MX2008005520A - Novel herbicide resistance genes - Google Patents

Abstract

The subject invention provides novel plants that are not only resistant to 2,4-D, but also to pyridyloxyacetate herbicides. Heretofore, there was no expectation or suggestion that a plant with both of these advantageous properties could be produced by the introduction of a single gene. The subject invention also includes plants that produce one or more enzymes of the subject invention"stacked"together with one or more other herbicide resistance genes. The subject invention enables novel combinations of herbicides to be used in new ways. Furthermore, the subject invention provides novel methods of preventing the development of, and controlling, strains of weeds that are resistant to one or more herbicides such as glyphosate. The preferred enzyme and gene for use according to the subject invention are referred to herein asAAD-12(AryloxyAlkanoateDioxygenase). This highly novel discovery is the basis of significant herbicide tolerant crop trait and selectable marker opportunities.

Description

GENES NOVEDOSOS FOR RESISTANCE TO HERBICIDE BACKGROUND OF THE INVENTION Weeds can quickly deplete the soil of valuable nutrients needed for crops and other desirable plants. There are many different types of herbicides currently used for weed control. An extremely popular herbicide is glyphosate. Crops have been developed, such as corn, soybeans, sugarcane, cotton, sugar beets, wheat, turf, and rice, which are resistant to glyphosate. Therefore, fields with actively growing glyphosate-resistant soybeans, for example, can be sprayed for weed control without significant damage to soybean plants. With the introduction of genetically engineered glyphosate-tolerant crops (GTCs) in the mid-1990s, farmers were endowed with a simple, convenient, flexible, and inexpensive tool for the control of a broad spectrum of broadleaf and grass weeds in a non-parallel way in agriculture. Consequently, the producers quickly adopted the GTCs and in many cases abandoned many of the best accepted agronomic practices such as crop rotation, rotational action herbicide, tank mixing, mechanical incorporation with mechanical pest control and by crop. glyphosate-tolerant soybeans, cotton, corn, and sugarcane are commercially available in the United States and elsewhere in the Western Hemisphere Alfalfa was the first perennial GTC introduced, increasing the opportunity for repeated use of glyphosate on it harvest and fields repeatedly over a period of years More GTCs (eg, wheat, rice, sugar beets, turf, etc.) are waiting for introduction as they are accepted into the global market. Many other glyphosate-resistant species are in the experimental stage or development (for example, cane sugar, sunflower, beets , peas, carrot, cucumber, lettuce, onion, strawberry, tomato, and tobacco, forestry species such as poplar and ocozole, and horticultural species similar to calendula, petunia, and begonias, see the web site "isb vt edu / cfdocs / f? eldtests1 cfm, 2005") In addition, the cost of glyphosate has fallen dramatically in recent years to the point where few conventional programs for weed control can effectively compete on cost and performance with GTC systems. with glyphosate G-Phosphate has been used successfully in controlled fires and other non-harvest areas for the control of total vegetation for more than 15 years. In many cases, as with GTCs, glyphosate has been used 1-3 times per year by 3, 5, 10, up to 15 years in a row These circumstances have led to an exaggerated confidence in the ghfosato and in the technology of GTC and has placed a high selection pressure on the native species of weeds for plants that are naturally more tolerant to glyphosate or which have developed a mechanism to resist the herbicidal activity of glyphosate. The extensive use of glyphosate-only weed control programs results in the selection of glyphosate-resistant weeds, and is selected for the propagation of weed species that are internally more tolerant to glyphosate than most white species (ie, change of weeds). (Powles and Preston, 2006, Ng et al., 2003, Simarmata et al., 2003, Lorraine-Colwill et al., 2003, Sfiligoj, 2004, Miller et al., 2003, Heap, 2005, Murphy et al., 2002; Martin er al., 2002.) Although glyphosate has been widely used globally for more than 15 years, it has been reported that only a few weeds have developed resistance to glyphosate (Heap, 2005); however, most of these have been identified in the last five years. Resistant weeds include both herbs and broadleaf species -Lolium rigidum, Lolium multiflorum, Eleusine indica, Sorghum halepense, Ambrosia artemisiifolia, Conyza canadensis, Conyza bonariensis, Plantago lanceolata, Amaranthus palmerii, and Amaranthus rudis. Additionally, weeds that have not previously been a problem in agriculture before the widespread use of GTCs are now becoming more prevalent and difficult to control in the context of GTCs, which comprise >80% of the hectares of cotton and soybeans in the United States and > 20% of the hectares of corn in the United States (Gianessi, 2005). These changes in weeds are occurring predominantly with (but not exclusively) broadleaf weeds that are difficult to control. Some examples include species of Ipomoea, Amaranthus, Chenopodium, Taraxacum, and Commelina. In areas where farmers are faced with glyphosate-resistant weeds or a shift to more difficult-to-control weed species, farmers can compensate for the weakness of glyphosate by tank mixing or alternating with other herbicides that will control non-affected weeds. A popular and effective tank mix partner for the control of broad leaf species not affected in many cases has been 2,4-dichlorophenoxyacetic acid (2,4-D). 2,4-D has been used in agriculture and non-harvest situations for a broad spectrum of broadleaf weed control for more than 60 years. Individual cases of more tolerant species have been reported, but 2,4-D is one of the most widely used herbicides globally. One limitation for the additional use of 2,4-D is that its selectivity in dicotyledonous crops such as soybean or cotton is very poor, and therefore 2,4-D is not typically used in sensitive dicot crops (and it is generally not used nearby). Additionally, the 2,4-D used in turfgrass crops is limited in some way by the nature of the crop injury that may occur. 2,4-D in combination with glyphosate has been used to provide a stronger treatment than controlled fires before planting without tillage of soybeans and cotton; however, due to the sensitivity of these dicotyledonous species to 2,4-D, these controlled fire treatments must be presented at least 14-30 days before sowing (Agriliance, 2005). 2,4-D is the class of phenoxy acid herbicides, as is MCPA. 2,4-D has been used in many monocotyledonous crops (such as corn, wheat, and rice) for the selective control of broadleaf weeds without severe damage to the plants of the desired crop. 2,4-D is a synthetic auxin derivative that acts by deregulating normal cell-hormone homeostasis and obstructs balanced, controlled growth; however, the exact mode of action is still unknown. Triclopir and fluroxypir are herbicides of pyridyloxyacetic acid whose mode of action is also like that of a synthetic auxin. These herbicides have different levels of selectivity on certain plants (for example, dicotyledons are more sensitive than turfgrass). The differential metabolism by different plants is an explanation for the variable levels of selectivity. In general, plants metabolize 2,4-D slowly, so the various plant responses to 2,4-D may be more likely explained by a different activity at the target site (s) (WSSA, 2002). The plant metabolism of 2,4-D typically occurs via a two-phase mechanism, typically hydroxylation followed by conjugation with amino acids or glucose (WSSA, 2002). Over time, microbial populations have developed an alternate and efficient route for the degradation of this particular xenobiotic, resulting in the complete mineralization of 2,4-D.

Successive applications of the herbicide select microbes that can use the herbicide as a carbon source for growth, providing them with a competitive advantage in the soil. For this reason, 2,4-D is currently formulated as an element with relatively short half-life in soil, and no significant remaining effects have been found in subsequent crops. This adds to the herbicidal activity of 2,4-D. An organism that has been extensively investigated for its ability to degrade 2,4-D is Ralstonia eutropha (Streber et al., 1987). The gene that codes for the first enzymatic step in the mineralization pathway is tfdA. See U.S. Pat. No. 6,153,401 and GENBANK Acc. No. M16730. TfdA catalyzes the conversion of 2,4-D acid to dichlorophenol (DCP) via an a-ketoglutarate-dependent dioxygenase reaction (Smejkal et al., 2001). DCP has little herbicidal activity compared to 2,4-D. TfdA has been used in transgenic plants to impart resistance to 2,4-D in dicotyledonous plants (for example, cotton and tobacco) that are normally sensitive to 2,4-D (Streber et al. (1989), Lyon et al. (1989). ), Lyon (1993), and U.S. Patent No. 5,608,147). A large number of tfdA genes encoding proteins capable of degrading 2,4-D and deposited within the Genbank database have been identified from the environment. Many homologues are similar to tfdA (> 85% amino acid identity) and have enzymatic properties similar to tfdA. However, there are a number of homologues that have a significantly lower identity to tfdA (25-50%), although they have the characteristic residues associated with a-ketoglutarate Fe + 2 dioxygenases. Therefore, it is not evident what the substrate specificities of these dioxygenases are. A single example with low homology to tfdA (31% amino acid identity) is sdpA from Delftia acidovorans (Kohler et al., 1999, Westendorf et al., 2002, Westendorf et al., 2003). It has been shown that this enzyme catalyses the first step in (S) -diclorprop (and other (S) -phenoxypropionic acids) as well as in the mineralization of 2,4-D (a phenoxyacetic acid) (Westendorf et al., 2003) . The transformation of this gene into plants has not been reported until now. As a result, the development of new herbicide tolerant harvesting technologies (HTC) has been limited due largely to the efficiency, low cost, and convenience of GTCs. Consequently, there has been a very high adoption rate for the GTCs among the producers. This has created a small incentive for the development of new HTC technologies. The chemical substructures of aryloxyalkanoate are a common entity of many commercialized herbicides including phenoxyacetate auxins (such as 2,4-D and dichlorprop), pyridyloxyacetate auxins (such as fluroxypyr and triclopyr), aryloxyphenoxypropionate inhibitors (AOPP) acetyl coenzyme A carboxylase (ACCase) (such as haloxifop, quizalofop, and diclofop), and inhibitors of 5-substituted phenoxyacetate protoporphyrinogen oxidase IX (such as pyraflufen and flumiclorac). However, these classes of herbicides are quite distinct, and there is no evidence in the current literature for common degradation pathways between these chemical classes. Recently, a multifunctional enzyme for the degradation of herbicides has been described, covering multiple modes of action (PCT US / 2005/014737, filed on May 2, 2005). Another unique multifunctional enzyme and its potential uses are described below.

BRIEF DESCRIPTION OF THE INVENTION The present invention provides novel plants that are not only resistant to 2,4-D, but also to pyridyloxyacetate herbicides. Until now, there was no expectation or suggestion that a plant with both advantageous properties could be produced by introducing a particular gene. The present invention also includes plants that produce one or more enzymes of the present invention "stacked" together with one or more genes resistant to the herbicide, including, but not limited to, genes for glyphosate resistance, ALS (imidazolinone, sulfonylurea), aryloxyalkanoate, HPPD, PPO, and glufosinate, so as to provide herbicide tolerant plants compatible with broader and stronger weed control and options for the management of herbicide resistance. The present invention further includes methods and compositions utilizing homologs of the genes and proteins exemplified in the present invention. In some embodiments, the invention provides monocotyledonous and dicotyledonous plants tolerant to 2,4-D, MCPA, triclopyr, fluroxypyr, and one or more commercially available herbicides (eg, glyphosate, glufosinate, paraquat, ALS inhibitors (eg, sulfonylureas) , imidazolinones, triazolopyrimidine sulfonanilides, et al), inhibitors of HPPD (for example, mesotrione, isoxaflutol, et al.), dicamba, bromoxynil, aryloxyphenoxypropionates, and others). Also described are vectors comprising nucleic acid sequences responsible for said tolerance to the herbicide, such as methods for the use of said tolerant plants and combinations of herbicides for weed control and prevention of changes in the weed population. The present invention allows novel combinations of herbicides to be used in new ways. In addition, the present invention provides novel methods for preventing the development of, and control of, weed strains that are resistant to one or more herbicides such as glyphosate. The present invention allows novel uses of novel combinations of herbicides and crops, including preplanting an area to be planted immediately before sowing with a seed for plants that might otherwise be sensitive to that herbicide (such as 2, 4-D). The present invention relates in part to the identification of an enzyme that is not only capable of degrading 2,4-D, but also surprisingly possesses new properties, which distinguishes the enzyme of the present invention from the tfdA proteins previously known, for example. More specifically, the present invention relates to the use of an enzyme that is capable of degrading both the 2,4-D herbicides and those treated with pyridyloxyacetate. A-ketoglutarate-dependent dioxygenase enzyme that has the ability to degrade herbicides of both phenoxyacetate herbicides and of auxin pyridyloxyacetate herbicides has not been previously reported. The preferred enzyme and the gene for use in accordance with the present invention are referred to in the present invention as AAD-12 (Aryloxy-Alcanoate Dioxygenase). This highly novel discovery is the basis of the important trait of crop tolerant to the herbicide (HTC) and the selection marker opportunities. The plants of the present invention can be resistant throughout their life cycle. There was no prior motivation to produce plants comprising an AAD-12 gene (preferably an AAD-12 polynucleotide having a sequence optimized for expression in one or more types of plants, as exemplified in the present invention), and there was no an expectation that said plants could effectively produce an AAD-12 enzyme to render the plant resistant to a phenoxyacetic acid herbicide (such as 2,4-D) and / or one or more pyridyloxyacetate herbicides such as triclopyr and fluroxypyr. Therefore, the present invention provides many advantages that were not thought to be possible in the art.

This invention also relates in part to the identification and use of genes encoding aryloxyalkanoate dioxygenase enzymes which are capable of degrading the auxin phenoxyacetate herbicides and / or auxin pyridyloxyacetates. Methods for the selection of proteins for these activities are within the scope of the present invention. Therefore, the present invention includes the degradation of 2,4-dichlorophenoxyacetic acid herbicide and other auxin aryloxyalkanoate herbicides by a recombinantly expressed enzyme AAD-12. The present invention also includes methods for weed control wherein said methods comprise applying one or more pyridyloxyacetate herbicides or auxin phenoxyacetate herbicides to plants comprising an AAD-12 gene. The present invention also provides methods for using an AAD-12 gene as a selection marker for the identification of plant cells and total plants transformed with AAD-12, optionally including one, two, or more exogenous genes simultaneously inserted into the plant cells White. The methods of the present invention include the selection of transformed cells that are resistant to appropriate levels of a herbicide. The present invention further includes methods for the preparation of a polypeptide, having the biological activity of the aryloxyalkanoate dioxygenase, by cultivating plants and / or cells of the present invention.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 is an amino acid sequence alignment of an exemplified AAD-12 protein, TfdA, AAD-2, AAD-1, and TauD. Figure 2 illustrates the activity of AAD-12 (v2) on 2,4-D and enantiomers of dichlorprop.

BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 is the nucleotide sequence of AAD-12 from Delftia acidovorans. SEQ ID NO: 2 is the sequence of the translated protein encoded by SEQ ID NO: 1. SEQ ID NO: 3 is the plant optimized nucleotide sequence of AAD-12 (v1). SEQ ID NO: 4 is the sequence of the translated protein encoded by SEQ ID NO: 3. SEQ ID NO: 5 is the nucleotide sequence optimized in E. coli of AAD-12 (v2). SEQ ID NO: 6 is the sequence of the forward trigger M13. SEQ ID NO: 7 is the sequence of the reverse primer M13.

SEQ ID NO: 8 is the forward initiator sequence AAD-12 (v1) Pl \ J. SEQ ID NO: 9 is the sequence of the reverse primer AAD-12 (v1) PTU. SEQ ID NO: 10 is the sequence of the forward trigger for PCR that encodes AAD-12 (v1). SEQ ID NO: 11 is the reverse primer sequence for PCR that encodes AAD-12 (v1). SEQ ID NO: 12 shows the sequence of the primer "sdpacodF" AAD-12 (v1). SEQ ID NO: 13 shows the sequence of the "sdpacodR" initiator AAD-12 (v1). SEQ ID NO: 14 shows the initiator sequence "Brady Nco1". SEQ ID NO: 15 shows the initiator sequence "Sad de Brady. " DETAILED DESCRIPTION OF THE INVENTION The present development of a gene for resistance to 2,4-D and the subsequent resistant crops provide excellent options for the control of broadleaf weeds species, resistant to glyphosate (or highly tolerant and modified) for applications in harvest. 2, 4-D is a broad spectrum, relatively inexpensive, and strong broadleaf herbicide that could provide an excellent utility for farmers if it could provide greater crop tolerance in similar dicotyledonous and monocotyledonous crops. The crops of transgenic dicot tolerant to 2,4-D could also have a greater flexibility in the regime and application rate. An additional utility of the herbicide tolerance trait for 2,4-D is its utility to prevent damage to crops normally sensitive to 2,4-D entrainment, volatilization, inversion (or other phenomenon of off-site movement), poor application, vandalism, and the like. An additional benefit of the AAD-12 gene is that unlike all the tfdA homologues characterized to date, AAD-12 is capable of degrading auxin pyridyloxyacetates (e.g., triclopir, fluroxypir) in addition to achiral phenoxy auxins (e.g. 2,4-D, MCPA, 4-chlorophenoxyacetic acid). See table 1. A general illustration of the chemical reactions catalyzed by the present enzyme AAD-12 is shown in scheme A. (The addition of 02 is stereospecific; the degradation of the intermediate towards phenol and glyoxylate is spontaneous). It should be understood that the chemical structures in Scheme A illustrate the molecular base structures and that various R groups and the like (such as those shown in Table 1) are included but are not necessarily specifically illustrated in Scheme A. Multiple mixtures of Different combinations of phenoxy auxin have been used globally to direct the specific spectrum of weeds and environmental conditions in various regions. The use of the AAD-12 gene in plants allows protection to a much broader spectrum of auxin herbicides, thereby increasing the flexibility and spectrum of weeds that can be controlled. The present invention can also be used to protect from trawling or other synthetic auxin herbicide injury off-site for all commercially available phenoxine auxins. Table 1 defines commercially available pyridyloxy and phenoxy auxins and provides relevant chemical structures.

SCHEME A phenol glyoxylate a-ketoglutarate succinate TABLE 1 Commercially available phenoxyacetate and pyridyloxyacetate auxins. The reference to phenoxy auxin and pyridyloxy auxin herbicides is generally made with respect to the active acid but some are commercially formulated as any of a variety of corresponding ester formulations and these are similarly considered as substrates for the enzyme AAD-12 in plant as esterases General vegetables that convert these esters to the active acids in plant. The similar reference may also be for the corresponding organic or inorganic salt of the corresponding acid. The possible relationship intervals for use can be as treatments alone or in combination with other herbicides for both harvest uses if 00 Currently, a particular gene (AAD-12) has been identified which, when genetically designed for expression in plants, has the properties of allowing the use of phenoxy auxin herbicide in plants where there was never an inherent tolerance or not enough elevated to allow the use of these herbicides. Additionally, AAD-12 can provide in-plant protection to pyridyloxyacetate herbicides where the natural tolerance was also not sufficient to allow selectivity, expanding the potential utility of these herbicides. Plants containing AAD-12 alone can currently be treated sequentially or mixed in tank with one, two, or a combination of several phenoxy auxin herbicides. The ratio for each phenoxy auxin herbicide can have a range of 25 to 4000 g ae / ha, and more typically 100 to 2000 g ae / ha for the control of a broad spectrum of dicotyledonous weeds. Similarly, one, two, or a mixture of several auxin pyridyloxyacetate compounds can be applied to plants that express AAD-12 with a reduced risk of injury from said herbicides. The ratio for each pyridyloxyacetate herbicide can have a range of 25 to 2000 g ae / ha, and more typically 35-840 g ae / ha for the control of additional dicotyledonous weeds. Glyphosate is used extensively because it controls a very broad spectrum of broadleaf and weed species. However, the repeated use of glyphosate in GTCs and non-harvest applications has been selected, and will continue to be selected for changes in weeds with respect to the most naturally tolerant species or glyphosate-resistant biotypes. Participants in tank-mix herbicide used at efficient ratios that offer control of the same species but have different modes of action are prescribed by most herbicide resistance management strategies as a method to delay the emergence of resistant weeds . The stacking of AAD-12 with a glyphosate tolerance trait (and / or with other herbicide tolerance traits) could provide a mechanism to allow the control of glyphosate-resistant dicotyledonous weed species in GTCs by allowing the use of herbicides from glyphosate, phenoxy auxin (s) (e.g., 2,4-D) and auxin pyridyloxyacetates (e.g., triclopyr) selectively in the same crop. The applications of these herbicides could be simultaneously in a tank mixture comprising two or more herbicides of different modes of action; individual applications of a particular herbicide composition in sequential applications such as pre-plant, presurgical, or post-emergence and separation regimen of applications having a range of from about 2 hours to about 3 months; or, alternatively, any combination of any number of herbicides representing each chemical class can be applied at any time within approximately 7 months from the sowing of the crop to the first appearance of the crop (or the pre-harvest interval for the individual herbicide) , whichever is shorter).

It is important to have flexibility in controlling a broad spectrum of broadleaf weeds and weeds in terms of application regime, individual herbicide ratio, and the ability to control difficult or resistant weeds. The applications of glyphosate in a crop with a gene for Resistance to glyphosate / AAD-72 applied could have a range of approxily 250-2500 g ae / ha, auxogenous phenoxy herbicide (s) (one or more) could be applied of approxily 25-4000 g ae / ha , and herbicide (s) of auxin pipdiloxyacetates (one or more) could be applied from 25-2000 g ae / ha The optimal combination (s) and the regimen of this aplcacaon ( is) will depend on the particular situation, species, and environment, and will be best determined by a person skilled in the art of weed control and having the benefit of the present disclosure. Seedlings are typically resistant throughout their entire life cycle. growth Plants transformed typically s They will be resistant to a new application of herbicide at any time the gene is expressed. In the present invention, tolerance to 2,4-D is shown throughout the life cycle using the constitutive promoters evaluated so far (mainly CsVMV and AtUbi 10) Typically one might expect this, but it is an improvement over other non-metabolic activities where tolerance can be significantly impacted by the reduced expression of a resistance mechanism at the site of action, for example One example is Roundup Ready cotton, where the plants were tolerant if sprinkled early, but if sprinkled too late the glyphosate was concentrated in the meristems (because it was not metabolized and translocated); The used Monsanto viral promoters did not express well in the flowers. The present invention provides an improvement in this regard. Herbicide formulations (for example, formulation in ester, acid, or salt, or soluble concentrate, emulsifiable concentrate, or soluble liquid) and additives for tank mixing (eg, adjuvants, surfactants, entrainment retardants, or agents) for compatibility) can significantly affect weed control from a given herbicide or combination of one or more herbicides. Any combination of these with any of the aforementioned herbicide chemistries is within the scope of this invention. One skilled in the art could also observe the benefit of combining two or more modes of action to increase the spectrum of controlled weeds and / or for the control of naturally more tolerant or resistant weeds species. This could also be extended to chemicals for which herbicide tolerance was included in crops through human participation (either transgenically or non-transgenically) beyond the GTCs. In fact, the traits that encode glyphosate resistance (for example, resistant EPSPS in plant or bacteria, glyphosate oxidoreductase (GOX), GAT), resistance to glufosinate. { for example, Pat, bar), resistance to the herbicide that inhibits acetolactate synthase (ALS) (for example, imidazolinone, sulfonylurea, triazolopyrimidine sulfonanilide, pyrimidinylthiobenzoates, and other chemicals = AHAS, Csr1, SurA, et al.), resistance to bromoxynil (for example, Bxn), resistance to inhibitors of the HPPD enzyme (4-hydroxyphenyl-pyruvate-dioxygenase), resistance to phytoene desaturase inhibitors (PDS), resistance to herbicides that inhibit photosystem II (for example, psbA), resistance to herbicides that inhibit photosystem I, resistance to herbicides that inhibit protoporphyrinogen oxidase IX (PPO) (eg, PPO-1), resistance to phenylurea herbicides (eg, CYP76B1), enzymes that degrade dicamba (see, for example , US 20030135879), and others could be stacked alone or in multiple combinations to provide the ability to effectively control or prevent weed changes and / or resistance to any herbicide of the foregoing classes. mentioned. Modified in vivo EPSPS can be used in some preferred embodiments, as well as glyphosate resistance genes class I, class II, and class III. With respect to the additional herbicides, some preferred additional ALS inhibitors include but are not limited to sulfonylureas (such as chlorsulfuron, halosulfuron, nicosulfuron, sulfometuron, sulfosulfuron, trifloxysulfuron), imidazoloninones (such as imazamox, mazethapyr, imazaquin), triazolopyrimidine sulfonanilides (such as cloransulam-methyl, diclosulam, florasulam, flumetsulam, metosulam, and penoxsulam), pyrimidinylthiobenzoates (such as bispyribac and piritiobac), and flucarbazone. Some preferred HPPD inhibitors include but are not limited to mesotrione, isoxaflutole, and sulcotrione. Some preferred PPO inhibitors include but are not limited to flumiclorac, flumioxazin, flufenpir, pyraflufen, fluthiacet, butafenacil, carfentrazone, sulfentrazone, and diphenylethers (such as acifluorfen, fomesafen, lactofen, and oxyfluorfen). Additionally, AAD-12 alone or stacked with one or more additional HTC traits may be stacked with one or more additional internal traits (eg, insect resistance, fungal resistance, or stress tolerance, et al.) Or external (e.g. , increased yield, improved oil profile, improved fiber quality, et al.). Therefore, the present invention can be used to provide a complete agronomic package of improved crop quality with the flexibility and cost-effective ability to control any number of agronomic pests. The present invention relates in part to the identification of an enzyme that is not only capable of degrading 2,4-D, but also surprisingly possesses novel properties, for example which distinguish the enzyme of the present invention from the previously known tfdA proteins. Even though this enzyme has very low homology with tfdA, the genes of the present invention can still be generally classified in the same general family of a-ketoglutarate-dependent dioxygenases. This family of proteins is characterized by three conserved histidine residues in a motif? X / EJXza ^ eCT / SJXi-M-ißaHX-io-iaR "which comprises the active site.The histidines coordinate the Fe + 2 ion in the active site that is essential for catalytic activity (Hogan et al., 2000) The preliminary in vitro expression experiments discussed in the present invention were modified to help select novel attributes.These experiments also indicate that the enzyme AAD-12 is single of other enzymes of the same kind, described in a previously filed patent application (PCT US / 2005/014737; filed on May 2, 2005). The AAD-1 enzyme of that application shares only approximately 25% sequence identity with the present AAD-12 protein. More specifically, the present invention relates in part to the use of an enzyme that is not only capable of degrading 2,4-D, but also pyridyloxyacetate herbicides. Α-ketoglutarate-dependent dioxygenase enzyme that has the ability to degrade herbicides of different chemical classes and modes of action has not been previously reported. Preferred enzymes and genes for use in accordance with the present invention are referred to in the present invention as genes and proteins of AAD-12 (Aryloxy-Alkanoate Dioxygenase). This invention also relates in part to the identification and use of genes encoding aryloxyalkanoate dioxygenase enzymes that are capable of degrading phenoxy auxin and pyridyloxyacetate herbicides. Therefore, the present invention relates in part to the degradation of 2,4-dichlorophenoxyacetic acid herbicides, other phenoxyacetic acids, and pyridyloxyacetic acid by a recombinantly expressed AAD-12 enzyme. The present proteins were evaluated as positive for the conversion of 2,4-D to 2,4-dichlorophenol ("DCP", herbicidally inactive) in analytical tests. The partially purified proteins of the present invention can rapidly convert 2,4-D to DCP in vitro. An additional advantage provided by plants transformed with AAD-12 is that the parent herbicide (s) is metabolized into inactive forms, thus reducing the potential for harvesting residues of the herbicide in grains or in forage. The present invention also includes methods for weed control wherein said methods comprise the application of a pyridyloxyacetate and / or a phenoxy auxin herbicide to plants comprising an AAD-12 gene. In light of these findings, novel plants comprising a polynucleotide encoding this type of enzyme are now provided. Henceforth, there was no motivation to produce such plants, and there was no expectation that such plants could effectively produce this enzyme to render the plants resistant not only to acid phenoxy herbicides (such as 2,4-D) but also to to pyridyloxyacetate herbicides. Therefore, the present invention provides many advantages that were not thought to be possible in the art. Strains available to the public (deposited in culture collections such as ATCC or DSMZ) can be purchased and selected, using techniques described in the present invention, for novel genes. The sequences described in the present invention can be used to amplify and clone the homologous genes within a recombinant expression system for selection and further evaluation in accordance with the present invention. As discussed above in the background section of the invention, an organism that has been investigated extensively for its ability to degrade 2,4-D is Ralstonia eutropha (Streber et al., 1987). The gene that codes for the first enzyme in the degradation pathway is tfdA. See U.S. Pat. No. 6,153,401 and GENBANK Acc. No. M16730. TfdA catalyzes the conversion of 2,4-D acid to herbicidally inactive DCP via an a-ketoglutarate-dependent dioxygenase reaction (Smejkal et al., 2001). TfdA has been used in transgenic plants to impart resistance to 2,4-D in dicotyledonous plants (e.g., cotton and tobacco) normally sensitive to 2,4-D (Streber et al., 1989; Lyon et al., 1989; Lyon et al., 1993). A large number of tfdA-like genes that encode proteins capable of degrading 2,4-D have been identified from the environment and deposited within the Genbank database. Many homologs are quite similar to tfdA (> 85% amino acid identity) and have enzymatic properties similar to tfdA. Nevertheless, a small collection of α-ketoglutarate dependent dioxygenase homologs has currently been identified as having a low level of homology with respect to tfdA. The present invention relates in part to the surprising discoveries of new uses and functions of a distantly related enzyme, sdpA, from Delftia acidivorans (Westendorf et al., 2002, 2003) with low homology with respect to tfdA (31% of amino acid identity). This purified α-ketoglutarate-dependent dioxygenase enzyme in its native form had previously been shown to degrade 2,4-D and S-dichlorprop (Westendorf et al., 2002 and 2003). However, it had not previously been reported that the a-ketoglutarate-dependent dioxygenase enzyme had the ability to degrade herbicides of the chemical class of pyridyloxyacetate. SdpA had never been expressed in plants, nor was there any motivation to do so in plants because the development of new HTC technologies has been limited due mainly to the efficiency, low cost, and convenience of GTCs (Devine, 2005). In light of the novel activity, the proteins and genes of the present invention have been referred to in the present invention as AAD-12 proteins and genes. It has now been confirmed that AAD-12 degrades a variety of auxoxide phenoxyacetate herbicides in vitro. However, this enzyme, as reported for the first time in the present invention, was also surprisingly found to be capable of degrading additional substrates of the class of aryloxyalkanoate molecules. Substrates of significant agronomic importance include the auxin pyridyloxyacetate herbicides. This highly novel discovery is the basis for the significant opportunities for herbicide tolerant harvesting (HTC) and trait selection marker. This enzyme is unique in its ability to deliver degenerative activity of the herbicide to a range of broad-spectrum broadleaf herbicides (phenoxyacetate and pyridyloxyacetate auxins).

Therefore, the present invention relates in part to the degradation of 2,4-dichlorophenoxyacetic acid, other phenoxyacetic auxin herbicides, and pyridyloxyacetate herbicides by a recombinantly expressed aryloxyalkanoate dioxygenase enzyme (AAD-12). This invention also relates in part to the identification and uses of genes encoding a degenerative aryloxyalkanoate dioxygenase enzyme (AAD-12) capable of degrading phenoxy and / or pyridyloxy auxin herbicides. The present enzyme allows transgenic expression that results in tolerance to combinations of herbicides that could control almost all broadleaf weeds. AAD-12 can serve as an excellent crop trait tolerant to the herbicide (HTC) for stacking with other HTC traits [eg, glyphosate resistance, glufosinate resistance, resistance to the ALS inhibitor (eg, imidazolinone, sulfonylurea, triazolopyrimidine sulfonanilide ), resistance to bromoxynil, resistance to the HPPD inhibitor, resistance to the PPO inhibitor, et al.], and insect resistance traits (CrylF, CrylAb, Cry 34/45, other Bt proteins, or insecticidal proteins of an origin no Bacillis, et al.) for example. Additionally, AAD-12 can serve as a selection marker to aid in the selection of primary transformants of genetically engineered plants with a second gene or group of genes. In addition, the present microbial gene has been redesigned in such a way that the protein is encoded by codons that have a predilection for both the use of monocotyledonous plants and dicotyledonous plants (hemicot). Arabidopsis, corn, tobacco, cotton, soybeans, sugarcane, and rice have been transformed with constructions containing AAD-12 and have shown high levels of resistance to both phenoxy herbicides and pyridyloxy auxin herbicides. Therefore, the present invention also relates to "plant optimized" genes that encode proteins of the present invention. The oxyalkanoate groups are useful for the introduction of a stable acid functionality into the herbicides. The acid group can impart mobility to the phloem by "acid trapping", a desirable attribute for the action of the herbicide and therefore could be incorporated into the new herbicides for mobility purposes. The aspects of the present invention also provide a mechanism for the creation of HTCs. There are many commercially and experimentally potential herbicides that can serve as substrates for AAD-12. Therefore, the use of the present genes can also result in herbicide tolerance to those other herbicides as well. The HTC traits of the present invention can be used in novel combinations with other HTC traits (including but not limited to glyphosate tolerance). These combinations of traits give rise to novel methods for the control of weed species (and the like), due to the recently active resistance or the inherent tolerance to the herbicides (eg, glyphosate). Therefore, in addition to the HTC traits, novel methods for controlling weeds using herbicides, for which tolerance to the herbicide was created for said enzyme in transgenic crops, are within the scope of the invention. This invention can be applied in the context of commercialization of a 2,4-D resistance trait stacked with the current glyphosate resistance traits in soybeans, for example. Therefore, this invention provides a tool for combating changes in broadleaf weed species and / or broadleaf weed selection resistant to the herbicide, which culminates in an extremely high confidence by farmers with respect to glyphosate for the control weed control with various crops. The transgenic expression of the present AAD-12 genes is exemplified in, for example, Arabidopsis, tobacco, soybeans, cotton, rice, corn and sugarcane. Soybeans are a preferred crop for transformation in accordance with the present invention. However, this invention can be used in multiple other monocotyledonous crops (such as pasture grasses or turf grasses) and dicot crops such as alfalfa, clover, tree species, et al. Similarly, 2,4-D (or other AAD-12 substrates) can be used more positively in herbal crops where tolerance is moderate, and increased tolerance via this trait could provide farmers with the opportunity of using these herbicides with more efficient relationships and during a longer application time without the risk of injury to the crop.

Even further, the present invention provides a particular gene that can provide resistance to herbicides controlling broadleaf weeds. This gene can be used in multiple crops to allow the use of a broad spectrum herbicide combination. The present invention can also control the weeds resistant to the present chemicals, and assist in the control of the weed change spectrum resulting from the present agronomic practices. The subject AAD-12 can also be used in efforts to effectively detoxify additional herbicidal substrates to non-herbicidal forms. Therefore, the present invention is provided for the development of additional HTC features and / or selection marker technology. In addition to, or in addition to the use of the present genes to produce HTCs, the present genes can also be used as selection markers to successfully select transformants in cell cultures, greenhouses, and in the field. There is a high inherent value for the present genes simply as a selection marker for biotechnology projects. The promiscuity of AAD-12 for other auxinic aryloxyalkanoate herbicides provides many opportunities to use this gene for HTC and / or selection marker purposes.

Proteins (and source isolates) of the present invention. The present invention provides functional proteins. By "functional activity" (or "active") it is meant in the present invention that the proteins / enzymes for use in accordance with the present invention have the ability to degrade or decrease the activity of a herbicide (alone or in combination with other proteins). ). The plants that produce proteins of the present invention will preferably produce "an effective amount" of the protein so that when the plant is treated with a herbicide, the level of expression of the protein is sufficient to render the plant completely or partially resistant or tolerant to the herbicide (a typical relationship, unless otherwise specified, typical application relationships can be found in the well-known Herbicide Handbook (Weed Science Society of America, Eighth Edition, 2002), for example). The herbicide can be applied at ratios that would normally kill the white plant, at normal ratios and concentrations of field use. (Due to the present invention, the level and / or concentration may be optionally higher than those that have been previously used.) Preferably, the plant cells and plants of the present invention are protected against inhibition of growth or injury. caused by the herbicide treatment. The transformed plants and plant cells of the present invention have preferably become resistant or tolerant to a herbicide, as discussed in the present invention, meaning that the transformed plant and the plant cells can grow in the presence of effective amounts of one or more herbicides as discussed in the present invention. The preferred proteins of the present invention have catalytic activity to metabolize one or more aryloxyalkanoate compounds.

One can not easily discuss the term "resistance" and not use the verb "tolerate" or the adjective "tolerant". The industry has spent countless hours debating Herbicide Tolerant Crops (HTC) against Herbicide Resistant Crops (HRC). HTC is a preferred term in the industry. However, the official definition of resistance by the Weed Science Society of America is "the inherited ability of a plant to survive and reproduce after exposure to a dose of herbicide normally lethal to the wild type." In a plant, resistance can be present naturally or can be induced by techniques such as genetic engineering or selection of variants produced by tissue culture or mutagenesis. " As used in the present invention unless otherwise indicated, the "resistance" to the herbicide is inheritable and allows a plant to grow and reproduce in the presence of a typical herbicidally effective treatment by a herbicide for a given plant, as suggested by the present edition of The Herbicide Handbook and hereby invention. As recognized by those skilled in the art, a plant can be considered "resistant" even when a certain degree of plant injury is evident from exposure to the herbicide. As used in the present invention, the term "tolerance" is broader than the term "resistance", and includes "strength" as defined in the present invention, as well as an improved ability of a particular plant to withstand the various grades of herbicidally induced lesion that typically results in wild type plants of the same genotype at the same herbicidal dose. The transfer of functional activity to plant or bacterial systems may include a nucleic acid sequence, which encodes the nucleic acid sequence for a protein of the present invention, integrated within an expression vector of the protein appropriate to the host in which the vector will reside. One way to obtain a nucleic acid sequence encoding a protein with functional activity is to isolate the native genetic material from the bacterial species that produce the protein of interest, using information deduced from the amino acid sequence of the protein, such as they are described in the present invention. Native sequences can be optimized for expression in plants, for example, as described in greater detail below. An optimized polynucleotide can also be designed based on the sequence of the protein. The present invention provides classes of proteins that have novel activities as identified in the present invention. One way of characterizing these classes of proteins and the polynucleotides they encode is by defining a polynucleotide for its ability to hybridize, under a range of specified conditions, with an exemplified nucleotide sequence (the complement thereof and / or a probe or probes derived from each strand) and / or by their ability to be amplified by PCR using primers derived from the exemplified sequences. There are numerous methods for obtaining proteins for use in accordance with the present invention. For example, antibodies to the proteins described in the present invention can be used to identify and isolate other proteins from a mixture of proteins. Specifically, antibodies can be generated to portions of proteins that are more conserved or more distinct, compared to other related proteins. These antibodies can then be used to specifically identify equivalent proteins with characteristic activity by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), or immunoblot. Antibodies to the proteins described in the present invention, or equivalent proteins, or fragments of these proteins, can be easily prepared using standard procedures. Said antibodies are an aspect of the present invention. The antibodies of the present invention include monoclonal and polyclonal antibodies, preferably produced in response to an exemplified or suggested protein. One skilled in the art could readily recognize that the proteins (and genes) of the present invention can be obtained from a variety of sources. Since it is known that all operons for herbicide degradation are also encoded in transposition elements such as plasmids, such as the genetically integrated proteins of the present invention, they can be obtained from a wide variety of microorganisms, for example, including bacteria recombinants and / or wild-type bacteria. Mutants of bacterial isolates can be made by methods that are well known in the art. For example, asporogenous mutants can be obtained from the mutagenesis of an isolate with ethyl methane sulfonate (EMS). Mutant strains can also be made using ultraviolet light and nitrosoguanidine by methods well known in the art. A protein "from" or "that is obtained from" any of the present isolates referred to or suggested in the present invention means that the protein (or a similar protein) can be obtained from the isolated source or from another source, such as another bacterial strain or a plant. "Derived from" also has this connotation, and includes proteins that are obtained from a given type of bacterium that is modified for expression in a plant, for example. One skilled in the art will readily recognize that, given the description of a bacterial gene and protein, a plant can be designed to produce the protein. Antibody preparations, nucleic acid probes (DNA, RNA, or PNA, for example), and the like can be prepared using the polynucleotide sequences and / or amino acid sequences described in the present invention and used to select and retrieve other genes related from other sources (natural).

Standard techniques of molecular biology can be used to clone and sequence the proteins and genes described in the present invention. Additional information can be found in Sambrook et al., 1989, which is incorporated herein by reference.

