MX2008000245A - Methods and compositionsfor expressing negative-sense viral rna in canine cells - Google Patents

Abstract

The present invention provides novel canine pol I regulatory nucleic acid sequences useful for the expression of nucleic acid sequences in canine cells such as MDCK cells. The invention further provides expression vectors and cells comprising such nucleic acids as well as methods of using such nucleic acids to make influenza viruses, including infectious influenza viruses.

Description

METHODS AND COMPOSITIONS FOR EXPRESSING VIRAL RNA NEGATIVE SENSE IN CANINE CELLS FIELD OF THE INVENTION In one aspect, the present invention provides an isolated nucleic acid comprising a regulatory sequence of canine RNA polymerase I. In other aspects, the invention provides cells and expression vectors comprising such nucleic acids as well as methods of using such nucleic acids to make influenza viruses, including infectious influenza viruses.

BACKGROUND OF THE INVENTION Influenza pandemics are defined by a dramatic overall increase in morbidity and mortality due to influenza illness. Several factors combine to modulate the severity and extent of the pandemic including the low degree of immunity in the population and the efficiency with which the virus can be transmitted between humans. The latter is generally influenced not only by the virus itself, but by the density of the population and ease of travel within and outside of a region. The virus responsible for the pandemic is generally an antigenic variant recently emerged with which the majority of the population has not had previous experience and, therefore, Ref. 188901 has little or no immunity. In addition, efficient human-to-human transmission is a prerequisite for rapid spread and, in the case of zoonotic introduction of animal viruses into human populations, the virus must adapt to human replication and be capable of efficient transmission. Pandemic influenza expands very rapidly and can have a devastating impact. The most severe pandemic of the 20th century, the pandemic of 1918, killed 500,000 American citizens and between 20 and 40 million people in the world. The pandemic can produce waves of disease, with peaks of incidence separated by several weeks to months. The relatively rapid and widespread onset of pandemic influenza presents several problems that respond to a global attack of this magnitude and imposes overwhelming burdens for those responding to emergencies and health care workers. The response and rapid identification to the emerging pandemic is clearly a necessary element of the solution; Several programs are currently in global locations to monitor emerging influenza viruses including avian influenza viruses that infrequently cause disease in humans. These surveillance data are used in conjunction with predefined pandemic alert levels to identify the threat probability and provide guidance for an effective response.

Vaccination is the most important public health measure to prevent the disease caused by annual influenza epidemics. The short interval between the i-dentification of a potential pandemic and the onset of significantly increased disease levels present significant challenges in producing enough vaccine to protect a large segment of the population. Having manufacturing infrastructure and vaccine technology in place prior to the emergence of the next pandemic will be critical in the improvement of a significant amount of disease and health. The short response times needed to produce a "pandemic vaccine" will not allow the prolonged search or development of the process to be conducted to provide an effective response. To date, all influenza vaccines commercially available for non-pandemic strains in the United States have been propagated in embryonated chicken eggs. Although the influenza virus grows well in chicken eggs, the production of vaccines is dependent on the availability of eggs. The egg supply must be organized, and the strains for vaccine production selected months before the next flu season, limiting the flexibility of this procedure, and frequently resulting in delays and shortages in production and distribution. Unfortunately, some strains for influenza vaccine, such as the prototype A / Fujian / 411/02 strain that circulated during the 2003-04 seasons, do not replicate well in embryonated chicken eggs, and have been isolated by cell culture in an expensive and time-consuming procedure. Systems to produce influenza viruses in cell culture have also been developed in recent yearstO.

(See, for example, Furminger, Vaccine Production, in Nicholson et al. (eds) Textboo of Influenza pp. 324-332; Merten et al. (1996) Production of influenza virus in cell cultures for vaccine preparation, in Cohen & Shafferman (eds) Novel Strategies in Design and Production of Vaccines pp. 141-151). Typically, these methods involve infection of suitable immortalized host cells with a selected virus strain. Although eliminating many of the difficulties associated with the production of vaccines in chicken eggs, not all pathogenic strains of influenza also grow and can be produced according to established tissue culture methods. In addition, many strains with desirable characteristics, eg, attenuation, temperature sensitivity and cold adaptation, suitable for the production of live attenuated vaccines, have not been successfully developed in tissue culture using established methods. In addition to cell culture-based methods that rely on infecting the cell culture with live virus, fully infectious influenza viruses have been produced in cell culture using recombinant DNA technology. The production of recombinant-DNA influenza viruses significantly increases the flexibility and usefulness of tissue culture methods for the production of influenza vaccine. Recently, systems for production of influenza A and B viruses from recombinant plasmids incorporating cDNAs encoding the viral genome have been reported. See, for example, Neumann et al. (1999) Generation of influenza A virus from cloned cDNAs. Proc Nati Acad Sci USA 96: 9345-9350; Fodor et al. (1999) Rescue of influenza A virus from recombinant DNA. J. Virol 73: 9679-9682; Hoffmann et al. (2000) A DNA transfection system for generation of influenza A virus from eight plasmids Proc Nati Acad Sci USA 97: 6108-6113; WO 01/83794; Hoffmann and Webster (2000), Unidirectional RNA polymerase I-polymerase II transcription system for the generation of influenza A virus from eight plasmids, 81: 2843-2847; Hoffmann et al. (2002), Rescue of influenza B viruses from 8 plasmids, 99 (17): 11411-11416; US Patent Nos. 6,649,372 and 6,951,754; North American Publication Nos. 20050003349 and 20050037487, which is incorporated herein by reference. These systems, often referred to as "plasmid rescue" offer the potential to produce recombinant virus that expresses the immunogenic NA and HA proteins of any selected strain. However, these recombinant methods rely on the use of expression vectors comprising regulatory elements of poly-S-RNA I (RNA pol I) to direct the transcription of viral genomic rRNA. Such regulatory elements are necessary to produce the defined 5 'and 3' ends of the influenza genomic RNA so that a fully infectious influenza virus can be made. Current recombinant systems, such as those described above, use the human RNA pol L regulatory system to express viral RNA. Due to the species specificity of the RNA pol L promoter, these regulatory elements are only active in human or primate cells. Accordingly, rescue of influenza virus plasmids has been possible to date only by transfecting appropriate plasmids in human or primate cells. In addition, such human or primate cells frequently do not produce a sufficient titer of influenza virus required for vaccine manufacture. However, Madin-Darby canine kidney cells (cells, for their acronym in English MDCK) can be used to replicate vaccine strains to a sufficient degree to manufacture commercial vaccines. Accordingly, the production of an influenza vaccine using plasmid rescue currently requires the use of at least two different cell cultures. The identification and cloning of the regulatory sequences of canine RNA pol I could allow - that the rescue of the plasmid be carried out in the same cell culture as viral replication, eliminating the need for a separate rescue crop. As such, this maintains a need for the identification and cloning of canine pol L RNA regulatory elements that can be used to construct appropriate vectors for rescue of plasmids in MDCK and other canine cells. These and other unfulfilled needs are provided by the present invention. The citation or discussion of a reference herein will not be construed as an admission that it is the prior art for the present invention. In addition, the citation of a patent will not be constructed as an admission of its validity.

