MX2010014428A - Method for the positive selection of genetically transformed vegetable cells of maize and other species. - Google Patents

Abstract

The present invention provides a non-toxic method for the selection of transformed cells from a population consisting in transformed and non-transformed cells. The method comprises the following steps: a) introducing to a cell at least a nucleotide sequence of interest and at least a nucleotide sequence of selection for obtaining genetically transformed cells, where the nucleotide sequence of selection comprises a sequence that promotes the inhibition of the endogenous trehalase enzyme; b) locating the population with transformed and non-transformed cells in a culture medium containing an osmoregulating substance such as PEG 8000 and c) selecting the transformed cells from the population based on the capacity of the transformed cells to survive and develop in the presence of the osmoregulating substance, thus providing the plants resulting from these genetic transformation events with the capacity to tolerate drought and cold.

Description

Method for the positive selection of plant cells genetically transformed corn and other species Field of the invention.

The present invention belongs to the area of genetic engineering, specifically to the processes of transgenesis and cisgenesis of plant and tissue of plant origin with the objective of providing a method to select genetically transformed plant cells avoiding using as a selection marker genes of resistance to toxic substances , and without the need for the transformed cell to produce a protein and / or a new or different metabolite that has a potential negative effect on the plant cell, on the plant or on its final consumers and intermediaries. Thus, in the method of the present invention, a selection nucleotide sequence comprising a nucleic acid sequence that promotes the inhibition of the endogenous trehalase enzyme is used, conferring to the plants derived from this selection method the tolerance capacity to the drought BACKGROUND OF THE INVENTION It is known that when a genetic material is introduced into a cell population by means of transformation, only a certain number of cells will be transformed successfully. After transformation, the transformed cells must be identified and selected from a population of transformed and non-transformed cells. Identification and separation of transformed cells has traditionally been carried out using "negative selection" methods, where transformed cells are able to survive and grow, while untransformed cells are subject to growth inhibition or elimination by a substance to which, the transformed cells, by virtue of their transformation, are capable of tolerating. Generally for this purpose a selection gene, in addition to the transgene of interest, is also introduced to the cell.

This selection gene typically provides resistance to an antibiotic or herbicide, with which genetically transformed cells can be identified. After transformation, the population of transformed and untransformed cells are then cultured in a culture medium containing the antibiotic or herbicide to which the transformed cells are resistant, by virtue of the selection gene, thus allowing the non-transformed cells that they do not contain the resistance gene to the antibiotic or herbicide, they are subject to growth inhibition, and only the transformed cells are able to survive and grow due to the presence of the introduced selection gene. Among these examples we can cite the patents US6174724 and EP0131623 that use as a selection marker the gene that codes for the enzyme neomycin phosphotransferase type II (nptll), which confers resistance to certain antibiotics of the family of the aminoglycosides (kanamycin, neomycin, G418 , paromomycin), as well as patent US4727028 which uses the hygromycin phosphotransferase gene. { hpt) to give resistance to the hygromycin antibiotic.

Despite their observed effectiveness, negative selection methods have certain disadvantages. For example, untransformed cells die due to the presence of antibiotics or herbicides in the growth medium, and as a result there is a risk that not only untransformed cells but also transformed cells may die, because the cells do not Transformed damaged or in process of elimination can excrete toxic compounds.

Another disadvantage of great importance is that generally the use of such selection genes that provide resistance to a toxic compound is not recommended, from the environmental and food safety point of view, for the transgenic and cisgenic crops that are introduced and released to large scale in the environment, particularly food crops.

An additional disadvantage of the negative selection is that plant cells or tissues treated with toxic substances become more susceptible to bacterial infection. This represents a problem when Agrobacterium is used as a transformation vector, because the tissues or cells can sometimes have overgrowth of the bacteria even though antibiotics are used to prevent growth.

Within the methods of positive selection we can cite the patents US6444878 and US5767378 that use genes for the metabolism of compounds that are toxic for the cell. The first patent discloses the use of a nucleotide sequence encoding glucosamine-6-phosphate deaminase activity, as a resistance gene of genetically transformed cells growing in a culture medium containing the toxic metabolite glucosamine or one of its derivatives. The second patent describes the use of a group of genes that encode phosphomanoisomerases, phosphomanomutase, manosaepiemarase, etc., involved in the metabolism of mannose, or its derivatives or precursors; as well as the addition of any of said toxic compounds in the selection culture medium. In both cases, as in the use of genes for resistance to antibiotics and herbicides, the genetically transformed cell is produced to produce a foreign protein that, besides being an allergen, implies a metabolic expense for the transformed organism that already has been selected and does not require more of this product.

Recently, patent US7449290 describes a method of selecting genetically transformed cells where a nucleotide sequence coding for a protein having trehalase activity, which catalyzes the sugar trehalose or its methylated or halogenated derivatives, is used as a selection marker. . In this method, the enzyme trehalase is overexpressed to allow the genetically transformed cell to survive toxic concentrations of the metabolite added to the selection medium. As in the previous cases, the genetically modified organism presents an overproduction of a protein that is unnecessary after the selection process, and also involves the addition of an extra compound to the selection culture medium.

The aforementioned disadvantages can be overcome, at least substantially, by a positive selection with the method according to the present invention, which makes it possible to identify and isolate genetically transformed cells without eliminating by toxicity the untransformed cells of the population and without the co-introduction of resistance genes to antibiotics, herbicides and other compounds, besides suppressing the need to add an extra compound to the culture medium. The method according to the present invention also avoids the extra production of a protein or polypeptide, which at the end of the selection process is unnecessary.

US 7214858 and US7560613 describe fragments of nucleic acids encoding enzymes involved in the metabolism of trehalose in plants and seeds in order to obtain genetically modified plants. We propose the use of gene sequences such as: trehalase, trehalose phosphate synthetase and trehalose 6-phosphate-phosphatase. In these documents only experimental evidence is presented in transgenic plants that express trehalose 6-phosphate-phosphatase, without presenting experimental evidence for the case of the gene that codes for trehalase. In spite of this, Perry and colleagues carry out sequence alignments analysis of the trehalose enzyme of Glycine max, Neurospora crassa, corn and soybean and it is from these computational studies that they propose the use of the trehalase gene to produce genetically modified plants. where the metabolism of trehalose can be altered in plants, but without even suggesting its use as a method of selection.

Brief description of the figures.

Figure 1. A map of the gene expression unit to transform corn is observed.

Figure 2. The strategy for generating PEG 8000-tolerant corn transgenic plants by using embryogenic calli and biobalistic is observed.

Figure 3. The selection of seeds tolerant to PEG 8000 simulator of drought in T1 and verification of the molecular insertion of the functional unit corresponding to 35S NPTII is observed.

Figure 4. The amplification of the cisgen and a segment of the promoter is observed using specific oligonucleotides, from total DNA of GM Bt7 plants and control. A representative amplification is shown, however, all the seeds that germinated under stress, gave a positive signal to the PCR.

Figure 5. The quantification by RT-PCR in real time of the accumulation of the mRNA of the gene encoding the WT trehalase, wild; T1 and T4, GMs; H20, irrigated; SEQ, drought.

Figure 6. Seedlings grown in pots and tubes are observed to observe a possible effect of the container.

Figure 7. Plants are observed two months after germination in PVC tubes designed to apply drought to maize and allow physiological and soil measurements.

Figure 8. The differences in growth between the varieties are observed. The plants B73 GM is larger when compared to the B73 control plant (left panel). A comparison of the size is observed, note that the leaf can be more wavy or exuberant, thus maintaining a larger photosynthetic surface (right panel).

Figure 9. Male flowering is observed in line B73 T1 and T4 GM.

Figure 10. The appearance of the ears is observed in both GM plants, each plant having 3 to 5 ears of corn. The phenotype is substantially identical to that of the control plants.

Figure H The measurement of growth of size from sowing in cylinder until senescence is observed. The beginning of the drought is indicated, which lasted two weeks for the GM lines. The Creoles had to irrigate a week, for the symptoms developed in this application of severe drought.

Figure 12. Physiological comparisons between the varieties are observed.

Figure 13. The phenotype of plants under drought treatment is observed. Each photograph shows the plant subjected to drought to the left, while to the right is the control plant grown under irrigation. The above photos show the criollos, where plants with drought lost turgor and size. In the lower photos it is shown in the middle of the control plant, with a significant difference in size. It is worth mentioning the GM T1 plant, (extreme left) which did not show a statistically significant reduction with its control under irrigation.

Figure 14. The comparison of the photosynthesis measurement in humid and drought conditions in B73 is observed. Time of measurements: Day 1: Normal irrigation. Day 6: five days after the onset of drought. Day 13: thirteen days after the beginning of drought and the drought is suspended. Day 22: ten days after the drought is suspended.

Figure 15. Comparison of water conductance measurements in humid and drought conditions in B73 is observed.

Figure 16. The comparison of the water content measurement in wet and dry conditions in B73 is observed.

Figure 17. The comparison of the measurement of the percentage of relative humidity in humid and drought conditions in B73 is observed both in the plant and in the soil.

