MX2008000979A - Protein extracted from plants of the genus lupinus or produced in recombinant form, nucleotide sequence encoding it and its usein animal nutrition, as a plant growth promoter and in the fight against pathogenic fungi - Google Patents

Abstract

This invention is related to the extraction of a protein from the seeds, cotyledons or plantlets ofLupinusgenus, as well as to the way of producing it in recombinant form and of expressing it in genetically modified plants. Due to the exceptional characteristics exhibited by this protein in what concerns:its potent antifungal and anti-Oomycete activity, which confers great potential to the protein as a fungicide, (2) its strong plant growth promoter activity, particularly notorious on unhealthy or naturally weakenedplants, (3) its extreme resistance to denaturation, which allows the use of the protein under field conditions, (4) its great susceptibility to proteolytic attack, which makes it harmless to the environment and nontoxic for man, and (5) its well balanced amino acid composition. It is claimed its use, or of any modification of the protein that maintains its biological properties, as a supplement in human or animal nutrition and as a fungicide, insecticide, growth promoter, fertilizer or in the preparation of genetically modified organisms.

Description

PROTEIN EXTRACTED FROM GENDER PLANTS Lup ± n s O WHICH IS PRODUCED RECOMBINANTLY, NUCLEOTIDE SEQUENCE THAT CODIFIES FOR THE SAME AND ITS USE IN ANIMAL NUTRITION, AS A PROMOTER OF VEGETABLE GROWTH AND IN THE FIGHT AGAINST PATHOGENIC FUNGI FIELD OF THE INVENTION This invention is included in the area of Biology, with its practical applicability as a fungicide, insecticide, growth promoter or fertilizer belongs to the fields of Agronomic and Agricultural Sciences and due to its applicability as a complement in the diet of animals belongs to the Field of Human and Animal Nutrition.

