MX2008004098A - Invertase and inhibitors from coffee - Google Patents

Abstract

Disclosed herein are nucleic acid molecules isolated from coffee (Coffea spp.) comprising sequences that encodes various sucrose metabolizing enzymes, along with their encoded proteins. Specifically, three types of invertase and four invertase inhibitors and their encoding polynucleotides from coffee are disclosed. Also disclosed are methods for using these polynucleotides for gene regulation and manipulation of the sugar profile of coffee plants, to influence flavor, aroma, and other features of coffee beans.

Description

INVERTASA AND COFFEE INHIBITORS FIELD OF THE INVENTION The present invention relates to the field of agricultural biotechnology. More particularly, the invention relates to enzymes involved in the metabolism of sucrose in plants, in coffee in particular, and to the genes and nucleic acid sequences encoding these enzymes, together with the regulatory mechanisms that regulate the metabolism of the enzyme. sucrose via these enzymes.

ENVIRONMENT OF THE INVENTION Various publications, including Patents, published applications and school articles, cited through this specification, are hereby incorporated by reference in their entirety. Appointments that are not mentioned within the specification can be found at the end of it.

Sucrose plays an important role in the final aroma and flavor that is delivered by a grain or coffee bean. During the roasting of the coffee bean, the sugars of Reduction will react with an amino group containing molecules in a Maillard-type reaction, which generates a significant number of products with caramel, sweet and burnt type aromas and dark colors that are typically associated with coffee flavor (Russwurm, 1969; Holscher and Steinhart, 1995; Badoud, 2000). It has been found to be the highest quality Arabica grain. { Coffea Arábica) has appreciably higher levels of sucrose (between 7.3 and 11.4%) than Robusta grain of lower quality. { Coffea canephora) (between 4 and 5%) (Russwurm, 1969, Illy and Viani, 1995, Chahan et al., 2002, Badoud, 2000). Despite being significantly degraded during roasting, sucrose still remains in the roasted grain at concentrations of 0.4-2.8% dry weight (DW); contributing directly to the sweetness of coffee. There is a clear correlation between the level of sucrose in the grain and the taste of the coffee. Therefore, identifying and isolating the main enzymes responsible for the metabolism of sucrose and the underlying genetic bases for variations in the metabolism of sucrose, will allow advances in the technique of improving coffee quality.

Currently, there are no published reports on the genes or enzymes involved in the metabolism of Sucrose in the coffee. However, the metabolism of sucrose has been studied in the Lycopersicon esculen tum tomato (a close relative of coffee, both are members of the class I of astérido), especially during the development of the tomato fruit. An overview of the enzymes directly involved in the metabolism of sucrose in tomato, is shown in Figure 1 (Nguyen-Quoc et al., 2001). The key reactions in this pathway are (1) the continuous rapid degradation of sucrose in citostol by means of sucrose synthase (SuSy) and cytoplasmic invertase (I), (2) synthesis of sucrose by SuSy or phosphate synthase of sucrose (SPS), (3) the hydrolysis of sucrose in the vacuole or in the apoplast (region external to the plasma membrane, including cell walls, xylem vessels, etc.) by acidic invertase (vacuolar or attached to the cell wall) and, (4) rapid synthesis and decomposition of starch in the amioplasto .

As in other deposit organs, the sucrose pattern that is discharged is not constant during the development of tomato fruits. In the early stages of fruit development, sucrose is discharged intact from the phloem by the symplast pathway (direct connections between cells) and does not degrade to its hexoses Composed during the download. Both of the expression and enzymatic activity of SuSy are higher at this stage and are directly correlated with the discharge capacity of the phloem sucrose (phenomenon also called deposit force; Sun, et al., 1992; Zrenner et al. , nineteen ninety five). Later in the development of the fruit, the simplistic connections are lost. Under these discharge conditions, sucrose is rapidly hydrolyzed out of the cells of the fruit by the invertase attached to the cell wall and then the products of glucose and fructose are imported into the cells by the hexose transporters. Sucrose is subsequently synthesized de novo in the cytoplasm by SuSy or by SPS (Figure 1), SPS catalyzes an essentially irreversible reaction in vivo due to its close association with the enzyme phosphatase of sucrose phosphate (Echeverría et al., 1997). In parallel with the loss of the simplistic connections, the activity of SuSy decreases, and eventually it becomes undetectable in the fruit at the beginning of maturation (Robinson et al., 1998; Wang et al., 1993). Therefore, late in the development of tomato fruit, the SPS enzyme, in association with SP, appear as the main enzymes for. the synthesis of sucrose.

The invertases of the plants have been separated into two groups based on the optimum pH for the activity. The invertases of the first group are identified as neutral invertas, which are characterized by having an optimum pH on the scale of 7-8.5. It has been found that neutral invertases are located in the cytosol of plant cells. The invertases of the second group are identified as acidic invertases, and are characterized by having an optimum pH for activity between 4.5 and 5.5. It has been shown that acid invertase exists in both soluble and insoluble forms (Sturm and Chrispeels, 1990). The insoluble acid invertase is irreversibly and covalently associated with the cell wall; while the soluble acid invertase is located in both the vacuole and the apoplast.

Research during the past decade showed that vacuolar invertase, as well as that linked to the cell wall, are key enzymes in the regulation of sucrose metabolism during the development of the fruit of several species. The red fruit species of the tomato, such as the commercial species Lycopersicon esculentum and the wild species L. pimpinela folium, for example, do not store high levels of gsacarosa but, instead, accumulate hexoses in the form of glucose and fructose.

The evidence of crosses of red fruit species with green fruit species that accumulate sucrose (Yelle et al., 1991) has demonstrated the crucial role of acidic invertase to avoid the final accumulation of sucrose in red fruit tomato species . Genetic analysis studies have located the site that confers high levels of soluble solids in the L fruit. pimpinellifolium with the known position of vacuolar invertase TIV1 (Tanksley et al., 1996, Grandillo and Tanksley, 1996). A similar conclusion was reached from the analysis of the expression of a TIV1 cDNA construct of contrasense in transgenic tomatos (Klann et al., 1993; Klann et al., 1996). Therefore, it is considered that the vacuolar form of invertase plays a major role both in the regulation of hexose levels in mature fruits and in the regulation of the mobilization of sucrose stored in vacuoles (Klann et al., 1993; Yau and Simón, 2003). It is believed that isoforms attached to the cell wall are involved in the discharge of the phloem and in the partition of sucrose (Scholes et al., 1996).

The importance of invertase bound to the cell wall has been demonstrated by studies with transgenic tomato plants (Dickinson et al., 1991) and tobacco (von Schaewen et al., 1990) overexpressing invertase of the cell wall n a constitutive form. The high levels of invertase activity in these plants caused reduced levels of saccharose transport between the reservoir and source tissues, which led to atrophied growth and the general morphology of the atrophied plant. The reduction of invertase activity has also been shown to have dramatic effects on plant and seed development in several species. The analysis of transgenic carrots with reduced levels of invertase in the cell wall due to the constitutive expression of an invertase construction of contrasts in the cell wall (Tang et al., 1999) has shown dramatic consequences in the early development of the plant. as in the formation of the columnar root during the early lengthening phase.

Studies of mutant seed minia ture-1 . { mnl) in corn (Lowe and Nelson, 1946), which is characterized by an aberrant pedicel and a drastic reduction in the size of the endosperm, have shown that the Mnl site of the seed encodes an invertase of the cell wall, the C I- 2 (Miller and Chourey, 1992; Cheng et al., 1996). Interestingly, in the mnl mutant, the overall activity of acidic invertase (vacuolar and attached to the cell wall) is dramatically reduced, suggesting control coordinated of both activities of vacuolar enzymes and cell wall.

Due to the importance of sucrose for the taste of high quality coffee, there is a need to determine the metabolism of sucrose grains and the interaction of the genes involved in that metabolism. There is also a need to identify and isolate the genes encoding these enzymes in coffee, thereby providing the genetic and biochemical tools to modify the production of sucrose in coffee beans to manipulate the flavor and aroma of coffee.

DESCRIPTION OF THE INVENTION One aspect of the present invention represents a nucleic acid molecule isolated from coffee (Coffea spp.) Comprising a coding sequence that encodes an invertase or an invertase inhibitor. In one embodiment, the coding sequence encodes an invertase, which may be a cell wall invertase, a vacuolar invertase or a neutral invertase. In the specific representations, the invertase of the cell wall comprises a conserved domain having the amino acid sequence WECPDF. IN several representations, -Jila invertase comprises an amino acid sequence greater than 55% identical to SEQ ID NO: 9 or SEQ ID NO: 13, and preferably comprises SEQ ID NO: 9 or SEQ ID NO: 13. In the example representations , the nucleic acid molecule comprises SEQ ID NO: 1 or SEQ ID NO:.

In another embodiment, the invertase is a vacuolar invertase and comprises a conserved domain having the amino acid sequence WECVDF: The vacuolar invertase may comprise an amino acid sequence 70% or more identical to SEQ ID NO: 10, and preferably comprises the SEQ ID NO: 10. In an exemplary embodiment, the nucleic acid molecule encoding the vacuolar invertase comprises SEQ ID NO: 2.

In another embodiment, the invertase is a neutral invertase, which may comprise an amino acid sequence 84% or more identical to SEQ ID NO: 11, and preferably comprises SEQ ID NO: 11. In an exemplary embodiment, the molecule of Nucleic acid encoding the neutral invertase comprises SEQ ID NO: 3.

In other embodiments, the coding sequence encodes an invertase inhibitor. In certain In embodiments, the invertase inhibitor comprises four cysteine residues conserved in their amino acid sequence. The invertase inhibitor may comprise an amino acid sequence that is 25% or more identical to any of SEQ ID NOS: 13, 14, 15 or 16, and preferably comprises any of SEQ ID NOS: 13, 14, 15 or 16 In the exemplary embodiments, the nucleic acid molecule encoding the invertase inhibitor comprises any of SEQ ID NOS: 5, 6, 7 or 8.

In certain embodiments, the coding sequence described above is an open reading frame of a gene. In other representations, it is a mRNA molecule produced by the transcription of that gene, or a cDNA molecule produced by the reverse transcription of the mRNA molecule of claim. Other representations are directed to an oligonucleotide of between 8 and 100 bases in length, which is complementary to a segment of the above nucleic acid molecule.

Another aspect of the invention represents a vector comprising the coding sequence of the invertase or the invertase inhibitor encoding the nucleic acid molecules described above. In certain In one embodiment, the vector is an expression vector selected from the group of vectors consisting of plasmid, phagemid, cosmid, baculovirus, bacmid, bacterial, yeast and viral vectors. Several representations comprise vectors in which the coding sequence of the nucleic acid molecule is operably linked to a constitutive promoter, or to an inducible promoter, or to a specific tissue promoter, preferably a seed-specific promoter in this latter embodiment.

Host cells transformed with any of the vectors described above are also provided in another aspect of the invention. The host cells can be plant cells, bacterial cells, fungal cells, insect cells or mammalian cells. A fertile produced from a transformed plant cell of the invention is also provided.

Another aspect of the invention represents a method for modulating the flavor or aroma of coffee beans, which comprises modulating the production or activity of one or more invertases or invertase inhibitors within the coffee seeds. In certain representations, the method comprises the increased production or activity of the one or more invertases or invertase inhibitors. In certain embodiments, this is achieved by increasing the expression of one or more endogenous invertase inhibitor or invertase genes within the coffee seeds. Other representations include introducing an invertase - or invertase inhibitor - that encodes the transgene within the plant.

In a particular embodiment, the method comprises increasing the production or activity of one or more invertase inhibitors. In this representation, the endogenous invertase activity in the plant can be decreased compared to an equivalent plant in which the production or activity of the invertase is not increased. In addition, the plant may contain more sucrose in its seeds than that which has an equivalent plant in which the activity of the invertase inhibitor is not increased.

In other embodiments, the method comprises decreasing the production or activity of one or more invertases or invertase inhibitors. This can be achieved by introducing a nucleic acid molecule in the coffee that inhibits the expression of one or more of the invertase-or invertase inhibitor-coding genes. In a particular representation, the expression or activity of the invertase are decreased. In this representation, the plant may contain more sucrose in its seeds than it has an equivalent plant in which the activity of the invertase is not diminished.

Other representations and advantages of the invention will be understood with reference to the detailed description and to figures 1 to 9 below.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Model for the metabolism of sucrose in tomato fruit. The S (Sucrose) is imported from a phloem by a sympathetic pathway or is hydrolyzed by the invertase in the cell wall. Glucose and fructose are imported into the cytosol by the specific Sugar Transporter Proteins. In the cytosol, sucrose is degraded by SS (sucrose synthase) and its re-synthesis is catalyzed by SPS (sucrose phosphate synthase) associated with SP (sucrose phosphatase) or SS. Sucrose can be exported into the vacuole and hydrolyzed by the vacuolar invertase. UDP glucose after modifications can be used for the synthesis of starch in the chromoplast. Abbreviations: G, glucose; F, fruitful; F6-P, 6-fructose phosphate; UDP-G, glucose-UDP; G6-P, glucose 6-phosphate; S6-P, 6-sucrose phosphate; I, invertase; SP, sucrose phosphatase; SPP, sucrose synthase phosphate.

Figure 2. Alignment of the Cclnv2 protein sequence with vacuolar acid invertase proteins. The protein sequences were selected based on the BLASTp homology search using Cclnv2 (Invertase 2 from Coffea canephora, SEQ ID NO: 10). The access numbers to GenBank are: P29000 for the acid invertase of the TIVL tomato . { Lycopersicon esculen tum) (SEQ ID NO .: 17), C7? A47636.1 for the acid invertase of the carrot. { Daucus carota) (SEQ ID NO .: 18), AAQ17074 for the acid invertase of the potato. { Solarium tuberosum) (SEQ ID NO .: 19) and CAE01318 for the arabic Coffea inv2 (SEQ ID NO.:20). The amino acids that differ from those of the Cclnv2 sequence are colored in gray. The alignment was made using the Clustal W program in the MegAlign software (Lasergene package, DNA STAR). The NDPNG amino acid sequence is a characteristic of plant acid invertases (motif WECVDF is specific for vacuolar invertase.

Figure 3. Alignment of the Calnv3 protein sequence with vacuolar acid invertase. The sequences of protein were selected based on the BLASTp homology search using Calnv3 (Coffea arabica Invertase 3, SEQ ID NO: 11). The access numbers to GenBank are: NP_567347 for AT NInv (neutral cytoplasmic invertase of A. thaliana) (SEQ ID NO.:21), and CAG30577 for LJNInvl (neutral cytoplasmic invertase of Lotus cornicula tus var. Japonicus) (SEQ ID NO .: 22). The alignment was done using the Alignment was done using the Clustal W program in the MegAlign software (Lasergene package, DNA STAR). The amino acids that differ from those of the Calnv3 sequence are colored in gray.