Figure 18. The comparison of the measurement of CO2 content in humidity and drought conditions in B73 is observed.

Figure 19. The comparison of the transpiration measurements in conditions of humidity and drought in B73 is observed.

Detailed description of the invention.

The present invention describes a method for selecting genetically transformed cells in which a nucleotide sequence of interest has been incorporated which gives the transformed cells a selective advantage. The selective advantage that the transformed cells possess may be due to their better capacity, in relation to the non-transformed cells, to survive and develop in a medium with low water availability for the cells.

One of the objects of the present invention is to provide an efficient method of selection of transformants, for example plants, where the disadvantages mentioned above for the methods using selection marker genes are eliminated. To achieve this objective the present invention provides a method for identifying and / or selecting cells that have a metabolic advantage as a result of having been transformed from a population of transformed and non-transformed cells, which are grown on or in a culture medium. containing an osmoregulatory agent, such as for example polyethylene glycol 8000 (PEG8000), mannitol, sorbitol, NaCl or any other osmoregulatory agent, wherein the method comprises: a) introducing to a cell at least one nucleotide sequence of interest and at least one selection nucleotide sequence to obtain a genetically transformed cell, wherein the selection nucleotide sequence comprises a region encoding an endogenous trehalase inhibitor, b) placing the population of transformed and untransformed cells in contact with a culture medium comprising a concentration of an osmoregulatory agent selected from the group comprising Polyethylene glycol 8000 (PEG8000), mannitol, sorbitol, NaCl or mixtures thereof, preferably at a concentration of 4% and c) select the transformed cells of the population based on the ability of the transformed cells to survive and develop in the presence of the osmoregulatory agent.

The cells that have said metabolic advantage are able to grow in the presence of the osmoregulatory agent, simulating water stress (drought) at which the growth of non-transformed cells is inhibited.

Polyethylene glycol (PEG) is a polymer produced in a range of molecular weights. In 1961, Lagerwerff published that PEG can be used to modify the osmotic potential of a nutrient solution in culture and thereby induce a water deficit in plants in a relatively controlled and appropriate manner for experimental drought protocols.

Cells, in particular plant cells, can not normally develop in a culture medium in which a relatively high concentration of PEG 8000 (4%) or higher is present because they are prevented from capturing water and nutrients causing the cell death The method according to the invention is used to select transformed cells. For this purpose, the cells are transformed with the nucleotide sequence comprising a sequence that codes for a product that promotes the inhibition of the endogenous trehalase enzyme. The population of transformed and untransformed cells is then placed in contact with a culture medium containing an osmoregulatory agent, such as PEG 8000. Transformed cells can then be distinguished from untransformed cells by the presence in their genome of a sequence nucleotide selection that codes for a product that promotes the inhibition of the endogenous trehalase enzyme, which allows it to survive and develop in a medium with an osmoregulatory agent such as PEG 8000. A nucleotide sequence that promotes the inhibition of the function of the enzyme Endogenous trehalase can be a sequence that codes for a protein that has an inhibitory effect on the enzymatic activity of trehalase, such as, for example, the sequences that code for the 85kD protein of the cockroach. { Periplaneta americana), or the proteins involved in the synthesis of validamycin, trehazolin, trehalostatin, casteligin, suidatestrin, etc., as well as their active modified forms. Another alternative to alter the endogenous trehalase enzyme in the plant is the use of antisense RNA. This strategy consists of introducing into the plant cells a genetic construct that produces an RNA that is sufficiently complementary to the endogenous RNA that codes for the enzyme trehalase, so that it interacts with the endogenous transcript of the plant itself, preventing the mRNA from translate into ribosomes and degrading the RNA by post-transchptional gene silencing, thus inhibiting the translation of said transcript. This is known as gene silencing, either through antisense technology or RNA interference (RNAi), which to date are widely known.

Thus, the nucleotide sequence that promotes the inhibition of the endogenous trehalase enzyme may preferably be a transcriptable nucleotide sequence that produces an RNA whose sequence is identical or at least partially complementary to that of the RNA produced by a DNA sequence coding for the endogenous trehalase. Said transcriptable nucleotide sequence gives the cell a competitive advantage in the culture medium with an osmoregulatory agent such as PEG 8000. The transcriptable nucleotide sequence can also be a nucleotide sequence that produces an RNA identical to the RNA produced by a nucleotide sequence that codes for endogenous trehalase.

According to the present invention, the inhibition of the enzyme trehalase is obtained by transforming a plant with the antisense of the trehalase gene of a sequence that is partially or completely homologous to the gene of the endogenous trehalase that it is desired to silence. Thus, the antisense or interfering RNA of the trehalase gene sequence used for the transformation of the cell, the population of cells, the tissue or the plant, will be partially or completely homologous to its gene or to its messenger RNA. endogenous or the trehalase sequence described in the alfalfa trehalase sequence, identified as the sequence of the MSTRE gene, as well as the corn trehalase sequence, identified as ZmTRE.

Therefore, in the present invention it is described that the sequence of the MSTRE gene of alfalfa trehalase (Medicago sativa), more specifically of the MSTRE1 gene of alfalfa trehalase, can be used to inhibit the expression of trehalase in corn, due to that the alfalfa sequence is homologous to other trehalase sequences of plant origin. In the same way, the maize sequence has homology with trehalase from other plants to be used in silencing events of the gene encoding trehalase. It is thus glimpsed that the alfalfa or maize sequence can be used in other species, considering the fact that 100% homology is not required to silence the gene. In addition, it is sufficient to express only part of the homologous gene in antisense orientation or in an interfering RNA in order to achieve an effective inhibition of the expression of endogenous trehalase.

The isolated cDNA encoding the enzyme that degrades trehalose or part of it, nucleotide sequences that transcribe antisense RNA or interfering RNA, is subsequently fused to a promoter sequence such that transcription results in the synthesis of a messenger RNA (mRNA). ) antisense or an interfering RNA (RNAi).

RNA interference is understood (RNAi) to the RNA molecules involved in the post-transcriptional silencing of a gene by this mechanism, namely RNAs orquilla (hairpin RNA, for its acronym in English: hpRNA), small RNAs (small RNAs, its acronym in English: sRNA) and microRNAs (miRNA).

The plant cell transformation techniques used to carry out the present invention are known to those skilled in the art and can be consulted in any literature related to the subject.

The method for introducing to the plant the expressible sequence encoding an inhibitor of the enzyme trehalase is not crucial for the present invention, provided that the gene is expressed in the plant cell, whether in a mono or dicotyledonous plant cell. The processes of introducing two or more genes in the same plant can be achieved with one of the following methods already known in the state of the art, for example: (a) transforming the plant with a multicopy construction containing more than one gene to be inserted, (b) co-transforming the plant with different constructions simultaneously, (c) through subsequent rounds of transformation of the same plant with the genes to be introduced, (d) crossing two floors, where each of them carries a different gene to be introduced in the same plant, or (e) combinations of the previous methods.

The term "cell" within the context of the invention includes protoplasts, and the term "cell population" includes tissues, organs or portions thereof, a population of individual cells on or within a substrate, or a complete organism, for example. , a plant.

The term "cell population" is understood according to the invention as a population of individual cells, as well as to cells in tissues, organs or parts thereof; or cells in complete organisms, such as plants, where the whole plant or parts thereof may consist of genetically transformed cells.

The term "plant" refers to a differentiated multicellular organism capable of carrying out photosynthesis, such as angiosperms and algae.

The term "plant cell" includes any cell derived from a plant and includes undifferentiated tissue, such as callus or crown tumor, also as plant seeds, propagules, pollen and plant embryos. J The present invention also includes transformed cells that have been selected using the method according to this invention, in particular plant cells, and plants regenerated therefrom, as well as their seeds and their progeny.

The method according to the invention is preferably used to select genetically modified plant cells. Examples of plants for which the method according to the invention can be used include: fruit crops such as tomato (Lycopersicum esculentum L), mango, peach, apple, pear, banana, melon, etc .; field crops such as sunflower, tobacco, sugarcane. { Saccharum officinarum L), etc .; small grain cereals such as wheat (Tritricum aestivum L), soybean (Glycine max L), barley, corn (Zea mays L), cotton, etc .; vegetables such as potatoes (Solanum tuberosum L), carrots, lettuce, squash, onions etc., as well as leguminous plants such as beans, lentils, beans and those that need to improve their tolerance to drought and / or cold.

Through the method of the invention, the transformed cells will be able to survive and grow in drought and / or cold conditions, to which a plant cell is unable to survive and develop. In this way the transformed cells can thus be selected from the total population based on their ability to survive and develop.

Since genetically modified plants are capable of inhibiting the enzyme trehalase at some level due to the introduction of the nucleotide selection sequence, the cell is able to modify its glucose flow and survive in a medium that lacks an optimal concentration of glucose. carbon available for the cell. Genetically modified plants may therefore develop while the development of non-transformed plants is inhibited. When the method according to the invention is used for the genetic selection of cells in plants, the transformed plants can be identified visually.