Polynucleotides and probes. The present invention further provides nucleic acid sequences encoding proteins for use in accordance with the present invention. The present invention further provides methods for identifying and characterizing genes encoding proteins having the desired herbicidal activity. In one embodiment, the present invention provides unique nucleotide sequences that are useful as probes for hybridization and / or primers for PCR techniques. The primers produce characteristic fragments of the gene that can be used in the identification, characterization, and / or isolation of specific genes of interest. The nucleotide sequences of the present invention encode proteins that are distinct from the proteins previously described. The polynucleotides of the present invention can be used to form complete "genes" to encode proteins or peptides in a desired host cell. For example, as one skilled in the art could easily recognize, the present polynucleotides can be appropriately placed under the control of a promoter in a host of interest, as is readily known in the art. The level of gene expression and tissue temporal / specific expression can greatly impact the utility of the invention. Generally, higher levels of expression of a protein from a degenerative gene will result in faster degradation and more complete degradation of a substrate (in this case a white herbicide). Promoters will be expected to express the target gene at elevated levels unless the high expression has a consequent negative impact on the health of the plant. Typically, one may wish to have the AAD-12 gene constitutively expressed in all tissues for complete protection of the plant at all stages of growth. However, alternatively one could use a vegetatively expressed resistance gene; this could allow the use of the white herbicide in harvest for weed control and subsequently could control the sexual reproduction of the white crop by applying it during the flowering stage. In addition, the desired levels and expression times may also depend on the type of plant and the desired tolerance level. Some preferred embodiments utilize strong constitutive promoters combined with transcription enhancers and the like to increase expression levels and to improve tolerance to desired levels. Some of these applications are discussed in more detail below, before the examples section. As the person skilled in the art knows, DNA typically exists in a double-stranded form. In this arrangement, one string is complementary to the other string and vice versa. Since DNA replicates in a plant (for example), additional complementary strands of DNA are produced. The "coding strand" is frequently used in the art to refer to the chain that binds to the antisense strand. The mRNA is transcribed from the "antisense" strand of DNA. The "sense" or "coding" chain has a series of codons (a codon is the three nucleotides that can be read as a unit of three residues to specify a particular amino acid) that can be read as an open reading frame (ORF - by its acronym in English) to form a protein or peptide of interest. In order to produce a protein in vivo, a DNA strand is typically transcribed into a complementary strand of mRNA which is used as the template for the protein. Therefore, the present invention includes the use of the exemplified polynucleotides shown in the list of annexed sequences and / or equivalents including the complementary strands. RNA and PNA (peptide nucleic acids) that are functionally equivalent to the exemplified DNA molecules are included in the present invention. In an embodiment of the present invention, bacterial isolates can be cultured under conditions that result in a high multiplication of the microbe. After treatment of the microbe to provide a single-stranded genomic nucleic acid, the DNA can be contacted with the primers of the invention and subjected to PCR amplification. The characteristic fragments of the genes of interest will be amplified by the procedure, thereby identifying the presence of the gene (s) of interest.

Additional aspects of the present invention include genes and isolates identified using the methods and nucleotide sequences described in the present invention. Therefore the identified genes can encode proteins for resistance to the herbicide of the present invention. The proteins and genes for use in accordance with the present invention can be identified and obtained for example by the use of oligonucleotide probes. These probes are detectable nucleotide sequences that can be detected by virtue of an appropriate label or can be produced in an inherently fluorescent manner as described in International Application No. WO 93/16094. The probes (and the polynucleotides of the present invention) can be DNA, RNA, or PNA. In addition to adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U; for RNA molecules), the synthetic probes (and polynucleotides) of the present invention may also have inosine (a neutral base capable of mating with the four bases, sometimes used instead of a mixture of the four bases in the synthetic probes) and / or other synthetic bases (not natural). Therefore, where a synthetic, degenerate oligonucleotide is referred to in the present invention, and "N" or "n" is used generically, "N" or "n" may be G, A, T, C, or inosine . The ambiguity of the codes as used in the present invention is in accordance with the standard IUPAC naming conventions as shown in the present application (e.g., R means A or G, Y means C or T, efe).

As is well known in the art, if a hybrid probe molecule with a nucleic acid sample, it can reasonably be assumed that the probe and the sample have substantial homology / similarity / identity. Preferably, hybridization of the polynucleotide is carried out initially followed by washes under conditions of low, moderate, or high severity by techniques well known in the art, as described in, for example, Keller, G.H., M.M. Manak (1987) DNA probes, Stockton Press, New York, NY, pp. 169-170. For example, as set forth in the present invention, low stringency conditions can be achieved by an initial wash with 2x SSC (Standard Saline Citrate - SSC) /0.1% SDS (Sodium Dodecyl Sulfate) by 15%. minutes at room temperature. Typically, two washes are carried out. The highest severity can be achieved by decreasing the salt concentration and / or by raising the temperature. For example, the above described wash can be followed by two washes with 0.1x SSC / 0.1% SDS for 15 minutes each at room temperature followed by subsequent washes with 0.1x SSC / 0.1% SDS for 30 minutes each at 55 ° C. These temperatures can be used with other hybridization and washing protocols established in the present invention and as one skilled in the art would know (SSPE can be used as the salt instead of SSC, for example). The 2x SSC / 0.1% SDS can be prepared by adding 50 ml of 20x SSC and 5 ml of 10% SDS to 445 ml of water. 20x SSC can be prepared by the combination of NaCl (175.3 g / 0.150 M), sodium citrate (88 2 g / 0 015 M), and water, adjusting the pH to 7 0 with 10 N NaOH, then adjusting the volume to 1 liter 10% SDS can be prepared by dissolving 10 g of SDS in 50 ml of autoclaved water, then diluting to 100 ml Detection of the probe provides a means for determination in a known manner if the hybridization is This analysis of the probe provides a rapid method for the identification of genes of the present invention. The nucleotide segments used as probes according to the invention can be synthesized using a DNA synthesizer and standard procedures. These nucleotide sequences can also be used as PCR primers for amplifying the genes of the present invention. Hybridization characteristics of a molecule can be used to define polynucleotides of the present invention. therefore the present invention includes polynucleotides (and / or their complements), preferably their total complements) that hybridize with a polynucleotide exemplified in the present invention. That is, one way of defining a gene (and the protein it encodes), for example, is by its ability to hybridize (under any of the conditions specifically described in the present invention) with a known or specifically exemplified gene. As used in the present invention, the "stringent" conditions for hybridization refer to conditions that reach the same, or approximately the same degree of hybridization specificity as the conditions employed by the invention. the present applicants. Specifically, hybridization of DNA immobilized on Southern blots with 32 P-labeled gene-specific probes can be carried out by standard methods (see, for example, Maniatis et al., 1982). In general, hybridization and subsequent washings can be carried out under conditions that allow detection of target sequences. For probes of the double-stranded DNA gene, hybridization can be carried out overnight at 20-25 ° C below the melting temperature (Tm) of the DNA hybrid in 6x SSPE, 5x solution of Denhardt, 0.1% SDS, 0.1 mg / ml denatured DNA. The melting temperature is described by the following formula (Beltz et al., 1983): Tm = 81.5 ° C + 16.6 Log [Na +] + 0.41 (% of G + C) - 0.61 (% of formamide) - 600 / length of the duplex in base pairs. The washes can typically be carried out as follows: (1) Twice at room temperature for 15 minutes in 1x SSPE, 0.1% SDS (low severity wash). (2) Once at Tm-20 ° C for 15 minutes in 0.2x SSPE, 0.1% SDS (wash of moderate severity). For oligonucleotide probes, hybridization can be carried out overnight at 10-20X below the melting temperature (Tm) of the hybrid in 6x SSPE, 5x Denhardt's solution, 0.1% SDS, 0.1 mg / ml of denatured DNA. The Tm for the oligonucleotide probes can be determined by the following formula: Tm (° C) = 2 (number of base pairs T / A) + 4 (number of base pairs G / C) (Suggs et al., 1981). Washes are typically performed as follows: (1) Twice at room temperature for 15 minutes 1x SSPE, 0.1% SDS (low severity wash). (2) Once at the hybridization temperature for 15 minutes in 1x SSPE, 0.1% SDS (wash of moderate severity). In general, salt and / or temperature can be altered to change the severity. With a DNA fragment labeled > 70 or so of bases in length, the following conditions can be used: Low: 1 or 2x SSPE, low ambient temperature: 1 or 2x SSPE, 42 ° C Moderate: 0.2x or 1x SSPE, 65 ° C High: O.lx SSPE, 65 ° C. Duplex formation and stability depend on the substantial complementarity between the two strands of a hybrid, and, as mentioned above, some degree of inconsistency can be tolerated. Therefore, the sequences of the probe of the present invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions allow the formation of stable hybrids with the white polynucleotide of interest. Mutations, insertions, and deletions can occur in a given polynucleotide sequence in many ways, and these methods are known to one skilled in the art. Other methods may be known in the future.

PCR technology. The polymerase chain reaction (PCR) is a repetitive, enzymatic, barley synthesis of a nucleic acid sequence. This method is well known and is commonly used by those skilled in the art (see Mullis, U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159, Saiki et al., 1985). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to the opposite strands of the target sequence. The initiators are preferably oriented with the 3 'ends pointing to each other. Repeated cycles of heat denaturation of the template, fixation of the primers with their complementary sequences, and extension of the primers fixed with a DNA polymerase result in the amplification of the segment defined by the ends towards 5 'of the PCR primers. The extension product of each primer can serve as a template for the other primer, so that each cycle essentially doubles the amount of the DNA fragment produced in the previous cycle. This results in the exponential accumulation of the specific white fragment, up to several million times in a few hours. By using a thermostable DNA polymerase such as Taq polymerase, isolated from the thermophilic bacterium Thermus aquaticus, the amplification process can be completely automated. Other enzymes that can be used are known to those skilled in the art. The exemplified DNA sequences, or segments thereof, can be used as primers for PCR amplification. To carry out PCR amplification, some degree of inconsistency between the primer and the template can be tolerated. Therefore, mutations, deletions, and insertions (especially additions of the nucleotides to the 5 'end) of the amplified primers fall within the scope of the present invention. Mutations, insertions, and deletions can be produced in a given primer by methods known to one skilled in the art.

Modification of genes and proteins. The present genes and proteins can be fused with other genes and proteins to produce chimeric proteins or fusion proteins. Genes and proteins useful in accordance with the present invention include not only the full length sequences specifically exemplified, but also portions, segments and / or fragments (including contiguous fragments and internal and / or terminal deletions as compared to full length molecules ) of these sequences, variants, mutants, chimerics, and fusions thereof. The proteins of the present invention can have substituted amino acids as long as they retain the desired functional activity. "Variant" genes have nucleotide sequences that encode the same proteins or equivalent proteins that have equivalent or similar activity with an exemplified protein. The two superior results of the BLAST searches with the native nucleotide sequence of aad-12 show a reasonable level of homology (approximately 85%) in the 120 base pairs of the sequence. One would expect that hybridization under certain conditions would include these two sequences. See GENBANK Acc. Nos. DQ406818.1 (89329742; Rhodoferax) and AJ6288601.1 (44903451; Sphingomonas). Rhodoferax is very similar to Delftia but Sphingomonas is a completely different phylogenetically class. The terms "variant proteins" and "equivalent proteins" refer to proteins that have the same or essentially the same biological / functional activity against the target substrates and equivalent sequences as the exemplified proteins. As used in the present invention, reference to an "equivalent" sequence refers to sequences that have amino acid substitutions, deletions, additions, or insertions that improve or do not adversely affect activity to a significant degree. Fragments that retain activity have also been included in this definition. Fragments and other equivalents that retain the same function or activity or a similar function or activity as a corresponding fragment of an exemplified protein are within the scope of the present invention. Changes, such as amino acid substitutions or additions, can be made for a variety of purposes, such as the increase (or decrease) in protease stability of the protein (without materially / substantially diminishing the functional activity of the protein) , remove or add a restriction site, and the like. The variations of the genes can be easily performed using standard techniques for the elaboration of point mutations, for example. In addition, the Patent of E.U.A. No. 5,605,793, for example, describes methods for generating additional molecular diversity by using DNA reassembly after random or localized fragmentation. This can be referred to as "change" of the gene, which typically includes mixing fragments (of a desired size) of two or more different DNA molecules, followed by repeated rounds of renaturation. This can improve the activity of a protein encoded by an initial gene. The result is a chimeric protein having improved activity, altered substrate specificity, increased stability of the enzyme, altered stereospecificity, or other characteristics. The "change" can be designed and directed after obtaining and examining the 3D (three-dimensional) atomic coordinates and the crystal structure of a protein of interest. Therefore, "localized change" can be directed to certain segments of a protein that are ideal for modification, such as segments exposed on the surface, and preferably non-internal segments that participate in the folding of the protein and essentially the structural integrity 3d Specific changes to the "active site" The enzyme can be made to affect the inherent functionality with respect to activity or stereospecificity (see the alignment in Figure 1). Muller et. to the. (2006). The known crystal structure of tauD was used as a dioxygenase model to determine the residues of the active site while binding to its inherent substrate taurine. Elkins et al. (2002) "X-ray crystal structure of Escherichia coli taurine / alpha-ketoglutarate dioxygenase complexed to ferrous iron and substrates", Biochemistry 41 (16): 5185-5192. With regard to the optimization of the sequence and the designation of the active sites of the enzyme, see Chakrabarti et al., PNAS, (August 23, 2005), 102 (34): 12035-12040. Variant genes can be used to produce variant proteins; recombinant hosts can be used to produce variant proteins. Using these "gene change" techniques, genes and equivalent proteins can be made that comprise any 5, 10, or 20 contiguous residues (amino acids or nucleotides) of any sequence exemplified in the present invention. As one skilled in the art knows, gene change techniques, for example, can be adjusted to obtain equivalents having, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 1 13, 114, 115, 116, 117, 1 18, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 1 89, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, or 293 contiguous residues (amino acids or nucleotides), corresponding to a segment (of the same size) in any of the exemplified or suggested sequences (or complements (total complements) thereof). Segments of similar size, especially those for conserved regions, can also be used as probes and / or primers. Fragments of the full length genes can be made using commercially available exonucleases or endonucleases in accordance with standard procedures. For example, enzymes such as 8a / 31 or site-directed mutagenesis can be used to systematically cut nucleotides from the ends of these genes. Also, genes encoding active fragments can be obtained by using a variety of restriction enzymes. Proteases can be used to directly obtain active fragments of these proteins. It is within the scope of the invention as described in the present invention that the proteins can be truncated and still retain functional activity. By "truncated protein" is meant that a portion of a protein can be cleaved while the remaining truncated protein retains and exhibits the desired activity after cleavage. The cleavage can be achieved by various proteases. In addition, effectively cleaved proteins can be produced using molecular biology techniques wherein the DNA bases encoding said protein are removed either through digestion with restriction endonucleases or other techniques available to the skilled artisan. After truncation, said proteins can be expressed in heterologous systems such as E. coli, baculovirus, plant-based viral systems, yeast, and the like and are then placed in insect assays as described in the present invention to determine the activity. It is well known in the art that truncated proteins can be successfully produced so that they retain functional activity even though they have less than the full length sequence, complete. For example, the proteins of B.t. they can be used in a truncated form (core protein) (see, for example, Hófte et al. (1989), and Adang et al. (1985)). As used in the present invention, the term "protein" may include functionally active truncations. In some cases, especially for expression in plants, it may be advantageous to use truncated genes that express truncated proteins. Preferred truncated genes will typically code 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of the full-length protein. Certain proteins of the present invention have been specifically exemplified in the present invention. Since these proteins are merely exemplary of the proteins of the present invention, it should be readily apparent that the present invention comprises variant or equivalent proteins (and nucleotide sequences that encode equivalents thereof) that have the same activity or a similar activity in comparison with the exemplified proteins. Equivalent proteins will have amino acid similarity (and / or homology) to an exemplified protein. The amino acid identity will typically be at least 60%, preferably at least 75%, more preferably at least 80%, even more preferably at least 90%, and can be at least 95%. The preferred proteins of the present invention can also be defined in terms of more particular identity and / or similarity intervals. For example, the identity and / or similarity can be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% compared to a sequence exemplified or suggested in the present invention. Any previously listed number can be used to define the upper and lower limits. Unless otherwise specified, as used in the present invention, the identity and / or percent sequence similarity of two nucleic acids is determined using the algorithm of Karlin and Altschul, 1990, modified as in Karlin and Altschul 1993. Said algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990. The BLAST nucleotide searches are carried out with the NBLAST program, evaluation = 100, word length = 12. The BLAST with spaces can be used as described in Altschul et al., 1997. When BLAST and BLAST programs are used with spaces, the default parameters of the respective programs (NBLAST and XBLAST) are used. See the NCBI / NIH website. To obtain alignments with spaces for comparison purposes, the AlignX function of the Vector NTI 8 series (InforMax, Inc., North Bethesda, MD, E.U.A.) was used, using the default parameters. These were: a sanction for space opening of 15, a sanction for extension of space of 6.66, and a sanction for space separation with a range of 8. You can also modify various properties and three-dimensional characteristics of the protein without affecting adversely affect the activity / functionality of the protein. Conservative amino acid substitutions can be tolerated / elaborated so as not to adversely affect the activity and / or three-dimensional configuration of the molecule. The amino acids can be placed in the following classes: non-polar, polar non-charged, basic, and acidic. Conservative substitutions wherein an amino acid of one class is replaced with another amino acid of a similar type fall within the scope of the present invention so long as the substitution is not adverse to the biological activity of the compound. Table 2 provides a list of examples of amino acids that belong to each class.

TABLE 2 In some cases, non-conservative substitutions can also be made. However, preferred substitutions do not deviate significantly from the functional / biological activity of the protein. As used in the present invention, reference to "isolated" polynucleotides and / or "purified" proteins refers to these molecules when they are not associated with the other molecules with which they could be found in nature. Therefore, the reference to "isolated" and / or "purified" means the participation of the "hand of man" as described in the present invention. For example, a bacterial "gene" of the present invention placed within a plant for expression is an "isolated polynucleotide". Similarly, a protein derived from a bacterial protein and produced by a plant is an "isolated protein". Due to the degeneracy / redundancy of the genetic code, a variety of different DNA sequences can encode the amino acid sequences described in the present invention. This is within the ability of a person skilled in the art to create alternative DNA sequences encoding the same proteins, or essentially the same proteins. These variant DNA sequences are within the scope of the present invention. This is also discussed in more detail below in the section entitled "Optimization of the sequence for expression in plants".

Optimization of the sequence for expression in plants. To obtain high expression of heterologous genes in plants it is generally preferred to redesign the genes so that they are expressed more efficiently in (the cytoplasm of) plant cells. Corn is one such plant where it may be preferred to redesign the heterologous gene (s) prior to transformation to increase the level of expression thereof in said plant. Therefore, an additional step in the design of genes encoding a bacterial protein is the re-design of a heterologous gene for optimal expression, using the codon predilection most closely aligned with the target plant sequence, whether from a dicotyledonous species or monocot. The sequences can also be optimized for expression in any of the more particular types of plants discussed elsewhere in the present invention.

Transgenic hostages. The genes encoding the protein of the present invention can be introduced into a wide variety of microbial or plant hosts. The present invention includes transgenic plant cells and transgenic plants. Preferred plants (and plant cells) are corn, Arabidopsis, tobacco, soybeans, cotton, cañola, rice, wheat, turf, legume forages (e.g., alfalfa and clover), pasture grasses, and the like. Other types of transgenic plants can also be made according to the present invention, such as fruits, vegetables, ornamental plants, and trees. More generally, dicotyledons and / or monocots can be used in various aspects of the present invention. In preferred embodiments, expression of the gene results, directly or indirectly, in the intracellular production (and maintenance) of the protein (s) of interest. In this way the plants can become resistant to the herbicide. Such hosts can be referred to as transgenic, recombinant, transformed, and / or transfected hosts and / or cells. In some aspects of this invention (when the gene of interest is cloned and prepared, for example), microbial (preferably bacterial) cells can be produced and used in accordance with standard techniques, with the benefit of the present disclosure. The plant cells transfected with a polynucleotide of the present invention can be regenerated into whole plants. The present invention includes cell cultures including tissue cell cultures, liquid crops, and seeded crops. Seeds produced by and / or used to generate the plants of the present invention are also included within the scope of the present invention. Other tissues and plant parts are also included in the present invention. Similarly, the present invention includes methods for the production of plants or cells comprising a polynucleotide of the present invention. A preferred method for the production of said plants is by seeding a seed of the present invention. Although plants may be preferred, the present invention also includes the production of highly active recombinant AAD-12 in a host strain of Pseudomonas fluorescens (Pf), for example. The present invention includes preferred growth temperatures for the maintenance of active soluble AAD-12 in this host; a fermentation condition wherein AAD-12 is produced as more than 40% total cellular protein, or at least 10 g / L; a purification process results in a high recovery of recombinant AAD-12 from a Pf host; a purification scheme which produces at least 10 g of active AAD-12 per kg of cells; a purification scheme which can produce 20 g of active AAD-12 per kg of cells; a formulation process that can store and restore activity to the AAD-12 in solution; and a lyophilization process that can retain AAD-12 activity for long-term storage and shelf life.

Insertion of genes to form transgenic hosts. One aspect of the present invention is the transformation / transfection of plants, plant cells, and other host cells with polynucleotides of the present invention that express proteins of the present invention. Plants transformed in this way can become resistant to a variety of herbicides with different modes of action. A wide variety of methods are available for the introduction of a gene encoding a desired protein into the white host under conditions that allow stable maintenance and expression of the gene. These methods are well known to those skilled in the art and are described, for example, in the U.S. Patent. No. 5,135,867. Vectors comprising an AAD-12 polynucleotide are included within the scope of the present invention. For example, a large number of cloning vectors comprising a replication system in E. coli and a marker that allows the selection of transformed cells is available for preparation in the insertion of external genes within higher plants. The vectors include, for example, pBR322, the pUC series, the M13mp series, pACYC184, etc. Accordingly, the sequence encoding the protein can be inserted into the vector at a suitable restriction site. The resulting plasmid is used for transformation into E. coli. The E. coli cells are grown in a suitable nutrient medium, then harvested and lysed. The plasmid was recovered by purification from the genomic DNA. Sequence analysis, restriction analysis, electrophoresis, and other biochemical-molecular biology methods are generally carried out as methods of analysis. After each manipulation, the DNA sequence used can be digested by restriction and linked to the next DNA sequence. Each plasmid sequence can be cloned into the same plasmid or into another plasmid. Depending on the method of inserting the desired genes into the plant, other DNA sequences may be necessary. If, for example, the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right end, but frequently the right and left end of the T-DNA of the Ti or Ri plasmid, has to be joined as the flanking region of the genes to be inserted. The use of T-DNA for the transformation of plant cells has been investigated intensively and is described in EP 120 516; Hoekema (1985); Fraley et al. (1986); and An et al. (1985). A large number of techniques are available for the insertion of DNA into a plant host cell. These techniques include the transformation with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation agent, fusion, injection, biolistic (bombardment of microparticles), silicon carbide whiskers, aerosol radiation, PEG, or electroporation as well as other possible methods . If Agrobacteria is used for the transformation, the DNA to be inserted has to be cloned into special plasmids, that is to say within an intermediary vector or within a binary vector. Intermediary vectors can be integrated into the Ti or Ri plasmid by homologous recombination due to sequences that are homologous to the sequences in the T-DNA. The Ti or Ri plasmid also comprises the vir region necessary for the transfer of the T-DNA. Intermediary vectors can not replicate themselves in Agrobacteria. The intermediate vector can be transferred into Agrobacterium tumefaciens by means of an auxiliary plasmid (conjugation). The binary vectors can replicate themselves in both E. coli and Agrobacteria. These comprise a selection marker gene and a linker or polylinker which are in frame by the regions towards the right and left end of the T-DNA. These can be transformed directly into Agrobacteria (Holsters), 1978). The Agrobacterium used as a host cell comprises a plasmid carrying a vir gene. The vir region is necessary for the transfer of T-DNA into the plant cell. They may also contain additional T-DNA. The bacterium thus transformed is used for the transformation of plant cells. Plant explants can be advantageously grown with Agrobacterium tumefaciens or Agrobacterium rhizogenes for the transfer of DNA into the plant cell. The whole plants can then be regenerated from the infected plant material (for example, leaf pieces, stem segments, roots, but also protoplasts or cells grown in suspension) in a suitable medium, which may contain antibiotics or biocides for selection. . The plants thus obtained can then be evaluated for the presence of the inserted DNA. No special requirements are placed on the plasmids in the case of injection and electroporation. It is possible to use ordinary plasmids, such as, for example, pUC derivatives. The transformed cells are grown inside the plants in the usual manner. These can form germ cells and transmit the transformed trait (s) to the plants of the progeny. Said plants can be grown in a normal way and cross with plants that have the same transformed hereditary factors or other hereditary factors. The resulting individual hybrids have the corresponding phenotypic properties. In some preferred embodiments of the invention, the genes encoding the bacterial protein are expressed from transcriptional units inserted into the plant genome. Preferably, said transcriptional units are recombinant vectors capable of carrying out stable integration into the plant genome and allowing the selection of transformed plant lines expressing the mRNA encoding the proteins.

Once the inserted DNA has been integrated into the genome, it is relatively stable there (and does not come out again). It normally contains a selection marker which confers on the transformed plant cells resistance to a biocide or an antibiotic, such as kanamycin, G418, bleomycin, hygromycin, or chloramphenicol, inter alia. Plant selection markers can also typically provide resistance to various herbicides such as glufosinate (eg, PAT / bar), glyphosate (EPSPS), ALS inhibitors (eg, imidazolinone, sulfonylurea, triazolopyrimidine sulfonanilide, et al.), Bromoxynil , resistance to the inhibitor of HPPD, inhibitors of PPO, inhibitors of ACC-asa, and many others. The individually used marker must therefore allow the selection of the transformed cells in place of the cells that do not contain the inserted DNA. The gene (s) of interest preferably is expressed either by constitutive or inducible promoters in the plant cell. Once expressed, the mRNA is translated into proteins, thus incorporating amino acids of interest within the protein. Genes encoding a protein expressed in plant cells can be under the control of a constitutive promoter, a tissue-specific promoter, or an inducible promoter. There are several techniques for the introduction of external recombinant vectors within plant cells, and for obtaining plants that stably maintain and express the introduced gene. Such techniques include the introduction of the microparticle coated genetic material directly into the cells (U.S. Patent Nos. 4,945,050 to Cornell and 5, 141, 131 to DowEIanco, now Dow AgroSciences, LLC). In addition, plants can be transformed using Agrobacterium technology, see U.S. Patents. Nos. 5,177,010 to University of Toledo; 5,104,310 to Texas A &M; European Patent Application 0131624B1; European Patent Applications 120516, 159418B1 and 176.1 12 to Schilperoot; the Patents of E.U.A. Nos. 5,149,645, 5,469,976, 5,464,763 and 4,940,838 and 4,693,976 to Schilperoot; European Patent Applications 116718, 290799, 320500, all to Max Planck; European Patent Applications 604662 and 627752, and the Patent of E.U.A. No. 5,591, 616, to Japan Tobacco; European Patent Applications 0267159 and 0292435, and the Patent of E.U.A. No. 5,231, 019, all to Ciba Geigy, currently Syngenta; the Patents of E.U.A. Nos. 5,463, 174 and 4,762,785, both to Calgene; and the Patents of E.U.A. Nos. 5,004,863 and 5, 159,135, both to Agracetus. Another transformation technology includes whisker technology. See the Patents of E.U.A. Nos. 5,302,523 and 5,464,765, both to Zeneca, currently Syngenta. Another transformation technology through direct DNA administration includes aerosol-type radiation technology. See U.S. Pat. No. 6,809,232. Electroporation technology has also been used to transform plants. See WO 87/06614 to Boyce Thompson Institute; the Patents of E.U.A. Nos. 5,472,869 and 5,384,253, both to Dekalb; and WO 92/09696 and WO 93/21335, both to Plant Genetic Systems. In addition, viral vectors can also be used to produce transgenic plants that express the protein of interest. For example, monocotyledonous plants can be transformed with a viral vector using the methods described in the U.S. Patent. No. 5,569,597 to Mycogen Plant Science and Ciba-Geigy (now Syngenta), as well as the Patents of E.U.A. Nos. 5,589,367 and 5,316,931, both to Biosource, now Large Scale Biology. As previously mentioned, the manner in which DNA construction was introduced into the plant host is not critical to this invention. Any method that provides efficient transformation can be employed. For example, various methods for plant cell transformation are described in the present invention and include the use of Ti or Ri plasmids and the like to carry out Agrobacterium-mediated transformation. In many cases, it will be desirable to have the construction used for transformation at the end on one or both sides by the ends of DNA-T-DNA, more specifically the right end. This is particularly useful when the construction uses Agrobacterium tumefaciens or Agrobacterium rhizogenes as a mode of transformation, although the T-DNA ends may find use with other modes of transformation. When Agrobacterium is used for plant cell transformation, a vector can be used which can be introduced into the host for homologous recombination with T-DNA or the Ti or Ri plasmid present in the host. The introduction of the vector can be carried out via electroporation, tri-parental pairing and other techniques for transformation of gram-negative bacteria which are known to those skilled in the art. The manner of transformation of the vector within the Agrobacterium host is not critical to this invention. The Ti or Ri plasmid containing the T-DNA for recombination may be capable or incapable of causing the formation of galls, and is not critical for said invention as long as the vir genes are present in said host. In some cases where Agrobacterium is used for transformation, the expression construct that lies within the ends of the T-DNA will be inserted into a vector with greater spectrum such as pRK2 or derivatives thereof as described in Ditta er al. (1980) and EPO 0 120 515. Included within the expression construct and the T-DNA will be one or more markers as described in the present invention which allows the selection of transformed Agrobacterium and transformed plant cells. The particular marker used is not essential for this invention, with the preferred marker depending on the host and the construction used. For the transformation of plant cells using Agrobacterium, the explants can be combined and incubated with the transformed Agrobacterium for a sufficient time to allow the transformation thereof. After transformation, the Agrobacteria are removed by selection with the appropriate antibiotic and the plant cells are cultured with the appropriate selection medium. Once the calluses have been formed, the formation of the stem can be promoted by the use of appropriate plant hormones in accordance with methods well known in the art of plant tissue culture and plant ratio. However, an intermediate stage in callus formation is not always necessary. After the formation of the stem, said plant cells can be transferred to the medium that promotes the formation of the root thus completing the plant regeneration. The plants can then be grown up to seed and said seed can be used to establish future generations. Regardless of the transformation technique, the gene encoding a bacterial protein is preferably incorporated into a vector for gene transfer adapted to express said gene in a plant cell by including in the vector a plant promoter regulatory element, as well as termination regions transcripts not translated to 3 'such as Nos and the like. In addition to numerous technologies for the transformation of plants, the type of tissue that comes into contact with external genes can also vary. Said tissue could include, but could not be limited to, embryogenic tissue, callus tissue types I, II, and III, hypocotyledon, meristem, root tissue, tissues for expression in the phloem, and the like. Almost all plant tissues can be transformed during dedifferentiation using the appropriate techniques described in the present invention. As mentioned above, if desired, a variety of selection markers can be used. The preference for a particular marker is at the discretion of the person skilled in the art., but any of the following selection markers may be used along with any other gene not listed in the present invention which may function as a selection marker. Said selection markers include but are not limited to the aminoglycoside phosphotransferase gene of transposon Tn5 (Aph II) which codes for resistance to the antibiotics kanamycin, neomycin and G41; resistance to hygromycin; resistance to methotrexate, as well as those genes that code for resistance or tolerance to glyphosate; phosphinothricin (bialaphos or glufosinate); herbicides that inhibit ALS (imidazolinone herbicides, sulfonylureas and triazolopyrimidine), ACC-asa inhibitors (eg, aryloxypropionates or cyclohexanediones), and others such as bromoxynil, and HPPD inhibitors (eg, mesotrione) and the like. In addition to a selection marker, it may be desirable to use a reporter gene. In some cases a reporter gene can be used with or without a selection marker. Reporter genes are genes that are typically not present in the recipient organism or tissue and typically code for proteins that result in some phenotypic change or enzymatic property. Examples of such genes are provided in Weising et al., 1988. Preferred reporter genes include beta-glucuronidase (GUS) from the uidA locus of E. coli, the chloramphenicol acetyl transferase gene from Tn9 of E. coli. , the green fluorescent protein from the bioluminescent jellyfish Aequorea victoria, and the luciferase genes from the firefly Photinus piralis. An assay for detecting the expression of the reporter gene can then be carried out at an appropriate time after said gene has been introduced into recipient cells. A preferred assay includes the use of the gene encoding beta-glucuronidase (GUS) from the uidA locus of E. coli as described by Jefferson et al., (1987) to identify transformed cells. In addition to the regulatory elements of the plant promoter, the regulatory elements of the promoter from a variety of sources can be used efficiently in plant cells to express external genes. For example, the regulatory elements of the promoter of bacterial origin can be used, such as the octopine synthase promoter, the nopaline synthase promoter, the mannopine synthase promoter; promoters of viral origin, such as cauliflower mosaic virus (35S and 19S), 35T (which is a re-engineered 35S promoter, see U.S. Patent No. 6,166,302, especially example 7E) and the like . Regulatory elements of the plant promoter include but are not limited to the small subunit of ribulose-1, 6-bisphosphate (RUBP) carboxylase (ssu), the beta-conglycinin promoter, the beta-phaseolin promoter, the ADH promoter , heat shock promoters, and tissue specific promoters. Other elements such as the matrix binding regions, base structure binding regions, templates, enhancers, polyadenylation sequences and the like may be present and therefore may improve the efficiency of transcription or integration of the DNA . Such elements may or may not be necessary for the function of DNA, although they may provide better expression or functioning of the DNA by affecting transcription, stability of the mRNA, and the like. These elements can be included in the DNA as desired to obtain the optimal performance of the transformed DNA in the plant. Typical elements include but are not limited to Adh-intron 1, Adh-intron 6, the leader sequence of the cover protein of the alfalfa mosaic virus, the UTR sequences of osmotin, the leader sequence of the coat protein of the corn vein virus, as well as other elements available to a person skilled in the art. The regulatory elements of the constitutive promoter can also be used thus directing the continuous expression of the gene in all cell types and at all times (eg, actin, Ubiquitin, CaMV 35S, and the like). The tissue-specific promoter regulatory elements are responsible for the expression of the gene in specific cell or tissue types, such as leaves or seeds (e.g., zein, oleosin, napkin, ACP, globulin and the like) and these also They can be used. The regulatory elements of the promoter can also be active (or inactive) during a certain stage of plant development as well as can be active in plant tissues and organs. Examples of such regulatory elements include but are not limited to pollen-specific promoter regulatory elements., specific to the embryo, specific to the maturation of the corn, specific to the cotton fiber, specific to the root, specific to the endosperm of the seed, or specific to the vegetative phase and the like. Under certain circumstances it may be desirable to use an inducible regulatory element of the promoter, which is responsible for the expression of genes in response to a specific signal, such as: physical stimuli (heat shock genes), light (RUBP carboxylase), hormone (Em), metabolites, chemicals (which respond to tetracycline), and stress. Other desirable elements of transcription and translation that work in plants can be used. Numerous vectors for transfer of plant-specific genes are known in the art. Systems based on viral plant RNA can also be used to express bacterial protein. In doing so, the gene encoding a protein can be inserted into the envelope promoter region of a suitable plant virus which will infect the host plant of interest. Therefore the protein can be expressed then providing protection of the plant from the damage by the herbicide. Systems based on viral plant RNA are described in the patent of E.U.A. No. 5,500,360 to Mycogen Plant Sciences, Inc. and the Patents of E.U.A. Nos. 5,316,931 and 5,589,367 to Biosource, currently Large Scale Biology.

Modes to further increase tolerance or resistance levels. It is shown here that novel features of herbicide resistance can be included in the plants of the present invention without adverse effects observable in the phenotype including yield. Said plants are within the scope of the present invention. The plants exemplified and suggested in the present invention can withstand 2X, 3X, 4X, and 5X typical application levels, for example, of at least one subject herbicide. Improvements in these tolerance levels are within the scope of this invention. For example, various techniques are known in the art, and can be optimized previously and can be further developed, to increase the expression of a given gene. One such method includes the increase in the number of copies of the subject AAD-12 genes (in expression cassettes and the like). Transformation events can also be selected for those who have multiple copies of the genes. Strong promoters and enhancers can be used to "overload" the expression. Examples of such promoters include the preferred 35T promoter which utilizes 35S enhancers. The promoters of 35S, Ubiquitin from corn, Ubiquitin from Arabidopsis, actin from A.t., and CSMV are included for such uses. Other strong viral promoters are also preferred. The enhancers include 4 OCS and the double 35S enhancer. Matrix-binding regions (MARs) can also be used to increase efficiencies of transgene expression and expression, for example. The change (directed evolution) and the transcription factors can also be used for the embodiments according to the present invention. Variant proteins that differ in sequence level but retain the same three-dimensional structure or an essential three-dimensional structure similar in general, distribution of surface charge, and the like can also be designed. See for example the U.S. Patent. No. 7,058,515; Larson et al., Protein Sci. 2002 1 1: 2804-2813, "Thoroughly sampling sequence space: Large-scale protein design of structural ensembles"; Crameri et al., Nature Biotechnology 15, 436-438 (1997), "Molecular evolution of an arsenate detoxification pathway by DNA shuffiing"; Stemmer, W.P.C.1994. DNA shuffiing by random fragmentation and reassembly: in vitro recombination for molecular evolution. Proc. Nati Acad. Sci. USA 91: 10747-10751; Stemmer, W.P.C.1994. Rapid evolution of a protein in vitro by DNA shufflin. Nature 370: 389-391; Stemmer, W.P.C. 1995. Searching sequence space. Bio / Technology 13: 549-553; Crameri, A., Cwirla, S. and Stemmer, W.P.C.1996. Construction and evolution of antibody-phage libraries by DNA shuffiing. Nature Medicine 2: 100-103; and Crameri, A., Whitehorn, E.A., Tate, E. and Stemmer, W.P.C. 1996. Improved green fluorescent protein by molecular evolution using DNA shuffiing. Nature Biotechnology 14: 315-319. The activity of the recombinant polynucleotides inserted into the plant cells may depend on the influence of the endogenous plant DNA adjacent to the insert. Therefore, another option is to take advantage of events that are known to be excellent locations in a plant genome for insertions. See for example WO 2005/103266 A1, in relation to the events of cryl F cotton and crylAc; the subject AAD-12 gene can be substituted in these genomic loci instead of the cryl and / or crylAc inserts. Therefore, directed homologous recombination can be used, for example, in accordance with the present invention. This type of technology is the subject of, for example, WO 03/080809 A2 and the application of E.U.A. published publication (USPA 20030232410), which refers to the use of zinc fingers for directed recombination. The use of recombinases (cre-lox and flp-frt for example) is also known in the art. It is believed that the detoxification of AAD-12 occurs in the cytoplasm. Thus, methods for further stabilizing this protein and mRNAs (including blocking mRNA degradation) are included in aspects of the present invention, and therefore techniques known in the art can be applied. The subject proteins can be designed to resist degradation by proteases and the like (protease cleavage sites can be effectively removed by redesigning the amino acid sequence of the protein). Said modalities include the use of the UTRs similar to the stem structures 5 'and 3' asa from osmotin, and per5 (5 'untranslated sequences rich in UA). 7-Methyl or 2'-0-methyl groups similar to the 5 'ends, for example 7-methylguanilic acid residue, can also be used. See, for example: Proc. Nati Acad. Sci. USA Vol. 74, No. 7, pp. 2734-2738 (July 1977) Importance of 5'-terminal blocking structure to stabilize mRNA in eukaryotic protein synthesis. Protein complexes or groups for blocking the ligand can also be used.

The 5 'or 3"UTR computational design most suitable for AAD-12 (synthetic forks) can also be carried out within the scope of the present invention In general, computer modeling, as well as gene change and evolution directed, are discussed elsewhere in the present invention, more specifically with respect to computer modeling and UTRs, computer modeling techniques for use in the prognosis / evaluation of the 5 'and 3' UTR derivatives of the present invention. invention include, but are not limited to: MFold version 3.1 available from Genetics Corporation Group, Madison, Wl (see Zucker et al., Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide, in RNA Biochemistry and Biotechnology, 11 -43, J. Barciszewski &BFC Clark, eds., NATO ASI Series, Kluwer Academic Publishers, Dordrecht, NL, (1999), Zucker et al., Expanded Sequence Dependence of Thermodynamic Parameters Improves Predi ction of RNA Secondary Structure. J. Mol. Biol. 288, 911-940 (1999); Zucker et al., RNA Secondary Structure Prediction. In Current Protocols in Nucleic Acid Chemistry S. Beaucage, D.E. Bergstrom, G.D. Glick, and R.A. Jones eds., John Wiley & Sons, New York, 11.2.1-11.2.10, (2000)), COVE (RNA structure analysis using covariance models (stochastic context free grammar methods)) v.2.4.2 (Eddy &Durbin, Nucí Acids Res. 1994, 22: 2079-2088) which is freely distributed as a source code and which can be downloaded by accessing the website at genetics.wustl.edu/eddy/software/, and FOLDALIGN, also freely distributed and available to download on the web site bioinf.au.dk.