Figure 4. Partial alignment of the sequence of the Cclnv4 protein with the TIV1 and LIN6 acid invertase proteins. The partial protein alignment between Cclnv4 (SEQ ID NO.:12), TIV1 (vacuolar invertase) (SEQ ID NO .: 17) and LIN6 (invertase bound to the cell wall) (SEQ IN NO.:23), was made using the Clustal W program in the MegAlign software (Lasergene package, DNA STAR). The access numbers to GenBank are P29000 for TIV1 and AAM28823 for LIN6 of the tomato. { Lycopersicon esculen tum). The amino acids that differ from those of the Cclnv4 sequence are colored in gray.

Figure 5 Alignment of protein sequence of Ccinvl with invertase proteins bound to the cell wall. The protein sequences were selected based on the BLASTp homology search using Ccinvl (Invertase 1 from Coffea canephora, SEQ ID N0: 9). The access numbers to GenBank are: CAB85897 for LIN5 (SEQ ID NO.:24), AAM28823 for LIN6 of tomato (Lycopersicon esculentum) (SEQ ID NO.:23), CAA49162.1 for invertase DCCWInv of carrot. { Da ucus carota) (SEQ ED NO.:25), and CAE01317 for invl of Coffea arabica (SEQ ID N0.26). The amino acids that differ from the Ccinvl sequence are colored in gray. The alignment was made using the Clustal W program in the MegAlign software (Lasergene package, DNA STAR). The amino acid sequence NDPNG (SEQ ID NO.:27) is a characteristic of acidic invertases it is specific for the periplasmic invertase or the one attached to the cell wall.

Figure 6. Alignment of the Cclnv protein sequence with invertase inhibitor proteins. Alignment of the proteins Ccinvl, 2, 3 and 4 (SEQ ID NOS .: 13, 14, 15 and 16, respectively) with the Zm-lnvl (CAC69335.1) of the maize. { Zea mays) (SEQ ID NO.:29) and the Nt Invl (AAT01640) of tobacco. { Nicotiana tabacum) (SEQ ID NO.:30). The amino acids identical to the consensus sequence are colored in Gray. Four conserved Cys residues are noted. The alignment was made using the Clustal W program in the MegAlign software (Lasergene package, DNA STAR).

Figure 7. Changes in activity of acidic invertase and neutral in whole grains (separated from the pericarp and locules) during CCCA12 (C. arabica) and FRT05, FRT64 (C. canephora). For this study, coffee beans have been used in four different ripening stages characterized by size and color, that is, SG (small green, acronym in English), LG (large green), Y (yellow), and R (red). Enzyme activities are expressed in μmoles. h ~ 1.mg ~ 1proteins.

Figure 8. Tissue-specific expression profile of the Ccinvl inverted (bound to the cell wall), Cclnv2 (vacuolar) (A and B) and Cclnv3 (cytoplasmic) in C. canephora (robusta, BP 409) and C. arabica (Arabica, T2308) using RT-PCR in real time. Total RNA was isolated from root, flower, leaf and coffee beans harvested in four different stages of maturation, ie, small green (SG), large green (LG), yellow (Y), and red (R). For each stage of maturation, the coffee cherries were separated from the pericarp (P) and the grains (G). Total RNA was reverse transcribed and subjected to real-time PCR using TaqMan-MGB probes. The relative amounts were calculated and normalized with respect to the rpl39 transcript levels. The data shown represent the average values obtained from three amplification reactions and the error bars indicate the SD of the mean.

Figure 9. Tissue-specific expression profile of the invertase inhibitors Cclnvll, CcInvI2, CcInvI3 and CcInvI4 in C. canephora (robusta, BP409) and C. arabica (Arabica, T2308) using real-time RT-PCR. The total RNA of root, flower, leaf and coffee beans harvested was isolated in four different stages of maturation, ie, small green (SG), large green (LG), yellow (Y), and red (R). For each stage of maturation, the coffee cherries were separated from the pericarp (P) and the grains (G). Total RNA was reverse transcribed and subjected to real-time PCR using TaqMan-MGB probes. The relative amounts were calculated and normalized with respect to the rpl39 transcript levels. The data represent the average values obtained from three amplification reactions and the error bars indicate the SD of the mean.

DETAILED DESCRIPTION OF ILLUSTRATIVE REPRESENTATIONS Definitions: Various terms relating to biological molecules and other aspects of the present invention are used throughout the specification and the claims. The terms are assumed to have their usual meaning in the field of molecular biology and biochemistry, unless specifically defined otherwise here.

The term "sucrose metabolizing enzyme" refers to enzymes of plants whose function is primarily to accumulate sucrose or to degrade sucrose within the plant and includes, for example, saccharose synthase (SuSy), sucrose synthase phosphate ( SPS) and sucrose phosphatase (SP), as well as invertases (Inv) of various types, and invertase inhibitors (Invl). Together, the different enzymes metabolizing sucrose operate to control the metabolism of sucrose as required by the plant either for storage or energy needs.

"Isolated" means altered from the natural state "by the hand of man". If a composition or substance occurs in nature, it has been "isolated" if it has been changed or removed from its natural environment, or both. For example, a polynucleotide or a peptide naturally present in a living plant or animal is not "isolated", but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is used herein.

"Polynucleotide", also called "nucleic acid molecule", generally refers to any polyribonucleotide or polideoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides include, without limitation, single or double stranded DNA, DNA that is a mixture of the single and double stranded regions, single and double stranded RNA, and RNA that is a mixture of the regions of single and double strand, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded, or a mixture of single-stranded and double-stranded regions.In addition, "polynucleotide" refers to regions triple strand comprising RNA or DNA or both RNA and DNA The term polynucleotide also includes DNAs or RNAs that contain one or more modified bases and DNAs or RNAs with principal elements modified for stability, or by other The "modified" bases include, for example, tritilated bases and bases unusual such as inosine. A variety of modifications to DNA and RNA can be made; therefore, "polynucleotide" encompasses the chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also encompasses relatively short polynucleotides, often called oligonucleotides.

"Polypeptide" refers to any polypeptide or protein comprising two or more amino acids joined together by means of peptide bonds or modified peptide bonds, that is, isosteres. "Polypeptide" refers to both short chains, commonly known as peptides, oligopeptides or oligomers, and long chains, generally called proteins. The polypeptides may contain amino acids other than the amino acids encoded by the gene 20. The "polypeptides" include the amino acid sequences modified either by natural processes, such as the post-translational process, or by chemical modification techniques that are well known in the art. The technique. These modifications are described a lot in the basic texts and in more detailed monographs, as well as in a voluminous literature of investigation. Modifications can occur anywhere in a polypeptide, including the main element of the peptide, the amino acid side chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in equal or variant degrees at several sites in a given polypeptide. Also, a given polypeptide can contain many types of modifications. The polypeptides can be branched as a result of ubiquitination, and can be cyclic, with or without branching. The cyclic, branched and branched cyclic polypeptides can be the result of natural post-translational processes or can be made by synthetic methods. Modifications include acetylation, acylation, ADP ribosylation, amidation, covalent binding of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, covalent crosslink formation, cystine formation, pyroglutamate formation, formylation, gamma carboxylation, glycosylation, GPI anchoring, hydroxylation, iodination, methylation, myristoylation, oxidation, processing proteolytic, phosphorylation, prenylation, racemization, selenoylation, sulfation, amino acid addition mediated by RNA transfer to proteins, such as arginilation and ubiquitination. See, for example, Proteins - Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al., "Analysis for Protein Modifications and Nonprotein Cofactors", Meth Enzymol (1990) 182: 626-646 and Rattan et al., "Protein Synthesis: Posttranslational Modifications and Aging", Arm NY Acad Sci (1992) 663: 48-62.

"Variant", as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, respectively, but that retains essential properties. A typical variant of a polynucleotide differs in the nucleotide sequence from another reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Changes in the polynucleotide can result in substitutions, additions, deletions, fusions and truncations of the amino acid in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in the amino acid sequence of another reference polypeptide. Generally, the differences are limited so that the sequences of the reference polypeptide and variant are generally similar and, in many regions, identical. A variant and the reference polypeptide may differ in the amino acid sequence by one or more substitutions, additions or deletions in any combination. A substituted or inserted amino acid residue may or may not be encoded by the genetic code. A variant of a polynucleotide or polypeptide can be naturally occurring, such as an allelic variant, or it can be a variant that is not known to occur naturally. The non-naturally occurring variants of polynucleotides and polypeptides can be made by means of mutagenesis techniques or by direct synthesis.

With reference to mutant plants, the terms "null mutant" or "loss-of-function mutant" are used to designate an organism or a genomic DNA sequence that causes a genetic product to be non-functional or largely absent. These mutations can occur in coding regions and / or regulation of the gene, and can be changes of individual residues, or insertions or deletions of nucleic acid regions. These mutations can also occur in the coding and / or regulatory regions of other genes that can regulate or control a gene and / or the encoded protein so that the protein is caused to be non-functional or largely absent.

The term "substantially the same" refers to nucleic acid or amino acid sequences that have sequence variations that do not materially affect the nature of the protein (i.e., structure, stability characteristics, substrate specificity and / or the biological activity of the protein). With particular reference to the nucleic acid sequences, the term "substantially the same" is intended to refer to the coding region and the conserved sequences that govern expression, and refers primarily to the degenerate codons encoding the amino acid, or alternating codons that encode the conservative substitute amino acids in the encoded polypeptide. With reference to the amino acid sequences, the term "substantially the same" generally refers to substitutions and / or conservation variations in polypeptide regions not involved in the determination of the structure or function.

The terms "identical percent" and "similar percent" are also used herein in comparisons between the amino acid and nucleic acid sequences. When referring to the amino acid sequences, "identity" or "identical percent" refers to the percentage of the amino acids in the subject amino acid sequence that have coincided with identical amino acids in the compared amino acid sequence by means of a test program of sequence. "Similar percent" refers to the percentage of the amino acids of the subject amino acid sequence that has coincided with the identical or conserved amino acids. Preserved amino acids are those that differ in structure but are similar in physical properties such that the exchange of one for the other does not appreciably change the tertiary structure of the resulting protein. Conservation substitutions are defined in Taylor (1986, J. Theor, Biol. 119: 205). When referring to nucleic acid molecules, "identical percent" refers to the percentage of nucleotides in the subject nucleic acid sequence that have matched the identical nucleotides by means of a sequence analysis program.

"Identity" and "similarity" can be easily calculated by known methods. The nucleic acid sequences and the amino acid sequences can be compared using computer programs that align the similar sequences of the nucleic acid and the amino acids and therefore define the differences. In the preferred methodologies, the BLAST programs (NCBI) and their parameters are used, and the DNAstar system (Madison, Wl) is used to align the sequence fragments of the genomic DNA sequences. However, alignments and equivalent similarity / identity assessments can be obtained through the use of any standard alignment software. For example, the GCG Wisconsin Package version 9.1, available at the Genetics Computer Group in Madiso, Wisconsin, and the system parameters used by the program (penalty for creation of space = 12, penalty for extension of space = 4) can also be used to compare the identity and sequence similarity.

"Antibodies", as used herein, include polyclonal and monoclonal, chimeric, single chain antibodies, and humanized antibodies, as well as antibody fragments (e.g., Fab, Fab ', F (ab') 2 and F Immunoglobulin expression library. With respect to antibodies, the term "immunologically specific" or "specific" refers to antibodies that bind to one or more epitopes of a protein of interest, but that do not substantially recognize them and bind to other molecules in a shows that it contains a mixed population of antigenic biological molecules. Trace assays to determine the binding specificity of an antibody are well known and are routinely practiced in the art. For a comprehensive discussion of these trials, see Harlow et al. (Eds.), ANTIBODIES TO LABORATORY MANUAL; Cold Spring Harbor Laboratory; Cold Spring Harbor, NY (1988), Chapter 6.

The term "substantially pure" refers to a preparation comprising at least 50-60% by weight of the compound of interest (eg, nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90-99% by weight, of the compound of interest. Purity is measured with methods appropriate for the compound of interest (eg, chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like).

With respect to the single-stranded nucleic acid molecules, the term "specifically hybridizing" refers to the association between two single-stranded nucleic acid molecules of sufficiently complementary sequence to allow such hybridization under the predetermined conditions generally used in the art ( sometimes called "substantially complementary"). In particular, the term refers to the hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule, with the substantial exclusion of hybridization of the oligonucleotide with single-stranded or sequence-nucleic acids not complementary.

A "coding sequence" or "coding region" refers to a nucleic acid molecule that has the sequence information necessary to produce a gene product, when the sequence is expressed. The coding sequence may comprise untranslated sequences (e.g., regions not translated 3 'or 5' of introns) within the three-layered regions, or may lack such intervening non-translated sequences (e.g., as in the cDNA).

"Intron" refers to polynucleotide sequences in a nucleic acid that do not encode information related to protein synthesis. These sequences are transcribed in the mRNA, but are removed before the translation of the mRNA to a protein.

The term "operably linked" or "operably inserted" means that the regulatory sequences necessary for the expression of the coding sequence are placed in a nucleic acid molecule at the appropriate positions relative to the coding sequence so that expression is allowed. of the coding sequence. By way of example, a promoter is operably linked to a coding sequence when the promoter is capable of controlling the transcription or expression of that coding sequence. The coding sequences can be operably linked to promoters or regulatory sequences in a sense or counter-sense orientation. The term "operably linked" is sometimes applied to the arrangement of other transcription control elements (eg, enhancers) in an expression vector.

The transcriptional and translational sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, which are provided for the expression of a coding sequence in a host cell.

The terms "promoter region" or "promoter sequence" generally refer to transcriptional regulatory regions of a gene, which may be found on the 5 'or 3' side of the coding region, or within the coding region, or within the introns . Typically, a promoter is a DNA regulatory region capable of agglutinating the RNA polymerase in a cell and initiating the transcription of a downstream coding current (3 'direction). The typical 5 'promoter sequence is linked at its 3' terminal by the transcription start site and extends upstream (5 'direction) to include the minimum number of bases or elements necessary to initiate transcription at detectable levels above. of the environment. Within the promoter sequence is a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the agglutination of RNA polymerase.

A "vector" is a replicon, such as a plasmid, osmid, or virus, to which another segment of nucleic acid can be operably inserted to cause replication or segment expression.

The term "nucleic acid construct" or "DNA construct" is sometimes used to refer to a coding sequence or sequences operably linked to the appropriate regulatory sequences and inserted into a vector to transform a cell. This term can be used interchangeably with the term "transformation DNA" or "transgenic". This nucleic acid construct can contain a coding sequence for a genetic product of interest, together with a selectable marker gene and / or a reporter gene.

A "marker gene" or "selectable marker gene" is a gene whose encoded genetic product confers a characteristic that allows a cell containing the gene to be selected from among cells that do not contain the gene. The vectors used for genetic engineering typically contain one or more selectable marker genes. Types of selectable marker genes include: (1) antibiotic resistance genes, (2) tolerance or resistance genes, herbicides; and (3) metabolic marker genes or auxotrophs that allow transformed cells to synthesize an essential component, usually an amino acid, that cells can not produce otherwise.