Therefore, the method according to the invention provides a simple and environmentally friendly selection system of transformed cells, particularly for genetically transformed cells. The ability of the transformed cells to survive and develop in a medium with low water availability overrides the need to add a selection marker compound, such as antibiotics and herbicides, to the medium.

According to the invention, any nucleotide sequence that codes for a product that promotes the inhibition of the enzyme trehalase can be used as a nucleotide selection sequence in genetically transformed cells. Although exogenous nucleotide sequences, such as those belonging to bacteria, yeast or insects, can be used, endogenous nucleotide sequences can also be used; having the advantage of not introducing material of another species.

The fact that the nucleotide sequence of selection codes for an RNA homologous or complementary to the endogenous trehalase sequence has a greater advantage, because its expression will cause a mechanism of posttranscriptional silencing of the gene either by antisense RNA, by interfering RNA or by cosuppression, which by preventing the translation of the messenger RNA, either endogenous or transgen, will prevent the production of an additional protein in the plant. To these advantages can be added the convenient use of inducible or regulatable promoters to limit the transcription process of the selection sequence to the moment when it is required to select the cells, when they are in culture after being introduced the nucleotide sequence (s). of interest next to the selection sequence.

With the above you can create genetically modified plants that we will call "cisgenic", when the nucleotide sequences come from the same species. For this invention, the antisense sequence for the enzyme trehalase for corn will come from this same species.

The desired transgene or cisgen and the selection nucleotide sequence can be introduced into the cell by transformation by standard molecular biology techniques. Although not essential, the transgene and the selection gene may be linked to one another, so that the presence of the selection gene means that the transgene is also present.

Optionally, the transgene and the selection gene can be part of the same genetic construct and be introduced into the cell by the same vector.

Since it is necessary that the introduced nucleotide sequences be expressed in the transformed cell, a genetic construct containing the two nucleotide sequences will typically contain regulatory sequences that enable the expression thereof, eg, known promoters and transcription terminators. Thus, the cointroduced nucleotide sequence will typically be associated with a promoter, which can be constitutive or regulatable.

Many cells, particularly the cells of higher plants such as Glycine max and Arabidopsis thaliana, have in their genome the genes for endogenous trehalase.

In a desirable inclusion of the method according to the invention, the selection nucleotide sequence comprises the complementary DNA (cDNA) of the enzyme MSTRE of alfalfa trehalase (Medicago sativa), or a portion thereof, as well as the corn ZmTRE gene .

In another suitable inclusion of the invention the nucleotide selection sequence comprises a sequence complementary to the cDNA of the enzyme MSTRE of trehalose of alfalfa [Medicago sativa), or a portion thereof, as well as the gene ZmTRE of corn.

In a further inclusion of the method of the invention, the transformed cells can be selected using a combination of positive selection and negative selection. For this the nucleotide sequence of interest is cointroduced into the cells transformed with a nucleotide sequence, additional to the selection sequence, which codes for resistance to at least one member selected from a group consisting of toxins, antibiotics and herbicides, and the medium in which the cells are cultured comprises at least one member selected from a group consisting of toxins, antibiotics and herbicides to which the transformed cells have existence. Although for technical reasons, the expression units; that is, the promoter plus the MSTRE gene or the promoter plus the ZmTRE gene, must be propagated in a bacterial vector in the bacterium Escherichia coli, the expression unit is isolated from the vector through obtaining it by PCR or by digestion with restriction enzymes at its ends. Once obtained the expression unit or DNA containing the promoter and trehalase gene in antisense, it is used in the genetic transformation. In this way, the plants generated lack undesirable sequences present in the bacterial vector, such as resistance to antibiotics, origin of replication, etc.esent invention is illustrated in the following examples, which are not intended to limit the scope of the invention, so that specialists in the technical field will appreciate certain modifications that may be applied to the invention without changing its scope and original spirit.

Example 1. Materials and methods. a) Manipulation of nucleic acids.

Plasmid DNA. The procedures for isolation, restriction, ligation and transformation of bacterial plasmid DNA were carried out ading to standard protocols (Sambrook et al., 1989). For the ligation of PCR products in the TOPO pCR2.1 MR vector (Invitrogen, Inc.), the manufacturer's recommendations were carried out. The sequencing of the fragments obtained by RT-PCR, 3'RACE and GeneRacer ™, was carried out in the DNA Chemistry Laboratory of CINVESTAV-Irapuato, from a small scale preparation.

Plant DNA For the cloning of the rd29A promoter sequence of Arabidopsis thaliana, a phenol: chloroform extraction of genomic DNA was carried out from Arabidopsis plants of 10 days of germination in 0.7% MS agar medium.

Plant RNA For the cloning of the cDNA of the alfalfa trehalase gene, an extraction of total RNA from tissue of alfalfa seedlings was carried out. { M. sativa cv. CUF-101) of 7 days germinated in vitro in MS agar medium 0.8%, using TRI Reagent ™ reagent (Molecular Research Center, Inc.), ading to the manufacturer's instructions. Corn 'cDNA synthesis was performed through PCR assembled with long complementary oligonucleotides.

Primers The primers used were the following: Frd29Hind 5 'AAGCTTGGAGGAGCCATAGATGCA 3' (SEQ ID No. 1), Rrd29Xba 5 'TCTAGATTTTTTTCTTTCCAATAG_3_' (SEQ ID No. 2); d [T] 23MR (SIGMA, Inc!) (SEQ ID No. 3), Tre300 5 'TATTAYTGGGATTCYTATTGG 3', where Y is T or A (SEQ ID No. 4). Tre351 5"CTGTTASTRTATRAWGCTCT 3 ', where S is C or G, R is T. A or C and W is G, C or A (SEQ ID No. 5), 3Tre300 5 'ACCAATCTCATTTCATTGAT 3' (SEQ ID No. 6), 5T18HXS 5"GTCGACTCTAGAAGC [T] 183 '(SEQ ID No. 7) 3Tre320 5 'CGGGTTTGTGCTTAATGGTG 3' (SEQ ID No. 8), Gene RacerMR RNA Oligo: 5 'CGACUGGAGCACGAGGACACUGACAUGGACUGAA GGAGUAGAAA 3' (SEQ ID No. 9) Gene Racer ™ Oligo dT: 5 'GCTGTCAACGATACGCTACGTAACGGCATGACAGT G (T) ie 3' (SEQ ID No. 10), GeneRacer R 5 'CGACTGGAGCACGAGGACACTGA 3' (SEQ ID.? ^. 11) 5Tre350 5 'AAACCCGTATTCCTCAATCA 3' (SEQ ID No. 12), Tre333 5 'TATTACTGGGATTCTTATTGGG 3' (SEQ ID No. 13), TreNsiR 5 'TTGATTTAAATGCATTTCTACCCGGG 3' (SEQ ID No. 14), USSmaR '5' CCCGGGTTGTTTGCCTCCCTGCTGCG 3 '(SEQ ID No. 15), and GUSNsiF 5 'ATGCATGATATCTACCCGCTTCGCGT 3' (SEQ ID No. 16). b) Biological material.

Plasmids For the ligation of PCR products, pGEM-T Easy Vector ™ vectors (Promega, Inc.) and TOPO TA pCR2.1 ™ (Invitrogen, Inc.) were used. The vector pBI-121MR (Clontech, Inc.) was used for the construction of expression vectors in plants.

Bacterial strains The plasmids obtained from the ligation of fragments were introduced by thermal shock to competent calcium cells of E. coli of the strains DH5a, JM109, or of the commercial strain One Shoot MR TOP 10F '(Invitrogen, Inc.).

Vegetal material. For the extraction of alfalfa RNA, alfalfa seeds variety CUF-101 were germinated in 0.7% MS agar medium. For the extraction of Arabidopsis DNA, Arabidopsis seeds were germinated in 0.7% MS agar medium. For the bombardment of snuff tobaleaf explants were used Nicotiana tabacum L. cv Xhanti, growing axenically in MS agar medium 0.7% supplemented with 2% sucrose. The Crops were maintained under cycles of 16 hrs. light / 8 hrs. dark at 26 ° C, and subcultured after 30-40 days in fresh medium.

Example 2. Cloning of the cDNA of the MsTRE gene of alfalfa.

Because the sequence coding for alfalfa trehalase is not reported, which we call MsTRE (Ms: Medicago sativa, TRE: trehalase), and in order to obtain the fragment to be used in the constructions to inhibit said enzyme, We proceeded to obtain the complete sequence of your cDNA. To this end, protocols based on the transcription amplification of this gene (RT) and its subsequent amplification by PCR (RT-PCR) were used. a) Amplification of an internal fragment by reverse transcription RT and PCR (RT-PCR).

For the amplification of internal fragments of the cDNA, simple RT-PCR assays were carried out, using degenerate oligonucleotides that were designed based on a conserved region between the coding sequences reported in the data bank (Entrez, NCBI) for the enzyme trehalase of Arabidopsis (Arabidopsis thaliana; access AAF22127), potato (Solanum tuberosum; access A67882) and soybean (Glycine max; access AAD22970). The alignment of the sequences was done using the Clustal method (Software DNA Star).

