in incubation chambers with photophase of 14:10 h (light and dark) at a temperature of 25 ° C and a relative air humidity of 75%. After seven days, the experimental reading was performed and the LC50 was determined by Probit analysis (Finney, Probit Analysis, Cambridge University Press, 1971).

The toxicity of the mixture of OB and purified CryI OAa crystals from Spodoptera frugiperda carcasses infected with the recombinant baculovirus vSynCryI OAa was determined for neonatal larvae of Anthonomus grandis. The results in table 10 are the average of three repetitions. The LC50 of the CryI OAa protein for the neonatal larvae of the weevil was 7.12 pg / mL (Table 10). The results demonstrated that the recombinant protein CryI OAa was toxic to the insect analyzed, demonstrating the efficacy of the expression system based on baculovirus insect cells, for the production of Cry proteins that are biologically similar to native proteins.

In other trials, the required weight of powder for each dilution was taken in 5 ml of 0.01% Tween 20 to achieve a more homogeneous suspension and this was added to 35 ml of the artificial diet before it was poured into the Petri dish. and he had 48 holes. Each hole received a neonatal larva. Five doses (from 0.10 to 1.5 mg / ml) were tested. Four repetitions were prepared and a bacteria-free control was included. The bioassay was maintained in an incubator with a photoperiod of 14/10 at 27 ° C. One week later, the bioassay was evaluated (Praca et al. Coleoptera e Diptera Presq Ag Bras 39: 1-16, 2004) and the LC5o was determined by Probit analysis (Finney, 1971). The bioassay was repeated 3 times and the LC50 was compared by ANOVA analysis through the Sigmastat program. Bioassays with purified toxins were achieved by adding dry toxin to a final concentration of 200 mg / ml artificial diet of the weevil. Four replicates were prepared and a bacteria-free control was included. Mortality rates were compared by ANOVA analysis through the Sigmastat program. When different strains expressing the toxin were tested in combination, equal amounts of each powder were used and the doses were adjusted so that the last concentration of spore powder was maintained at 200 mg / ml. o O O Table 8 Interval interval Bioassay Dosage Mortality Mortality LC 50 LC 95 Dead Treaties confidence trust 3 rep. (Mg / ml) corrected% (MQ / ml) (Mg / ml) (μ9 / mL) (9 mL) 1 20 60 50 83.3 83.0 2 10 60 47 78.3 77.9 3 5 58 36 62.1 61 .4 4 2.5 60 37 61.6 61.0 2,061 1,451 -2,927 75,489 30,248-188,393 5 1.25 56 25 44.6 43.7 6 0.625 56 14 25 23.7 Control 0 60 0 0 0 negative UJ Í) - > * -| 0 (if O O Table 9 Bioassay P ° f iS .. Dead Treatments Mortality ^ ^ Limits LC 95 Limits (ng / ml)% 1 100 60 55 91.6 2 65 60 48 80 3 42.25 60 29 48.3 40.909 36.831-45611 121.247 99.732-158.253 4 27.4625 60 12 20 5 17.850625 60 9 15 6 1 1.6029063 60 2 3.3 Control 0 60 0 0 Table 10 Confidence limit Reference Sample n LC50 (μ9 / mL) (μ9 / mL) bibliographic CryI OAa 75 7.12 (5.27-9.8) to this document Cryl the 75 21.5 (17.0-26.0) to Martins, 2005 S1806 75 300.0 (250-360) to Martins et al., 2006 S1989 75 740.0 (610-910) 3 Martins et al., 2006 LC50 Lethal concentration for 50% of the individuals evaluated during a week. to samples with p > 0.05 and G > 0.04. n number of insects used per repetition.