A "reporter gene" is also a type of marker gene. It generally encodes a genetic product that is capable of being tested or detected by standard laboratory means (eg, enzymatic activity, fluorescence).

The term "expressed" or "expression" of a gene refers to the biosynthesis of a gene product. The process involves the transcription of the gene into a mRNA and then the translation of the mRNA into one or more polypeptides, and covers all naturally occurring modifications.

"Endogenous" refers to any constituent, for example, a gene or a nucleic acid, or polypeptide, which can be found naturally within the specified organism.

A "heterologous" region of a nucleic acid construct is an identifiable segment or segments of the nucleic acid molecule within a further molecule large that are not found in association with the largest molecule, in its nature. Therefore, when the heterologous region comprises a gene, the gene will usually be flanked by DNA that does not flank the genomic DNA in the genome of the source organism. In another example, a heterologous region is a construct in which the coding sequence itself is not found in nature (eg, a cDNA in which the genomic sequence contains introns, or synthetic sequences that have codons different from those of the native gene). ). Allelic variations or naturally occurring mutational events do not result in a heterologous region of DNA as defined herein. The term "DNA construction", as defined above, is also used to refer to a heterologous region, particularly one constructed for use in the transformation of a cell.

A cell has been "transformed" or "transfected" by exogenous or heterologous DNA, when said DNA has been introduced into the cell. The transformation DNA may or may not be integrated (linked covalently) within the genome of the cell. In prokaryotes, yeast and mammalian cells, for example, transformation DNA can be maintained in an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transformation DNA has been integrated into a chromosome, so that it is inherited by daughter cells through the replication of the chromosome. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transformation DNA. A "clone" is a population of cells derived from a single cell or common ancestor, by mitosis. A "cell line" is a clone of a primary cell that is capable of stable development in vi tro for many generations.

"Grain", "seed" or "bean" refer to the unit of reproduction of the flowering of a plant, capable of developing in another equal plant. As used herein, especially with respect to coffee plants, the terms are used synonymously and interchangeably.

As used herein, the term "plant" includes reference to whole plants, plant organs (e.g., leaves, stems, shoots, roots), seeds, pollen, plant cells, plant cell organelles, and progeny of the same. The parts of transgenic plants they should be understood within the competence of the invention, comprising for example plant cells, protoplasts, tissues, callus, embryos, as well as flowers, stems, seeds, pollen, fruits, leaves, or roots that originate in transgenic plants or in his progeny Description Sucrose is a major contributor to the reduction sugars involved in the Maillard reaction that occurs during the roasting of the coffee bean. Therefore, it is widely believed that it is an important flavor precursor molecule in the green coffee bean. Consistent with this idea, higher quality Arabica beans have appreciably higher levels of sucrose (between 7.3 and 11.4%) than lower quality Robusta beans (between 4 and 5%). Also sucrose, although it is significantly degraded during roasting, can remain in the roasted grain at concentrations of 0.4-2.8% dry weight (DW) and thus directly participates in the sweetness of coffee. Due to the clear correlation between the level of sucrose in the grain and the flavor of the coffee, the ability to understand and manipulate the underlying genetic basis for the variations of the sucrose metabolism and the carbon partition in the coffee bean is important. .

The key enzymes involved in the metabolism of sucrose have been characterized in model organisms (eg, tomato, potato, Arabidopsis). In accordance with the present invention, the protein sequences of these enzymes have been used to perform similarity searches in cDNA libraries of Coffea canephora and C. Arabica and in EST databases using the tBLASTn algorithm, as described in more detail in the examples. The full-length cDNAs encoding Ccinvl (invertase bound to the cell wall), Cclnv2 (vacuolar invertase) and Calnv3 (cytoplasmic invertase) were isolated. A partial cDNA sequence (Cclnv4) was also isolated, and is believed to represent an invertase attached to the cell wall. In addition, four full-length cDNA sequences encoding similarly to the invertase inhibitors Cclnvll, CcInvI2, CcInvI3 and CchivI4 have been identified and characterized.

One aspect of the present invention relates to coffee nucleic acid molecules that encode a variety of invertases: the cell wall invertase Ccinvl (SEQ ID NO: l) and Cclnv4 (SEQ ID NO: 4 - partial sequence), invertase vacuolar Cclnv2 (SEQ ID NO 2), and neutral invertase Calnv3 (SEQ ID NO.3), and four inhibitors of full-length invertase: Cclnvll (SEQ ID N0.:5), Cclnvl2 (SEQ ID NO .: 6), Cclnvl3 (SEQ ID NO: 7), and CcInvI4 (SEQ ID NO: 8).

Another aspect of the present invention relates to proteins produced by the expression of these nucleic acid molecules and their uses. The nucleic acid sequences deduced from the proteins by the expression of SEQ IN US: 1, 2, 3, 4, 5, 6, 7, and 8, are listed here as SEQ NOS .: 9, 10, 11 , 12, 13, 14, 15 and 16, respectively. Still other aspects of the invention relate to the uses of the nucleic acid molecules and the encoded polypeptides in the production of the plants and in the genetic manipulation of plants, and finally in the manipulation of the flavor, aroma and other qualities of the coffee. .

Although the polynucleotides encoding the invertase and the invertase inhibitors of Coffea canephora are described and exemplified herein, this invention is intended to encompass nucleic acids and encoded proteins from other Coffea species that are sufficiently similar to be used interchangeably with the polynucleotides and proteins of C. canephora for the purposes described below. From Accordingly, when the terms "invertase" and "invertase inhibitor" are used herein, it is intended that they encompass all invertases and invertase inhibitors of Coffea having the physical, biochemical and functional characteristics described herein, and polynucleotides that encode them, unless specifically stated otherwise.

Considered in terms of their sequences, the invertase or invertase inhibitor polynucleotides of the invention include the allelic variants and the natural mutants of SEQ ID NOS; 1, 2, 3, 4, 5, 6, 7, and 8, which appear to be found in different varieties of C. canephora, and the homologs of the SEQ. ID. NOS .: 9, 10, 11, 12, 13, 14, 15 and 16 seem to be found in different coffee species. Because these variants and homologs are expected to have certain differences in nucleotide and amino acid sequence, this invention provides: (1) isolated nucleic acid molecules encoding the invertase encoding the respective polypeptides having at least about 70 % (and, in increasing order of preference, 71%, 72%, 73%, 74%, 75%, 76%, 77-ß, 78 -s, 79-ß, 70-s, 81-5, 82- s, 83-s, 84-8, 85-5, 86-5, 87-s, 88-5, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%) of identity with the encoded polypeptide of any of SEQ ID NOS .: 9, 10, 11 or 12, and (2) nucleic acid molecules encoding the invertase inhibitor encoding the respective polypeptides having at least about 25% (and, in increasing order of preference, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 70%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98% and 99%) of identity with the encoded polypeptide of any of SEQ ID NOS .: 13, 14, 15 or 16, and comprises a nucleotide sequence having equivalent levels of identity with any of SEQ ID NOS .: 1, 2, 3, 4, 5, 6, 7 or 8, respectively. Due to the variation of the natural sequence that seems to exist between the invertases and the invertase inhibitors, and the genes that encode them in different varieties and coffee species, someone with experience in the technique would expect to find this level of variation, while still being able to they maintain the unique properties of the polypeptides and polynucleotides of the present invention. This expectation is due in part to the degeneracy of the genetic code, as well as to the known evolutionary success of the conservative variations of the amino acid sequence, which does not appreciably alter the nature of the encoded protein. Accordingly, these variants and homologs are considered substantially equal to each other and are included within the competence of the present invention.

The following sections set forth the general procedures involved in the practice of the present invention. To the extent that the specific materials are mentioned, it is merely for the purpose of illustration, and is not intended to limit the invention.

Unless otherwise specified, general biochemical and molecular biology procedures such as those set forth in Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory (1989), or Ausubel et al. (eds), Current Protocols in Molecular Biology, John Wiley & Sons (2005).

Nucleic acid molecules, proteins and antibodies. The nucleic acid molecules of the invention can be prepared by two general methods: (1) they can be synthesized from appropriate nucleotide triphosphates, or (2) they can be isolated from biological sources.

Both methods use protocols well known in the art.

The availability of the nucleotide sequence information, such as 1 cDNA having the SEQ ID NOS .: 1, 2, 3, 4, 5, 6, 7 or 8, allows the preparation of a nucleic acid molecule isolated from the invention, by means of synthesis of the oligonucleotide. Synthetic oligonucleotides can be prepared by the phosphoramidite method employed in the Applied Biosystems 38A DNA Synthesizer or in similar devices. The resulting construction can be purified according to methods known in the art, such as high performance liquid chromatography (HPLC). The large, double-stranded polynucleotides, such as the DNA molecule of the present invention, must be synthesized in stages, due to the size limitations inherent in current methods of oligonucleotide synthesis. Therefore, for example, a large double-stranded molecule can be synthesized as several smaller segments of appropriate complementarity. The complementary segments thus produced can be paired so that each segment possesses the appropriate cohesive terminals for joining an adjacent segment. The adjacent segments can be linked by the cohesive pairing terminals in the presence of DNA-bound to build a large double whole molecule strand. A synthetic DNA molecule thus constructed can then be cloned and amplified into an appropriate vector.

In accordance with the present invention, nucleic acids having the appropriate level of sequence homology with part of or with all regions of coding and / or regulation of the invertase inhibitor polynucleotides, can be identified using hybridization and washing conditions of appropriate restriction. Those skilled in the art will appreciate that the aforementioned strategy, when applied to genomic sequences, in addition to allowing the isolation of the coding sequences for the glucose metabolism enzyme, will also allow the isolation of promoters and other regulatory sequences from the gene associated with the genes of the enzyme of sucrose metabolism, even when the regulatory sequences themselves may not share sufficient homology to allow adequate hybridization.

As a typical illustration, hybridizations can be performed, according to the method of Sambrook et al., Using a hybridization solution comprising: 5X SSC, 5X Denhardt's reagent, 1.0% SDS, 100 denatured salmon sperm, fragmented , 0.05% of sodium pyrophosphate and up to 50% formamide. Hybridization is carried out at 37-42 ° C for at least 6 hours. After hybridization, the filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1% SDS (2) 15 minutes at room temperature in X SSC and 0.1% SDS (3) from 30 minutes to 1 hour at 37 ° C in 2X SSC and 0.1% SDS (4) 2 hours at 45-55 ° C in 2X SSC and 0.1% SDS, changing the solution every 30 minutes.

A common formula for calculating the restriction conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology (Sambrook et al., 1989) is: Tm = 81.5 ° C + 16.6 Log [Na +] + 0.41 (% of G + C) - 0.63 (% of formamide) - 600 / # bp in duplex As an illustration of the formula above, using [Na +] = [0.368] and 50% formamide, with a GC content of 42% and an average probe size of 200 bases, the Tm is 57 ° C. The Tm of a DNA duplex decreases by 1-1.5 ° C with each 1% decrease in homology. Therefore, targets with more than 75% sequence identity should be observed using a hybridization temperature of 42 ° C. In one representation, hybridization is at 37 ° C and washing final is at 42 ° C; in another representation the hybridization is at 42 ° C and the final wash is at 50 ° C; and in yet another embodiment, the hybridization is at 42 ° C and the final wash is at 65 ° C, with the above hybridization and washing solutions. High restriction conditions include hybridization at 42 ° C in the above hybridization solution and a final wash at 65 ° C in 0. IX SSC and 0.1% SDS for 10 minutes.

The nucleic acids of the present invention can be maintained as DNA in any convenient cloning vector. In a preferred embodiment, the clones are maintained in cloning / expression plasmid vectors, such as pGEM-T (Promega Biotech, Madison, Wl), pBluescript (Stratagene, La Jolla, CA), pCR4-TOPO (Invitrogen, Carlsbad, CA ) or pET28a + (Novagen, Madison, Wl), all of which can be propagated in a suitable E. coli host cell.

The nucleic acid molecules of the invention include cDNA, genomic DNA, RNA, and fragments thereof, which may be single stranded, double stranded, or even triple stranded. Therefore, this invention provides oligonucleotides (sense or antisense strands of DNA or RNA) having sequences capable of hybridizing to at least one sequence of a nucleic acid molecule of the present invention. Such oligonucleotides are useful as probes for detecting invertase inhibitor or invertase mRNA or inverter mRNA genes in plant tissue test samples, for example, by PCR amplification, or for positive or negative regulation of gene expression. invertase or invertase inhibitor encoders during or before the translation of mRNA into proteins. The methods in which the oligonucleotides or polynucleotides encoding the invertase or the invertase inhibitor can be used as probes for such assays include, but are not limited to: (1) in situ hybridization; (2) Southern hybridization; (3) Northern hybridization; and (4) selected amplification reactions such as polymerase chain reactions (PCR, including RT-PCR) and ligase chain reaction (LCR).

Oligonucleotides having sequences capable of hybridizing with at least one sequence of a nucleic acid molecule of the present invention include the antisense oligonucleotides. Counter-sense oligonucleotides that target specific regions of mRNA that are critical for translation can be used. The use of counter-sense molecules to decrease the expression levels of a gene predetermined, it is known in the art. The molecules of contrasentido can be provided in if your transforming cells of plant with a construction of DNA that, with the transcription, produces the sequences of ARN of contrasentido. These constructions can be designed to produce full or partial length contrasense sequences. This silencing effect of the gene can be improved by transgenerably overproducing both the sense and counter-sense RNAs of the gene encoding the sequence so that a high amount of dsRNA is produced (see for example Waterhouse et al., 1998, PNAS 95: 13959-13964 ). In this regard, the dsRNA containing the sequences corresponding to part or all of at least one intron, has been found to be particularly effective. In one representation, part or all of the opposite strand of the coding sequence of invertase sucrose is expressed by a transgene. In another embodiment, the strands of sense and contradictory sense of hybridization of part or of the entire invertase coding sequence are transgenically expressed. In another embodiment, the invertase genes can be silenced with the use of interfering RNA (siRNA, Elbashir et al., 2001, Genes Dev. 15 (2): 188-200) using commercially available materials and methods (e.g. Invitrogen, Inc., Carlsbad CA). Preferably, the antisense oligonucleotides they recognize and silence the invertase mRNA or the invertase expression.

The polypeptides encoded by the nucleic acids of the invention can be prepared in a variety of ways, according to known methods. If they are produced in situ, the polypeptides can be purified from appropriate sources, for example, seeds, pericarps, or other parts of the plant.

