MX2008009762A

MX2008009762A - Il-17 antagonistic antibodies fpr treating cancer

Info

Publication number: MX2008009762A
Application number: MXMX/A/2008/009762A
Authority: MX
Inventors: E Di Padova Franco; Cooreman Michael
Original assignee: Cooreman Michael; E Di Padova Franco; Novartis Ag; Novartis Pharma Gmbh
Priority date: 2006-01-31
Filing date: 2008-07-30
Publication date: 2008-10-03

Abstract

An IL-17 binding molecule, in particular an antibody to human IL-17, more preferably a human antibody to human IL-17 is provided, wherein the hypervariable regions of the heavy and light chains have amino acid sequences as defined, for use in the treatment of a solid or hematological malignant diseases.

Description

ANTIGONIST ANTIBODIES OF IL-17 The present invention relates to immunotherapy, and more particularly provides the use of IL-17 binding molecules in the treatment of a proliferative disease, and in particular of solid malignant proliferative diseases or hematological proliferative diseases. IL-17, a cytokine derived from T-cells present, for example, in rheumatoid arthritis (RA), acts as a pro-inflammatory cytokine, particularly in conjunction with IL-1 and TNF-α, and blocking IL -1 and IL-17 have a synergistic effect on inflammation and bone destruction in vivo. The inappropriate or excessive production of IL-17 is associated with the pathology of different diseases and disorders, such as rheumatoid arthritis, osteoarthritis, loosening of bone implants, rejection of acute transplantation, septicemia, septic or endotoxic shock, allergies, asthma, bone loss , psoriasis, ischemia, systemic sclerosis, embolism, and other inflammatory disorders. Antibodies have been proposed for IL-17, for use in the treatment of diseases and disorders mediated by IL-17; see, for example, International Publication Number WO 95/18826, and the discussion in the introduction thereto.

It has now been found, in accordance with the present invention, that the IL-17 binding molecules are useful for inhibiting the growth of certain solid and haematological malignancies. In accordance with the above, in a first aspect, the present invention provides the use of an IL-17 binding molecule in the treatment of a proliferative disease, such as cancer, and in particular of solid malignant proliferative diseases or hematological malignant proliferative diseases. Preferably, an IL-17 binding molecule is used as described in PCT Application Number PCT / EP2005 / 008470, which is incorporated herein by reference, which comprises at least one binding site of antigen comprising an IL-17 binding molecule, which comprises an antigen binding site comprising at least one immunoglobulin heavy chain variable domain (VH) comprising, in sequence, the hypervariable regions CDR1, CDR2, and CDP.3, the CDR1 having the amino acid sequence SEQ ID NO: 1 (NYWMN), the CDR2 having the amino acid sequence SEQ ID NO: 2 (AlNQDGSEKYYV-GSVKG), and the CDR3 having the amino acid sequence SEQ ID NO: 3 (DYYDlLTDYYlHYWYFDL); or the direct CDR equivalents thereof. In one embodiment, the IL-17 binding molecule comprises at least one immunoglobulin light chain variable domain (VL), comprising, in sequence, the hypervariable regions CDR1 ', CDR2', and CDR3 ', having CDR1' the amino acid sequence SEQ ID NO: 4 (RASQSVSSSYLA), CDR2 'having the amino acid sequence SEQ ID NO: 5 (GA- S-S-R-A-T), and having the CDR3 'the amino acid sequence SEQ ID NO: 6 (Q-Q-Y-G-S-S-P-C-T), or their direct CDR' equivalents.

In another preferred embodiment, the IL-17 binding molecule comprises an antigen binding site comprising at least one immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1-X, CDR2-X and CDR3-X, the CDR1-x having the amino acid sequence SEQ ID NO: 11 (GFTFSNYW- -N), the CDR2-X having the amino acid sequence SEQ ID NO: 12 (AlNQDGSEKYY), and having the CDR3-X the amino acid sequence SEQ ID NO: 13 (CVRDYYDlLTDYYlHYWYFDL-WG); or its CDR- equivalents? direct Additionally, in a preferred embodiment, the IL-17 binding molecule comprises the variable domains of both heavy chain (VH) and light chain (VL); this IL-17 binding molecule comprises at least one antigen binding site, which comprises: a) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1, CDR2, and CDR3, the CDR1 having the amino acid sequence SEQ ID NO: 1, the CDR2 having the amino acid sequence SEQ ID NO: 2, and the CDR3 having the amino acid sequence SEQ ID NO: 3, or their direct CDR equivalents; and b) a variable immunoglobulin light chain (VL) domain, which comprises, in sequence, the hypervariable regions CDR1 ', CDR2', and CDR3 ', the CDR1' having the amino acid sequence SEQ ID NO: 4, the CDR2 'having the amino acid sequence SEQ ID NO: 5, and the CDR3' having the amino acid sequence SEQ ID NO: 6, or its direct CDR equivalents. Moreover, the IL-17 binding molecule can also comprise the variable domains of both heavy chain (VH) and light chain (VL); this IL-17 binding molecule comprises at least one antigen binding site comprising: a) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1-X, CDR2- X, and CDR3-X, the CDR1-x having the amino acid sequence SEQ ID NO: 11, the CDR2-X having the amino acid sequence SEQ ID NO: 12, and the CDR3-X having the amino acid sequence SEQ ID NO : 13, or its direct CDR-x equivalents; and b) an immunoglobulin light chain variable domain (VL), which comprises, in sequence, the hypervariable regions CDR1 ', CDR2', and CDR3 ', the CDR1' having the amino acid sequence SEQ ID NO: 4, having the CDR2 'the amino acid sequence SEQ ID NO: 5, and CDR3' having the amino acid sequence SEQ ID NO: 6, or its direct CDR 'equivalents. Unless otherwise indicated, any polypeptide chain is described herein as having an amino acid sequence that begins at the N-terminus, and ends at the C-terminus.