For the reverse transcription reaction (RT) the Enhanced Avian HS RT-PCR system (SIGMA, Inc.) was used and 1 pg of good quality total alfalfa RNA was required, which was incubated at 70 ° C for 10 minutes. min with 1 μ? _ of Anchored Oligo (dT) 23 R (0.5pg / L) and 1 requests a mixture of dNTPs (dideoxynucleotides) (10 mM each), in a final volume of 10 pL with sterile bidistilled water, according to the manufacturer's instructions. The mixture was placed immediately on ice after incubation in heat, and 6 μ? Of water reagent grade PCR, 2 μ? Of Buffer for AMV-RT 10X, 1 μ? Of RNase inhibitor ( 20U / pL) and 1 μ? _ Of RT Enhanced AMV enzyme (201? / Μ? _), In a final volume of 20 μ ?. This mixture was incubated at 42 ° C for 60 min, to allow the synthesis of the first strand of DNA.

For PCR amplification, 3 μ? _ Of the first strand synthesized by RT, 1 μ? _ Of JumpStart AccuTaqMR DNA Polymerase (2.5U / pL), 5 μ? _ Of Buffer AccuTaq R 10X, 1 μ? _ Of mixture of dideoxynucleotides (10 mM each), 2 μ? _ of the degenerate sense oligonucleotide (100 ng / L) and 2 μ? _ of the degenerate reverse oligonucleotide (100 ng / pL), in a final volume of 50 μ? _ with water reagent grade PCR. With this reaction mixture, the chain polymerization was performed to amplify an internal fragment of the trehalase cDNA.

The fragment obtained by PCR was cloned in the vector pGEM-T Easy Vector ™, which was later introduced by thermal shock of 45 sec at 42 ° C to calcium-competent DH5a bacteria. The transformed bacteria were characterized by enzymatic EcoRI digestion of their plasmid DNA, those that released the amplified fragment were selected. The sequencing of this fragment gave us the nucleotide sequence on which the oligonucleotides used in the following protocols were designed for the cloning of the 5 'and 3' ends of the alfalfa trehalase cDNA. b) Amplification of the 3 'end by the 3'RACE protocol.

For the 3'RACE protocol, the first DNA strand synthesized initially by reverse transcription was used. With this cDNA a first amplification was carried out by PCR, using a pair of specific oligonucleotides designed from the sequence obtained for the internal fragment. This amplification was followed by a semi-stained PCR, using the same specific reverse oligonucleotide used in the first PCR together with a new specific sense oligonucleotide designed from a more internal position of the sequence obtained for the internal fragment. The amplified sequence was cloned in a TOPO TA vector pCR2.1MR (Invitrogen, Inc.), originating the plasmid TOPO-3Tre, which was purified for its enzymatic characterization Eco Rl and its subsequent sequencing and manipulation. Because in this region most of the regions conserved between the trehalase sequences of plant origin are found, this fragment is sufficient to design the vectors to inhibit the endogenous trehalase enzyme. c) Amplification of the 5 'end by GeneRacer.

To obtain the 5 'end of the alfalfa trehalase cDNA, the GeneRacer ™ system was used. This protocol was based on 3pg of the total RNA previously handled, following the manufacturer's instructions for the dephosphorylation of the RNA, the removal of the CAP structure and its subsequent ligation to the supplied RNA oligo.

From this modified messenger RNA, we proceeded to the synthesis of the complementary chain (cDNA) using the AMV-RTMR system (SIGMA, Inc.). The complementary strand obtained was subsequently used as a template in the PCR amplification using the GeneRacer 5, R oligonucleotides and a specific reverse oligonucleotide designed from the sequence of the internal fragment obtained by. RT-PCR. The amplified sequence was cloned in the TOPO TA vector pCR2.1 MR, giving rise to the TOPO-5Tre plasmid, which was purified for its enzymatic characterization with the Eco Rl endonuclease and for its subsequent sequencing.

From the alignment of the three fragments obtained by this strategy, the complete sequence of the alfalfa trehalase cDNA shown in the MSTRE1 Sequence was obtained.

Example 3. Design of the TRE antisense (TREas) and interfering RNA (TRE-RNAi) sequences.

| A) Amplification and cloning of the internal TRE fragment with greater homology between species.

To express in plants an antisense trehalase sequence under the 35S and rd29A promoters, an internal 560 bp fragment of the sequence was first selected, which includes small conserved regions between the different plant trehalases, and is shown in Sequence 2. To this end, a pair of specific oligonucleotides Tre333 and TreNsiRw were designed that amplify the internal fragment (TRE) selected from plasmid DNA of the TOPO-3Tre vector. The TreNsiRw oligo introduces an Xma I site followed by a 'Nsi I site at the 3' end of the sequence. The amplified product was cloned into the TOPO TA pCR2.1 MR vector, giving rise to the TOPO-tre560s and TOPO-tre560as plasmids, due to the bidirectional insertion of the fragment into the vector. In these two constructions the insert is flanked at one end by the Sacl site and on the other side by the Xba I and Nsi I sites of the vector, which allowed us to determine the direction of the fragment by digestion at the Nsi I site of the sequence TRE, with respect to these sites (direction sense: Sacl-Xbal, antisense address: Xbal-Sacl). b) Construction of the TOPO-GUS intermediary vector.

In the construction of the interfering RNA for alfalfa trehalase, it was necessary to have a "loop" sequence to join the two copies of the TRE sequence. An internal 1.020 bp fragment of the sequence of the b-glucuronidase gene (GUS, uidA gene) of E. coli was used. This sequence was amplified by PCR using the primers GUSSmaR and GUSNsiF, from plasmid DNA of plasmid pBI-121. The primers used were designed based on the GUS sequence included in the vector sequence pBI-121 (access AFA85783), and introduced at the ends of the amplified fragment an Xma I site and a Nsi I site, respectively. The PCR product was cloned into the TOPO TA pCR2.1 R vector, giving rise to the TOPO-GUSs and TOPO-GUSas plasmids, due to the bidirectional insertion of the fragment into the vector, which was determined by Nsi I digestion. c) Construction of the interference RNA with the TRE fragment.

For the construction of the interference RNA for trehalase, two copies of the TRE fragment placed opposite to each other (head to head), and ligated with the amplified 1, 020 bp fragment of the GUS sequence were placed. For this, the TRE fragment of the plasmid pTOPO-tre560as was initially released as an Xba \ -Nsi I fragment, and inserted in the same sites of the pTOPO-GUSs plasmid, giving rise to the pTOPO-GT plasmid (GUS: TRE). Subsequently, the GT fragment (GUS: TRE) was released from this plasmid by Sacl -Xma digestion and was cloned in the same sites of plasmid pTOPO-GUS AS, to give rise to the plasmid pTOPO-TGT (TRE: GUS: TRE) . The clones positive for this construction were characterized by double digestion Sac \ -Xba I, and by simple digestion Nsi.

Example 4. Construction of expression control vectors. a) Amplification of the rd29A promoter sequence.

The rd29A promoter sequence was amplified by PCR from genomic DNA extracted from leaf tissue of Arabidopsis seedlings. The seeds were provided by the Institute of Biotechnology of the UNAM-Cuernavaca. For the amplification the oligos Frd29Hind and Rrd29Xba were designed, based on the reported promoter sequence (access D13044). This pair of oligos amplify the fragment comprised of nucleotide 4563 to 5504, and flank it with the Hind III and Xba I sites. The PCR product was cloned into the TOPO TA vector pCR2.1 MR to yield the TOPO-rd29 plasmid. b) Construction of the inducible expression control vector in plants: prd29A: GUS.

The rd29A promoter sequence was released from the TOPO-rd29 vector by an enzymatic double digestion with Hind \ W-Xba I, and subcloned in the same sites of the pBI-121 MR vector (Clontech, Inc.). In this construct, the rd29A sequence replaces the 35S CaMV promoter, giving rise to plasmid prd29A: GUS. This vector constitutes the control plasmid of the inducible expression vectors for the antisense and interfering RNA of trehalase. c) Vector control of constitutive expression in plants: pBI-121 (p35S: GUS).

The rd29A promoter sequence was freed from the TOPO-rd29 vector by an enzymatic double digestion with Hind III and Xba I, and subcloned in the same sites of the pBI-121 MR vector (Clontech, Inc.). In this construct, the rd29A sequence replaces the 35S CaMV promoter, giving rise to plasmid prd29A: GUS. This vector constitutes the control plasmid of the inducible expression vectors for the antisense and interfering RNA of trehalase.

Example 5. Construction of the expression vectors for the TRE antisense fragment (TREas) and interference RNA (TRE-RNAi). a) Construction of the expression vector of the antisense TRE fragment (TREas) under the promoters 35S and rd29A.

To direct the trehalase sequence in antisense orientation in the plasmids with the 35S and rd29A promoters, said trehalase fragment was released from the TOPO-tre560s vector by Sac-Xba I digestion, and subcloned in the same sites of the pBI- plasmids 121 and prd29A: GUS, giving rise to plasmids p35S: TREas and prd29: TREas, respectively. In both vectors, the antisense fragment replaces the GUS gene and precedes the NOSter region (terminator and polyadenylation region of the gene encoding nopaline synthase). b) Construction of the RNAi-TRE cassette expression vector under the 35S and rd29A promoters.