Alternatively, the ability of the nucleic acid molecules encoding the polypeptides allows the production of the proteins using in vitro expression methods known in the art. For example, a cDNA or a gene can be cloned in vi tro into an appropriate transcription vector, such as a pSP64 or pSP65 for transcription in vi tro, followed by cell-free translation in a suitable cell-free translation system, such as wheat germ or rabbit reticulocytes. Transcription and translation systems in vi tro are commercially available, for example, at Promega Biotech, Madison, Wl, BRL, Rockville, MD or at Invitrogen, Carlsbad, CA.

According to a preferred embodiment, larger amounts of polypeptides can be produced by means of expression in a suitable prokaryotic or eukaryotic system. For example, part or all of a DNA molecule, such as the cDNA having SEQ ID NOS .: 1, 2, 3, 4, 5, 6, 7 or 8, can be inserted into a plasmid vector adapted for expression in a bacterial cell (such as E. coli) or a yeast cell (such as Saccharomyces cerevisiae), or in a baculovirus vector for expression in an insect cell. These vectors comprise the regulatory elements necessary for the expression of DNA in the host cell, positioned in such a way as to allow the expression of the DNA in the host cell. These regulatory elements required for expression include promoter sequences, transcription initiation sequences and, optionally, enhancer sequences.

Polypeptides produced by gene expression in a prokaryotic or eukaryotic recombinant system can be purified according to methods known in the art. In a preferred embodiment, a commercially available expression / secretion system may be used, by means of which the recombinant protein is expressed and henceforth secreted from the host cell, then purified from the surrounding medium. An alternative approach involves purifying the recombinant protein by affinity separation, for example, via immunological interaction with antibodies that specifically bind to the recombinant protein.

The polypeptides of the invention, prepared by the aforementioned methods, can be analyzed according to standard procedures.

Polypeptides purified from coffee or recombinantly produced can be used to generate polyclonal or monoclonal antibodies, fragments or antibody derivatives as defined herein, according to known methods. In addition to making antibodies to the complete recombinant protein, if protein analysis or Southern analysis and cloning (see below) indicate that the cloned genes belong to a multigenetic family, member-specific antibodies made for synthetic peptides can be generated corresponding to the non-conserved regions of the protein.

Also included are kits comprising an antibody of the invention for any of the purposes described herein. In general, this kit includes a control antigen for which the antibody is immunospecific.

Vectors, cells, tissues and plants. Also represented according to the present invention, are vectors and kits for producing transgenic host cells containing a polynucleotide or oligonucleotide encoding invertase or invertase inhibitor, or variants thereof in a sense or sense orientation, or the gene reporter and other constructs under the control of the promoters of the enzyme of sucrose metabolism and other regulatory sequences. Suitable host cells include, but are not limited to, plant cells, bacterial cells, yeast and other fungal cells, insect cells and mammalian cells. Vectors for transforming a wide variety of these host cells are well known to those skilled in the art. These include, but are not limited to, plasmids, cosmids, baculoviruses, bacmids, artificial bacterial chromosomes (BAC's), artificial yeast chromosomes (YAC's), as well as other bacterial, yeast and viral vectors. Typically, kits for producing transgenic host cells contain one or more vectors and instructions for producing the transgenic cells using the vector. The kits may also include one or more additional components, such as culture medium for culturing the cells, reagents for transforming the cells and reagents for testing the gene expression in the transgenic cells, to mention a few.

The present invention includes transgenic plants comprising one or more copies of an invertase encoding or invertase inhibitor gene, or nucleic acid sequences that inhibit the production or function of an endogenous invertase from a plant. This is accomplished by transforming plant cells with a transgene comprising part or all of the coding sequence of an invertase or an invertase inhibitor, or a mutant, counter-sense or variant thereof, including RNA, controlled by any of the sequences regulatory or recombinant, as described below. Preferred coffee species of transgenic plants include, without limitation, C. abeokutae, C. arabica, C. arnoldiana, C. aruwemiensis, C. bengalensis, C. canephora, C. congensis, C. dewevrei, C. excelsa , C. eugenioides, and C. heterocalyx, C. kapaka ta, C. khasiana, C. liberica, C. moloundou, C. rasemosa, C. salva trix, C. sessiflora, C. stenophylla, C. travencorensis, C. wightiana and C. zanguebariae. Plants of any species are also included in the invention; These include, but are not limited to, tobacco, Arabidopsis and other "laboratory friendly" species., cereal crops such as corn, wheat, soybeans, barley, rye, sorghum, alfalfa, clover and the like, oil-producing plants such as cañola, saffron, sunflower, peanut, cocoa and the like, vegetable crops such as tomato, tomatillo, potato, pepper, egg plant, sugar beet, carrot, cucumber, lettuce, pea and similar, horticultural plants such as daisies, begonia, chrysanthemum, delphinium, petunia, zinia, grass and grasses and the like.

Transgenic plants can be generated using standard transformation methods known to those skilled in the art. These include, but are not limited to, Agrobacterium vectors, protoplast treatment with polyethylene glycol, DNA biolistic delivery, micro UV laser beam, geminivirus vectors or other viral plant vectors, treatment of protoplasts with calcium phosphate, electroporation of protoplasts isolated, agitation of cell suspensions in solution with micro beads covered with the transformed DNA, agitation of suspension of cells in solution with silicon fibers covered with the transformed DNA, direct DNA absorption, liposome-mediated DNA absorption, and the like. These methods have been published in the art. See, for example, Methods for Plant Molecular Biology (Weissbach &Weissbach, eds., 1988); Methods in Plant Molecular Biology (Schuler &Zielinski, eds., 1989); Plant Molecular Biology Manual (Gelvin, Schilperoort, Verma, eds., 1993); and Methods in Plant Molecular Biology - A Laboratory Manual (Maliga, Klessig, Cashmore, Gruissem &Varner, eds., 1994).

The transformation method depends on the plant that is to be transformed. Agrobacterium vectors are frequently used to transform dicotyledonous species. Agrobacterium binary vectors include, but are not limited to, BIN19 and derivatives thereof, the series of vectors pBI, and the binary vectors pGA482, pGA492, pLH7000 (access to GenBank AY234330) and any of the appropriate pCAMBIA vectors (derivatives of vectors pPZP, vectors constructed by Hajduldewicz, Svab &Maliga, (1994) Plant Mol Biol 25: 989-994, available from CAMBIA, GPO Box 3200, Canberra ACT 2601, Australia, or via the Internet at CAMBIA.org). For the transformation of monocotyledonous species, the biolistic bombardment with particles covered with the transformed DNA and silicon fibers covered with DNA transformed are often useful for nuclear transformation. Alternatively, "superbinary" vectors of Agrobacterium um have been successfully used for the transformation of rice, maize and several other monocotyledonous species.

The DNA constructs for transforming a selected plant comprise a coding sequence of interest operably linked to the appropriate 5 'regulatory sequences (eg, translational regulatory and promoter sequences) and to the 3' regulatory sequences (eg, terminators). In a preferred embodiment, a dehydrin or LEA protein coding sequence is used under the control of its 5 'and 3M natural regulatory elements. In other embodiments, the coding and regulatory sequences of the dehydrin or the LEA protein are changed (e.g. , the CcLEA1 coding sequence operably linked to the CcDH2 promoter) to alter the water or protein content of the transformed plant seed for phenotypic improvement, for example, in flavor, aroma or other characteristic.

In an alternative representation, the coding region of the gene is placed under a promoter powerful constituent, such as the 35S promoter of the Cauliflower Mosaic Virus (CaMV) or the 35S promoter of the minor celandine mosaic virus. Other constitutive promoters contemplated for use in the present invention include, but are not limited to: T-DNA mannopine synthase promoters, nopaline synthase and octopine synthase. In other embodiments, a strong monocotyledonous promoter is used, for example, the maize ubiquitin promoter, the rice actin promoter or the rice tubulin promoter (Jeon et al., Plant Physiology., 123: 1005-14, 2000).

Transgenic plants expressing the invertase or invertase inhibitor coding sequences under an inducible promoter are also contemplated as being within the purview of the present invention. Inducible plant promoters include the controlled promoter of the tetracycline repressor / operator, the heat shock genetic promoters, the stress-induced promoters (eg, by wound), the genetic defense response promoters (eg, lyase genes). of phenylalanine ammonia), wound-induced genetic promoters (eg, hydroxyproline-rich cell wall protein genes), chemically-inducible genetic promoters (e.g. nitrate reductase genes, glucanase genes, chitinase genes, etc.) and dark-inducible gene promoters (eg, asparginase synthetase gene), to name a few.

Tissue-specific and developmental-specific promoters are also contemplated for use in the present invention, in addition to the seed-specific dehydrin or LEA protein promoters of the invention. Non-limiting examples of other seed-specific promoters include the Ciml (message induced by cytokinin), CZ19B1 (19 kDa corn starch). milps (myo-inositol-1-phosphate synthase) and celA (cellulose synthase) (US Application Serial No. 09 / 377,648), bean beta-phaseolin, napkin, beta-conglycinin, soy bean lectin, cruciferin, zein 15 kDa, 22 kDa cein, 27 kDa cein, g-cein, waxy corn, parchment 1, parchment 2, and globulin 1, corn, US bean legume soybean (Báumlein et al., 1992), and protein storage of US seed of C. canephora (Marraccini et al, 1999, Plan t Physiol Biochem.37: 273-282). See also WO 00/12733, which describes the promoters of the preferred seed and endl genes. Other Coffea seed-specific promoters can also be used, including, but not limited to, oleosin gene promoter described in the co-pending joint patent application No. [STILL NOT ASSIGNED] and the dehydrin gene promoter described in co-pending PCT Application of joint membership No. [STILL NOT ASSIGNED]. Examples of other tissue-specific promoters include, but are not limited to: the genetic promoters of the small subunit of ribulose bisphosphate carboxylase (RuBisCo) (e.g., the promoter of the small subunit of coffee as described in Marracini et al. , 2003) or the promoters of the chlorophyll a / b agglutination gene (CAB) for expression in photosynthetic tissue; and the promoters of the root specific glutamine synthetase gene when expression is desired in the roots.

The coding region is also operably linked to an appropriate 3 'regulatory sequence. In representations in which the native 3 'regulatory sequence is not useful, the polyadenylation region of nopaline synthetase can be used. Other useful 3 'regulatory regions include, but are not limited to, the polyadenylation region of octopine synthase.

The selected coding region, under the control of the appropriate regulatory elements, is operably linked to a nuclear marker of drug resistance, such as resistance to kanamycin. Other useful selectable marker systems include genes that confer resistance to antibiotics or herbicides (eg, resistance to hygromycin, sulfonylurea, phosphinothricin, or glyphosate) or genes that confer selective development (eg, phosphomannose isomerase, which allows the development of plant cells on mannose). Selectable marker genes include, without limitation, genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO, dihydrofolate reductase (DHFR) and hygromycin phosphotransferase (HPT)), as well as genes which confer resistance to herbicidal compounds, such as glyphosate-resistant EPSPS and / or glyphosate oxidoreducatase (GOX), Bromoxinyl Nitrilasse (BXN) for bromoxynil resistance, AHAS genes for resistance to imidazolinones, resistance genes to the sulfonylurea, and 2, 4-dichlorophenoxyacetate (2, 4-D) resistance genes.

In certain embodiments, the promoters and other expression regulatory sequences that are encompassed by the present invention are operably linked to the reporter genes. Reporter genes contemplated for use in the invention include, but are not limited to, the genes encoding the green fluorescent protein (GFP), the red fluorescent protein (DsRed), the fluorescent protein cyan (CFP), the yellow fluorescent protein (YFP), the fluorescent orange protein of cerianto (cOFP) lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), aminoglycoside phosphotransferase (neor, G418r) dihydrofolate reductase (DHFR), hyigromycin-B-phosphotransferase (HPH), thymidine kinase (TK), lacZ (encoding a-galactosidase), and xanthine guanine phosphoribosyltransferase (XGPRT), Beta-Glucuronidase (gus), Alkaline Placental Phosphatase (PLAP), Alkaline Phosphatase secreted by the embryo (SEAP), or firefly or bacterial luciferase (LUC). As with many of the standard procedures associated with the practice of the invention, experienced persons will be aware of the additional sequences that may serve for the function of a marker or reporter.

Additional sequence modifications to improve gene expression in a cellular host are known in the art. These modifications include the elimination of sequences encoding superfluous polyadenylation signals, exon-intron binding site signals, transposon-like repeats, and other well-characterized sequences that can be harmful to gene expression. Alternatively, if necessary, the G / C content of the coding sequence can be adjusted to average levels for a given coffee plant host cell, calculated with reference to known genes expressed in a coffee plant cell. Also, when possible, the coding sequence is modified to avoid the predicted fork mRNA structures. Another alternative to improve gene expression is to use 5M leader sequences. Leading translational sequences are well known in the art, and include the cis-acting (omega ') derivative of the 5' (omega) leader sequence of the mosaic virus. tobacco, the 5 'leader sequences of the bromine mosaic virus, the alfalfa mosaic virus, and the turnip yellow mosaic virus.

The plants are transformed and thereafter screened for one or more properties, including the presence of the transgenic product, the mRNA that encodes the transgenic, or an altered phenotype associated with the expression of the transgenic. It should be recognized that the amount of expression, as well as the specific tissue and temporal pattern of the expression of transgenics in Transformed plants may vary depending on the position of their insertion in the molecular genome. These position effects are well known in the art. For this reason, several nuclear transformants should be regenerated and tested for the expression of the transgenic.

Methods The nucleic acids and polypeptides of the present invention can be used in any of numerous methods by means of which protein products can be expressed in coffee plants so that proteins can play a role in flavor improvement and / or aroma of coffee drink or coffee products finally produced from the coffee plant grain expressing the protein.

There is a strong correlation between the concentration of sucrose in green beans and high quality coffee (Russwurm, 1969, Holscher and Steinhart, 1995, Badoud, 2000, Illy and Viani, 1995, Leloup et al., 2003). The improvement of the sucrose content in the coffee bean can be obtained by: (1) classical production or (2) genetic engineering techniques, and by the combination of these two approaches. Both approaches have been considerably improved through the isolation and characterization of the genes related to the metabolism of sucrose in coffee, according to the present invention. For example, the genes that encode the enzyme that metabolizes sucrose can be genetically mapped and the Specific Characteristic Sites (QTLs) involved in the taste of coffee can be identified. Then, it would be possible to determine if such QTL correlates with the position of genes related to sucrose. Alleles (haplotypes) can also be identified for genes that affect the metabolism of sucrose, and examined to determine if the presence of specific haplotypes is strongly correlated with high sucrose. These "high sucrose" markers can be used to excel in marker-assisted production programs. A third advantage of isolating the polynucleotides involved in the sucrose metabolism is to generate the expression data for these genes during maturation of the coffee bean in varieties with high and low levels of sucrose, examples of which are discussed below, in the Examples section. This information is used to direct the choice of genes to be used in genetic manipulation aimed at generating new transgenic coffee plants that have increased levels of sucrose in the mature grain, as described below.