When the antigen binding site comprises both VH and VL domains, these can be located on the same polypeptide molecule, or preferably, each domain can be on a different chain, the VH domain being part of an immunoglobulin heavy chain or fragment thereof, and the VL domain being part of an immunoglobulin light chain or fragment thereof. "Linkage molecule of I L-1 7" means any molecule capable of binding to antigen I L-1 7, either alone or in association with other molecules. The binding reaction can be shown by conventional methods (qualitative assays), including, for example, a binding assay, a competition assay, or a bioassay, to determine the inhibition of the binding of IL-1 7 to its receptor, or any kind of binding assays, with reference to a negative control test where an antibody of an unrelated specificity but of the same isotype is used, for example an anti-CD25 antibody. Examples of the antigen binding molecules include antibodies produced by B-cells or hybridomas, and chimeric antibodies, grafted with CD R, or human, or any fragment thereof, for example F-segments ( ab ') 2, and Fab, as well as the antibodies of a single chain or of a single domain. A single-chain antibody consists of the variable domains of the heavy and light chains of an antibody covalently linked by a peptide linker, which it usually consists of from 1 to 30 amino acids, preferably from 1 to 25 amino acids. Accordingly, this structure does not include the constant part of the heavy and light chains, and it is believed that the small peptide spacer must be less antigenic than a whole constant part. "Chimeric antibody" means an antibody wherein the constant regions of the heavy or light chains, or both, are of human origin, while the variable domains of both heavy and light chains are of non-human origin (eg, murine) ), or of human origin but derived from a different human antibody. "CDR-grafted antibody" means an antibody wherein the hypervariable regions (CDRs) are derived from a donor antibody, such as a non-human antibody (eg, murine), or from a different human antibody, while all or substantially all of the other parts of the immunoglobulin, for example the constant regions and highly conserved parts of the variable domains, ie, the structure regions, are derived from an acceptor antibody, for example an antibody of human origin. However, a CDR-grafted antibody can contain as many amino acids of the donor sequence in the framework regions, for example, in the regions of the structure regions adjacent to the hypervariable regions. "Human antibody" means an antibody wherein the constant and variable regions of both heavy and light chains are all of human origin, or substantially identical to the sequences of origin human, and not necessarily the same antibody, and includes the antibodies produced by mice, wherein the variable and constant murine immunoglobulin part genes have been replaced by their human counterparts, for example, as described generally in the Patents Nos. EP 0546073 B1, USP 5545806, USP 5569825, USP 5625126, USP 5633425, USP 5661016, USP 5770429, EP 0 438474 B1 and EP 0 463151 B1. Particularly preferred IL-17 binding molecules of the invention are human antibodies, especially the antibody AIN457, as described in Examples 1 and 2 of PCT Publication Number PCT / EP2005 / 008470. Accordingly, in the preferred chimeric antibodies, the variable domains of both heavy and light chains are of human origin, for example, those of the AIN457 antibody shown in SEQ ID NO: 10 (= light chain variable domain, i.e. , amino acids 1 to 109 of SEQ ID NO: 10), and SEQ ID NO: 8 (= heavy chain variable domain, ie, amino acids 1 to 127 of SEQ ID NO: 8). The domains of the constant region preferably also comprise suitable human constant region domains, for example, as described in "Sequences of Proteins of Immunological Interest", Kabat EA et al., United States Department of Health and Human Services, Service of Public Health, National Institute of Health. Hypervariable regions may be associated with any class of structure regions, although they are preferably of human origin. Suitable framework regions are described in Kabat E. A. et al., Ibid. The preferred heavy chain structure is a human heavy chain structure, for example, that of the AIN457 antibody. It consists of the sequence, for example, of the regions FR1 (amino acids 1 to 30 of SEQ ID NO: 8), FR 2 (amino acids 36 to 49 of SEQ ID NO: 8), FR3 (amino acids 67 to 98 of the SEQ ID NO :), and FR4 (amino acids 117 to 127 of SEQ ID NO: 8). Taking into consideration the determined hypervariable regions of AIN457 by X-ray analysis, another preferred heavy chain structure consists of the sequence of the FR1-X regions (amino acids 1 to 25 of SEQ ID NO: 8), FR2-x ( amino acids 36 to 49 of SEQ ID NO: 8), FR3-X (amino acids 61 to 95 of SEQ ID NO: 8), and FR4 (amino acids 119 to 127 of SEQ ID NO: 8). In a similar manner, the light chain structure consists, in sequence, in the FR1 'regions (amino acids 1 to 23 of SEQ ID NO: 10), FR2' (amino acids 36 to 50 of SEQ ID NO: 10), FR3 '(amino acids 58 to 89 of SEQ ID NO: 10), and FR4 (amino acids 99 to 109 of SEQ ID NO: 10). An IL-17 binding molecule according to the invention comprises at least one antigen binding site comprising either a first domain having an amino acid sequence substantially identical to that shown in SEQ ID NO: 8 , starting with the amino acid in position 1 and ending with the amino acid in position 127, or a first domain as described above, and a second domain having an amino acid sequence substantially identical to that shown in SEQ ID NO: 10, starting with the amino acid in position 1, and ending with the amino acid in position 109. Monoclonal antibodies reproduced against a protein found naturally in all humans, they typically develop in a non-human system, for example in mice, and as such, are typically non-human proteins. As a direct consequence of this, a xenogeneic antibody as produced by a hybridoma, when administered to humans, elicits an undesirable immune response that is predominantly mediated by the constant part of the xenogeneic immunoglobulin. This clearly limits the use of these antibodies, because they can not be administered for a prolonged period of time. Accordingly, it is particularly preferred to use single chain antibodies, single-domain, chimeric, grafted with CDR, or in particular humans, which are not likely to elicit a substantial allogeneic response when administered to humans. In view of the foregoing, a most preferred IL-17 binding molecule of the invention is selected from an anti-human IL-17 antibody, which comprises at least: a) an immunoglobulin heavy chain or fragment of the same comprising: (i) a variable domain comprising, in sequence, the hypervariable regions CD1, CDR2, and CDR3, or their direct CDR equivalents, and (ii) the constant part or fragment thereof of a human heavy chain; having this CDR1 the amino acid sequence SEQ ID NO: 1, this CDR2 having the amino acid sequence SEQ ID NO: 2, and this CDR3 having the amino acid sequence SEQ ID NO: 3; and b) an immunoglobulin light chain or fragment thereof, which comprises: (i) a variable domain comprising, in sequence, the hypervariable regions, and optionally also the hypervariable regions CDR1 ', CDR2', and CDR3 'or their direct CDR 'equivalents, and (ii) the constant part or fragment thereof of a human light chain, this CDR1' having the amino acid sequence SEQ ID NO: 4, this CDR2 'having the amino acid sequence SEQ ID NO: 5, and this CDR3 'having the amino acid sequence SEQ ID NO: 6. Alternatively, an IL-17 binding molecule according to the invention can be selected from a single chain binding molecule, which comprises an antigen binding site comprising: a) a first domain comprising, in sequence, the hypervariable regions CDR1, CDR2, and CDR3, or their direct CDR equivalents, with CDR1 having the amino acid sequence SEQ ID NO: 1, with CDR2 having the amino acid sequence SEQ ID NO: 3, and the CDR3 having the amino acid sequence SEQ ID NO: 3; and b) a second domain comprising the regions hypervariables CDR1 ', CDR2', and CDR3 ', or their direct CDR' equivalents, CDR1 'having the amino acid sequence SEQ ID NO: 4, CDR2' having the amino acid sequence SEQ ID NO: 5, and having the CDR3 'the amino acid sequence SEQ ID NO: 6; and c) a peptide linker that binds either to the N-terminal extremity of the first domain and to the C-terminal extremity of the second domain, or to the C-terminal extremity of the first domain and to the N-terminal extremity of the second domain. domain. As is well known, minor changes in the amino acid sequence, such as deletion, addition, or substitution of one, a few, or even several amino acids, can lead to an allelic form of the original protein, which has substantially identical properties. Accordingly, the term "their direct CDR equivalents" means the IL-17 binding molecules that comprise, in sequence, the hypervariable regions CDR1, CDR2, and CDR3, (instead of CDR1, CDR2, and CDR3). ), wherein: (i) the hypervariable region CDR1j differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDR1, as shown in SEQ ID NO: 1; and (ii) the hypervariable region CDR2j differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDR2, as shown in SEQ ID NO: 2; and (iii) the hypervariable region CDR3¡ differs by 3, preferably by 2, more preferably by 1 amino acid, of the hypervariable region CDR3, as shown in SEQ ID NO: 3; and (iv) this molecule comprising, in sequence, the hypervariable regions CDR1, CDR2, and CDR3, is capable of inhibiting the activity of human IL-17 1 nM (= 30 nanograms / milliliter), in a concentration 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of this molecule per 50 percent, and this inhibitory activity is measured on the human-induced IL-6 production -IL-17 in human dermal fibroblasts. In a similar manner, the term "their direct CDR-x equivalents" means the IL-17 binding molecules that comprise, in sequence, the hypervariable regions CDR1¡-x, CDR2¡-x, and CDR3¡-x (in place of CDRI-x, CDR2-X, and CDR3-x), where: (v) the hypervariable region CDR1'-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDRI-x, as shown in SEQ ID NO: 11; and (vi) the hypervariable region CDR2i-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDR2-X, as shown in SEQ ID NO: 12; and (vii) the hypervariable region CDR3i-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDR3-X, as shown in SEQ ID NO: 13; and (viii) this molecule comprising, in sequence, the hypervariable regions CDR1-x, CDR2-x, and CDR3-x, is capable of inhibiting the activity of human IL-17 1 nM (= 30 nanograms / milliliter), at a concentration of 50 nM, preferably 20 nM, preferably more preferably 10 nM, and most preferably 5 nM, of this molecule by 50 percent, and this inhibitory activity is measured on the production of IL-6 induced by hu-IL-17 in human dermal fibroblasts. In a similar manner, the term "their direct CDR equivalents" means a domain comprising, in sequence, the hypervariable regions CDR1'¡, CDR2'¡, and CDR3'¡, where: (i) the hypervariable region CDR1'i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDR1 ', as shown in SEQ ID NO: 4; and (ii) the hypervariable region CDR2'i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDR2 ', as shown in SEQ ID NO: 5; and (iii) the hypervariable region CDR3'i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region CDR3 ', as shown in SEQ ID NO: 6; and (iv) this molecule comprising, in sequence, the hypervariable regions CDR1 ', CDR2'¡, and CDR3'¡, is capable of inhibiting the activity of human IL-17 1 nM (= 30 nanograms / milliliter), in a concentration of 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of this molecule by 50 percent, and this inhibitory activity is measured on the production of IL-6 induced by hu-IL-17 in human dermal fibroblasts. Alternatively, an IL-17 binding molecule according to the invention can be an IL-17 binding molecule comprising at least one antigen binding site comprising at least one immunoglobulin heavy chain variable domain. (VH), which comprises, in sequence, a) the hypervariable regions CDR1 (SEQ ID NO: 1), CDR2 (SEQ ID NO: 2), and CDR3 (SEQ ID NO: 3), or b) the hypervariable regions CDR1 ¡, CDR2¡, CDR3¡, where the hypervariable region CDR1¡ differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR1, as shown in SEQ ID NO: 1, the region hypervariable CDR2¡ differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR2, as shown in SEQ ID NO: 2; and the hypervariable region CDR3i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR3, as shown in SEQ ID NO: 3; and the IL-17 binding molecule comprising, in sequence, the hypervariable regions CDR1X, CDR2X, and CDR3X, is capable of inhibiting the activity of human IL-17 1 nM (= 30 nanograms / milliliter), at a concentration of 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of the molecule per 50 percent, and this inhibitory activity is measured on the IL-6 production induced by hu-IL-17 in human dermal fibroblasts. In a similar manner, an IL-17 binding molecule according to the invention can be an IL-17 binding molecule comprising at least one antigen binding site comprising at least one variable domain of the heavy chain of immunoglobulin (VH), which comprises, in sequence, a) the hypervariable regions CDFM-x (SEQ ID NO: 11), CDR2-X (SEQ ID NO: 12), and CDR3-X (SEQ ID NO: 13) , or b) the hypervariable regions CDR1¡-x, CDR2¡-x, CDR3¡-x, where the hypervariable region CDR1¡-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDRI-x, as shown in SEQ ID NO: 11; the hypervariable region CDR2i-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR2-X, as shown in SEQ ID NO: 12; and the hypervariable region CDR3i-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR3-X, as shown in SEQ ID NO: 13; and the IL-17 binding molecule which comprises, in sequence, the hypervariable regions CDR1¡.X, CDR2¡.X, and CDR3¡.X, is capable of inhibiting the activity of human IL-17 1 nM (= 30 nanograms / milliliter), at a concentration of 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of the molecule per 50 percent, and this inhibitory activity is measured on the IL-6 production induced by hu-IL-17 in human dermal fibroblasts. In a similar manner, an IL-17 binding molecule according to the invention can be an IL-17 binding molecule comprising at least one antigen binding site comprising at least one variable domain of light chain of immunoglobulin (Vu), which comprises, in sequence, a) the hypervariable regions CDR'1 (SEQ ID NO: 4), CDR'2 (SEQ ID NO: 5), and CDR'3 (SEQ ID NO: 6) , or b) the hypervariable regions CDR ', CDR2'¡, CDR3'¡, where the hypervariable region CDR'1¡ differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR'1 , as shown in SEQ ID NO: 4; the hypervariable region CDR'2i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR'2, as shown in SEQ ID NO: 5; and the hypervariable region CDR'3i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR'3, as shown in SEQ ID NO: 6; and the IL-17 binding molecule comprising, in sequence, the hypervariable regions CDR'1i, CDR'2i, and CDR'3i, is capable of inhibiting the activity of human IL-17 1 nM (= 30 nanograms / milliliter), at a concentration of 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of the molecule per 50 percent, and this inhibitory activity is measured on the IL-6 production induced by hu-IL-17 in human dermal fibroblasts. Alternatively, an IL-17 binding molecule according to the invention can be an IL-17 binding molecule comprising the variable domains of both heavy chain (VH) and light chain (VL), and the IL-17 binding molecule comprises at least one antigen binding site comprising: a) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1 (SEQ ID NO: 1) ), CDR2 (SEQ ID NO: 2), and CDR3 (SEQ ID NO: 3); and an immunoglobulin light chain variable domain (VL), which comprises, in sequence, the hypervariable regions CDR1 '(SEQ ID NO: 4), CDR2' (SEQ ID NO: 5), and CDR3 '(SEQ ID NO. : 6); or b) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1, CDR2, and CDR3, wherein the hypervariable region, CDR1, differs by 3, preferably by 2, more preferably by 1 amino acid, of the hypervariable region of CDR1, as shown in SEQ ID NO: 1; the hypervariable region CDR2¡ differs by 3, from preference for 2, more preferably for 1 amino acid, of the hypervariable region of CDR2, as shown in SEQ ID NO: 2; and the hypervariable region CDR3i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR3, as shown in SEQ ID NO: 3; and a variable immunoglobulin (VL) light chain domain, which comprises, in sequence, the hypervariable regions CDR1 ', CDR2'¡, CDR3'¡, where the hypervariable region CDR'1¡, differs by 3, preferably by 2, more preferably by 1 amino acid, of the hypervariable region of CDR'1, as shown in SEQ ID NO: 4; the hypervariable region CDR'2i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR'2, as shown in SEQ ID NO: 5; and the hypervariable region CDR'3i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR'3, as shown in SEQ ID NO: 6; and the IL-17 binding molecule defined in b) comprises, in sequence, the hypervariable regions CDR1, CDR2, CDR3i, CDR1, CDR2, and CDR3, and is capable of inhibiting the activity of human IL-17 1 nM (= 30 nanograms / milliliter), at a concentration of 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of this molecule per 50 percent, and the inhibitory activity is measured on the production of IL-6 induced by hu-IL-17 in human dermal fibroblasts. Alternatively, an IL-17 binding molecule of according to the invention can be an IL-17 binding molecule comprising the variable domains of both heavy chain (VH) and light chain (Vu), and this IL-17 binding molecule comprises at least one binding site of antigen comprising: a) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1-X (SEQ ID NO: 11), CDR2-X (SEQ ID NO: 12) , and CDR3-X (SEQ ID NO: 13); and an immunoglobulin light chain variable domain (VL), which comprises, in sequence, the hypervariable regions CDR1 '(SEQ ID NO: 4), CDR2' (SEQ ID NO: 5), and CDR3 '(SEQ ID NO. : 6); or b) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1¡-x, CDR2¡-x, and CDR3¡-x, where the hypervariable region CDR1¡-x differs by 3, preferably by 2, more preferably by 1 amino acid, of the hypervariable region of CDRI-x, as shown in SEQ ID NO: 11; the hypervariable region CDR2-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR2-x, as shown in SEQ ID NO: 12; and the hypervariable region CDR3i-x differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR3-X, as shown in SEQ ID NO: 13; and a variable immunoglobulin light chain domain (Vu), which comprises, in sequence, the hypervariable regions CDFM'i, CDR2'¡, CDR3'¡, where the hypervariable region CDR'1¡, differs by 3, preferably by 2, more preferably by 1 amino acid , of the hypervariable region of CDR'1, as shown in SEQ ID NO: 4; the hypervariable region CDR'2i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR'2, as shown in SEQ ID NO: 5; and the hypervariable region CDR'3i differs by 3, preferably by 2, more preferably by 1 amino acid, from the hypervariable region of CDR'3, as shown in SEQ ID NO: 6; and the IL-17 binding molecule defined in b) comprises, in sequence, the hypervariable regions CDR1, CDR2, CDR3, CDR1, CDR2, and CDR3, and is capable of inhibit the activity of 1 nM human IL-17 (= 30 nanograms / milliliter), at a concentration of 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of this molecule by 50 percent, and the inhibitory activity is measured on the IL-6 production induced by hu-IL-17 in human dermal fibroblasts. The inhibition of the binding of IL-17 with its receptor can be conveniently tested in different assays, including the assays described, for example, in PCT Publication Number PCT / EP2005 / 008470. The term "to the same degree" means that the reference molecules and equivalents exhibit, on a statistical basis, an essentially identical inhibitory activity of IL-17 in one of the assays referred to in I presented. For example, the IL-17 binding molecules of the invention typically have IC50s for the inhibition of human IL-17 or on the production of IL-6 induced by human IL-17 in human dermal fibroblasts, which are within +/- x5, ie, below 10 nM, more preferably 9, 8, 7, 6.5, 4, 3, or 2 nM of that, preferably substantially the same as, the IC50 of the corresponding reference molecule, when tested as described in Example 1 of the PCT Publication Number PCT / EP2005 / 008470. Alternatively, the assay used may be a competitive inhibition assay of the binding of IL-17 by soluble IL-17 receptors (eg, the R / Fc constructs of human IL-17 of Example 1), and IL-17 binding molecules of the invention. More preferably, the human IL-17 antibody comprises at least: a) a heavy chain comprising a variable domain having an amino acid sequence substantially identical to that shown in SEQ ID NO: 8, starting with the amino acid in position 1, and ending with the amino acid in position 127, and the constant part of a human heavy chain; and b) a light chain comprising a variable domain having an amino acid sequence substantially identical to that shown in SEQ ID NO: 10, starting with the amino acid in position 1, and ending with the amino acid in position 109, and constant part of the human light chain. The constant part of a human heavy chain can be of the type ??, Y2,? 