B. turingiensis assays against A. grandis and lepidopteran targets.

B. thuringiensis subsp. israelensis showed no toxicity against Lepidoptera insects P. sylostella, A. gemmatalis or S. frugiperda in the individual concentration tests at 200 mg / ml (results not shown), in contrast to the results previously obtained with caterpillars of a different taxonomic family , Hylesia metabus (Lepidoptera: Saturniidae) (Vassal et al., FEMS Microbiol Lett 107: 199-204, 1993). However, close to 100% mortality of A. grandis was observed (figure 4). Therefore, the LC50 value at 7 days against A. grandis was determined together with B. thuringiensis subsp. tenebrionis (T08017), a strain known to be active against coleopteran insects (US5382429). B. thuringiensis subsp. israelensis IPS82 showed an LC5o of 0.74 mg / ml (confidence limits: 0.61 -0.91 mg / ml), comparable with that of ß. thuringiensis subsp. tenebrionis (LC500.32 mg / ml, confidence limits: 0.23-044 mg / ml) but produces a different profile of toxins. As a result of this and given that the cloned genes were already available for B. thuringiensis subsp. israelensis, bioassays were carried out with strains expressing individual toxins.

The results of the bioassays of individual toxins and their combinations are shown in Figure 4. Of the individual toxins, the toxicity of the strain producing Cry1 1Aa was the lowest. The producing strains Cry4Aa and Cry4Ba were more active with the highest level of mortality produced by CytlAa. The relative levels of toxin production were evaluated by densitometry analysis of SDS-PAGE gels of the different spore / crystal preparations. The levels of CytlAa and Cry1 1A were both approximately twice those of Cry4Aa, while the level of Cry4Ba was approximately four times that of Cry4Aa. As a result, Cry1 1Aa would seem to make a small contribution to the toxicity of A. grandis. However, Cry4Aa is present in the lowest amount but has one of the highest activities, although Cyt1 Aa may also contribute to the toxicity for this insect. Toxin combinations assays did not produce a 100% mortality in our trials, even though the four toxin-producing strains were used in high doses and the toxicity was too low for the LC50 to be determined. The low toxicity of the four toxins tested here, alone or in combination, suggests that these toxins are not the main determinants of activity against A. grandis and that other factors of B. thuringiensis subsp. Israelensis may be involved. While Cry4Aa, Cry4Ba, Cry1 1Aa and CytlAa are the most important crystal proteins produced by this strain, the plasmid encoding the pBtoxis toxin also carries the cryIOAa, cyt2Ba and cytICa genes, all of which are expressed in the host S. thuringiensis. The CytI Ca protein does not show mosquitocidal activity (Manasherob, et al., CytI Ca from Bacillus thuringiensis subsp. israelensis: production in Esherichia coli and comparison of its biological activities with those of other Cyt-líke proteins. Microbiol. 152: 2651-2659, 2006) although its activity against other insects is unknown. It is possible that one or more of these minor crystal proteins is responsible for coleopterous toxicity, either on its own or in synergy with other toxins.

Claims (20)

Claims

1. A composition comprising at least two isolated Bacillus thuringiensis polypeptides selected from the group comprising SEQ. ID. DO NOT. 5 (cyt1), SEQ. ID. DO NOT. 3 (cry4A), SEQ. ID. DO NOT. 5 (cry4B), SEQ. ID. DO NOT. 7 (cry10), SEQ. ID. DO NOT. 9 (cry1 1), SEQ. ID. DO NOT. 1 1 (cyt2), SEQ. ID. DO NOT. 13 (cry3), a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 1, a variant with at least 90% identity of the amino acids of SEQ. ID. DO NOT. 3, a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 5, a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 7, a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 9, a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 11, a variant with at least 90% identity of the amino acids of SEQ. ID. DO NOT. 13 and a polypeptide processed from any of the above polypeptides.

2. The composition according to claim 1, wherein at least two polypeptides are SEQ. ID. DO NOT. 3 (cry4A) and SEQ. ID. DO NOT. 5 (cry4B).

3. The composition according to claim 1, wherein at least two isolated polypeptides are SEQ. ID. DO NOT. 1 (cytl) and SEQ. ID. DO NOT. 7 (cry7).

4. The composition according to claim 1, wherein at least two isolated polypeptides are SEQ. ID. DO NOT. 1 (cytl), SEQ. ID. DO NOT. 3 (cry4A) and SEQ. ID. DO NOT. 5 (cry4B).