In one aspect, the present invention represents methods for altering the profile of metabolizing enzyme, or sugar profile, in a plant, preferably coffee, comprising increasing or decreasing an amount or activity of one or more metabolizing enzymes of the sucrose in the plant. Specific embodiments of the present invention provide methods for altering the sugar profile of a plant by increasing or decreasing the production of invertases or invertase inhibitors.

The data produced according to the present invention strongly indicate that a decrease in the activity of the invertase (acidic or neutral invertases) in the final stages of the maturation of the coffee bean will lead to the accumulation of sucrose in the grain. Accordingly, a preferred embodiment of the present invention comprises transforming the coffee plants with a polynucleotide encoding the invertase inhibitor, such as a cDNA corresponding to SEQ ID NOS .: 5, 6, 7 or 8, for the purpose of overproducing that inhibitor in various coffee tissues. In one representation, coffee plants are constructed for a general increase in the production of the inhibitor of invertase, for example, through the use of a promoter such as the RuBisCo small subunit promoter (SSU) or the CaMV35S promoter functionally linked to an invertase inhibitor gene. In another embodiment designed to limit the overproduction of the invertase inhibitor only to the reservoir organ of interest, ie, the grain, a grain-specific promoter, particularly one of the Coffea-specific promoters, described above can be used.

The sucrose profile of a plant can be improved by modulating the production, or activity, of one or more invertases or invertase inhibitors in the plant, such as coffee. Additionally, plants expressing improved levels of sucrose can be screened for naturally occurring variants of the invertase or the invertase inhibitor. For example, mutant plants with loss of function (null) can be created or selected from populations of currently available plant mutants. Those skilled in the art will also appreciate that populations of mutant plants can also be traced for mutants that express downward or overexpress a particular enzyme metabolizing sucrose, using one or more of the methods described herein. Mutant populations can be made by chemical mutagenesis, radiation mutagenesis, and transposon or T-DNA insertions, or directing local lesions induced in the genomes (TILLING, see, for example, Henikoff et al., 2004, Plan t Physiol. 135 (2): 630 -636; Gilchrist &Haughn, 2005, Curr Opin. Plant Biol. 8 (2): 211-215). Methods for making mutant populations are well known in the art.

The nucleic acids of the invention can be used to identify mutant forms of sucrose metabolizing enzymes in various plant species. In species such as maize or Arabidopsis, where the transposon insertion lines are available, oligonucleotide baits can be designed to track the lines for insertions in the invertase or invertase inhibitor genes. By means of production, a plant line that is heterozygous or homozygous for the interrupted gene can then be developed.

A plant can also be constructed to exhibit a phenotype similar to that seen in null mutants created by mutagenic techniques. A transgenic null mutant can be created by expressing a mutant form of a selected invertase protein to create a "dominant negative effect". Although without limiting the invention to no single mechanism, this mutant protein will be supplemented with the wild-type protein for the interacting proteins or other cellular factors. Examples of this type of "dominant negative" effect are well known for both insect and vertebrate systems (Radke et al, 1997, Genetics 145: 163-171, Kolch et al., 1991, Nature 349: 426-428).

Another class of null transgenic mutant can be created by inhibiting the translation of the mRNA that encodes the enzyme of sucrose metabolization, by "post-transcriptional genetic silencing". These techniques can be used to have an advantage in the down regulation of the inverts in the grain of a plant, thereby promoting the accumulation of sucrose. For example, a gene encoding invertase of the species indicated for down regulation, or a fragment thereof, can be used to control the production of the encoded protein. For this purpose full-length counter-sense molecules can be used. Alternatively, antisense oligonucleotides directed to specific regions of the mRNA that are critical for translation can be used. The use of counter-sense molecules to decrease the expression levels of a predetermined gene is known in the art. The Counter-sense molecules can be provided in you by transforming the plant cells with a DNA construct that, with transcription, produces the RNA sequences of nonsense. These constructions can be designed to produce full or partial length contrasts. This silencing effect of the gene can be improved by overproducing both sense and counter-sense RNAs transgenically from the coding sequence of the gene, so that a high amount of dsRNA is produced (See for example Waterhouse et al., 1998, PNAS 95 : 13959-13964). In this regard, it has been found that sequences containing the dsRNA that corresponds to part or all of at least one intron are particularly effective. In one representation, part of or all of the counter-sense strand of the sequence encoding the invertase is expressed by a transgene. In another embodiment, the hybridization strands of sense and contradictory of part of or of the entire coding sequence are expressed transgenically.

In another representation, genes can be silenced through the use of a variety of other post-transcriptional techniques of genetic silencing (RNA silencer) that are currently available for plant systems. RNA silencing involves the processing of double-stranded RNA (dsRNA) into small fragments of 21-28 nucleotides by means of an H-based RNase enzyme ("Dicer" or "Dicer-like"). The cleavage products, which are the siRNA (small interfering RNA) or miRNA (microRNA) are incorporated into the protein effector complexes that regulate gene expression in a sequence-specific manner (for reviews of RNA silencing in plants, see Horiguchi, 2004, Differentiation 72: 65-73, Baulcombe, 2004, Nature 431: 356-363, Herr, 2004, Biochem. Soc. Trans. 32: 946-951).

The small interfering RNAs can be synthesized or chemically transcribed and amplified in vi tro, and then delivered to the cells. The delivery can be done by microinjection (Tuschl T et al., 2002), chemical transfection (Agrawal N et al., 2003), electroporation or cationic transfection mediated by liposome (Brummelkamp TR et al, 2002, Elbashir SM et al, 2002) , or by any other means available in the art, which will be appreciated by the experienced person. Alternatively, the siRNA may be expressed intracellularly by inserting DNA templates for the siRNA into the cells of interest, for example, by means of a plasmid (Tuschl T et al., 2002), and may be specifically targeted to the selected cells. Small interfering RNAs have been successfully introduced into plants (Klahre U et al., 2002).

A preferred method of silencing RNA in the present invention is the use of short hairpin RNAs (shRNA). A vector containing a DNA sequence encoding a particular desired siRNA sequence is delivered into a target cell by common means. Once in the cell, the DNA sequence is continuously transcribed in the RNA molecules that are looped together and form hairpin structures through the pairing of the intramolecular base. These fork structures, once processed by the cell, are equivalent to the siRNA molecules and are used by the cell to mediate RNA silencing of the desired protein. Several constructs of particular utility for the silencing of RNA in plants are described in Horiguchi, 2004, supra. Typically, such a construct comprises a promoter, a sequence of the target gene to be silenced in the "sense" orientation, a spacer, the meta-sense sequence of the target gene, and a terminator.

Another type of synthetic null mutant can also be created by the "co-suppression" technique (Vaucheret et al., 1998, Plant J. 16 (6): 651-659). The plant cells are transformed with a copy of the endogenous gene that is targeted to be repressed. In many cases, this results in complete repression of the native as well as the transgenic gene. In one embodiment, a gene encoding invertase of the species of plant of interest is isolated and used to transform the cells of that same species.

The mutant or transgenic plants produced by any of the above methods are also represented according to the present invention. Preferably, the plants are fertile, being thereby useful for production purposes. Therefore, mutants or plants that show one or more of the aforementioned desirable phenotypes can be used for the production of the plant, or directly in agricultural or horticultural applications. They can also be useful as research tools for the subsequent elucidation of the participation of enzymes for the metabolization of sucrose and its effects on sucrose levels, which thus affect the flavor, aroma and other characteristics of coffee seeds. The plants that contain a transgene or a specified mutation can also be crossed with plants that contain a transgenic or a complementary genotype to produce plants with improved or combined phenotypes.

The following Examples are provided to describe the invention in greater detail. The examples are for purposes of illustration, and are not intended to limit the invention.

EXAMPLE 1 Materials and Methods for the Subsequent Examples Plant material Any of the leaves, flowers, stems, roots or cherries were harvested in different stages of development of Coffea arabá L. cv. Ca turra T2308 developed under greenhouse conditions (25 ° C, 70% RH) or Coffea canephora BP409 (robusta) developed in the field at the Indonesian Center for Coffee and Cacao Research (ICCRI) of Indonesia. The fruit was harvested in defined stages and immediately frozen in liquid nitrogen, and then packed in dry ice for transport. The cherries of FRT05, FRT64 (robusta) and CCCA12 (Arabica) were obtained from trees grown in Quito, Ecuador. The Samples were frozen at -25 ° C for transportation, then stored at -80 ° C until use.

Universal Genomic Walker. The genomic DNA of the BP09 was extracted from leaves harvested from the trees developed in the greenhouse, according to Crouzillat et al., 1996. The genomic DNA was digested with four different restriction enzymes. { Dral, EcoRV, Pvul, Stul) and the resulting fragments were ligated at the blunt end with the Genomic Walker Adapter provided by the Universal Genome Waiker (BD Biosciences). Both sets of reactions were performed in accordance with the equipment user manual. Then the four libraries were used as templates in PCR reactions using gene specific baits (GSP) (Table 1) . The reaction mixtures contained 1 μl of Genomic Walker library template, 10 nmol of each dNTP, 50 pmol of each bait and 1 U of DNA polymerase.

(Takara, Combrex Bio, Belgium) in a final volume of 50 μl with the appropriate Takara regulator. The following conditions were used for the first PCR: after pre-denaturing at 95 ° C for 2 min, the seven cycles were performed at a denaturation temperature of 95 ° C for 30 s, followed by a pairing and elongation step at 72 ° C for 3 min. 35 others were made cycles, with the denaturation step at 95 ° C for 30 s followed by the pairing / elongation step at 67 ° C for 3 min. The products of the first amplification using the first pair AP1 / GSP-GW1, served as a template for the second PCR using AP2 / GSP-GWN1, with AP2 and GSP-GWN as baits. The second PCR used 2 μl of the first amplification reaction (undiluted and with different dilutions up to 1:50), and was performed as described above for the first reaction, with the exception that the second reaction used only 25 amplification cycles. The resulting PCR fragments were separated and purified by agarose gel electrophoresis. The PCR fragments from the main bands were purified, cloned and sequenced. TABLE 1 List of baits used for the Genomic Walker experiments DNA sequence analysis. For DNA sequencing, recombinant plasmid DNA was prepared and sequenced according to standard methods. Computer analysis was performed using ADN Star software (Lasergene). Sequence homologies were verified against the GenBank databases using the BLAS programs (Altschul et al., 1990).

Preparation of the cDNA. The RNA was extracted from different tissues, that is, root, stem, leaves, flowers, pericarp and grain, in the four different stages of maturation, SG (small green), LG (large green), Y (yellow), R ( red), as previously described (Benamor and Me Carthy, 2003). The cDNA was prepared from total RNA and oligo dT (18) (Sigma), as follows: a sample of 1 μg of total RNA plus 50 ng of oligo dT was taken up to 12 μl of final volume, with water treated with DEPC. Subsequently this mixture was incubated at 70 ° C for 10 min and then cooled rapidly on ice. Next, 4 μl of the first strand regulator (5x, Invitrogen), 2 μl of DTT (0.1 M, Invitrogen) and 1 μl of dNTP mixture (10 mM each, Invitrogen) were added. These reaction mixtures were pre-incubated at 42 ° C for 2 min before adding 1 μl of SuperScript III reverse transcriptase Rnasa H (200 Y / μl, Invitrogen). Subsequently, the tubes were incubated at 42 ° C for 50 min, followed by inactivation of the enzyme by heating at 70 ° C for 10 min. The generated cDNA samples were then diluted one hundred times and 5 μl of the diluted cDNA was used for the Q-PCR.

RACE 3 '(Rapid amplification of the 3' ends of cDNA) for the isolation of CcINVl cDNA. RNA was extracted from the pericarp and the grain at the four different stages of maturation SG, LG, Y, R, as described previously (Benamor and Me Carthy, 2003, Benamor et al., Report in preparation). The cDNA was then prepared from the total RNA, using the dT (i8) tail bait (^ cttccg occtacgctttmttttttttttt ^) (SEQ ID NO-: 45) 'as follows: a sample of 1 ug of total RNA, plus 50 ng of dT Tail bait (i8>, was taken to final 12 μl with water treated with DEPC.) This mixture was subsequently incubated at 70 ° C for 10 min and then rapidly cooled on ice. Then, 4 μl of first-strand regulator (5x, Invitrogen), 2 μl of DTT (0.1 M, Invitrogen) and 1 μl of dNTP mixture (10 mN each, Invitrogen) were added. These reaction mixtures were pre-incubated at 42 ° C for 2 min before adding 1 μl of SuperScript III Rnasa reverse transcriptase (200 U / μl, Invitrogen). Subsequently, the tubes were incubated at 42 ° C for 50 min, followed by inactivation of the enzyme by heating at 70 ° C for 10 min. The cDNA samples generated were used in a PCR reaction with Invl-3'al (5'gacgtgaatggttgctggtcagg3 ') (SEQ ID NO.:46) and RACE 3' of the tail (5'cttccgatccctacgc3 ') (SEQ ID NO. : 47) as baits for the first PCR and Invl-3'a2 (5'tacagtgggtgctgagctttggt3 ') (SEQ ID NO.:48) and RACE 3' of the tail as baits for the second PCR. The PCR reactions were performed in 50 μl reactions, as follows: 5 μl of cDNA; 1 x PCR regulator (Regulator II of Mg ++ plus, from PCR), 800 nM of each specific primer of the gene, 200 μM each of dNTP, 0.5 U of DNA polymerase Takara LA Taq (Cambrex Bio Science). After denaturing at 94 ° C for 5 min, the amplification consisted of 35 cycles of 1 min at 94 ° C, 1 min at 55 ° C and 2 min at 72 ° C. A final elongation step was carried out at 72 ° C for 7 min.

Full-length amplification of cDNA from JNV1 and INV3. To amplify at full length the cDNA of INV1 and INV3, the two sets of baits: INV1-ATG (5'atggctagcttttacctctggctaatgtg3 ') (SEQ ID NO.:49), INV1-STOP (5'tcaattctttcgattgatactggcattct3') (SEQ ID NO. .50), and INV3-ATG (5'atggagtgtgttagagaatatcaact3 ') (SEQ ID NO: 51), INV3-ST0P (5'tcagcaggtccacgaggaggatctct3) (SEQ ID NO .: 52), were respectively designed on the INV1 or INV3 sequences obtained of the first walker or the RACE 3 'experiments. These two sets of baits have been used to perform the RT-PCR reaction using the cDNA samples described above. The PCR reactions were carried out in 50 μl reactions, as follows: 5 μl of cDNA; regulator 1 x PCR (Mg ++ plus Regulator of PCR), 800 nM of each of the specific baits of the gene, 100 μM each of dNTP, 0.5 U of DNA polymerase Takara LA Taq (Cambrex Bio Science). After denaturing at 94 ° C for 5 min, the amplification consisted of 35 cycles of 1 min at 94 ° C, 1 min at 55 ° C and 2 min at 72 ° C. An additional final elongation step was performed at 72 ° C for 7 min. The fragments obtained were purified from agarose gel, chlorinated and sequenced.