3, Y, μ. ai, a2, d, or e, preferably of type?, more preferably of type? ^ while the constant part of a light chain can be of type or? (which includes subtypes A1t? 2, and? 3), but preferably is of the type. The amino acid sequences of all these constant parts are given in Kabat et al. (Supra). Conjugates of the binding molecules of the invention, for example the conjugates of enzyme or toxin or radioisotope, are also included within the scope of the invention. "Polypeptide", if not otherwise specified herein, includes any peptide or protein comprising amino acids joined to each other by peptide bonds, having an amino acid sequence beginning at the N-terminus and ending at the extremity C-terminal. Preferably, the polypeptide of the present invention is a monoclonal antibody, more preferably it is a chimeric monoclonal antibody (also referred to as V-grafted) or humanized (also referred to as CDR-grafted), and most preferably a fully human antibody. which can be obtained, for example, by the technology exemplified in Example 1. The humanized (CDR-grafted) or fully human monoclonal antibody may or may not include additional mutations introduced into the structure (FR) sequences of the acceptor antibody A functional derivative of a polypeptide, as used herein, includes a molecule having a qualitative biological activity in common with a polypeptide of the present invention, that is, having the ability to bind to the L-1 7 human A functional derivative includes peptide fragments and analogs of a polypeptide according to the present invention. The fragments comprise the regions within the sequence of a polypeptide according to the present invention, for example, of a specified sequence. The term "derivative" is used to define variants of amino acid sequences, and covalent modifications of a polypeptide according to the present invention, for example, of a specified sequence. The functional derivatives of a polypeptide according to the present invention, for example, of a specified sequence, for example, of the hypervariable region of the light chain and the heavy chain, preferably have a global sequence homology of at least about 65 percent, more preferably at least about 75 percent, still more preferable when I am about 85 percent, and most preferably at least about 95, 96, 97, 98, or 99 percent with the amino acid sequence of a polypeptide according to the present invention, for example of a specified sequence, and substantially retains the ability to bind to human I L-1 7, or , by example, to neutralize the production of I L-6, of human dermal fibroblasts induced by I L-1 7. The term "covalent modification" includes modifications of a polypeptide according to the present invention, for example, from a specified sequence; or a fragment thereof, with a proteinaceous or non-proteinaceous organic derivatizing agent, fusions with heterologous polypeptide sequences, and post-translational modifications. Covalent modified polypeptides, for example, of a specified sequence, still have the ability to bind to human I L-1 7, or, for example, to neutralize I L-6 production of human dermal fibroblasts induced by IL - 17 by crosslinking. Covalent modifications are traditionally introduced by reacting the targeted amino acid residues with an organic derivatizing agent that is capable of reacting with the selected end residues or residues., or with a harness in the mechanisms of post-translational modifications that work in selected recombinant host cells. Certain post-translational modifications are the result of the action of recombinant host cells on the expressed patient. The glutaminyl and asparagi residues do not often deaminate after translation, to the corresponding glutamyl and aspargyl residues. In an alternative manner, these residues are deaminated under mildly acidic conditions. Other post-translational modifications include the hydroxylation of proline and Usin, phosphorylation of the hydroxyl groups of the seryl, tyrosine or threonyl residues, methylation of the a-amino groups of the side chains of lysine, arginine and histidine; see, for example, T. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pages 79-86 (1 983). Covalent modifications, for example, include fusion proteins comprising a polypeptide according to the present invention, for example of a specified sequence, and its amino acid sequence variants, such as immunoadhesins, and N-terminal fusions with sequences of heterologous signals. "Homology", with respect to a native polypeptide and its derivative, is defined herein as the percentage of amino acid residues in the candidate sequence that are identical to the residues of a corresponding native polypeptide, after aligning the sequences and of introducing holes, if necessary, to reach the maximum percentage of homology, and without considering any conservative substitutions as part of the identity of the sequence. N- or C-terminal extensions or inserts will not be construed to reduce identity or homology. The methods and computer programs for alignment are well known. "Amino acids" refers to all L-a-amino acids that occur naturally, for example and including the non-acid D-ami. The amino acids are identified by the well-known single-letter or three-letter designations. The term "amino acid sequence variant" refers to molecules with some differences in their amino acid sequences, compared to a polypeptide of confo rmity with the present invention, for example of a specified sequence. Variants of amino acid sequences of a polypeptide according to the present invention, for example, of a specified sequence, still have the ability to bind to human I L-1 7, or, for example, to neutralize the production of IL -6 of human dermal fibroblasts induced by I L-1 7. Substitution variants are those that have at least one amino acid residue removed, and a different amino acid inserted in its place in the same position in a polypeptide in accordance with the present invention, for example, of a specified sequence. These substitutions can be individual, where only one amino acid has been substituted in the molecule, or they can be multiple, where they have been replaced or more amino acids in the same molecule. The insertion variants are those with one or more amino acids inserted inmediately adjacent to an amino acid at a particular position in a polypeptide according to the present invention, for example of a specified sequence. Immediately adjacent to an amino acid means connected to either the functional a-carboxyl group or the a-amino group of the amino acid. Deletion variants are those with one or more amino acids in a polypeptide according to the present invention, example of a specified sequence, removed. Ordinarily, deletion variants will have one or two amino acids deleted in a particular region of the molecule. The desired antibody can be produced in a cell culture or in a transgenic animal. A suitable transgenic animal can be obtained according to conventional methods, which include microinjection in eggs of the first and second DNA constructs placed under the appropriate control sequences, which transfer the eggs as prepared to the appropriate pseudopregnant females. , and a descendant that expresses the desired antibody is selected. When the antibody chains are produced in a cell culture, the DNA constructs must first be inserted either in a single expression vector or in two separate but compatible expression vectors., preferring the last possibility. In accordance with the foregoing, the invention also provides an expression vector capable of replicating in a prokaryotic or eukaryotic cell line, comprising at least one of the DNA constructs described above. Each expression vector containing a DNA construct is then transferred to a suitable host organism. When the DNA constructs are inserted separately on two expression vectors, they can be transferred separately, that is, one type of vector per cell, or they can be co-transferred, the latter possibility being preferred. A host organism Suitable may be a bacterium, a yeast, or a mammalian cell line, the latter being preferred. More preferably, the mammalian cell line is of lymphoid origin, for example, a myeloma, hybridoma, or a normal immortalized B-cell, which conveniently does not express any heavy or light chain of endogenous antibody. For expression in mammalian cells, it is preferred that the coding sequence of the IL-17 binding molecule is integrated into the host cell DNA within a locus that allows or promotes a high level of expression of the link of IL-17. The cells in which the coding sequence of the IL-17 binding molecule is integrated into these favorable loci can be identified and selected based on the levels of the IL-17 binding molecule they express. Any selectable marker suitable for the preparation of host cells containing the coding sequence of the IL-17 binding molecule can be used; for example, a dhfr / methotrexate gene selection or equivalent system can be used. Alternative systems for the expression of the IL-17 binding molecules of the invention include GS-based amplification / selection systems, such as those described in European Patent Numbers EP 0256055 B, EP 0323997 B, and in the Application for European Patent Number 89303964.4. For the purposes of the present invention, an antibody is "capable of inhibiting the binding of IL-17 such as AIN457", if the antibody it is capable of inhibiting the binding of IL-17 with its receptor substantially to the same extent as the antibody AIN457, where "to the same degree" has the meaning defined above. The AIN457 antibody has a binding affinity for IL-17 that is higher than the affinities previously reported for anti-IL-17 antibodies, in particular for any anti-human IL-17 antibody. Accordingly, AIN457 has a KD dissociation equilibrium constant for inhibiting IL-17 of about 0.188 + 0.036 nM (determined by BIAcore, for example, as described in PCT Application Number PCT / EP2005 / 008470). This high binding affinity makes the AIN457 antibody particularly suitable for therapeutic applications. In the present description, the terms "treatment" or "treating" refer to both prophylactic and preventive treatment, as well as to the curative treatment or modifier of the disease, including the treatment of a patient at risk of contracting the disease, or suspected of having contracted the disease, as well as patients who are ill or who have been diagnosed as suffering from a disease or medical condition, and includes the suppression of clinical recurrence. The IL-17 binding molecules defined above, which have binding specificity for human IL-17, in particular antibodies that are capable of inhibiting the binding of IL-17 to its receptor; and antibodies to IL-17 that are capable of inhibiting activity of human IL-17 1 nM (= 30 nanograms / milliliter) at a concentration of 50 nM, preferably 20 nM, more preferably 10 nM, and most preferably 5 nM of this molecule per 50 nM percent, wherein this inhibitory activity is measured on the production of IL-6 induced by hu-IL-17 in human dermal fibroblasts, are referred to herein as the Antibodies of the Invention. Preferably, the Antibodies of the Invention are human antibodies, more preferably the AIN457 antibody or its direct equivalents. The pharmacological activities of the antibodies of the invention can be demonstrated in conventional test methods, for example, as described below: Neutralization of interleukin-6 production by the primary human fibroblasts dependent on IL-17: Production of IL-6 in primary human (dermal) fibroblasts depends on IL-17 (Hwang SY et al., (2004) Arthritis Res Ther; 6: R120-128). Briefly, human dermal fibroblasts are stimulated with the recombinant IL-17 in the presence of different concentrations of the antibody of the invention or of the human IL-17 receptor with the Fe part. The chimeric anti-CD25 Simulect® antibody is used ( basiliximab) as a negative control. The supernatant is taken after 16 hours of stimulation, and tested for IL-6 by ELISA. The antibodies of the invention typically have IC50s for the inhibition of IL-6 production (in the presence of human IL-17) of about 50 nM or less (eg, from about 0.01 to about 50 nM), when tested as above, that is, the inhibitory activity is measured on the production of IL-6 induced by hu-lL-17 in human dermal fibroblasts. Preferably, the antibodies of the invention have an IC50 for the inhibition of IL-6 production as defined above, of about 20 nM or less, more preferably of about 10 nM or less, and most preferably of about 0 nM or less, and most preferably about 2 nM or less, and more preferably about 1 nM or less. As indicated in the above assay, the Antibodies of the Invention potently block the effects of IL-17. In accordance with the foregoing, the antibodies of the invention have pharmaceutical utility as follows: Antibodies of the Invention are useful for the prophylaxis and treatment of diseases or medical conditions mediated by IL-17, for example, the inhibition of growth of malignant solid or hematological proliferative diseases. Solid malignancies can include malignant tumor diseases, wherever the tumor is located (or metastasis). Preferably, the malignant tumor disease is breast cancer, genitourinary cancer, cancer pulmonary, gastrointestinal cancer, for example colo-rectal tumor or genitourinary tumor, especially a prostate cancer or a gastrointestinal stromal tumor (GIST), squamous cell cancer, melanoma, ovarian cancer, pancreatic cancer, neuroblastoma, head and neck cancer such as, for example, mouth cancer or laryngeal cancer, bladder cancer, or in a broader sense, kidney, brain, or gastric cancer, a lung tumor, especially a non-microcellular lung tumor. Haematological malignancies ("liquid tumors") include, for example, lymphoma, leukemia, especially those that express c-kit, KDR, Flt-1, or Flt-3, myeloma or lymphoid malignancies, but also spleen cancers , and cancers of the lymph nodes. More particular examples of these cancers associated with B-cells, including, for example, high-grade, intermediate and low-grade lymphomas (including B-cell lymphomas, such as, for example, B-cell lymphoma of lymphoid tissue associated with non-Hodgkin's mucosa and lymphoma, mycosis fungoides, Sezary's syndrome, mantle cell lymphoma, Burkitt's lymphoma, small lymphocytic lymphoma, marginal zone lymphoma, diffuse macrocellular lymphoma, follicular lymphoma, and Hodgkin's lymphoma, and lymphomas of T-cells), and leukemias (including secondary leukemia, chronic lymphocytic leukemia, such as B-cell leukemia (CD5 + B lymphocytes), myeloid leukemia, such as acute myeloid leukemia, chronic myeloid leukemia, lymphoid leukemia, such as acute lymphoblastic leukemia , and myelodysplasia), multiple myeloma, such as malignancy of plasma cells, and other hematological cancers and / or associated with B-cells or T-cells. Also included are additional hematopoietic cell cancers, including polymorphonuclear leukocytes, such as basophils, eosinophils, neutrophils and monocytes, dendritic cells, platelets, erythrocytes, and natural killer cells. The origins of B-cell cancers are as follows: C-cell lymphoma of the marginal zone originates in the B-cells of the marginal zone; the follicular infoma and diffuse large B-cell lymphoma originates in the centrocytes of the clear zone of the germinal centers; Multiple myeloma originates in plasma cells; chronic lymphocytic leukemia and small lymphocytic leukemia originates in B1 cells (CD5 +); mantle cell lymphoma originates in pure B-cells in the mantle zone; and Burkitt's lymphoma originates in the centroblasts of the dark zone of the geminal centers. For these indications, the appropriate dosage will, of course, vary depending on, for example, the antibody of the particular invention to be employed, the host, the mode of administration, and the nature and severity of the condition being trying. However, in prophylactic use, it is generally indicated that satisfactory results are obtained with dosages from approximately 0.05 milligrams to approximately 20 thousand igrams or 10 milligrams per kilogram of body weight, more usually from approximately 0.1 thousand igres approximately. 5 m il igramos per kilogram of body weight. The frequency of dosage for prophylactic uses will normally be in the range of about one per week to about one every three months, more usually in the range of about once every two weeks to about once every ten weeks, for example once every four to eight weeks The Antibody of the Invention is conveniently administered parenterally, intravenously, for example in the antecubital vein or other peripheral vein, intramuscularly, or subcutaneously. A prophylactic treatment typically comprises administering the antibody of the invention once a month to once every two to three months, or with less frequency. Antibodies of the invention can be administered as the sole active protein, or in conjunction with, for example, as an adjuvant to, or in combination with, other drugs, for example drugs useful in the treatment, prevention, the improvement, and / or cure of cancers, for example for the treatment or prevention of the diseases mentioned above. For example, the antibodies of the invention can be used in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be administered with the antibodies of the invention include, but are not limited to, antibiotic derivatives (e.g., doxorubicin (adriamycin), bleomycin, daunorubicin, and dacti nomicin); anti-estrogens (for example, tamoxifen); anti-metabolites (eg, fluoro-uracil, 5-FU, methotrexate, fluoxuridine, interferon alfa-2b, glutamic acid, plicamycin, mercapto-purine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine-arabinoside, cyclophosphamide, estramustine, hydroxy urea, procarbazine, mitomycin, busulfan, cisplatin, and vincristine sulfate); hormones (eg, medroxy-progesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyl-testosterone, diethyl stilbestrol diphosphate, chloro-trianisine, and testolactone); nitrogen mustard derivatives (e.g., mephalene, chlorambucil, mechlorethamine (nitrogen mustard), and thiotepa); steroids and combinations (e.g., betamethasone sodium phosphate); and others (eg, dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, etoposide, topotecan, 5-fluoro-uracil, paclitaxel (Taxol), cisplatin, cytarabine, and IFN-gamma, irinotecan (Camptosar, CPT- 11), Irinotecan analogs, gemcitabine (GE ZAR®), and oxaliplatin, ifosfamide, and nitroso-urea compounds). In specific embodiments, the Antibodies of the Present Invention may be administered in combination with one or more chemotherapeutic agents or other therapeutic agents useful in the treatment, prevention, amelioration, and / or cure of cancers, including, but not limited to, a, one or more agents of Table 1. TABLE 1: 81C6 (anti-tenascin monoclonal antibody), 2-chloro-deoxy-adenosine, A007 (4-4'-dihydroxy-benzophenone-2,4-dinitrophenyl) hydrazone), Abarelix® (Abarelix-Depot-M®, PPI-149, R-3827); Abiraterone® acetate (CB-7598, CB-7630), ABT-627 (ET-1 inhibitor), ABX-EGF (anti-EGFr monoclonal antibody), Acetyl-dinaline (CI-994, GOE-5549, GOR- 5549, PD-130636), AG-2034 (AG-2024, AG-2032, GARFT inhibitor [glycine amide ribonucleoside transformylase]), Alanosine, Aldesleucine (IL-2, Proleukin®), Alemtuuumab® (Campath®), Alitretinoin (Panreting, LGN-1057), Allopurinol (Aloprim®, Zyloprim®), Altretamine (Hexalen®, hexamethyl-melamine, Hexastat®), Amifostine (Ethyol®), Amino-camptothecin (9-AC, 9-Amino-camptothecin , NSC 603071), Amino-glutethimide (Cytadren®), aminolevulinic acid (Levulan®, Kerastick®), Aminopterin, Amsacrine, Anastrozole (Arimidex®), Angiostatin, Anamycin (AR-522, LN anamycin, Aronex®), anti-therapy -idiotype (BsAb), anti-CD19 / CD3 monoclonal antibody (anti-CD19 / CD3 scFv, anti-NHL monoclonal antibody), APC-8015 (Provenge®, dendritic cell therapy), Aplidine (Aplidin®, Aplidin®), Arabinosil-guanine (Ara-G, GW506U78, Nelzarabine®, Compound 506U78), arsenic trioxide (Trisenox®, ATO, Atrivex® ), Avorelin® (Meterelin®, MF-6001, EP-23904), B43-Genistein (conjugate of anti-CD19 antibody / genistein), B43-PAP (conjugate of anti-CD19 antibody / antiviral protein of ivy), conjugates of antibodies B7, BAY 43-9006 (Raf kinase inhibitor), BBR 3464, Betatin (Beta-LT), Avastin® (Bevacizumab, anti-VEGF monoclonal antibody, rhuMAb-VEGF), Sutent® (sunitinib malate), Nexavar® (sorafenib tosylate), RAD001 (everolimus), Bexarotene (Targretin®, LGD1069), BIBH-1 (anti-FAP monoclonal antibody), BIBX-1382, Biclutamide (Casodex®), Biricodar dicitrate (Incel®, Incel MDR inhibitor), Bleomycin (Blenoxane®), BLP-25 (MUC-1 peptide), antagonists of BLyS, BMS-214662 (BMS-192331, BMS-193269, BMS-206635), BNP-1350 (BNPI-1100, Carenitecins), Boron Protoporphyrin Compound (PDIT, photodynamic immunotherapy), Briostatin-1 (Bryostatin®, BMY-45618, NSC-339555), Budesonide (Rhinocort®), Busulfan (Busulfex®, Myleran®), C225 (IMC-225, EGFR inhibitor, anti-EGFr monoclonal antibody, Erbitux® (Cetuximab), C242-DM1 ( huC242-DM1), Cabergoline (Dostinex®), Capecitabine (Xeloda®, Doxifluridine®, oral 5-FU), Carbendazine® (FB-642), Carboplatin (Paraplatin®, CBDCA), Carboxy-amldo-triazole (NSC 609974, CAI, L-651582), Carmustine (DTI-015, BCNU, BiCNU, Gliadel Water®), CC49-zeta gene therapy, CEA-cide®) (Labetuzumab®, anti-CEA monoclonal antibody, hMN-14), CeaVac ® (MAb 3H1), Celecoxib (Celebrex®), CEP-701 (KT-5555 ), Cereport® (Lobradimil®, RMP-7), Chlorambucil (Leukeran®), CHML (Heterogeneous Cytotropic Molecular Lipids), Colecaliferol, Cl-1033 (Pan-erbB RTK inhibitor), Cilengitide (EMD-121974, integrin antagonist) alfavbeta3), Cisplatin (Platinol®, CDDP), Cisplatin-epinephrine gel (IntraDose®, FocaCist®), Cisplatin-liposomal (SPI-077), 9-cis-retinoic acid (9-cRA), Cladribine (2-CdA) , Leustatin®), Clofarabine (chloro-fluoro-araA), Clonadine hydrochloride (Duration®), CMB-401 (anti-PEM monoclonal antibody / calicheamicin), CMT-3 (COL-3, Metastat®), Cordycepin, Cotara® (chTNT-1 / ?, [131 l] -chTNT-1 / B), CN-706, CP-358774 (Tarceva®, OSI-774, EGFR inhibitor), CP-609754, IL-4 toxin CP (IL-4 fusion toxin), CS-682, CT-2584 (Apra®, CT-2583, CT-2586, CT-3536), CTP-37 (Avicina®, hCG blocking vaccine), Cyclophosphamide (Cytoxan®, Neosar®, CTX), Cytarabine (Cytosar-U®, ara-C, cytosine-arabinoside, DepoCyt®, D-limonene, DAB389-EGF (EGF fusion toxin), Dacarbazine (DTIC), Daclizumab® (Zenapax®), Dactinomycin (Cosmegen®), Daunomycin (Daunorubicin®, Cerubidin®), Daunorubicin (DaunoXome®, Daunorubicin®, Cerubidin®), DeaVac® (CEA anti-idiotype vaccine), Decitabine (5-aza-2) '-deoxy cytidine), Declopramide (Oxi-104), Denileucine-diftitox (Ontak®), Depsipeptide (FR901228, FK228), Dexamethasone (Decadron®), Dexrazoxane (Zinecard®), Diethyl-norespermine (DENSPM), Diethyl- stilbestrol (DES), Dihydro-5-azacytidine, Docetaxel (Taxotere®, Taxano®), dolasetron mesylate (Anzemet®), Dolastatin-10 (DOLA-10, NSC-3 76128), Doxorubicin (Adriamicin®, Doxil®, Rubex®), DPPE, DX-8951f (DX-8951), Edatrexate, EGF-P64k vaccine, Elliott® Solution B, EMD-121974, Endostatin, Enil-uracil ( 776c85), E09 (E01, E04, E068, EO70, E072), Epirubicin (Ellence®, EPI, 4'-epi-doxorubicin), Epratuzumab® (Lymphocide®, humanized anti-CD22, HAT), Erythropoietin (EPO®, Epogen®, Procrit®), Estramustine (Emcyt®), Etanidazole (Radinyl®), Etoposide Phosphate (Etopofos®), Etoposide (VP-16, Vepesid®), Exemestane (Aromasin®, Nikidess®), Exetecan mesylate ( DX-8951, DX-8951f), Exisulind (SAAND, Aptosina®, inhibitor of CGMP-PDE2 and 5), F19 (anti-FAP monoclonal antibody, anti-FAP iodinated monoclonal antibody), Fadrozole (Afema®, fadrozole hydrochloride, Arensina®), Fenretinide® (4HPR), fentanyl citrate (Actiq® ), Filgrastim (Neupogen®, G-CSF), FK-317 (FR-157471, FR-70496), Flavopiridol (HMR-1275), Fly3 / flk2 ligand (Mobista®), Fluasterraine, Fludarabine (Fludara®, FAMP ), Fludeoxy-glucose (F-8®), Fluoro-uracil (5-FU, Adrucil®, Fluoroplex®, Efudex®), Flutamide (Eulexin®), F dC (KW-2331, MDL-0173), Formestane ( Lentaron®), Fotemustine (Nuphoran®, Mustophoran®), FUDR (Floxuridine®), Fulvestrant (Faslodex®), G3139 (Genasense®, GentaAnticode®, Bcl-2-anti-sense), texaphyrin of dadolinium (Motexafin gadolinium, Gd -Tex®, Xcytrin®), galarubicin hydrochloride (DA-125), GBC-590, Gastrimmune® (anti-gastrin-17 immunogen, anti-g17), Gemcitabine (Gemto®, Gemzar®), Gentuzumab-ozogamicin (Mylotarg ®), GL331, hexasaccharide Balloon H (Balloon H- KLH®), Glufosfamideg (ß-D-glucosyl-isophosfamide mustard, D19575, INN), goserelin acetate (Zoladex®), Granisetron (Kytril®), GVAX (gene therapy GM-CSF), Her-2 / Neu vaccine, Herceptin® (Trastuzumab®, anti-HER-2 monoclonal antibody, anti-EGFR-2 monoclonal antibody), HSPPC-96 (HSP cancer vaccine, shock protein complex by heat gp96-peptide), Hu1D10 (anti-HLA-DR monoclonal antibody, SMART 1D10), HumaLYM (anti-CD20 monoclonal antibody), Hydrocortisone, Hydroxy-urea (Hydrea®), Hypericin® (VltRxyn®), 1-131 Lipidiol®, lbritumomab®tiuxetano (Zevalin®), Idarubicin (Idamycin®, DMDR,o.