BRIEF DESCRIPTION OF THE INVENTION Nucleic acids which comprise regulatory elements that can be used to express, for example, influenza genomic RNA in canine cells are described herein. Compositions such as isolated nucleic acids, vectors, and cells comprising the canine regulatory sequences of the invention, and methods of using the same are embodiments of the subject invention. Accordingly, in certain aspects, the isolated nucleic acids of the invention comprise a regulatory sequence of canine RNA polymerase I (pol I). In certain embodiments, the regulatory sequence comprises a promoter. In certain embodiments, the regulatory sequence comprises an enhancer. In certain embodiments, the regulatory sequence comprises both a promoter and an enhancer. In one embodiment, the regulatory sequence comprises nucleotides -250 to -1 (relative to the first nucleotide transcribed from the promoter, also known as the +1 nucieotide) of the corresponding native promoter or a functional derivative thereof. In one embodiment, the regulatory sequence is operably linked to a viral DNA, for example, a cloned viral cDNA. In one embodiment, the cloned viral cDNA encodes viral RNA from a negative or positive strain virus or the corresponding cRNA. In certain embodiments, the cloned viral cDNA encodes the genomic viral RNA (or the corresponding cRNA) of an influenza virus. In one embodiment, the isolated nucleic acids of the invention comprise a canine RNA polymerase I regulatory sequence and a transcriptional termination sequence. In certain embodiments, the transcriptional termination sequence is a RNA polymerase I termination sequence. In a specific embodiment, the transcriptional termination sequence is a human, monkey, or canine pol L terminator sequence. In certain aspects, the present invention provides an isolated nucleic acid comprising a canine RNA pol L promoter. Preferably, the canine RNA pol L promoter is operably linked to a nucleic acid to be transcribed, such as, for example, an influenza genomic RNA. In one embodiment, the introduction of the nucleic acid into a canine cell results in the transcription of the influenza genomic RNA, and, in the presence of suitable influenza proteins, the transcription of the RNA can be packaged in a virus-of infectious influenza. In one embodiment, isolated nucleic acids are provided which comprise a canine RNA regulatory sequence of the invention (eg, a canine RNA pol L promoter), wherein the regulatory sequence is operably linked to a nucleic acid for to be transcribed and, in the presence of suitable proteins (eg, a RNP complex in the case of a nucleic acid encoding an influenza vRNA segment) in vitro or in vivo, is transcribed. In one embodiment, the nucleic acid operably linked to the regulatory sequence is a segment of influenza vRNA. In certain embodiments, the nucleic acids of the invention comprise a polynucleotide sequence or a functionally active fragment thereof, eg, a canine RNA pol L regulatory sequence, which binds a human, primate, mouse or canine polypeptide polypeptide. and is at least 100% or approximately 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identical to one or more selected nucleotide sequences of the group consisting of: SEQ ID Nos: 1-19. In one embodiment, the polynucleotide sequence or functionally active fragment thereof further retains the ability to initiate transcription, in the presence of appropriate polypeptides (e.g., pol I polypeptides of human, primate, mouse or canine), from a second sequence of polynucleotides operably linked to the nucleotide sequence. In one embodiment, the "functionally active fragments" of the nucleic acids described in SEQ ID Nos: 1-19 retain one or more functional activities described herein in the full length sequences of SEQ ID NOS: 1-19. For example, the functionally active fragments of the regulatory sequence described as SEQ ID NO: 1 are provided whereby the regulatory sequence fragment is operably linked to a nucleic acid to be transcribed and, in the presence of suitable proteins in vitro or in vivo, It is transcribed. In certain embodiments, the nucleic acids of the invention comprise a polynucleotide sequence or a fragment thereof, eg, a canine RNA pol L regulatory sequence, which binds a polypeptide of human, primate, mouse or canine pol I and / or is 100% or at least or about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identical or one or more nucleotide sequences selected from the group consisting of: SEQ ID Nos: 1-19. In one embodiment, the polynucleotide sequence or fragment thereof furthermore retains the ability to initiate transcription, in the presence of appropriate polypeptides (e.g., polypeptides of human, primate, mouse or canine poly I), of a second polynucleotide sequence. linked operatively to the nucleotide sequence. In other embodiments, the isolated nucleic acids of the invention comprise a regulatory sequence of canine RNA polymerase I and a ribozyme sequence. This may be, for example, the genomic ribozyme sequence of the hepatitis delta virus or a functional derivative thereof. In one embodiment, the nucleic acids of the invention encode the genomic viral RNA of any negative-strand RNA virus known to one of skill in the art without limitation. In certain embodiments, the viral RNA encodes the genomic viral RNA of a virus from the order of Mononegavirales. In certain embodiments, the viral RNA encodes the genomic viral RNA of a virus of the family Para yxoviridae, Pneumovirinae, Rhabdoviridae, Filoviridae, Bornaviridae, Orthomyxoviridae, Bunyaviridae, or Arenaviridae. In certain embodiments, the viral RNA encodes the genomic viral RNA of a Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, Avulavirus, Pneumovirus, Metapneumovirus, Vesiculovirus, Lyssavirue, Ephemerovirus, Cytorhabdovirus, Nucleorhabdovirus, Novirhabdovirus, Marburgviru, Ebolavirus, Bornavirus, Influenzavirus viruses. A, Influenza virus B, Influenza virus C, Thogotovirus, Isavirus, Orthobunyavirus, Hantavirus, Nairovirus, Phlebovirus, Tospovirus, Arenavirus, Ophiovirus, Tenuivirus, or Deltavirus. In certain embodiments, the viral RNA encodes the genomic viral RNA of a virus selected from the group consisting of Sendai virus, Measles virus, Mum virus, Hendra virus, Ne castle disease virus, Human respiratory syncytial virus, Avian pneumovirus, virus. of Indiana of Vesicular stomatitis, Rabies virus, Bovine ephemeral fever virus, Yellow necrotic virus of Lettuce, Yellow potato dwarf virus, Infectious necrosis virus, Lake Victoria marburgvirus, Zaire ebolavirus, Malnutrition virus Boma, Influenza A virus, Influenza B virus, Influenza C virus, Thogoto virus, Salmonella infectious anemia virus, Bunyam era virus, Hantaan virus, Dugbe virus, Rift Valley fever virus, Withered spotted tomato, Lymphocytic choriomeningitis virus, Citrus psorosis virus, Rice streak virus, and Hepatitis delta virus. In another aspect, the invention provides a vector comprising a nucleic acid of the invention. In certain embodiments, the vector is an expression vector. In certain embodiments, the vector comprises a bacterial origin of replication. In certain embodiments, the vector comprises a source of eukaryotic replication. In certain embodiments, the vector comprises a selectable marker that can be selected in a prokaryotic cell. In certain embodiments, the vector comprises a selectable marker that can be selected in a eukaryotic cell. In certain embodiments, the vector comprises a multiple cloning site. In certain modalities, the multiple cloning site is oriented relative to the regulatory sequence of canine RNA polymerase I to allow transcription of the polynucleotide sequence introduced into the multiple cloning site of the regulatory sequence. In certain embodiments, the vector comprises a polynucleotide sequence that can be expressed in canine cells, for example, in MDCK cells. In one embodiment, the invention provides expression vectors useful to recombinantly rescue a virus from cell culture, for example, cell cultures of MDCK. Generally, vectors are useful to rescue any virus known to one skilled in the art to require the production of RNA with defined ends during its life cycle. Such viruses include, but are not limited to, negative sense strand RNA viruses, such as those described above. Preferably, the virus is an influenza virus, for example, an influenza A, influenza B, or influenza C virus. In certain embodiments, one or more of the vectors of the invention further comprise an RNA transcription termination sequence. In certain embodiments, the transcription termination sequence is selected from the group consisting of a transcription termination sequence of RNA polymerase I, transcription termination sequence of RNA polymerase II, transcription termination sequence of RNA polymerase III, and a ribozyme In certain embodiments, the expression vectors are uni-directional expression vectors. In other embodiments, the expression vectors are bidirectional expression vectors. In some embodiments, the bidirectional expression vectors of the invention incorporate a first promoter inserted between a second promoter and a polyadenylation site, for example, an SV40 polyadenylation site. In certain embodiments, the first promoter is a canine RNA pol L promoter. In certain embodiments, the second promoter is a canine RNA pol I promoter. In one embodiment, the first promoter and the second promoter can be positioned in opposite orientations flanking at least one cloning site. In certain embodiments, the expression vectors comprise a ribozyme sequence or 3 'transcription termination sequence of at least one cloning site relative to the canine RNA pol L promoter. In certain embodiments, the