Quantitative RT-PCR. The TaqMan PCR was performed as recommended by the manufacturer (Applied Biosystems, Perkin-Elmer). The DNA samples used in this experiment were described above. All reactions contained lx of regulator TaqMan (Perkin-Elmer) and 5 mM of MgCl2, 200 μM of each of dATP, dCTP, dGTP and dTTP, 5 μl of cDNA, and 0.625 units of AmpliTaq Gold polymerase. PCR was performed using 800 nM of each of the specific baits of the gene, forward and reverse, and 200 nM of TaqMan probe. The primers and probes were designed using the PRIMER EXPRESS software (Applied Biosystems, Table 2). The reaction mixtures were incubated for 2 min at 50 ° C, 10 min at 95 ° C, followed by 40 cycles of amplification for 15 sec at 95 ° C / 1 min at 60 ° C. The mixtures were quantified in the Sequence Detection System GeneAmp 7500 (Applied Biosystems). Transcript levels were determined using rpl39 as a basis of comparison.

TABLE 2 List of baits and probes used for the experiment -PCR MGB probes were labeled at 5 'with fluorescent reporter dye 6-carboxyfluorescein (FAM) and at 3' with dye off 6-carboxy-tetramethyl-rhodamine (TAMRA) The rpl3 probe was labeled at 5 'with the fluorescent reporter dye VIC and at the 3' end with the TAMRA damper. All sequences are given from 5 'to 3' Quantification of soluble sugars. The tissues of the grain were separated from the pericarp and from the peels. The grains were homogenized in a cryogenic mill with liquid nitrogen and the powder obtained was lyophilized for 48 hours (Lyolab bll, Secfroid). Each sample was weighed and suspended in 70 ml of distilled double water previously preheated to 70 ° C, then stirred vigorously and incubated for 30 min at 70 ° C. After cooling to room temperature, the sample was brought to 100 ml by the addition of double distilled water, and then filtered on paper (paper filter 597.5 by Schleicher and Schuell). The sugars from the tissues extracted from the coffee bean were separated by HPAE-PED according to Locher et al., 1998, using a Dionex PA 100 column (4x250 mm). The sugar concentration was expressed in g per 100 g of DW (dry weight).

Analysis of enzymatic activity. The neutral and acid invertase activities were measured according to King, et al., 1997.

EXAMPLE 2 Identification of the invertase proteins encoding cDNA in C. canephora We identified more than 47,000 EST sequences from several coffee libraries made with RNA isolated from young leaves and from grain tissues and the pericarp of cherries harvested at different stages of development. The overlapped ESTs were subsequently "grouped" into "unigenes" (ie, contiguous) and the unigan sequences were annotated by doing a BLAST search of each individual sequence against the NCBI non-redundant protein database.

The enzymes directly involved in the synthesis and degradation of sucrose have been extensively studied in plants, and especially during the development of the fruit, the tuber and the seed in plants such as tomatoes. { Lycopersi with esculen tum), potato. { Solanum tuberosum) and corn. { Zea mays). The DNA sequences encoding all known key proteins involved in the synthesis and degradation of sucrose have been identified and characterized in several species and are available from GenBank. Accordingly, known sequences of plant enzymes, especially the sequences of organisms closely related to coffee (eg, tomato and potato), were used to find similar sequences present in the EST libraries described above and in other libraries of coffee cDNA To search for the aforementioned EST collection, the tomato and potato protein sequences were used in a tBLAST search of the "unigen" set 5 as described in Example 1. Those "unigenes" in silico whose open reading frames showed the highest degree of identity with the sequence in doubt, were selected for further study. Enb some cases, the selected "unigenes" contained at least one EST sequence that potentially represented a full-length cDNA clone, and then that clone was selected for re-sequencing to confirm both its identity and the "unigén" sequence.

Based on its solubility, subcellular localization, optimal pH and isoelectric fist, three different types of invertase isoenzymes can be distinguished: the vacuolar invertase (Invl), cell wall bound (InvCW) and neutral (InvN). InvN and InvCW have similar enzymatic and biochemical properties and share a high degree of general sequence homology and two conserved amino acid motifs. A common feature is the pentapeptide N-DPN-G / A (SEQ ID NO.:77) (fructofuranosidase motif, Sturm and Chrispeels, 1990, Roitsch and Gonzalez, 2004). The second conserved characteristic is the highly conserved cysteine sequence, the WECX (P / V) DF (SEQ ID NO.:78) (Sturm and Chrispeels, 1990) in which V and P distinguish respectively the vacuolar invertase and the invertase attached to the cell wall (periplasmic).

To find the cDNA that encodes the three invertase isoenzymes in coffee, the protein sequences corresponding to: (1) the invertase have been used TIV-1 tomato vacuolar, (2) the LIN6 cell wall invertase, and (3) the neutral (cytoplasmic) invertase-like protein of A. thaliana, to perform a similarity search of the unigene set using the tBLASTn algorithm.

A. Cclnv2 (SEQ ID NO: 10). It was found that the unigene ORF # 127336 had a high degree of homology with the vacuolar invertase of the TIV-1 tomato (NCIB protein identifier No. P29000; Klann et al., 1992). The only EST in this unigén, clone cccl20fll, was isolated and its insert was completely sequenced. It was found that the cDNA of the insert was 2212 bp in length. The complete sequence of the ORF of this clone was 1761 bp in length, starting at position 192 and ending at position 1952. The deduced protein was 586 aa in length with a predicted molecular weight of 64 kDa. The protein encoded by cccl20fll had been annotated as Cclnv2 (Invertase 2 from Coffea canephora). The Cclnv2 is 69.6% identical to the vacuolar invertase of the TIV-1 tomato and 85% identical to an invertase characterized in the STVInv of the potato (Figure 2). Marraccini et al. has recently placed a partial sequence of Arabica Coffea cDNA that potentially encodes a vacuolar invertase in the public databases (NCBI identifier). nucleotide No. AJ575258. They have called this partial protein sequence Inv2 (NCBI protein identifier No. CAE01318). The partial alignment between Cclnv2 and inv2 has shown 93.8% identity (Figure 2). The proposed vacuolar localization of this robusta invertase is supported by the presence of a V in the highly conserved WECVDF domain (Figure 2, Sturm and Chrispeels, 1990) while the inv2 protein sequence is characterized by the presence of a P in this domain, suggesting that inv2 may be an invertase attached to the cell wall. The alignment in Figure 2 shows that the N-terminal region of the Cclnv2 is shorter than those observed for two homologs of other plants. However, the cccl20fll cDNA insert currently initiates 190 bp beyond the first amino acid shown for Cclnv2 in Figure 2. This 190 bp sequence has two open reading frames, but none is in the frame with the main ORF. In addition, the amino acid sequences of the short ORFs do not correspond to the sequences observed in the other two homologous sequences (Figure 2). These results could be explained by either the N-terminal region of this Coffea canephora protein which is shorter than the comparable region in the homologous proteins of other plants, or the presence of an intron in this region of the cDNA clone.

B. Cclnv3 (SEQ ID NO .: 11). The protein encoded by the clone cccp28p22 (unigén # 96095) has a high homology with the neutral cytoplasmic invertase of A. thaliana (protein identifier No. NP_567347). The protein encoded by clone cccp28p22 has been annotated as Cclnv3 (Invertase 3 from Coffea canephora). According to the optimal alignment obtained, the cDNA insert of cccp28p22 is not full length, that is, it does not code for the complete protein (approximately 1500 bases are missing). Using several turns of the principal directed genome walker, we were able to amplify the genomic sequence of C. canephora corresponding to the 5 'region upstream of the cccp28p22 sequence. Using specific baits, we amplified the total length cDNA by means of RT-PCR. Several samples of RNA from C. arabica and C. canephora were used, the positive amplification corresponding to the sequence of total length cDNA was only obtained using the RNA extracted from the Arabica grain in the yellow state. The protein encoded by this new cDNA sequence has been annotated as Calnv3 (Invertase 3 from Coffea arabica). The Calnv3 cDNA is 1675 bp in length. The deduced protein is 558 aa in length, with a predicted molecular weight of 63.8 kDa. The encoded protein sequence by the Calnv3 cDNA shows a very high level of homology (83.7%) with the neutral cytoplasmic invertase of A. thaliana (Figure 3).

C. Cclnv4 (SEQ ID NO .: 12). The protein encoded by the clone cccs46w27d20 (unigén # 123705) has a significant degree of identity (62.7%) with the invertase LIN6 bound to the cell wall of the tomato (NCBI identifier of protein No. AAAM28823). The alignment is shown in Figure 4. According to the optimal alignment obtained, the cDNA insert of cccs46w27d20 is not full-length, that is, it does not code for the entire protein (approximately 1500 bases are missing). It is important to note that the protein encoded by cccs46w27d20 also shares 38% identity with tomato vacuolar TIV-1 invertase (Klann et al., 1992). The protein encoded by clone cccs46w27d20 has been annotated as Cclnv4 (Invertase 4 from Coffea canephora). This protein shares higher homology with the vacuolar invertase than the invertase bound to the cell wall. The Genomic Walker and the 5 'RACE have been made to isolate the missing 5' terminal region.

Based on the data presented above, we have isolated a cDNA that codes for each type of isoenzyme of invertase from the C. canephora database.

D. Ccinyl (SEQ ID NO: 9). A full length homologous cDNA sequence of C. canephora (robusta) was isolated using a partial cDNA sequence encoding a Coffea arabic cell wall invertase (made available by Marraccini et al .: NCBI identifier of nucleotide No. AJ575257 , and the partial protein sequence encoded (Invl) with NCBI identifier of protein No. CAE1317.1). Using the partial cDNA sequence and the 3 'RACE, as well as the "baited assisted" genomic walker experiments, as described in Example 1, the full-length homologous cDNA was found to be 1731 bp in length and the The deduced protein was 576 aa in length with a predicted molecular weight of 64.6 kDa. This protein has been annotated as Ccinvl (Invertase 1 of Coffea canephora).

The protein sequence obtained for Ccinvl is not identical to the sequence obtained by Marraccini et al., Which has 4 amino acid differences over the 163 known amino acids for the partial arabic cDNA sequence. A Ccinvl alignment with several highly homologous database sequences shows that Ccinvl has a 55.2% identity with LIN6 attached to the wall cellular of the tomato and 54.3% with Inv DCCW (Figure 5), an invertase attached to the cell wall identified in the carrot. The proposed cellular location of Ccinvl is supported by the presence of a P in the highly conserved WECPDF domain (Figure 5, Sturm and Chrispeels, 1990).

EXAMPLE 3 Identification of the cDNA that encodes the invertase inhibitor proteins in C. canephora Recent publications of the past decade have shown that the activity of invertases can be regulated at the post-translational level by interacting with a group of small molecular weight proteins (<20 kDa) called invertase inhibitors (Greiner et al. , 1998, Greiner et al., 2000, Helentjaris et al., 2001, Bate et al., 2004). Many sequences of several plant species have been identified in public databases, but few of them are biochemically characterized. Recently, two invertase inhibitors, tobacco NtINVINHl (protein identifier No. CAA73333; Greiner, et al., 1998), and corn ZM-INVINH1 (nucleotide identifier No. AX214333; Bate et al., 2004; corresponding to the protein ID.l in Helentjaris et al., 2001), have been characterized biochemically For example, ZM-INVINHl has been shown to directly control the metabolism of sucrose for its ability to act as a sucrose sensor (Bate et al., 2004). In the presence of high concentrations of sucrose, the invertase inhibitor ZM-INVINH1 remains inactive, allowing the hydrolysis of sucrose during the early development of the fruit. When sucrose levels fall below a specific level, this invertase inhibitor then becomes active and inhibits invertase activity (Helentjaris et al., 2001, Bate et al., 2004).

The invertase inhibitor sequences of many different organisms (tomato, tobacco, maize and A. thaliana) are available in GenBank, but most of them have been annotated simply based on the results of the homology obtained using BLAST, and not by the direct characterization of its biochemical activity. It is noted that the relatively small number of invertase inhibitors that have been characterized biochemically usually show weak homologies to each other (Bate et al., 2004), and to date, this class of protein has not defined the highly conserved sequence motifs. (Bate et al., 2004). Therefore, entries to the database noted as "invertase inhibitors" or "protein similar to the invertase inhibitor", should be interpreted with caution. To perform the blast search in the cafe invertase coffee databases, we used sequences that encode the biochemical chemically characterized inverters inhibitors ZM-INVINH1, NtINvI and protein ID.31 in Helentjaris et al., 2001. (identifier of protein No. CAC69345).

Based on this search, the four cccp2dl clones (unigén) have been identified in the EST databases. # 124209), cccs30wl4i24 (unigén # 125332), cccs30w24n8 (unigene # 122705) and A5-1462 with similarity to the d-invertase inhibitors of the database.

A. cCiNVil (SEQ ID NO.:13). The 670 bp cDNA insert of the cccp2dl clone is apparently full length, with a full ORF sequence of 558 bp, which encodes a protein with a potential molecular weight of 20.7 kDa. The cccp2dl protein sequence is 31.2% identical to the invertase inhibitor ZM-INVINH1 characterized in maize (Bate et al., 2004) (Figure 6). This cDNA has been annotated as Cclnvll (Inhibitor of Invertase 1 of Coffea canephora).

B. CCINVÍ2 (SEQ ID NO .: 14).

The 692 bp cDNA insert of clone cccs30wl4i24 is apparently full-length, with a complete ORF sequence of 537 bp, which codes for a protein with a potential molecular weight of 19.6 kDa. The protein sequence of cccs30wl4i24 is 34.6% identical to the invertase inhibitor Ntlnvl characterized in tobacco (Greiner et al., 1998; Weil et al., 1994) (Figure 6). This cDNA has been annotated as CcInvI2 (Invertase Inhibitor 2 of Coffea canephora).

SNC. Ccinyl 3 (SEQ ID NO .: 15). The Blast tracing of the cDNA library described in PCT application No. PCT / EP2004 / 006805 resulted in the discovery of clone A5-1462 of cDNA. The 704 bp cDNA insert of clone A5-1462 is apparently full length, with a complete ORF sequence of 495 bp, which codes for a protein with a potential molecular weight of 18.4 kDa. The protein sequence of A5-1462 is only 13% identical to ZM-INVINH1 (Figure 6), but 24.4% identical to protein ID.31 (Nucleotide Identification No. AX214363; Helentjaris et al., 2001). This cDNA has been annotated as CcInvI3 (Invertase Inhibitor 3 of Coffea canephora).

D. CcInvI4 (SEQ ID NO .: 16).

The 640 bp cDNA insert of clone cccs30w24n8 is apparently full-length, with a complete ORF sequence of 555 bp, which codes for a protein with a potential molecular weight of 20.2 kDa. The protein sequence of cccs30w24n8 is 20.5% identical to ZM-ININH1 (Figure 6) and 25.7% identical to protein ID.31 (nucleotide identification No. AX214363; Helentjaris et al., 2001). This cDNA has been annotated as CcInvI4 (Invertase Inhibitor 4 from Coffea canephora).