FOLDALIGN / (see Finding the Most Significant Common Sequence and Structure Motifs in a Set of RNA Sequences, J. Gorodkin, LJ Heyer and GD Stormo, Nucleic Acids Research, Vol 25, No. 18 pp 3724-3732, 1997; Finding Common Sequence and Structure Motifs in a set of RNA Sequences, J. Gorodkin, LJ Heyer, and GD Stormo, ISMB 5, 120-123, 1997). The embodiments of the present invention can be used in conjunction with naturally-developed mutants or chemically-induced mutants (mutants can be selected by screening techniques, then transformed with AAD-12 and possibly other genes). The plants of the present invention can be combined with resistance to ALS and / or develop resistance to glyphosate. Aminopyralid resistance, for example, can also be combined or "stacked" with an AAD-12 gene. Traditional cross breeding techniques can also be combined with the present invention to strongly combine, introduce, and improve desired traits. Additional improvements also include use with safeners (chemicals added to a pesticide so that the pesticide does not harm the plants) appropriate to further protect the plants and / or to add cross-resistance to more herbicides. Safeners typically act by increasing the immune system of plants by activating / expressing cP450. Safeners are chemical agents that reduce the phytotoxicity of herbicides to crop plants through a physiological or molecular mechanism, without compromising the efficiency of weed control). The herbicidal safeners include benoxacor, cloquintocet, citometrinil, diclormid, diciclonon, dietolato, fenclorazole, phenchlorim, flurazole, fluxofenim, furilazole, soxadifen, mefenpir, mefenate, naphthalic anhydride, and oxabetrinil. Plant activators (a new class of compounds that protect plants by activating their defense mechanisms) can also be used in the embodiments of the present invention. These include acibenzolar and probenazole. The commercialized safeners can be used for the protection of herbs crops with large seeds, such as corn, sorghum grains, and wet-seeded rice, against the herbicides incorporated in preplant or applied herbicides, presurgery of the thiocarbamate and chloroacetanilide families. . The safeners have also been developed to protect winter grain crops such as wheat against the post-emergence applications of the aryloxyfenoxypropionate and sulfonylurea herbicides. The use of safeners for the protection of corn and rice against sulfonylurea herbicides, imidazolinone, cyclohexanedione, soxazole, and tarrozone is also well established. An improvement of the detoxification of the herbicide induced by the safener in plants with safener is widely accepted as the main mechanism involved in the action of the safener. Safeners induce cofactors such as glutathione and herbicide-detoxifying enzymes such as glutathione S-transferases, cytochrome P450 monooxygenases, and glucosyl transferases. Hatzios KK, Burgos N (2004) "Metabolism-based herbicide resistance: regulation by safeners", Weed Science: Vol. 52, No. 3 pp. 454-467. The use of a cytochrome p450 monooxygenase gene stacked with AAD-12 is a preferred embodiment. There are P450s involved in the metabolism of the herbicide; for example cP450 may be of mammalian origin or of plant origin. In higher plants, it is known that cytochrome P450 monooxygenase (P450) directs secondary metabolism. This also plays an important role in the oxidative metabolism of xenobiotics in cooperation with the NADPH-cytochrome P450 oxidoreductase (reductase). Resistance to some herbicides has been reported as a result of metabolism by P450 as well as metabolism by glutathione S-transferase. Numerous microsomal species of P450 involved in xenobiotic metabolism in mammals have been characterized by molecular cloning. It has been reported that some of these metabolize several herbicides efficiently. Therefore, transgenic plants with plant or mammalian P450 can show resistance to several herbicides. A preferred embodiment of the foregoing is the use of cP450 for acetochlorine resistance (acetochlorine-based products include the herbicides Surpass®, Keystone®, Keystone LA, F? LTime® and TopNotch®) and / or trifluralin (such as Treflan) ®). Said resistance in soybeans and / or corn is included in some preferred embodiments. For further guidance regarding such modalities, see for example Inui et al., "A selectable marker using cytochrome P450 monooxygenases for Arabidopsis transformation", Plant Biotechnology 22, 281-286 (2005) (which refers to a selection system for the transformation of Arabidopsis thaliana via Agrobacterium tumefaciens using cytochrome P450 human monooxygenases that metabolize the herbicides, the herbicide tolerant seedlings were transformed and selected with the herbicides acetochlor, amiprofos-methyl, chlorprofam, chlorsulfuron, norflurazon, and pendimethalin); Siminszky et al., "Expression of a soybean cytochrome P450 monooxygenase cDNA in yeast and tobacic enhances the metabolism of phenylurea herbicides", PNAS Vol. 96, No. 4, 1750-1755, February 16, 1999; Sheldon et al, Weed Science: Vol. 48, No. 3, pp. 291-295, "A cytochrome P450 monooxygenase cDNA (CYP71A10) confers resistance to linuron transgenic Nicotiana tabacum", and "Phytoremediation of the atrazine herbicides and metolachlor by transgenic rice expressing human CYP1A1, CYP2B6, and CYP2C19", J Agrie Food Chem. 2006 April 19; 54 (8): 2985-91 (which refers to the test of a cytochrome p450 monooxygenase from human in rice where rice plants continuously showed a high tolerance to chloroacetomides (acetochlor, alachlor, metoaclor, pretilachlor, and tenilchlor) , oxyacetamides (mefenacet), pyridazinones (norflurazon), 2,6-dinitroanalines (trifluralin and pendimethalin), phosphamidates (amiprophos-methyl, thiocarbamates (pyributicarb), and ureas (clortoluron)).

There is also the possibility of altering or using different 2,4-D chemistries to make the AAD-12 subject genes more efficient. Such possible changes include the creation of better substrates and better residual groups (greater electronegativity). Auxin transport inhibitors (eg, diflufenzopyr) can also be used to increase herbicidal activity with 2,4-D. Unless specifically indicated or implied, the terms "a", "an", and "he" mean "at least one" as used in the present invention. All patents, patent applications, provisional applications, and publications referenced or cited in the present invention are incorporated by reference in their entirety to the extent that they are not inconsistent with the explicit teachings of this specification. Below are examples that illustrate the procedures for practicing the invention. These examples should not be considered as limiting. All percentages are by weight and all proportions of the solvent mixture are by volume unless otherwise mentioned.

EXAMPLE 1 Method to identify genes that impart resistance to 2,4-D In Plant As a way to identify genes that possess plant-degrading herbicide activities, it is possible to search current public databases such as NCBI (National Center for Biotechnology Information). To begin the process, it is necessary to have a sequence of the already identified functional gene encoding a protein with the desired characteristics (ie, a-ketoglutarate dioxygenase activity). This protein sequence is then used as the input for the BLAST algorithm (Altschul et al., 1997) to compare against the sequences of the Basic Local Alignment Search Tool (Basic Local Alignment Search Tool). of protein available in NCBI deposited. Using the default settings, this search returns more than 100 homologous protein sequences to varying degrees. These have a range of high identity (85-98%) at a very low identity (23-32%) at the amino acid level. Traditionally, it could be expected that only sequences with high homology retain similar properties with respect to the sequence of entry. In this case, only the sequences with < 50% homology were chosen. As exemplified in the present invention, cloning and homologs that are expressed recombinantly with as little as 31% amino acid conservation (relative to a tfdA from Ralstonia eutropha) can be used to impart commercial levels of resistance not only to the intended herbicide, but also to substrates that have never been previously evaluated with these enzymes. A particular gene (sdpA) was identified from the NCBI database (see the website at ncbi.nlm.nih.gov; access # AF516752) as a homolog with only 31% amino acid identity with respect to tfdA. Percentage identity was determined by initial translation of both the sdpA and tfdA DNA sequences deposited in the protein database, then using ClustalW in the VectorNTI software package to carry out multiple sequence alignment.

EXAMPLE 2 Optimization of the sequence for expression in plants and bacteria 2. 1 - Background To obtain higher levels of expression of heterologous genes in plants, it may be preferable to redesign the sequence of the genes encoding the protein so that they are expressed more efficiently in plant cells. Corn is one such plant where it may be preferable to re-design the coding region of the heterologous protein prior to transformation to increase the level of expression of the gene and the level of the protein encoded in the plant. Therefore, an additional step in the design of genes that encode a bacterial protein is the redesign of a heterologous gene for optimal expression. A reason for the redesign of bacterial protein for the expression of maize is due to the non-optimal G + C content. of the native gene For example, the very low G + C content of many native bacterial genes (and consequently skewing towards the high content of A + T) results in the generation of sequences that mimic or duplicate the control sequences of the plant gene known to be highly rich in A + T The presence of some sequences rich in A + T within the DNA of gene (s) introduced into plants (for example, the TATA box regions normally found in the promoters of the gene) can result in aberrant transcription of the gene (s) On the other hand, the presence of other regulatory sequences residing in the transcribed mRNA (for example, pohadenylation signal sequences (AAUAAA), or sequences complementary to the small nuclear RNAs involved in pre-mRNA processing) can producing RNA instability Therefore, an objective in the design of genes encoding a bacterial protein for expression in maize, more preferably injured as a gene (is) optimized in plant, is the generation of a DNA sequence that has a higher content of G + C, and preferably a close to the genes of corn that encode for metabolic enzymes Another objective in the design of the gene (is) optimized in plant that encodes a Bacterial protein is the generation of a DNA sequence in which the modifications of the sequence do not prevent the translation.

Table 3 illustrates how high the G + C content is in the corn. For the data in Table 3, the coding regions of the genes are extracted from the GenBank records (Reléase 71), and the Base compositions were calculated using the MacVectorTM program (Accelerys, San Diego, California). The sequences of the intron were ignored in calculations.

TABLE 3 Compilation of the G + C contents of the coding regions of the corn gene protein Protein class3 Interval% G + Media% G + C b C Metabolic enzymes (76) 44.4-75.3 59.0 (. + - .8.0) Structural proteins (18) 48.6-70.5 63.6 (. + - .6.7) Regulatory proteins (5) 57.2-68.8 62.0 (. + - .4.9) Uncharacterized proteins (9) 41.5-70.3 64.3 (. + -, 7.2) All proteins (108) 44.4-75.3 60.8 (. + 5.2) c a Number of genes in the class given in parentheses. b Standard deviations given in parentheses. cMedia ignored of the combined groups in the calculation of the half Due to the plasticity obtained by the redundancy / degeneracy of the genetic code (that is, some amino acids are specified by more than one codon), the evolution of genomes in different organisms or classes of organisms has resulted in the differential use of redundant codons . This "codon predilection" is reflected in the average composition of bases of the coding regions of the protein. For example, organisms with relatively low contents of G + C use codons that have A or T in the third position of the redundant codons, while those that have higher contents of G + C use codons that have G or C in the third position It is thought that the presence of "minor" codons within an mRNA can reduce the absolute translation ratio of this mRNA, especially when the relative abundance of the charged tRNA corresponding to the minor codon is low. An extension of this is that the decrease in the translation ratio by individual minor codons could be at least additive for multiple minor codons. Therefore, mRNAs having relatively high contents of minor codons could have relatively low translation ratios. This relationship could be reflected by the subsequently low levels of the encoded protein. In the design of genes that encode a bacterial protein for expression in maize (or another plant, such as cotton or soybeans), it will determine the predilection of the codon of the plant. The codon's predilection for corn is the statistical distribution of the codon used by the plant for the coding of its proteins and the preferred use of the codon is shown in table 4. After determining the predilection, the percentage frequency of the codon is determined. the codons in the gene (s) of interest. The primary codons preferred by the plant should be determined, as well as the second, third, and fourth choices of the preferred codons when multiple choices exist. Therefore a new designed DNA sequence can be designed which encodes the amino sequence of the bacterial protein, but the new DNA sequence differs from the native bacterial DNA sequence (which encodes the protein) by the substitution of the codons of the plant (first preferred, second preferred, third preferred, or fourth preferred) to specify the amino acid at each position within the amino acid sequence of the protein. The new sequence is then analyzed for the restriction enzyme sites that may have been created by the modification. The identified sites are further modified by replacing the codons with the first, second, third, or fourth choice of the preferred codons. Other sites in the sequence that could affect the transcription or translation of the gene of interest are the exon: intron junctions (5 'or 3'), poly A addition signals, or RNA polymerase termination signals. The sequence was further analyzed and modified to reduce the frequency of TA or GC doublets. In addition to doublets, blocks of sequence G or C that have more than about four residues that are the same can affect the transcription of the sequence. Therefore, these blocks are also modified by replacing the codons of the first or second election, etc. with the next preferred codon of choice.

TABLE 4 Preferred amino acid codons for proteins expressed in corn Amino Acid Codon "Alanine GCC / GCG Cysteine TGCGGGT Aspartic Acid GAC / GAT Glutamic Acid GAG / GAA Phenylalanine TTC / TTT Glycine GGC / GGG Histidine CAC / CAT Isoleucine ATC / ATT Lysine AAG / AAA Leucine CTG / CTC Methionine ATG Asparagine AAC / AAT Proline CCG / CCA Glutamine CAG / CAA Arginine AGG / CGC Serine AGC / TCC Treonine ACC / ACG Valine GTG / GTC Tryptophan TGG Tyrosine TAC / TAT Stop TGA / TAG It is preferred that the optimized plant gene (s) encode a bacterial protein contains approximately 63% of the codons of first choice, between approximately 22% to approximately 37% of the codons of second choice, and between approximately 15% a approximately 0% codons of third or fourth choice, where the Total percentage is 100%. The most preferred plant-optimized gene (s) contains approximately 63% of the codons of first choice, at least about 22% of the codons of second choice, about 7.5% of the codons of third choice, and about 7.5% of the codons of fourth choice, where the total percentage is 100% The method described above enables one skilled in the art to modify the gene (s) that is foreign to a particular plant so that the genes are optimally expressed in the plants. The method is further illustrated in PCT application WO 97/13402. Therefore, in order to design plant-optimized genes that encode a bacterial protein, a DNA sequence was designed to encode the amino acid sequence of said protein using a redundant genetic code established from a compilation box of the compiled codon from the gene sequences for the particular plant or plants. The resulting DNA sequence has a greater degree of codon diversity, a desirable base composition, may contain strategically placed restriction enzyme recognition sites, and lacks sequences that could interfere with transcription of the gene, or with translation of the mRNA product. Therefore, synthetic genes that are functionally equivalent to the proteins / genes of the present invention can be used to transform hosts, including plants. Additional guidance regarding the production of synthetic genes can be found in, for example, U.S. Pat. No. 5,380,831. 2. 2 - Analysis of plant construction with AAD-12. Extensive analysis of the 876 base pairs (bp) of the DNA sequence of the native coding region of AAD-12 (SEQ ID NO: 1) revealed the presence of several sequence motifs that are thought to be detrimental to the expression optimal plant, as well as a non-optimal codon composition. The protein encoded by SEQ ID NO: 1 (AAD-12) is presented as SEQ ID NO: 2. To improve the production of the recombinant protein in monocotyledons as well as in dicots, an AAD-12 DNA sequence was developed (v1 ) (SEQ ID NO: 3) "plant optimized" which encodes a protein (SEQ ID NO: 4) which is the same as the native SEQ ID NO: 2 except for the addition of an alanine residue in the second position (underlined in SEQ ID NO: 4). The additional alanine codon (GCT, underlined in SEQ ID NO: 3) encodes part of a Ncol restriction enzyme recognition site (CCATGG) spanning the ATG translational start codon. Therefore, it serves the dual purpose of facilitating subsequent cloning operations while improving the context of the sequence surrounding the ATG start codon to optimize the start of translation. The proteins encoded by the native coding regions and by the plant-optimized coding regions (v1) are 99.3% identical, differing only in amino acid number 2. In contrast, the native DNA sequences and the DNA sequences optimized in plant (v1) ) of the coding regions are only 79.7% identical. Table 5 shows the differences in the codon compositions of the native sequences (Columns A and D) and of the plant optimized sequences (Columns B and E), and allows the comparison with a theoretical sequence optimized in plant (Columns C and F). TABLE 5 Comparisons of the codon composition of the coding regions of Native AAD-12, optimized version in plant (v1) and a theoretical version optimized in plant It is evident from the examination of Table 5 that the native coding regions and the optimizing coding regions in the plant, although they encode almost identical proteins, are substantially different from each other. The optimized plant version (v1) closely mimics the codon composition of a region. theoretical coding optimized in plant that encodes the AAD-12 protein 2 3 Reconstruction for E coli expression Specially designed strains of Eschepchia coli and vector-associated systems are often used to produce relatively large amounts of proteins for biochemical and analytical studies. It has sometimes been found that a native gene encoding the desired protein does not is suitable for the high level of expression in E coli, even though the source organism for the gene may be of another bacterial genus In such cases it is possible and desirable to redesign the coding region of the gene protein to make it more suitable for expression in E coli E coll class II genes are defined as those that are highly and continuously expressed during the exponential growth phase of E coli cells (Henaut, A and Danchin, A (1996) in Eschenchia coh and Salmonella typhimunum cellular and molecular biology, vol 2, pp 2047-2066 Neidhardt, F, Curtiss III, R, Ingraham, J Lin, E, Low, B, Maga Sanik, B, Rezntkoff, W, Riley, M, Schaechter, M and Umbarger, H (eds) American Society for Microbiology, Washington, DC) Through the examination of the codon compositions of the coding regions of the E genes. co // class II, one can devise an average codon composition for these coding regions of the E. coli class II gene. It is thought that a coding region of the protein having an average codon composition that mimics that of the class II genes will be favored for expression during the exponential growth phase of E. coli. Using these guides, a novel DNA sequence encoding the AAD-12 protein (SEQ ID NO: 4) was designed; including the additional alanine in the second position, as mentioned above), in accordance with the average codon composition of the coding regions of the E. coli class II gene. The initial sequence, whose design was based solely on the composition of the codon, was further designed to include certain restriction enzyme recognition sequences suitable for cloning into the E. coli expression vectors. Detrimental sequence characteristics such as highly stable stem-stem structures were avoided, as well as intragenic sequences homologous to the 3 'end of 16S ribosomal RNA (ie Shine Dalgarno sequences). The sequence optimized in E. coli (v2) was describes as SEQ ID NO: 5 and encodes the protein described in SEQ ID NO: 4. The native DNA sequences and the DNA sequences optimized for E. coli (v2) are 84.0% identical, while the DNA sequences optimized in plant (v1) and DNA sequences optimized in E. coli (v2) are 76.0% identical. Table 6 presents the codon compositions of the native coding region of AAD-12 (Columns A and D), a coding region of AAD-12 optimized for expression in E. coli (v2; Columns B and E) and composition of the codon of a theoretical coding region for the AAD-12 protein having an optimal codon composition of the E. coli class II genes (Columns C and F). TABLE 6 Comparisons of the codon composition of the coding regions of Native AAD-12, optimized version in E. coli (v2) and a theoretical version optimized in E. coli class II It is apparent from the examination of Table 6 that the native coding regions and the coding regions optimized for E. coli, although they encode nearly identical proteins, are substantially different from each other. The optimized version for E. coli (v2) closely mimics the composition of the codon of a theoretical coding region optimized for E. cou encoding the AAD-12 protein. 2. 4 -Design of a DNA sequence with preference of codon of soybean that codifies a EPSPS of soybeans that has mutations that confer tolerance to glyphosate. This example teaches the design of a novel DNA sequence encoding a mutated 5-enolpiruvoilshikimate 3-phosphate synthase soybean (EPSPS), but is optimized for expression in soybean cells. The amino acid sequence of a triple mutated soybean EPSPS is described as SEQ ID NO: 5 of WO 2004/009761. The amino acids mutated in the sequence thus described are found in residue 183 (threonine of the native protein replaced with isoleucine), in residue 186 (arginine in the native protein replaced with lysine), and in residue 187 (proline in the protein native replaced with serine). Therefore, one can deduce the amino acid sequence of the native soybean EPSPS protein by replacing the substituted amino acids of SEQ ID NO: 5 of WO 2004/009761 with the native amino acids at the appropriate positions. Said native protein sequence is described as SEQ ID NO: 20 of PCT / US2005 / 014737 (filed May 2, 2005). A double-mutated soybean EPSPS protein sequence, containing a mutation at residue 183 (threonine of the native protein replaced with isoleucine), and at residue 187 (proline in the native protein replaced with serine) is described as SEQ ID NO: 21 of PCT / US2005 / 014737. A codon usage table was obtained for the protein coding sequences of soybean (Glycíne max), calculated from 362,096 codons (approximately 870 coding sequences), from the web site "kazusa.or.jp/ codon ". These data were taken as shown in table 7. Columns D and H of table 7 present the distributions (in% of use for all codons for this amino acid) of the synonymous codons for each amino acid, as found in the regions coding genes for soybean protein. It is evident that some synonymous codons for some amino acids (an amino acid can be specified by 1, 2, 3, 4, or 6 codons) are relatively rare in the protein coding regions of soybeans (for example, compare the use of GCG and GCT codons to specify alanine). A table of use of the preferred codon of soybeans was calculated from the data in Table 7. The codons found in the genes of soybeans representing less than about 10% of the total presences for the particular amino acid were ignored . To balance the distribution of the remaining codon choices for an amino acid, an average representation was calculated with a relative value for each codon, using the formula: relative value% of C1 = 1 / (% C1 +% C2 +% C3 + etc .) x% C1 x 100 where C1 is the codon in question, C2, C3, etc. represent the remaining synonymous codons, and the% values for the relevant codons are taken from columns D and H of table 7 (ignoring the values for the rare codons in bold). The relative value% for each codon is given in columns C and G of table 7. TGA was chosen arbitrarily as the terminator of the translation. The frequencies of use of the codon preference were entered into a specialized genetic code frame for use by the OptGene ™ gene design program (Ocimum Biosolutions LLC, Indianapolis, Indiana).

TABLE 7 Representation of synonymous codons in the coding sequences of the soybean protein, and calculation of a preferred codon representation established for the design of the synthetic gene optimized in soybean * DNU = Do not use To derive a sequence of DNA optimized for soybeans that encodes the doubly mutated EPSPS protein, the protein sequence of SEQ ID NO: 21 from PCT / US2005 / 014737 was retro-transcribed using the OptGene ™ program using the preferred genetic code of soybeans previously derived. Therefore, the initial sequence of derived DNA was then modified by compensatory changes in the codon (while retaining the overall average representation of the relative value for the codons) to reduce the numbers of CG and TA doublets among the adjacent codons, increase the numbers of CT and TG doublets between the adjacent codons, remove the highly stable ntrachain structures, remove or add the restriction enzyme recognition sites, and remove other sequences that may be detrimental to the expression manipulations or of cloning of the designed gene. Additional refinements of the sequence were performed to eliminate potential plant intron processing sites, long A / T or C / G residue extensions, and other motifs that may interfere with RNA stability, transcription, or translation of the coding region in plant cells. Other changes were made to eliminate the long internal open reading frames (frames different to +1). All these changes were made within the constraints of retention of the preferred codon composition of soybeans as described above, and as long as the amino acid sequence described as SEQ ID NO: 21 of PCT / US2005 / 014737 is preserved. The preferred DNA sequence of soybeans encoding the EPSPS protein of SEQ ID NO: 21 is described as bases 1-1575 of SEQ ID NO: 22 of PCT / US2005 / 014737. The synthesis of a DNA fragment comprising SEQ ID NO: 22 of PCT / US2005 / 014737 was carried out by a commercial supplier (PiccoScript, Houston TX).

EXAMPLE 3 Cloning of expression and transformation vectors 3. 1 Construction of E. coli, expression vector pET. Using the restriction enzymes corresponding to the sites added with the additional cloning linkers (Xba 1, Xho 1) AAD-12 (v2) was removed from the picoscript vector, and ligated into a streptomycin / spectinomycin resistant vector pET280. The ligated products were then transformed into TOP10F 'of E. coli, and plated on agar plates with Luria broth + 50 μg / ml streptomycin and spectinomycin (LB S / S). To differentiate between AAD-12 (v2): pET280 and pCR2.1: The pET280 ligations, approximately 20 isolated colonies were selected within 6 ml of LB-S / S, and were grown at 37 ° C for 4 hours with shaking. Each culture was then seeded in groups on 50 μg / ml LB + kanamycin plates, which were incubated at 37 ° C overnight. It was assumed that colonies that grew on LB-K had the vector pCR2.1 ligated in, and were discarded. The plasmids were isolated from the remaining cultures as mentioned above, and were monitored for correction with Xbal / Xhol digestion. The final expression construction was given the designation pDAB32223. 2- Construction of the Pseudomonas expression vector The open reading frame of AAD-12 (v2) was initially cloned into the modified expression vector pET (Novagen), "pET280 S / S", as a Xbal-Xhol fragment. The resulting plasmid pDAB725 was confirmed with restriction enzyme digestion and sequencing reactions. The open reading frame of AAD-12 (v2) from pDAB725 was transferred into the Pseudomonas expression vector, pMYC1803, as a Xbal-XhoI fragment. The positive colonies were confirmed by digestion by restriction enzyme. The completed structure pDAB739 was transformed into the expression strains of Pseudomonas MB217 and MB324 3 3 - Term of binary vectors The optimized gene in plant AAD-12 (v1) was received from Picoscppt (the reconstructed gene design was completed (see above) and used as a source in Picoscript for construction) and the sequence was verified (SEQ ID NO 3) internally, to confirm that no alterations of the expected sequence were present. The sequencing reactions were carried out with the forward M13 primers (SEQ ID NO 6) and reverse M13 (SEQ ID NO 7) using the Beckman Coulter reagents "Dye Terminator Cycle Sequencing with Quick Start Kit" as mentioned above. Sequence data were analyzed and the results indicated that no abnormalities were present in the DNA sequence AAD-12 (v1) optimized in plant. AAD-12 (v1) was cloned into pDAB726 as a Neo I-Sac I fragment. The resulting construct was designated pDAB723, which contained [AtUbil O promoter Nt OSM 5'UTR AAD-12 (v1) Nt OSM 3'UTR ORF 1 poIyA 3'UTR] (verified with a restriction digestion Pvull and Not I) A Not l-Not I fragment containing the described cassette was then cloned into the Not I site of the binary vector pDAB3038 The resulting binary vector, pDAB724, which contained the following cassette [Atubil O promoter Nt OSM5'UTR AAD-12 (v1) Nt OSM 3'UTR ORF1 poIyA 3'UTR CsVMV promoter PAT ORF25 / 26 3'UTR] was digested by restriction (with Bam Hl, Neo I, Not I, Sacl, and Xmn I) to verify the correct orientation. The verified completed construction (pDAB724) was used for transformation within Agrobacterium (see section 7.2). 3. 4 - Cloning of the additional transformation constructions. All other constructs created for transformation into appropriate plant species were constructed using similar procedures previously described in the present invention, and other standard methods of molecular cloning (Maniatis et al., 1982). Table 8 lists all the transformation constructions used with appropriate promoters and defined characteristics, as well as the transformed harvest.

TABLE 8 Binary constructions used in the transformation of diverse plant species OR * A = Arabidopsis T = tobacco S = soybean Ct = cotton R = rice Cn = corn Ca = Cañóla CsVMV = promoter of the mosaic virus of the cassava vein AtUbilO = Ubiquitin 10 promoter of Arabidopsis thaliana Atubi3 = Ubiquitin 3 promoter of Arabidopsis thaliana AtAct2 = Actin 2 promoter of Arabidopsis thaliana RB7 Mar v2 = Nicotiana tabacum matrix associated region (MAR) Nt Osm = 5 untranslated region 'of Osmotina de Nicotiana tabacum and the untranslated region towards 3' of Osmotina de Nicotiana tabacum ZmUbil = promoter of Ubiquitin 1 of Zea mays Hptll = hygromycin phosphotransferase EXAMPLE 4 Expression and purification of recombinant AAD-12 (v2) in Pseudomonas fluorescens 4 1- Fermentation of Pseudomonas fluorescens For experiment in a shake flask, 200 μl of the storage solution in ghcerol of Pseudomonas fluorescens strain MB324 carrying the construction AAD-12 (v2) pDAB739 (sec 3 2) was used to inoculate ml of fresh LB medium supplemented with 30 μg / ml tetracynic / HCI The culture (in an Erlenmeyer flask with deviations of 250 ml) was incubated on a shaker (New Brunswick Scientific Model Innova 44) at 300 rpm and 30 ° C for 16 minutes. hours 20 ml of seed culture was transferred into 1 L of Pseudomonas fluorescens culture medium (yeast extract, 5 g / L, K2HP04, 5 g / L, (NH4) 2 P04, 7 5 g / L, (NH4) 2S04, MgSO4-7H20, 1 g / L, KCl, 0 5 g / L, CaCl2-2H20, 0 5 g / L, Na-2H20 Citrate, 15 g / L, G cerol, 95 g / L, solution of trace elements, 10 ml / L, trace elements solution FeCI3-6H20, 5 4 g / L, MnCI2-4H20, 1 g / L, ZnS04-7H20, 1 45 g / L, CuS04-5H20, 0 25 g / L , H3BO3, 0 1 g / L, (NH4) 6M07024, 0 1 g / L, concentrated HCl, 13 ml / L) supplemented assayed with 20 μg / ml tetracycline / HCl and 250 μl of Pluronic L61 (ant? -foaming) in a 2 8 L Erlenmeyer flask with deviations The cultures were incubated at 30 ° C and 300 rpm for 24 hours Isopropyl was added ß-D-1-t? ogalacto-p? canoside (IPTG) at 1 mM final in the cultures and continued to incubate for approximately 48 hours at 25 ° C The cells were harvested by centrifugation at 7 krpm at 4 ° C for 15 minutes, and cell paste was stored at -80 ° C or processed immediately for purification. For tank experiments, 1 ml of each of the glycerol storage solutions was inoculated into 1 L of the flask containing deviations containing 200 ml of LB medium supplemented with 30 μg / ml tetracycline / HCI at 300 rpm and 32 ° C for 16-24 hours. The combined culture from three bottles (600 ml) was then transferred aseptically to a 20 L (B. Braun Bioreactor Systems) thermenator containing 10 L of medium defined by the Dow patent (through Teknova, Hollister, CA ) designed to maintain growth at a high cell density. The growth temperature was maintained at 32 ° C and the pH was controlled at the desired set point through the addition of aqueous ammonia. The dissolved oxygen was maintained at a positive level in the liquid culture by the regulation of the sprayed air flow and the stirring ratios. The fermentation process of the feed lot was carried out for approximately 24 hours until the cell density reached D0575 170-200. IPTG was added at 1 mM to induce the expression of the recombinant protein and the temperature was reduced and maintained at 25 ° C using cold water circulation. The induction phase of the fermentation was allowed to continue for another 24 hours. Samples (30 ml) were collected for various analyzes to determine the cell density and the level of expression of the protein at 6, 12, and 18 hours at the time points after induction. At the end of a fermentation process, the cells were harvested by centrifugation at 10 krpm for 30 minutes. The cell concentrates were frozen at -80 ° C for further processing. 4. 2- Purification of AAD-12 (v2) for biochemical characterization and antibody production Approximately 100-200 g of frozen (or fresh) Pseudomonas cells were thawed and resuspended in 1-2 L of pH regulator for extraction containing 20 mM Tris-HCl, pH 8.5, and 25 ml of the protease inhibitor cocktail (Sigma cat # P8465). The cells were fragmented using Microfluidizer (model M110L or 110Y) (Microfluidics, Newton, MA) on ice with a step at 773.3-843.6 kg / cm2. The lysate was centrifuged at 24,000 rpm for 20 minutes. The supernatant was transferred and dialyzed against 10 volumes of 20 mM Tris-HCl, pH 8.5 overnight at 4 ° C, or diafiltered with this pH regulator and filtered through a 0.45 μm membrane before to apply to column separations. All subsequent separations of the protein were carried out using Pharmacia AKTA Explorer 100 and carried out at 4 ° C. Prior to loading, a Q Sepharose rapid flow column (Pharmacia XK 50/00, 500 ml bed size) was equilibrated with a pH control buffer of 20 mM Tris-HCl, pH 8.5. The sample was applied to the column at 15 ml / minutes \ and then washed with this pH regulator until the one diluted to OD280 returned to the baseline. The proteins were eluted with 2 L of linear gradient of NaCl 0 to 0.3 M at a flow rate of 15 ml / minutes, while fractions of 45 ml were collected. Fractions containing AAD-12 activity as determined by the enzyme colorimetric assay and also corresponding to the predicted molecular weight of the AAD-12 protein (approximately a 32 kDa band in SDS-PAGE) were pooled. Solid ammonium sulfate at a final concentration of 0.5 M was added to the sample, and then applied to a phenyl HP column (Pharmacia XK 50/20, bed size 250 ml) equilibrated in 0.5 M ammonium sulfate in 20 mM Tris-HCl, pH 8.0. This column was washed with the pH regulator for binding at 10 ml / minute. Until the D028o of the eluate returned to the baseline, the proteins were eluted in 2 column volumes at 10 ml / minute by a linear gradient of 0.5 M a 0 of ammonium sulfate in 20 mM Tris-HCl, pH 8.0, and fractions of 12.5 ml were collected. The major peak fractions containing AAD-12 were pooled and, if necessary, concentrated using a centrifuge filter device with a MWCO limit of 10 kDa (Millipore). In some cases the sample was additionally applied to a Superdex 75 gel filtration column (Pharmacia XK 16/60, 110 ml bed size) with pH PBS buffer at a flow rate of 1 ml / minute. Peak fractions containing pure AAD-12 were pooled and stored at -80 ° C. In most cases, the purity of the AAD-12 protein is close to or greater than 99% after sequential separation in two column steps for ion exchange and in column for hydrophobic interaction. A typical yield for purified AAD-12 is 12-18 mg / g of wet cells. The mass protein sample was formulated in 20 mM Tris-HCl, pH 8.0, 0.1 M NaCl, 2 mM DTT, and 1% Trehalose by diafiltration, and lyophilized in the Virtis Freezemobile Model 25EL (Virtis, Cardiner, NY) for long-term storage. The protein concentration was initially measured by the Bradford assay using the Bio-Rad protein assay kit (cat # 500-0006) with bovine serum albumin as standard. When necessary, a more precise protein concentration was determined by the use of total amino acid hydrolysis. The sample was analyzed in the Agilent 1100 CLAR system (Agilent Technologies, Santa Clara, CA) with standards for amino acid calibration (cat # PN5061-3330) obtained from Agilent. The AAD-12 activity was determined through the processes to ensure that there is no loss of enzymatic activity for each treatment and manipulation, as described in Example 5 below. The purity of the protein was monitored by the use of SDS-PAGE and analytical size exclusion chromatography. The purified protein sample was further verified and confirmed by sequencing of the N-terminal amino acid, and showed to be consistent with the expected residues AQTTLQITPT at its N-terminus. The stability of the protein was evaluated at short and long term by means of enzymatic activity and by native PAGE and SDS-PAGE gel analysis both under non-reducing and reducing conditions and it was evident that AAD-12 is prone to oligomerization via disulfide bond formation, therefore, 2 mM DTT was typically used for storage of the protein. Saline solution with pH regulated with phosphate (PBS) and Saline with pH regulated with Tris (TBS) were evaluated for lyophilization of the protein, with and without the presence of 1% trehalose. Additionally, the contaminating DNA and endotoxin were measured in the context from the purified sample respectively, and the integrity of the AAD-12 protein was also tested by isoelectric focus (IEF) analysis. Ten milligrams of purified AAD-12 (v2) was administered to Zymed Laboratories, Inc. (South San Francisco, CA) for production of rabbit polyclonal antibody. The rabbit received 5 injections in the 5 week period with each injection containing 0.5 mg of the purified protein suspended in 1 ml of Freund's complete adjuvant. The sera were evaluated in both ELISA and Western blot experiments to confirm specificity and affinity before affinity purification, and horseradish peroxidase conjugation (HRP) (Zymed Lab Inc).

EXAMPLE 5 In vitro assays of AAD-12 activity . 1 - Test via phenometric colorimetric detection. Enzyme activity was measured by colorimetric detection of the phenol product using a modified protocol from that of Fukumori and Hausinger (1993) (J. Biol. Chem. 268: 24311-24317) to allow deployment in a microplate format of 96. wells The colorimetric assay has been described for use in measuring the activity of dioxygenases which cleave 2,4-D and dichlorprop to liberate the 2,4-dichlorophenol product. The color yield was compared from various phenols with respect to the yield of 2,4-dichlorophenol using the previously described detection method to evaluate which phenol products could be easily detected. The phenols and phenol analogs were evaluated at a final concentration of 100 μM in 0.15 ml 20 mM MOPS pH 6.75 containing 200 μM NH (FeS04) 2, 200 μM sodium ascorbate. The pyridinoles derived from fluroxypyr and triclopir did not produce a significant color. The color yield of 2,4-dichlorophenol was linear and proportional with respect to the phenol concentration in the assay to -500 μM. A calibration curve that was carried out under standard assay conditions (160 μl of final assay volume) indicated that an absorbance at 510 nm of 0.1 was obtained from 17.2 μM of phenol. Enzymatic assays were carried out in a total volume of 0.16 ml 20 mM MOPS pH 6.75 containing 200 μM NH4FeS04, 200 μM sodium ascorbate, 1 mM α-ketoglutarate, the appropriate substrate (added from a storage solution 100 mM made in DMSO), and enzyme. The tests were initiated by the addition of the substrate aryloxyalkanoate, enzyme or α-ketoglutarate at time zero time. After 5 minutes of incubation at 25 ° C, the reaction was determined by the addition of 30 μl of a 1: 1: 1 mixture of 50 mM Na EDTA; pH regulator at pH 10 (3.09 g boric acid + 3.73 g KCI + 44 mM N KOH) and 0.2% of 4-aminoantipyrine. Then 10 μl 0.8% potassium ferricyanide was added and after 5 or 10 minutes, the absorbance at 510 nm was recorded in a microplate spectrophotometric reader. The targets contained all the reagents except for the enzyme that is taken into account for occasional light contamination of some of the substrates by small amounts of phenols. . 2 - Chloropyridinol detection assay The action of AAD-12 on potential substrates such as the triclopyr herbicide containing a substituted pyridine (instead of benzene rings) will release a pyridinol during the cleavage of the aryloxyalkanoate bond. The pyridinoles were not detected using the aminoantipyrin / phenolic ferricyanide detection described in the preceding section. However, it was found that chloropyridine products strongly absorb in the near-UV region with a temperature of 325 nm at pH 7 (extinction coefficient -8,400 M'Vcm "1) This was used to create a continuous spectrophotometric assay based on microplate The assays were carried out in a total volume of 0.2 ml 20 mM MOPS pH 6.75 containing 200 μM NH FeS04, 200 μM sodium ascorbate, 1 mM α-ketoglutarate, the appropriate substrate (added from a solution of 100 mM storage made in DMSO), and enzyme The assays were initiated by the addition of the aryloxyalkanoate, enzyme or α-ketoglutarate substrate at time zero and the increase in absorbance followed by 10 minutes at 325 nm in a microplate reader. The first 2 minutes of the reaction were used to determine the initial velocities.A calibration curve that was carried out under standard assay conditions (200 μl of final assay volume) indicated that the had an absorbance at 510 nm of 0.1 from 11.9 μM chloropyridinol. . 3 - Colorimetric assay using 2- (2-chloro, 4-nitrophenoxy) propionate A convenient assay of AAD-12 was devised using 2- (2-chloro, 4-nitrophenoxy) propionate (CNPP) as the substrate. CNPP cleavage by AAD-12 releases 2-chlorine, 4-nitrophenol. This phenol has a bright yellow absorbance at 410 nm at pH 7 allowing the reaction to be followed completely or by terminal point analysis. The presence of AAD-12 activity can be monitored visually without the need to add additional reagents. Microplate-based spectrophotometric assays were carried out in a total volume of 0.2 ml 20 mM MOPS pH 6.75 containing 200 μM NH4FeS04, 200 μM sodium ascorbate, 1 mM α-ketoglutarate, the appropriate amount of CNPP (added from a storage solution 10 mM made in DMSO), and enzyme. Assays were initiated by the addition of CNPP, enzyme, or α-ketoglutarate at time zero and the increase in absorbance followed by 10 minutes at 410 nm in a microplate reader. The first 2 minutes of the reaction were used to determine the initial velocities. A calibration curve that was carried out under standard assay conditions (200 μl final assay volume) indicated that an absorbance at 410 nm of 0.1 was obtained from 25.1 μM 2-chloro, 4-nitrophenol. Using this test, it was determined that the kinetic constants for CNPP as a substrate were Km = 31 ± 5.5 μM and kcat = 16.2 ± 0.79 minutes "1.