expression vectors comprise a ribozyme sequence or 3 'transcription termination sequence of at least one cloning site relative to the canine RNA pol L promoter such that the vRNA can be synthesized intracellularly with 5' ends and 3 'exact. In one embodiment, in the bi-directional expression vectors of the invention, a gene or cDNA is located between a pol II promoter in the 5 'direction and a canine pol I regulatory sequence in the 3' direction (eg, a promoter). of pol I) of the invention. The transcription of the pol II promoter gel or cDNA produces positive sense viral mRNA encapsulated and the transcription of the canine pol I regulatory sequence produces unencapsulated, negative sense vRNA. Alternatively, in a unidirectional vector system of the invention, the gene or cDNA is located downstream of a pol I and pol II promoter. The pol II promoter produces encapsulated positive sense viral mRNA and the pol I promoter produces positive non-encapsulated viral sense cRNA. In another aspect, the invention provides a composition comprising one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, or seventeen vectors, wherein the Vectors comprise one or more nucleic acids of the invention (eg, a canine pol I regulatory sequence of the invention) operably linked to viral cDNA, eg, influenza viral cDNA. In certain modalities, one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more than twelve of the vectors of the invention are present in a single plasmid. In certain embodiments, at least two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve of the vectors are present in a separate plasmid. In certain embodiments, each vector is in a separate plasmid. In certain embodiments, the vectors of the invention are bi-directional expression vectors. A bi-directional expression vector of the invention typically includes a first promoter and a second promoter, wherein the first and second promoters are operably linked to alternative strands of the same double-stranded cDNA encoding the viral nucleic acid including a segment of the genome of influenza virus. Generally, at least one of these promoters is a canine RNA pol I promoter. Optionally, the bi-directional expression vector may include a polyadenylation signal and / or a termination sequence. For example, the polyadenylation signal and / or the termination sequence can be located by flanking a segment of the internal influenza virus genome to the two promoters. A favorable polyadenylation signal is a SV40 polyadenylation signal. In one embodiment, the invention comprises a bidirectional plasmid-based expression system and a unidirectional plasmid-based expression system, wherein the viral cDNA is inserted between a canine pol I regulatory sequence (e.g., a polypeptide promoter). I) of the invention and termination sequences (internal transcription unit). This internal transcription unit is flanked by an RNA polymerase II (pol II) promoter and a polyadenylation site (external transcription unit). In the unidirectional system, the pol I and pol II promoters are upstream of the cDNA and produce unencapsulated cRNA of positive sense (of the promoter of pol I) and mRNA encapsulated of positive sense (of the promoter of pol II). The pol I promoter, pol I terminator sequence, pol II promoter and polyadenylation signal in the unidirectional system can be referred to as comprising an "orientation 3 'to the 5'" direction. In the bidirectional system, the pol I and pol II promoters are on opposite sides of the cDNA where a poly II promoter in the 5 'direction produces mRNA encapsulated in the positive sense and a poly I promoter in the 3' direction produces non-viral RNA. negative sense encapsulation (vRNA). These pol I-pol II systems begin with the initiation of transcription of the two cellular RNA polymerase enzymes from their own promoters, presumably in different compartments of the nucleus. The pol I termination sequence and pol I promoter in the bi-directional system can be referred to as comprising an "orientation 3 'to the 5'" direction while the pol II promoter and the polyadenylation signal in the system bidirectional can be referred to as comprising an "orientation in direction 5 'to address 3'". In other aspects, the invention described herein includes compositions comprising an expression vector comprising a polynucleotide sequence transcribable by canine RNA polymerase 1. In certain embodiments, the polynucleotide produces an influenza cRNA or vRNA. In certain embodiments, the composition comprises a plurality of expression vectors each comprising a polynucleotide sequence transcribable by canine RNA polymerase I. In certain embodiments, the polynucleotides produce a plurality of influenza vRNA or cRNA. In certain embodiments, the polynucleotides produce all eight influenza vRNAs or cRNAs. In other aspects, the invention described herein includes compositions comprising a plurality of expression vectors of the invention which, when introduced into a canine cell in the absence / presence of a cooperating virus, results in the production of a genome. of influenza. In certain modalities, the compositions of the invention comprise a plurality of expression vectors that, when introduced into a canine cell in the absence / presence of a helper virus, result in the production of an infectious influenza virus. In certain embodiments, the infectious influenza virus is a cold-sensitive influenza virus. In certain embodiments, the infectious influenza virus is an attenuated influenza virus. In certain embodiments, the infectious influenza virus is a temperature-sensitive influenza virus. In certain modalities, the infectious influenza virus is an influenza virus adapted to the cold. In certain embodiments, the infectious influenza virus is an influenza virus adapted to the cold, temperature sensitive, attenuated. In certain embodiments, the compositions of the invention comprise a vector comprising, from 5 'to 3', a promoter operably linked to sequences of 5 'non-coding influenza viruses linked to cDNA linked to 3' non-coding influenza virus sequences. linked to a transcription termination sequence. In certain embodiments, one or more cDNAs in the vectors are in sense orientation. In certain embodiments, one or more cDNA in the vectors is in the antisense orientation. In certain embodiments, the invention provides compositions which comprise a plurality of vectors, wherein the plurality of vectors comprises a vector comprising a canine regulatory sequence operably linked to a cDNA of influenza protein polymerase (PA) acid linked to a transcription termination sequence, a vector comprising a canine regulatory sequence operably linked to a polymerase basic protein 1 (PB1) cDNA of influenza virus linked to a transcription termination sequence, a vector comprising a regulatory sequence of canine operably linked to a basic protein cDNA 2 (PB2) of influenza virus polymerase linked to a transcription termination sequence, a vector comprising a canine regulatory sequence operably linked to a hemagglutinin (HA) cDNA of the virus of influenza bound to a transcription termination sequence, a vector comprising a canine regulatory sequence operably linked to a nucleoprotein cDNA <; NP) of influenza virus linked to a transcription termination sequence, a vector comprising a canine regulatory sequence operably linked to a neuraminidase (NA) cDNA of influenza virus linked to a transcription termination sequence, a vector comprising a canine regulatory sequence operably linked to an influenza virus matrix protein cDNA linked to a transcription termination sequence, and a vector comprising a canine regulatory sequence operably linked to an influenza virus NS cDNA linked to a transcription termination sequence. In certain embodiments, the composition further comprises one or more expression vectors that express an mRNA encoding one or more influenza polypeptides selected from the group consisting of: PB2, PB1, PA, HA, NP, NA, matrix protein 1 ( Mi), matrix protein 2 (M2), and non-structural proteins 1 and 2 (NS1 and NS2). In one embodiment, the composition, when introduced into a canine cell, results in the production of influenza viruses from infections. In certain embodiments, the infectious influenza virus is a cold-sensitive influenza virus. In certain embodiments, the infectious influenza virus is an attenuated influenza virus. In certain embodiments, the infectious influenza virus is a temperature-sensitive virus. In certain modalities, the infectious influenza virus is an influenza virus adapted to the cold. In certain embodiments, the infectious influenza virus is an influenza virus adapted to the cold, temperature sensitive, attenuated. In certain embodiments, the invention provides a composition which generates infectious influenza virus of the cloned viral cDNA, comprising a set of plasmids wherein each plasmid comprises cDNA encoding at least one viral genomic segment, and wherein the corresponding viral cDNA the viral genomic segment is inserted between a canine RNA polymerase I regulatory sequence of the invention and a regulatory element (eg, a canine pol 1 terminator sequence) for the synthesis of vRNA or cRNA with an exact 3 'end , which results in expressions of vRNA or cRNA. In certain embodiments, the invention provides a composition which generates infectious influenza virus of the cloned viral cDNA, comprising a set of plasmids wherein each plasmid comprises cDNA encoding at least one viral genomic segment, and wherein the corresponding viral cDNA the viral genomic segment is inserted between a canine RNA polymerase I regulatory sequence of the invention and a regulatory element (eg, a canine pol 1 terminator sequence) for the