BACKGROUND OF THE INVENTION This invention relates to a protein with antifungal, anti-oomycete and plant growth promoter properties, extracted from seeds, cotyledons or seedlings of the genus Lupinus, and its application in the control of pathogens that attack plants and as a bio -stimulant vegetable. This protein can be applied directly to plants, or plants can be They can genetically modify them to express the protein in their tissues. In addition, due to its inherent unusual characteristics, the protein can be used in the preparation of protein concentrates useful as supplements in the diet of humans and other animals. The present invention also describes the nucleotide DNA sequence corresponding to the gene fragment coding for the Lupinus protein, as well as its sequence of amino acid residues, to microorganisms transformed with the gene fragment encoding the Lupinus protein and methods for its application as a fungicide, insecticide, plant growth promoter or fertilizer or as a complement in human or animal nutrition. Also an object of this invention is the protein characterized by the sequence of amino acid residues referred to above, in which one or more amino acid residues are absent, have been replaced or added, or maintain their biological activity after being subjected to chemical modification , such as, for example, glycosylation. The control of pathogens is a serious problem worldwide with respect to the most important crops. Pathogenic fungi are particularly important in regard to the storage of agricultural products. Currently, control over fungal growth is usually achieved through massive applications of chemical fungicides. However, the phytopharmaceutical products currently available on the market show several serious disadvantages. On the one hand, they present high economic and environmental costs; On the other hand, many fungal species have developed mechanisms of resistance against some important fungicides, often making them obsolete in a few years after their introduction to the market. Even when plants do not have an immune system that resembles that of animals, they have developed an inherent resistance to the attack of pathogenic fungi. However, the techniques used for cultivation, harvest and vegetable storage in modern agriculture very often promote adequate or optimal conditions for the development of pathogens. In addition, the number of microbial pathogens that can affect and put at risk plant crops is quite high. As an example, reference can be made to the following genera: Al ternaría, Ascochyta, Botrytis, Cercospora, Colletotrichum, Diplodia, Erysiphe, Fusarium, Gaeumanomyces, Macrophomina, Nectria, Phoma, Phomopsis, Phyma totrichum, Phytophthora, Plasmopara, Puccinia, Pythium, Rhizoctonia, Uncinula, and Verticilliu. The application of fungicides currently available in the market is limited to some of these genera, and is not an effective solution for the control of plant infections. An alternative strategy in the fight against microbial pathogens is the identification and purification of substances of biological origin that have potent anti-fungal activity. The identification of said compounds involves investigating a variety of organisms, such as plants and microorganisms, with respect to substances that are later analyzed in antifungal tests and finally isolated and characterized. In this way, many classes of antifungal proteins have already been isolated, including chitinases, cysteine-rich proteins that bind strongly to chitin, β-1,3-glucanases, permeatins, thionins and proteins for lipid transfer. It is believed that these proteins play a fundamental role in the natural defenses of plants against the attack of pathogens. In the available literature several methodologies are described on the use of antifungal proteins, extracted from plants or microorganisms, either for direct application on pathogens, or on transgenic plants that express said proteins. The antifungal proteins most frequently used in these methodologies include chitinases, glucanases, osmotin-like proteins and lysozymes. Several studies have shown that genetically modified plants that overexpress these proteins have increased resistance to many pathogens (European Patent No. 0392 225). Modern Molecular Biology techniques allow the development of recombinant DNA technology and, consequently, plant transformation with genes that code for antifungal proteins. This method usually involves the insertion of the gene encoding the protein of interest into a plant tissue, followed by regeneration of a whole plant from the genetically modified plant tissue. However, the activity of some of these proteins is reduced by the presence of ions, in particular potassium, sodium or calcium. For this reason, although proteins may exhibit potent antifungal activity in in vitro tests, they may be ineffective in vivo due to the high physiological concentrations of the ions that are naturally present in the transformed plant tissues. In conclusion, it is imperative to identify and purify novel compounds of biological origin that have anti-pathogenic properties in the fight against pathogens that affect plants. Particular importance should be given to those compounds that are effective over a broad range of pathogens and that maintain biological activity under in vivo conditions. Agricultural practices have been optimized, over a long period of time, to promote plant growth and development and to increase crop production. On the other hand, it is predictable that, in the medium to long term, there may be a shortage of food in many areas of the planet. Current techniques to control plant growth under environmentally controlled conditions are costly and require complex equipment. For these reasons, many researchers have investigated and reported physiologically active substances, either natural or synthetic, that exhibit an intensifying effect on the growth and development of crops. However, only a few of these substances have found practical application under real agricultural conditions. Therefore, it is also increasingly important to discover or develop plant growth promoters that are not aggressive to the environment and that do not present toxicity to humans, animals and the environment. Leguminous plants or, in a more specifies, its seeds, are considered as the main source of protein worldwide for the 'nutrition of humans and animals. In this sense, soybeans play a prominent role, not only because of the high protein content and quality of their seeds but also because of their richness in oil. However, from the agricultural point of view, soybeans require fertile soils and an abundant supply of water. The plants that belong to the genus Lupinus have conquered, through the last decades, a relevant position, strong and of great potential in comparison with the soybeans. If, on the one hand, their seeds have levels of protein and oil comparable to those of soybeans, on the other hand, their species are well adapted to poor soils and conditions of low water availability. For these reasons, lupins have sometimes been considered the "poor cousins" of soybeans. The high level of alkaloids that are toxic to animals and that are naturally present in traditional wild-type lupine seeds have long prevented the widespread cultivation of Lupinus species and the use of their seeds for animal and human consumption. . This is the main reason why the lupine crop has lagged behind the Soy bean cultivation. In Portugal, for example, the traditional consumption of lupine seeds has long been associated with the ingestion of beer. These seeds are first boiled in water (heating to 100 ° C destroys the ability of the seeds to germinate but does not block the imbibition process) and then they are submerged under running water for a few days to remove the toxic alkaloids. However, the recent application of selection techniques allowed the development of the so-called sweet lupine varieties, characterized by containing a low alkaloid content in the seed (<0.004% w / w), as opposed to the more bitter traditional cultivars. (alkaloid content > 0.004% w / w). For this reason, the seeds of sweet lupine varieties can be used safely as food for humans and animals. Therefore, an increasing development of food products derived from lupine is predictable for the nutrition of both humans and animals, as has happened for several decades with soybeans. This is particularly important in the case of lupine seed proteins, either albumins or globulins.