IDA), Ifosfamide (IFEX®), Imatinib mesylate (STI-571, Imatinib®, Glivec®, Gleevec®, tyrosine kinase inhibitor Ab1), INGN-101 (p53 gene therapy / retrovirus), INGN-201 ( p53 / adenovirus gene therapy), Interferon-alpha (Alfaferone®, Alpha-IF®), Interferon-alpha 2a (Intron A®), Interferon-gamma (Gamma-interferon, Gamma 100®, Gamma-IF), Interleukin- 2 (Proleiukin®), Intopicin (RP 60475), Irinotecan (Camptosar®, CPT-11, Topotecin®, CaptoCPT-1), Irofulvene (MGI-114, Ivofulvane, acyl-fulvene analog), ISIS-2053 (PKC- alpha anti-sense), ISIS-2503 (anti-sense Ras), ISIS-3521 (anti-sense PKC-alpha), ISIS-5132 (K-ras / anti-sense raf), Isotretinoin (13-CRA, 13-acid) -cis-retinoic acid, Accutane®), ketoconazole (Nizoral®), KRN-8602 (MX, MY-5, NSC-619003, MX-2), L-778123 (Ras inhibitors), L-asparaginase (EIspar®, Crastinin®, Asparaginase medac®, Kidrolase®), Leflunomide (SU-101, SU-0200), Letrozole (Femara®), Leucovorin (Leucovorin®, Wellcovori n®), Leuprolide acetate (Viadur®, Lupron®, Leuprogel®, Eligard®), Leuvectin® (cytofectin + IL-2 gene, IL-2 gene therapy), Levamisole (Ergamisol®), Liarozol (Liazal, Liazol, R-75251, R-85246, Ro-85264), Lmb-2 immunotoxin (recombinant anti-CD25 immunotoxin, anti-Tac (Fv) -PE38), Lometrexol (T-64, T-904064), Lomustine (CCNU ®, CeeNU®), LY-335979, Lym-1 (131-1 LYM-1), lymphoma vaccine (Genitope), Mannan-MUC1 vaccine, Marimastato® (BB-2516, TA-2516, MMP inhibitor) , MDX-447 (MDX-220, BAB-447, EMD-82633, H-447, anti-EGFr / FcGammaR1 r), Mechlorethamine (nitrogen mustard, HN2, Mustargen®), acetate megestrol (Megace®, Pallace®), Melphalan (L-PAM, Alkeran®, phenyl-alanine mustard), Mercaptopurine (6-mercaptopurine, 6-MP), Mesna (Mesnex®), Met otrexate® (MTX, Mexate® , x®), Methoxsalen (Uvadex®), 2-methoxy-estradiol (2-ME, 2-ME2), Methyl-prednisolone (Solumedrol®), Methyl-testosterone (Android-10®, Testred®, Virilon®), MGV, Mitomycin C (Mitomycin®, Mutamicin®, Mito Extra®), Mitoxantrone (Novantrone®, DHAD), Mitumomab® (BEC-2, EMD-60205), Mivobulin isethionate (CI-980), MN-14 (immuno -radiation therapy anti-CEA, 131I-MN-14, 188Re-MN-14), Motexafina de Lutetium (Lutrin®, Optrin®, Lu-Tex®, lutecio texaphyrin, Lucyn®, Antrin®), MPV-2213ad (Finrozole ®), MS-209, Muc-1 vaccine, NaPro Paclitaxel, Nelarabine (Compound 506, U78), Neovastato® (AE-941, MMP inhibitor), Neugene compounds (Oncomcina-NG, Resten-NG, anti-myc sense), Nilutamide (Nilandron®), NovoMAb-G2 scFv (NovoMAb-G2 IgM), 06-benzyl-guanine (BG, Procept®), octreotide acetate (Sandostatin) LAR® Reservoir), Odansetron (Zofran®), Onconase (Ranpimasa®), OncoVAX-CL, OncoVAX-CL Jenner (GA-733-2 vaccine), OncoVAX-P (OncoVAX-PrPSA), Onyx-0 5 (therapy p53 genetics), Oprelvecin (Neumage®), Orzel (Tegafur + Uracil + Leucovorin), Oxaliplatin (Eloxatin®, Eloxatin®), Pacis® (BCG, live), Paclitaxel (Paxene®, Taxol®), Paclitaxel-DHA ( Taxoprexin®), Pamidronate (Aredia®), PC SPES, Pegademasa (Adagen®, bovine Pegademasa), Pegaspargasa® (Oncospar®), Peldesina (BCX-34, PNP inhibitor), Pemetrexed-disodium (Alimta®, MTA, antite of multiple objectives, LY 231514), Pentostatin (Nipent®, 2-deoxy-coformicin), Perfosfamide (4-hydroperoxy-cyclophosphamide, 4-HC), perillic alcohol (perilla alcohol, perillol alcohol, perillol, NSC-641066), phenyl butyrate, Pirarrubicin (THP), pivaloyloxy-methyl butyrate (AN-9, Pivanex®), Porfimer-sodium (Photofrin®), Prednisone, Prinomastato® (AG-3340, MMP inhibitor), Procarbazine (Matulane®), PROSTVAC, Vaccine of Breast Cancer at Providence Portland Medical Center, PS-341 (LDP-341, 26S proteasome inhibitor), monoclonal antibody PSMA (prostate-specific membrane antigen monoclonal antibody), Pirazoloacridine (NSC-366140, PD-115934) , Quinine, R115777 (Zarnestra®), Raloxifene hydrochloride (Evista®, Cheoxifen hydrochloride), Raltitrexed (Tomudex®, ZD-1694), Rebeccamycin, Retinoic acid, R-flurbiprofen (Flurizan, E-7869, MPC-7869) , RFS-2000 (9- nitro-camptotecan), 9-NC, rubitecano®), Rituximab® (Rituxan®, anti-CD20 monoclonal antibody), RSR-13 (GSJ-61), Satraplatin (BMS-182751, JM-216), SCH-6636, SCH-66336, Sizofilan® (SPG, Sizofiran®, Schizophyllan®, Sonifilan®), SKI-2053R (NSC-D644591), Sobuzoxane (MST-16, Perazolin®), Squalamine (MSI-1256F), SR-49059 (vasopressin receptor inhibitor) , V1a), streptozocin (Zanosar®), SU5416 (Semaxanib®, VEGF inhibitor), SU6668 (PDGF-TK inhibitor), T-67 (T-138067, T-607), Talc (Sclerosol®), Tamoxifen ( Nolvadex®), Taurolidine (Taurolin®), Temozolamide (Temodar®, NSC 362856), Teniposide (VM-26, Vumon®), TER-286, Testosterone (Andró®, Androderm®, Testoderm TTS®, Testoderm®, DepoTestosterone®, Androgel®, depoAndro®), Tf-CRM107 (Transferrin-CRM-107), Thalidomide, Teratopa, Thioguanine (6-thioguanine, 6-TG), Tiotepa (triethylene-thiophosphoramide, Thioplex®), Thymosin alfa I ( Zadaxin®, Thymalfasin®), Thiazofurine (Tlazole®), Tirapazamine (SR-259075, SR-4233, Tirazone®, Win-59075), TNP-470 (AGM-1470, Fumagillin), Tocladesine (8-C1-cAMP) , Topotecan (Hycamtin®, SK &F-104864, NSC-609699, Evotopin®), Toremifene (Estrirnex®, Fareston®), Tositumomab® (Bexxar®), Tretinoin (Retin-A®, Atragen®, ATRA, Vesanoid® ), TriAb® (anti-idiotype antibody immunostimulator), Trilostane (Modrefen®), Triptorelin pamoate (Trelstar Depot®, Decapeptyl®), Trimetrexate (Neutrexin®), Troxacitabine (BCH-204, BCH-4556, Troxatyl®) , TS-1, UCN-01 (7-hydroxy-staurosporine), Valrubicin (Valstar®), Valspodar (PSC 833), Vapreotide® (BMY-41606), Vaxid (B-cell lymphoma DNA vaccine), Vinblastine (Velban®, VLB), Vincristine (Oncovin®, Onco TCS®, VCR, Le urocristina®), Vindesina (Eldisina®, Fildesina®), Vinflunina (Javlor®, tubulin polymerization inhibitor), Vinorelbine (Navelbine®), Vitaxin® (LM-609, integrin antagonist monoclonal antibody alphavbeta3), WF10 (regulator of macrophages), WHI-P131, vaccine WT1, XR-5000 (DACA), XR-9576 (XR-9351, P-glycoprotein / MDR inhibitor), ZD-9331, ZD-1839 (IRESSA®), and Zoledronate ( Zometa®). Preferred combination components include Erbitux® (Cetuximab), Avastina® (Bevacizumab), Nexavar® (sorafenib tosylate), Sutent® (sunitinib malate), Tarceva® (erlotinib), RAD001 (everolimus), Docetaxel (Taxotere®), Cisplatin, Capecitabine (Xeloda®, Doxifluridine®, oral 5-FU). In one embodiment, the present invention provides a pharmaceutical composition comprising an antibody of the invention, in particular AIN457, as an active ingredient, and at least one additional anticancer agent of Table 1, wherein the active ingredients are present in each in free form or in the form of a pharmaceutically acceptable salt, and optionally at least one pharmaceutically acceptable carrier, for simultaneous, separate, or sequential use. In a preferred embodiment, the Antibody of the Invention, in particular AIN457, and the at least one additional anticancer agent of Table 1, are comprised in a single pharmaceutical formulation. These combinations, according to the present invention, are particularly useful for the treatment of a proliferative disease, such as cancer, and in particular of solid malignant diseases or malignant hematological diseases. In accordance with the foregoing, the present invention provides, in yet a further aspect: A method as defined above, which comprises the co-administration, for example in a concomitant or sequential manner, of a therapeutically effective amount of a molecule of IL-17 binding, for example an Antibody of the Invention, and at least one second drug substance, this second drug substance being an immunosuppressive / immunomodulatory, anti-inflammatory, chemotherapeutic, or anti-infective drug, for example as indicated above. Or, a therapeutic combination, for example a kit, comprising a therapeutically effective amount of: a) an IL-1 7 binding molecule, for example an antibody of the invention, and b) at least one second substance selected from an immunosuppressant / immunomodulatory, anti-inflammatory, chemotherapeutic, or anti-infective drug, for example as indicated above. The kit can include instructions for its administration. When the Antibodies of the invention are administered in conjunction with another immunosuppressive / immunomodulatory, anti-inflammatory, chemotherapeutic, anti-infectious therapy, the dosages of the co-administered combination compound will, of course, vary depending on the type of co-drug used, if it is a DMAR D, anti-TN F, L-1 blocker, or others, of the specific drug used, of the condition being treated, etc. The pharmaceutical compositions of the invention can be manufactured in a conventional manner. A composition according to the preference invention is provided in a lyophilized form. For immediate administration, it is dissolved in a suitable aqueous vehicle, for example sterile water for injection, or sterile regulated physiological sleep. If it is considered desirable to form a solution of a larger volume for its administration bynstead of doing it as a bolus injection, it is convenient to incorporate human serum albumin or the patient's own heparinized blood into the serum at the time of formulation. In an alternative way, the formulation is given subcutaneously. The presence of an excess of this physiologically inert protein prevents the loss of the antibody by adsorption on the walls of the container and the tubing used with the solution for infusion. If albumin is used, a suitable concentration is 0.5 percent to 4.5 percent by weight of the saline solution. Other formulations comprise a liquid or lyophilized formulation. The invention is further described by way of illustration in the following Examples. EXAMPLES Example 1 The antibody AIN457 is generated, and it is shown that it binds with a very high affinity with recombinant human IL-17 (hulL-17); the KD is 0.188 + 0.036 nM (BIAcore), and neutralizes human IL-6 production induced by hulL-7 in human dermal fibroblasts; the IC50 is 2.1 + 0.1 nM at a concentration of 1.87 nM of hulL-17, as described in the Application TCP Number PCT / EP2005 / 008470. Example 2: Table 2: Nucleotide and amino acid sequence of the light chain. The amino acid sequence that codes for the domain variable is bold and underlined. Oligonucleotide primers used for cloning are indicated (underlined).