synthesis of vRNA or cRNA with an exact 3 'end , which results in the expression of vRNA or cRNA, where the regulatory sequence of canine RNA polymerase I, viral cDNA, and a regulatory element for the synthesis of vRNA or cRNA with an exact 3 'end are in turn inserted between an RNA polymerase II (pol II) promoter and a polyadenylation signal, which results in expression of viral mRNA and a corresponding viral protein, wherein the expression of the complete cloning of vRNA or cRNA and viral proteins results in the assembly of an infectious influenza virus. In certain embodiments, the regulatory element for the synthesis of vRNA or cRNA with an exact 3 'end is a termination sequence of RNA polymerase I (pol I). When one skilled in the art is aware, the efficient replication and transcription of influenza vRNA requires very specific sequences at the 5 'and 3' ends of the vRNA. A terminator of RNA polymerase I (pol I) can be used by a person skilled in the art to ensure that the '3' end sequence of the RNA transcript made is defined as the exact endpoint desired for efficient replication and / or transcription of this genomic RNA. In certain modalities, the regulatory element for the synthesis of vRNA or cRNA with an exact 3 'end is a ribozyme sequence. In certain embodiments, the pol I promoter is close to the polyadenylation signal and the pol I termination sequence is close to the pol II promoter. In certain embodiments, the pol I promoter is close to the pol II promoter and the pol I termination sequence is close to the polyadenylation signal. In certain embodiments, the influenza virus is an influenza A virus. In certain embodiments, the influenza virus is an influenza B virus. In another aspect, the invention provides a method for producing an influenza genomic RNA, which comprises transcribing a nucleic acid of the invention, thereby producing an influenza genomic RNA. In certain embodiments, influenza genomic RNA is transcribed into a cell-free system. In certain embodiments, influenza genomic RNA is transcribed into a canine cell, for example, a MDCK cell. In one embodiment, the methods encompassed comprise transcribing a plurality of nucleic acids of the invention, thereby producing a plurality of RNA molecules, for example, a plurality of influenza genomic RNAs. In certain modalities, one, two, three, four, five, six, seven, or eight genomic RNAs of influenza are transcribed. In certain modalities, a complete set of influenza genomic RNAs is transcribed. In certain embodiments, influenza genomic RNA, when a MDCK cell is -transcribed in a canine cell, in the presence of PA, PB1, PB2, and NP, expresses an influenza protein. In certain embodiments, the influenza protein is selected from the group consisting of PB2, PB1, PA, HA, NP, NA, Mi, M2, NS1, and NS2. In certain embodiments, the complete set of influenza genomic RNAs, when transcribed into a canine cell, eg, an MDCK cell, in the presence of PA, PBl, PB2, and NP, express an infectious influenza virus. In certain embodiments, the methods comprise introducing PA, PBl, PB2, and NP in conjunction with influenza genomic RNAs. In certain modalities, PA, PBl, PB2, and NP are provided by a cooperating virus. In certain embodiments, the complete set of influenza genomic RNAs is from an antennuated influenza virus, sensitive to temperature, adapted to cold. In one embodiment, a method of transcribing a vRNA segment from an influenza virus is provided, the method comprising the steps of 1) contacting a polynucleotide comprising a nucleic acid (or active fragment thereof) selected from the group consists of: SEQ ID Nos 1-19 with one or more influenza proteins PBl, PB2, NP, and PA, wherein the nucleic acid is operably linked to a cDNA molecule that encodes the vRNA segment; and 2) isolate a transcribed vRNA segment. In a specific embodiment, cooperating virus is used in the method. In one aspect, the invention provides a method for producing recombinant infectious recombinant virus comprising a segmented RNA genome (e.g., an infectious influenza virus), comprising the steps of culturing canine host cells, e.g., MDCK cells, comprising one or more expression vectors of the invention comprising viral cDNA corresponding to each gene in the viral genome and one or more expression vectors expressing viral mRNA encoding one or more viral polypeptides; and isolate a population of infectious virus. In one embodiment, the infectious virus population is a population of influenza viruses. In one embodiment, the method further comprises the step of introducing one or more expression vectors into canine host cells prior to the culture step. In one embodiment, the method further comprises the step of making one or more expression vectors prior to the introduction step. In one embodiment, a method is provided for producing recombinant infectious recombinant virus comprising a segmented RNA genome (eg, an infectious influenza virus) wherein the method comprises the steps of: a) inserting into one or more expression vectors of the invention viral cDNA corresponding to each gene in the viral genome; (b) introducing (e.g., by electroporation) the expression vectors and one or more expression vectors that express the viral mRNA encoding one or more viral polypeptides in a host cell (e.g., a canine cell) or a population of host cells; (c) incubating the host cells; and d) isolate a population of infectious virus. In one embodiment, the infectious recombinant virus is influenza. In certain modalities, the influenza virus is an attenuated influenza virus, sensitive to temperature, adapted to the cold. In one embodiment, a method is provided for producing an infectious recombinant virus comprising a segmented RNA genome (eg, an infectious influenza virus) wherein the method comprises the steps of: a) inserting into one or more expression vectors of the invention a viral cDNA corresponding to each gene in the viral genome; (b) introducing (e.g., by electroporation) the expression vectors into a host cell (e.g., a canine cell) or a population of host cells; (c) incubating the host cells; and d) isolate a population of infectious virus. In one embodiment, the infectious recombinant virus is influenza. In certain modalities, the influenza virus is an attenuated influenza virus, sensitive to temperature, adapted to the cold. In one embodiment, the present invention provides method for generating infectious recombinant influenza viruses in host cells using expression vectors of the invention to express the corresponding vRNA or cRNA segments and influenza virus proteins, in particular PBl, PB2, PA and NA According to this embodiment, the cooperating virus may or may not be used to generate the infectious recombinant influenza viruses. In another embodiment, the invention provides a method for producing a recombinant influenza virus, comprising culturing canine cells comprising a plurality of nucleic acids comprising a canine RNA polymerase I regulatory sequence operably linked to one or more cDNAs encoding each RNA genomic influenza and one or more expression vectors expressing viral mRNA encoding one or more influenza polypeptides: PB2, PB1, PA, HA, NP, NA, Mi, M2, NS1 and NS2; and isolate the recombinant influenza virus from the cells. In certain embodiments, the methods comprise introducing into canine cell expression vectors which direct expression in the cells of genomic or antigenomic viral RNA segments, a nucleoprotein, and an RNA-dependent polymerase, so that the ribonucleoprotein complexes are they can form and viral particles can gather in the absence of a cooperating virus; and (b) culturing the cells where the viral particles are packaged and rescued. In certain embodiments, the recombinant negative strand virus is a non-segmented virus. In certain embodiments, the recombinant negative strand RNA is a segmented virus. In certain embodiments, the negative-strand RNA virus is an influenza virus. In certain embodiments, the methods comprise introducing into the expression vectors of cultured canine cells which direct the expression of the genomic or antigenomic RNA segments of a segmented negative-strand RNA virus, a nucleoprotein, and a polymerase dependent on RNA under conditions that allow the formation of RNP complexes containing the genomic RNA segments of the virus and assembly of viral particles in the absence of cooperating virus; and cultivate the cells where the viral particles are produced. In certain embodiments, expression vectors direct expression of genomic RNA segments of the virus. In certain embodiments, the canine cells used in the methods of the invention comprise one or more expression vectors that express one or more proteins selected from the nucleoprotein and the subunits of the RNA-dependent RNA polymerase. In certain embodiments, expression vectors direct the expression of one or more of the nucleoproteins and subunits of the RNA-dependent RNA polymerase. In certain embodiments, the expression of one or more viral proteins of the expression vectors is under the control of a regulatory sequence selected from the last major promoter of adenovirus 2 linked to the human tripartite bound sequence of human adenovirus type 2 or the immediate promoter- of human cytomegalovirus, or a functional derivative of the regulatory sequence. In certain embodiments, the virus is an influenza virus of type A, B or C. In certain embodiments, the virus is a rearranged virus that has vRNA segments derived from more than one virus of origin. In certain embodiments, the methods of the invention comprise introducing a plurality of vectors of the invention, each of which incorporates a portion of an influenza virus in a population of host cells capable of supporting viral replication. Host cells can be cultured under conditions permissive for viral growth, and influenza viruses can be recovered. In some embodiments, influenza viruses are attenuated viruses, viruses adapted to cold and / or temperature-sensitive viruses. For example, in certain embodiments, the recombinant influenza viruses derived from the vector may be temperature-sensitive, cold-adapted, attenuated viruses, such that they are suitable for administration as a live attenuated vaccine, eg, in a vaccine formulation. intranasal In an exemplary embodiment, viruses are produced by introducing a plurality of vectors that incorporate all or part of an influenza B / Ann Arbor / 1/66 influenza virus genome, for example, a ca B / Ann Arbor / 1 / genome. 