SUMMARY OF THE INVENTION It is expected that the present invention solves the technical problem associated with the identification and purification of compounds of biological origin that are capable of controlling a wide variety of pathogens that affect plant crops and that act as promoters of plant growth while maintaining their biological activities under in vivo conditions. The solution is based on the discovery and identification by the present invention of a protein present in plants belonging to the genus Lupinus, which exhibits the following unusual characteristics: (i) potent antifungal and anti-oomycete activity, which confers it great potential as a fungicide; (ii) strong activity. as a promoter of plant growth, particularly noticeable in diseased or naturally weakened plants; (iii) extreme resistance to denaturation, which allows its use under field conditions; (iv) a very high susceptibility to proteolysis, which makes it harmless, environmentally friendly and non-toxic to humans and animals; and (v) a well-balanced amino acid composition. Therefore, the first aspect of this invention relates to the protein defined in claim 1. A second aspect of the present invention relates to a DNA fragment encoding the protein (claim number 3). The invention also relates to the use of the protein, or any preparation that contains it, as a fungicide, insecticide, growth promoter or fertilizer, either by direct application, in recombinant form or by expression in genetically modified organisms. Finally, the invention considers the use of the protein or any preparation that contains it as a complement in human or animal nutrition.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 - Grape leaves highly infected with powdery mildew are sprinkled with water (leaf on the right) or with the protein extracted from Lupinus (leaf on the left). (A) 24 hours after sprinkling; (B) 2 months after the spraying. Figure 2 - Observations of optical microscopy of the germination of spores from the fungus responsible for powdery mildew in vine. The fungal spores are carefully removed from the surface of infected young vine leaves and inoculated on agar with 0.6% water (w / v). (A), (B) and (C) - Controls; (D) and (E) -addition of 200 μg of the total protein fraction from mature grapes, which contain proteins related to pathogenesis (PR); (F) and (G) - addition of 200 μg of the protein extracted from Lupinus. Each test is observed after 24 and 48 hours. Phase contrast microscopy is used and the magnification used is 125X. Figure 3 - Observations with metallurgical microscope of vine leaves. (A) Healthy leaves; (B) Leaves infected with powdery mildew; (C) Leaves infected with powdery mildew, 12 hours after spraying with the protein extracted from Lupinus. The magnification used is specified in each photograph. Figure 4 - Effect of the protein from Lupinus, produced in a recombinant form in Escherichia coli, on the germination and development of spores of Uncinula neca tor, the causative agent of powdery mildew. Figure 5 - Rose plants are sprayed in the same stage of development with water (rose plant to the right) or with a solution containing the protein extracted from Lupinus (200 μg of protein / ml; left) . The photograph shows the stage of development of both plants three weeks after the aspersion. Figure 6 - Watermelon plants produced in a nursery. Six weeks after the start of germination the plants are sprayed with water (control; A), a crude Lupinus extract containing 100 μg of protein / ml (B), a commercially available plant growth promoter (recommended concentration) by the manufacturer) (C), and a crude Lupinus extract containing 200 μg of protein / ml (D). The experiment is followed for two weeks and the plants are photographed. Figure 7 - Typical profile of the insolubility of globulins from plants of the genus Lupinus as a function of calcium and magnesium concentrations. This profile is taken as an example to show the effect of these cations on the self-aggregation of the protein extracted from Lupinus (M) and Lupinus β-conglutin (O). β-Conglutine (0.5 mg * ml_1; O) and protein extracted from Lupinus (0.5 mg-ml-1; M) are purified from dry seeds or from cotyledons detached from seedlings that are germinated and grown for eight days, respectively .

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to a protein Novelty with powerful antifungal properties, which exhibits a potent activity on the germination and development of spores from fungal and oomycete pathogens for plants, and with activity of plant growth promoter, particularly notable in diseased or naturally weakened plants. The invention also considers the use of the protein or any preparation that contains it as a complement in human or animal nutrition. The DNA nucleotide sequence of the gene fragment encoding the Lupinus protein does not share any significant homology with any other antifungal protein that has been isolated from plants. The Lupinus protein constitutes a novel type of protein between proteins. antifungal agents described in plants. The protein referred to in the present invention is purified from cotyledons extracted from germinated seedlings of the genus Lupinus. The present invention includes the description of the methodology used to isolate the protein from plant tissues, the DNA nucleotide sequence of the gene (A) fragment encoding it, and the corresponding sequence of amino acid residues (B) .