MV417 ACCATGGAAACCCCAGCGGAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACC TGGTACCTTTGGGGTCGCCTCGAAGAGAAGGAGGACGATGAGACCGAGGGTCTATGGTGG T M E T P E L L F L L L L W L P D T T MV 19 GGAGAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCC 61 + + + + + --- + 120 CCTCTTTAACACAACTGCGTCAGAGGTCCGTGGGACAGAAACAGAGGTCCCCTTTCTCGG G E I V L T Q S P G T L S L S P G E R A ACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAGCTACTTAGCCTGGTACCAGCAG 121 + + + + + + 180 TGGGAGAGGACGTCCCGGTCAGTCTCACAATCGTCGTCGATGAATCGGACCATGGTCGTC T L S C R S S Q S V S S S Y L A W Y O Q AAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCAGCAGGGCCACTGGCATC 181 + + + + + + 240 TTTGGACCGGTCCGAGGGTCCGAGGAGTAGATACCACGTAGGTCGTCCCGGTGACCGTAG K P G Q A P R L L I Y G A S S R A T G I CCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTG 241 + + + + + + 300 GGTCTGTCCAAGTCACCGTCACCCAGACCCTGTCTGAAGTGAGAGTGGTAGTCGTCTGAC P D R F S G S G S G T D F T L T I S R L GAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGTGCACCTTC ?? CAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAG_661_+ + + + + - 711 # 223 GTCCCGGACTCGAGCGGGCAGTGTTTCTCGAAGTTGTCCCCTCTCACAATC Q G L S S P V T K S F N R G E C * Table 3: Nucleotide and amino acid sequence of the heavy chain. The amino acid sequence that codes for the variable domain is bold and underlined. Oligonucleotide primers used for cloning and sequencing are indicated.