EXAMPLE 6 In vitro activity of AAD-12 on various substrates 6. 1 - Activity of AAD-12 (v2) on (R, S) -d¡chlorprop. (R) -diclorprop, (S) -diclorprop and 2,4-D Using the phenol detection assay described in Example 5.1, four phenoxyalkanoates were tested in a reaction mixture containing 4.4 μg of AAD-12 (v2) purified. (R, S) -diclorprop (R.S-DP) was evaluated at 1 mM and (R) -diclorprop, (S) -diclorprop and 2,4-D were evaluated at 0.5 mM. The results are shown in Figure 2, which illustrates the activity of AAD-12 (v2) on 2,4-D and on the enantiomers of dichlorprop. 4.4 μg AAD-12 (v2) were incubated with 0.5 mM of the substrate (1 mM for (R, S) -diclorprop) and the reaction was initiated by the addition of α-ketoglutarate. After 5 minutes, the reaction was stopped, and the absorbance at 510 nm determined after the addition of reagents for colorimetric detection was recorded. It was subtracted by the background value without the enzyme. AAD-12 (v2) had excellent activity on (R.S) -diclorprop and (S) -diclorprop and had minimal activity on (R) -dichlorprop. This indicates that AAD-12 (v2) had an obvious (S) -enantiomer preference. The activity of AAD-12 (v2) on 2,4-D was equivalent to that of (S) -diclorprop indicating that the enzyme can process oxipropionate and oxyacetates effectively. 6. 2 - Activity of AAD-12 (v2) on pyridyloxyalkanoates Using the pyridinol assay described in Example 5.2, five pyridyloxyalkanoates at 1 mM were tested in a reaction mixture containing 6.8 μg of purified AAD-12 (v2). The rates of each reaction were monitored and presented in Table 9. The five pyridyloxyalkanoates were cleaved to release pyridinoles by AAD-12 (v2). The speeds for the oxypropionate substrates 116844 and 91767 were somewhat faster than those for the corresponding acetates (triclopyr and 93833 respectively) indicating a preference for AAD-12 (v2) for oxypropionate compared to the oxyacetate side chains. These data show that AAD-12 (v2) is capable of effectively degrading pyridyloxyalkanoate herbicides such as triclopyr.

TABLE 9 Relationships of the cleavage of pyridyloxyalkanoate by AAD-12 (v2). 6.8 μg of AAD-12 (v2) were incubated with 1 mM substrate, the reaction was initiated by the addition of α-ketoglutarate and the subsequent increase in absorbance monitored at 325 nm. The background ratio of 1.4 mAU / min without α-ketoglutarate was subtracted from the ratios without substrate 6. 3 - Kinetic constants of AAD-12 (v2) for 2,4-D, (R.SV DCP and triclopyr The Km and kcat values of AAD-12 (v2) purified for the herbicides 2,4-D, (R, S) -diclorprop and triclopir were determined using the appropriate assay method.The substrate inhibition occurred at high concentrations (> 1 mM) of 2,4-D and (R, S) -DCP so that the concentrations per below these were used to fit the data with the Michaelis-Menten equation using Grafit 4.0 (Erithacus Software, UK) No inhibition of the substrate was observed by triclopir up to 2 mM.The kinetic constants are summarized in table 10. of these data, the rate of cleavage by AAD-12 (v2) of triclopyr is -5% compared to that of 2,4-D, under conditions of maximum velocity.

TABLE 10 Kinetic constants of AAD-12 (v2) for three herbicidal substrates * Due to the (S) -enantiomeric preference of AAD-12, the Km value was calculated assuming that 50% of the racemic mixture was available as a substrate EXAMPLE 7 Transformation in Arabidopsis and selection 7. 1 - Growth conditions in Arabidopsis thaliana. The wild-type Arabidopsis seed was suspended in a 0.1% agarose solution (Sigma Chemical Co., St. Louis, MO). The suspended seed was stored at 4 ° C for 2 days to complete the inactivity requirements and ensure the synchronous germination of the seed (stratification). The Sunshine Mix LP5 (Sun Gro Horticulture, Bellevue, WA) was coated with fine vermiculite and sub-irrigated with Hoagland solution until wet. The soil mixture was allowed to dry for 24 hours. The stratified seed was seeded on the vermiculite and covered with domes for moisture (KORD Products, Bramalea, Ontario, Canada) for 7 days. The seeds were germinated and the plants were grown in a Conviron (models CMP4030 and CMP3244, Controlled Environments Limited, Winnipeg, Manitoba, Canada) under long day conditions (16 light hours / 8 dark hours) at a luminous intensity of 120-150 μmol / m2sec under constant temperature (22 ° C) and humidity (40-50%). Initially the plants were given water with Hoagland solution and subsequently with deionized water the soil was moistened but not soaked. 7. 2 - Transformation with Agrobacterium. A plate of LB + agar with erythromycin was used (Sigma Chemical Co., St. Louis, MO) (200 mg / L) or spectinomycin (100 mg / L) containing a DH5a colony sown to provide a colony to inoculate 4 ml of mini prep cultures (liquid LB + erythromycin). The cultures were incubated overnight at 37 ° C with constant agitation. Qiagen (Valencia, CA) Spin Mini Preps, made according to the manufacturer's instructions, were used to purify the plasmid DNA. The electro-competent cells of Agrobacterium tumefaciens (strains Z707s, EHA101s, and LBA4404s) were prepared using a protocol from Weigel and Glazebrook (2002). The competent Agrobacterium cells were transformed using an electroporation method adapted from Weigel and Glazebrook (2002). 50 μl of agro-competent cells were thawed on ice and 10-25 ng of the desired plasmid was added to the cells. The DNA and the cell mixture were added to pre-cooled containers for electroporation (2 mm). An Electroporator Eppendorf 2510 was used for the transformation with the following conditions, Voltage: 2.4kV, Pulse length: 5msec. After electroporation, 1 ml of the YEP broth (per liter: 10 g yeast extract, 10 g Bacto-peptone, 5 g NaCl) was added to the vessel, and the cell-YEP suspension was transferred to a culture tube. 15 ml. The cells were incubated at 28 ° C in a bath with water with constant agitation for 4 hours. After incubation, the culture was seeded on YEP + agar with erythromycin (200 mg / L) or spectinomycin (100 mg / L) and streptomycin (Sigma Chemical Co., St. Louis, MO) (250 mg / L). The plates were incubated for 2-4 days at 28 ° C. The colonies were selected and plated on plates freshly prepared with YEP + agar with erythromycin (200 mg / L) or spectinomycin (100 mg / L) and streptomycin (250 mg / L) and incubated at 28 ° C for 1-3. days. Colonies were selected for PCR analysis to verify the presence of the gene insert through the use of vector-specific primers. Qiagen Spin Mini Preps, performed according to the manufacturer's instructions, were used to purify the plasmid DNA from selected colonies of Agrobacterium with the following exception: 4 ml aliquots were used from a mini-prep culture of 15 ml throughout the night (liquid YEP + erythromycin (200 mg / L) or spectinomycin (100 mg / L)) and streptomycin (250 mg / L)) for DNA purification. An alternative to the use of the Qiagen Spin Mini Prep DNA was to lyse the transformed Agrobacterium cells, suspended in 10 μl of water, at 100 ° C for 5 minutes. Plasmid DNA from the binary vector used in the transformation of Agrobacterium was included as a control. The PCR reaction was completed using Taq DNA polymerase from Takara Mirus Bio Inc. (Madison, Wisconsin) according to the manufacturer's instructions at 0.5x concentrations. The PCR reactions were carried out in a programmed MJ Research Peltier Thermal Cycler with the following conditions; 1) 94 ° C for 3 minutes, 2) 94 ° C for 45 seconds, 3) 55 ° C for 30 seconds, 4) 72 ° C for 1 minute, for 29 cycles then 1 cycle of 72 ° C for 10 minutes. The reaction was maintained at 4 ° C after the cycle process. The amplification was analyzed by electrophoresis in 1% agarose gel and visualized by staining with ethidium bromide. A colony was selected whose PCR product was identical to the control plasmid. 7. 3 - Transformation in Arabidopsis. Arabidopsis was transformed using the submerged method floral. The selected colony was used to inoculate one or more 15-30 ml cultures of YEP broth containing erythromycin (200 mg / L) or spectinomycin (100 mg / L) and streptomycin (250 mg / L). The culture (s) was incubated overnight at 28 ° C with constant agitation at 220 rpm. Each pre-culture was used to inoculate two cultures of 500 ml of YEP broth containing erythromycin (200 mg / L) or spectinomycin (100 mg / L) and streptomycin (250 mg / L) and the cultures were incubated overnight at 28 ° C with constant agitation. The cells were then concentrated at approximately 8700x g for 10 minutes at room temperature, and the resulting supernatant was discarded. The cell concentrate was gently resuspended in 500 ml of infiltration medium containing: 1 / 2x Murashige and Skoog salts / Gamborg vitamins B5, 10% (w / v) sucrose, 0.044 μM benzylamino purine (10 μl / liter a storage solution 1 mg / ml in DMSO) and 300 μl / liter Silwet L-77. Plants about 1 month old were submerged in the medium for 15 seconds, safe to submerge the newer inflorescence. Later the plants were left to rest on their sides and covered (transparent or opaque) for 24 hours, then washed with water, and placed upwards. The plants were grown at 22 ° C, with a photoperiod of 16 light hours / 8 dark hours. Approximately 4 weeks after submerging, the seeds were harvested. 7. 4 - Selection of transformed plants. The recently harvested Tt seed [gene AAD-12 (v1)] was allowed to dry for 7 days at room temperature. The Ti seed was seeded in 26.5 x 51-cm germination trays (TO Plastics Inc., Clearwater, MN), each receiving a 200 mg aliquot of the stratified TT seed (-10,000 seeds) that had previously been suspended in 40 ml of a 0.1% agarose solution and stored at 4 ° C for 2 days to complete inactivity requirements and ensure synchronous germination of the seed. The Sunshine Mix LP5 (Sun Gro Horticulture Inc., Bellevue, WA) was covered with fine vermiculite and sub-irrigated with Hoagland solution until wet, then allowed to dry by gravity. Each 40 ml aliquot of the stratified seed was seeded homogeneously on the vermiculite with a pipette and covered with humidity domes (KORD Products, Bramalea, Ontario, Canada) for 4-5 days. The domes were removed 1 day before the initial selection of the transformant using post-emergence sprinkling of glufosinate (selecting for the co-transformed PAT gene). Seven days after sowing (DAP) and again 11 DAP, the Ti plants (cotyledon and 2-4 leaf stage, respectively) were sprayed with a 0.2% Liberty herbicide solution (200 g ai / L glufosinate, Bayer Crop Sciences, Kansas City, MO) at a spray volume of 10 ml / tray (703 L / ha) using a DeVilbiss compressed air spray nozzle to deliver an effective ratio of 280 g ai / ha glufosinate per application. Survivors (actively growing plants) were identified 4-7 days after the final spraying and transplanted individually into 7.5 cm pots prepared with pot medium (Metro Mix 360). The transplanted plants were covered with domes for humidity for 3-4 days and placed in a chamber for growth at 22 ° C as mentioned above or moved directly to the greenhouse. Subsequently the domes were moved and the plants were left in the greenhouse (22 ± 5 ° C, 50 ± 30% RH, 14 h light: 10 dark, minimum 500 μE / m2s1 natural light + supplementary light) at least 1 day before AAD-12 (v1) capacity test (plant-optimized gene) to provide resistance to phenoxy auxin herbicide.

The T-i plants were then randomly assigned at various 2,4-D ratios. For Arabidopsis, 50 g ae / ha 2,4-D is an effective dose to distinguish sensitive plants from others with significant resistance levels. High ratios were also applied to determine the relative resistance levels (50, 200, 800, or 3200 g ae / ha). Tables 10 and 11 show comparisons with respect to a resistance gene to the aryloxyalkanoate herbicide (AAD-1 (v3)) previously described in PCT / US2005 / 014737. All applications of the auxin herbicide were performed using the DeVilbiss sprinkler as described above to apply 703 L / ha of spray volume (0.4 ml solution / 7.5 cm pot) or spray applied to the tray in a spray volume of 187 L / ha. 2,4-D using was either technical grade (Sigma, St. Louis, MO) dissolved in DMSO and dissolved in water (< 1% DMSO final concentration) or the commercial formulation of dimethylamine salt (456 g ae / L , NuFarm, St Joseph, MO). Dichlorprop using was commercial grade formulated as a potassium salt of R-dichlorprop (600 g ai / L, AH Marks). Since the herbicide ratios increased beyond 800 g ae / ha, the pH of the spray solution became excessively acidic, burning the leaves of younger, more tender Arabidopsis plants and complicating the evaluation of the primary effects of the herbicides. The application of these high rates of herbicides in pH 200 mM HEPES pH 7.5 regulator became a standard practice.

Some Ti individuals were subjected to alternative commercial herbicides instead of a phenoxy auxin. A point of interest was to determine if the herbicides of pyridyloxyacetate auxin, triclopir and fluroxipyr, could be effectively degraded in plant. The herbicides were applied to Ti plants with the use of a tray sprinkler in a spray volume of 187 L / ha. The Ti plants that exhibited tolerance to 2,4-D DMA could be further accessed in the T2 generation. 7. 5 - Results of the selection of transformed plants. The first transformations of Arabidopsis were carried out using AAD-12 (v1) (gene optimized in plant). The Ti transformants were initially selected from the genetic background of non-transformed seeds using a glufosinate selection scheme. More than 300,000 Ti seeds were selected and 316 glufosinate resistant plants were identified (PAT gene), matching a transformation / selection frequency of 0.10% which lies in the normal range of the frequency of selection of the constructions where PAT + Liberty are used for selection. The Ti plants previously selected were subsequently transplanted into individual pots and sprayed with various ratios of commercial aryloxyalkanoate herbicides. Table 11 compares the response of the AAD-12 (v1) and control genes to impart resistance to 2,4-D in Ti transformants of Arabidopsis. The answer is presented in terms of% visual injury 2 WAT. The data is presented as a histogram of individuals exhibiting little or no injury (<20%), a moderate injury (20-40%), or a severe injury (> 40%). Since each of Ti is an independent transformation event, one can expect a significant variation in the individual Ti responses within a given relationship. We present an arithmetic mean and a standard deviation for each treatment. The interval is also indicated in an individual response in the last column for each relation and transformation. Arabidopsis transformed with PAT / Cry1F served as a transformed control sensitive to auxin. The AAD-12 (v1) gene imparted herbicide resistance to the individual Arabidopsis Ti plants. In a given treatment, the level of plant response varied greatly and can be attributed to the fact that each plant represents an independent transformation event. It is important to point out that in each 2.4-D relationship evaluated, there were individuals who were not affected while some were affected to a large extent. A general average injury to the population with respect to the relationship is presented in Table 11 simply by demonstrating the significant difference between plants transformed with AAD-12 (v1) against wild-type controls or transformed with PAT / Cry1F . The lesion levels tend to be higher and the frequency of the non-injured plants was lower at high ratios up to 3,200 g ae / ha (or 6x ratio in the field). Also, at these high ratios, the spray solution becomes highly acidic unless a pH regulator is used. Arabidopsis grown mainly in the growth chamber had a very thin cuticle and several burn effects can complicate the evaluation at these high ratios. However, many individuals have survived 3,200 g ae / ha of 2,4-D with few lesions or no lesions.

TABLE 11 Response of Arabidopsis Ti transformed with AAD-12 (vi) to a range of 2,4-D ratios applied post-emergence, compared to a homozygous AAD-1 v3 (T4) homozygous population, or a sensitive control to auxin, transformed with Pat-Cry1F Transformants Tt of the gene% of injury% of injury AAD-12 (v1) Averages < 20% 20-40% > 40% Prom D E Untreated control - regulator of 6 0 0 0 0 pH 50 g ae / ha 2,4-D 6 0 2 16 24 200 g ae / ha 2,4-D 6 1 1 1 1 18 00 800 g ae / ha 2,4-D 5 2 1 15 20 3200 g ae / ha 2,4-D 8 0 0 6 6 PATVCryl F (control% of lesion% of lesion transformed) Averages < 20% 20-40% > 40% Prom DE Control untreated -regulator of 10 0 0 0 0 pH 50 g ae / ha 2,4-D 4 1 5 31 16 200 g ae / ha 2,4-D 0 0 10 70 2 800 g ae / ha 2,4-D 0 0 10 81 8 3200 g ae / ha 2,4-D 0 0 10 91 2 T4 homozygous plants of the% ssion% lesion% AAD-1 (v3) Averages < 20% 20-40% > 40% Prom D.E. Control untreated • regulator 10 0 0 0 0 pH 50 g ae / ha 2,4-D 10 0 0 0 0 200 g ae / ha 2,4-D 10 0 0 0 0 800 g ae / ha 2,4 -D 10 0 0 0 0 3200g ae / ha 2,4-D 9 1 0 2 6 | NJ CD Table 12 shows a similarly conducted dose response of Arabidopsis to phenoxypropionic acid, dichlorprop. The data show that the (R-) isomer of herbicidally active dichlorprop does not serve as a suitable substrate for AAD-12 (v1). The fact that AAD-1 will metabolize R-dichlorprop sufficiently well to impart commercially acceptable tolerance is a characteristic that distinguishes the two genes (Table 12). AAD-1 and AAD-12 are considered to be specific a-ketoglutarate dioxygenases of R- and S, respectively.

TABLE 12 Response of Arabidopsis Ti to a range of R-diclorprop ratios applied post-emergence % injury% of Gen AAD-12 v1 injury Averages < 20% 20-40% > 40% Prom DE Control untreated 6 0 0 0 0 50 g ae / ha R-dichlorprop 0 0 8 63 7 200 g ae / ha R-dichlorprop 0 0 8 85 10 800 g ae / ha R-dichlorprop 0 0 8 96 4 3200 g ae / ha R-dichlorprop 0 0 8 98 2 PAT / Cry1 F% injury% Averages injury DE co < 20% 20-40% > 40% Prom Control untreated 10 0 0 0 0 50 g ae / ha R-dichlorprop 0 10 0 27 2 200 g ae / ha R-dichlorprop 0 0 10 69 3 800 g ae / ha R-dichlorprop 0 0 10 83 6 3200 g ae / ha R-dichlorprop 0 0 10 90 2 T4 plants homozygous% injury% gene AAD-1 (v3) injury < 20% 20-40% > 40% Prom DE Control untreated 10 0 0 50g ae / ha R-dichlorprop 10 0 0 200 g ae / ha R-dichlorprop 10 0 0 800 g ae / ha R-dichlorprop 10 0 0 3200 g ae / ha R-dichlorprop 10 0 0 ro o o o o o o o o o o 7. 6 - AAD-12 (v1) as a selection marker. The ability to use AAD-12 (v1) as a selection marker using 2,4-D as the selection agent was initially analyzed with transformed Arabidopsis as described above. Approximately 50 seeds of Arabidopsis generation T4 (homozygous for AAD-12 (v1)) were marked compared to approximately 5,000 miles of wild type (sensitive). Several treatments were compared, each tray of plants received either one or two applications with the 2,4-D regimen in one of the following treatment schemes: 7 DAP, 1 1 DAP, or 7 followed by 1 1 DAP. Since all individuals also contained the PAT gene in the same transformation vector, AAD-12 selected with 2,4-D could be directly compared to PAT selected with glufosinate. The treatments were applied with a DeVilbiss spray nozzle as previously described. The plants were identified as resistant or sensitive 17 DAP. The optimal treatment was 75 g ae / ha of 2,4-D applied 7 and 11 days after sowing (DAP), it was equally effective in selection frequency, and resulted in a lower herbicidal injury to individuals transformed into comparison with the Liberty selection scheme. These results indicate that AAD-12 (v1) can be effectively used as an alternative selection marker for a population of transformed Arabidopsis. 7. 7 - Inheritance A variety of Ti events were self-pollinated to produce T2 seeds. These seeds were progeny evaluated by the application of 2,4-D (200 g ae / ha) to 100 T2 suckers at random. Each individual T2 plant was transplanted into 7.5-cm square pots for application of the spray (tray sprinkler at an application rate of 187 L / ha). Seventy-five percent of the T-i families (T2 plants) segregated in the resistant 3 prospective model: 1 sensitive for a particular dominantly inherited locus with Mendelian inheritance as determined by Chi square analysis (P> 0.05). The seeds were harvested from 12 to 20 T2 individuals (T3 seeds). Twenty-five T3 offsprings from each of the eight T2 families randomly selected were progeny evaluated as previously described. Approximately one third of the anticipated T2 families as homozygous (non-segregating populations) have been identified in each line. These data show that AAD-12 (v1) is stably integrated and inherited in Mendelian fashion for at least three generations. 7. 8 - Additional foliar applications for herbicide resistance in Arabidopsis AAD-12. The ability of AAD-12 (v1) to provide resistance to other auxin aryloxyalkanoate herbicides in transgenic Arabidopsis was determined by foliar application of several substrates. The T2 generation of the seeds of Arabidopsis was stratified, and planted in selection trays similarly to Arabidopsis (example 6.4). A transformed control line containing PAT the insect resistance gene CrylF was seeded in a similar manner. The shoots were transferred to individual 7.5 cm pots in the greenhouse. All the plants were sprinkled with the use of a tray sprinkler adjusted to 187 L / ha. The plants were sprayed with a range of pyridyloxyacetate herbicide solution: 280-2240 g ae / ha triclopir (Garlon 3A, Dow AgroSciences) and 280-2240 g ae / ha fluroxipir (Starane, Dow AgroSciences); and the 2,4-D metabolite resulting from the activity of AAD-12, 2,4-dichlorophenol (DCP, Sigma) (at a molar equivalent to 280-2240 g ae / ha of 2,4-D, DCP technical grade was used). All applications were formulated in water. Each treatment was repeated 3-4 times. Plants were evaluated at 3 and 14 days after treatment. There is no effect of the metabolite 2,4-D, 2,4-dichlorophenol (DCP), on transgenic Arabidopsis control non-AAD-12 (Pat / Cry1F). Plants transformed with AAD-72 were also clearly protected from injury by the herbicide triclopir and fluroxypir that was observed in the non-resistant transformed controls (see Table 13). These results confirm that AAD-12 (v1) in Arabidopsis provides resistance to the evaluated pyridyloxyacetic auxins. This is the first report of an enzyme with significant activity on pyridyloxyacetic acid herbicides. Other enzymes that degrade 2,4-D with similar activity have not been reported.

TABLE 13 Comparison of Tg ^ AAD-12 (v1) and response of the control plant transformed with Arabidopsis to various applied auxinic herbicides to the foliage Auxins pyridyloxy acetic Average of the lesion% to 14DAT Treatment with Segregating Plants T2 AAD-12 Pat / Cry1f herbicide (j (pPAB724.01.120) Control 280 g ae / ha Triclopyr 0 52 560 g ae / ha Triclopir 3 58 1120 g ae / ha Triclopir 0 75v 2240 g ae / ha Triclopir 3 75 * 280 g ae / ha Fluroxipir 0 75 * 560 g ae / ha Fluroxipir 22 75 * 1120 g ae / ha Fluroxipir 33 75 * 2240 g ae / ha Fluroxipir 5 75 * Metabolite inactive DCP 280 g ae / ha 2,4-DCP 0 0 560 g ae / ha 2,4-DCP 0 0 1120 g ae / ha 2,4-DCP 0 0 2240 g ae / ha 2,4-DCP 0 0 * The plants in this experiment were dwarfed and were severely epinastic, but they remained green and did not receive injury classifications > 75% 7. 9 - Molecular analysis of Arabidopsis AAD-12 (v1) An Invader test was carried out (Third Wave methods Agbio Kit Procedures) for the analysis of the number of copies of the PAT gene with the DNA obtained from the Qiagen DNeasy team in multiple homozygous lines AAD-12 (v1) to determine the stable integration of the plant transformation unit containing PAT and AAD -12 (v1). The analysis involved the direct physical union of these genes as they were contained in the same plasmid. The results showed that all tested plants resistant to 2,4-D, contained PAT (and therefore by inference, AAD-12 (v1)). The analysis of the number of copies showed that the total inserts had an interval of 1 to 5 copies. This also correlates with the AAD-12 protein expression data (v1) indicating that the presence of the enzyme produces significantly high levels of resistance to all commercially available phenoxyacetic and pyridyloxyacetic acids. 7. 10 - Arabidopsis transformed with molecular stacking of AAD-12 (v1) and a gene for glyphosate resistance. The Ti seed of Arabidopsis was produced, as previously described, which contained the plasmid pDAB3759 (AAD-12 (v1) + EPSPS) which encodes a putative glyphosate resistance trait. Ti transformants were selected using AAD-12 (v1) as the selection marker as described in Example 7.6. The Ti plants (individually transformed events) were recovered from the first selection attempt and transferred to 7.5 cm pots in the greenhouse as previously described. Three different control lines of Arabidopsis were also evaluated: Columbia-0 wild type, homozygous lines AAD-12 (v1) + PAT T4 (transformed with pDAB724), and homozygous line PAT + CrylF (transformed with the control). The plants transformed with pDAB3759 and pDAB724 were pre-selected in the seedling stage for tolerance to 2,4-D. Four days after transplantation, the plants were homogenously divided for foliar treatment by tray sprinkler as previously described with 0, 26.25, 105, 420, or 1680 g ae / ha glyphosate (Glyphomax Plus, Dow AgroSciences) in water. All treatments doubled 5 to 20 times. Plants were evaluated 7 and 14 days after treatment. Evaluation of the initial resistance indicated that plants tolerant to 2,4-D were subsequently tolerant to glyphosate when compared to the response of the three control lines. These results indicate that resistance can be imparted to the plants to two herbicides with different modes of action, including tolerance to 2,4-D and glyphosate, allowing the application of both post-emergence herbicides. Additionally, AAD-12 + 2,4-D was effectively used as a selection marker for a true resistance selection.

TABLE 14 Response of Arabidopsis Ti to a range of qlifosate ratios Applied postsurgitation (14 DAT). AAD-12 v1 + EPSPS +% injury of Hptll% (pDAB3759) injury (averages) < 20% 20-40% > 40% Prom D E Control not treated 5 0 0 0 0 26 25 g ae / ha glyphosate 13 2 1 1 1 16 105 g ae / ha glyphosate 10 1 5 34 38 420 g ae / ha glyphosate 5 6 5 44 37 1680 g ae / ha ghfosato 0 0 16 85 9 PAT / Cry1 F% of injury% of Averages injury < 20% 20-40% > 40% Prom D E Control untreated 5 0 0 0 0 26 25 g ae / ha glyphosate 0 0 5 67 7 105 g ae / ha glyphosate 0 0 5 100 0 420 g ae / ha glyphosate 0 0 5 100 0 1680 g ae / ha ghfosato 0 0 5 100 0 Wild type (Col-0)% injury Injury averages < 20% 20-40% > 40% Prom D E Untreated control 5 0 0 0 0 26 25 g ae / ha ghfosato 0 0 5 75 13 105 g ae / ha g phosate 0 0 5 100 0 420 g ae / ha g phosate 0 0 5 100 0 1680 g ae / ha glyphosate 0 0 5 100 0 pDAB724 T4 (PAT + AAD-12) of averages lesion injury < 20% 20-40% > 40% Prom D E Untreated control 0 0 26 25 g ae / ha glyphosate 0 0 5 66 8 105 g ae / ha ghfosato 0 0 5 100 0 420 g ae / ha glyphosate 0 0 5 100 0 1680 g ae / ha ghfosato 0 0 5 I 100 0 7.11 - Arabidopsis AAD-12 genetically stacked with AAD-1 to produce a broader spectrum of tolerance to the herbicide. Plants AAD-12 (v1) (pDAB724) and AAD-1 (v3) (pDAB721) were reciprocally crossed and the Fi seed was collected. Eight Fi seeds were planted and allowed to grow to produce seed. Tissue samples were taken from eight Fi plants and subjected to Western analysis to confirm the presence of both genes. It was concluded that the 8 plants evaluated expressed both AAD-1 and AAD-12 proteins. The seed was grouped and allowed to dry for a week before sowing. A hundred seeds of F2 were sown and 280 g ai / ha of glufosinate were applied. Ninety-six F2 plants survived selection by glufosinate adjusted to an expected segregation ratio for two loci independently classified for glufosinate resistance (15 R: 1 S). The plants resistant to glufosinate were then treated with 560 g ae / ha of R-dichlorprop + 560 g ae / ha of triclopir, applied to the plants under the same spray regime that was used for the other tests. The plants were classified at 3 and 14 DAT. Sixty-three of the 96 plants that survived the glufosinate selection also survived the herbicide application. These data are consistent with an expected segregation pattern (9R: 6S) of two independently classified dominant traits where each gene provides resistance to only one of the auxinic herbicides (either R-dichlroprop or triclopyr). The results indicate that AAD-12 (pDAB724) can be successfully stacked with AAD-1 (pDAB721), thus increasing the spectrum of herbicides that can be applied to the crop of interest [(2,4-D + R -diclorprop) and (2,4-D + fluroxypir + triclopyr), respectively]. This could be useful to produce tolerance to 2,4-D to very sensitive species through the conventional stacking of two separate 2,4-D resistance genes. Additionally, if any gene is used as a selection marker for a third and fourth gene of interest through independent transformation activities, then each pair of genes could be carried through conventional activities of crossing and subsequently selecting the generation Fi to through aspersions paired with herbicides that are exclusive between the enzymes AAD-1 and AAD-12 (as shown with R-dichlorprop and triclopyr for AAD-1 and AAD-12, respectively, mentioned above). Other AAD stacks are also within the scope of the present invention. The TfdA protein discussed elsewhere in the present invention (Streber et al.), For example, can be used in conjunction with target AAD-12 genes to impart novel spectra of herbicide resistance in transgenic plants of the present invention.

EXAMPLE 8 Transformation mediated by corn whiskers using selection with imazethapir 8. 1 - Cloning of AAD-12 (v1). The AAD-12 gene (v1) was cut from the intermediate vector pDAB3283 as an Nco1 / Sac1 fragment. This was directionally ligated into the similarly cut vector pDAB3403 which contained the monocotyledone ZmUbil promoter. The two fragments were ligated together using T4 DNA ligase and transformed into DH5a cells.

Miniprerations were carried out in the resulting colonies using Qiagen QIA Spin mini prep equipment, and the colonies were digested to monitor orientation. This first intermediary construction (pDAB4100) contained the ZmUbil cassette: AAD-12 (v1). This construct was digested with Not1 and Pvu1 to release the gene cassette and digest the unwanted base structure. This was ligated with pDAB2212 cut with Not1, which contained the AHAS selection marker run by the OsActl rice actin promoter. The final construct was designated pDAB4101 or pDAS1863, and contains ZmUbi1 / AAD-72 (V7J / ZmPer5 :: OsAct1 / AHAS / LZmLip. 8. 2 - Callus start / suspension. To obtain immature embryos for the start of callus culture, the Fi crosses were carried out between the Hi-ll parents grown in greenhouse A and B (Armstrong et al., 1991). When the embryos were 1.0-1.2 mm in size (approximately 9-10 days after pollination), the ears were harvested and sterilized on the surface by carving with Liqui-Nox® soap, submerged in 70% ethanol by 2-3 minutes, then submerged in 20% commercial bleach (0.1% sodium hypochlorite) for 30 minutes. The ears were rinsed in sterile, distilled water, and the immature zygotic embryos were aseptically excised and cultured in medium 15Ag10 (Medium N6 (Chu et al., 1975), 1.0 mg / L 2,4-D, 20 g / L sucrose, 100 mg / L casein hydrolyzate (enzymatic digestion), 25 mM L-proline, 10 mg / L AgNO3, 2.5 g / L Gelrite, pH 5.8) for 2-3 weeks with the scutellum facing the opposite side medium. The tissue that showed adequate morphology (Welter et al., 1995) was selectively transferred at biweekly intervals in recently prepared 15Ag10 medium for approximately 6 weeks, then transferred to medium 4 (Medium N6, 1.0 mg / L 2,4-D , 20 g / L sucrose, 100 mg / L casein hydrolyzate (enzymatic digestion), 6 mM L-proline, 2.5 g / L Gelrite, pH 5.8) at biweekly intervals for approximately 2 months. To initiate cultures in embryogenic suspension, approximately 3 ml packed cell volume (PCV) of callus tissue originating from a single embryo was added to approximately 30 ml of H9CP + liquid medium (MS salt mixture basal (Murashige and Skoog, 1962), modified MS vitamins containing 10 times less nicotinic acid and 5 times more thiamine-HCl, 2.0 mg / L 2,4-D, 2.0 mg / L a-naphthaleneacetic acid (NAA), 30 g / L sucrose, 200 mg / L casein hydrolyzate (acid digested), 100 mg / L Anyo-inositol, 6 mM L-proline, 5% v / v coconut water (added just before subculture), pH 6.0) . The suspension cultures were kept under dark conditions in 125 ml Erlenmeyer flasks on a shaker with controlled temperature set at 125 rpm at 28 ° C. Typically the cell lines were established within 2 to 3 months after onset. During the establishment, suspensions were subcultured every 3.5 days by the addition of 3 ml of PCV cells and 7 ml of medium conditioned to 20 ml of freshly prepared H9CP + liquid medium using a pipette with a wide orifice. Once the tissue started growing duplication, the suspensions were scaled and maintained in 500 ml flasks in which 12 ml of PCV cells and 28 ml of conditioned medium were transferred into 80 ml of medium H9CP +. Once the suspensions were fully established, they were cryopreserved for future use. 8. 3 - Cryopreservation and thawing of suspensions. Two days after the subculture, 4 ml of a suspension of PCV cells and 4 ml of conditioned medium were added to 8 ml of cryoprotectant (dissolved in H9CP + medium without coconut water, 1 M glycerol, 1 M DMSO, 2 M sucrose, sterilized by filter) and allowed to stir at 125 rpm. 4 ° C for 1 hour in a 125 ml flask. After 1 hour 4.5 ml was added to a 5.0 ml Corning cooled cryo vial. Once filled, the individual vials were kept for 15 minutes at 4 ° C in a controlled freezer, then allowed to freeze at a -0.5 ° C / minute until they reached a final temperature of -40 ° C. After reaching the final temperature, the vials were transferred to boxes inside grids of a Cryoplus 4 storage unit (Forma Scientific) filled with vapors of liquid nitrogen. To defrost, the vials were removed from the storage unit and placed in a closed container with dry ice, then submerged in a bath with water maintained at 40-45 ° C until "boiling". When thawed, the contents were poured onto a stack of ~ 8 sterile 70 mm Whatman filter papers (No. 4) in 100x25 mm covered Petri dishes. The liquid was allowed to absorb into the filters for several minutes, then the upper filter containing the cells was transferred onto GN6 medium (N6 medium, 2.0 mg / L 2,4-D, 30 g / L sucrose, 2.5 g / L Gelrite, pH 5.8) for 1 week. After 1 week, only the tissue with promising morphology was transferred out of the filter paper directly onto the freshly prepared GN6 medium. This tissue was subcultured every 7-14 days until 1 to 3 grams were available for the start of the suspension in approximately 30 ml of H9CP + medium in 125 ml Erlenmeyer flasks. Three ml of PCV were subcultured into freshly prepared H9CP + medium every 3.5 days until a total of 12 ml of PCV was obtained, at which point the subculturing was carried out as previously described. 8. 4 - Stable transformation Approximately 24 hours before the transformation, 12 ml PCV of pre-cryopreserved corn suspension embryogenic cells plus 28 ml of conditioned medium were subcultured into 80 ml of GN6 liquid medium (GN6 medium lacking Gelrite) in a 500 ml Erlenmeyer flask, and placed on a 125-well shaker. rpm at 28 ° C. This was repeated 2 times using the same cell line in such a way that a total of 36 ml of PCV was distributed in 3 flasks. After 24 hours the GN6 liquid medium was removed and replaced with 72 ml of GN6 S / M osmotic medium (N6 medium, 2.0 mg / L 2,4-D, 30 g / L sucrose, 45.5 g / L sorbitol, 45.5 g / L mannitol, 100 mg / L myo-inositol, pH 6.0) per flask in order to plasmolyze the cells. The flasks were placed on an agitated shaker at 125 RPM in the dark for 30-35 minutes at 28 ° C, and during this time a 50 mg / ml suspension of silicon carbide whiskers was prepared by editing the appropriate volume 8.1 ml from GN6 S / M liquid medium to -405 mg sterile silicon carbide whiskers pre-autoclaved (Advanced Composite Materials, Inc.). After incubation in GN6 S / M, the contents of each flask were grouped in a 250 ml centrifuge bottle. Once all the cells had settled to the bottom, all except -14 ml of the GN6 S / M liquid medium was removed and collected in a sterile 1-L flask for future use. The pre-moistened whisker suspension was subjected to vortex for 60 seconds at maximum speed and then 8 1 ml was added to the bottle, to which 170 μg of DNA was added as a final step. The bottle was immediately placed in a commercially available Red Devil 5400 modified paint mixer and stirred for 10 seconds After shaking, the cocktail of cells, media, whiskers and DNA were added to the contents of the 1-L flask together with 125 ml of medium GN6 liquid recently prepared to reduce the osmotic agent The cells were allowed to recover on a shaker at 125 RPM for 2 hours at 28 ° C before being filtered on Whatman # 4 filter paper (5 5 cm) using a glass cell collection unit that was connected to a vacuum line Approximately 2 ml of the dispersed suspension was pipetted onto the filter surface as the vacuum was removed. The filters were placed on 60 x 20 mm plates of GN6 medium. The plates were cultured for 1 week at 28 ° C in a dark box After 1 week, filter papers were transferred to 60x20 mm plates of GN6 medium (3P) (N6 medium, 2.0 mg / L 2,4-D, 30 g / L sucrose, 100 mg / L myo-inositol, 3 μM imazethapyr a from Pursuit® DG, 2 5 g / L Gelpte, pH 5 8) Plates were placed in boxes and cultured for an additional week Two weeks after transformation, the tissue was imbibed by scraping all the cells on the plaque in 3.0 ml of molten GN6 agarose medium (N6 medium, 2.0 mg / L 2,4-D, 30 g / L sucrose, 100 mg / L myo-inositol, 7 g / L Sea Plaque agarose, pH 5.8 , autoclaved for only 10 minutes at 121 ° C) containing 3 μM imazethapir from Pursuit® DG. The tissue was fragmented and 3 ml of agarose and tissue were poured homogeneously onto the surface of a 100 x 15 mm plate of GN6 (3P). This was repeated for all the remaining plates. Once embedded, the plates were individually sealed with Nescofilm® or Parafilm M®, and then cultured until putative isolates appeared. 8. 4.1- Protocol for isolation, recovery and regeneration. Putatively transformed events were isolated from the embedded plates containing Pursuit® approximately 9 weeks after transformation by transferring to freshly prepared selection medium of the same concentration in 60 x 20 mm plates. If sustained growth was evident after approximately 2-3 weeks, the event was considered resistant and subjected to molecular analysis. Regeneration was initiated by transferring the callus tissue to an induction medium based on cytokinin, 28 (3P), containing 3 μM imazethapir from the Pursuit® DG, MS salts and vitamins, . 0 g / L sucrose, 5 mg / L BAP, 0.25 mg / L 2,4-D, 2.5 g / L Gelrite; pH 5.7. The cells were grown in low light (13 μEm "2s'1) for one week, then in greater light (40 μErrfV1) for another week, before being transferred to regeneration medium, 36 (3P), which was identical to 28 (3P) except that it lacked the plant growth regulators.Small seedlings (3-5 cm) were removed and placed in 150 x 25 mm culture tubes containing SHGA-free selection medium (basal salts of Schenk and Hildebrandt and vitamins, 1972, 1 g / L myo-inositol, 10 g / L sucrose, 2.0 g / L Gelrite, pH 5.8) Once the seedlings developed a root system and adequate stem, they were transplanted to soil In the greenhouse, from 4 experiments, complete seedlings, comprising a stem and a root, were formed in vitro in the selection plates embedded under dark conditions without carrying out a traditional phase of callus. from nine of these "early regenerators" were subjected to for PCR in coding region and PCR in plant transcription unit (PTU) for the AAD-12 gene and the gene cassette, respectively. All had an intact AAD-12 coding region, while 3 did not have a full-length OCT (Table 15). These "early regenerators" were identified as events 4101 to differentiate them from traditionally derived events, which were identified as "1283" events. Plants from 19 additional events, obtained through selection and standard regeneration, were sent to the greenhouse, grown to maturity and cross-pollinated with a patented inbred line in order to produce T-i seed. Some of the events appeared to be clones of others due to similar banding patterns after the Southern blot, so only 14 unique events are represented. The T0 plants from the events were tolerant to 70 g / ha of imazethapir. The Invader analysis (AHAS gene) indicated insertion of the complex having an interval of 1 a > 10 copies. Thirteen events contained the coding region of competence for AAD-12, however, additional analysis indicated that the complete plant transformation unit had been incorporated for nine events. None of the 1863 compromised events advanced beyond stage T1 and the additional characterization used events 4101. 8. 5- Molecular analysis: materials and methods of corn. 8.5.1 - Harvest of the tissue, isolation and quantification of DNA. The fresh tissue was placed inside tubes and lyophilized at 4 ° C for 2 days. After the tissue was completely dried, a bed of tungsten (Valenite) was placed in the tube and the samples were subjected to 1 minute of dry milling using a Kelco bed mill. Then the standard DNeasy DNA isolation procedure was followed (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and read in the fluorometer (BioTek) with known standards to obtain the concentration in ng / μl. 8. 5.2 - Analysis of the Invader test. The DNA samples were diluted to 20 ng / μl and then denatured by incubation in a thermal cycler at 95 ° C for 10 minutes. The signal probe mixture was then prepared using the mixture of oligo provided and MgCl2 (Third Wave Technologies). A 7.5 μl aliquot was placed in each well of the Invader assay plate followed by a 7.5 μl aliquot of controls, standards, and 20 ng / μl of the unknown samples diluted. Each well was loaded on top with 15 μl of mineral oil (Sigma). The plates were then incubated at 63 ° C for 1 hour and read on the fluorometer (Biotek). The calculation of the% signal on the background signal for the white probe was divided by the% signal of the internal background control probe that will calculate the ratio. The relationship of the known standards of copying was developed and validated with Southern blot analysis used to identify the estimated copies of the unknown events. 8. 5.3 - Polymerase chain reaction. A total of 100 ng of total DNA was used as the template. 20 mM of each primer was used with the Takara Ex Taq PCR polymerase (Mirus TAKRR001A). The primers from PTU AAD-12 (v1) are forward - GAACAGTTAGACATGGTCTAAAGG (SEQ ID NO: 8) and reverse - GCTGCAACACTGATAAATGCCAACTGG (SEQ ID NO: 9). The PCR reaction was carried out in the Geneamp 9700 thermocycler (Applied Biosystems), by submitting the samples at 94 ° C for 3 minutes and 35 cycles of 94CC for 30 seconds, 63 ° C for 30 seconds, and 72 ° C for 1 minute and 45 seconds followed by 72 ° C for 10 minutes.