(A) 5 'CGTAGACAAAGGAACCCTTATCACTTCAGCTCTCAAAGATTCCAAACTCT TTACAAAAATAGGAATGGCAAAATCCGTGTG CTCGAGAGGTTTGAC- CAAAGAACCAATAGACTTGAGAATCTCCAAAACTACCGCATTGTTGAGTTC CAATCAAAACCTAACA CTCTCATTCTCCCTAAACACTCTGATGCTGAC- TACGTCCTCGTTGTACTCAATGGTAGAGCCACAATCACGATAGTAAACCC TGATAGAAGACAAGCATATAACCTTGAGTATGGCGATGCTCTCAGAATCCC AGCTGGCTCAACTTCATATATCCTTAACCCG GATGACAACCAGAAGCTTA- GAGTAGTCAAGCTCGCAATACCCATCAACAATCCTGGCTACTTTTATGATT TCTATCCATCGA GTACTAAAGACCAACAATCCTACTTCAGTG- ACAAAGGATTATTTTAGGGAATGAGGAT GCTTCAGCAGGAACACTTTAGAGGCCACCTTCAATACTCGTTATGAAGAGA T 3' (B) 5 'RRQRNPYHFS SQRFQTLYKN RNGKIRVLER FDQRTNRLEN LQNYRIVEFQ SKPNTLILPK HSDADYVLVV LNGRA TITIV NPDRRQAYNL EYGDALRIPA GSTSYILNPD DNQKLRVVKL AIPINNPGYF YDFYPSSTKD QQSYFSGFSR NTLEATFNTR YEEIQRIILG NED 3 'This protein seems to occur naturally only during a very short period of time in the life of seedlings of the genus Lupinus. The inventors of the present invention have shown that β-conglutin, the most important seed reserve protein of the genus Lupinus, is the biosynthetic precursor of the Lupinus protein. In effect, the Lupinus protein is a protein highly processed that has experienced several levels of chemical modification. This greatly increases the difficulty of their study, including the sequence determination of the amino acid residues and the corresponding nucleotides. During the formation of the seed, the gene coding for β-conglutin is transcribed in the corresponding mRNA, whose translation results in the synthesis of the biosynthetic precursor of β-conglutin. This precursor is then extensively processed, including glycosylation, from which the several tens of different types of subunits constituting β-conglutin are produced. In the next cycle of vegetative growth, several days after the onset of germination, the initial steps in the catabolism of β-conglutin involve the proteolytic cleavage of all or most of its constituent subunits, which results in the accumulation of the protein described in this invention. Due to its intrinsic antifungal properties, which are naturally exploited by the host plant, this protein is maintained at very high concentrations in the cotyledons of the developing plants, during a life stage in which the plant is more sensitive to attack by fungi and insects. After a few days, the protein is degraded and its amino acids are used in the growth of the young plant. The Lupinus protein described in the present invention has some properties that distinguish it from the other antifungal proteins described in the literature. This makes it a promising target with great potential to develop an efficient method to control the fungi that affect plants and / or animals: (1) Powerful antifungal and anti-oomycete activity, which gives great potential to the protein as a fungicide, (2) Strong activity of plant growth promoter, particularly noticeable in diseased or naturally weakened plants, (3) extreme resistance to denaturation, which allows the use of the protein under field conditions, (4) Great susceptibility to proteolytic attack , which makes it harmless to the environment and non-toxic to the human, and (5) A well-balanced amino acid composition. The protein can also be used as an insecticide, growth promoter or fertilizer, and as a food supplement in human or animal nutrition. Two practical problems in today's agriculture in day they are the reduction or inhibition of growth observed in diseased or naturally weakened plants and the toxicity normally associated with the biostimulants available. The protein extracted from plant tissues of Lupinus exhibits a strong growth promoter activity during the growth and development of the plant. In fact, the Lupinus preparations or extracts containing the protein possess a strong bio-stimulatory activity in all the plants analyzed, including, for example, grapevine, rose, watermelon and tomato. This effect is notorious for protein concentrations equal to or greater than 200 μg / ml. The other components present in non-pure extracts of the Lupinus protein add value to the preparations because they act as a foliar fertilizer. The absence of toxicity of Lupinus protein for humans, animals and the environment indicates that its application in agriculture does not have any harmful effect on the environment. Another aspect of the present invention refers to the methodology used for the recombinant production of Lupinus protein in bacteria, with the aim of expressing it constitutively in genetically modified plants. Eventually, these plants may present a high level of resistance to pathogenic fungi, specifically with respect to fungi that are difficult to control (as in the case of fungi responsible for the so-called wood diseases), against which traditional fungicides of exogenous application are not fully effective. The protein is extracted from seedlings of Lupinus albus cv. LeBlanc eight days old. The seeds are placed in a room at constant temperature (25 ° C in the day, 20 ° C at night) with a photoperiod of 16 light hours / 8 dark hours. After harvesting, the cotyledons are frozen in liquid nitrogen. Protein extraction is carried out in buffer solution 100 mM Tris-HCl, pH 7.5, containing 10% (w / v) NaCl, 10 mM EDTA (ethylenediaminetetraacetic acid) and 10 mM EGTA (ethylene glycol bis ( ß-aminoethyl ether) -N, N, N ', N' -tetra-acetic). After an incubation period of 30 minutes at 4 ° C, the extract is centrifuged at 30,000 g, for 1 hour at 4 ° C. The salt of the supernatant is removed and the protein extracted from Lupinus is subsequently purified by FPLC (liquid chromatography of peptide and rapid protein) -anion exchange chromatography. The N-terminal sequence determination of the protein extracted from Lupinus is achieved by Edman degradation. The sequence obtained from amino acid residues is used to design degenerate primers. MRNA Total is extracted from developing seeds of Lupinus albus at a stage in which the maximum synthesis of the β-conglutin precursor occurs. The extraction of mRNA is carried out using protocols / kits for purification of mRNA from plant material. The cDNA corresponding to the gene fragment coding for the protein extracted from Lupinus is amplified by PCR (polymerase chain reaction) using the previously designed degenerate primers. Using the nucleotide sequence obtained as a template, new primers are designed and the complete nucleotide sequence of the gene fragment coding for the protein extracted from Lupinus is achieved using the RACE 3 'and 5' technique (rapid amplification of the cDNA ends). The Lupinus protein is produced recombinantly in the bacterium Escherichia coli. The gene fragment encoding the Lupinus protein is cloned into