MV416 ACCATGGAATTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCACTGT 1 +. + + + + + 60 TGGTACCTTAACCCCGACTCGACCCAAAAGGAACAACGATAAAATCTTCCACAGGTGACA T M E L G L S W V F L V A I L E G V H C V418 GAGGTGCAGTTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTC 61 + + + + + +! 20 CTCCACGTCAACCACCTCAGACCCCCTCCGAACCAGGTCGGACCCCCCAGGGACTCTGAG E V O L V E S G G G L V Q G G S L R L TCCTGTGCAGCCTCTGGATTCACCTTTAGTAACTATTGGATGAACTGGGTCCGCCAGGCT 121 + + + + + + 180 AGGACACGTCGGAGACCTAAGTGGAAATCATTGATAACCTACTTGACCCAGGCGGTCCGA S C A A S G F T F S N Y W M N W V R Q A CCAGGGAAAGGGCTGGAGTGGGTGGCCGCCATAAACCAAGATGGAAGTGAGAAATACTAT 181 - - + + + + + + 240 GGTCCCTTTCCCGACCTCACCCACCGGCGGTATTTGGTTCTACCTTCACTCTTTATGATA P G K G L E W V A A I N O D G S E K Y Y GTGGGCTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTAT 241 + + + + + + 300 CACCCGAGACACTTCCCGGCTAAGTGGTAGAGGTCTCTGTTGCGGTTCTTGAGTGACATA V G S V K G R F T I S R D N A K N S L Y MV432 CTGCAAATGAACAGCCTGAGAGTCGAGGACACGGCTGTGTATTACTGTGTGAGGGACTAT 301 + + + + + - + 360 GACGTTTACTTGTCGGACTCTCAGCTCCTGTGCCGACACATAATGACACACTCCCTGATA L Q M N S L R V E D T A V Y Y C V R D Y TACGATATTTTGACCGATTATTACATCCACTATTGGTACTTCGATCTCTGGGGCCGTGGC 361 + + + + + + 420 ATGCTATAAAACTGGCTAATAATGTAGGTGATAACCATGAAGCTAGAGACCCCGGCACCG And D I L T D Y Y I H Y W Y F D L W G R G MV433 ACCCTGGTCACTGTCTCCTCAGCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCC 421 + + + + + 480 MV434 TGGGACCAGTGACAGAGGAGTCGGAGGTGGTTCCCGGGTAGCCAGAAGGGGGACCGTGGG T L V T V S S A S T K G P S V F P L A P TCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTC 481 + + + + + + 540 AGGAGGTTCTCGTGGAGACCCCCGTGTCGCCGGGACCCGACGGACCAGTTCCTGATGAAG S S K S T S G G T A A G C L V K D Y F CCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTC 541 + + + + + + 600 GGGCTTGGCCACTGCCACAGCACCTTGAGTCCGCGGGACTGGTCGCCGCACGTGTGGAAG P E P V T V S W N S G A L T S G V H T F CCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCC 601 + + + - + + + 660 GGCCGACAGGATGTCAGGAGTCCTGAGATGAGGGAGTCGTCGCACCACTGGCACGGGAGG P A V L Q S S G L Y S L S S V V T V P S AGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAG 661 + + + - + + + 720 MV43S TCGTCGAACCCGTGGGTCTGGATGTAGACGTTGCACTTAGTGTTCGGGTCGTTGTGGTTC S S L G T Q T Y I C N V N H K P S N T K GTGGACAAGAGAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCA 721 + + + + + 780 # 265 CACCTGTTCTCTCAACTCGGGTTTAGAACACTGTTTTGAGTGTGTACGGGTGGCACGGGT V D K R V E P K S C D K T H T C P P C P TAA 781 --- 783 ATT Table 4: (Amino acid sequences of the CDR cycles): Example 3 Cell proliferation assay (incorporation of MTF or [3H] -thymidine): Cell proliferation is monitored, for example, with the Cell Proliferation Assay of a CelITiter 96 AQUEOus Solution (Promega, UK). In the preliminary experiments, cultures of different cell lines are established, for example five different cell lines (1 x 10 5 cells / milliliter in the tissue culture flasks), in the presence or absence of AIN457. The proliferation is evaluated on the aliquots taken daily from day to day 4, in order to establish the most representative point of time. Subsequently, replication experiments are established by applying the cells directly to the 96-well plates, and staining with MTS. A minimum of 95 percent viability, evaluated by staining with trypan blue, is required to start any experiment. For each cell line, 50 microliters of a cell suspension are seeded in a suitable culture medium at 1x105 cells / milliliter, in flat bottom wells (1x104 cells / well), to which 50 microliters of the culture medium are added, or a binding molecule of IL-17 2x, for example AIN457, in a suitable culture medium. All samples are applied in quadruplicate. The plate is incubated in an atmosphere humidified, with C02 at 5 percent. On day 3, 20 microliters of ILTS reagent are added to each well, and the plate is re-incubated for 3 to 4 additional hours for the development of the stain. At the end of this period, the plates are shaken gently, and the absorbance at 490 nanometers is recorded in an automatic microplate reader (MRX, Dynatech, Billingshurst, United Kingdom). Control values averaged (no cells, no IL-17 binding molecule, for example AIN457) are subtracted from the sample values, and these corrected values of A490 are calculated as the percentages of the control cultures that grow in the absence of the IL-17 binding molecule, for example AIN457. The error bars indicate the interval defined in the duplicate experiments, and the significant differences are considered as those that fall outside the region of overlap in the intervals of the averages. Example 4: Xenograft model. Activity in xenograft models (human tumors implanted in SCID mice): Tumors are established in SCID mice by subcutaneous injection of a suspension of human tumor cells derived from cultures of human tumor cells in the flank of the animal. Treatment begins once the tumors have reached a certain size (for example, 150 cubic millimeters), or after a certain time after the inoculation of the cells (for example, day 4-7). The IL-17 binding molecule, for example AIN457, to be tested, is administered intraperitoneally or intravenously once a day (or once every 2 to 4 days). The anti-tumor activity is expressed as T / C% (average increase in the tumor volumes of the treated animals divided by the average increase in the tumor volumes of the control animals, multiplied by 100), and the percentage of regressions (volume of the tumor less initial tumor volume divided by the initial volume of the tumor and multiplied by 100). Example 5: Evaluation of the effect of IL-17 on the release of cytokine by tumor cells. Tumor cell lines or freshly explanted tumor cells (1x10A5 / ml) are cultured in PMI 1640 containing 10 percent fetal calf serum, 2 mM L-glutamine, 10 International Units / milliliter of penicillin, and 100 micrograms / milliliter streptomycin, with or without IL-17 (range of 0.1 nanogram / milliliter to 1 microgram / milliliter), or IL-17 plus an excess of 10 to 100 times of AIN457 for 48 or 72 hours. Supernatants without cells can be collected and tested immediately, or stored at -70 ° C for several days or even months. The concentrations of many different cytokines, such as, for example, IL-6, IL-8, CXCL1, CXCL5 (but not limited thereto), are measured using commercially available ELISA kits, such as those of R &D Systems . The concentration of PGE2 can also be evaluated, using commercial sources, such as the Cayman Chemicals assay. The concentration of measured cytokines should be significantly lower when cultures are grown tumor cells in the presence of an IL-17 binding molecule, for example AIN457. Example 6: Carcinogenesis model. The mice are treated with 9, 10-dimethyl-1,2-benzanthracene (DMBA, Sigma) in 200 milliliters of acetone at 100 milligrams per mouse once at the age of 2 to 3 months, and then treated twice at the same time. week with the tumor promoter of 12-0-tetradecanoyl-phorbol (TPA; Fisher) in 200 milliliters of acetone, at 30 micrograms per mouse for up to 1 year. The tumors observed are presented as papillomas (keratoacanthomas), but can progress to carcinomas and metastasize by draining the lymph. Papilloma counts are routinely conducted by visual examination, and can be evaluated statistically. The role of IL-17 is assessed by administration of AIN457, for example at 1 milligram per mouse per week, daily, or every second or third day. Mice treated with an IL17 binding molecule, for example AIN457, must show a significantly lower incidence of papilloma, and a slower progress towards carcinomas and metastases. Example 7 Clinical study: A phase 1 dose finding study of AIN457 administered once every three weeks to adult patients with advanced solid tumors. Primary Objectives: Characterize the safety profile, including both acute and cumulative toxicities, and determine the maximum tolerated dose of the individual AI N457 agent administered by intravenous infusion once every three weeks to adult patients with advanced solid tumors who have failed with systemic therapy standard, or for whom there is no standard systemic therapy. Secondary: 1. Characterize the pharmacokinetics of the individual AI N457 agent administered by intravenous infusion once every three weeks to this patient population; the data obtained are used in concert with pharmacodynamic data to make the pharmacokinetic / pharmacodynamic correlations (PK / PD) that help predict safety and efficacy. 2. Obtain preliminary evidence of the anti-tumor activity of A1N 457 administered by intravenous infusion once every three weeks to this patient population. 3. Correlate intra-tumor drug levels among adult patients with advanced solid tumors receiving AI N457 by intravenous infusion once every three weeks, with those associated with efficacy in the pre-clinical models. 4. Collect information about tumors from samples of tumor biopsies when they are available and accessible before and after therapy, in order to identify the biological factors that correlate with efficacy and answer. Design This is an open-label, dose-scale study to evaluate the safety, pharmacokinetics, and pharmacodynamics of AIN457 administered by intravenous infusion once every three weeks to adult patients with advanced solid tumors who have failed systemic therapy. standard, or for whom there is no standard systemic therapy. The treatment period consists of up to six cycles of 21 days. Patients who experience an unacceptable toxicity or progress of the disease are discontinued prematurely. Patients who achieve a complete or partial response, or patients with stable disease at the end of the six cycles, continue the additional treatment according to an extension protocol at the discretion of the investigator, and after approval by the sponsor . Eligible patients receive additional cycles until the progress of the disease or unacceptable toxicity is observed. In the absence of dose-limiting toxicity (DLT), the dose scale proceeds as follows: 1. First dose scale: 1 00 percent dose increase (unless a grade 2 toxicity is identified in the first cohort, in which case, the dose scale is 25 percent to 67 percent). 2. Dose scales following the dose increase of 1 00 percent from the first to the second cohort: dose increases of 67 percent until a grade 2 toxicity is identified. 3. Final dose scales following the identification of grade 2 toxicity: dose increases of 25 percent to 67 percent, based on the consensus reached between the researchers and the sponsor. The dose scale is based on the toxicities from the first cycle for each cohort of patients. The maximum provisional tolerated dose (MTD) is defined as the dose level immediately below that in which the dose-limiting toxicity is observed in at least two of 3 to 6 patients. The cohort defined as the maximum provisional tolerated dose then enrolls additional patients up to a total of 12, to confirm the maximum tolerated dose through further evaluation of the safety, pharmacokinetic, and pharmacodynamic profiles of the AIN457. An intra-patient dose scale will not be allowed. All toxicities are defined according to the Common Toxicity Criteria of the National Cancer Institute of the United States reviewed. The dose-limiting toxicities are defined in the protocol; however, in general, the nature of a dose-limiting toxicity is such that it is considered unacceptable even when an incurable solid tumor is established. Patients Inclusion Criteria The following criteria must be met to be included in the study: 1. Male or female patients of > 18 years old . 2. Histologically documented advanced solid tumor, which has failed in standard systemic therapy, and even an additional systemic therapy, or for which there is no standard systemic therapy. 3. At least one measurable, assessable, or non-assessable site of disease, as defined by the Criteria of Solid Tumor Response of the Southwestern Oncology Group (SWOG), including the tumor marker value that is above the upper limit of the institutional normal. 4. Women with potential to raise children should have a pregnancy test of ß-HCG in negative serum before starting the study drug. Male and female patients of reproductive potential must agree to employ an effective method of birth control throughout the study and for up to 3 months following the discontinuation of the study drug. 5. Performance Status Score of the World Health Organization (WHO) of < 2. 6. Life expectancy of at least 3 months. 7. Written informed consent is obtained prior to any classification procedure.