The primers for PCR of the coding region of AAD-12 (v1) are forward - ATGGCTCAGACCACTCTCCAAA (SEQ ID NO: 10) and reverse - AGCTGCATCCATGCCAGGGA (SEQ ID NO: 11). The PCR reaction was carried out in the Geneamp 9700 thermal cycler (Applied Biosystems), by submitting the samples at 94 ° C for 3 minutes and 35 cycles of 94 ° C for 30 seconds, 65 ° C for 30 seconds, and 72 ° C C for 1 minute and 45 seconds followed by 72 ° C for 10 minutes. The PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr. 8. 5.4 - Southern blot analysis. Southern blot analysis was carried out with genomic DNA obtained from the Qiagen DNeasy team. A total of 2 μg of leaf genomic DNA or 10 μg of callus genomic DNA was digested overnight using the restriction enzymes BSM I and SWA I to obtain the PTU data. After digestion throughout the night an aliquot of -100 ng was processed in a 1% gel to ensure complete digestion. After having this safety, the samples were processed in a large 0.85% agarose gel overnight at 40 volts. The gel was then denatured in 0.2 M NaOH, 0.6 M NaCl for 30 minutes. The gel was then neutralized in 0.5 M Tris HCl, 1.5 M NaCl pH 7.5 for 30 minutes. An apparatus for gel containing 20x SSC was then adjusted to a gravity gel for transfer to a nylon membrane (Millipore INYC00010) overnight. After overnight transfer the membrane was then subjected to UV light via a crosslinker (Stratagene UV stratalinker 1800) at 1200 X100 microjoules. The membrane was then washed in 0.1% SDS, 0.1 SSC for 45 minutes. After the 45 minute wash, the membrane was baked for 3 hours at 80 ° C and then stored at 4 ° C until hybridized. The template fragment was prepared for hybridization using the PCR of the aforementioned coding region using the plasmid DNA. The product was processed on a 1% agarose gel and excised and then the gel was extracted using the Qiagen gene extraction procedure (28706). The membrane was then subjected to a prehybridization step at 60 ° C for 1 hour in Perfect Hyb pH regulator (Sigma H7033). The Prime it RmT dCTP-labelin rxn procedure (Stratagene 300392) was used to develop the p32-based probe (Perkin Elmer). The probe is cleaned using the Probé Quant columns. G50 (Amersham 27-5335-01). Two million CPM accounts were used to hybridize the southern blots throughout the night. After overnight hybridization the blots were then subjected to two washes for 20 minutes at 65 ° C in 0.1% SDS, 0.1 SSC. The blots were then exposed to the film overnight, incubating at -80 ° C. 8. 6 - Tolerance to the postemergence herbicide in corn Tn transformed with AAD-12. Four To events were allowed to acclimate in the greenhouse and were grown until 2-4 new leaves emerged, which were observed normal from the whorl (ie, the plants had a transition from the growing conditions of the tissue culture to the greenhouse) . The plants were grown at 27CC under conditions of 16 hours of light: 8 hours of darkness in the greenhouse. The plants were then treated with commercial formulations of either Pursuit® (imazethapyr) or 2, 4-D Amine 4. Pursuit® was sprayed to demonstrate the function of the selection marker gene present within the evaluated events. Herbicide applications were made with a tray sprinkler at a spray volume of 187 L / ha, 50-cm spray height. The plants were sprayed with either a lethal dose of imazethapir (70 g ae / ha) or a ratio of 2,4-D DMA salt capable of significantly injuring untransformed corn lines (2240 g ae / ha). A lethal dose is defined as the ratio that causes >95% injury to inbred Hi-ll. Hi-ll is the genetic background of the transformants of the present invention. Several individuals were treated with safener from the herbicides with respect to which the respective genes provided resistance. However, the individual clone '001' from the event "001" (also known as 4101 (0) -001-001), presented minor injuries but recovered to 14 DAT. Three of the four events moved forward and the individuals crossed with 5XH751 and were taken to the next generation. Each herbicide tolerant plant was positive for the presence of the AAD-12 coding region (PCR assay) or the presence of the AHAS gene (Invader assay) for 2,4-D tolerant plants and imazethapyr, respectively. The AAD-12 protein was detected in all events of the T0 plants tolerant to 2,4-D containing an intact coding region. The copy number of the transgene (s) (AHAS, and by inference AAD-72) varied significantly from 1 to 15 copies. The individual T0 plants were grown to maturity and cross-pollinated with a patented inbred line in order to produce the T-i seed.

TABLE 15 Characterization of T0 maize plants transformed with AAD-12 8. 7 - Verification of the high tolerance to 2,4-D in corn T. The seeds T-i AAD-12 (v1) were sown in 7.5 cm pots containing half Metro Mix and in the 2-leaf stage they were sprayed with 70 g ae / ha of imazethapir to eliminate the null plants. The surviving plants were transplanted into 3.8-liter pots containing Metro Mix medium and placed in the same growth conditions as mentioned above. At stage V3-V4 the plants were sprinkled in the tray sprinkler adjusted to 187 L / ha at either 560 or 2240 g ae / ha of 2,4-D DMA. The plants were classified at 3 and 14 DAT and compared with the control plants 5XH751 x Hi II. A rating scale of 0-10 (without injury to extreme injury by auxin) was developed to distinguish the lesion from the root for attachment. Root evaluations for clamping were taken at 14DAT to show tolerance to 2,4-D. 2,4-D causes malformation of the root for subjection, and is a consistent indicator of injury by the auxinic herbicide in corn. The root datum for subjection (as shown in the table below) shows that 2 of the 3 events evaluated were very tolerant to 2240 g ae / ha of 2,4-D DMA. The event "pDAB4101 (0) 001.001" was apparently unstable; however, the other two events were more tolerant to 2,4-D and 2,4-D + imazethapyr or 2, -4D + glyphosate (see Table 16).

TABLE 16 Root lesion for restraint where plants transformed with AAD-12 (vt) and non-transformed corn control plants. A scale of 0-10, 10% being the highest, was used for classification of the lesion by 2,4-D DMA. The results are a visual average of four replicates per treatment 8. 8 - inheritance of AAD-12 (v1) in corn. A progeny test was also carried out in seven Ti AAD-12 families (v1) that had been crossed with 5XH751. Seeds were planted in 7.5 cm pots as described above. In the 3 leaf stage all the plants were sprayed with 70 g ae / ha of imazethapir in the pan sprinkler as previously described. After 14 DAT, resistant and sensitive plants were counted. Four of six evaluated lines were segregated as a particular locus, dominant Mendelian trait (1 R: 1S) as determined by Chi square analysis. Plants that survived were subsequently sprayed with 2,4-D and all plants were considered to be tolerant to 2,4-D (ratio 560 g ae / ha). AAD-12 is inheritable as a strong gene for resistance to the aryloxyalkanoate auxin in multiple species when it crosses reciprocally with a commercial hybrid. 8. 9 - Stacking of AAD-12 (v1) to increase the spectrum of the herbicide AAD-12 (v1) (pDAB4101) and a Roundup Ready elite inbred (BE1146RR) were crossed reciprocally and the F- | seeds were collected. Seeds from two F lines were sown and treated with 70 g ae / ha of imazethapir in step V2 to eliminate the null plants. To the surviving plants, the representative parts were separated and treated with either 1120 g ae / ha of 2,4-D DMA + 70 g ae / ha of mazethapir (to confirm the presence of the AHAS gene) or 1120 g ae / ha of 2,4-D DMA + 1680 g ae / ha of glyphosate (to confirm the presence of the Round Up Ready gene) in a tray sprinkler calibrated at 187 L / ha. The plants were classified 3 and 16 DAT. The spray data showed that AAD-12 (v1) can be stacked conventionally with a glyphosate tolerance gene (such as the Roundup CP4-EPSPS gene) or other genes for herbicide tolerance to provide an increased spectrum of herbicides that can be Apply safely to corn. Similarly, tolerance to imidazolinone + 2,4-D + glyphosate was observed in Fi plants and did not show a negative phenotype by molecular epilations or cross-stacked combinations of these multiple transgenesTABLE 17 Data demonstrating the spectrum of increased tolerance to the herbicide because it results from a stacking Fi of AAD-12 (v1) and BE1146RR (an elite endo-glyphosate tolerant plant is abbreviated AF) 8 10- Tolerance in the field of maize plants transformed with pDAB4 01 to herbicides 2,4-D, triclopir and fluroxypir Tolerance tests were carried out at field level in two events AAD-12 (v1) pDAB4101 (4101 ( 0) 003 R 003 AF and 4101 (0) 005 R001 AF) and a Roundup Ready control hybrid (RR) (2P782) in Fowler, Indiana and Wayside, Mississippi The seeds were sown with a sowing cone in rows separated by 1 meter in Wayside and separated by 70 centimeters in Fowler. The experimental design was a completely random block design with 3 replicas. Treatments with herbicide treatments were 2,4-D (dimethylamine salt) at 1120, 2240 and 4480 g ae / ha, triclopir at 840 g ae / ha, fluroxipir at 280 g ae / ha and an untreated control. The AAD-12 events (v1) contained the AHAS gene as a selection marker. The F2 maize events were segregating so that the AAD-12 plants (v1) were treated with imazethapir at 70 g ae / ha to remove the null plants. The herbicide treatments were applied when the corn reached the V6 stage using a backpack sprinkler with compressed air that administered 187 L / ha of vehicle volume at a pressure of 130-200 kpa. Classifications of visual lesions were taken at 7, 14 and 21 days after treatment. Root lesion classifications for clamping were taken at 28DAT on a scale of 0-10 with 0-1 being light fusion of the root for clamping, 1-3 being moderate swelling / extension and proliferation of the root of the root for subjection, 3-5 being moderate fusion of the root for subjection, 5-9 being severe fusion of the root for subjection and malformation and 10 being the total inhibition of the roots for subjection. The response of the event AAD-12 (v1) to 2,4-D, triclopir, and fluroxipir at 14 days after treatment are shown in table 18. Harvest injury was more severe at 14 DAT. Control corn RR (2P782) was severely injured (44% at 14 DAT) by 2,4-D at 4480 g ae / ha, which is 8 times (8X) the ratio of normal field use. The AAD-12 events (v1) demonstrated excellent tolerance to 2,4-D to 14 DAT with 0% injury at the 1, 2, and 4X ratios, respectively. Control corn (2P782) was severely injured (31% at 14 DAT) by the 2X ratio of triclopir (840 g ae / ha). The AAD-12 events (v1) demonstrated tolerance to the 2X relationships of triclopyr with an average of 3% injury at 14 DAT through both events. Fluroxipir at 280 g ae / ha caused 11% visual injury to wild type maize at 14 DAT. The AAD-12 events (v1) demonstrated increased tolerance with an average of 8% injury to 5 DAT. The applications of auxinic herbicides to maize in the V6 growth stage can cause malformation of the roots for subjection. Table 18 shows the severity of the root injury for fastening caused by 2,4-D, triclopir, and fluroxypyr. Triclopir at 840 g ae / ha caused the most severe fusion of the root for subjection and the malformation resulted in an average classification of the root lesion for subjection of 7 in the control type corn 2P782. Both maize AAD-12 (v1) events showed no root lesion for subjection from triclopyr treatment. Root lesion for attachment in 2P782 maize increased as the 2,4-D ratios increased. At 4480 g ae / ha of 2,4-D, the AAD-12 events showed no root injury for subjection; whereas, severe fusion of the root was observed for subjection and malformation in the hybrid 2P782. Fluroxipir caused only moderate root swelling for clamping and spreading in wild type maize with AAD-12 events (v1) that did not show root injury for clamping. This data clearly shows that AAD-12 (v1) transmits a high level of tolerance in corn to 2,4-D, triclopir and fluroxipir ratios that are far exceeded compared to those commercially used and that do not cause severe visual damage to the AAD-12 corn (v1) and to the root for subjection. TABLE 18 Visual injury of AAD-12 and wild-type maize events after foliar applications of 2,4-D, triclopir and fluroxypyr under field conditions % of visual injury to 14DAT RRelation AAD-12 AAD- 2P782 Treatment (g ae / ha) 4101 (0) 003.R.003.AF 124101 (0) 005.001.AF untreated control 0 0 0 0 2,4-D 1120 0 0 9 2,4-D 2240 0 1 20 2,4-D 4480 0 1 34 Fluroxipir 280 1 5 11 Triclopir 840 3 4 31 Dicamba 840 8 8 11 TABLE 19 Classifications of the root lesion for attachment by AAD-12 and wild type maize plants in response to 2,4-D, triclopir and fluroxypyr under field conditions Classification of the root lesion for subjection (scale 0-10) 28DAT Relationship (g Event AAD-12 Event AAD-12 NK603 type Treatment ae / ha) 4101 (0) 003. R.003.AF 4101 (0) 005.001.AF wild Not treated 0 0 0 0 2,4-D 1120 0 0 3 2,4-D 2240 0 0 5 2,4-D 4480 0 0 6 Fluroxipir 280 0 0 2 Triclopir 840 0 0 7 Dicamba 840 1 1 1 EXAMPLE 9 Detection of the protein from transformed plants via antibody 9.1 - Extraction of AAD-12 (v1) from plant leaves. Approximately 50 to 100 mg of leaf tissue were cut into small pieces (or 4 discs of sheets punched with a single hole) and placed in 2-ml Cluster tubes containing 2 stainless steel BB beds (4.5 mm; Daisy Co ., cat. # 145462-000). Five hundred microliters of plant pH regulator for extraction (PBS containing 0.05% Tween 20 and 1% bovine serum albumin) were added to each sample. The tubes were capped and secured in the Geno / Grinder (Model 2000-115, Certiprep, Metuchen, NJ) and shaken for 6 minutes with 1x adjustment at 500 rpm. The tubes were centrifuged at 5000x g for 10 minutes and the supernatant containing the soluble proteins for AAD-12 (v1) was analyzed using Western Blots and ELISA. 9. 2 - Enzyme-linked immunosorbent assay (ELISA). The test was carried out at room temperature unless it was established otherwise. One hundred micro-liters of purified anti-AAD-12 antibody (0.5 μg / ml) was used to cover a 96-well microtiter plate and incubated at 4 ° C for 16 hours. The plate was washed four times with pH buffer for washing (100 mM saline with phosphate buffered pH (PBS, pH 7.4) containing 0.05% Tween 20) using a plate washer, followed by blocking with 4% milk skimmed solution dissolved in PBS for 1 hour. After washing, 100 μL of standard AAD-12 of known concentrations or plant extracts from different samples were incubated in the wells. For the standard curve, purified AAD-12 was serially diluted 2 times from 52 to 0.813 ng / ml in triplicate. The plant extracts were diluted 5, 10, 20, and 40 times in PBS and analyzed in duplicate. After 1 hour of incubation, the plate was washed as mentioned above. One hundred micro-liters of anti-AAD-12 antibody conjugated to HRP (0.5 ug / ml) was incubated in each well for 1 hour before washing. One hundred micro-liters of the HRP substrate, 1-Step ™ Ultra TMB-ELISA (Pierce, Rockford, IL), was incubated in each well for 10 minutes before the reaction was stopped by the addition of 100 μL 0.4N H2S04 . The OD of each well was measured using a microplate reader at 450 nm. To determine the concentrations of AAD-12 (v1) in the plant extract, the DO value of the duplicates was averaged and extrapolated from the standard curve using Softmax® Pro ver. 4.0 (Molecular Devices). For comparison, each sample was normalized with its fresh weight and the percentage expression was calculated. 9. 3 - Western blot analysis. The plant extracts or AAD-12 standards (5 and 0.5 μg / ml) were incubated with pH regulator for Laemmli sample at 95 ° C for 10 minutes and separated electrically in an 8-16% gel of Tris. -Precast mold. The proteins were then transferred electrically onto a nitrocellulose membrane using a standard protocol. After blockage in 4% skimmed milk in PBS, the AAD-12 protein (v1) was detected by anti-AAD-12 antiserum followed by goat anti-rabbit / HRP conjugates. The detected protein was visualized by the chemiluminescent substrate ECL Western Analysis Reagent (Amersham, NJ).

EXAMPLE 10 Transformation of tobacco The transformation of tobacco with Agrobacterium tumefaciens was carried out by a method similar, but not identical, to published methods (Horsch et al., 1988). To provide source tissue for transformation, tobacco seed (Nicotiana tabacum cv. KY160) was sterilized on the surface and seeded on the surface of the TOB medium, which is a hormone-free Murashige and Skoog medium (Murashige and Skoog). , 1962) solidified with agar. The plants were grown for 6-8 weeks in a fourth incubator illuminated at 28-30X and the collected leaves were sterilized for use in the transformation protocol. The pieces of approximately one square centimeter were cut sterile from the leaves, excluding the middle rib. The cultures of the Agrobacterium strains (EHA101S containing pDAB3278, aka pDAS1580, AAD-12 (v1) + PAT), were grown overnight in a flask on a shaker set at 250 rpm at 28 ° C, concentrated in a centrifuge and resuspended in sterile salts of Murashige & Skoog, and they were adjusted to a final optical density of 0.5 to 600 nm. The leaf pieces were immersed in this bacterial suspension for approximately 30 seconds, then dried in a blot on sterile paper towels and placed with the front facing up in TOB + medium (Murashige and Skoog medium containing 1 mg / L of indole acetic acid and 2.5 mg / L benzyladenine) and incubated in the dark at 28 ° C. Two days later the leaf pieces were changed to TOB + medium containing 250 mg / L cefotaxime (Agri-Bio, North Miami, Florida) and 5 mg / L glufosinate ammonium (active ingredient in Basta, Bayer Crop Sciences) and incubated 28-30 ° C in the light. The leaf pieces were changed to freshly prepared TOB + medium with cefotaxime and Basta twice a week for the first two weeks and once a week thereafter.

Four to six weeks later the leaf pieces were treated with the bacteria, small plants that were generated from the transformed foci were removed from this tissue preparation and seeded in TOB medium containing 250 mg / L cefotaxime and 10 mg / L Enough in Phytatray ™ II containers (Sigma). These seedlings were grown in a fourth illuminated incubator. After 3 weeks, stem cuts were taken and re-rooted in the same medium. The plants were ready to be sent to the greenhouse after 2-3 additional weeks. The plants were changed to the greenhouse by washing the agar from the roots, transplanted into soil in 13.75 cm square pots, placing the pot inside a Ziploc® bag (SC Johnson &Son, Inc.), placing running water in the bottom of the bag, and placing the bag under indirect light in a greenhouse at 30 ° C for a week. After 3-7 days, the bag opened; the plants were fertilized and allowed to grow in the open bag until the plants were acclimated to the greenhouse, at which time the bag was removed. The plants were grown under ordinary warm greenhouse conditions (30 ° C, 16 hours of day, 8 hours of darkness, minimum of natural light + additional = 500 μE / m2s1). Before propagation, the T0 plants were sampled for DNA analysis to determine the number of copies of the insert. The PAT gene which was molecularly associated with AAD-12 (v1) was tested for convenience. The fresh tissue was placed inside tubes and lyophilized at 4 ° C for 2 days. After the tissue was completely dried, a bed of tungsten (Valenite) was placed in the tube and the samples were subjected to 1 minute of dry milling using a Kelco bed mill. The standard procedure was then performed for DNeasy DNA isolation (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was stained with Pico Green (Molecular Probes P7589) and read in the fluorometer (BioTek) with known standards to obtain the concentration in ng / μl. The DNA samples were diluted to 9 ng / μl and then denatured by incubation in a thermal cycler at 95 ° C for 10 minutes. The signal probe mixture was then prepared using the mixture provided with oligomers and MgCl2 (Third Wave Technologies). A 7.5 μl aliquot was placed in each well of the Invader assay plate followed by a 7.5 μl aliquot of the controls, standards, and 20 ng / μl of the unknown samples diluted. Each well was overloaded with 15 μl of mineral oil (Sigma). The plates were then incubated at 63 ° C for 1.5 hours and read on the fluorometer (Biotek). The calculation of the% signal compared to the background for the white probe divided by the% signal compared to the internal background control probe will calculate the ratio. The relationship of the known copy standards developed and validated with the southern blot analysis was used to identify the estimated copies of the unknown events. All events were also tested for the presence of the AAD-12 (v1) gene by PCR using the same samples of extracted DNA. A total of 100 ng of total DNA was used as template. 20 mM of each primer was used with the Takara Ex Taq PCR polymerase kit. The primers for PCR of the plant transcription unit (PTU) AAD-12 were (SdpacodF: ATGGCTCA TGCTGCCCTCAGCC) (SEQ ID NO: 12) and (SdpacodR: CGGGCAGGCCTAACTCCACC AA) (SEQ ID NO: 13). The PCR reaction was carried out in the Geneamp 9700 thermocycler (Applied Biosystems), by submitting the samples at 94 ° C for 3 minutes and 35 cycles of 94 ° C for 30 seconds, 64 ° C for 30 seconds, and 72 ° C C for 1 minute and 45 seconds followed by 72 ° C for 10 minutes. The PCR products were analyzed by electrophoresis in 1% agarose gel stained with EtBr. Four to 12 clonal lineages were regenerated from each of the 18 positive events by PCR with 1-3 copies of the PAT gene (and presumably AAD-12 (v1) since these genes are physically associated) and moved towards the greenhouse. . 1 Tolerance to postemergence herbicide in tobacco Tn transformed with AAD-12 (v1) The T0 plants from each of the 19 events were tested with a wide range of 2,4-D, triclopir, or fluroxipir sprayed on plants that they were 7.5-10 centimeters tall. Spray applications were performed as previously described using a tray sprinkler at a spray volume of 187 L / ha. The salt of 2,4-D dimethylamine (Riverside Corp) was applied at 0, 140, 560, or 2240 g ae / ha to the representative clones from each of the events mixed in ionized water. Similarly, Fluroxipir was applied at 35, 140, or 560 g ae / ha. Triclopir was applied at 70, 280, or 1120 g ae / ha. Each treatment was repeated 1-3 times. The lesion classifications were recorded at 3 and 14 DAT. Each event evaluated was more tolerant to 2,4-D than the non-transformed control line KY160. In several events, there was a certain initial epinastia related to the auxinic herbicide at a dose of 560 g ae / ha at 2,4-D or less. Some events did not present injuries to 2,4-D applied to 2240 g ae / ha (equivalent to 4X of the relation in field). In total, AAD-12 events (v1) were more sensitive to fluroxipyr, followed by triclopir, and were less affected by 2,4-D. The quality of the events with respect to the magnitude of the resistance was discerned using the responses of the T0 plants at 560 g ae / ha fluroxypyr. Events were categorized as "low" (> 40% injury to 14 DAT), "medium" (20-40% injury), "high" (<20% injury). Some events were inconsistent in the response between replicates and were considered "variables." TABLE 20 # of Tolerance Relative to # of plant ID copies PTU PCR Total PTU and total PTU and Herbicide8 Tube PAT AAD-12 low 2 1 copy 1 1580 [1] -001 6 + Not evaluated 2 1580 [1 002 8 + Not evaluated 3 1580 [1 003 10 + Not evaluated 4 1580 [1] -004 1 + • • High 5 1580 [1] -005 2 + • Variable 6 1580 [1} -006 6 + Not evaluated 7 1580 [1 007 4 + Not evaluated 8 1580 [1J-008 3 + Variable 9 1580 | 1J-009 4 + Not evaluated 10 1580 [1} -010 8 + Not evaluated 11 1580 [1J-011 3 + High 12 1580 [1] -012 12 + Not evaluated 13 1580 [1 > 013 13 + Not evaluated 14 1580 [1) -014 4 + Not evaluated 1580 [1 015 2 + High 16 1580 [1 016 1? + * High 17 1580 [1 017 3 + High 18 1580 | 1 018 1 + • Variable 19 1580 [1 > 019 1 + * Variable 20 1580 [1J-020 1 + * Not evaluated 21 1580 [1] -021 1 + • Not evaluated 22 1580 [1) -022 3 + Variable 23 1580 [1J-023 1 + • Variable 24 1580 | 1J-024 1 + »Variable 25 1580 [1) -025 5 + Not evaluated 26 1580 [1) -026 3 + Variable 27 1580 [1] -027 3 + Low 28 1580 [1 J-028 4 + Not evaluated 29 1580 [1} -029 3 + Variable 30 1580 [1) -030 1 + • * High 31 1580 [1] -031 1 + * • High 32 1580 [1 032 2 + • High ^ Distinguish the performance of herbicide tolerance from events that required relative tolerance assessment when treated with 560 g ae / ha fluroxypir where tolerance was variable across events. . 2 Verification of a high tolerance to 2,4-D in tobacco Ti. Two to four T0 individuals that survived the high 2,4-D and fluroxipyr ratios were saved from each event and allowed to self-fertilize in the greenhouse to produce T-i seed. The Ti seed was stratified, and planted in a selection tray like those of Arabidopsis (example 7.4), followed by the selective removal of the non-transformed nulls in this segregating population with 560 g ai / ha glufosinate (selection of the PAT gene) . The survivors were transformed into individual 7.5 cm pots in the greenhouse. These lines provided high levels of resistance to 2,4-D in the T0 generation. An improved response consistency was anticipated in Ti plants that did not come directly from tissue culture. These plants were compared against the wild type tobacco plant KY160. All the plants were sprinkled with a sprinkler solution in tray adjusted to 187 L / ha. The plants were sprayed from an interval of 140 - 2240 g ae / ha salt of 2, 4-D dimethylamine (DMA), 70-1120 g ae / ha triclopir or 35-560 g ae / ha fluroxipir. All applications were formulated in water. Each treatment was repeated 2-4 times. Plants were evaluated 3 and 14 days after treatment. The plants were assigned with a classification of the lesion with respect to dwarfism, chlorosis, and necrosis. The Ti generation is segregating, so that some variable responses are expected due to the difference in zygosity.

No lesion was observed at the 4X field ratio (2240 g ae / ha) for 2,4-D or below this ratio. Some lesions were observed with treatments with triclopir in an event line, but the greatest lesion was observed with fluroxipir. The fluroxipyr lesion was brief and the novel growth in an event was almost indistinguishable from the control not treated by 14 DAT (Table 21). It is important to note that untransformed tobacco is excessively sensitive to fluroxypir. These results indicate that a tolerance to the commercial level of 2,4-D can be provided by AAD-12 (v1), even in a dicotyledonous crop very sensitive to auxin such as tobacco. These results also show that resistance can be imparted to the herbicides of pyridyloxyacetic acid, triclopyr and fluroxypyr. Having the ability to prescribe treatments in a crop tolerant to the herbicide protected by AAD-12 with various active ingredients that have variable spectra of weed control is extremely useful for farmers.

TABLE 21 Cross-tolerance evaluation of the response of the plants of Tobacco Ti AAD-12 (v1) to various phenoxy and pyridyloxy auxin herbicides 1580 (1) -018 KY160 - 1580 (1) -004 (high tolerance type tolerance in the wild generation T0) generation T0) Herbicide injury% average of replicates of 14 DAT 140 g ae / ha 2,4-D DMA 45 0 0 560 g ae / ha 2,4-D DMA 60 0 0 2240 g ae / ha 2,4-D DMA 73 0 0 70 g ae / ha triclopir 40 0 5 280 g ae / ha triclopir 65 0 5 1 120 g ae / ha triclopir 80 0 8 35 g ae / ha fluroxypir 85 0 8 140 g ae / ha fluroxipir 93 0 10 560 g ae / ha fluroxipir 100 3 18 . 3 AAD-12 inheritance (v1) in tobacco A test was also carried out on 100 progeny plants in seven Ti lines of the AAD-12 lines (v1). The seeds were stratified, sowed, and transplanted with respect to the procedure above mentioned with the exception that the null plants were not removed by selection with Liberty. All the plants were then sprinkled with 560 g ae / ha 2,4-D DMA as previously described. After 14 DAT, it They counted resistant and sensitive plants. Five of seven lines evaluated they segregated as a particular locus, dominant Mendelian trait (3R: 1 S) as determined by the analysis of Chi square. AAD-12 is inherited as a strong gene for resistance to aryloxyalkanoate auxin in multiple species. . 4 - Tolerance in the field of tobacco plants pDAS1580 to the herbicides 2,4-D, dichloprop, triclopir and fluroxypir. The tests were carried out with tolerance at the field level in three lines AAD-12 (v1) (events pDAS1580- [1] -018.001, pDAS1580- [1] -004.001 and pDAS1580- [1] -020.016) and a line type wild (KY160) in field stations in Indiana and Mississippi. Tobacco transplants were grown in the greenhouse by sowing the Ti seed in 72 well transplant wells (Hummert International) that contained Metro 360 medium in accordance with the growth conditions previously indicated. The null plants were removed selectively by selection with Liberty as previously described. The plants for transplant were transported to the field stations that were sown at 35 or 60 centimeters apart using industrial plant seeders. Drip irrigation at the Mississippi site and top irrigation at the Indiana site were used to keep the plants growing vigorously. The experimental design was a divided pot design with 4 replicas. The main pot was treated with herbicide and the sub-pot was the tobacco line. The herbicide treatments were 2,4-D (dimethylamine salt) at 280, 560, 1120, 2240 and 4480 g ae / ha, triclopyr at 840 g ae / ha, fluroxypir at 280 g ae / ha and a control not treaty. The pots were of a row for 750-900 cm. The herbicide treatments were applied 3-4 weeks after transplanting using a backpack type sprinkler with compressed air that administered 187 Uha of 130-200 kPa pressure vehicle volume. The visual classification of the lesion was taken, inhibition of growth, and epinastia at 7, 14 and 21 days after treatment. The response of the event AAD-12 (v1) to 2,4-D, triclopir, and fluroxypyr are shown in table 22. The line of untransformed tobacco was severely injured (63% at 14 DAT) by 2,4- D at 560 g ae / ha which was considered the application ratio in 1X field. The AAD-12 (v1) lines demonstrated an excellent tolerance to 2,4-D to 14 DAT with an average lesion of 1, 4, and 4% of lesion observed at the 2, 4, and 8X ratios, respectively. The untransformed tobacco line was severely injured (53% at 14 DAT) by the 2X ratio of triclopir (840 g ae / ha); whereas, the AAD-12 lines (v1) demonstrated a tolerance with an average of 5% of injury to 14 DAT across the three lines. Fluroxipir at 280 g ae / ha caused a severe injury (99%) to the non-transformed line at 14 DAT. The AAD-12 lines (v1) demonstrated an increased tolerance with an average of 11% of injury at 14 DAT. These results indicate that the lines of the transformed event AAD-12 (v1) exhibits a high level of tolerance to 2,4-D, triclopyr and fluroxypyr at multiple commercial use ratios that were lethal or that caused severe epinotic malformations to untransformed tobacco under representative field conditions.

TABLE 22 Response of tobacco plants AAD-12 (v1) to 2,4-D, triclopir, and fluroxypyr under field conditions Herbicide treatment Average% injury between 14 DAT locations Ingredient Type pDAS1580- pDAS1580- pDAS1580- active Wild ratio [1 J-004.001 [1 J-020.016 [1J-018.001 2,4-D 280 GM AE / HA 48 0 0 0 2,4-D 560 GM AE / HA 63 0 0 2 2,4-D 1120 GM AE / HA 78 1 1 2 2,4-D 2240 GM AE / HA 87 4 4 4 2,4-D 4480 GM AE / HA 92 4 4 4 Triclopir 840 GM AE / HA 53 5 5 4 Fluroxipir 280 GM AE / HA 99 11 11 12 . 5 Protection of AAD-12 (v1) against high ratios of 2,4-D The results showing the protection of AAD-12 (v1) against high ratios of 2,4-D DMA in the greenhouse are shown in Table 23. Ti AAD-12 plants (v1) from an event are segregated 3R: 1 S when selected with 560 g ai / ha Liberty using the same protocol as previously described. The seed Ti AAD-1 (v3) was also seeded for the controls of transformed tobacco (see PCT / US2005 / 014737). KY160 not transformed served as the sensitive control. The plants were sprinkled using a tray sprinkler set at 187 L / ha at 140, 560, 2240, 8960, and 35840 g ae / ha at 2,4-D DMA and classified as 3 and 14 DAT. Both tobacco plants were effectively protected with AAD-12 (v1) and AAD-1 (v3) against the injury by 2,4-D at doses up to 4X of the commercial use ratios. AAD-12 (v1), however, clearly demonstrates a marked advantage compared to AAD-1 (v3) by protecting up to 64X of standard field relationships.