an appropriate vector, which allows the association of the gene of interest to the T71ac promoter. This promoter is inductive; therefore, the expression of genes that are associated with it occurs exclusively in the presence of isopropylthio-β-galactoside sugar. Finally, the competent cells of Escherichia coli are transformed. As described above, the protein of Lupinus is obtained in a recombinant form from bacteria. However, to be analyzed for its antifungal activity, the recombinant Lupinus protein has to be isolated from all other bacterial proteins. For this purpose, the Lupinus protein is previously produced in a recombinant form with a histidine residue tag (His-Mark). The methodology used for its purification is based on the high affinity of nickel ions for the His brand. In this way, having nickel ions bound to an agarose matrix, the purification of the recombinant protein is achieved knowing that among all the proteins present in the total bacterial extract, only the Lupinus protein binds to the agarose matrix. Subsequently, the Lupinus protein is recovered after an appropriate set of washes and elutions, and the His-mark is removed after treatment with an appropriate proteolytic enzyme. The careful choice of an appropriate promoter is a prerequisite for the genetic modification of plants. In the literature, several types of promoters are described, which allow the expression of the associated genes. To express the gene fragment encoding the protein described in the present invention, the selected promoter can be inductive or constitutive, depending on the type of expression required. The choice of the promoter is also important to direct the synthesized protein to the selected cell tissue or compartment (post-transcriptional modifications). The transformation of the plant can be achieved using different methodologies such as, transformation of the plant by Agrobacterium, protoplast transformation, transfer of genes to pollen grains, direct injection into reproductive organs or immature embryos, and particle bombardment. Each of these methods has specific advantages and disadvantages. However, all of these have already been used in different types of plants. To transform plants with the gene fragment encoding the Lupinus protein, the selected method is transformation by Agrobacterium (Fraley et al., 1983), using an appropriate expression vector, which contains a coding region for the associated gene of interest to an appropriate marker gene. Plant regeneration, plant development and transfer of the plant to the culture medium from a single protoplast can be achieved by following several methodologies available in the literature. This procedure includes several steps in the selection of transformed cells and the subsequent cultivation of these cells by the usual methods employed in the development of embryogenic crops. The regenerated plantlets are finally grown in an appropriate culture medium, usually soil. It is also an objective of the present invention any agricultural formulation that includes as the active ingredient the protein according to claims 1 or 2, or a recombinant form of the protein obtained according to claim 9, characterized by being used in the prevention , control and fight against fungi or pathogenic oomycetes or pests caused by insects, or as a growth promoter or fertilizer. Another aspect of the present invention relates to the frequent reduced levels in vegetable proteins of the diets for humans and animals and, in some cases, to the low protein digestibility and to an unbalanced amino acid composition. In fact, crude preparations containing the Lupinus protein possess not only an important globulin (the Lupinus protein, object of the present invention) but also a variety of albumins that are naturally present in the plant material used in the protein extraction. Therefore, these crude preparations of Lupinus protein are particularly rich in proteins and can be used as a protein supplement in animal nutrition or humans as tofu (after precipitating the globulin with calcium and magnesium) or as ricotta (after precipitating the albumins). The analysis of the amino acid composition of the Lupinus protein and its great susceptibility to all the proteases analyzed (including trypsin, chymotrypsin, subtilisin, proteinase K and pronase) indicates that this protein has a high nutritional value for animals. However, the protein considered in the present invention is a globulin. For this reason, the Lupinus protein is insoluble in water and in diluted saline solutions, but it is easily soluble in solutions of high ionic strength. However, legume globulins are insoluble only when they are in the presence of calcium, magnesium and other alkaline earth cations (Ferreira et al., 1999). These divalent cations, positively charged at neutral pH values, act as electrostatic bridges between negatively charged globulin molecules, promoting or inducing self-aggregation as complexes that are so large that they become insoluble (Ferreira et al., 1999; Ferreira et al., 2003). Tofu, for example, is a curd similar to cheese or cottage cheese that is prepared by adding calcium and magnesium ions to a hot extract of soybeans. Both cations are used routinely in the preparation of tofu and can be obtained commercially in the form of Nigari®. In this way, a crude preparation of Lupinus protein, containing both globulins and albumins, can be used in the preparation of Lupinus globulin concentrates after their precipitation with calcium and / or magnesium. Figure 7, for example, shows the precipitation pattern of Lupinus protein () as a function of aggregate concentrations of calcium and magnesium. For comparative purposes, the precipitation profile of its precursor protein, β-conglutin (the main reserve protein present in Lupinus seeds, O) is also presented. The albumins that remain in the resulting serum can also be recovered, for example, by thermal precipitation, in a procedure similar to that used in the preparation of ricotta (thermal precipitation of the milk albumins that remain in the serum after the removal of casein during the making of cheese). In this way, preparations containing the Lupinus protein can be used as a protein supplement in the diet of humans or animals. To understand the potential of the present invention, several practical examples are presented. However, these examples are not limiting in the sense that alternative methodologies can be used in the use of the Lupinus protein as an agent for antifungal and oomycete control, as an insecticide, as a growth promoter, as a fertilizer or as a complement, a protein in the diet of humans or animals.