As mentioned before, Ccinvl proteins are not well conserved, and share a weak homology with ZM-INVINHl or Ntlnvl, for example. The four "conserved" Cys residues known as essential for function (Rausch and Greiner, 2003, Scognamiglio et al., 2003, Hothorn et al., 2003, Hothorn et al., 2004), are present in each protein (Figure 6). ).

EXAMPLE 4 Activities of acidic invertase and neutral during the ripening of coffee beans The concentrations of glucose, fructose and sucrose have been determined in whole grains from FRT05 (robusta) and CCCA12 (arabica) during the maturation of the coffee bean. We have chosen to analyze these two genotypes because they have previously been found to have significantly different sucrose levels (Charles Lambot, unpublished data). To understand the basis of this difference, we analyzed the accumulation of sucrose during the development of the grain of these two varieties, as well as the levels of glucose and fructose. In parallel, we examined the activities of acid and neutral invertase to determine if there could be a correlation between the accumulation of free sugar and these particular activities. Similar experiments have been performed using samples from a second variety of robusta, FRT6. The results are shown in Table 3 and in Figure 7.

TABLE 3 Activities of acidic invertase and neutral during maturation of coffee beans.

For this study, coffee cherries have been used in four different maturation stages characterized by size and color, that is, SG (small green), LG (large green), Y (yellow) and R (red). The concentrations of sucrose, glucose and fructose in the coffee bean were measured in the samples harvested in parallel with those used for invertase activity assays. The concentration of the sugars is expressed in g / 100 g of PS (dry weight) while the enzymatic activities are expressed in μmoles. h "1.mg_1 protein.

Genotype Stage d, e S "acarose G" l_, ucosa _F_.ructose In, ve.r.tasa Invertase development acxda neutral SG 0.72 1.54 0.33 1.50 0.43 LG 1.45 ERT05 1.71 0.09 0.58 0.17 and 3.13 0.09 0 0.26 0.3 R 6.70 0.04 0.09 1.44 0.54 SG 1.79 2.82 0.40 0.21 0.15 FRT64 LG 1.94 2.48 0.27 0.19 0.12 and 4.46 0.04 0. 0.45 0.28 R 6.6 0.07 0.16 0.58 0.51 SG 2.65 14.41 1.52 0.17 0.09 CCCA12 LG 3.11 5.62 0.49 1.70 0.49 and 8.04 0.1 0.12 0.19 0.20 R 9.83 0.08 0.1 0.34 0.14 A. Sugar levels during maturation of the coffee bean At the earliest maturity stage examined (GS stage), the main free sugar was glucose, but the concentration was 10 times higher at CCCA12 (14%) than at FRT05 (1.5%). In the same stage, the concentration of fructose was also higher in arabica (1.5%) than in FRT05 (0.3%) but clearly fructose accumulated less than glucose. By the end of the grain development, the glucose and fructose concentrations had decreased to very low levels for both species being detected only traces in the red stage of maturation (R). The decrease of these two sugars was accompanied by an increase in sucrose, which approached 100% of the total free sugars in the mature grains, being again higher in arabica (9.82%) than in robusta (6.71%). The same global annotations can be made on the variations of sucrose, glucose and fructose during the ripening of FRT64 coffee beans. Glucose was more accumulated in the earlier stage than fructose. At the end of development, sucrose was the main accumulated sugar.

Interestingly, even its the FRT64 and the FRT05 had the same final concentration of sucrose in the R stage (around 6.6% of PS), sucrose was more accumulated in the FRT64 samples than in the FRT05 samples in all the previous stages, that is, SG (60% more), LG (25% more) and Y (30 % plus). It is important to note that these results represent only the accumulation of free sugar and do not include its modified form such as UDP-G, F6-P and S6-P, which is also directly involved in the metabolism of sucrose.

B. Invertase activity (acid and neutral) during the maturation of the coffee bean. The activities of the acid and neutral enzymes evolved in a similar way during the maturation of the coffee bean CCCA12. The low activities of the acid invertase (0.17 U) and neutral (0.09 U) were observed in the SG stage of the CCCA12. Both enzymatic activities arose drastically between stage SG and LG and reached an activity of 1.70 U for acidic invertase and 0.49 U for neutral invertase. In this last stage of development, the activity of the AI and the IN declined dramatically to reach approximately similar low levels of activity in the Y stage (0.19 and 0.20 U, respectively). Between the stages Y and R, while the activity of the AI increased to 0.34 U, the activity of the IN decreased to 0.14 U. Interestingly, the activities of IA and IN have variations similar to those of the SuSy activity previously observed for the same samples (see provisional co-pending common property application No .: [STILL NOT ASSIGNED]). There is a clear correlation with the decrease in the activities of both invertases and the accumulation of sucrose in the later stages of CCCA12 grain maturation.

Notably, AI and IN activities evolved very differently for FRT05 and FRT64 versus those observed for CCCA12. The enzymes IA (1.50 U) and IN (0.43 U) were highly active early during the development of FRT05 (SG stage). The activity of IA decreased drastically between stages SG and Y until reaching 0.26 U (almost the same activity as that observed for CCCA12 in stage Y). The activity of AI in FRT05 arose between stage Y and R until reaching 1.44 U. The decreased activity of neutral invertase was also observed, but only between stages SG and LG. The increased activity of the neutral invertase was observed between the LG stage and the R, the IN reached its maximum activity at 0.54 U. The late development stage of the FRT05 grain is characterized by high activity of IA and IN. For the FRT64 genotype, the AI and IN activities were low in the FRT64 grain in SG. Both activities remained stable between stages SG and LG and increased between stages LG and R, with the increase being greater for the IN than for the AI. The FRT64 had the same increase in neutral invertase activity between the LG and R stages as the FRT05, but in parallel the activity of the acid invertase is 2.5 higher in the FRT05 than in the FRT64 in the R stage. In conclusion, the FRT05 and FRT64 have the same final concentration of sucrose in the mature grain, but the invertase activity, mainly of the acid, was drastically different.

In general, it appears that CCCA12 can accumulate more sucrose than FRT05 and FRT64, in part due to the weaker global activity of invertase in the final stage of maturation. Even if sucrose is synthesized after import from the phloem, the activity of the invertase is preventing the late development of sucrose accumulation by means of immediate degradation in both robust.

EXAMPLE 5 Accumulation of invertase mRNA and invertase inhibitors during maturation of the coffee bean We characterized the expression of the invertase genes Ccinvl, Cclnv2 and Cclnv3 as well as the invertase inhibitor genes Cclnvll, 2, 3 and 4, during the development of T2308 grain (C. arabica) and BP09 (C. canphora). For comparison purposes, we also characterize the expression of these genes in different coffee tissues, such as leaf, flower and root. It is emphasized that these genetic expression studies refer to varieties different from those used in the enzymatic activity analysis experiments. However, the data of this expression allow a general comparison between the expression of these genes in arabica versus robusta.

RNA was extracted from the coffee cherries BP409 and T2308 in four different maturation stages characterized by size and color, ie SG (small green), LG (large green), Y (yellow) and Y (red or mature). For each step, the pericarp and the grain were separated before extracting the total RNA as described in Example 1. Total RNA was also extracted from other tissues (leaf, root and flower). Genetic expression was analyzed by performing 1 RT-PCR in real time (TaqMan, Applied Biosystems). The relative levels of transcript against an endogenous constitutive rpl39 transcript were quantified. The specific baits of the gene and the TaqMan probes used are listed in Table 2 above.

The first general observation regarding the genetic expression of Cclnv is that it was discovered that these genes were expressed poorly, especially in the grain, in all stages of maturation and for both genotypes (Figure 8). The Ccinvl transcripts (a cell wall invertase) were not detected in the grain of any genotype. Interestingly, Cclnvlk transcripts were not detected in the pericarp of T2308, while significant levels could be detected in the pericarp of BP409 in the same stages. Conversely, relatively significant levels of Ccinvl were detected in the root and leaf tissues of BP409 but not in the same tissues of the T2308. This inverse expression strongly suggests that these differences are not due to allelic differences in the genes of BP409 and T2308 that encode these transcripts, but are apparently due to differences in the transcript levels of these genes in each genotype. A very high level of expression of Cclnv2 was detected in the flowers of T2308 in relation to the expression of BP409 (Figure 8, panel A, difference of approximately 10 times, T2308 (4.8 RQ) versus BP409 (0.38 RQ)).

It has been previously noted that there are significant differences in the expression of several other genes in the whole flower samples of T2308 and BP409 that were used here (eg CcHQT, CcPALl and CcPAL3, unpublished data), which led to the idea that These samples of complete flower may not be precisely in the same stage of development. When the expression data of Cclnv2 were investigated in more detail (Figure 8, panel B) it was observed that, apart from the small green grain of robusta, Cclnv2 was expressed at very low levels in the arabica or robusta grain. However, it was observed that there seems to be a slight tendency for the weak expression of Cclnv2 in the grain to increase towards maturity. A relatively significant expression of Cclnv2 was detected in the tissues of pericarp of arabica and robusta, although the The pattern of this expression was different.

In all the tested stages of Arabica pericarp, there was relatively similar expression; while in robust, the expression of Cclnv2 was very low in the small green pericarp and then gradually increased, detecting the highest expression in the mature pericarp tissue. Low Cclnv2 expression was also detected in the roots and leaves of BP409, but not in T2308.

The highest expression of Cclnv3, which is thought to encode a neutral invertase (cytoplasmic), was found in the flowers of arabica and robusta. In the other tissues, much lower levels of Cclnv3 expression were detected. In all stages of the grain, the level of Cclnv3 transcripts appeared to be marginally higher in arabica than in robusta, while in the pericarp, it seemed to be the opposite case, with the expression being robust marginally higher in the large green stages than red than in arabica.

Although the control of the invertases at the transcriptional level is important, significant control can also be exerted at the post-transcriptional level by the interaction of invertase proteins with a group of small molecular weight proteins (<20 kDa) so-called invertase inhibitors (Greiner et al., 1998; Greiner et al., 2000; Helentjaris et al., 2001; Bate et al., 2004). As mentioned above, four full length cDNAs that are believed to encode the invertase inhibitors were isolated from the EST libraries. The results of the analysis of expression of these genes are presented in Figure 9.

In the Arabica, it was found that the Cclnvll was expressed exclusively in the grain in the small green stage and to a much lesser degree in the large green stage, whereas in the robust stage this gene was expressed mainly in the large green grain (Figure 9). ). Very low levels of Cclnvll expression were detected in both yellow grains of arabica and robusta, but not in the mature grain (red).

Less specificity was observed for the expression of CcInvI2 (Figure 9). This gene is expressed at a relatively high level in whole flowers in both arabica and robusta. In the pericarp of arabica and robusta, the expression of Cclnvl2 can be detected at a relatively low level during the small green stage, but clearly increases significantly in both species as the cherry matures. It seems that the Cclnvll is expressed at extremely low levels in all stages of the grain, as well as in roots and leaves.

Like that of Cclnvll, the expression of Cclnvl3 and CcInvI4 showed a high level of tissue specificity. CcInvI3 seems to be expressed exclusively in the small green Arabica grain and in the yellow grain of robusta. The expression of CcInvI4 was detected almost exclusively in the small green tissue of the Arabica grain, while in the robust one, it was expressed in the large green grain as well as in the leaves to a lesser degree.

REFERENCES Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z., Miller. And Lipman D. 1990. Gapped BLAST and PSI-Blast: a new generation of protein datbase search. Nucleic Acids Res.25: 3389-3402.

Arabidopsis Genome Initiative. 2000. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796-815.

Badoud., 2000. "What do we know about coffee chemistry, flavor formation and stability?" Internal note, October 23, 2000.

Bate N. J., Niu X., Wang. , Reimann K. S. and Helentjaris T.G. 2004. An invertase inhibitor from maize localizes to the embryo surrounding region during early kernel development. Plan t Physiol. 134.1-9.

BenAmor M. and Me Carthy J. 2003. Modulation of coffee flavor precursor levéis in green coffee grains. European patent Application No.03394056.0 NESTEC S.A.

Chahan Y., Jordon A., Badoud R. and Lindinger W. 2002. From the green bean to the cup of coffee: investing coffee roasting by on-line monitoring of volatiles. Eur Food Res Technol. 214: 92-104.

Cheng W.-H., Taliercio E.W. and Chourey P.S. nineteen ninety six.

The Miniature 1 seed locus of maize encodes to cell wall invertase required for normal development of endosperm and maternal cells in the pedicel. Plant Cell. 8: 971-983.

Clough, S.J. and Bent A.F. 1998. Floral dip: a simplified method for Agrobacteriura-mediated transformation of Arabidopsis thaliana. Plant Journal 16; 735-743.

Crouzillat D., Lerceteau E., Petiard V., Morera J., Rodriguez H., Waiker D., Philips W.R.R. , Schnell J., Ose! J. and Fritz P. 1996. Theobroma cacao L .: a genetic linkage map and quantitative trait loci analysis. Theor Appl Genet. 93: 205-214.

Dali N., Michaud D. and Yelle S. 1992. Evidence for the involvement of sucrose phosphate synthase in the pathway of sugar accumulation in sucrose-accumulating tomato fruits. Plan t Physiol. 99: 434-438.

Dickinson CD., Atabella T. and Chrispeels M.J. 1991. Slow growth phenotype of transgenic tomato expressing apoplastic invertase. Plant Physiol. 95: 51-57.

Fridman E. and ZamirD. 2003. Functional divergence of a synthenic invertase gene family in tomato, potato and Arabidopsis. Plan t Physiol. 131: 603-609.

Fridman E, Carrari F, Liu YS, Fernie AR, Zamir D. 2004. Zooming in on a quantitative trait for tomato yield using interspecific introgressions. Science. 305 (5691): 1786-9.

Godt, D. E. et T. Roitsch. 1997. Regulation and tissue-specific distribution of mRNAs for three extracellular invertase isoenzymes of tomato suggest an important function in establishing and maintaining sink metabolism. Plant Physiol 115: 273-282.

Grandillo S. and Tanksley S.D. 1996. QTL analysis of horticultural traits differentiating the cultivated tomato fruit from the closely related species L. pimpinellífolium. Theor Appl Gene. 92: 935-951.

Greiner, S., Krausgrill, S. and Rausch, T. 1998.

Cloning of a tobacic apoplasmic invertase inhibitor. Proof of function of the recombinant protein and expression analysis during plant development. Plan t Physiol. 1116: 733-742.

Greiner S., T. Rausch, Sonne ald U. and Herbers K. 1999. Ectopic expression of a tobaceous invertase inhibitor homolog prevents cold-induced sweetening of potato tubers. Na ture Biotech. 17: 708-711 Greiner S. Koster Lauer K, Rosenkranz H, Vogel R, Rausch T. 2000. Plant invertase inhibitors: expression in cell culture and during plant development. Australian Journal of Plan t Physiology, 27: 807-814.