66 In some embodiments, a plurality of vectors comprising cDNA encoding at least the 6 internal genome segments (e.g., genome segments encoding all influenza proteins except for HA and NA) of an influenza strain and cDNA encoding one or more genome segments (e.g., HA and NA vRNA segments) of a different influenza strain can be introduced into a population of host cells. For example, at least the 6 segments of the internal genome ("the skeleton") of a strain of influenza A or B sensitive to temperature and / or adapted to cold, attenuated selected, for example, a strain ca, att, ts of B / Ann Arbor / 1/66 or a strain of influenza A or B ca, att, ts artificially engineered, can be introduced into a population of host cells together with one or more segments encoding immunogenic antigens derived from other strains of virus . Typically the immunogenic surface antigens include either or both of the hemagglutinin (HA) and / or neuraminidase (NA) antigens. In embodiments where a single segment encoding an immunogenic surface antigen is introduced, the 7 complementary segments of the selected viruses are also introduced into the host cells. In certain embodiments, the expression vectors are transfected into the cells by electroporation. In certain embodiments, expression vectors are introduced into cells by transfection into cells in the presence of a liposomal transfection reagent or by means of calcium phosphate precipitation. In certain embodiments, the expression vectors are plasmids. In certain embodiments, the expression vectors comprise a separate expression vector for expression of each genomic RNA segment of the virus or corresponding coding RNAs. In certain embodiments, the expression of each genomic RNA segment or coding RNA is under the control of a promoter sequence derived from a canine Pol I promoter as described herein. In certain embodiments, a plurality of plasmid vectors incorporating influenza virus genome segments are introduced into a population of host cells. For example, in certain embodiments, 8 plasmids, each of which incorporates a different genome segment, can be used to introduce a complete influenza genome into the host cells. Alternatively, a larger number of plasmids, which incorporate smaller genomic subsequences, may be employed. In another aspect, the present invention provides a method for generating infectious viral particles from cultured cells and segmented negative strand RNA viruses that have more than 3 genomic vRNA segments, for example an influenza virus such as an influenza A virus, the method comprises: (a) introducing into a population of cells capable of supporting the growth of the virus a first set of expression vectors capable of expressing in the genomic vRNA segments of cells to provide the complete genomic vRNA segments of the virus; (b) introducing into the cells a second set of expression vectors capable of expressing the mRNA encoding one or more polypeptides of the virus; and (c) culturing the cells by means of which the viral particles are produced. In certain embodiments, the cells are canine cells. In certain embodiments, the cells are MDCK cells. In certain embodiments, the virus is influenza B virus. In certain embodiments, the first set of expression vectors is contained in 1-8 plasmids. In certain embodiments, the first set of expression vectors is contained in a plasmid. In certain embodiments, the second set of expression vectors is contained in 1-8 plasmids. In certain embodiments, the second set of expression vectors is contained in a plasmid. In certain modalities, the first, second, or both sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encode each vRNA segment of an influenza virus. In certain embodiments, the second set of expression vectors encode the mRNA of one or more influenza polypeptides. In certain embodiments, the first set or second set of expression vectors (or both sets) comprise a nucleic acid of the invention, eg, a canine regulatory sequence of the invention (eg, canine pol I). In certain embodiments, the first set or second set of expression vectors (or both sets) encode a vRNA or mRNA of a second virus. For example, a set of vectors comprise one or more vectors encoding the vRNA and / or HA and / or NA mRNA of a second influenza virus. The present invention also provides a method for generating infectious viral particles from cultured RNA cells of segmented negative strand viruses that have more than 3 genomic vRNA segments, for example an influenza virus such as an influenza A virus, the method comprises (a) introducing into a population of cells capable of supporting the growth of the virus a set of expression vectors capable of expressing in the genomic vRNA segments of cells to provide the complete genomic vRNA segments of the virus and capable of expressing the mRNA which encodes one or more virus polypeptides; (b) culturing the cells by means of which the viral particles are produced. In certain embodiments, the cells are canine cells. In certain embodiments, the cells are MDCK cells. In certain embodiments, the virus is influenza B virus. In certain embodiments, the set of expression vectors is contained in 1-17 plasmids. In certain embodiments, the set of expression vectors is contained in 1-8 plasmids. In certain embodiments, the set of expression vectors is contained in 1-3 plasmids. In certain embodiments, sets of expression vectors are introduced by electroporation. In certain embodiments, the set of expression vectors encode each vRNA segment of an influenza virus. In certain embodiments, the set of expression vectors encodes the mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors encode each vRNA segment of an influenza virus and the mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, e.g., a canine regulatory sequence of the invention (e.g., pol I canine). In certain embodiments, the set of expression vectors encodes a vRNA or mRNA of a second virus. For example, the set of vectors comprises one or more vectors encoding the vRNA and / or HA and / or NA mRNA of a second influenza virus. In certain embodiments, the first set or second set of expression vectors (or both sets) encode a vRNA or mRNA of a second virus. For example, a set of vectors comprise one or more vectors encoding the HA and / or NA mRNA and / or RNA of a second influenza virus. In certain embodiments, the methods further comprise amplifying viral particles produced by the canine cells by one or more stages of additional cellular infection using cells which are the same or different from the canine cells. In certain embodiments, the methods further comprise isolating infectious viral particles. In certain embodiments, the methods also comprise a viral attenuation or annihilation step. In certain embodiments, the methods further comprise incorporating attenuated or annihilated viral particles in a vaccine composition. In one embodiment, methods for producing viruses of the invention result in virus titers (24 hours, 36, or 48 hours after introducing vectors of the invention into host cells) of at least 0.1 x 10 3 PFU / ml, or at least 0.5 x 103 PFU / ml, or at least 1.0 x 103 PFU / ml, or at least 2 x 103 PFU / ml, or at least 3 x 103 PFU / ml, or at 4 x 103 PFU / ml at least, or at range of 0.1-lx 103 PFU / ml, or in the range of 1 x 103 - 5x 103 PFU / ml, or greater than 5 x 103 PFU / ml. In some embodiments, the influenza virus corresponds to an influenza B virus. In some embodiments, the influenza virus corresponds to an influenza A virus. In certain embodiments, the methods include recovering recombinant and / or reordered influenza viruses capable of causing an immune response during administration, for example, nasal administration, to a subject. In certain modalities, the virus is inactive - prior to administration, in other modalities, live attenuated viruses are administered. Recombinant and reordered influenza A and influenza B viruses produced in accordance with the methods of the invention are also a feature of the invention. In certain embodiments, the viruses include an attenuated influenza virus, a cold-adapted influenza virus, a temperature-sensitive influenza virus, or a virus with any combination of these desirable properties. In one embodiment, the influenza virus incorporates a strain of influenza strain B / Ann Arbor / 1/66, for example, a strain of B / Ann Arbor / 1/66 attenuated, adapted to the cold, sensitive to temperature. In another modality, the influenza virus incorporates a virus of strain A / Ann Arbor / 6/60 of influenza, for example, an attenuated strain of A / Ann Arbor / 6/60, adapted to the cold, sensitive to temperature. Optionally, rearranged viruses are produced by introducing vectors encoding the six internal vRNAs of a viral strain selected from its favorable properties with respect to vaccine production, in combination with vectors encoding vRNA segments of the surface antigens (HA and NA ) of a selected, for example, pathogenic strain. For example, the HA segment can be favorably selected from a pathogenically relevant Hl, H3 or B strain, as routinely performed for vaccine production. Similarly, the HA segment can be selected from an emerging pathogenic strain such as a strain of H2 (eg, H2N2), a strain H5 (eg, H5N1) or a strain of H7. { for example, H7N7). Alternatively, the seven segments of the complementary gene of the first strain are introduced in combination with any of the coding segments of HA or NA. In certain embodiments, the segments of the internal gene are derived from strain A / Ann Arbor / 6/60 or B / Ann Arbor / 1/66 influenza. In addition, an influenza virus can be produced (for example, an H5N1, H9N2, H7N7, or HxNy (where x = 1-9 and y = l-15) comprising a modified HA gene, for example, the HA gene can be modifying by removing the polybasic cleavage site In another aspect, the invention provides a host cell comprising a nucleic acid or expression vector of the invention In certain embodiments, the cell is a canine cell.In certain embodiments, the canine cell is a kidney cell In certain embodiments, the kidney cell is a MDCK cell In other embodiments, the cell is selected from the group consisting of Vero cells, Per.C6 cells, BHK cells, PCK cells, MDCK cells, MDBK cells , 293 cells (eg, 293T cells), and COS cells In some embodiments, co-cultures of a mixture of at least two of these cell lines, eg, a combination of COS and MDCK cells or a combination of cells 293T and MDCK, constit uye the population of the host cells. The host cells comprising the influenza vectors of the invention can be grown in culture under conditions permissive for virus replication and assembly. Typically, host cells that incorporate the influenza plasmids can be cultured at a temperature below 37 ° C, preferably at a temperature equal to, or less than, 35 ° C. In certain embodiments, the cells were cultured at a temperature between 32 ° C and 35 ° C. In some embodiments, the cells are cultured at a temperature between about 32 ° C and 34 ° C, for example, at about 33 ° C. Following the culture for a suitable period of time to allow replication of the virus in a particular way, recombinant viruses can be recovered. Optionally, recovered viruses can be inactivated. In still another aspect, the invention provides a method of engineering an influenza virus such that its growth is restricted to particular cell types including, but not limited to, MRC-5, WI-38, FRhL-2, PerC6, 293, NIH 3T3, CEF, CEK, DF-1, Vero, MDCK, MvlLu, human epithelial cells and SF9 cell types. In one embodiment, growth is restricted such that an influenza virus may not grow in a human primary cell (e.g., PerC6). In another embodiment, growth is restricted so that an influenza virus may not grow in a human epithelial cell. One skilled in the art will recognize that the growth restriction phenotype can be combined with one or more additional phenotypes such as cold adapted, temperature sensitive, attenuated, etc. It will also be recognized that a mutation responsible for a restricted growth phenotype may also contribute and / or be responsible for additional phenotypes such as those listed above. In another aspect, the invention provides novel methods for rescuing recombinant or rearranged influenza A or influenza B viruses (i.e. strains of influenza virus and / or wild type influenza A and variants) of MDCK cells in culture. In certain embodiments, a plurality of vectors incorporating an influenza virus genome whose transcription is controlled by a canine regulatory sequence of the invention is electroporated into a population of MDCK cells. The cells can be grown under conditions permissive for viral replication, for example, in the case of temperature-sensitive strains of virus, attenuated, adapted to the cold, the MDCK cells are grown at a temperature below 3 ° C, preferably at a temperature equal to, or less than, 35 ° C. Typically, the cells are cultured at a temperature between 32 ° C and 35 ° C. In some embodiments, the cells are cultured at a temperature between about 32 ° C and 34 ° C, for example, at about 33 ° C. Optionally, (for example for vaccine production), MDCK cells are grown in serum-free medium without any animal-derived products. In some embodiments of the methods described above, the influenza virus can be recovered by following the culture of the host cells that incorporate the influenza genome plasmids. In some embodiments, the viruses recovered are recombinant viruses. In some embodiments, the viruses are reordered influenza viruses that have genetic contributions from more than one strain of parental virus. Optionally, the recovered recombinant or rearranged viruses are further amplified by passage in cultured cells or in chicken eggs. Optionally, recovered viruses can be inactivated. In some embodiments, the recovered viruses comprise an influenza vaccine. For example, the recovered influenza vaccine may be a reordered influenza virus (eg, rearranged 6: 2 or 7: 1 viruses) having an HA and / or NA antigen derived from a selected strain of influenza A or influenza B In one embodiment, the HA or NA antigen is modified. In certain favorable modalities, reordered influenza viruses have an attenuated phenotype. Optionally, the rearranged viruses are adapted to the cold and / or are sensitive to temperature, for example, a temperature-sensitive or cold-adapted influenza A or B virus, attenuated. Such influenza viruses are useful, for example, as live attenuated vaccines for the prophylactic production of a specific immune response for, for example, a selected pathogenic influenza strain. Influenza viruses, for example, attenuated reordered viruses, produced according to the methods of the invention are a further feature of the invention. In another aspect, the invention relates to methods for producing one. recombinant influenza virus vaccine comprising introducing a plurality of vectors incorporating an influenza virus genome whose transcription is controlled by a canine regulatory sequence of the invention (eg, a canine RNA pol L promoter) in a population of cells hosts capable of supporting the replication of influenza viruses, culturing the host cells at a temperature less than or equal to 35 ° C, and recovering an influenza virus capable of eliciting an immune response upon administration to a subject. The vaccines may comprise either influenza A strain or influenza B strain. In some embodiments, influenza vaccine viruses include an attenuated influenza virus, a cold-adapted influenza virus, or a temperature-sensitive influenza virus. . In certain embodiments, viruses possess a combination of these desirable properties. In one embodiment, the influenza virus contains a virus of strain A / Ann Arbor / 6/60 influenza. In another modality, the influenza virus incorporates a virus strain B / Ann Arbor / 1/66 influenza. Alternatively, the vaccine includes artificially engineered influenza A or influenza B virus that incorporates at least one substituted amino acid which influences the biological properties characteristic of A / Ann Arbor / 6/60 or ca / B / Ann Arbor / 1 / 66, such as a single amino acid of these strains. In one embodiment, a vaccine is provided comprising a population of recombinant virus (or viruses derived therefrom) produced by the methods of the invention. In a specific embodiment, the vaccine comprises a live virus produced by the methods. In another specific embodiment, the vaccine comprises an annihilated or inactivated virus produced by the methods. In another specific embodiment, the vaccine comprises an immunogenic composition prepared from a live, killed or inactivated virus produced by the methods. In another specific embodiment, the vaccine comprises an immunogenic composition prepared from a temperature-sensitive, cold-adapted, live attenuated influenza virus produced by the method. In another specific embodiment, the vaccine comprises a temperature-sensitive, cold-adapted, attenuated, live influenza virus produced by the method or a virus derived therefrom.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows growth curves of strain B (B / Beijing / 243/97) wt (wild type) and ca (adapted to cold) in both PerC6 and MDCK cells; the virus titer was determined for each time point by test of TCID50. Figure 2 shows growth curves of strains A (A / Sydney / 05/97 and A / Beijing / 262/95) wt and ca in both PerCd and MDCK cells; the virus titer was determined for each time point by the TCID50 assay. Figure 3 presents strain growth curves A (A / Ann Arbor / 6/60) wt and ca in both PerC6 and MDCK cells; the virus titer was determined for each time point by the TCID50 assay. Figure 4 presents real-time analysis of A / Sydney viral RNA in PerCd and MDCK cells, using Taqman® probes (Roche Molecular Systems, Palo Alto, CA) specific for the M segment of the viral RNA. Figure 5 shows growth curves of A / Vietnam / 1203/2004 (H5N1) ca in MDCK cells; the virus titer for each time point was determined by the TCID50 test. Figure 6 presents a diagram showing the rescue of each influenza gene segment as a rearranged 7: 1 generated by the rescue technique of eight plasmids. Figure 7 shows growth curves of each of the rearranged 7: 1 in PerCd cells; the virus titer for each time point was determined by the TCID50 assay. Figure 8 presents a restriction map of an Eco Rl fragment comprising a canine RNA pol L regulatory sequence. Figures 9A, 9B and 9C present the nucleotide sequence. { SEQ ID NO: l) of a nucleic acid of about 3.5 kB cloned from canine genomic DNA, which encodes at least a portion of the 18s rRNA gene, starting at nucleotide 1804 in the presented sequence.