EXAMPLES Examples 1 and 2 - Effect of sprinkling the Lupinus protein on the surface of vine leaves infected with the fungus Uncnula necator (the causative agent of powdery mildew on grapevine) The antifungal activity of the Lupinus protein is evaluated after sprinkling the surface of a vine leaf with a solution containing 200 mg of pure protein / ml. As a control, a similar sheet is sprinkled under identical conditions with water. The results obtained are presented in figure 1 and show that the vine leaves remain healthy two months after sprinkling the leaves with the protein, without traces of the presence of the fungus, although the sprinkled leaves are always and permanently in close contact with leaves highly infected Another test is carried out following an identical methodology, but the observations of the surfaces of treated vine leaves are made using a Metallurgical microscope (Figure 3).

EXAMPLE 3 Effect of Lup ± nus protein on the germination and development of spores of Unc ± nula necator The spores of the Uncinula fungus are removed from the surface of infected vine leaves and inoculated on agar with 0.6% (w / v) water, which contains 200 mg of pure Lupinus protein per me, or 200 mg of the fraction of total protein from mature grapes (containing PR proteins) per my. The germination of the spores and the development of the germ tubes is followed by optical microscopy using the contrast phase lens system, for 24 and 48 hours. The results obtained, presented in figure 2, show that there is a marked reduction in the presence of the medium containing the Lupinus protein, not only in the number of germinated spores, but also in the length of the germ tubes. This effect is remarkable when compared to the result observed in the presence of PR proteins.

EXAMPLE 4 Effect of Lupinus protein on the germination and development of spores of the Phomops ± s viticulture fungus (the causative agent of excoriation in the vines) Spores of the fungus Phomopsis vi tícola are inoculated in PDA medium (potato dextrose agar). After 15 minutes, the spores are removed and mixed with a solution containing the Lupinus protein in a final volume of 2.5 ml. These tiny droplets are placed in petri dishes and covered with slides which are subsequently sealed, creating a humid chamber. The development of the spores is followed by observations with an optical microscope. Clear inhibition of spore germination is evident. After 24 hours the hyphae under development undergo lysis.

EXAMPLE 5 Effect of recombinant Lupinus protein on spore germination of the fungus üncinula necator The recombinant protein of Lupinus, expressed in bacteria, is purified and its antifungal activity is evaluated. These tests are carried out as previously described in examples 2 and 3. The results obtained, presented in Figure 4, show that the recombinant protein has antifungal properties identical to those observed for the protein extracted from Lupinus plants. After an incubation period of 48 hours in the presence of the recombinant Lupinus protein, destruction of the cell walls of the spore is observed.

EXAMPLE 6 Effect of recombinant Luplnus protein on spore germination of Plasmopara oomycete for viticulture (the causative agent of pubescent downy mildew) The spores of the Plasmopara oomycete are removed from the surface of infected vine leaves and placed on agar with 0.6% (w / v) water, which contains 200 mg of pure recombinant Lupinus protein per my. The germination of the spore is followed for 48 hours by optical microscope observations. Spore germination on water agar is used as a control. After 24 hours, the cell walls of the spores are destroyed, with the concomitant release of the cellular contents.