Excluding Criteria An exclusion from the study is required if any of the following applies: 1. Female patients who are pregnant or nursing. Post-menopausal women should be amenorrheic for at least 12 months to consider that they have no potential to raise children. 2. The patient has a severe and / or uncontrolled medical illness (ie, uncontrolled diabetes, congestive heart failure, myocardial infarction within six months of the study, chronic kidney disease, or active uncontrolled infection). 3. The patient has a known brain metastasis. 4. The patient has an acute or known chronic liver disease (ie chronic active hepatitis, cirrhosis). 5. The patient has a known diagnosis of infection by the human immunodeficiency virus (VI H). 6. The patient has received any research agent within 30 days before entering the study. 7. The patient received myotherapy within four weeks (six weeks for nitrosoureas or mitomycin C) before entering the study. 8. The patient received prior radiation therapy within four weeks before entering the study. 9. The patient previously received radiotherapy until > 25 percent of the bone marrow.

. The patient had a major surgery within two weeks before entering the study. 11. The patient has a history that does not comply with medical regimens. 12. The patient has impaired hepatic, renal, or hematologic function, as defined by the following laboratory parameters: Platelet count < 100 x 109 / liter. Absolute neutrophil count (ANC) < 1.5 x 109 / liter. ALT (SGPT) or AST (SGOT) in serum > 2.5 x institutional upper limit of normal (IULN) (> 5 x IULN for patients with liver metastases). Total serum bilirubin > 1.5 x IULN. Serum creatinine > 1.5 x IULN. 13. The patient has < 5 years free of another primary malignancy; however, nonmelanomatous skin cancer and cervical carcinoma in situ are excluded only if the patient has the active disease. Sample Size This study requires approximately 40 patients. Treatments The AIN457 is supplied in individual 6-milliliter glass jars, each containing 50 milligrams of AIN457 as a freeze-dried cake. Reconstitution with 1.2 milliliters of water for injections will produce a transparent to opalescent solution, colorless Concentrate for Solution for Infusion at a concentration of 47 milligrams / milliliter from which at least 1 milliliter can be removed from the bottle with a standard 20 gauge needle with a syringe connected. The substance is formulated in an isotonic regulator (pH of 5.8 + 0.5) containing histidine, sucrose, and Polyisobate 80, and must be diluted in 250 milliliter infusion bags containing a 5 percent glucose solution before being administered to patients. . The initial dose level is 0.3 milligrams / square meter. This dose is calculated as one third of the low toxic dose (TDL) in the most sensitive species studied, which, for AI N457, is the dog. Because there are no mortalities in the lower part of the two doses administered to the dogs in the LPG toxicology study - 0.1 milligrams / kilogram, repeated once three weeks later -, the low toxic dose is estimated in the interval of 0.05 milligrams / kilogram. Using a factor of 20 to convert the milligrams / kilogram in the dog to milligrams / square meter in human beings, this initial dose is calculated as: 1/3 x 0.05 mg / kg x 20 kg / m2 = 0.3 mg / m2 The dose scale proceeds according to the scheme illustrated above. The study defines treatment delays, dose reductions, or withdrawal of treatment for individuals who experience haematological toxicities or other toxicities know that they result from AI N457. The treatment continues for up to six cycles, unless the patient experiences the progress of the disease or unacceptable toxicity. At the end of the six cycles, patients who have achieved a complete or partial response, and patients who have had stable disease, can continue the additional treatment according to an extension protocol at the discretion of the researcher, and then of approval by the sponsor. Safety Variables The safety of AI N457 assessed by physical examination and evaluation of vital signs, clinical laboratory results, adverse events, and use of concomitant medications. Adverse events are both provoked and voluntary, and are scored using the Common Toxicity Criteria of the Revised United States National Cancer Institute. Efficacy Variables Although this phase 1 study is not designed to detect efficacy, activity is shown as a function of the objective response rate of the tumor and survival rate if progress and overall. Evaluations of baseline tumors include the optimal evaluation of all measurable, measurable, and non-evaluable disease. The evaluations include a chest physical examination and roentgenogram, and, as appropriate, a computer tomogram of the chest, abdomen, and pelvis; sonogram of abdomen and pelvis; bone scintigraphy, with a bone roentgenogram of all known bone lesions; and determination of tumor marker values. Follow-up studies are obtained every two cycles and after cessation of treatment. The target status is clinically evaluated using the Novartis guidelines, which are based on the SWOG response criteria. All complete and partial answers must be confirmed by a second evaluation at least four weeks later. The best tumor response is calculated for each patient using the SWOG response criteria. Pharmacokinetics The following pharmacokinetic parameters are calculated and analyzed for cycles 1 and 2: tmax, Cmax, ??, X 2, AUC, and RA-RA = the proportion of AUCTC¡CIO2 / AUCXC¡CIo1 is evaluated as an index of accumulation. The preliminary assessment of dose proportionality is based on the AUC from the last dose between different dose groups. The pharmacokinetic / pharmacodynamic correlations with the toxicities observed (for example hematopoietic) are carried out as a predictor of safety. Pharmacodynamics Biopsy samples are obtained from tumors where they are feasible and accessible before therapy and after the first cycle of therapy, in order to identify biological factors that correlate with efficacy and response. Statistical Methods Patients with clinical adverse events emerging in the treatment are identified (especially those with a dose-limiting toxicity), or with laboratory abnormalities, viral signs, or physical examination (which are newly present or worsen from the time of treatment). base line), and the values are marked. The abnormality index is tabulated by cohort. Objective response rates (including both complete and partial responses) are presented by cohort. Descriptive statistics are used to summarize basic pharmacokinetic parameters by cohort.