Helentjaris, T., Bate, N.J. and Alien, S.M. 2001 Novel invertase inhibitors and methods of use. Patent: WO 0158939. PIONEER HI-BRED INTERNATIONAL, INC. (US); EJ. DU PONT DE NEMOURS and COMPANY (US) Holscher, W. and Steinhart, H. 1995. Development in Food Science V37A Food Flavors: Generation, Analysis and Process Influence. Elsevier, 785-803.

Hothorn M., Bonneau F., Stier G., Greiner S. and Scheffzek K. 2003. Bacterial expression, purification and preliminary X-ray crystallographic characterization of the invertase inhibitor Nt-CIF from tobáceo. Acta Cryst D59: 2279-2282.

Hothorn M., Wolf S., Aloy P., Greiner S. and Scheffzek K. 2004. Structural insights into the target specificity of inverted plant and pectin methylesterase inhibitory proteins. Plant Cell. 16: 3437-3447.

Illy, A. and Viani, R. 1995. Espresso Coffee: The Chemistry of Quality. Academic Press. London Academic Press Ltd.

King S.P., Lunii, J.E. and Furbank R.T. 1997. Carbohydrate content and enzyme metabolism in developing cañola siliques. Plan t Physiol. 114: 153-160.

Klann E., Yelle S. and Bennett A.B. 1992. Tomato acid invertase complementary DNA. Plan t Physiol. 99: 351-353.

Klann E.M., Chetelat R. T. and Bennett A.B. 1993. Expression of acid invertase gene controls sugar composition in tomato (Lycopersicon) fruit. Plan t Physiol. 103: 863-870.

Klann E.M., Hall B., and Bennett A.B. 1996. Antisense acid invertase (TIV1) gene alters soluble sugar composition and size in transgenic tomato fruit. Plant Physiol. 112: 1321-1330.

Leloup V., Gancel C, Rytz, A. and Pithon, A. 2003. Precursors of Arabica character in green coffee, chemical and sensory studies. R &D Report RDOR-RD030009.

He and J. and Nelson O.E., Jr. 1946. Miniature seed-A study in the development of a defective caryopsis in maize. Genetics 31: 525-533.

Marraccini P., Deshayes A., Pétiard V. and Rogers W.J. 1999. Molecular cloning of the complete US seed storage protein gene of Coffea arabica and promoter analysis in the transgenic tobaceous plants. Plan t Physiol.

Biochem. 37: 273-282.

Marraccini P, Courjault C, Caillet V, Lausanne F, LePage B, Rogers W, Tessereau S, and Deshayes A. 2003. Rubisco small subunit of Coffea arabica: cDNA sequence, gene cloning and promoter analysis in transgenic tobáceo plants. Plant Physiol. Biochem. 41: 17-25.

Miller M.E. and Chourey P.S. 1992. The maize invertase-deficient miniature-1 seed mutation is associated with aberrant pedicel and endosperm development. Plant Cell. 4: 297-305.

Mirón D. and Schaffer A.. 1991. Sucrose phosphate synthase, sucrose synthase and invertase activities in developing fruit of Lycopersicon hirsutum Humb. and Bonpl. Plan t Physiol. 95: 623-627. 'tchobo H. , Dali. , Nguyen-Quoc B. , Foyer CH. and Yelle S. 1999. Starch synthesis in tomato remains constant throughout fruit development and is dependent on sucrose supply and sucrose activity. J. Exp. Bot. 50. 1457-1463.

Nguyen-Quoc, B. and C. H. Foyer. 2001. A role for 'futile eyeles' iving invertase and sucrose synthase in sucrose metabolism of tomato fruit. J. Exp. Bot. 52: 881-889. Ohyama A., I or H., Sato T., Nishimura S., Imai T. and Hirai M. 1995. Suppression of acid invertase activity by antisense RNA modifies the sugar composition of tomato fruit. Plan t Cell Physiol. 36: 369-376.

Privat L., Eychenne M., Kandalaft L., Caillet C, LinC, Tanksley S. and James McCarthy, 2005. Molecular characterization of sucrose synthase CcSS2 and sucrose phosphate synthase CcSPSl genes: quantitative expression and enzymatic activity in low and high sucrose coffee varieties. Infernal Report.

Rausch T. and Greiner S. 2004. Plant protein inhibitors of invertases. Biochimica et Biophysica Acta. 1696: 253-261.

Robinson N.L. , Hewitt J.D. and Bennett A.B. 1998 Sink metabolism in tomato fruit. Plant Physiol. 87: 732-730.

Rogers W. J., Michaux S., Bastin M. and P. Bucheli. 1999. Changes to the content of sugars, sugar alcohols, myo-inositol, carboxylic acids and inorganic anions in developing grains from different varieties of Robusta (Coffea canephora) and Arabica (C arabica) coffees. Plant Sc. 149: 115-123.

Roitsch T. and González M-C. 2004. Function and regulation of plant invertases: sweet sensations. Trends in Plan t Science. 9 (12): 606-613.

Russwurm, H. 1969. Fractionation and analysis of aroma precursors in green coffee, ASIC 4: 103-107.

Scholes J., Bundock N., Wilde R. and Rolfe S. 1996.

The impact of reduced vacuolar invertase activity on the photosynthetic and carbohydrate metabolism of tomato. Plant . 200: 265-272.

Scognamiglio M. A., Ciardiello M. A., Ta burrini M., Carratore V., Rausch T. and Camardella L. 2003. The plant invertase inhibitor shares structural properties and disulfide bridges arrangement with the pectin methylesterase inhibitor. Journal of Protein Chemistry. 22 (3) -363-369.

Sturm A. Chrispeels M.J. 1990. cDNA cloning of carrot extracellular ß-fructosidase and its expression in response to wounding and bacterial infection. Plant Cell 2: 1107-1119.

Sun J., Loboda T. , Sung S. J. S. and Black, C. C. J. 1992. Sucrose synthase in wild tomato, Lycopersicon chmielewskii, and tomato fruit sink strength. Plant Physiol. 98: 1163-1169.

Tang G.Q. , Luscher M. and Sturm A. 1999. Antisense repression of vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning. Plant Cell. 11: 177-189.

Tanksley S. D., Grandillo T.M., Ful on T.M. , Zamir D., Eshed Y., Petirad V., Lopez J. and Beck-Bunn T. nineteen ninety six. Advanced backcross QTL analysis in a cross between an elite processing line of tomato and its wild relative L. pimpinelli foli um. Theor Appl Gene. 92: 213-214. von Schaewen A., Stitt M., Schmidt R., Sonnewald U. and Willmitzer L. 1990. Expression of yeast-derived invertase in the cell wall of tobaceous and Arabidopsis plants leads to accumulation of carbohydrate and inhibition of photosynthesis and strongly influences growth and phenotype of transgenic tobáceo plants. EMBO J. 9: 3033-3044.

Wang F., Smith A.G. and Brenner M.L. 1993. Sucrose synthase starch accumulation and tomato fruit sink strength. Plan t Physiol 101: 321-327.

Weil M., Krausgrill S., Schuster A. and Rausch T. 1994. At 17 kDa Nicotiana tabacum cell -wall peptide acts as an in vitro inhibitor of the cell-wall isoform of acid invertase. Plant . 193: 438-445.

Yau Y-Y and Simón P. W. 2003. A 2.5 kb insert eliminates acid soluble invertase isozyme II transcript in carrot (Daucus carota L.) roots, causing high sucrose accumulation. Plan t Mol Biol. 53: 151-162.

Yelle S., Chetelat R.T. , Doráis M., Deverna J. W. and Bennett A. 1991. Sink metabolism in tomato fruit. Genetic and biochemical analysis of sucrose accumulation. Plan t Physiol. 95: 1026-1036. Ziegler H. 1975. Nature of transported substances. Encyclopedia of Plan t Physiology. 25: 505-509.

Zrenner, R., Salanoubat, M., Willmitzer, L., and Sonnewald, U. 1995. Evidence of crucial role of sucrose synthase for sink strength using transgenic potato plants. { Solanum tuberosum L. ). Plan t J. 7: 97-107.

The present invention is not limited to the representations described and exemplified above, but is capable of variation and modification within the competence of the appended claims.

Claims (46)

1. Nucleic acid molecule isolated from coffee. { Coffea spp. ) comprising a coding sequence that encodes an invertase or an invertase inhibitor.

2. Nucleic acid molecule according to claim 1, characterized in that the coding sequence encodes an invertase.

3. Nucleic acid molecule according to claim 2, characterized in that the invertase is a cell wall invertase, a vacuolar invertase or a neutral invertase. .

Nucleic acid molecule according to claim 3, characterized in that the invertase is a cell wall invertase and comprises a conserved domain having the amino acid sequence WECPDF.

5. Nucleic acid molecule according to claim 4, characterized in that the invertase comprises an amino acid sequence more than 55% identical to SEQ ID NO: 9 or SEQ ID NO: 13.

6. Nucleic acid molecule according to with claim 5, characterized in that the invertase comprises SEQ ID NO: 9 or SEQ ID NO: 13.

7. Nucleic acid molecule according to claim 6, characterized in that it comprises SEQ ID N0: 1 or SEQ ID NO: 4.

8. Nucleic acid molecule according to claim 3, characterized in that the invertase is a vacuolar invertase and comprises a conserved domain having the amino acid sequence WECVDF.

9. Nucleic acid molecule according to claim 8, characterized in that the invertase comprises an amino acid sequence 70% or more identical to SEQ ID NO: 10.

10. Nucleic acid molecule according to claim 9, characterized wherein the invertase comprises SEQ ID NO: 10.

11. Nucleic acid molecule according to claim 10, characterized in that it comprises SEQ ID NO: 2.

12. Nucleic acid molecule according to claim 3, characterized in that the invertase is a neutral invertase.

13. Nucleic acid molecule according to claim 12, characterized in that the invertase comprises an amino acid sequence 84% or more identical to SEQ ID NO: 11.

14. Nucleic acid molecule according to claim 13, characterized wherein the invertase comprises SEQ ID NO: 11.

15. Nucleic acid molecule according to claim 14, characterized in that it comprises SEQ ID NO: 3.

16. Nucleic acid molecule according to claim 1, characterized in that the coding sequence encodes an invertase inhibitor.

17. Nucleic acid molecule according to claim 16, characterized in that the invertase inhibitor comprises four conserved cysteine residues in its amino acid sequence.

18. Nucleic acid molecule according to claim 17, characterized in that the invertase inhibitor comprises an amino acid sequence that is 25% or more identical to any of SEQ ID NOS: 13, 14, 15 or 16.

19. Nucleic acid molecule according to claim 18, characterized in that the invertase inhibitor comprises any of SEQ ID NOS: 13, 14, 15 or 16.

20. Nucleic acid molecule according to claim 19, characterized in that it comprises any of SEQ ID NOS: 5, 6, 7 or 8.

21. Nucleic acid molecule according to claim 1, characterized in that the coding sequence is an open reading frame of a gene.

22. Molecule of mRNA produced by means of transcription of the gene according to claim 21.

23. CDNA molecule produced by means of the reverse transcription of the mRNA molecule according to claim 22.

24. Oligonucleotide of between 8 and 100 bases in length, which is complementary to a segment of the nucleic acid molecule according to the invention. claim 1.

A vector comprising the coding sequence of the nucleic acid molecule according to claim 1.

26. Vector according to claim 25, characterized in that it is an expression vector selected from the group of vectors consisting of plasmid, phagemid, cosmid, baculovirus, bacmid, bacterial, yeast and viral vectors.

27. Vector according to claim 25, characterized in that the coding sequence of the nucleic acid molecule is operably linked to a constitutive promoter.

28. Vector according to claim 25, characterized in that the coding sequence of the nucleic acid molecule is operably linked to an inducible promoter.

29. Vector according to claim 25, characterized in that the coding sequence of the nucleic acid molecule is operably linked to a tissue-specific promoter.

30. Vector according to claim 29, characterized in that the tissue-specific promoter is a seed-specific promoter.

31. Vector according to claim 30, characterized in that the seed-specific promoter is a specific promoter of coffee seed.

32. Host cell transformed with the vector according to claim 25.

33. Host cell according to claim 32, characterized in that it is selected from the group consisting of plant cells, bacterial cells, fungal cells, insect cells. and mammalian cells.

34. Host cell according to claim 32, characterized in that it is a plant cell selected from the group of plants consisting of: coffee, tobacco, Arabidopsis, corn, wheat, rice, soybean, barley, rye, sorghum, alfalfa , clover, cañola, saffron, sunflower, peanut, cacao, tomatillo, potato, pepper, egg plant, sugar beet, carrot, cucumber, lettuce, pea, daisy, begonia, chrysanthemum, delphinium, zinia, and pastures.

35. Fertile plant produced from the plant cell according to claim 34.

36. Method for modulating the flavor or aroma of coffee beans, comprising modulating the production or activity of one or more invertase or invertase inhibitors within of coffee seeds.

37. Method according to claim 36, characterized in that it comprises increasing the production or the activity of one or more invertases or invertase inhibitors.

38. Method according to claim 37, characterized in that it comprises increasing the expression of one or more endogenous invertase or invertase inhibitor genes within the coffee seeds.

39. Method according to claim 37, characterized in that it comprises introducing an invertase- or invertase inhibitor- that encodes the transgene within the plant.

40. Method according to claim 37, characterized in that it comprises increasing the production or activity of one or more invertase inhibitors.

41. Method according to claim 40, characterized in that the activity of the endogenous invertase in the plant decreases in comparison with an equivalent plant in which the production or the production is not increased. activity of the invertase inhibitor.

42. Method according to claim 40, characterized in that the plant comprises more sucrose in its seeds than an equivalent plant does in which the production or the activity of the invertase inhibitor is not increased.

43. Method according to claim 36, characterized in that it comprises decreasing the production or the activity of the one or more invertases or invertase inhibitors.

44. Method according to claim 43, characterized in that it comprises introducing a nucleic acid molecule in coffee, which inhibits the expression of one or more of the genes encoding the invertase or the invertase inhibitor.

45. Method according to claim 44, characterized in that the expression or activity of an invertase is decreased.

46. Method according to claim 45, characterized in that the plant comprises more sucrose in its seeds than an equivalent plant does in which the production or activity of the invertase is not decreased. SUMMARY Nucleic acid molecules isolated from coffee are described. { Coffea spp. ) comprising sequences encoding various enzymes that metabolize sucrose, together with their encoded proteins. Specifically, three types of invertase and four invertase inhibitors and their coffee coding polynucleotides are described. Methods for using these polynucleotides for genetic regulation and manipulation of the sugar profile of coffee plants, to influence the flavor, aroma and other characteristics of coffee beans, are also described.