For the expression in plants of interfering RNA of trehalase (TRE-RNAi), this cassette was released from the TOPO-TGT vector by means of a double digestion Sac \ -Xba I, and subcloned in the same sites of plasmids pBI-121 and prd29A: GUS, giving rise to plasmids p35S: TRE-RNAi and prd29: TRE-RNAi, respectively. In both vectors, the cassette of RNAi replaces the GUS gene and precedes the NOSter region (terminator region of the nopaline synthase gene).

Example 6. Obtaining corn GM plants according to the invention. a) Integration in corn of the constructs for the expression of the antisense TRE fragment (TRE AS) under the 35S and rd29A promoters.

To obtain maize GM plants from the pure lines B73 and H99 that express the antisense of the trehalase enzyme under the control of the 35S or rd29A promoters, the p35S-TREas and prd29A: TREas plasmids were integrated by the biobalistic system and with the use of embryogenic calluses growing in axenic culture. b) Preparation and bombardment of micro particles with DNA.

For the bombardment of the particles / DNA, the high pressure Helium system PDS 1000-HeMR was used. The preparation of the tungsten particles, the coating with the DNA and the bombardment parameters were carried out, according to protocols known to a technician with average knowledge, using 6 boxes for each construction of bombarded DNA.

Example 7. Evaluation of the system as selection marker.

A selection was made in culture medium with growth regulators to induce the formation of somatic embryos (embryogenic callus) supplemented with 4% PEG-8000 with embryogenic callus bombarded with the antisense constructs for trehalase and its controls, maintained in medium MS culture supplemented with Dicamba 2 mg / L. Adenine 40 mg / L, sucrose 3% and PEG 8000 4% and incubated at 26 ° C and photoperiod 16 hours light / 8 hrs. darkness.

Example 8. Construction of a corn trehalose expression unit.

The gene that codes for the enzyme corn trehalase was selected in order to generate a cisgenic plant. This open reading frame (ORF) was inverted and obtained the complementary one, to express it under the regulation of the simple 35S promoter, with the polyadenylation sequence of the gene encoding the enzyme nopaline synthase of Agrobacterium tumefaciens. The sequence obtained was modified in two bases to eliminate two internal EcoRI restriction sites, also, a non-coding sequence was inserted, which will serve as a flag (Tag) to identify this transformation event. It should be noted that the antisense gene does not contain any open reading frame, so there is no synthesis of any protein when inverting said ORF There is a restriction site for asymmetric natural EcoRV that serves as a reference in detection tests through other methods (Figure 1) This expression unit was obtained by annealing long complementary oligonucleotides in vitro, assisted by PCR. The produced 1802 bp fragment was cloned into a bacterial vector pCR8 Topo (Qiagen). Digestion with EcoRI produced a 1.8 Kb fragment, which was purified and used in biobalistic experiments on corn embryogenic callus.

Example 9. Genetic transformation of the B73 pure line of corn with the use of embryogenic callus and biobalistic.

Embryogenic callus were induced from the pure line of B73 maize (see Figure 2) from mature seeds in an MS medium (Murashige and Skoog 1961) supplemented with Dicamba 2 mg / L, Adenine 40 mg / L, sucrose 3%, pH 5.8 and gelrite 2.5 g / L. An embryogenic callus line with a high cell division capacity was used, compared with the rest of the lines.

Embryogenic corn calluses were bombarded with the plasmid containing the antisense trehalase expression unit, gold microparticles, were selected in the presence of 4% PEG 8000 for two months (three subcultures were carried out) until generating tolerant clones. PEG and the non-bombarded callus (which we call negative controls) presented cell death.

The transgenic clones were propagated for one month in medium with PEG, until a sufficient mass was obtained to carry out the regeneration of plants in an MS culture medium (Murashige and Skoog 1962) supplemented with BAP 0.2 mg / L, Cinetin 0.1 mg / L , 1% sucrose, gelrite 2.5 g / L. The regenerated seedlings were transferred to soil and under greenhouse conditions to promote their life cycle until obtaining seeds. The seeds generated were sterilized with chlorinated gases to avoid future contamination with fungi. To monitor the tolerance to PEG 8000, the transgenic seeds, T1 generation, were seeded in jars containing 7% PEG 8000 and compared their survival capacity with seeds of the unprocessed B73 (wild) pure line. The transgenic seeds in the T1 generation showed a segregation for their growth capacity in 4% PEG 800 (25% tolerant) while the negative controls were not able to germinate under these conditions. In this phase the transformed plants showed their ability to survive in an environment with water deficit. The tolerant plants were transferred to the greenhouse to obtain the subsequent generations 12, T3, following the procedures of selection in the seed phase with the PEG 8000, until generating a population that produced ears with 100% of seeds tolerant to PEG 8000. They were selected two transgenic lines that we call T1 and T4 to submit to drought tolerance assessments. These lines showed the best agronomic behaviors in their life cycle. (Figure 3).

Plants resistant to 7% PEG 8000 were transferred to greenhouse conditions to allow them to complete their life cycle. DNA from 5 independent events of genetic transformation was isolated to verify the insertion of the 35S functional unit, neomycin phosphotransferase type II NPTII gene present in the bombarded plasmid. Lane 1 and 2 correspond to papaya plants transformed with the same vector, where the expected 1.8 Kb signal is appreciated, lane 3 is a negative control of corn, lane 4 corresponds to corn line T4, lane 5, to line T7, lane 6 to line T12, lane 7 to line T1, lane 8 to line 6, lane 9 is undigested DNA from line T4. Due to its capacity for growth and vigor, we selected lines T1 and T4 for future drought tolerance experiments.

Example 10. Molecular characterization of drought-tolerant corn plants.

Seeds derived from the third inbred generation of transgenic lines T1 and T4 were used for this phase. For this phase, the selection of plants to develop the experiment consisted of germinating the seeds in a 7% PEG 8000 solution, which represents a means of water stress by not leaving the PEG available to the water to be absorbed by the seed. Seeds that were able to germinate under this selective agent were subsequently grown under greenhouse containment conditions and controlled growth rooms. A segment of 2 cm2 of leaf was taken from the plants, from which total DNA was extracted with the DNeasy kit from Qiagen. This DNA was used as a template to amplify the open reading frame of the gene and an internal segment of the 35S promoter, using specific oligonucleotides. The products were resolved in a 1% agarose gel, where a band in the GM plants of approximately 950 base pairs is observed, which corresponds to the expected size. As control, DNA from control plants was used, while a negative reaction was carried out without the addition of hardened DNA. (Figure 4).

Example 11. Detection of the trehalase transcript by quantitative RT-PCR (RT-PCR in real time).

The molecular strategy of gene attenuation was carried out through the expression of the open antisense reading frame of the gene encoding the enzyme trehalase. Because this strategy does not turn off the transcription of the reference gene, the muted ratio was calculated by quantifying the accumulation of this gene. As shown in graph 1, in drought conditions, the expression attenuation is manifested, through the lower accumulation of the reference transcript at 86 and 76% of the highest value that the plants have when they grew under normal irrigation. . This attenuation is consistent with the decrease in mRNA accumulation between 14 and 24%, which is sufficient to provide a phenotype of stress tolerance to drought in GM plants. (Figure 5).

Example 12. Quantification of total glucose as a measure of the activity of the enzyme trehalase.

Trehalase is an enzyme that uses trehalose as substrate and in the presence of water produces two molecules of glucose. The method described by Freydiere et al. (2002) adapted to corn. 100 mg of fresh tissue was macerated in a microtube using a pistil. The homogenate was centrifuged and the supernatant was transferred to a clean tube. The microcell with Roche Accu-chek electronic device, pre-calibrated for glucose, was used. The values obtained of glucose in wild plants were of 64 mg / dL, while the GM plants expressing trehalase in antisense showed values of 51 mg / dL. The trehalase attenuated by the molecular strategy prevents hydrolysis to glucose from trehalose, being consistently quantified in 79% of the concentration determined in wild plants. These results are consistent with the accumulation of the mRNA detected by quantitative RT-PCR in real time.

Example 13. Physiological characterization of drought tolerant corn plants. a) Growth of lines B73 GMs.

Evaluation and selection of seeds.

Seeds of the B73-T1 and B73-T4 cisgenic lines of corn and wild B73 maize were placed to germinate as control, black and white Creole; as well as white corn and cacahuazintle, these were placed in petri dishes with water in the growth chamber at 26 ° C for 5 days. After germination, the seedlings were transferred to substrate containing peat, sandy soil and agrolite, in a 60 cm PVC tube. of depth and 25 cm in diameter. The lower cover contains many perforations to allow drainage of water, this cover can be detached to observe the root part. Finally, the vegetative growth, appearance of anthers and female flowers, seed production and senescence were monitored. b) Measurement of agronomic parameters in the vegetative phase (figures 6 and 7).