TABLE 23 The results demonstrate protection provided by AAD-12 (v1) and AAD-1 (v3) against high 2,4-D ratios . 6 Stacking of AAD-12 to increase the spectrum of the herbicide The homozygous plants AAD-12 (v1) (pDAS1580) and AAD-1 (v3) (PDAB721) (see PCT / US2005 / 014737 for the latter) were crossed reciprocally and the Fi seed was collected. The Fi seed from two reciprocal crosses of each gene were stratified and 4 treated replicas of each cross were treated under the same spray regime as was used for the other test with one of the following treatments: 70, 140, 280 g / ha fluroxipir (selective for the AAD-12 gene (v1)); 280, 560, 1120 g ae / ha R-dichloroprop (selective for the AAD-7 (v3) gene) o 560, 1120, 2240 g ae / ha 2,4-D DMA (to confirm tolerance to 2.4 -D). The homozygous T2 plants of each gene were also seeded for use as controls. The plants were classified to 3 and 14 DAT. Spray results are shown in Table 24. The results confirm that AAD-12 (v1) can be successfully stacked with AAD-1 (v3), thus increasing the spectrum of herbicides that can be applied to the crop of interest (phenoxyacetic acids + phenoxypropionic acids against penoxyacetic acids + pyridyloxyacetic acids for AAD-1 and AAD-12, respectively). The complementary nature of the cross-resistance patterns to the herbicide allows the convenient use of these two genes as complementary markers and stacked markers selected in the field. In crops where tolerance to a particular gene may be marginal, one skilled in the art recognizes that one can increase tolerance by stacking a second gene for tolerance for the same herbicide. As can be done using the htesame gene with the same promoter or with a different promoter; however, as observed in the present invention, the stacking and tracing of two complementary features can be facilitated by the cross protection that distinguishes phenoxypropionic acids [from AAD-1 (v3)] or piydyloxyacetic acids [AAD- 12 i) TABLE 24 Comparison of cross tolerance to auxinic herbicide of plants T? AAD-12 (v1) (pDAS1580) and AAD-1 (v3) (pDAB721) compared to crosses AAD-12 x AAD-1 F1 and with the wild type EXAMPLE 11 Transformation of soybeans Soybean improvement via gene transfer techniques has been achieved for traits such as herbicide tolerance (Padgette et al, 1995), amino acid modification (Falco et al, 1995), and insect resistance (Parrott et al. 1994) The introduction of foreign traits within crop species requires methods that will allow the routine production of transgenic lines using selection marker sequences, which contain simple inserts. Transgenes must be inherited as a particular functional locus in order to simplify the cross The administration of external genes has been reported in soybeans grown by microprojectile bombardment of the zygotic embryonic axes (McCabe et al, 1988) or somatic emboligenic cultures (Finer and McMullen, 1991), and Agrobactenum-mediated transformation of plant explants. cotyledons (Hinchee et al, 1988) or zygotic embryos (Chee et al, 1989) Derived transformants From Agrobacterium-mediated transformations, they tend to possess simple inserts with low copy numbers (Birch, 1991). There are benefits and disadvantages associated with each of the three target tissues investigated for gene transfer within the soybean zygotic embryonic axis. (Chee et al, 1989, McCabe et al, 1988), cotyledon (Hinchee et al, 1988) and somatic embryo cultures (Finer and McMullen, 1991) The latter has been investigated extensively as a white tissue for direct transfer of The embryo cultures tend to be quite prolific and can be maintained for a prolonged period. However, the sterility and chromosomal aberrations of the primary transformants have been associated with the age of the embryonic suspensions (Singh et al, 1998) and so both the continuous start of new crops seems to be necessary for soybean processing systems that use this tissue. This system requires a high level of 2,4-D, at a concentration of 40 mg / L, to initiate embryogenic calluses and this presents a fundamental problem in the use of the AAD-12 gene (v1) since the transformed locus does not it could be further developed with 2,4-D in the middle. Thus, the meristem-based transformation is ideal for the development of a plant resistant to 2,4-D using AAD-12 (v1). 1 1.1 Gateway Cloning of binary constructs The coding sequence AAD-12 (v1) was cloned into five different Gateway donor vectors containing different plant promoters. The resulting AAD-12 (v1) plant expression cassettes were subsequently cloned into a binary target Gateway vector via the LR Clone reaction (Invitrogen Corporation, Carlsbad Ca, Cat # 1 1791 -019). A Ncol-Sacl fragment containing the coding sequence AAD-12 (v1) was digested from DASPIC012 and ligated into the corresponding Ncol-Sacl restriction sites within the following Gateway donor vectors: pDAB3912 (attLI // CsVMV promoter // AtuORF23 3'UTR // attL2); pDAB3916 (attLI // AtUbil Or promoter // AtuORF23 3'UTR // attL2); pDAB4458 (attLI // AtUbi3 promoter // AtuORF23 3'UTR // attL2); pDAB4459 (attLI // ZmUbil promoter // AtuORF23 3'UTR // attL2); and pDAB4460 (attLI // AtAct2 promoter // AtuORF23 3'UTR // attL2). The resulting constructs containing the following plant expression cassettes were designated: pDAB4463 (attLI // CsVMV promoter // AAD-12 (v1) II AtuORF23 3'UTR // attL2); pDAB4467 (attLI // AtUbil Or promoter // AAD-12 (v1) // AtuORF23 3'UTR // attL2); pDAB4471 (attLI // AtUbi3 promoter // AAD-12 (v1) II AtuORF23 3'UTR // attL2); pDAB4475 (attLI // ZmUbil promoter // AAD-12 (v1) II AtuORF23 3'UTR // attL2); and pDAB4479 (attLI // AtAct2 promoter // AAD-12 (v1) II AtuORF23 3'UTR // attL2). These constructs were confirmed via restriction enzyme digestion and sequencing. The plant expression cassettes were recombined into the target binary Gateway vector pDAB4484 (RB7 MARv3 // attR1 - ccdB - resistance to chloramphenicol - attR2 // CsVMV promoter // PATvß // AtuORFI 3'UTR) via the Gateway LR Clonasa reaction . The Gateway technology uses site-specific recombination based on lambda phage instead of restriction endonuclease and ligase to insert a gene of interest into an expression vector. Invitrogen Corporation, Gateway Technology: A Universal Technology to Clone DNA Sequences for Functional Analysis and Expression in Multiple Systems, Technical Manuel, Catalogs # 12535-019 and 12535-027, Gateway Technology Version E, 9/22/2003, # 25-022 . The sequences for DNA recombination (attL, and attR,) and the enzymatic mixture of LR Clonase allow the formation of any DNA fragment flanked by a recombination site to be transferred into any vector containing a corresponding site. The site of the attLI donor vector corresponds to attR1 of the binary vector. Similarly, the site of the donor vector attL2 corresponds to attR2 of the binary vector. Using Gateway technology, the in-plant expression cassette (from the donor vector) that is flanked by the attL sites can recombine within the attR sites of the binary vector. The resulting constructs containing the following plant expression cassettes were marked as: pDAB4464 (RB7 MARv3 // CsVMV promoter // AAD-12 (v1) II AtuORF23 3'UTR // CsVMV promoter // PATvß II AtuORFI 3'UTR); pDAB4468 (RB7 MARv3 // Promoter Atubil // AAD-12 (v1) II AtuORF23 3'UTR // CsVMV promoter // PATvß II AtuORFI 3'UTR); pDAB4472 (RB7 MARv3 // AtUbi3 promoter // AAD-12 (v1) II AtuORF23 3'UTR // CsVMV promoter // PATvß II AtuORFI 3'UTR); pDAB4476 (RB7 MARv3 // ZmUbil promoter // AAD-12 (v1) II AtuORF23 3'UTR // CsVMV promoter // PATvß II AtuORFI 3'UTR); and pDAB4480 (RB7 MARv3 // AtAct2 promoter // AAD-12 (v1) II AtuORF23 3'UTR // CsVMV promoter // PATvß II AtuORFI 3'UTR) (see Table 8). These constructs were confirmed via restriction enzyme digestion and sequencing. 11. 2 Transformation method 1: transformation of the cotyledonary node of soybeans mediated by Aqrobacterium tumefaciens. The first reports of transformation of soybeans directed by meristematic cells in the region of the cotyledonary node (Hinchee et al., 1988) and the multiplication of the stem from apical meristems (McCabe et al., 1988). In the method of a cotyledonary node based on A. tumefaciens, the preparation of the explant and the composition of the culture medium stimulate the proliferation of auxiliary meristems in the node (Hinchee et al., 1988). It is not yet clear if a truly de-differentiated but totipotential callus culture is initiated by these treatments. The recovery of the multiple clones of a transformation event from a particular explant and the rare recovery of the chimeric plants (Clemente et al., 2000; Olhoft et al., 2003) indicates a unique cellular origin followed by multiplication of the transgenic cell to produce either a transgenic meristem culture in proliferation or a uniformly transformed stem that performs further multiplication of the rod. The method of multiplication of the soybean rod, originally based on microprojectile bombardment (McCabe et al., 1988) and, more recently, adapted for Agrobacterium-mediated transformation (Martinell et al., 2002), apparently does not perform the same level or type of dedifferentiation as the cotyledonary node method because the system is based on the successful identification of the germline chimeras. The range of genotypes that have been transformed via the cotyledonary node method based on Agrobacterium is growing steadily (Olhoft and Somers, 2001). This method of de novo meristem and rod multiplication is less limited to specific genotypes. Also, this is a non-2,4-D based protocol that could be ideal for the 2,4-D selection system. Therefore, the method of cotyledonary node may be the method of choice to develop soybean cultivars resistant to 2,4-D Although this method was described as early as 1988 (Hinchee et al, 1988), only very recently it has been optimized for routine transformation at high frequency of the various genotypes of soybeans (Zhang et al, 1999, Zeng et al, 2004) 11 2 1 - Production of plant transformation of AAD-12 tolerant phenotypes (v1) The explants derived from "Mavepck" seed and the protocol of transformation of cot-node mediated by Agrobacterium were used to produce transgenic plants AAD-12 (v1) ) 11 2 2- Preparation of Agrobacterium and inoculation The Agrobacterium strain EHA101 (Hood et al 1986), which carried each of the five binary vectors pDAB (Table 8) was used to initiate the transformation Each binary vector contains the AAD-12 gene (v1) and a gene cassette for plant selection (PAT) within the T-DNA region. Each gene is directed by the promoters listed in Table 8 and these plasmids were mobilized within the Agrobacterium strain EHA101 by electroporation. Selected colonies were then analyzed for gene integration prior to treatment with Agrobacterium from the soybean explants. Mavepck seeds were used in all transformation experiments and seeds were obtained from University of Missouri, Columbia, MO transformation of soybeans (Glycine max) mediated by Agrobacterium using the PAT gene as a selection marker coupled with the glufosinate herbicide as a selection agent was carried out followed by a modified procedure of Zeng et al. (2004). Seeds were germinated on basal B5 medium (Gamborg et al., 1968) solidified with 3 g / L Phytagel (Sigma-Aldrich, St. Louis, Mo.); 1-cysteine was added to the co-culture medium at 400 mg / L and the co-culture lasted 5 days (Olhoft and Somers 2001); the medium for start of the rod, elongation of the rod, and for root formation was supplemented with 50 mg / L of cefotaxime, 50 mg / L timentin, 50 mg / L vancomycin, and solidified with 3 g / L Phytagel. The selected rods were then transferred to the root formation medium. The optimal selection scheme was the use of glufosinate at 8 mg / L through the start stages of the first and second shanks in the medium and 3-4 mg / L during the elongation of the shank in the medium. Upon transfer of the elongated rods (3-5 cm) to the medium for root formation, the excised end of the internodes was immersed in 1 mg / L of indole 3-butyric acid for 1-3 minutes to promote root formation (Khan et al., 1994). Roots of the rods were placed in 25 * 100 mm glass culture tubes containing for root formation and then transferred to a soil mix for acclimatization of the seedlings in Metro-mix 200 (Hummert International, Earth City, Mo.) in open Magenta boxes in Convirons. Glufosinate, the active ingredient of the Liberty herbicide (Bayer Crop Science), was used for selection during the start and elongation of the rod. Seedlings with root formation were acclimatized in open Magenta boxes for several weeks before they were selected and transferred to the greenhouse for acclimation and further establishment. 1 1 .2.3 - Assay of putatively transformed seedlings, and analysis of To plants established in the greenhouse. The terminal leaflets selected from these seedlings were painted with 50 mg / L of glufosinate twice at weekly intervals to observe the selection results for putative transformants. The selected seedlings were then transferred to the greenhouse and after acclimation the leaves were painted with glufosinate again to confirm the state of tolerance of these seedlings in the GH and were considered as putative transformants. The plants that were transferred to the greenhouse can be tested for the presence of an active PAT gene additionally non-destructively by painting a section of the leaves of primary To transformant, or progeny thereof, with a glufosinate solution [0.05- 2% v / v Liberty herbicide, preferably 0.25-1.0% (v / v), = 500-2000 ppm glufosinate, Bayer Crop Science]. Depending on the concentration used, the evaluation of the glufosinate lesion can be performed 1-7 days after treatment. Plants can also be evaluated for tolerance to 2,4-D non-destructively by the selective application of a 2,4-D solution in water (0.25-1% v / v of a commercial salt formulation of dimethylamine 2). , 4-D, preferably 0.5% v / v = 2280 ppm 2,4-D ae) to the terminal leaflet of the trifoliate leaf that has recently expanded one or two, preferably two, nodes below the younger emergent trifoliate leaf . This test allows the evaluation of plants sensitive to 2,4-D 6 hours several days after application by the assessment of leaf shake or rotation > 90 degrees from the plane of the adjacent leaflets. Plants that tolerate 2,4-D will not respond to 2,4-D. The T0 plants will be able to self-fertilize in the greenhouse to give rise to Ti seeds. The Ti plants (and to a sufficient degree the clones of the T0 plant produced) will be sprayed with a range of herbicide doses to determine the level of protection of the herbicide produced by the genes AAD-12 (v1) and PAT in the bean of transgenic soy. The 2,4-D ratios used in the T0 plants typically will comprise one or two selection ratios in the range of 100-1120 g ae / ha using a tray sprinkler as previously described. The Ti plants will be treated with a larger herbicide dose that has a range of 50-3200 g ae / h to 2,4-D. Similarly, the T0 and Ti plants can be selected for glufosinate resistance by post-emergence treatment with 200-800 and 50-3200 g ae / ha glufosinate, respectively. Resistance to glyphosate (in plants transformed with constructions containing EPSPS) or another gene for tolerance to glyphosate can be evaluated in the Ti generation by post-emergence glyphosate applications with a dose range of 280-2240 g ae / ha glyphosate. The analysis of the expression of the protein will be presented as described below. Individual T0 plants were evaluated for the presence of the coding region of the gene of interest (AAD-12 (vi) or PAT vβ) and the number of copies. The determination of the inheritance of AAD-12 (v1) will be made using the segregation of the progeny Ti and T2 with respect to tolerance to the herbicide as described in the previous examples. A subpopulation of the initial transformants was evaluated in the T0 generation in accordance with the aforementioned methods. Any plant that confirmed having the AAD-12 coding region (v1), regardless of the promoter that directed the gene did not respond to the leaf paint with 2,4-D while the wild-type Maverick soybeans did so ( box of section 11.2.3). The plants transformed only with PAT responded the same as the wild type plants to the paint applications of 2,4-D in sheet 2, 4-D was applied to a subpopulation of plants that were similar in size to wild-type control plants with either 560 or 1 120 g to 2,4-D. All the plants containing AAD-12 (v1) were evidently resistant to the application of the herbicide against wild-type Maverick soybeans. A slight level of damage was observed (2 DAT) for two plants AAD-12 (v1), however, the lesion was temporary and no lesion was observed at 7 DAT. The wild-type control plants were severely injured 7-14 DAT at 560 g ae / ha at 2,4-D and removed at 1120 g ae / ha.

These data are consistent with the fact that AAD-12 (v1) can impart a high tolerance (> 2X compared to field relationships) to a sensitive crop similar to soybeans. The selected plants were then sampled for molecular and biochemical analysis for confirmation of the integration of the AAD12 (VT) genes, number of copies, and their levels of gene expression as described below and reported in table 25.

TABLE 25 CD ro CD 11. 2.4- Molecular analysis: soybean 11.2.4.1- Isolation and quantification of DNA harvested from tissue. The fresh tissue was placed inside tubes and lyophilized at 4 ° C for 2 days. After the tissue was completely dried, a bed of tungsten (Valenite) was placed in the tube and the samples were subjected to 1 minute of dry milling using a Kelco bed mill. Then the standard DNeasy DNA isolation procedure was followed (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and read in the fluorometer (BioTek) with known standards to obtain the concentration in ng / μL. 11. 2.4.2- Polymerase Chain Reaction. A total of 100 ng of total DNA was used as the template. 20 mM of each primer was used with the Takara Ex Taq PCR polymerase kit (Mirus TAKRR001A). The primers for AAD-12 (v1) PTU are (forward -ATAATGCCAGC CTGTTAAACGCC) (SEQ ID NO: 8) and (reverse side -CTCAAGCATATGAATGACCT CGA) (SEQ ID NO: 9). The PCR reaction was carried out in the Geneamp 9700 thermocycler (Applied Biosystems), by submitting the samples at 94 ° C for 3 minutes and 35 cycles of 94 ° C for 30 seconds, 63 ° C for 30 seconds, and 72 ° C C for 1 minute and 45 seconds followed by 72 ° C for 10 minutes. The primers for the PCR coding region of AAD-12 (v1) are (forward - ATGGCTCATGCTGCCCTCAGCC) (SEQ ID NO: 10) and (reverse side - CGGGC AGGCCTAACTCCACCAA) (SEQ ID NO: 11). The PCR reaction was carried out in the Geneamp 9700 thermal cycler (Applied Biosystems), by submitting the samples at 94 ° C for 3 minutes and 35 cycles of 94 ° C for 30 seconds, 65 ° C for 30 seconds, and 72 ° C C for 1 minute and 45 seconds followed by 72 ° C for 10 minutes. The PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr. 11. 2.4.3- Southern blot analysis. The Southern blot analysis was carried out with total DNA obtained from the Qiagen DNeasy team. A total of 10 μg of genomic DNA underwent digestion overnight to obtain the integration data. After digestion throughout the night an aliquot of -100 ng was processed in a 1% gel to ensure complete digestion. After ensuring this, the samples were processed in a large 0.85% agarose gel overnight at 40 volts. The gel was then denatured in 0.2 M NaOH, 0.6 M NaCl for 30 minutes. Subsequently, the gel was neutralized in 0.5 M Tris HCl, 1.5 M NaCl pH 7.5 for 30 minutes. A gel instrument containing 20x SSC was adjusted until a gravity transfer of the gel to nylon membrane (Millipore INYC00010) was achieved overnight. After overnight transfer the membrane was then subjected to UV light via a crosslinker (Stratagene UV stratalinker 1800) at 1200 X100 microjoules. The membrane was then washed in 0.1% SDS, 0.1 SSC for 45 minutes. After washing for 45 minutes, the membrane was baked for 3 hours at 80 ° C and then stored at 4 ° C until hybridization. The fragment of the template for hybridization was prepared using the aforementioned PCR coding region using the plasmid DNA. The product was processed on a 1% agarose gel and excised and then the gel was extracted using the Qiagen gel extraction procedure (28706). Subsequently the membrane was subjected to a step of pre-hybridization at 60 ° C for 1 hour in Perfect Hyb pH regulator (Sigma H7033). The Prime it RmT dCTP-labeling rxn procedure (Stratagene 300392) was used to develop the p32-based probe (Perkin Elmer). The probe was cleaned using the Probé Quant columns. G50 (Amersham 27-5335-01). Two million CPM accounts were used to hybridize the southern blots throughout the night. After overnight hybridization the blots were then subjected to two 20 minute washes at 65 ° C in 0.1% SDS, 0.1 SSC. The blots were then exposed to film overnight, incubating at -80 ° C. 11. 2.5 - Biochemical analyzes: soybeans 11.2.5.1 - Tissue sampling and extraction of the AAD-12 protein (v1) from soybean leaves. Approximately 50 to 100 mg of leaf tissue was sampled from the N-2 sheets that were painted with 2,4-D, but after 1 DAT. The N-2 terminal flake was removed and cut into small pieces or perforated sheet disks with 2 unique holes (~ 0.5 cm in diameter) and frozen in dry ice instantaneously. Further analysis of the protein (ELISA and Western analysis) was completed according to methods described in example 9. 11. 2.6 - Evaluation of the progeny Ti. The To plants will be left to self-fertilize to derive the T ^ families. The evaluation of the progeny (segregation analysis) will be tested using glufosinate at 560 g ai / ha as the selection agent applied to the growth stage V1-V2. Surviving plants will be further tested for tolerance to 2,4-D in one or more growth stages from V2-V6. The seeds will be produced through self-fertilization to allow the wider evaluation of a herbicide on transgenic soybeans. The transgenic Maverick AAD-12 (v1) soybeans plants have been generated through a system of transformation of cot-node mediated by Agrobacterium. The T0 plants obtained tolerated up to 2X levels of 2,4-D for field applications and fertile seeds were developed. The frequency of transgenic fertile soybean plants was 5.9%. The integration of the AAD1-12 (v1) gene into the soybean genome was confirmed by Southern blot analysis. This analysis indicated that the majority of the transgenic plants contained a low number of copies. Plants selected with antibodies to AAD-12 (v1) were found to be ELISA positive and the appropriate band in Western analysis. 11. 3 Transformation Method 2: Transformation mediated by aerosol beam of soy bean embryogenic callus tissue. Soy bean embryogenic callus tissue culture and subsequent formation of the bundle can be achieved as described in the U.S. Patent. No. 6,809,232 (Held et al.) To create transformants using one or more constructions in table 8. 11. 4 Transformation method 3. Soybean biolistic bombardment This can be achieved using the meristem of embryonic axes derived from mature seed (McCabe et al. (1988)). After establishing biolistic bombardment methods, one can expect the recovery of the transformed soybean plants. Once the plants have been regenerated, the evaluation of the events could be presented as described in example 11.2. 11. 5 Transformation method 4. Transformation mediated by Whiskers. Whisker preparation and whisker processing can be anticipated in accordance with the methods previously described by Terakawa et al. (2005)). After establishing biolistic bombardment methods, one can expect the recovery of the transformed soybean plants. Once the plants have been regenerated, the evaluation of the events could be presented as described in example 11.2. Maverick seeds were sterilized on the surface with 70% ethanol for 1 minute followed by immersion in 1% sodium hypochlorite for 20 minutes and then rinsed three times in sterile distilled water. The seeds were soaked in distilled water for 18-20 hours. The embryonic axes were excised from the seeds, and the apical meristems were exposed by removing the primary leaves. The embryonic axes were placed in the medium for bombardment [BM: MS (Murashige and Skoog 1962) medium of basal salts, 3% sucrose and 0.8% phytagel Sigma, pH 5.7] with the apical region directed upwards in dishes for culture 5 cm containing 12 ml of culture medium. 11. 6 Transformation method 5. Transformation mediated by bombardment of particles for embryonic callus tissue can be optimized according to previous methods (Khalafalla et al., 2005; El-Shemy et al., 2004, 2006). The regenerated plants can also be evaluated in accordance with example 11.2.

EXAMPLE 12 AAD-12 (v1) in cotton 12. 1 - Protocol of transformation into cotton. Cotton seeds (genotype Co310) were sterilized on the surface with 95% ethanol for 1 minute, rinsed, sterilized with 50% commercial bleach for twenty minutes, and then rinsed 3 times with sterile distilled water before being germinated in medium G-media (table 26) in Magenta GA-7 containers and kept under a high light intensity of 40-60 μE / m2, with the photoperiod established at 16 hours of light and 8 hours of darkness at 28 ° C . Tables of cotyledon segments (~5 mm) were isolated from 7-10 day old seedlings in liquid medium M (Table 26) in Petri dishes (Nunc, # of article 0875728). The cut segments were treated with a solution of Agrobacterium (for 30 minutes) then transferred to semi-solid M medium (Table 26) and co-culture was carried out for 2-3 days. After co-culture, the segments were transferred to MG medium (Table 26). Carbenicillin is the antibiotic used to eliminate Agrobacterium and glufosinate-ammonium is the selection agent that could allow the growth of only those cells that contain the transferred gene.

Preparation of Aqrobacterium. One 35 ml inoculum of medium Y (table 26) (containing streptomycin (storage solution 100 mg / ml) and erythromycin (storage solution 100 mg / ml)), with a loop of bacteria to grow overnight in the laboratory. dark at 28 ° C, while stirring at 150 rpm. The next day, the Agrobacterium solution was poured into a sterile oakridge tube (Nalge-Nunc, 3139-0050), and centrifuged in Beckman J2-21 at 8,000 rpm for 5 minutes. The supernatant was poured and the concentrate was resuspended in 25 ml of liquid M (Table 26) and vortexed. An aliquot was placed inside a glass culture tube (Fisher, 14-961-27) for reading in Klett (Klett-Summerson, model 800-3). It was diluted to fresh suspension using liquid M medium in a Klett measuring reader of 108 colony forming units per ml with a total volume of 40 ml. After three weeks, the callus from the cotyledon segments was isolated and transferred to fresh MG medium. The callus was transferred for 3 weeks on MG medium. In a side-by-side comparison, the MG medium can be supplemented with dichlorprop (added to the medium at a concentration of 0.01 and 0.05 mg / L) to supplement for the degradation of 2,4-D, since dichlorprop is not a substrate for the enzyme AAD-12, however, dichlorprop is more active in cotton than in 2,4-D. In a separate comparison, the segments that were seeded on MG medium that did not contain growth regulator compared to the standard MG medium, showed reduced callus formation, but still callus growth occurred. The callus was then transferred to GC medium (Table 26), and transferred back to freshly prepared selection medium after three weeks. After another three weeks the callus tissue was transferred to medium D (Table 26) which lacked regulators. of plant growth for induction of emboligenic callus After 4-8 weeks in this medium, the embolus callus was formed, and it was possible to distinguish it from the non-embogenic callus due to its yellowish white color and granular cells The embryos began to regenerate shortly after and they are of a distinctive green color. Cotton can take time to regenerate and form embryos, one of the ways to accelerate this process is to stress the tissue. Drying is a common way of achieving this, via changes in the tissue microenvironment and the plate, by using less culture medium and / or by adopting various ways of closing the plate (lid against parafilm) The larger embryos, well des The cells were isolated and transferred to DK medium (Table 26) for embryo development. After 3 weeks (or when the embryos had developed), the germinated embryos were transferred to freshly prepared medium for shoot and root development. -8 weeks, any well-developed plants were transferred to soil and grown to maturity. After a couple of months, the plant had grown to a point that could be sprinkled to determine if it had resistance to 2,4-D TABLE 26 Media for transformation into OO cotton 12 2 - Transformation of the cell Several experiments were initiated in which the cotyledon segments were treated with Agrobacterium containing pDAB724 More than 2000 of the resulting segments were treated using various auxin options for the proliferation of the cotton callus pDAB724, either 0 1 or 0 5mg / L of R-dichlorprop, standard concentration of 2,4-D and without treatment with auxin The callus was selected on glufosinate-ammonium, due to the inclusion of the PAT gene within the construction The analysis of the line callus in the form of PCR and Invader will be used to determine if and to ensure that the gene was present in the callus stage, subsequently the callus lines that are embogenic will be sent for Western analysis, essentially as described in section 1 1 2 3. The cotton swab callus can be stressed using drying techniques to improve the quality and quantity of the recovered tissue Almost 200 event callus cells have been selected for intact PTU and expression using Western analysis for the AAD-12 gene (v1) Below is a subpopulation of the data for some of the cotton callus that have been evaluated 12. 3 - Plant regeneration. The AAD-12 (v1) cotton lines that have produced plants in accordance with the aforementioned protocol will be sent to the greenhouse. To demonstrate that the AAD-12 (v1) gene provides resistance to 2,4-D in cotton, both the AAD-12 (v1) cotton plant and the wild-type cotton plants will be sprayed with a tray sprayer that administers 560 g ae / ha 2,4-D at a spray volume of 187 L / ha. Plants will be evaluated 3 and 14 days after treatment. Plants that survive a selective 2,4-D ratio will be self-pollinated to create the TT seed. Or they will be exo-crossed with an elite cotton line to produce the F- seed. The seed subsequently produced will be sown and evaluated for resistance to the herbicide as previously described. The AAD-12 events (v1) can be combined with other desired HT or IR traits as described in experiments 18, 19, 22, and 23.

EXAMPLE 13 Transformation by Agrobacterium of other crops In light of the present disclosure, additional crops can be transformed in accordance with the present invention using techniques that are known in the art. For the transformation of rye mediated by Agrobacterium, see, for example, Popelka and Altpeter (2003). For the transformation of Agrobacterium-mediated soybeans, see, for example, Hinchee et al., 1988. For the transformation of Agrobacterium-mediated sorghum, see, for example, Zhao et al., 2000. For the transformation of barley mediated by Agrobacterium, see, for example, Tingay et al., 1997. For wheat transformation mediated by Agrobacterium, see, for example, Cheng et al., 1997. For the transformation of rice mediated by Agrobacterium, see, for example , Hiei et al., 1997. The Latin names for these and other plants are given below. It should be evident that these and other transformation techniques (non-Agrobacterium) can be used to transform AAD-12 (v1), for example, within these and other plants, including but not limited to corn (Zea mays), wheat (Triticum) spp.), rice (Oryza spp. and Zizania spp.), barley (Hordeum spp.), cotton (Abroma augusta and Gossypium spp.), soybeans (Glycine max), sugar and sugar beet (Beta spp.), cane sugar (Arenga pinnata), tomato (Lycopersicon esculentum and other spp., Physalis ixocarpa, Solanum incanum and other spp., and Cyphomandra betacea), potato (Solanum tubersoum), sweet potato (Ipomoea betatas), rye (Sécale spp. ), peppers (Capsicum annuum, sinense, and frutescens), lettuce (Lactuca sativa, perennis, and pulchella), squash (Brassica spp), celery (Apium graveolens), eggplant (Solanum melongena), peanut (Arachis hypogea), sorghum (all species of sorghum), Alfalfa (Medicago sativua), carrot (Daucus carota), beans (Phaseolus spp., and other genera), oats (Avena sativa and strigosa), Peas (Pisum, Vigna, and Tetragonolobus spp. ). Sunflower (Helianthus annuus), squash (Cucurbit spp.), Cucumber (Cucumis sativa), tobacco (Nicotiana spp.), Arabidopsis (Arabidopsis thaliana), turf (Lolium, Agrostis, Poa, Cynadon, and other genera), clover (Tifolium) ), carob (Vicia). Such plants, with the AAD-12 (vi) genes, for example, are included in the present invention. AAD-12 (v1) has the potential to increase the application of key auxinic herbicides for seasonal use in many deciduous and ever-greenwood harvest systems. Wood species resistant to Triclopir, 2,4-D, and / or fluroxipyr could increase the flexibility of top-use of these herbicides without concern for the production of lesions. These species could include, but are not limited to: alder (Alnus spp.), Ash (Fraxinus spp.), Aspen and poplar species (Populus spp.), Beech (Fagus spp.), Birch (Betula spp.) , cherry (Prunus spp.), eucalyptus (Eucalyptus spp.), pecan (Carya spp.), maple (Acer spp.), oak (Quercus spp.), and pine (Pinus spp.). The use of auxin resistance for the selective control of weeds in ornamental and fruit species is also within the scope of this invention Examples could include, but are not limited to, rose (Rosa spp), burning shrub (Euonymus spp) , petunia (Petunia spp), begonia (Begonia spp), rhododendron (Rhododendron spp), apple tree or apple tree (Malus spp), pear tree (pirus spp), peach tree (Prunus spp), and marigolds (Tagetes spp) EXAMPLE 14 Additional evidence of surprising results: AAD-12 versus AAD-2 14 1 - Initial Cloning of AAD-2 (v1) Another gene was identified from the NCBI database (see the web site nebí nlm nih gov, access # AP005940) as a homolog with only 44% identity of amino acids to tfdA This gene is referred to herein as AAD-2 (v1) for consistency Percentage identity was determined micially by translating the DNA sequences of both AAD-2 and tfdA (SEQ ID NO 12 from PCT / US2005 / 014737 and GENBANK access No M16730, respectively) to proteins (SEQ ID NO 13 from PCT / US2005 / 014737 and GENBANK access No M16730, respectively), then using ClustalW in the VectorNTI software package to carry out multiple sequence alignment strain of Brad rhizobium japonicum containing the AAD-2 gene (v1) was obtained from the Northern Regional Research Laboratory (NRRL, strain # B4450) The lyophilized strain was revived in accordance with the NRRL protocol and stored at -80 ° C in 20% ghcerol for int use As Dow Bacterial strain DB 663 From this frozen storage solution, a tryptic soy agar plate was seeded with a loop of cells to isolation, and incubated at 28 ° C for 3 days. A single colony was used to inoculate 100 ml of tpptica soy broth in a flask with three deviations of 500 ml, which was incubated overnight at 28 ° C on a floor stirrer at 150 rpm. From this, the total DNA was isolated with the gram protocol negative of the Qiagen DNeasy kit (Qiagen cat # 69504) The following primers were designed to amplify the target gene from the genomic DNA, forward 5 'ACT AGT AAC AAA GAA GGA GAT ATA CCA TGA CGA T 3' [(brjap 5 '(spel) SEQ ID NO 14 from PCT / US2005 / 014737 (restriction site added Spe I and site for pbosome binding (RBS))] and reverse 5' TTC TCG AGC TAT CAC TCC GCC GCC TGC TGC TGC 3 '[ (br jap 3 '(xhol) SEQ ID NO 15 from PCT / US2005 / 014737 (an Xho I site was added)] CI reactions were processed count microliters as follows Fail Safe pH regulator 25 μl, each initiator 1 μl (50 ng / μl), 1 μl gDNA (200 ng / μl), 21 μl H20, 1 μl Taq pohmeres (2 5 units / μl) Regulators of pH Three Fail Safe A, B, and C were used in three separate reactions The PCR was carried out under the following conditions 95 ° C 3 0 minutes in a cycle of heat denaturation, 95 ° C 1 0 minute, 50 ° C 1 0 minute, 72 ° C 1 5 minutes, for 30 cycles, followed by a final cycle of 72 ° C 5 minutes, using the FailSafe PCR system (Epicenter cat # FS99100) The resulting PCR product of ~ 1 kb was cloned within pCR 2 1 (invitrogen cat # K4550-40) following the protocol included, with E. coli TOP10F 'chemically competent as the host strain, for verification of the nucleotide sequence. Ten of the resulting white colonies were selected in 3 μl of Luria broth + 1000 μg / ml ampicillin (LB Amp), and grown overnight at 37 ° C with shaking. The plasmids were purified from each culture using Nucleospin Plus Plasmid Miniprep Kit (BD Biosciences cat. # K3063-2) and following the included protocol. The restriction digestion of the isolated DNAs was completed to confirm the presence of the PCR product in the pCR2.1 vector. The plasmid DNA was digested with the restriction enzyme EcoRI (New England Biolabs cat. # R0101S). Sequencing was carried out with the Beckman CEQ Quick Start equipment (Beckman Coulter cat. # 608120) using forward M13 primers [5 'GTA AAA CGA CGG CCA G 3'] (SEQ ID NO: 6) and reverse [5 'CAG GAA ACÁ GCT ATG AC 3'] (SEQ ID NO: 7), according to the instructions of the manufacturers. This gene sequence and its corresponding protein were given a new general designation AAD-2 (v1) for internal consistency. 14. 2 - Termination of the binary vector AAD-2 (v1). The AAD-2 gene (v1) was amplified by PCR from pDAB3202. During the PCR reaction, alterations were made inside the primers to introduce the Afllll and Sacl restriction sites in the 5 'primer and the 3' primer., respectively. See PCT / US2005 / 014737. The primers "Ncol from Brady" \ 5 'TAT ACC ATA TGT CGA TCG CCA TCC GGC AGC TT 3'] (SEQ ID NO: 14) and "Sacl de Brady" [5 'GAG CTC CTA TCA CTC CGC CGC CTG CTG CTG CAC 3 '] (SEQ ID NO: 15) were used to amplify a DNA fragment using the Fail Safe PCR system (Epicenter). The PCR product was cloned into the cloning vector pCR2.1 TOPO TA (Invitrogen) and the sequence was checked with the forward M13 primers and reverse M13 using the reagents for Beckman Coulter sequencing "Dye Terminator Cycle Sequencing with Quick Start Kit " The sequence data identified a clone with the correct sequence (pDAB716). The Afllll / Sacl AAD-2 gene fragment (v1) was then cloned into the vector. Ncol / Sacl pDAB726. The resulting construction (pDAB717); Promoter Atubil: Nt OSM 5'UTR: AAD-2 (v1): Nt OSM3'UTR: ORF1 poIyA 3'UTR was verified with restriction digests (with Ncol / Sacl). This construct was cloned into the binary pDAB3038 as a Notl-Notl DNA fragment. The resulting construction (pDAB767); Atubil OR promoter: Nt OSMd'UTR: AAD-2 (v1): Nt OSM 3'UTR: ORF1 poIyA 3'UTR: CsVMV promoter: PAT: ORF25 / 26 3'UTR was digested by restriction (with Notl, EcoRI, HinDIII , Ncol, Pvull, and Salí) to verify the correct orientation. The completed construction (pDAB767) was then used for transformation into Agrobacterium. 14. 3 - Evaluation of transformed Arabidopsis. The recently harvested Ti seed, transformed with an AAD-12 gene (v1) optimized in plant or with a native AAD-2 (v1) gene was seeded and selected for glufosinate resistance as previously described. Plants were randomly assigned at various 2,4-D ratios (50-3200 g ae / ha). The applications of herbicide were applied by means of a tray sprinkler in a spray volume of 187 L / ha. The 2,4-D used was the commercial formulation of dimethylamine salt (456 g ae / L, NuFarm, St Joseph, MO) mixed in buffer of pH 200 mM Tris (pH 9.0) or regulator of pH 200 mM HEPES (pH 7.5). AAD-12 (v1) and AAD-2 (v1) provide detectable resistance to 2,4-D against the transformed and untransformed control lines; however, the individual constructs varied widely in their ability to impart resistance to 2,4-D to an individual plant of TT Arabidopsis. Surprisingly, the transformants AAD-2 (v1) and AAD-2 (v2) were much less resistant to 2,4-D than the AAD-12 gene (v1), both from a frequency of highly tolerant plants with a lesion general average. No plants transformed with AAD-2 (v1) survived 200 g ae / h to 2,4-D relatively without the presence of lesions (<20% of visual lesions), and the lesion in the general population was approximately 83% ( see PCT / US2005 / 014737). Conversely, AAD-12 (vi) had an average population injury of approximately 6% when treated with 3,200 g ae / ha 2,4-D (Table 11). The tolerance was slightly improved for plant-optimized AAD-2 (v2) against the native gene, however, the comparison of both plant-optimized AAD-12 and AAD-2 genes indicates a significant advantage for AAD-12 (v1) m plant These results are unexpected given that the in vitro comparison of AAD-2 (v1) (see PCT / US2005 / 014737) and AAD-12 (v2) indicated that both were highly efficient at degrading 2,4-D and both shared a S type specificity with respect to the chiral substrates of aploxyalkanoate AAD-2 (v1) was expressed in individual TT plants at varying levels, however, a small protection was achieved from the 2,4-D injury by this protein expressed A substantial difference in the level of expression of the protein (in plant) was not evident for the native and plant-optimized AAD-2 genes (see PCT / US2005 / 014737). These data corroborate the early findings that make the functional expression unexpected of AAD-12 (v1) m plan ta, and the resulting resistance to 2,4-D herbicide and pindyloxyacetate herbicides EXAMPLE 15 Pre-plant burn applications This and the following examples are specific examples of novel uses of the herbicides that are made possible by the present invention with respect to AAD-12 The applications of pre-plant burn herbicide are intended to eliminate weeds that arise in the winter or early winter. spring before planting a given crop. Typically these applications are applied in no-till or reduced-tillage management systems where physical weed removal is not completed before planting. Therefore, a herbicide program must control a very broad spectrum of broadleaf weeds and grass weeds present at the time of planting. Glyphosate, gramoxone, and glufosinate are examples of non-selective, non-residual herbicides widely used for pre-plant burn herbicide applications. However, some weeds are difficult to control at this time of the season due to one or more of the following: inherent insensitivity of the weed species or biotype to the herbicide, relatively large size of annual winter weeds, and weather conditions cold that limit the intake and activity of the herbicide. Several herbicide options are available to the tank mix with these herbicides to increase the spectrum and activity on the weeds where the non-selective herbicides are weak. An example could be the applications of tank mix of 2,4-D with glyphosate to help in the control of Conyza canadensis (erectile of Canada). Glyphosate can be used from 420 to 1680 g ae / ha, more typically from 560 to 840 g ae / ha, for control of preplant burning of most of the weeds present; however, 280 - 1120 g ae / ha of 2,4-D can be applied to aid in the control of many broadleaf weed species (eg, Canada's epgeron) 2,4-D is an herbicide of choice because it is effective in a very broad range of broadleaf weeds, is effective even at low temperatures, and is relatively inexpensive. However, if the subsequent crop is a sensitive crop of dicots, the residues of 2,4- D on the ground (although they have a short life) can negatively impact the harvest Soybeans are a sensitive crop and require a minimum period of 7 days (for a ratio of 280 g ae / ha 2.4 -D) up to at least 30 days (for 2,4-D applications of 1120 g ae / ha) occurring between burning applications and planting 2,4-D has been banned as a burn treatment prior to cotton planting (see federal brands, most are available through CPR, 2005 or online at c dms net / manuf / manuf asp) with cotton or soybeans transformed with AAD-12 (v1), these crops must be able to survive 2,4-D residues in the soil from burning applications applied just in and even after sowing before the emergence of the crop The increased flexibility and reduced cost of the tank mix partners (or the commercial premix) will improve the weed control options and increase the strength of the applications Burning in important situations without tillage and with reduced tillage This example is one of many options that will be available Those skilled in the weed control art will notice a variety of other applications including, but not limited to Gramoxone + 2,4-D or glufosinate + 2,4-D through the use of products described in the federal herbicide brands (CPR, 2005) and the uses described in the Agriliance Crop Protection Guide (2005), as examples. Those skilled in the art will also recognize that the above-mentioned example can be applied to any crop sensitive to 2,4-D (or other phenoxy auxin herbicide) that could be protected by the AAD-12 (v1) gene if it is transformed from stable way. Similarly, the only attribute of AAD-12 that allows the degradation of triclopyr and fluroxipyr increases utility by allowing the substitution or tank mixing of 70-1120 or 35-560 g ae / ha of triclopyr and fluroxipyr, respectively, to increase the spectra and / or to increase the capacity to control the species of perennial weeds or invasive plants.

EXAMPLE 16 Use of phenoxy auxin herbicides in harvest in soybeans. cotton, and other dicotyledonous crops transformed only with AAD-12 (v1) AAD-12 (v1) may allow the use of phenoxy auxin herbicide (eg, 2,4-D and MCPA) and pyridyloxy auxins (triclopyr and fluroxypir) to control a broad spectrum of broadleaf weeds directly on crops normally sensitive to 2,4-D. The application of 2,4-D at 280 to 2240 g ae / ha could control the majority of broadleaf weeds present in agronomic environments. More typically, 560-1120 g ae / ha are used. For tpclopir, the application ratios typically could have a range of 70-1120 g ae / ha, more typically 140-420 g ae / ha. For fluroxypyr, the application ratios typically they could have a range of 35-560 g ae / ha, more typically 70-280 ae / ha One advantage for this additional tool is the extremely low cost of the broadleaf herbicide component and the potential short-lived residues for the control of weeds provided by high ratios of 2,4-D, tpclopir, and fluroxypir when used at high ratios, while a non-residual herbicide such as agosphate could not provide control of the weeds that germinate later. This tool also provides a mechanism for combine the modes of action of the herbicide with the convenience of HTC as an integrated resistance to the herbicide and a modified weed management strategy. An additional advantage that will This tool is the ability to tank mix a broad spectrum of herbicides for the control of broadleaf weeds (eg, 2,4-D, tpclopyr and fluroxypir) with the herbicides for the control of commonly used residual weeds. herbicides are typically applied before or during planting, but are often less effective on established, established weeds that may exist in the field before planting. By extending the utility of these aploxy auxin herbicides to include in-plant applications, Pre-emergence, or pre-plant, flexibility of residual weed control programs increases. One skilled in the art could recognize that the residual herbicide program will differ based on the crop of interest, but typical programs could include herbicides. of the families of herbicides chloracetamide and dmitroanil, but could also include herbicides such as clomazone, sulfentrazone , and a variety of inhibitors that inhibit ALS that inhibit PPO, and herbicides that inhibit HPPD Additional benefits could include the tolerance to 2,4-D, tpclopir or fluroxipir required before planting after the application of the herbicide of aploxiacético auxina acid (see previous example), and minor problems of contamination injury to dicotyledonous crops resulting from incompletely clean bulk tanks that could contain 2,4-D, tpclopir or fluroxipyr Dicamba (and many other herbicides) can still be used to the subsequent control of voluntary harvests of dicotyledonous plants transformed with AAD-12 (v1) Those skilled in the art will also recognize that the above-mentioned example can be applied to any crop sensitive to 2,4-D (or other aploxy auxin herbicide) which could be protected by the AAD-12 gene (v1) if it is transformed in a stable manner. One skilled in the art of weed control p It could be recognized that the use of various commercial phenoxy or pipdoyloxy auxin herbicides alone or in combination with a herbicide is allowed by the transformation of AAD-12 (v1). The specific ratios of other herbicides representative of these chemicals can be determined by the brands of herbicide compiled in the CPR (Crop Protection Reference) book or in a similar compilation or in any commercial reference or academic reference for crop protection such as the Crop Protection Guide from Agriliance (2005). Each alternative herbicide that has been included for use in HTCs by AAD-12 (v1), whether used alone, mixed in tank, or sequentially, is considered to be within the scope of this invention.

EXAMPLE 17 The use of phenoxy auxin and pyridyloxy auxin herbicides in harvest in corn only transformed with AAD-12 (v1), rice, and other monocotyledonous species In an analogous manner, the transformation of pasture species (such as, but not limited to, maize, rice, wheat, barley, or grass and pasture grasses) with AAD-12 (v1) could allow the use of phenoxy and pyridyloxy auxins highly efficient in crops where the normality of selectivity is not safe. Most grass species have a natural tolerance to auxinic herbicides such as phenoxy auxins (ie, 2,4-D.). However, a relatively low level of crop selectivity has resulted in a decreased utility in these crops due to the shorter time of the application window or an unacceptable risk of injury. Therefore, monocotyledonous crops transformed with AAD-12 (v1) could allow the use of a similar combination of treatments described for dicotyledonous crops such as the application of 2,4-D at 280 to 2240 g ae / ha to control the most broadleaf weed species. More typically, 560-1,220 g ae / ha are used. For triclopir, the application rates typically could have a range of 70-1120 g ae / ha, more typically 140-420 g ae / ha. For fluroxypir, the application ratios typically could have a range of 35-560 g ae / ha, more typically 70-280 ae / ha. An advantage to this additional tool is the extremely low cost of the broadleaf herbicidal component and the control of potential short-lived residual weeds provided by higher ratios of 2,4-D, triclopir, or fluroxypyr. In contrast, a non-residual herbicide such as glyphosate may not provide control of the weeds that germinate subsequently. This tool could also provide a mechanism to rotate the modes of action of the herbicide with the convenience of HTC as an integrated strategy for herbicide resistance and weed change management strategy in a glyphosate-tolerant crop combination strategy / AAD-72 (v1) HTC, where a kind of harvest is broken or not broken. An additional advantage that this tool provides is the ability to tank-mix herbicides for broad-spectrum broadleaf weed control (eg, 2,4-D, triclopyr and fluroxypir) with herbicides for the control of residual weeds. used. These herbicides are typically applied before or during sowing, but are often less effective on established, established weeds that may exist in the field before planting. By extending the usefulness of these aryloxy auxin herbicides to include applications in plant, presurgical, or pre-plant, the flexibility of programs for the control of residual weeds is increased. One skilled in the art would recognize that the residual herbicide program differs based on the crop of interest, but typical programs could include herbicides from the herbicidal families of chloracetamide and dinitroaniline, and could also include herbicides such as clomazone, sulfentrazone, and a variety of herbicides that inhibit ALS that inhibit PPO, and herbicides that inhibit HPPD. The increased tolerance of maize, rice, and other monocotyledons to phenoxy or pyridyloxy auxins should allow the use of these herbicides in harvest without restrictions with respect to the growth stage or the potential to decrease a harvest, phenomena such as the unfolding of the leaf which can cause "rat tail", decrease of the crop, stem fragility induced by the growth regulator in the corn, or deformed roots for subjection. Each alternative herbicide allows use in HTCs by AAD-12 (v1), whether used alone, mixed in tank, or sequentially, it is considered within the scope of this invention.