5. The composition according to claim 1, wherein at least two polypeptides are a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 3 and a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 5.

6. The composition according to claim 1, wherein at least two polypeptides are a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 1 and a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 7

7. The composition according to claim 1, wherein at least two polypeptides are a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 1, a variant with at least 90% identity of the amino acids of SEQ. ID. DO NOT. 3 and a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 5.

8. The composition according to any of claims 1 to 7, further comprising an insect attractant.

9. A method for killing coleoptera or diptera insects comprising administering a composition according to any of claims 1 to 8.

10. A method of controlling insect infestation in plants, which comprises contacting the plants with a composition according to any of claims 1 to 8.

The method according to claim 10, wherein the plants are selected from the group consisting of Coffea arabica, Coffea robusta, Coffea canephora, Saccharum officinarum, Elaeis guineensis, Gossypium hirsutum, Gossypium barbadense, Gossypium arboretum and Gossypium herbaceum.

12. A method according to claim 10 or 11, wherein the insect infestation comprises insects of the Coleoptera order.

13. The method according to claim 10, wherein the insects are selected from the group consisting of Hyphotenemus hampei (coffee borer), Metamasius hemipterus (stem borer of rotten sugar cane), Aedes aegypti (mosquito), Rhynchophorus palmarum (weevil) American), Ips sexdentatus (pine borer beetle), Tomicus piniperda (pine beetles) and Orthotomicus erosus.

14. A host cell comprising an expression vector comprising the nucleic acid sequence encoding at least two polypeptides selected from the group comprising SEQ. ID. DO NOT. 1 (cytl), SEQ. ID. DO NOT. 3 (cry4A), SEQ. ID. DO NOT. 5 (cry4B), SEQ. ID. DO NOT. 7 (cry10), SEQ. ID. DO NOT. 9 (cry1 1), SEQ. ID. DO NOT. 1 1 (cyt2), SEQ. ID. DO NOT. 13 (cry3), a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 1, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 3, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 5, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 7, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 9, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 11, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 13, and a polypeptide for processing any of the above polypeptides.

15. A host cell comprising two or more expression vectors, wherein each vector comprises a nucleic acid sequence encoding a polypeptide selected from the group comprising SEQ. ID. DO NOT. 1 (cytl), SEQ. ID. DO NOT. 3 (cry4A), SEQ. ID. DO NOT. 5 (cry4B), SEQ. ID. DO NOT. 7 (cry 10), SEQ. ID. DO NOT. 9 (cry1 1), SEQ. ID. DO NOT. 1 1 (cyt2), SEQ. ID. DO NOT. 13 (cry3), a variant with at least 90% identity of the amino acids of the SEQ. ID. DO NOT. 1, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 3, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 5, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 7, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 9, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 1 1, a vanant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 13 and a polypeptide processed from any of the above polypeptides.

16. A host cell of any of claims 14 or 15 wherein the host cell is B. thuringiensis or Spodoptera frugiperda.

17. The host cell of any of claims 14 or 15 wherein the expression vector is a baculovirus vector.

18. The host cell of any of claims 14 or 15 wherein the host cell is a plant cell.

19. A transgenic plant comprising nucleotide sequences encoding at least two polypeptides selected from the group comprising SEQ. ID. DO NOT. 1 (cytl), SEQ. ID. DO NOT. 3 (cry4A), SEQ. ID. DO NOT. 5 (cry4B), SEQ. ID. DO NOT. 7 (cry 10), SEQ. ID. DO NOT. 9 (cry1 1), SEQ. ID. DO NOT. 1 1 (cyt2), SEQ. ID. DO NOT. 13 (cry3), a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 1, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 3, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 5, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 7, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 9, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 11, a variant with at least 90% amino acid identity of the SEQ. ID. DO NOT. 13 and a polypeptide processed from any of the above polypeptides.

20. The transgenic plant according to claim 19, characterized in that said plant is selected from the group consisting of Coffea arabica, Coffea robust, Coffea canephora, Saccharum officinarum, Elaeis guineensis, Gossypium hirsutum, Gossypium barbadense, Gossypium arboretum and Gossypium herbaceum.