Two varieties of criollo maize, known for their ability to tolerate drought, were used as an internal comparison control. Two months after planting the corn, the criollos showed greater size with respect to the transformed lines and the smaller ones the control B73. It should be noted that the size of the criollos is a genetic characteristic of the Creoles of reference, which manifests itself in any habitat. Figure 8 shows the phenotypes obtained from vegetative growth under irrigation conditions.

In these images you can see the clear differences in the growth between the varieties, the criollas are bigger, then in size they follow the transformed B73 T1 and T4 and the smaller ones the B73 control (see Figure 8).

The drought was applied simply by stopping the supply of water and mineral solution. As indicated, the substrate is composed of peat and agrolite, which have a low water retention. Below are the effects of the drought on the phase of greater susceptibility of the plant, which is the stage of production of female and male flowers, as well as the number of ears and grain filling. c) Flowering: male flower (anthers and pollen).

The first plants to produce spikes, which are components of the male flower were B73-T1 and T4, with respect to the B73 control plants that were 25 days later. The appearance of spikes of the landraces occurred 30 days later. This delay in flowering is a characteristic of plants that have water stress, as well as an increase in the interval of appearance of ears and ears (Figure 9). d) Flowering: female flower (ears).

The first plants to induce the formation of the female flower were the lines B73-T1 and T4, with respect to the control, which were 17 days later. Very noticeably, wild black and white Creole plants, although they produced spikes, the formation of female flowers or ears of corn did not occur, presumably because of the stress they were subjected to. Plants after grain filling entered the senescence period, characteristic of a decrease in photosynthesis and turgor in the plant (Figure 10). e) Seed production.

Seed production was evaluated by collecting the ears of each of the plants analyzed and in which they were developed. Before the evaluation, they were dried appropriately at 37 ° C for 8 days. As can be seen there is a marked increase in the seeds of the transformed plants in relation to the negative control. The number of seeds per row as well as the number of rows and the average weight indicates the marked superiority of these plants in the production of seeds. The results are the average of 15 ears per genotype (table 1).

Table 1 f) Senescence.

The state of senescence was comparable in all treatments, independently of the formation of female flowers.

Example 14. Measurement of agronomic parameters. a) Growth measurement.

Figure 1 1 shows the size of the base of the plant up to the apical growth zone, in a kinetics from germination of seeds to senescence. The plotted points show the averages obtained from the plants of each treatment. As can be seen, the plants of the B73 line showed a lower growth rate than the criollas. However, the comparison of GM BT73 and control showed a higher rate in GM. Regarding the landraces, these showed a greater growth and among them this was very similar, which reached to exceed 3.5 meters in height. It should be noted that the control line B73 increased its growth before starting flowering, here that had a greater expenditure of nutrients at that time since it used them to grow and bloom at the same time, unlike the transformations that were synchronized, first they grew and after a while they flourished. As indicated, the criollo plants stressed by drought failed to produce ears, despite having reached great heights. b) Physiological comparisons.

Regarding the physiological comparison between the varieties, in these images we can observe the differences in size, color of the leaves and stem, where the Creole varieties have a larger size than B73 and their coloration is a pale green and not very bright compared to B73 which has a strong and lustrous green and its leaves are more fleshy. For the case of the shape and thickness of the stem, the Creoles have a thinner and rounder stem and the B73 tend to be oval and thick, which gives greater resistance and the possibility of having a totally erect growth, contrary to the criollas that after the two meters of height its stem began to arch. It is necessary to carry out a field test, because the secondary rooting of maize is limited by controlled tests in the greenhouse (Figure 12).

Example 15. Measurement of photosynthetic parameters in conditions of humidity and stress due to drought. a) Induction of drought.

The plants were divided into two groups and one group was left to irrigate, keeping the other as control. Figure 13 shows the stress phenotype shown by the plants after stress, the photos show the characteristics after 13 days of having stopped the irrigation.

In these images we can observe the response of the plants to the stress of drought with respect to the plants that were not subjected to this treatment. Those that showed a greater affectation to drought were the black and white Creole varieties, where turgor loss of its leaves, wilting and chlorosis was observed; being even stronger these symptoms in the black Creoles. It should be noted that for the Creole plants, the drought should have been suspended 6 days after the beginning of the drought given that they already showed severe effects of damage from this stress. Plants that remained without watering after this time reached their permanent wilting point.

In the case of the cisgenic varieties, effects were only observed between 1 1 and 13 days after drought induced, where they saw a curling of their leaves and a slight chlorosis. The plants that showed a greater effect were the T4 and these also retarded their growth during the application of the drought. Regarding the control B73, these did not present very noticeable effects because at that time its longitudinal size was noticeably lower compared to the transformed, which gives it a lower water requirement. b) Photosynthetic parameters.

The B73-T1 line has a higher photosynthetic rate in humid conditions compared to the control and T4 varieties. In contrast, during the drought all decreased their photosynthesis at 6 days, but only T1 had a slight increase at 13 days, where the plants were irrigated. The violet bar indicates the photosynthetic rate at which the varieties return after starting irrigation (Figure 14).

Conductance is a measure of the concentration of ions in plants, whether intracellular or intercellular. In the case of conductance measurement, the GM T1 plant gave a conductance reduction response greater than 50% at 6 days and more than 100% at 13 days of drought. In comparison with T4, this conductance decreased to almost 50% at 6 days and control only at 13 days, who decreases it by approximately 40%. This leads us to conclude that T1 has a greater survival and water expenditure response than T4 and Creole. (Figure 15).

The results described in Figure 16 are describing the internal water content, where we can see that T1 is the one with the lowest water content compared to the T4 and the control in the drought. Plants T1 and T4 show a notorious adaptive response, since they can store significantly more water than the control plant after the drought stress regime.

An important parameter is the relative humidity of the substrate where the plant grows. To corroborate the response of the lack of water, the percentage of relative humidity in the plant and that of the soil was measured, where it is observed that the control plants started the dry period even with more water than the GM plants. Subsequently, the relative water content was decreasing as a result of the treatment. At 13 days the roots had absorbed 50% of the water in the pot unlike the control, this could be due to the control plants had a smaller size at the time of comparison and their water requirement are lower (Figure 17).

The measurement of intracellular C02 reflects the stomatal opening, which is influenced by drought. The opening of the cells responsible for allowing gaseous exchange is controlled by a mechanism dependent on abscisic acid, which is produced by water stress; among other abiotic stress factors. In this graph it is observed that in spite of applying the stress, the GM plants continue to exchange gases, in contrast to the control that remains with high concentrations of internal CO2 (Figure 18).

The previous idea can be corroborated with this graph of perspiration, which indicates the stomatal opening that exists at the time of measurement, where we observe that it is true that T1 has a lower respiratory rate since it closes its stomata at more than 50 %, T4 at the beginning of the drought takes a response but after 6 days it decreases its transpiration rate to more than 50% and as regards the control B73, it only decreases its respiratory rate at 6 days more than 30 % and 13 days to almost 50%. (Figure 19).

Example 16. Tolerance to cold stress in plants with trehalase in antisense. Control corn plants with the antisense trehalase gene were germinated at 4 ° C for three days and subsequently grown at 16 ° C. The wild plants could not progress in their growth, in contrast to the genetically modified, which were transferred to pots for the progression of their vegetative growth. Under controlled greenhouse conditions, temperature oscillation in the winter season of up to 2 ° C was allowed as the minimum temperature. The plants with the trehalase gene in antisense progressed in their vegetative growth, in contrast to the wild ones. The in vitro and greenhouse data are consistent in that plants enhanced with the antisense trehalase gene according to the present invention have cold tolerance. Likewise, the plants obtained were able to develop the first spikes, which are the male organ that generates pollen to start its reproductive stage.

There are three possible mechanisms that can explain the protective capacity of trehalose on biomolecules, such as water availability, crystal formation and chemical stability. These are not exclusive and may have additive effects to produce the effects of tolerance to drought and cold observed and generated according to the present invention. For example, the hydration layer formed by water interacting with the molecule through hydrogen bonds can stabilize the molecules and inhibit their irreversible denaturation (Roser et al., 1993; Clegg, 1985).

The glycosidic bond between the two D-glucose residues shows chiral flexibility, probably allowing trehalose to interact with other polar groups of different molecules. Trehalose is the only sugar that forms stable amorphous crystals in extreme temperatures. This disaccharide has been proposed as a protector of enzymatic activity, enzyme stabilizer, food additive, cryopreservator of cells, tissues and organs, and enhancer of flower storage life (Eroglu et al., 2000; Guo et al., 2000). ).

This disaccharide has also been described as a signaling molecule. The evidences in our laboratory have allowed us to quantify trehalose in the sap of the phloem and the enzymatic reaction for its synthesis is compartmentalized. The producing tissues 0 photosynthesizers contain the enzyme trehalose phosphate synthase, while trehalose phosphate phosphatase is found in consumer tissues.