EXAMPLE 18 AAD-12 (v1) stacked with the glyphosate tolerance trait in any crop The vast majority of the hectares of cotton, sugarcane, corn, and soybeans planted in North America contain a glyphosate tolerance (GT) trait, and the adoption of GT corn is growing. Additional GT crops (eg, wheat, rice, sugar beet, and turf) have been under development but have not yet been commercially released to date. Many other glyphosate-resistant species are in experimental or developing stages (eg, alfalfa, cane sugar, sunflower, beets, peas, carrots, cucumbers, lettuce, onions, strawberries, tomatoes, and tobacco), forestry species such as poplar and ocozole, and horticultural species such as calendula, petunia, and begonias, isb.vt.edu/cfdocs/fieldtests1.cfm, 2005 in the world network). GTCs are valuable tools to prevent the development of controlled weed extension and provide this system with convenience and cost effectiveness. However, the utility of glyphosate as a currently standard treatment base is selected for glyphosate-resistant weeds. In addition, weeds in which glyphosate is inherently less efficient are modified to predominant species in the field where chemical programs are practiced only with glyphosate. By stacking AAD-12 (v1) with a GT trait, either through the conventional cross or jointly as a novel transformation event, efficiency could be improved for weed control, flexibility, and ability to handle Weed changes and the development of herbicide resistance. As mentioned in the previous examples, by transforming crops with AAD-12 (v1), the monocotyledonous crops will have a greater margin of safety to phenoxy or pyridyloxy auxin, and the phenoxy auxins can be selectively applied in dicotyledonous crops. Several scenarios can be considered for improved weed control where AAD-12 (v1) and a GT trait are stacked on any monocot or dicotyledonous harvest species: a) glyphosate can be applied at a standard application rate after emergence (420 to 2160 g ae / ha, preferably 560 to 840 g ae / ha) for the control of most grasses and broadleaf weeds. For the control of glyphosate-resistant broadleaf weeds such as Conyza canadensis or weeds inherently difficult to control with glyphosate (for example, Commelina spp, Ipomoea spp, etc), 280-2240 g ae / ha (preferably 560-1120 g ae / ha) of 2,4-D can be applied sequentially, mixed in tank, or as a premix with glyphosate to provide effective control. For triclopir, the application rates typically could have a range of 70-1120 g ae / ha, more typically 140-420 g ae / ha. For fluroxypir, the application ratios typically could have a range of 35-560 g ae / ha, more typically 70-280 ae / ha. b) currently, the glyphosate ratios applied in GTC's generally have a range of 560 to 2240 g ae / ha per application regime. Glyphosate is much more efficient on grass species than on broadleaf weeds. The stacked traits AAD-12 (v1) + GT could allow effective glyphosate ratios in grass (105-840 g ae / ha, more preferably 210-420 g ae / ha). 2,4-D (at 280-2240 g ae / ha, more preferably 560-1120 g ae / ha) which could then be applied sequentially, mixed in tank, or as a premix with effective glyphosate ratios in grass for provide the necessary control of broadleaf weeds. Tricopyr and fluroxypyr at the aforementioned ratios could be acceptable components in the treatment regimen. The low glyphosate ratio could also provide some benefit to the control of broadleaf weeds; however, the primary control could be from 2, 4-D, triclopir, or fluroxypyr. One skilled in the art of weed control will recognize that the use of one or more commercial aryloxy auxin herbicides alone or in combination (sequentially or independently) is allowed by the transformation of AAD-12 (v1) into the crops. The specific ratios of the other herbicides representative of these chemistries can be determined by the brands of herbicides compiled in the CPR (Crop Protection Reference) book or in a similar compilation, trademarks compiled online (for example, cdms.net/manuf/manuf .asp), or any commercial or academic guidelines for crop protection such as the Crop Protection Guide from Agriliance (2005). Each alternative herbicide allowed for use in HTCs by AAD-12 (v1), whether used alone, mixed in tank, or sequentially, is considered to be within the scope of this invention.

EXAMPLE 19 AAD-12 (vi) stacked with the glufosinate tolerance trait in any crop Tolerance to glufosinate (PAT or bar) presently present in numerous crops planted in North America either as a selection marker for an internal trait such as resistance to insect proteins or specifically as an HTC trait. Crops include, but are not limited to, glufosinate tolerant, corn, and cotton. Additional crops that are tolerant to glufosinate (eg, rice, sugar beet, soybeans, and turf) have been under development but have not been commercially released to date. Glufosinate, like glyphosate, is a relatively nonselective herbicide with a broad spectrum of grasses and broadleaf weeds. The mode of action of glufosinate differs from that of glyphosate. This acts more quickly, resulting in desiccation and "burning" of the leaves treated 24-48 hours after the application of the herbicide. This is advantageous for the emergence of rapid weed control. However, this also limits the translocation of glufosinate to meristematic regions of the target plants resulting in less weed control as evidenced by the relative performance relationships for weed control of the two compounds in many species (Agriliance, 2005). By stacking AAD-12 (v1) with a trait for glyphosate tolerance, either through the conventional cross or together as a new transformation event, efficiency in weed control, flexibility, and capacity for manage the weed changes and the development of resistance of the herbicide. Several scenarios can be considered for improved weed control where AAD-12 (v1) and a trait for glufosinate tolerance are stacked in any monocotyledonous or dicotyledonous species: a) glufosinate can be applied at a standard application rate post-emergence ( 200 to 1700 g ae / ha, preferably 350 to 500 g ae / ha) for the control of many grasses and broadleaf weeds. To date, no glufosinate-resistant weeds have been confirmed; however, glufosinate has a greater number of weeds that are inherently more tolerant compared to glyphosate. i) Inherently tolerant broadleaf weed species (eg, Cirsium arvensis Apocynum cannabinum, and Conyza candensis) could be controlled by tank mixing of 280-2240 g ae / ha, more preferably 560-2240 g ae / ha , 2,4-D for effective control of these perennial species that are more difficult to control and to improve the strength of control over annual broadleaf weeds.

Triclopir and fluroxypyr could be acceptable components to consider the weed control regime. For triclopir, the application rates typically could have a range of 70-1120 g ae / ha, more typically 140-420 g ae / ha. For fluroxypir, the application ratios typically could have a range of 35-560 g ae / ha, more typically 70-280 ae / ha. b) A multiple combination of glufosinate (200-500 g ae / ha) +/- 2,4-D (280-1120 g ae / ha) +/- triclopyr or fluroxypyr (to the ratios listed above), for example, could provide a stronger, overlapping spectrum of weed control. Additionally, the superimposed spectrum provides an additional mechanism for the management or delay of herbicide-resistant weeds. One skilled in the art of weed control will recognize that the use of one or more commercially available aryloxyacetic auxin herbicides alone or in combination (sequentially or independently) is allowed by transformation with AAD-12 (v1) into the crops. The specific ratios of other herbicides representative of these chemistries can be determined by the herbicide brands compiled in the CPR (Crop Protection Reference) book or a similar compilation, online compiled brands (eg, cdms.net/manuf/manuf.asp ), or any commercial or academic guides for crop protection such as the Crop Protection Guide from Agriliance (2005). Each alternative herbicide allows use in HTCs by AAD-12 (v1), whether used alone, mixed in tank, or sequentially, it is considered within the scope of this invention.

EXAMPLE 20 AAD-12 (v1) stacked with the AHAS trait in any crop Tolerance to the herbicide imidazolinone (AHAS, et al.) Is presently present in numerous crops sown in North America including, but not limited to, corn, rice, and wheat. Additional imidazolinone-tolerant crops (eg, cotton and sugar beet) have been under development but have not been commercially released to date. Many imidazolinone herbicides (eg, imazamox, imazethapir, imazaquin, and imazapic) are currently used selectively in various conventional crops. The use of imazethapyr, imazamox, and the non-selective imazapir has been allowed through the imidazolinone tolerance traits such as AHAS et al. This chemical class also has significant residual activity in soil, therefore it is able to provide extended weed control beyond the application regime, unlike systems based on glyphosate or glufosinate. However, the weed spectrum controlled by imidazolinone herbicides is not as broad as the weed spectrum controlled by glyphosate (Agriliance, 2005). Additionally, imidazolinone herbicides have a mode of action (inhibition of acetolactate synthase, ALS) to which many weeds have developed resistance (Heap, 2005). By stacking AAD-12 (v1) with an imidazolinone tolerance trait, either through conventional cross or jointly as a new transformation event, weed efficiency could improve, flexibility, and ability to handle Weed changes and the development of herbicide resistance. As mentioned in the previous examples, by transforming the harvests with AAD-12 (v1), monocot crops will have a greater margin of safety with respect to phenoxy or pyridyloxy auxin, and these auxins can be applied selectively in crops dicotyledons. Several scenarios can be considered for improved weed control options where AAD-12 (v1) and an imidazolinone tolerance trait are stacked on any monocot or dicotyledonous crop species: a) Imazethapir can be applied at an application rate standard post-emergence of (35 to 280 g ae / ha, preferably 70-140 g ae / ha) for the control of many grasses and broadleaf weed species. i) Broadleaf weeds resistant to the ALS inhibitor such as Amaranthus rudis, Ambrosia trífida, Chenopodium album (among others, Heap, 2005) could be controlled by tank mixing of 280-2240 g ae / ha, more preferably 560- 1 120 g ae / ha, 2,4-D. For triclopir, the application ratios typically could have a range of 70-1 120 g ae / ha, more typically 140-420 g ae / ha. For fluroxypir, the application ratios typically could have a range of 35-560 g ae / ha, more typically 70-280 ae / ha. ii) Broadleaf weed species inherently more tolerant to imidazolinone herbicides such as Ipomoea spp. they can also be controlled by tank mixing of 280-2240 g ae / ha, more preferably 560-1120 g ae / ha, 2,4-D. See the aforementioned relationships for triclopyr or fluroxypyr. b) A multiple combination of imazethapir (35 to 280 g ae / ha, preferably 70-140 g ae / ha) +/- 2,4-D (280-1 120 g ae / ha) +/- triclopyr or fluroxipir (to the relationships listed above), for example, could provide a stronger, overlapping spectrum for weed control. Additionally, the superimposed spectrum provides an additional mechanism for the management or delay of herbicide-resistant weeds. One skilled in the art of weed control will recognize that the use of any of various commercial imidazolinone, phenoxyacetic or pyridyloxyacetic auxin herbicides, alone or in multiple combinations, is permitted by transformation with AAD-12 (v1) and stacking with any trait for imidazolinone tolerance either by conventional cross or genetic design. The specific ratios of other herbicides representative of these chemicals can be determined by the herbicide brands compiled in the CPR (Crop Protection Reference) book or a similar compilation, trademarks compiled online (for example, cdms.net/manuf/manuf.asp), or any commercial or academic guidelines for crop protection such as the Crop Protection Guide from Agriliance (2005). Each alternative herbicide allowed for use in HTCs by AAD-12 (v1), whether used alone, mixed in tank, or sequentially, is considered to be within the scope of this invention.

EXAMPLE 21 AAD-12 (v1) in rice 21. 1 - Description of the media. The culture media used were adjusted to pH 5.8 with 1 M KOH and solidified with 2.5 g / L Phytagel (Sigma). The embryogenic calli were cultured in 100 x 20 mm Petri dishes containing 40 ml of semi-solid medium. The rice seedlings were grown in 50 ml of medium in Magenta boxes. The cell suspensions were maintained in 125-ml conical flasks containing 35 ml of liquid medium and rotated at 125 rpm. The induction and maintenance of the embryogenic cultures was carried out in the dark at 25-26X, and the plant regeneration and the cultivation of the total plant was carried out in a 16-hour photoperiod (Zhang et al., 1996). The induction and maintenance of embryogenic callus were carried out in basal NB medium as previously described (Li et al., 1993), but it was adapted to contain 500 mg / L of glutamine. Suspension cultures were initiated and maintained in liquid SZ medium (Zhang et al., 1998) with the inclusion of 30 g / L of sucrose instead of maltose. The osmotic medium (NBO) consisted of NB medium with the addition of 0.256 M each of mannitol and sorbitol. The hygromycin-B resistant callus was selected on NB medium supplemented with 50 mg / L of hygromycin B for 3-4 weeks. The pre-regeneration was carried out in medium (PRH50) which consisted of NB medium without 2,4-dichlorophenoxyacetic acid (2,4-D), but with the addition of 2 mg / L of 6-benzylaminopurine (BAP) , 1 mg / L of α-naphthaleneacetic acid (NAA), 5 mg / L of abscisic acid (ABA) and 50 mg / L of hygromycin B for 1 week. The regeneration of the seedlings was followed via culture in regeneration medium (RNH50) comprising NB medium without 2,4-D, and supplemented with 3 mg / L of BAP, 0.5 mg / L of NAA, and 50 mg / L of hygromycin B until the rods were regenerated. The rods were transferred to medium for root formation with the basal salts of Murashige and Skoog at medium strength and vitamins B5 of Gamborg, supplemented with 1% sucrose and 50 mg / L of hygromycin B (1 / 2MSH50). 21 .2 - Development in tissue culture. The dried dried seeds of Oryza sativa L. japonica cv. Taipei 309 were sterilized as described in Zhang et al. 1996. Embryogenic tissues were induced by growing mature sterile rice seeds in NB medium in the dark. The primary callus, approximately 1 mm in diameter, was removed from the scutellum and used to initiate cell suspension in liquid SZ medium. The suspensions were then maintained as described in Zhang 1995.

The embryogenic tissues derived from the suspension were removed from the liquid culture 3-5 days after the previous subculture and were placed in osmotic NBO medium to form a circle of approximately 2.5 cm through a Petri dish and cultured for 4 hours before the bombing. Sixteen to 20 hours after the bombardment, tissues were transferred from NBO medium to selection medium with NBH50 hygromycin B, ensuring that the surface for bombardment was facing upward, and incubated in the dark for 14-17 days. The newly formed callus was then separated from the original bombed explants and placed in close proximity to the same medium. After an additional 8-12 days, a comparatively compact, opaque callus was visually identified and transferred to medium for PRH50 pre-regeneration for 7 days in the dark. The growing callus, which became more compact and opaque, was then subcultured on medium for RNH50 regeneration for a period of 14-21 days under a photoperiod of 16 hours. The regenerated shoots were transferred to Magenta boxes containing medium A MSH50. The multiple plants regenerated from a single explant were considered sisters and treated as an independent plant line. A plant was classified as positive for the hph gene if it produces coarse roots, white and grow vigorously in half 1/2 MSH50. Once the seedlings had reached the top of the Magenta boxes, they were transferred to soil in a 6 cm pot under 100% humidity for a week, then moved to a growth chamber with a period of 14 hours light at 30 ° C and in the dark at 21 ° C for 2-3 weeks before being transplanted into 13 cm pots in the greenhouse. The seeds were harvested and dried at 37 ° C for one week before storage. 21. 3 - Bombardment by microprojectile. All bombardments were carried out with the Biolistic PDS-1000 / He ™ system (Bio-Rad, Laboratories, Inc.). Three milligrams of 1.0-micron gold particles were washed once with 100% ethanol, twice with sterile distilled water and resuspended in 50 μl of water in a siliconized Eppendorf tube. Five micrograms of plasmid DNA representing a 1: 6 molar ratio of pDOW3303 (vector containing Hpt) to pDAB4101 (AAD-12 (v1) + AHAS), 20 μl spermidine (0.1 M) and 50 μl calcium chloride (2.5 M) ) were added to the gold suspension. The mixture was incubated at room temperature for 10 minutes, concentrated at 10,000 rpm for 10 s, resuspended in 60 μl of 100% cold ethanol and 8-9 μl distributed in each macrocarrier. These samples were bombarded at 77.33 kg / cm2 and 27 in Hg vacuum as described by Zhang et al. (nineteen ninety six). 21. 4 - Tolerance to the post-treatment herbicide in rice Tg transformed with AAD-12 (v1) The rice seedlings to the 3-5 leaf stage were sprayed with a solution at a lethal dose of 0.16% (v / v) of Pursuit (to confirm the presence of the AHAS gene) containing 1% Sunit II (v / v) and 1.25% UAN (v / v) using a tray sprinkler calibrated at 187 L / ha. A classification was carried out for sensitivity or resistance at 36 days after treatment (DAT). Ten of the 33 events sent to the greenhouse were strongly tolerant of Pursuit; others suffered from varying levels of herbicide injury. The plants were sampled (according to section 21.7 below) and molecular characterization was carried out as previously described in Example 8 identifying seven of these 10 events that contained both the coding region of AAD-12 (v1) PTU as the entire coding region of AHAS. 21. 5 - AAD-12 inheritance (v1) in Ti rice A test in 100 progeny plants was carried out in five Ti lines of AAD-12 lines (v1) that contained in both coding regions of AAD-12 (v1) OCT and from AHAS. Seeds were seeded with respect to the aforementioned procedure and sprayed with 140 g ae / ha of imazethapir using a tray sprinkler as previously described. After 14 DAT, resistant and sensitive plants were counted. Two out of five evaluated lines were segregated as a single locus, dominant Mendelian trait (3R: 1 S) as determined by Chi square analysis. AAD-12 cosegregó with the selection marker AHAS as determined by a lower evaluation of tolerance to 2,4-D. 21. 6 - Verification of the high tolerance to 2,4-D in rice Ti. The following TT AAD-12 (V1) single segregating locus lines were seeded in 7.5 cm pots containing Metro Mix medium: pDAB4101 (20) 003 and pDAB4101 (27) 002. In the 2-3 leaf stage they were sprayed with 140 g ae / ha of imazethapir. The null plants were removed and the individuals were sprayed in stage V3-V4 in the tray sprinkler set at 187 L / ha at 1120, 2240 or 4480 g ae / ha of 2,4-D DMA (2X, 4X, and 8X typical commercial use ratios, respectively). The plants were classified in 7 and 14 DAT and compared with the untransformed commercial rice cultivar, 'Lamont', as negative control plants. The lesion data (Table 27) show that the lines transformed with AAD-12 (v1) are more tolerant to high ratios of 2,4-D DMA than the non-transformed controls. Line pDAB4101 (20) 003 was more tolerant to high levels of 2,4-D compared to line pDAB4101 (27) 002. The data also show that the tolerance of 2,4-D is stable for at least two generations.

TABLE 27 Response of Ti AAD-12 (v1) and untransformed control to variable levels of 2,4-D DMA 21. 7 - Harvest of the tissue, isolation and quantification of DNA. The fresh tissue was placed inside tubes and lyophilized at 4 ° C by 2 days. After drying the tissue completely, a bed of tungsten (Valenite) was placed in the tube and the samples were subjected to 1 minute of dry milling using a Kelco bed mill. The standard DNeasy DNA isolation procedure was followed (Qiagen, Dneasy 69109). Subsequently an aliquot of the extracted DNA was stained with Pico Green (Molecular Probes P7589) and recorded in the fluorometer (BíoTek) with known standards to obtain the concentration in ng / μl. 21. 8 - Expression of AAD-12 (v1). The preparation of the sample and the conditions of analysis were as previously described. All 33 lines of transgenic T0 rice and 1 non-transgenic control were analyzed for AAD-12 expression using ELISA blot. AAD-12 was detected in clones of 20 lines, but not in the Taipai 309 control plant line. Twelve of the 20 lines that had some imazethapyr-tolerant clones expressed the AAD-12 protein, were positive to AAD-12 PTU-PCR , and positive to the coding region of AHAS. Expression levels ranged from 2.3 to 1092.4 ppm of the total soluble protein. 21. 9- Tolerance in the field of rice plants pDAB4101 to herbicides 2,4-D and triclopir. A field-level tolerance test was carried out with the event AAD-12 (v1) pDAB4101 [20] and a wild-type rice (Clearfield 131) in Wayside, Mississippi (an imidazolinone resistant transgenic variety). The experimental design was a completely random block design with a unique replication. The herbicide treatments were 2X ratios of 2,4-D (dimethylamine salt) at 2240 g ae / ha and triclopir at 560 g ae / ha plus an untreated control. In each herbicide treatment, two rows of TT generation pDAB4101 [20] and two rows of Clearfield rice were sown using a small seed drill with 20 cm row spacing. Rice pDAB4101 [20] contained the AHAS gene as a selection marker for the AAD-12 (v1) gene Imazethapir was applied to the stage of a leaf as a selection agent to remove any null plants to AAD-12 (v1) ) from the pots The herbicide treatments were applied when the rice reached the 2-leaf stage using a backpack-type sprinkler with compressed air that administered 187 L / ha of vehicle volume at a pressure of 130-200 kPa. Visual evaluations of the lesion were taken at 7, 14 and 21 days after the application. The response of the event AAD-12 (v1) to 2,4-D and tpclopir are shown in table 28 The untransformed rice line (Clearfield) severely injured (30% at 7DAT and 35% at 15DAT) by 2,4-D at 2240 g ae / ha which is considered the 4X commercial use ratio The AAD-12 event (v1) demonstrated excellent tolerance to 2,4-D without injury observed at 7 or 15DAT Untransformed rice was observed signifi critically injured (15% at 7DAT and 25% at 15DAT) for the 2X ratio of tpclopir (560 g ae / ha) The AAD-12 event (v1) demonstrated excellent tolerance to the 2X relationships of tpclopir without observed injury to either 7 or 15DAT These results indicate that the rice transformed with AAD-12 (v1) exhibited a high level of resistance to 2,4-D and tpclopir at ratios that caused a severe visual injury to the Clearfield rice. It also demonstrated the ability to stack multiple genes. for tolerance to the herbicide with multiple AAD-12 I species to provide resistance to a broader spectrum of effective chemicals.

TABLE 28 Response of Ti generation rice plants AAD-12 to 2,4-D and triclopyr under field conditions Herbicide treatment% visual injury 7DAT 15DAT Event Event Ingredient AAD-12 Clearfield AAD-12 Clearfield nte pDAB4101 [type pDAB41 active type ratio 20] wild 01 [20] wild 2240 GM 2,4-D AE / HA 0 15 0 35 840 GM Triclopyr AE / HA 0 30 0 25 untreated 0 0 0 0 EXAMPLE 22 AAD-12 (v1) in Cañóla 22. 1 - Transformation in Cañóla. The AAD-12 gene (v1) that confers resistance to 2,4-D was used to transform Brassica napus var. Nexera * 710 with transformation mediated by Agrobacterium and the plasmid pDAB3759. The construct contained the AAD-12 (v1) gene driven by the CsVMV promoter and the Pat gene driven by the AtUbil O promoter and the EPSPS agosaphosate-resistant trait driven by the AtUbd O promoter (see section 2 4). sterilized on the surface with 10% commercial bleach for 10 minutes and rinsed 3 times with sterile distilled water. The seeds were then placed at a medium concentration of the basal MS medium (Murashige and Skoog, 1962) and were kept under a regimen of growth adjusted to 25 ° C, and a photoperiod of 16 hours of light / 8 hours of darkness The segments of the hypocotyledon (3-5 mm) were excised from seedlings of 5-7. days of age and were placed on medium for callus induction K1 D1 (MS medium with 1 mg / L of kinetin and 1 mg / L of 2,4-D) for 3 days as pre-treatment. The segments were then transferred into a Petp box, were treated with Agrobacterium Z707S or with strain LBA4404 containing pDAB3759 The Agrobacterium was allowed to grow overnight at 28 ° C in the dark on a shaker 150 rpm and subsequently resuspended in the culture medium. 30 minutes of treatment of the segments of the hypocotyledon with Agrobacterium, these were again placed on the medium for induction of callus for 3 days After co-culture, the segments were placed in K1 D1TC (medium for induction of callus containing 250 mg / L of Carbenicilma and 300 mg / L of Timentina) for a week or two weeks of recovery. Alternatively, the segments were placed directly on medium for selection K1 D1 H1 (aforementioned medium with 1 mg / L of Herbiace). The carbenicillin and timentina were the antibiotics used to eliminate the Agrobacterium. The agent for selection Herbiace allowed the growth of the transformed cells. The hypocotyledon segments that formed callus were then placed on medium for regeneration of B3Z1 H1 rod (MS medium, 3 mg / L benzylamino purine, 1 mg / L Zeatin, 0.5 gm / L MES [2- (N- morpholino) sulphonic acid], 5 mg / L silver nitrate, 1 mg / L Herbiace, carbenicillin and timentin). After 2-3 weeks the rods began to regenerate. The hypocotyledon segments together with the rods were transferred to B3Z1 H3 medium (MS medium, 3 mg / L of benzylamino purine, 1 mg / L of Zeatin, 0.5 gm / L of MES [2- (N-morpholino) ethane sulphonic acid ], 5 mg / L of silver nitrate, 3 mg / L of Herbíace, carbenicilina and timentina) for another 2-3 weeks. The rods were excised from the hypocotyledon segments and transferred to medium for elongation of the MESH5 or MES10 rod (MS, 0.5 gm / L MES, 5 or 10 mg / L Herbiace, carbenicillin, timentina) for 2-4 weeks. . The elongated shoots were cultivated for root induction in MSI.1 (MS with 0.1 mg / L indole butyric acid). Once the plants had a well-established root system, they were transplanted to the soil. The plants were acclimated under controlled environmental conditions in the Conviron for 1-2 weeks before transfer to the greenhouse. 22. 2 - Molecular analysis: materials and methods in cane 22.2.1 - Harvest of tissue, isolation and quantification of DNA. The fresh tissue was placed in tubes and lyophilized at 4 ° C for 2 days. After the tissue was completely dried, a bed of tungsten (Valenite) was placed in the tube and the samples were subjected to 1 minute of dry milling using a Kelco bed mill. Then the standard DNeasy DNA isolation procedwas followed (Qiagen, DNeasy 69109). Subsequently an aliquot of the extracted DNA was stained with Pico Green (Molecular Probes P7589) and read in the fluorometer (BioTek) with known standards to obtain the concentration in ng / ul. 22. 2.2 - Polymerase Chain Reaction. A total of 100 ng of total DNA was used as the template. 20 mM of each primer was used with the Takara Ex Taq PCR Polymerase equipment (Mirus TAKRR001A). The primers for the coding region by PCR AAD-12 (v1) were (SEQ ID NO: 10) (forward) and (SEQ ID NO: 11) (reverse). The PCR reaction was carried out in the Geneamp 9700 thermal cycler (Applied Biosystems), by submitting the samples at 94 ° C for 3 minutes and 35 cycles of 94 ° C for 30 seconds, 65 ° C for 30 seconds, and 72 ° C C for 2 minutes followed by 72 ° C for 10 minutes. The PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr. 35 samples from 35 plants with the AAD-12 events (v1) were evaluated as positive. Three negative control samples were evaluated as negative. 22. 2.3 - ELISA. Using the established ELISA described in the previous section, the AAD-12 protein was detected in 5 different plant events for canola transformation. Expression levels ranged from 14 to more than 700 ppm of the total soluble protein (TSP). Three different non-transformed plant samples were evaluated in parallel with no detected signal, indicating that the antibodies used in the assay had minimal cross-reactivity with respect to the matrix of the canola cell. These samples were also confirmed as positive by Western analysis. A summary of the results is presented in table 29.

TABLE 29 Expression of AAD-12 (vi) in Cañóla plants 22 4 - Tolerance to the post-treatment herbicide in canola Tn transformed with AAD-12 (v1) Forty-five T0 events from the plant transformed with the construction pDAB3759, were sent to the greenhouse for a period of time and were allowed to acclimate in the greenhouse The plants were grown until 2-4 new leaves emerged, which were observed normal (ie, plants had a transition from growth conditions from tissue cultto greenhouse) The plants were then treated with a lethal dose of the commercial formulations of 2,4-D Amine 4 at a ratio of 560 g ae / ha Applications of the herbicide were made with a tray sprinkler at a spray volume of 187 L / ha, 50 cm of spray height A lethal dose is defined as the relationship that causes > 95% injury to untransformed controls Twenty-four of the events were tolerant to the application of herbicide 2,4-D DMA Some events incurred a minor injury but recovered to 14 DAT Events progressed to Ti (and the T2 generation ) by self-pollination under controlled conditions, on the stock exchange 22 5 - Inheritance of AAD-12 (v1) in Cañóla. A test on 100 progeny plants was also carried out in 1 1 TT lines of AAD-12 (v1) Seeds were sown and transplanted into 7 5 cm pots filled with Metro Mix medium. All the plants were then sprayed with 560 g ae / ha of 2,4-D DMA as required. described previously. After 14 DAT, resistant and sensitive plants were counted. Seven of the 1 1 lines evaluated were segregated as a single locus, dominant Mendelian trait (3R: 1 S) as determined by Chi square analysis. AAD-12 is inherited as a strong gene for resistance to auxin aryloxyalkanoate in multiple species and can be stacked with one or more additional genes for herbicide resistance. 22. 6 - Verification of the high tolerance to 2,4-D in canola Ti For TT AAD-12 (v1), 5-6 mg of seeds were stratified, sown, and a thin layer of Sunshine Mix # 5 medium was added as a top layer of soil. Emerging plants were selected with 560 g ae / ha of 2,4-D at 7 and 13 days after sowing. The surviving plants were transplanted in 7.5 cm pots containing half Metro Mix. Surviving plants from the T1 progenies, which were selected with 560 g ae / ha of 2,4-D, were also transplanted into 7.5 cm pots filled with Metro Mix soil. The plants in the 2-4 leaf stage were sprayed with either 280, 560, 1120, or 2240 g ae / ha of 2,4-D DMA. The plants were evaluated at 3 and 14 DAT and compared with the non-transformed control plants. A sample of the injury data from the Ti event to 14DAT can be seen in table 30. The data suggest that multiple events are strongly resistant to 2240 g ae / ha of 2,4-D, while other events demonstrate a tolerance less strong up to 1120 g ae / ha of 2,4-D. the surviving plants were transplanted into 13 cm pots containing Metro Mix medium and placed in the same growth conditions as mentioned above and self-pollinated to produce only homozygous seed.

TABLE 30 Response of T AAD-12 (v1) and untransformed control to variable relations post-emergence of 2,4-D DMA applications 22. 7- Tolerance in field of canola plants pDAB3759 to the herbicides 2,4-D, dichloprop, triclopir and fluroxipir. A field-level tolerance test was conducted in two events AAD-12 (v1) 3759 (20) 018.001 and 3759 (18) 030.001 and in a wild-type canopy (Nex710) in Fowler, Indiana. The experimental design was a completely random block design with 3 replicas. The herbicide treatments were 2,4-D (dimethylamine salt) at 280, 560, 1120, 2240 and 4480 g ae / ha, triclopyr at 840 g ae / ha, fluroxypir at 280 g ae / ha and a control not treaty. In each treatment of the herbicide, a single row of 6 meters row / event per event 3759 (18) 030.001 1, 3759 (18) 018.001 and wild type line (Nex710) with a row drill 4 at a row separation was seeded of 10 cm. The treatments with the herbicide were applied when the canopy reached the 4-6 leaf stage using a backpack sprinkler with compressed air that administered 187 L / ha of vehicle volume at a pressure of 130-200 kpa. Visual injury classifications were taken at 7, 14 and 21 days after application. The response of the rod to 2,4-D, triclopir, and fluroxipyr is shown in Table 31. The wild-type canola (Nex710) was severely injured (72% at 14DAT) by 2,4-D at 2240 g. / ha which is considered the 4X relation. All the AAD-12 events (v1) demonstrated an excellent tolerance to 2,4-D to 14DAT with an average lesion of 2, 3 and 2% observed at the 1, 2 and 4X ratios, respectively. The wild type canola was severely injured (25% at 14DAT) by the 2X ratio of triclopir (840 g ae / ha). The AAD-12 events (v1) demonstrated tolerance to the 2X relationships of triclopyr with an average of 6% injury to 14DAT through both events. Fluroxipir at 280 g ae / ha caused a severe injury (37%) to the line not transformed to 14 DAA. The AAD-12 events (v1) demonstrated increased tolerance with an average of 8% injury to 5DAT.

These results indicate that the events transformed with AAD-12 (v1) exhibited a high level of resistance to 2,4-D, tpclopir and fluroxypir at ratios that were lethal or that caused severe epinastic malformations compared to a non-transformed canola. It has been shown that AAD-12 has a relative efficiency of 2,4-D > triclopir > fluroxipir TABLE 31 Response of canola plants AAD-12 (pDAB3759) to 2,4-D, triclopir, and fluroxypyr under field conditions Herbicide treatment% of visual injury to 14 DAT ingredient Event AAD-12 Event AAD-12 active wild type Ratio 3759 (20) 018.001 3759 (18) 030.001 (Nex 710) 2,4-D 280 GM AE / HA 0 to 0 b O e 2,4-D 560 GM AE / HA 0 to 0 b 15 d 2,4-D 1120GM AE / HA 2 to 2 ab 33 be 2,4-D 2240GM AE / HA 3 to 3 ab 48 to Triclopyr 840 GM AE / HA 6 to 6 ab 25 cd Fluroxipyr 280 GM AE / HA 7 to 8 to 37 ab The means with a column with different letters are significantly different as defined by LSD (p = 0.05).

EXAMPLE 23 AAD-12 (v1) stacked with insect resistance (IR) or other internal features in any crop Insect resistance in crops given by a transgenic trait is prevalent in the production of corn and cotton in North America and throughout the world. Commercial products that have combined IR and HT traits have been developed by multiple seed companies. These include the Bt IR traits (for example the Bt toxins listed on the web site lifesci.sussex.ac.uk, 2006) and any or all of the aforementioned HTC traits. The value that this offers is the ability to control multiple pest problems through genetic methods in a single "sacrifice". The convenience of this "sacrifice" will be restricted if weed control and insect control are achieved independently of each other. AAD-12 (v1) alone or stacked with one or more additional HTC traits may be stacked with one or more additional internal traits (eg, insect resistance, fungal resistance, or stress tolerance, et al.) (Isb.vt) .edu / cfdocs / fieldtests1.cfm, 2005) either through conventional or jointly as a new transformation event. The benefits include the convenience and flexibility described in the aforementioned examples 15-20, along with the ability to manage insect pests and / or other agronomic stress in addition to the improved weed control achieved by AAD-72 and the tolerance associated with herbicide. .

Therefore, the present invention can be used to provide a complete agronomic package of improved crop quality with the capacity for flexibility and effective cost control of any number of agronomic elements. The combined traits of IR and HT have applications in most agronomic crops and horticultural / ornamental and forestry crops. The combination of AAD-12 and its tolerance in proportion to the herbicide and insect resistance produced by any of the numerous Bt or non-Bt IR genes can be applied to the crop species listed (but not limited to) in the example 13. A person skilled in the art of weed control will recognize that the use of any of the various commercial herbicides described in examples 18-20, phenoxyacetic or pyridyloxyacetic auxin herbicides, alone or in multiple combinations, is permitted by transformation and stacking of AAD-12 (v1) with the HT trait or the corresponding IR trait either by conventional cross or genetic design. The specific ratios of other herbicides representative of these chemistries can be determined by the herbicide brands compiled in the CPR (Crop Protection Reference) book or a similar compilation, compiled online (for example, cdms.net/manuf/manuf.asp ), or any commercial or academic guides for crop protection such as the Crop Protection Guide from Agriliance (2005). Each alternative herbicide allowed for use in HTCs by AAD-12 (v1), whether used alone, mixed in a tank, or sequentially, is considered to be within the scope of this invention EXAMPLE 24 AAD-12 (v) as a marker of dicotyledonous selection in vitro The genetic design of a plant cell, tissue, organ, and plant or organelle such as plastids begins with the process of inserting the genes of interest into the plant cells using an appropriate method of administration. However, when a gene is administered to plant cells, only an extremely small percentage of cells integrate the heterologous gene into their genome in order to select those few cells that have the gene of interest incorporated, the researchers associated a "marker gene" of selection or that the gene of interest (GOl) can be selected in the vector. The cells that contained these markers were identified from the total population of cells / tissue to which the vector was administered. Plasmid DNA By selecting those cells that express the marker gene, researchers are able to identify those few cells that may have GOl incorporated into their genome. There are a variety of selection markers available to allow this selection process to obtain transgenic cells, callus, embryos, offshoots and seedlings The selection markers preferred by the Ag industry are herbicide markers that allow the ease of spraying the compounds in the field to select the appropriate transgenic progenies during the classification process of the event in situation in the countryside. It has been shown that AAD-12 (v1) efficiently serves as a selection marker for the total plants transformed with the gene in the greenhouse and in the growth chamber (example 7) with 2,4-D as the selection agent. Field selection is possible as well as the use of 2,4-D in combination with the AAD-12 (v1) gene (example 11, 22), but using it in vitro for selection of cell levels complicated by the fact that 2,4-D is used almost ubiquitously as a plant growth regulator in systems for plant tissue culture. The degradation of this important hormone by AAD-12 (v1) may impact the ability to use this gene as an in vitro selection marker. The success of the development of 2,4-D as a marker gene depends on the identification of the appropriate alternate plant growth regulator that can mimic the effect of 2,4-D in the respective culture system and that at the same time has the capacity to be stable and not to be degraded by the enzyme AAD-12 when expressed in the transgenic cells. R-dichlorprop is a close analog to 2,4-D that is not a substrate for AAD-12 (v1) and is used as a substitute for non-metabolizable auxin in tobacco cell cultures that allows 2,4-D It is used at high ratios as a selection agent. This fact was used in the exemplified AAD-12 (v1) that could be used as an in vitro selection marker. 24. 1- Cell culture - alternative phases. AAD-12 (v1) degrades 2,4-D, but not R-2,4-dichlorophenoxypropionic acid (R-dichlorprop), which has at the same time the structural requirement of an auxinic growth regulator. Other non-metabolizable plant auxin mimics that can be used in cell culture include NAA (naphthalene acetic acid), IAA (indole acetic acid), dicamba, picloram, and R-mecoprop. It was investigated whether it was possible to substitute R-dichlorprop and to successfully maintain two cell cultures different from PHL tobacco (Petite Havanna) and BY2 suspensions. In contrast, for the cotton explants R-dichlorprop, dicamba, and picloram were evaluated as alternative auxins and the response to induction by embryogenic callus was evaluated in comparison with the standard growth regulator, 2,4-D. Petite Havana tobacco (PHL) and Coker cotton cotyledons were used in these experiments. 24. 1.1- Suspension of tobacco-2,4-D cells as selection agents. A dose-response study was carried out with both PHL cells accustomed to R-dichlorprop and the BY2 cells accustomed to R-dichlorprop wherein R-dichlorprop was directly substituted by 2,4-D in culture medium. Although the effect on PHL was studied, a dose response with BY2 was also analyzed in the case of possible future studies, in such a way that it helped to predict the dose response for PHL. For the response to the dose of PHL accustomed to dichlorprop, the levels of 2,4-D used (in medium LSBY2C with R-dichlorprop) were 0 (the control), 1, 2, 3, 5, 8, 10, 12 , 15, 18, 20, 40, 60, 80, 10, 110, 120 mg / L of 2,4-D. Four replications were made per concentration. For the dose response of the BY2 habituated to R-dichlorprop, the 2,4-D levels used (in LSBY2C medium) were 0 (the control), 1, 2, 3, 5, 8, 10, 20, 30, 40, mg / L of 2,4-D. The dose response was carried out showing that the whole concentration of 2,4-D evaluated was lethal above the concentrations at 10 mg / L. However, there was a growth in all concentrations up to 10 mg / L of 2 , 4-D where a slight growth of the PHL suspension was observed. The growth of the suspension colonies from the concentrations of 1- 8 mg / L of 2,4-D was comparable with the growth of the control treatments. The observation made in the suspension cells of BY2 was similar except that the concentration at 10 mg / L was found to be lethal and the sublethal concentration was a concentration at 8 mg / L. 24. 1.2- Transformation of the tobacco cell with AAD-12 (v1) and selection by 2,4-D. For the tobacco transformation experiment, 11 treatments were presented together: a control planted in LS-BY2C + dichlorprop medium, and 10 series of LSBY2C + dichlorprop + 2,4-D at variable levels of concentration (1, 2, 3, 5, 8, 10, 12, 15, 18, 20 mg / L). Four replications were made per treatment. The plasmid DNA vector used was pDAB724, and the vector used for transformation was EHA101 S strain of Agrobacterium tumefaciens. Four ml of PHL suspension at OD660 0.6 were mixed with 100 ul of Agrobacterium suspension (either with strain EHA101 or strain LBA4404) to ODO660 1.0 in a sterile Petri dish and mixed extensively and co-cultivated together in a condition without agitation in a dark growth chamber for 3 days at 25 ° C. After the co-culture period, 1.5 ml of the Agro-tobacco slurry mixture was sown in the 11 series of plates mentioned above. The experiment was repeated with 13 treatments: a media control LS-BY2C + dichlorprop (without 2,4-D), and LS-BY2C + dichlorprop + 2,4-D (1, 2, 3, 5, 8, 10 , 12, 15, 18, 20 mg / L); LSBY2C + 1mg / L 2,4-D + B10 (Bialophos); LSBY2C + 10 2,4-D + B10 + R-dichlorprop. Again, four replications were made per treatment, as well as a positive and negative control. All media contained 500 mg / L of carbenicillin (C) to control the growth of Agrobacterium in the selection medium.