Claims

1. The use of an IL-17 binding molecule that is capable of inhibiting the activity of 1 nM human IL-17 at a concentration of less than 5 nM by 50 percent, and this inhibitory activity is measured on the production of IL-6 induced by hu-IL-17 in human dermal fibroblasts, for the manufacture of a medicament for the treatment of a solid malignant proliferative disease or of a hematological proliferative disease.

2. The use of an IL-17 binding molecule, comprising the variable domains of both heavy chain (VH) and light chain (Vu); wherein this IL-17 binding molecule comprises at least one antigen binding site comprising: a) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1, CDR2, and CDR3, the CDR1 having the amino acid sequence SEQ ID NO: 1, the CDR2 having the amino acid sequence SEQ ID NO: 2, and the CDR3 having the amino acid sequence SEQ ID NO: 3, or their direct CDR equivalents; and b) an immunoglobulin light chain variable domain (VL), which comprises, in sequence, the hypervariable regions CDR1 ', CDR2', and CDR3 ', the CDRV having the , amino acid sequence SEQ ID NO: 4, with CDR2 'having the amino acid sequence SEQ ID NO: 5, and having CDR3' the amino acid sequence SEQ ID NO: 6, or their direct CDR 'equivalents; for the manufacture of a medicament for the treatment of a solid malignant proliferative disease or of a hematological proliferative disease.

3. The use of an IL-17 binding molecule comprising the variable domains of both heavy chain (VH) and light chain (VL); wherein this IL-17 binding molecule comprises at least one antigen binding site comprising: a) an immunoglobulin heavy chain variable domain (VH), which comprises, in sequence, the hypervariable regions CDR1-X, CDR2-X, and CDR3-X, the CDR1-x having the amino acid sequence SEQ ID NO: 11, the CDR2-x having the amino acid sequence SEQ ID NO: 12, and the CDR3-X having the amino acid sequence SEQ ID NO: 13, or its direct CDR-x equivalents; and b) an immunoglobulin light chain variable domain (Vu), which comprises, in sequence, the hypervariable regions CDR1 ', CDR2', and CDR3 ', the CDR1' having the amino acid sequence SEQ ID NO: 4, having the CDR2 'the amino acid sequence SEQ ID NO: 5, and CDR3' having the amino acid sequence SEQ ID NO: 6, or its direct CDR 'equivalents; for the manufacture of a medication for the treatment of a solid malignant proliferative disease or a hematological proliferative disease.

4. The use of an IL-17 binding molecule according to claims 1 to 3, wherein the solid malignant proliferative disease is selected from the group consisting of breast cancer, genitourinary cancer, lung cancer, gastrointestinal cancer , for example colo-rectal tumor or genitourinary tumor, especially a prostate cancer or a gastrointestinal stromal tumor (GIST), squamous cell cancer, melanoma, ovarian cancer, pancreatic cancer, neuroblastoma, head and neck cancer such as, for example, cancer of the mouth or cancer of the larynx, bladder cancer, or in a broader sense, renal, cerebral, or gastric cancer, a lung tumor, especially a non-microcellular lung tumor.

5. The use of an IL-17 binding molecule according to claims 1 to 3, wherein the hematological proliferative disease is selected from the group consisting of lymphoma, leukemia, especially those expressing c-kit, KDR, Flt-1, or Flt-3, myeloma or lymphoid malignancies, but also cancers of the spleen, and cancers of the lymph nodes.

6. A method for the treatment of a solid malignant proliferative disease or a hematological proliferative disease in a patient in need thereof, which comprises administering to the patient an effective amount of an IL-17 binding molecule in accordance with claims 1 to 3.