Figure 10 presents a map of plasmid pAD3000, which can be easily adapted to make an expression vector of the invention. Figure 11 presents a diagram of the MDCK pol I promoter constructs used in the mini-genome assay. Figure 12 presents the results of a mini-genome assay. The EGFP signal generated from the MCDK promoter constructs pol I -1, +1 and +2 are shown in the upper left, middle and right panels, respectively. A lower promoter control shows only background fluorescence (lower left). When positive control cells were also transfected with a CMV-EGFP construct (lower light).

DETAILED DESCRIPTION OF THE INVENTION The rescue of influenza virus plasmid generally comprises the introduction of expression vectors for expressing viral proteins and transcribing viral genomic RNA into suitable host cells. Transcription of viral genomic RNA is usually carried out with an RNA polymerase I enzyme, when these enzymes produce transcripts with termini suitable for use as viral genomes. Accordingly, the RNA pol L promoters and other regulatory elements are used to initiate the transcription of genomic RNAs during plasmid rescue. Unfortunately, RNA pol L promoters are highly specific species. That is, the pol I RNA of a species may or may not efficiently bind to an RNA pol I promoter of an unrelated species. Accordingly, the availability of RNA pol L promoters limits the cells in which the plasmid rescue is performed. Prior to the present invention, rescue of plasmid in canine cells was not possible. For the first time, rescue of plasmid in canine cells is possible based on the description of the present invention as follows. Accordingly, in a first aspect, isolated nucleic acids of the invention comprising canine RNA polymerase I regulatory sequences are provided. In certain embodiments, the regulatory sequence is a promoter. In one embodiment, the regulatory sequence is a canine pol I promoter sequence. In another modality, the regulatory sequence is operably linked to cloned viral cDNA. In yet another embodiment, the cloned viral cDNA encodes viral RNA from a negative or positive strand virus or the corresponding cRNA. In a specific embodiment, the cloned viral cDNA encodes genomic viral RNA (or the corresponding cRNA) of an influenza virus. In a specific embodiment, the isolated nucleic acids of the invention comprise a canine RNA polymerase I regulatory sequence and a transcriptional termination sequence. In certain embodiments, the transcriptional termination sequences is a pol I termination sequence. In certain embodiments, the transcriptional termination sequences is a human, monkey, or canine pol I termination sequence. In certain embodiments, the nucleic acids of the invention comprise a polynucleotide sequence or a functionally active fragment thereof, for example, a canine RNA pol L regulatory sequence, which binds a polypeptide of pol I of human, primate, mouse or canine and is at least 100% or approximately 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identical to one or more nucleotide sequences selected from the group consisting of: SEQ ID Nos: 1-19. In one embodiment, the polynucleotide sequence or functionally active fragment thereof retains further the ability to initiate transcription, in the presence of appropriate polypeptides (e.g., human, primate, mouse or canine polypeptide polypeptides), from a second polynucleotide sequence operably linked to the nucleotide sequence. In one embodiment, the "functionally active fragments" of the nucleic acids described in SEQ ID NOS: 1-19 retain one or more functional activities described herein in the full length sequences of SEQ ID NOS: 1-19. For example, functionally active fragments of the regulatory sequence described as SEQ ID NO: 1 are provided thereby the regulatory sequence fragment is operably linked to a nucleic acid to be transcribed and, in the presence of suitable proteins in vitro or in vivo , it is transcribed. In certain embodiments, the nucleic acids of the invention comprise a polynucleotide sequence or a fragment thereof, eg, a canine RNA pol L regulatory sequence, which binds a polypeptide of pol I of human, primate, mouse or canine and / or is 100% or at least or about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identical to one or more nucleotide sequences selected from the group consisting of: SEQ ID Nos: 1-19. In one embodiment, the polynucleotide sequence or fragment thereof also retains the ability to initiate transcription, in the presence of appropriate polypeptides (e.g. polypeptides of human, primate, mouse or canine pol L), of a second sequence of polynucleotides operably linked to the nucleotide sequence. In certain aspects, the present invention provides an isolated nucleic acid comprising a canine RNA pol L promoter. Preferably, the canine RNA pol L promoter is operably linked to a nucleic acid to be transcribed, such as, for example, an influenza genomic RNA. The introduction of the nucleic acid in a canine cell results in the transcription of influenza genomic RNA, and, in the presence of suitable influenza proteins, the transcribed RNA can be packaged in an infectious influenza virus. In one embodiment, isolated nucleic acids are provided which comprise a canine RNA regulatory sequence of the invention. { for example, a canine RNA pol L promoter), wherein the regulatory sequence is operably linked to a nucleic acid to be transcribed and, in the presence of suitable proteins in vitro or in vivo, is transcribed. In one embodiment, the nucleic acid operably linked to the regulatory sequence is a segment of influenza vRNA. In another aspect, the invention provides vectors and methods for producing recombinant influenza viruses in canine cell culture entirely from the cloned viral DNA. For example, influenza viruses can be produced by introducing a plurality of cloned cDNA vectors encoding each viral genome segment under the transcriptional control of a canine RNA regulatory sequence (eg, a canine pol I promoter) of the invention in canine hoepeting cells, culturing canine cells, and isolating recombinant influenza viruses produced from cell culture. When the vectors encoding an influenza virus genome are introduced like this. { for example, by electroporation) in canine cells, suitable recombinant viruses can be recovered as vaccines by standard purification procedures. Using the methods and vector system of the invention, rearranged viruses incorporating the six internal gene segments of a strain selected from its desirable properties with respect to vaccine production, and the immunogenic HA and NA segments of a selected strain , for example, pathogenic, can be rapidly and efficiently produced in tissue culture. Accordingly, the system and methods described herein are useful for the rapid production in canine cell culture of recombinant and rearranged influenza A and B viruses, including viruses suitable for use as vaccines, including live attenuated vaccines. Vaccines prepared according to the method of the invention can be administered intranasally or intra-molecularly. Typically, a single Principal Donor Virus (MDV) strain is selected for each of subtypes A and B. In the case of a live attenuated vaccine, the primary Donor Virus strain is typically chosen by its favorable properties, for example, sensitivity to temperature, adaptation to cold and / or attenuation, related to vaccine production. For example, exemplary Principal Donor Strains include such strains adapted to cold, temperature sensitive and attenuated from A / Ann Arbor / 6/60 and B / Ann Arbor / 1/66, respectively. For example, a type A primary donor virus (MDV-A) selected, or type B virus major donor (MDV-B), can be produced from a plurality of cloned viral cDNA that constitutes the viral genome. In an exemplary embodiment, the recombinant viruses are produced from eight cloned viral cDNAs. Eight viral cDNAs representing any of the MDV-A or MDV-B sequences selected from PB2, PB1, PA, NP, HA, NA, M and NS are cloned into an expression vector, eg, a bidirectional expression vector such as a plasmid. { for example, pAD3000), so that viral genomic RNA can be transcribed from an RNA polymerase I promoter (pol I) canine of a strand and viral mRNAs can be synthesized from an RNA polymerase II promoter. { pol II) from the other thread. Optionally, any gene segment can be modified, including the HA segment (for example, to remove the multibasic cleavage site). The infectious, recombinant MDV-A or MDV-B viruses are then recovered followed by transfection of plasmids carrying all eight viral cDNAs into appropriate host cells, for example, MDCK cells. Using the plasmids and methods described herein, the invention is useful, for example, for generating 6: 2 reordered influenza vaccines by co-transfecting the 6 internal genes (PB1, PB2, PA, NP, M and NS) of the selected virus (for example, MDV-A, MDV-B, PR8) together with the HA and NA derived from the influenza virus of different corresponding type (A or B). For example, the HA segment is favorably selected from a pathogenically relevant Hl, H3 or B strain, as is routinely performed for the production of vaccines. Similarly, the HA segment can be selected from a strain with emerging relevance as a pathogenic strain such as an H2 strain (eg, H2N2), an H5 strain (eg, H5N1) or a H7 strain. { for example, H7N7). Reordering can also occur that incorporates seven eegmentoe of the MDV genome and any of the HA or NA gene of a selected strain. { reordered 7: 1). In addition, this system is useful for determining the molecular basis of phenotypic characteristics, for example, attenuated phenotypes (att), adapted to cold (ca), and sensitive to temperature (ts), relevant for the production of vaccines.