The plasmid used in these experiments is pDAB724 and also has a selection marker PA T In this way, the experiments for control transformation were initiated using PHL accustomed to R-dichlorprop in the presence of 10 mg / L of bialophos following the standard protocol above described The treatments were performed side by side with 4 replicates to see if the selection of bialophos in this suspension is normal. There was a small growth observed in all the selected concentrations of 2,4D previously evaluated at 10 mg / L, however they were found vain colonies growing rapidly in 2, 5, an 8 mg / L concentration of 2,4-D and the representative sample was transferred to a fresh selection at 10 mg / L to group the callus Also, several putative colonies were selected from 12, 15, 18 and 20 mg / L 2,4-D, but when compared with 10 mg / L only a few colonies were observed in this selection plate. More control was carried out with selection of bialophos that showed the development of a normal colony It seems that 10 mg / L of 2,4-D is sub-lethal and above this concentration 2,4-D seems to be lethal to non-transformed cells All identified colonies were transferred to freshly prepared medium with 10 mg / L for selection and assayed for the presence of the PCR-mediated transgene as described in Example 10 The selected and pooled colonies had the transgenes as determined by PCR and by the expression of the genes as established by Western analysis (as described in example 10). Several colonies were identified as active growth and were transferred to freshly prepared selection medium with 10 mg / L of 2,4-D to group the callus. The pooled calli were then transferred to a higher level of 2,4-D to test the tolerance level in vitro. The levels used of 2,4-D were 20, 40, 60, 80, 100, and 120 mg / L 2,4-D. However, the callus did not grow beyond the concentrations of 20 mg / L 2, 4-D, indicating that there may be a threshold concentration higher than 20 mg / L. 24. 2.1- Cotton explant-alternatives to auxin A dose-response study was initiated to evaluate the multiple alternatives to auxin as a substitute for the use of 2,4-D as a growth regulator in cotton. The alternative auxins evaluated were 2,4-dichlorprop, dicamba, and picloram. These compounds were evaluated at concentrations of 0.2, 2.0, and 20.0 uM respectively. 2,4-D was used as the control treatment at the concentration of 0.02 uM. The medium used is the base medium for induction of callus of cotton (example 12). Beyond the initial phase of the culture, the auxin was removed from the medium to propel the tissue towards the regeneration process. R-dichlorprop was not effective in the induction of callus of the cotyledonary segments and appears to be toxic to cotton cells at the lowest evaluated concentration (0.02 uM). Dicamba effectively induces callus growth at all tested concentrations (0.02-20 uM) and had no obvious toxic effects in this concentration range. The induction of callus with picloram was increased to a maximum when the explants were treated with 0.2 uM to 20 uM. Callus quality was consistent with the standard 2,4-D treatment at the 2 uM concentration of picloram. At the highest concentration (20 uM) 2,4-D was also an inhibitor for the generation and growth of cotton callus. Cotton showed an initial ability to respond effectively to alternative auxins (at 2,4-D) in culture. At these sufficiently high concentrations, 2,4-D is toxic for cotyledonary explants of cotton. R-dichlorprop surprisingly is significantly more toxic to cotton than 2,4-D or other auxins. 2,4-D can be used as a selection agent and in combination with AAD-12 (v1) as the selection marker gene. Other non-metabolizable auxin substitutes (eg, dicamba, picloram, R-mecoprop, NAA, or IAA) could allow the use of AAD-12 as a selection marker in dicotyledonous plants with 2,4-D as the selection agent .

References Adang, M.J., M.J. Staver, T.A. Rocheleau, J. Leighton, R.F. Barker, and D.V. Thompson. 1985. Characterized full-length and truncated plasmid clones of the crystal protein of Bacillus thuringiensis subsp kurstaki HD-73 and their toxicity to Manduca sexta. Gene 36: 289-300.

Agriliance Crop Protection Guide. 2005. Agriliance, LLC. St Paul, MN. 614 p.

Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D.J. Lipman 1990. Basic local alighment search tool. J. Mol. Biol. 215: 403-410.

Altschul, S. F., T.L. Madden, A.A. Schaffer, J. Zhang, Z, Zhang, W. Miller, and D.J. Lipman 1997. Gapped BLAST and PSIBLAST: a new generation of protein databasesearch programs. Nucí Acids Res. 25: 3389-3402.

An, G., B.D. Watson, S. Stachel, M.P. Gordon, E. W. Nester. 1985. New cloning vehicles for transformation of higher plants. EMBO J. 4: 277-284.

Armstrong C.L., CE. Green, R.L. Phillips. 1991. Development and availability of germplasm with high Type II culture formation response. Maize Genet Coop News Lett 65: 92-93.

Beltz, G.A., K.A. Jacobs, T.H. Eickbush, P.T. Cherbas, and F.C.

Kafatos. 1983 Methods of Enzymology, R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100: 266-285 Birch R.G. and T. Franks. 1991. Development and optimization of microprojectile systems for plant genetic transformation. Aust. J. Plant Physiol. 18: 453-469.

CDMS. Crop Data Management Systems Labels and MSDS. On-line. Internet. March 13, 2004. Available in net / manuf / manuf.asp.

Chee P.P., K.A. Fober, J.L. Slightom. 1989. Transformation of soybean (Glycine max) by infecting germinating seeds with Agrobacterium tumefaciens. Plant Physiol. 91: 1212-1218.

Cheng M., J.E. Fry, S. Pang, H. Zhou, C.M. Hironaka, D.R. Duncan, T.W. Conner, and Y. Wan. 1997. Genetic transformation of wheat mediated by Agrobacterium tumefaciens. Plant Physiol 115: 971-980.

Chu C.C., C.C. Wang, C.S. Sun, C Hsu, K.C Yin, C.Y. Chu, F.Y. Bi. 1975. Establishment of an efficient medium for anther culture of rice through comparative experiments on the nitrogen sources. Sci. Sinica 18: 659-668.

Clemente T.E., B.J. La Va I reads, A.R. Howe, D. Conner-Ward, R.J. Rozman, P.E. Hunter, D.L. Broyles, D.S. Kasten, M.A. Hinchee 2000. Progeny analysis of glyphosate selected transgenic soybeans derived from Agrobacf er / um-mediated transformation. Crop Sci 40: 797-803.

CPR: Crop Protection Reference. 2005 Chemical and Pharmaceutical Press, New York, NY. 2647 p.

Devine, M. D. 2005. Why are there not more herbicide-tolerant crops? Pest Manag. Sci. 61: 312-317.

Dietrich, Gabriele Elfriede (1998) Imidazolinone resistant AHAS mutants. Patent of E.U.A. 5,731, 180.

Didierjean L, L. Gondet, R. Perkins, S.M. Lau, H. Schaller, D.P. O'Keefe, D. Werck-Reichhart. 2002. Engineering Herbicide Metabolism in Tobacco and Arabidopsis with CYP76B1, to Cytochrome P450 Enzyme from Jerusalem Artichoke. Plant Physiol 2002, 130: 179-189.

Ditta, G. S. Stranfiel, D. Corbin, and D.R. Helinski. 1980. Broad host range DNA cloning system for Gram-negative bacteria: Construction of a gene bank of Rhizobium leliloti. PNAS 77: 7347-7351.

Edwards, R.A., L.H. Keller, and D.M. Schifferli. 1998. Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Gene 207: 149-157.

El-Shemy A, M. Teraishi, M. Khalafalla, T. Katsube-Tanaka, S. Utsumi, M. Ishimoto. 2004. Isolation of soybean plants with stable transgene expression by visual selection based on green fluorescent protein Molecular Breeding 14: 227-238.

El-Shemy A, M. Khalafalla, K. Fujita, M. Ishimoto. 2006 Molecular control of gene co-suppression of transgenic soybean. J. Biochem. and Mole. Biol. 39: 61-67.

Falco S.C., T. Guida, M. Locke, J. Mauvais, C. Sanders, R.T. Ward, P. Webber. 1995 Transgenic cañola and soybean seeds with increased lysine Bio / Technology 13 577-582 Finer J. and M. McMullen. 1991 Transformation of soybean via particle bombardment of embryogenic suspension culture tissue In Vitro Cell Dev Biol 27P 175-182 Fraley, R.T., D.G. Rogers, and R. B. Horsch 1986 Genetic transformation in higher plants Cnt Rev. Plant Sci 4 1-46 Frame B.R., P.R. Drayton, S.V. Bagnall, CJ. Lewnau, W.P. Bullock, H.M. Wilson, J.M. Dunwell, J.A. Thompson, and K. Wang. 1994 Production of fertile maize plants by si with carbide whisker-mediated transformation Plant J 6 941-948 Fukumori, F., and R.P. Hausinger. 1993 Punfication and charactenzation of 2,4-d? Chlorophenoxyacetate / a -ketoglutarate dioxygenase J Biol Chem 268 24311-24317 Gamborg, O.L., R. A. Miller, and K. Ojima. 1968 Nutirent requirements of suspensions of cultures of soybean root cells Exp Cell Res 50 151-158 Gay, P., D. Le Coq, M. Steinmetz, E. Ferrari, and J. A. Hoch. 1983 Cloning structural gene sacB, which codes for exoenzyme levansucrase of Bacillus subtilis: expression of the gene in Eschericia coli. J. Bacteriol. 153: 1424-1431.

Gianessi, L. R. 2005 Economic and herbicide use of glyphosate-resistant crops. Pest. Manag. Sci. 61: 241-245.

Heap, I. The International Survey of Herbicide Resistant Weeds.

On-line. Internet. March 18, 2005. Available at weedscience.com.

Hiei Y., T. Komari, and T. Kubo. 1997. Tranformation of rice mediated by Agrobacterium tumefaciens, Plant Mol. Biol. 35: 205-218.

Hiei, Y., T. Komari (1997) Method for Transforming Monocotyledons. Patent of E.U.A. 5,591, 616.

Hinchee M.A.W., D.V. Conner-Ward, C.A. Newell, R.E. McDonnell, S.J. Sato, C.S. Gasser, D.A. Fischhoff, D.B. Re, R.T. Fraley, R.B. Horsch 1988. Production of transgenic soybean plants using Agrobacfer / u / 77-mediated DNA transfer. Bio / Technology 6: 915-922.

Hófte, H. and H. R. Whiteley. 1989. Insecticidal crystal proteins oí Bacillus thuringiensis. 1989. Microbiol. Rev. 53: 242-255.

Hoekema, A. 1985. In: The Binary Plant Vector System, Offset-durkkerij Kanters B.V., Alblasserdam, Chapter 5.

Hogan, D.A .; MR. Smith, E.A. Saari, J. McCracken, R.P. Hausinger. 2000. Síte-directed mutagenesis of 2,4-dichlorophenoxyacetic acid / a-ketoglutarate dioxygenase. Identification of residues involved in metallocenter formation and substrate binding. J. Biol. Chem. 275: 12400-12409.

Holsters, M., D. De Waele, A. Depicker, E. Messens, M. Van Montagu, and J. Schell. 1978. Transfection and transformation of Agrobacterium tumefaciens. Mol Gen. Genet. 163: 181-187.

Horsch, R., J. Fry, N. Hoffman, J. Neidermeyer, S. Rogers, and R. Fraley. 1988. In Plant Molecular Biology Manual, S. Gelvin et al. , eds., Kluwer Academic Publishers, Boston Horvath, M., G. Ditzelm? Ller, M. Lodl, and F. Streichsbier. 1990 Isolation and characterization of a 2- (2,4-dichlorophenoxy) propionic acid-degenerative soil bacterium. Appl. Microbiol Biotechnol. 33: 213-216.

Jefferson, R. A. M. Bevan, and T. Kavanagh. 1987. The use of Escherichia coli ß-glucuronidase gene as a gene for marker studies of gene expression in higher plants. Biochem. Soc. Trans. 15: 17-19.

Karlin, S. and S.F. Altschul 1990. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. PNAS 87: 2264-2268.

Karlin, S. and S.F. Altschul 1993. Applications and statistics for multiple high-scoring segments in molecular sequences. PNAS 90: 5873-5877 Keller, G.H., and M.M. Manak 1987. DNA Probes. Stockton Press, New York, NY, pp. 169-170.

Khalafalla M, S. Rahman, H. El-Shemy, Y. Nakamoto, K. Wakasa, M. Ishimoto. 2005. Optimization of partiole bombardment conditions by monitoring of transient sGFP (S65T) expression in transformed soybean. Breeding Sci. 55: 257-263.

Khan M, L. Table, L. Heath, D. Spencer, T. Higgins. 1994. Aarobacrer / 'um-mediated transformation of subterranean clover (Trifolium subterraneum / _.). Plant Physiol 105: 81-88.

Kohler, H.P.E. 1999. Delftia acidovorans MH: a versatile phenoxyalkanoic acid herbicide degrader. J. Ind Microbiol and Biotech. 23: 336-340.

Li L, Qu R, Kochko A de, Fauquet CM, Beachy RN (1993) An improved rice transformation system using the biolistic method. Plant Cell Rep 12: 250-255 Linsmaier, E.M. and F. Skoog (1965) Organic growth factor requirements of tobaceous tissue cultures. Physiol. Plant. 18: 100-127.

Lorraine-Colwill, D. F., S. B. Powles, T. R. Hoawkes, P.H. Hollingshead, S.A.J. Arner, and C Preston. 2003. Investigations into the mechanism of glyphosate resistance in Lolium rigidum. Pestic. Biochem. Physiol. 74: 62-73.

Luo, H., Q. Hu, K. Nelson, C Longo, A. P. Kausch, J. M.

Chandlee, J. K. Wipff and C R. Fricker. 2004 Agrobacterium tumefaciens-mediated creeping bentgrass (Agrostis stolonifera L) transformation using phosphinothpcín selection results in a high frequency of single-copy transgene integration Plant Cell Reports 22 645-652 Lyon, B.R., D. J. Llewellyn, J. L. Huppatz, E. S. Dennis, and W. J. Peacock. 1989 Expression of a bacterial gene in transgenic tobaceous confers resistance to the herbicide 2,4-d? Chlorophenoxyacet? C acid Plant Mol Bio 13 533-540 Lyon, B.R., Y. L. Cousins, D. J. Llewellyn, and E. S. Dennis. 1993 Cotton plants transformed with a bacterial degradation gene are protected from accidental spray dpft damage by the herbicide 2,4-dichlorophenoxyacetic acid Transgenic Res 2 166-169.

Maniatis, T., E.F. Fritsch, J. Sambrook 1982 Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Martin, J.R. and W.W. Witt. 2002 Response of glyphosate tolerant and susceptible biotypes of horseweed (Conyza canadensis) to foliar app ed herbicides Proc North Cent Weed So Soc 57 185 Martinell B.J., L.S. Julson, CA. Emler, H. Yong, D.E. McCabe, E.J. Williams. 2002 Soybean Agrobacterium transformation method Patent Application of E U A No 6384301 McCabe D.E., W.F. Swain, B.J. Martinell, P. Christou. 1988 Stable transformation of soybean (Glycine max) by particle acceleration Bio / Technology 6 923-926 Miller S.D., P.W. Stahlman, P. Westra, G.W. Wicks, R.G. Wilson, J.M. Tichota 2003 Risks of weed spectrum shrinks and herbicide resistance in glyphosate-resistant cropping systems Proc.West Soc Weed Sci 56 61-62 Muller R, S. Jorks, S. Kleinsteuber, W. Babel. 1999 Comamonas acidovorans stram MC1 a new isolate capable of degenerative the chiral herbicides dichlorprop and mecoprop and the herbicides 2,4-D and MCPA Microbiol Res 154 241-246 Muller T, S. Byrde, C Werlen, J. Roelof van der Meer, H-P.

Kohler 2004 Genetic Analysis of Phenoxyalkanoic Acid Degradation in Sphingomonas herbicidovorans MH Appl Environ Microbiol 70 (10) 6066-6075 Muller T, T. Fleischmann, J. Roelof van der Meer, H-P. Kohler 2006 Pupfication and Charactenzation of Two Enantioselective a- Ketoglutarate-Dependent Dioxygenases, RdpA and SpdA from Sphingomonas herbicidovorans MH. Appl. Environ. Mycrobiol. 72 (7): 4853-4861.

Muller T, M. Zavodszky, M. Feig, L. Kuhn, R. Hausinger. 2006. Structural basis for the enantiospecificities of R- and S-specific phenoxyproprionate / a-ketoglutarate dioxygenases. Protein Sci. 15: 1356-1368.

Murashige T. and F. Skoog. 1962. A revised medium for rapid growth and bioassays with tobáceo tissue cultures. Physiol. Plant. 15: 473-497.

Murphy G.P., T.E. Dutt, R.F. Montgomery, T.S. Willard, G.A.

Elmore. 2002. Control of horseweed with glyphosate. Proc.North Cent. Weed Sci. Soc. 57: 194.

Ng, C.H., R. Wickneswari, S. Salmigah, Y.T. Teng, and B.S. Ismail. 2003. Gene polymorphisms in glyphosate-resistant and-susceptible biotypes of Eleusine indica from Malaysia. Weed Res. 43: 108-115.

Olhoft P.M. and D.A. Somers. 2001. L-Cysteine increases A? Jobacfe v / tt-mediated T-DNA delivery into soybean cotyledonary-node cells. Plant Cell Rep 20: 706-711 Olhoft, P.M., L.E. Flagel, C.M. Donovan, and D.A. Somers. 2003 Efficient soybean transformation utilization hygromycin B selection in the cotyledonary-node method. Plant 216: 723-735 Padgette S.R., K.H. Kolacz, X. Delannay, D.B. Re, B.J.

LaVallee, C.N. Tinius, W.K. Rhodes, Y.l. Otero, G.F. Barry, D.A. Eichholtz, V.M. Peschke, D.L. Nida, N.B. Taylor, and G.M. Kishore 1995 Development, identification, and characterization of a glyphosate-tolerant soybean line. Crop Sci. 1995; 35: 1451-1461.

Parrott W.A., J. N. All, M.J. Adang, M.A. Bailey, H.R. Boerma, and C.N. Stewart, Jr. 1994. Recovery and evaluation of soybean plants transgenic for a Bacillus thuringiensis var. Insecticidal kurstaki gene. In Vitro Cell. Dev. Biol. 30P: 144-149.

Popelka, J. C and F. Altpeter 2003. Agrobacterium tumefaciens-mediated genetic transformation of rye (Sécale cereale L) Mol. Breed 11: 203-211 Powles, S.B. and C Preston. 2006. Evolved glyphosate resistance in plants: biochemical and genetic basis of resistance. Weed Tech 20: 282-289.

Saari, R.E., D.A. Hogan, and R.P. Hausinger. 1999. Stereospecific degradation of the pheonxypropionate herbicide dichlorprop. J. Mol. Catal. B: Enz. 6: 421-428.

Saiki, R.K., S. Scharf, F. Faloona, K.B. Mullis, G.T. Horn, H.A. Eriich, and N. Arnheim. 1985. Enzymatic Amplification of ß-Globin Genomic Sequences and Restriction Site Analysis for Diagnosis of Sickie Cell Anemia. Science 230: 1350-1354.

Sambrook, J., E.F. Fritsch, and T. Maniatís. 1989. Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press.

Sambrook, J. and D.W. Russell. 2000. Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Schenk, R.U. and A.C Hildebrandt (1972) Methods and techniques for induction and growth of monocotyiedenous and dicotyledenous plant cell cultures. Dog. J. Bot. 50: 199-204.

Sfiligoj, E. 2004. Spreading resistance. Crop Life Number of March.

Simarmata, M., J.E. Kaufmann, and D. Penner. 2003. Potential basis of glyphosate resistance in California rigid ryegrass (Lolium rigidum). Weed Sci. 51: 678-682.

Singh R.J., T.M. Klein, CJ. Mauvais, S. Knowlton, T.

Hymowitz, CM. Kostow. Cytological characterization of transgenic soybean. Theor. Appl. Genet 1998; 96: 319-324.

Smejkal, C.W., T. Vallaeys, S.K. Burton, and H.M. Lappin-Scott. 2001. Substrate specificity of chiorophenoxyalkanoic acid-degrading bacteria is not dependent upon phylogenetically related tfdA gene types. Biol. Fertile. You are 33: 507-513.

Streber, W. and L. Willmitzer. 1989. Transgenic tobaceous plants expressing a bacterial detoxifying enzyme are resistant to 2,4-D. Bio / Technology 7: 811-816.

Streber, W.R., K.N. Timmis, and M. H. Zenk. 2000. Microorganisms and plasmids for 2,4-dichlorophenoxyacetic acid (2,4-D) monooxygenase formation and process for the production of these plasmids and strains. Patent of E.U.A. 6,153,401.

Streber, W.R., K.N. Timmis, and M.H. Zenk 1987 Analysis, cloning, and high-level expression of 2,4-dichlorophenixyacetic monooxygenase gene tfdA of Alcaligenes eutrophus JMP134. J. Bacteriol. 169: 2950-2955.

Suggs, S.V., T. Miyake, E.H. Kawashime, M.J. Johnson, K. Itakura, and R.B. Wallace. 1981. ICN-UCLA Symp. Dev. Biol. Using Purified Genes, D.D. Brown [ed.], Academic Press, New York, 23: 683-693.

Terakawa T, H. Hisakazu, Y. Masanori. 2005. Efficient whisker mediated gene transformation in a combination with supersonic treatment. Breedíng science 55: 456-358.

Tingay, S., D. McEIroy, R. Kalla, S. Fieg, W. Mingbo, S. Thornton, and R. Bretell. 1997 Agrobacterium tumefac? Ens-med \ a \ ed barley transformation Plant J 11 1369-1376 Weigel, D. and J. Glazebrook. 2002 Arabidopsis A Laboratory Manual Cold Spring Harbor Lab Press, Cold Spring Harbor, N Y 358 pp Weising, K., J. Schell, and G. Kahl 1988 Foreign genes in plants transfer, structure, expression and app cations Ann Rev Genet 22 421-477 Welter, M.E., D.S. Clayton, M.A. Míler, and J.F. Petolino 1995 Morphotypes of friable embryogenic maize callus Plant Cell Rep 14 725-729 Westendorf A., D. Benndorf, R. Muller, W. Babel. 2002 The two enantiospecific dichlorprop / a-ketoglutarate-dioxygenases from Delftia acidovorans MC1 -protein and sequence data from Rdpa and SdpA Microbiol Res 157 317-22 Westendorf, A., R.H. Muller, and W. Babel. 2003 Punfication and charactepzation of the enantiospecific dioxygenases from Delftia acidovorans MC1 initiating the degradation of phenoxypropionates and phenoxyacetate herbicides Acta Biotechnol 23 3-17 WSSA. 2002 Herbicide Handbook (8th ed) Weed Science Society of America Lawrence, KS 492 pp Zeng P, D. Vadnais, Z. Zhang, and J. Polacco. 2004. Refined glufosinate selection in A? / Robacre /? / M-mediated transformation of soybean [Glycine max (L.) Merr.]. Plant Cell Rep. 22: 478-482.

Zhang S (1995) Efficient plant regenerated from indica (group 1) rice protoplasts of one advanced breeding line and three varieties. Plant Cell Rep 15: 68-71 Zhang S, Chen L, Qu R, Marmey P, Beachy RN, Fauquet CM (1996) Efficient plant regeneration from indica (group 1) rice protoplasts of one advanced breeding line and three varieties. Plant Cell Rep15: 465-469.

Zhang S, Song W, Chen L, Rúa D, Taylor N, Ronald P, Beachy RN, Fauquet CM (1998) Transgenic elite Indicates rice varieties, resistant to Xanthomonas oryzae pv. oryzae Mol Breed 4: 551-558.

Zhang, Z., A. Xing, P.E. Staswick, and T. E. Clemente. 1999. The use of glufosinate as a selective agent in Agrobacterium-med iated transformation of soybean. Plant Cell, Tissue, and Organ Culture 56: 37-46.

Zhao, Z.Y., T. Cai, L. Tagliani, M. Miller, N. Wang, H. Pang, M. Rudert, S. Schroeder, D. Hondred, J. Seltzer, and D. Pierce. 2000. Ag / robacferíum-mediated sorghum transformation, Plant Mol. Biol. 44: 789-798.

Zipper, C, M. Bunk, A. Zehnder, H. Kohler. 1998 Enantioselective uptake and degradation of the chiral herbicide dichlorprop [(RS) -2- (2,4-dichlorophenoxy) propanoic acid] by Delftia acidovorans MH. J. Bact. 13: 3368-3374.

Claims (1)

1. NOVELTY OF THE INVENTION CLAIMS 1 - . 1 - A transgenic plant cell comprising a polynucleotide encoding an AAD-12 protein selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, a variant of SEQ ID NO: 2, and a variant of SEQ ID NO: 4, said variant having aryloxyalkanoate dioxygenase activity and at least 95% sequence identity with a sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 4. 2.- The cell according to claim 1, further characterized in that the expression of said polynucleotide imparts to said cell an ability to convert an auxin phenoxyacetate herbicide to a non-herbicidal molecule. 3. The cell according to claim 1, further characterized in that the expression of said polynucleotide imparts to said cell an ability to convert a pyridyloxy auxin herbicide to a non-herbicidal molecule. 4. A transgenic plant comprising a plurality of cells of claim 1, wherein the expression of said polynucleotide returns to said plant tolerant to said herbicide. 5 - . 5 - A method for selecting for at least one transgenic plant cell of claim 1, wherein said method comprises applying an aploxyalkanoate herbicide on and / or around said transgenic plant cells and for lacking a plant cell that lacks said polynucleotide, and allowing said transgenic plant cell and said lacking plant cells to grow 6 - The method according to claim 5, further characterized in that said transgenic plant cell is a plant cell of a transgenic harvest plant that grows in a field, and said lacking cells are cells of a weed that grows in said field 7 -. 7 - The method according to claim 5, further characterized in that said transgenic plant cell is a plant cell transformed with said nucleotide po, and said lacking cells are not transformants, and all those cells are grown in tissue culture medium. 8 - A method for weed control, said method comprises the application of a 2,4-D herbicide to a harvest plant and a weed, said harvest plant comprising a plurality of plant cells of claim 1 - method according to claim 8, further characterized in that said harvesting plant is a soybean plant 10. - The method according to claim 8, further characterized in that said weed is resistant to glyphosate. 1 1 - A method for protecting a crop plant from damage by an aryloxyalkanoate dioxygenase herbicide, said method comprising growing a plant comprising an AAD-12 gene, and applying said herbicide to said plant. 12 - The method according to claim 1 1, further characterized in that said herbicide is 2,4-D. 13 - The method according to claim 8, further characterized in that said plant additionally comprises a glyphosate resistance gene, and said method further comprises the application of glyphosate to said plant and said weed. 14. The method according to claim 13, further characterized in that said plant additionally comprises a third gene for herbicide resistance, and said method additionally comprises the application of a third herbicide to said plant and said weed. 15. A transgenic plant comprising a heterologous polynucleotide that encodes an enzyme that confers resistance to a pyridyloxy auxin herbicide. 16 - The transgenic plant according to claim 15, further characterized in that said polynucleotide also confers resistance to a phenoxy auxin herbicide. 17. - The plant according to claim 16, further characterized in that said phenoxy auxin herbicide is selected from the group consisting of, 4-D and MCPA. 18. The plant according to claim 15, further characterized in that said plant additionally comprises at least one additional gene for resistance to the herbicide. 19. A plant comprising a polynucleotide that encodes a protein having aryloxyalkanoate dioxygenase activity, wherein a nucleic acid molecule encoding said hybrid protein under severe conditions with the total complement of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5. 20. A polynucleotide that encodes a protein having aryloxyalkanoate dioxygenase activity, wherein a nucleic acid molecule encoding said hybrid protein under severe conditions with the full complement of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5, wherein said polynucleotide comprises a codon composition that is optimized for expression in a plant. 21. A plant cell comprising a heterologous polynucleotide that encodes a protein having aryloxyalkanoate dioxygenase activity, wherein a nucleic acid molecule encoding said hybrid protein under severe conditions with the total complement of a sequence selected from the group that consists of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5. 22 - A method for selecting a transformed plant cell of claim 21, wherein said method comprises subjecting a plurality of plant cells to transforming with said polynucleotide, then growing said cells in a concentration of a herbicide which allows transformed cells expressing said polynucleotide to grow while removing or inhibiting the growth of untransformed cells, wherein said herbicide is selected from the group consisting of a phenoxy auxin herbicide and a pyridyloxy auxin herbicide. 23 - The method according to claim 22, further characterized in that said cells are cells of a plant and said method is used to select a transformed plant. 24. A method for controlling at least one weed in a field, said method comprises seeding in said field seed of at least one transgenic plant, said plant comprising a heterologous polynucleotide that encodes an enzyme that confers resistance to a pyridyloxy auxin herbicide , and a second heterologous polynucleotide encodes an enzyme that confers resistance to at least one other herbicide; said method further comprises the application to at least a portion of said field of a first herbicide selected from the group consisting of a pipdoyloxy auxin herbicide and a phenoxy auxin herbicide, and the application of said at least one other herbicide to said less a portion of said field 25 - The method according to claim 24, further characterized in that said herbicides are applied sequentially or concurrently - The method according to claim 24, further characterized in that said first herbicide is a phenoxy auxin herbicide 27 - The method according to claim 24, further characterized in that said at least one other herbicide is selected from the group consisting of acetochlor, acifluorfen, alloxidim, amidosulfuron, aminopyra d, atrazine, beflubutamid, bispipbac, butafenacil, cafenstrol, carfentrazone. , clophuron, chlorotoluron, cinidon-ethyl, clethodim, clodinafop, clomazone, c loproxidim, clopira d, cloransulam, cyanazine, cyclosulfamuron, cycloxydim, cyhalofop, daimuron, dicamba, diclofop, diclosulam, diflufenican, dimethenamid, diquat, dithiopir, diuron, ethalfluralin, fenoxaprop, flazasulfuron, florasulam, fluazifop, flucarbazone, flufenacet, flufenican, flufenpir , flumetsulam, flumiclorac, flumioxazina, fluroxipir, fluthiacet, fomesafen, foramsulfuron, glufosinate, glyphosate, halosafen, halosulfuron, haloxifop, imazamethabenz, imazamox, imazapic, imazapir, imazaquin, imazethapir, imazosulfuron, todosulfuron, loxinil, isoxaben, isoxaflutol, lactofen, linuron , mefenacet, mefluidide, mesosulfuron, mesotopone, metamifop, methazachlor, metosulam, metp-buzin, MSMA, napropamide, nicosulfuron, norflurazon, oryzalin, oxadiazon, oxyfluorfen, paraquat, pebulate, pendimethalin, penoxsulam, picloram, picolinafen, pinoxaden, primisulfuron, profoxidim, propanil , piraflufen, pirazosulfuron, piribenzoxim, piriminobac, pirithiobac, piroxasulfone, piroxsulam, quinclorac, qui nmerac, quizalofop, rimsulfuron, sethoxidim, simazine, sulcotrione, sulfentrazone, sulfometuron, tefuriltrione, tembotrione, tepraloxidim, terbacil, thiazopyr, thidiazuron, thiencarbazone, thifensulfuron, thiobencarb, topramezone, tralkoxidim, triasulfuron, tribenuron, triclopyr, trifloxysulfuron, trifluralin, triflusulfuron, and tritosulfuron. 28. A method for assaying a protein for its ability to cleave a pyridyloxyalkanoate herbicide, said method comprises providing a sample comprising said protein and a pyridyloxy auxin herbicide, and assaying said sample for the presence of a chloropyridinol. 29. A method for assaying a protein for its aryloxyalkanoate dioxygenase activity wherein said method comprises providing a sample comprising said protein and 2- (2-chloro, 4-nitrophenoxy) propionate and / or acetate, and assaying said sample for the presence of a 2-chloro, 4-nitrophenol. 30.- A heritable expression cassette comprising a nucleic acid molecule that encodes a protein that enzymatically degrades at least one herbicide selected from the group consisting of a phenoxy auxin and a pyridyloxy auxin, wherein said hybrid nucleic acid molecule under severe conditions with the total complement of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5. 31 - The expression cassette according to claim 30, further characterized in that said promoter is a plant promoter. 32 - The expression cassette according to claim 30, further characterized in that it comprises a promoter selected from a promoter of the mosaic virus of the cassava vein, promoter of CaMV 35S, promoter of the virus in mosaic of the escrofularia, promoter of rice actin, phaseolin promoter, Ubiquitin 10 promoter of Arabidopsis thaliana, Ubiquitin promoter of corn, Act2 promoter of Arabidopsis thaliana, Ubiquitin 1 1 promoter of Arabidopsis thaliana, and Ubiquitin 3 promoter of Arabidopsis thaliana. 33. The method according to claim 24, further characterized in that said plant is resistant to a herbicide formulation comprising glyphosate. 34 - A method for controlling weeds in a field, wherein said method comprises applying a first herbicide to said field and planting a seed in said field within the first 14 days of the application of said first herbicide, wherein said seed it comprises a cell according to claim 1, and wherein said first herbicide is selected from the group consisting of a phenoxy auxin and a pyridyloxy auxin. 35. - The method according to claim 34, further characterized in that said first herbicide is an acid, an inorganic salt, an organic salt, or an ester 36 - The method according to claim 34, further characterized in that said seed comprises a second gene returning to said plant resistant to a second herbicide, and said method additionally comprises the application of said second herbicide to said field before said seeding. 37. The method according to claim 36, further characterized in that said second herbicide is selected from the group consisting of glyphosate, gramoxone, and glufosinate. 38 - A method for detecting whether a plant comprises a polynucleotide of claim 20, wherein said method comprises collecting a sample from said plant and assaying said sample for the presence of said polynucleotide. 39.- The method according to claim 38, further characterized in that said method comprises assaying said sample for the presence of a protein encoded by said polynucleotide. The method according to claim 38, further characterized in that said method comprises using an initiator PCR or probe to detect the presence of said polynucleotide. 41. - The method according to claim 39, further characterized in that said method comprises using an antibody to detect the presence of said protein. 42. The plant according to claim 15, further characterized in that said plant further comprises a gene for resistance to the insect derived from an organism selected from the group consisting of Bacillus thuringiensis, Photorhabdus, and Xenorhabdus. 43.- The plant according to claim 15, further characterized in that said plant further comprises a gene for an agronomic trait selected from the group consisting of fungal resistance, stress tolerance, increased yield, improved oil profile, quality of improved fiber, viral resistance, delayed maturation, cold tolerance, and salt tolerance. 44. A method for controlling at least one weed in a field, said method comprising growing at least one transgenic plant of claim 15 in said field, and applying a pyridyloxy auxin herbicide to at least a portion of said field. 45.- A method for controlling at least one weed in a field, said method comprises growing at least one plant of claim 16 in said field, and applying a phenoxy auxin herbicide to at least a portion of said field. 46. The method according to claim 44, further characterized in that it comprises applying a phenoxy auxin herbicide to at least a portion of said field. 47. The method according to claim 44, further characterized in that said pyridyloxy auxin herbicide is selected from the group consisting of fluroxypyr and triclopyr. 48. The method according to claim 45, further characterized in that said phenoxy auxin herbicide is selected from the group consisting of 2,4-D and MCPA. 49. The method according to claim 45, further characterized in that said plant is resistant to a herbicide selected from the group consisting of glyphosate, glufosinate, imazethapyr, chlorsulfuron, dicamba, mesotrione, isoxaflutole, and butafenacil. 50 - The method according to claim 45, further characterized in that said herbicide is an achiral phenoxy auxin. 51 - The method according to claim 24, further characterized in that said plant is a monocot. 52. The method according to claim 51, further characterized in that said monocot is selected from the group consisting of corn, rice, wheat, barley, rye, herbs of warm and cold season turf, oats, sorghum, and pasture grasses. 53. - The method according to claim 24, further characterized in that said first herbicide is a phenoxy auxin and said plant is a dicotyledonous. 54. The method according to claim 53, further characterized in that said dicotyledon is selected from the group consisting of cotton, tobacco, cañola, and soybeans. 55 - A method for imparting resistance to the herbicide to a harvest wherein said method comprises introducing into the at least one plant cell of said harvest a polynucleotide which encodes an enzyme capable of using a pyridyloxy auxin herbicide and a phenoxy auxin herbicide as a substratum. 56.- A method to control glyphosate-resistant weeds, naturally tolerant to glyphosate, and / or tolerant to glufosinate naturally in a field of glyphosate-tolerant and / or glufosinate-tolerant crop plants, wherein said plants comprise a polynucleotide of claim 13, and said method comprises applying an aryloxyalkanoate herbicide to at least a portion of said field. 57. The method according to claim 56, further characterized in that said herbicide is a phenoxy auxin. 58. The method according to claim 57, further characterized in that said phenoxy auxin is 2,4-D. 59 - A method for controlling weeds that are resistant to a herbicide that inhibits ALS in a crop plant field comprising a polynucleotide of claim 20, said method comprising applying an aryloxyalkanoate herbicide to at least a portion of said field . 60. The cell according to claim 1, further characterized in that said plant cell is selected from the group consisting of dicotyledonous cells and monocotyledonous cells. 61.- The cell according to claim 60, further characterized in that said plant cell is dicotyledonous and is selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a bean cell soybean, and an Arabidopsis cell. 62. The cell according to claim 60, further characterized in that said plant cell is a monocotyledonous cell selected from the group consisting of a rice cell and a maize cell. 63.- The cell according to claim 61, further characterized in that said pyridyloxy auxin herbicide is selected from the group consisting of fluroxypyr and triclopyr. 64.- The plant according to claim 4, further characterized in that the expression of said polynucleotide returns to said plant resistant to both a phenoxyacetate auxin herbicide and a pyridyloxy auxin herbicide. 65 -. 65 - The method according to claim 8, further characterized in that said method comprises the application of a second herbicide 66 - The method according to claim 22, further characterized in that said 2,4-D herbicide and said second herbicide are applied sequentially 67 - The method according to claim 22, further characterized in that said first herbicide and said second herbicide are concurrently applied. The method according to claim 8, further characterized in that said plant is resistant to glyphosate. according to claim 24, further characterized in that said second polynucleotide is a modified EPSPS (5-enolp? ruv? lsh? k? mato-3-phosphate synthase) 70 - The method according to claim 24, further characterized in that said first herbicide is a phenoxy auxin and said second herbicide is selected from the group consisting of glyph Sato and glufosmate 71 - The method according to claim 70, further characterized in that said phenoxy auxin is 2,4-D and said second herbicide is glyphosate 72. - The method according to claim 24, further characterized in that said method additionally comprises the application of a third herbicide. 73.- A polynucleotide optimized for expression in a plant wherein said polynucleotide encodes a protein having aryloxy alkanoate dioxygenase activity, wherein a nucleic acid molecule encoding said hybrid protein under severe conditions with the full complement of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5. The polynucleotide according to claim 44, further characterized in that said polynucleotide is optimized for expression in a dicotyledonous plant or a monocotyledonous plant. 75.- An isolated polynucleotide that encodes a protein that enzymatically degrades a herbicide selected from the group consisting of a phenoxy auxin and a pyridyloxy auxin, wherein a nucleic acid molecule encoding said hybrid protein under severe conditions with the total complement of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5, wherein said polynucleotide is operatively associated with a promoter that is functional in a plant cell. 76 - The polynucleotide according to claim 75, further characterized in that said promoter is a plant promoter. 77. - The polynucleotide according to claim 76, further characterized in that said promoter is a promoter of the mosaic virus of the cassava vein. 78. The method according to claim 22, further characterized in that said polynucleotide is used as a selectable marker. 79.- A seed comprising a plant cell of claim 1. 80.- A plant grown from the seed of claim 79. 81 - A regenerable part, progeny, or element for asexual propagation of the plant of claim 4. 82.- The method according to claim 8, characterized also because said method is used to treat or prevent weeds resistant to the herbicide. 83. The plant according to claim 4, further characterized in that said plant additionally comprises a gene for resistance to the insect derived from an organism selected from the group consisting of Bacillus thuringiensis, Photorhabdus, and Xenorhabdus. 84.- The plant according to claim 4, further characterized in that said plant additionally comprises a gene for an agronomic trait selected from the group consisting of fungal resistance, stress tolerance, increased yield, improved oil profile, quality of Improved fiber, viral resistance, delayed maturation, cold tolerance, and salt tolerance 85 - A method for the control of glyphosate resistant weeds in a field of ghfosato-tolerant crop plants, where said plants comprise a nucleotide po of claim 20, and said method comprises applying an aploxyalkanoate herbicide to at least a portion of said field 86 - The method according to claim 85, further characterized in that said herbicide is a phenoxy auxin 87 - The method according to claim 25, further characterized in that said herbicides are applied from a mixture in tanq. 88. The method according to claim 10, further characterized in that said at least one of said weeds comprises at least one ghost resistant volunteer plant of a different species compared to that of said transgenic crop.