References. 1 Aguirre-Gomez, J.A., et.al 2000. A regional analysis of maize biological diversity in Southeastern Guanajuato, Mexico. Economic Botany. 54 (1): 60-72. 2 Aylor E.D., et.al. 2005. Some physical properties of teosinte (Zea mays subsp. Parviglumis) pollen. J Exp Bot 56 (419): 2401-2407. 3 Baltazar M.B, et.al. 2001. Maize pollen biology, pollen drift and transgenes. In: Proc 56th Cornand Sorghum Seed Res Conf. Chicago. 4 Baltazar M.B., et.al. 2007. Assessment of potential impact of hybridization between teosinte (Zea spp.) And maize (Zea mays spp. Mays) on dormancy characteristics of teosinte. Gene flow symposium at the North Center. 5 Baltazar M.B., et.al. 2005. Pollination between maize and teosinte: an important determinant of gene flow in Mexico. Theor Appl Genet. 1 10: 519-526. 6 Bassetti P., et.al. 1993a. Emergence, elongation, and senescence of maize silks. Crop Sci. 33: 271-275. 7 Bassetti P., et.al. 1993b. Senescence and receptivity of maize silks. Crop Sci. 33: 275-278. 8 Benz, B.F. 2001. Archaeological evidence of teosinte domestication from Güila Naquitz, Oaxaca. Proc. Nati Acad. Sci. USA 98, 2104-2106. 9 Bellon M.R., et.al. 1994. Keepers of maize in Chiapas, Mexico. Econ. Bot. 48: 196-209. 10 Castillo F (eds) ProcForum: gene flow among maize landraces, improved maize varieties, and teosinte: implications for transgenic maize. CIMMYT, Mexico City, pp 44-53 1 1 Castillo G.F., et.al. 1997. Research on gene flow between improved land races. In: Serratos JA, Willcox M.C., Castillo-Gonzalez F. (eds) Proc Forum: gene flow among maize landraces, improved maize varieties, and teosinte: implications for transgenic maize. "CIMMYT, El Batan, Mexico, pp. 67-72 12 Castro-Gil M. 1970. Frequencies of maize by teosinte crosses in a simulation of a natural association. Maize gen. Coop. Newsletter 44:21 -24. 13 Cervantes M.J.E. 1998. Genetic infiltration between local and introduced varieties of corn from the traditional system of Cuzalapa, Jalisco. PhD thesis, Postgraduate College, Montecillo-Texcoco, Edo. From Mexico, Mexico CIMMYT http://www.cimmyt.org/ 14 Clegg, J.S. The physical properties and metabolic status of Artemia cysts at low water contents: "The water replacement hypothesis". In Membranes, Metabolism and Dry Organisms; Leopold, A.C., Ed .; Cornell University Press: Ithaca, NY, USA, 1985; pp. 169-187. 15 De la Cruz L. 2007. Systems of genetic incompatibility in maize and teosinte (Zea spp.) In Mexico. Doctoral Thesis. University of Guadalajara, Zapopan, Jalisco. January 30, 2007. 16 Deng, M.Y., et.al. 1999. Molecular Characterization of Roundup Ready Corn Une NK603. Technical Report MSL-16214, Monsanto Company, St. Louis, MO. 17 Di-Giovanni F., et.al. 1991 Factors affecting pollen dynamics and its importance to pollen contamination: a review. Dog. J. For. Res. 21: 1 155-1 170. 18 Di-Giovanni F., et.al. 1995. The variability in settling velocities of some pollen and spores. Grana 34: 39-44. 19 Doebley, J. F. 1990. Molecular evidence and the evolution of maize. Econ. Bot. 44 (3 supplement): 6- 27. 20 Doebley J.F., et.al. 1980. Taxonomy of Zea (Gramineae). II. A subgeneric classificatíon with key to taxa. Amer. J. Botany 67: 982-993 21 Ellstrand N.C., et.al. 2007. Spontaneous hybridization between maize and teosinte. J. of Hered. 98 (2): 183-187. 22 Eroglu, A .; et.al. 2000. Intracellular trehalose improves the survival of cryopreserved mammalian cells. Nat. Biotechnol., 18, 163-167. 23 Eubanks M.W. 2001 The mysterious origin of maize. Econ. Bot. 55: 492-514. 24 Evans M.M.S., et.al. 2001 Teosinte crossing barrier, to locus governing hybridization of teosinte with maize. Theor. Appl. Genet 103: 259-265. 25 FAO http://www.fao.org/index_en.htm 26 Fink, L.A., et.al. 1983. Expression of bacterial genes in plant cells. Proc Nat Acad Sci U.S.A., 80 (15), 4803-07. 27 Source AgBios http://www.agbios.com/. 28 Goggi, A.S., et.al. 2006. Statistical analysis of outcrossing between adjacent grain production fields, Field Crops research. 29 Gould, F.W. 1968. Grass Systematics. McGraw Hill, N.Y., USA. 30 Guadagnuolo R., et.al. 2006. Relative fitness of transgenic vs. non-transgenic maize x teosinte hybrids: a field evaluation. Ecol. Appl. 16 (5): 1967-1974. 31 Guo, N .; et.al. 2000. Trehalose expression confers desiccation tolerance on human cells. Nat. Biotech., 18, 168-171. 32 Jones, J.M., et.al. 1950. Effectiveness and distance of border rows in preventing outcrossing in corn. Oklahoma Agrie. Exp. Pollen Sta. Tech. Bull. No. T-38. 33 Jugenheimer, R.W. 1976. Maize Improvement, Seed Production, and Uses, John Wiley & Sons, Inc. New York, New York. 34 Kato Y.T.A. 1997. Review of introgression between maize and teosinte. In: Serratos JA, Willcox MC, 35 Kermicle J. 1997. Cross compatibility within the genus Zea. In: Serratos JA, Willcox MC, Castillo F (eds) Proc Forum: Gene flow among maize landraces, improved maize varieties, and teosinte: implications for transgenic maize. CIMMYT, Mexico City, pp 43 36 Kiesselbach, T.A. 1980. The structure and reproduction of corn. Reprint of: Research Bulletin No. 161. 1949. Agricultural Experiment Station, Lincoln, Nebraska. University of Nebraska Press, p. 93 37 Kermicle J .. L. 1997. Tables and pathways, p. 306 in Mutants of Maize, edited by M. G.

NEUFFER, E. D. COE and S. R. WESSLER. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 38 Kiesselbach T.A. 1999. The structure and reproduction of corn, 50th anniversary. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 39 Luna V.S., et.al. 2001 Maize pollen longevity and distance isolation requirements for effective pollen control. Crop Sci 41: 1551-1557. 40 Mangelsdorf, P. C, et.al. 1981. The probable origin of annual teosintes. Bussey Inst., Harvard Univ. Publ. 10, 1-69. 41 Martinez-Soriano J.P.R., et.al. 2000. Transgenic maize n Mexico: No need for Concern. Sci. Vo. 278 (5457): 1399. 42 Mondrus-Engle, M. 1981. Tetraploid perennial teosinte seed dormancy and germination. J. of Range Manag. 34 (1): 59-61. 43 Nida, D.L., et.al. 1996. Glyphosate-Tolerant Cotton: The Composition of the Cottonseed Is Equivalent to That of Conventional Cottonseed. J. Agrie. Food Chem., 44: 1967 -1974. 44 Ode J. T., et.al. 1985. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35s promoter. Nature 313, 810-12. 45 OECD. 2002. Consensus document on compositional considerations for new varieties of maize (Zea mays): key food and feed nutrients, anti-nutrients and secondary plant metabolites. Organization for Economic Co-operation and Development, Environmental Health and Safety Publications. Paris, France ENV / JM / MONO (2002) 25 46 Purseglove, J.W. (1972). Tropical Crops: Monocotyledons 1. Longman Group Limited., London. Raynor, G.S., Ogden, E.C. & Hayes, J.V. (1972). Dispersion and deposition of com pollen from experimental sources. Agronomy Journal 64, 420-427. 47 Roser, B .; et.al. 1993. A sweeter way to fresh food. New Sci., 138, 25-28. 48 Rossi D. 2009. Drought tolerant corn: the expected event. www.engormix.com/MA- agriculture / corn / forums. 49 Watson, L, et.al. 1992. Grass Genera of the World: Descriptions, Illustrations, Identification, and Information Retrieval; including Synonyms, Morphology, Anatomy, Physiology, Phytochemistry, Cytology, Classification, Pathogens, World and Local Distribution, and References. Version: 18th August 50 Watson, S.A. 1982. Maize: Amazing Maize. General Properties. In CRC Handbook of Processing and Utilization in Agriculture, Volume II: Part 1 Plant Products. Wolff, I.A. Ed .; CRC Press, Inc .: Boca Raton, FL .; pp. 3-29. 51 Watson, S.A. 1987. Structure and composition. In Corn: Chemistry and Technology. 52 Watson, S.A., et.al. Eds .; American Association of Cereal Chemists, Inc.: St. Paul, MN; pp. 53-82.

Wiikes H.G. 1967. Teosinte: the closest relative of maize. Bussey Inst. Harvard Univ. 159 p.