EXAMPLE 7 Effect of sprinkling the protein extracted from Lupinus on rose plants The bio-stimulatory activity of the Lupinus protein is evaluated after sprinkling the leaf surfaces of a rose with a crude extract of Lupinus containing 200 μg of protein / ml. As a control, a rosebush in an identical development stage and incubated under the same environmental conditions is sprinkled with water. The obtained result, photographed three weeks after sprinkling, is presented in figure 5 and shows a superior growth for the plant sprinkled with the Lupinus protein, which is demonstrated by the premature appearance of the first flower buds.

EXAMPLE 8 Effect of sprinkling the protein extracted from Lupinus on nursery watermelon plants The bio-stimulating activity of the Lupinus protein is evaluated after spraying the foliar surfaces of 6-week-old nursery watermelon plants with a crude extract of Lupinus containing 200 μg of protein / ml. The test is carried out under conditions of greenhouse and plants are sprinkled with water (control; A); a crude extract of Lupinus containing 100 μg of protein / ml (B); a plant growth promoter commercially available in the market (concentration recommended by the manufacturer) (C); and a crude Lupinus extract containing 200 μg of protein / ml (D). 24 plants are used in each test. The test is followed during the two subsequent weeks and the results obtained are presented in figure 6. The plants sprinkled with the highest concentration of Lupinus protein (200 μg protein / ml; D) show the highest development and growth superior foliar when compared to plants treated with water or with the plant growth promoter commercially available in the market. Sprayed plants with the lowest concentration of Lupinus protein (100 μg protein / ml, B) have a lower level of development but are still higher than that observed for plants sprinkled only with water. The recommended level of application is therefore to spray the plants with a crude preparation of Lupinus protein containing 200 μg of protein / ml.

EXAMPLE 9 Effect of sprinkling the protein extracted from Lupinus on vines infected with üncinula necator (the fungal agent causing powdery mildew, economically the most important vine disease worldwide) A crude Lupinus extract containing 200 μg of the Lupinus protein is prepared by me. Vines infected with Uncinula neca tor and kept under greenhouse conditions are sprinkled with the extract or with water (control). 24 hours after the application, the sprinkled plants are observed - in relation to the control, the plants sprinkled with the Lupinus protein present a higher vigor and reveal the appearance of new shoots. This situation is maintained for at least a week, after which the plants, previously weakened by the presence of the fungus, are exuberant and with many new leaves without any symptoms of the disease.

EXAMPLE 10 Determination of the optimal concentrations of calcium and magnesium required for the preparation of a Lupinus tofu protein concentrate The well-balanced amino acid composition of Lupinus protein, as well as its excellent digestibility (the protein is easily hydrolyzed in its constituent amino acids by the action of the human digestive tract protests) highlight the great nutritional potential of the protein concentrate of Lupinus prepared after precipitating with 5 mM of calcium + magnesium the globulins present in a crude preparation of the Lupinus protein (see figure 7).

References Fraley, RT, Rogers, SG, Horsch, RB, Sanders, PR, Flick, JS, Adams, SP, Bittner, ML, Brand, LA, Fink, CL, Fry, JS, Galluppi, GR, Goldberg, SB, Hoffman , NL I or, S.C. (1983). Expression of bacterial genes in plant cells. Proceedings of the National Academy of Sciences USA, 80, 4801-4807. Ferreira, R.B., Franco, E. and Teixeira, A.R. (1999) . Calcium- and magnesium- dependent aggregation of legume seed storage proteins. Journal of Agricul tural and Food Chemistry, 47, 3009-3015. Ferreira, R.B., Freitas, R.L. and Teixeira, A.R. (2003). Self-aggregation of legume seed storage proteins inside the protein storage vacuoles is electrostatic in nature, rather than lectin-mediated. FEBS Letters, 534, 106-110.

Claims (15)

1. NOVELTY OF THE INVENTION Having described the present invention, it is considered a novelty and therefore the content of the following is claimed as property: CLAIMS 1. - A protein extracted from plants of the genus Lupinus, characterized by: (a) The sequence of amino acid residues presented in (B); (B) 5 'RRQRNPYHFS SQRFQTLYKN RNGKIRVLER FDQRTNRLEN LQNYRIVEFQ SKPNTLILPK HSDADYVLVV LNGRA TITIV NPDRRQAYNL EYGDALRIPA GSTSYILNPD DNQKLRVVKL AIPINNPGYF YDFYPSSTKD QQSYFSGFSR NTLEATFNTR YEEIQRIILG NED 3' (b) The sequence of amino acid residues presented in (B), in which one or more amino acid residues they are absent, have been substituted, added or modified, and the protein exhibits antifungal and anti-oomycete activity, plant growth promoter activity and / or maintains its biological properties.
2. 2. A protein extracted from plants of the genus Lupinus according to claim 1, characterized in that it is glycosylated, phosphorylated, rented and / or pre-filed.
3. 3. A fragment of DNA encoding the protein according to claim 1, characterized by: (a) The nucleotide sequence presented in (A); (A) 5 'CGTAGACAAAGGAACCCTTATCACTTCAGCTCTCAAAGATTCCAAACTCT TTACAAAAATAGGAATGGCAAAATCCGTGTG CTCGAGAGGTTTGAC- CAAAGAACCAATAGACTTGAGAATCTCCAAAACTACCGCATTGTTGAGTTC CAATCAAAACCTAACA CTCTCATTCTCCCTAAACACTCTGATGCTGAC- TACGTCCTCGTTGTACTCAATGGTAGAGCCACAATCACGATAGTAAACCC TGATAGAAGACAAGCATATAACCTTGAGTATGGCGATGCTCTCAGAATCCC AGCTGGCTCAACTTCATATATCCTTAACCCG GATGACAACCAGAAGCTTA- GAGTAGTCAAGCTCGCAATACCCATCAACAATCCTGGCTACTTTTATGATT TCTATCCATCGA GTACTAAAGACCAACAATCCTACTTCAGTG- ACAAAGGATTATTTTAGGGAATGAGGAT GCTTCAGCAGGAACACTTTAGAGGCCACCTTCAATACTCGTTATGAAGAGA T 3' (b) The nucleotide sequence shown in (A), in which one or more nucleotides are absent, have been replaced, added or modified, and encodes a protein with antifungal and anti-oomycete activity, with plant growth promoter activity and / or maintaining its biological properties.
4. 4. A recombinant vector characterized in that it contains the DNA fragment in accordance with the claim 3.- A transformed cell characterized in that it is transformed with the recombinant vector according to claim 4. 6. A transformed cell according to claim 5, characterized in that it is obtained from Escherichia coli. 7. A transformed cell according to claim 5, characterized in that it is obtained from a plant, animal or microorganism. 8. A transgenic plant characterized in that it contains a transformed cell according to claim 5 and because it exhibits resistance against pathogenic fungi, Oomycetes or pests caused by insects, which is obtained by regeneration of the aforementioned transformed cell. 9. A method for producing the protein according to claim 1, characterized in that it includes a culture of transformed cells according to claim 5, 6 and 7 and the recovery of the protein with antifungal activity from a cell culture or of a cellular extract. 10. A crude formulation or preparation of the protein, characterized in that it includes as an active ingredient the protein according to the claims 1 or 2, or its recombinant form obtained according to claim 9. 11.- A crude formulation or preparation of the protein according to claim 10, characterized in that it is used in the prevention, control or control against fungi and Oomycetes. , pathogens or not, pests caused by insects, as a promoter of plant growth and fertilizer. 12. The use of the protein according to claim 1 or 2, or its recombinant form obtained according to claim 9, in the preparation of a formulation, characterized in that it is directed to the prevention, control or fight against fungi and Oomycetes, pathogens or not, insects, as a promoter of plant growth and fertilizer. 13. The use of the protein according to claim 1 or 2, or its recombinant form obtained according to claim 9, in the prevention, control or control against fungi and Oomycetes, pathogens or not, pests caused by insects, as a promoter of plant growth and fertilizer, characterized in that a total or partial extract of Lupinus, which contains the protein according to claim 1 or 2, or its recombinant form obtained according to claim 9 is applied to the plant. 14. - The use of the protein according to claim 1 or 2, or its recombinant form obtained according to claim 9, or a crude preparation containing it, characterized in that it is applied as a bio-stimulant or as a growth promoter and plant development, said bio-stimulating activity can be observed particularly after sprinkling the foliage of plants naturally weakened or infected with pathogens that. 15. The use of the protein according to claims 1 or 2, or its recombinant form obtained according to claim 9, or a crude preparation containing it, characterized in that it is applied in the preparation of protein concentrates for human nutrition or animal with high nutritional value, either after the globulin is precipitated with calcium and magnesium salts or with and without physical treatment, such as heating for albumin precipitation.