Wiikes H.G. 1977. Hybridization of maize and teosinte in Mexico and Guatemala and the improvement of maize. Econ Bot 31: 254-293 WHO (World Health Organization). 1999. International Program on Chemical Safety (IPCS). 1999. http://biodiversity.uno.edu/delta

Claims (35)

1. Claims 1. A method for selecting genetically transformed plant cells from a population of cells, without the use of selection genes coding for resistance to antibiotics, herbicides and / or substances toxic to the cell, characterized by comprising the following steps: a) introducing to a cell or cell population at least one nucleotide sequence of interest and at least one selection nucleotide sequence for obtaining genetically transformed cells, wherein the selection nucleotide sequence comprises a region encoding an endogenous trehalase inhibitor; b) placing the population of transformed and untransformed cells in contact with a culture medium containing an osmoregulatory agent in sufficient quantity for it to survive; Y c) selecting on the basis of the competitive advantage at least a portion of cells genetically transformed on the non-transformed cells, where said genetically transformed cells carry a nucleotide sequence which codes for a trehalase inhibitor said sequence produces an RNA which is complementary to a RNA produced from a DNA sequence coding for endogenous trehalase, wherein the RNA produced by said introduced nucleotide sequence confers a competitive advantage on the culture medium with the osmoregulatory agent. 2. The method according to claim 2, wherein the selection nucleotide sequence is a nucleotide sequence encoding a trehalase, said sequence produces an RNA that is complementary to an RNA produced from a DNA sequence encoding endogenous trehalase . 3. The method according to claims 1 and 2, wherein the nucleotide selection sequence is the gene or a region of the MSTRE gene of alfalfa trehalase (Medicago sativa) and / or a sequence encoding maize trehalase. 4. The method according to the preceding claims, wherein the selection nucleotide sequence is complementary, more specifically, to the gene or to a region of the MSTRE1 gene of alfalfa trehalase. 5. The method according to the preceding claims, wherein the RNA transcribed from the selection nucleotide sequence is completely or partially complementary to the RNA produced from a DNA sequence encoding the endogenous trehalase. 6. The method according to claim 5, wherein the introduced selection nucleotide sequence is modified or. truncated 7. The method according to claim 1, wherein the nucleotide selection sequence codes for the 85kD protein of the cockroach (Periplaneta americana), for an enzyme involved in the metabolism of Validamycin A, trehazoline, trehalostin, casteligin, the sudatestrina, or any inhibitor of trehalasa or any of its modifications, where said nucleotide sequence. selection introduced allows the cell a competitive advantage. 8. The method of claim 1, wherein the culture medium comprises an osmoregulatory agent selected from: Polyethylene glycol 8000 (PEG8000), mannitol, sorbitol, NaCl or any other osmoregulatory agent. 9. The method of claim 8, wherein the culture medium comprises polyethylene glycol 8000 (PEG8000) as an osmoregulatory agent. 10. The method of claim 8, wherein the culture medium comprises PEG8000 at a concentration of 4%. 1. The method of the preceding claims, wherein the genetically transformed plant cell is selected from plants such as: tomato (Lycopersicum esculentum L), mango, peach, apple, pear, banana, melon, sunflower, tobacco, sugar cane. { Saccharum officinarum L) wheat (Triticum aestivum L), soybean (Glycine max L), barley, corn (Zea mays L), cotton, potato (Solanum tuberosum L), carrot, lettuce, squash, onion, among others. 12. The method of claims 1-11, wherein the selected cell is a genetically transformed plant cell which has the competitive advantage of growing in a culture medium containing an osmoregulatory agent whereby said cell is able to grow and survive under conditions of drought. 13. The method according to claim 1, wherein the cell or population of cells is further transformed with a nucleotide sequence of interest. 14. The method according to claim 13, wherein the nucleotide sequence of interest introduced can be a sequence encoding the enzyme trehalose-6-phosphate synthase (TPS), for the enzyme trehalose-6-phosphate phosphatase (TPP), an inhibitor of trehalose-6-phosphate phosphatase (TPP) and / or a nucleotide sequence that codes for resistance to toxins, antibiotics, herbicides or other products of biotechnological interest. 15. The method according to claim 1, wherein the transformation of the plant cells is carried out by a molecular construct or vector containing an operable plant promoter linked to at least one nucleotide sequence of interest and at least one nucleotide selection sequence for obtaining genetically transformed cells, wherein the selection nucleotide sequence comprises a region encoding an endogenous trehalose inhibitor. 16. The method according to claim 1 and 15, wherein the molecular construct or vector is a selection nucleotide sequence for obtaining genetically transformed cells, wherein the selection nucleotide sequence comprises a region encoding an endogenous trehalose inhibitor; one or two copies thereof, in such an arrangement that it inhibits the endogenous trehalase activity, and where said construction may comprise additional elements as a sequence of binding between the copies of the introduced sequence is complementary to the DNA sequence of the endogenous trehalase , such as an interfering RNA (RNAi). 17. A genetically transformed plant cell characterized by comprising a molecular construct or vector containing an operable plant promoter linked to at least one nucleotide sequence of interest and at least one selection nucleotide sequence for obtaining genetically transformed cells, wherein the selection nucleotide sequence comprises a region that codes for an endogenous trehalase inhibitor. 18. The cell as set forth in claim 17, wherein the selection nucleotide sequence comprises a region encoding a trehalase inhibitor, the latter being the sequence of the alfalfa trehalase gene and / or the DNA sequence encoding the endogenous corn trehalose, and wherein said introduced nucleotide sequence produces an RNA that is complementary to the RNA produced by a DNA sequence encoding endogenous trehalase. 19. The cell according to claim 17, wherein the selection nucleotide sequence comprises a region encoding a trehalose inhibitor, preferably the sequence of the alfalfa trehalose gene MSTRE1. 20. The cell according to claim 19, wherein the introduced selection nucleotide sequence is modified or truncated but produces an RNA that is completely or partially complementary to the RNA produced by a DNA sequence encoding the endogenous trehalase, conferring to the transformed cell a competitive advantage in the culture medium containing an osmoregulatory agent. twenty-one . The cell according to claim 18, wherein the selection nucleotide sequence is the gene or a region of the MSTRE gene of alfalfa trehalase and / or the nucleotide sequence or a region of the corn trehalase gene. 22. The cell according to claim 17, wherein the selection nucleotide sequence codes for the 85kD protein of the cockroach. { Periplaneta americana) or for an enzyme involved in the metabolism of Validamycin A, trehazoline, trehalostatin, casteligin, or any inhibitor of trehalase or any of its modifications, where said introduced selection nucleotide sequence allows the cell an advantage competitive 23. A plant regenerated from a genetically transformed plant cell according to claims 17-21, which comprises a molecular construct or vector containing an operable plant promoter linked to at least one nucleotide sequence of interest and at least one nucleotide sequence of selection for obtaining genetically transformed cells, wherein the selection nucleotide sequence comprises a region encoding an endogenous trehalose inhibitor. 24. The plant according to claim 22, wherein the plant has the competitive advantage of growing in a culture medium containing an osmoregulatory agent so that said plant is able to grow and survive in drought conditions. 25. The seeds of a plant according to claims 22 and 23. 26. The progeny of a plant according to claims 22 and 23. 27. A vector or molecular construct for genetically transforming one or more plant cells, which comprises an operable plant promoter linked at least with a selection nucleotide sequence that encodes a trehalase inhibitor and / or at least one nucleotide sequence of interest. 28. The vector according to claim 27, wherein the selection nucleotide sequence comprises a region encoding a trehalase inhibitor, said sequence can be selected from a sequence of the MSTRE gene of alfalfa trehalase and / or the DNA sequence. which encodes endogenous trehalase as for example a nucleotide sequence coding for corn trehalose, and wherein said introduced selection nucleotide sequence, produces an RNA that is at least partially complementary to the RNA produced by a DNA sequence encoding the endogenous trehalase. 29. The vector of claim 28, wherein the selection nucleotide sequence codes for a trehalase inhibitor, which has homology to the MSTRE1 sequence. 30. The vector according to claim 28, wherein the introduced selection nucleotide sequence is modified or truncated but produces an RNA that is completely or partially complementary to the RNA produced by a DNA sequence encoding endogenous trehalase. 31. The vector according to claim 27, wherein the nucleotide selection sequence codes for the 85kD protein of the cockroach (Periplaneta americana) or for an enzyme involved in the metabolism of Validamycin A, trehazoline, trehalostin, casteligin, or any inhibitor of trehalase or any of its modifications. 32. The vector according to claim 27, which further comprises a nucleotide sequence that encodes genes involved in resistance to toxins, antibiotics or herbicides. 33. The vector according to claims 27-31 useful for the transformation of plant cells, for the selection of genetically transformed cells from a population of transformed and non-transformed cells and for the production of genetically transformed plants. 34. Use of Polyethylene glycol 8000 (PEG 8000) to prepare an osmoregulated culture medium for the selection of genetically transformed plant cells from between a population of transformed and untransformed cells, wherein the genome of the transformed cells comprises at least one selection nucleotide sequence comprising a region encoding a trehalase inhibitor. 35. The use of claim 33 wherein the concentration of the Polyethylene glycol 8000 is 4%.