Definitions Unless otherwise defined, all scientific and technical terms are understood to have the same meaning as commonly used in the technique to which the member belongs. For the purpose of the present invention, the following terms are subsequently defined.

The terms "nucleic acid", "polynucleotide", "polynucleotide sequence" and "nucleic acid sequence" refer to single-stranded or double-stranded ribonucleotides or deoxyribonucleotides, or chimeras or analogs thereof. As used herein, the term optionally includes polymers of naturally occurring nucleotide analogs having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. (for example, peptide nucleic acids). Unless indicated otherwise, a particular nucleic acid sequence of this invention includes complementary sequences, in addition to the sequence explicitly indicated. The term "gene" is used broadly to refer to any nucleic acid associated with a biological function. Accordingly, the genes include coding sequences and / or regulatory sequences required for their expression. The term "gene" is applied to a specific genomic sequence, as well as to a cDNA or an mRNA encoded by this genomic sequence. The genes also include segments of non-expressed nucleic acids that, for example, form recognition sequences for other proteins. Non-expressed regulatory sequences include "promoters" and "enhancers", to which regulatory proteins such as transcription factors are linked, resulting in the transcription of adjacent or nearby sequences. A "tissue-specific" promoter or enhancer is one which regulates transcription in a specific cell type or tissue type, or types. A "promoter" or "promoter sequence" is a DNA regulatory region capable of initiating the transcription of a nucleic acid sequence to which they are operably linked, when the appropriate transcription-related enzymes, eg, RNA polymerase, are present under conditions, for example, culture or physiological conditions, so the enzymes are functional. A promoter may be present in the 5 'or 3' direction of the nucleic acid sequence whose transcription initiates it. A promoter sequence which is located 5 'of a cDNA is linked to its 3' terminus by a transcription initiation site and extends upstream (5 'direction) to include the minimum number of bases or elements needed to initiate Tracification at detectable levels above the bottom. A promoter sequence which is located downstream of a cDNA (to express an RNA (-)) is linked to its 5 'end by a transcription initiation site and extends downstream (3' direction) to include the minimum number of bases or elements necessary to initiate transcription at detectable levels above the bottom. The bidirectional system of the invention includes both 5 'and 3' direction promoters; the unidirectional seventh includes only promoters in the 5 direction. Within or adjacent to the promoter sequence will be a transcription initiation site. { suitably defined for example, making a map with nuclease Si), and may also include protein binding domains (consensus sequences) that promote, regulate, improve, or otherwise be responsible for the binding of RNA polymerase. A "canine RNA polymerase I regulatory sequence" or "canine RNA polymerase I regulatory element" (or functionally active fragments thereof), as used herein, refers to a nucleic acid sequence that is capable of increasing the transcription of a nucleic acid sequence to which it binds operably, when canine RNA polymerase I and, optionally, associated transcription factors, are present under conditions, for example, physiological or culture conditions, whereby the enzymes are functional. Examples of canine RNA polymerase I regulatory sequences include a canine polymeric RNA I promoter, which increases the transcription of a nucleic acid operably linked to it above the bottom, and a canine RNA polymerase I enhancer, which increases transcription of a nucleic acid operably linked to a canine RNA polymerase I promoter above the level observed in the absence of a canine RNA polymerase I enhancer. One test to identify a canine RNA polymerase I regulatory element is to introduce the putative canine RNA polymerase I regulatory element, operably linked to a nucleic acid of interest, into a suitable canine cell, eg, a MDCK cell, and detect the transcription of the nucleic acid of interest using a conventional assay, eg, a Northern blot. The comparison of nucleic acid transcription levels in the presence and absence of the putative canine RNA polymerase I regulatory element allows one skilled in the art to determine whether the nucleic acid element is a regulatory element of canine RNA polymerase I. The term "vector" refers to a nucleic acid, for example, a plasmid, viral vector, recombinant nucleic acid or cDNA that can be used to introduce heterologous nucleic acid sequences into a cell. A vector of the invention will typically comprise a regulatory sequence of the invention. The vectors can be replicated autonomously or not replicate autonomously. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA with the same strand, a DNA or RNA conjugated with polylysine, a DNA or RNA conjugated to a peptide, a DNA conjugated with liposome, or similar, that do not replicate autonomously. Most commonly, the vectors of the present invention are plasmids. An "expiry vector" is a vector, such as a plamidmid, which is capable of promoting the expression, eg, transcription, of a nucleic acid incorporated herein. An expression vector of the invention will typically comprise a regulatory sequence of the invention. The expression vectors can be replicated autonomously or not replicate autonomously. Typically, the nucleic acid to be expressed is "operably linked" to a promoter and / or enhancer, and is subject to regulatory control of transcription by the promoter and / or enhancer. A "bi-directional expression vector" is typically characterized by alternative promoter signals oriented in the opposite direction relative to a nucleic acid located between the promoter doe, so that expiration can be initiated in either direction by, for example, tracing RNA from so many strands or more. { +), and antisense or negative strand (-). Alternatively, the bidirectional expression vector may be an ambisentid vector, in which the viral mRNA and viral genomic RNA. { as a cRNA) are expressed from the strand. In the context of the invention, the term "isolated" refers to a biological material, such as a nucleic acid or a protein, which is naturally free of components that normally accompany or interact with it in its naturally occurring environment. The isolated material optionally comprises material not found with the material in its natural environment, for example, a cell. For example, if the material is in its natural environment, such as a cell, the material has been placed at a location in the cell (eg, genome or genetic element) not native to a material found in this environment. For example, a naturally occurring nucleic acid (e.g., a coding sequence), a promoter, an enhancer, etc.) becomes isolated and introduced by means that are not naturally present at a genome locus (eg, a vector, such as a virus or plasmid vector, or amplimer) not native to this nucleic acid. Such nucleic acids are also referred to as "heterologous" nucleic acids. The term "recombinant" indicates that the material (e.g., a nucleic acid or protein) has been altered artificially or einetically (not naturally) by human intervention. The alteration can be made in the material inside, or removed from, its state or natural environment.

Specifically, when referring to a virus, for example, a virus of influenza, the virus is recombinant when it is produced by the expression of a recombinant nucleic acid. The term "rearranged", when referring to a virus, indicates that the virus includes genetic and / or polypeptide components derived from more than one source or parental viral strain. For example, a rearranged 7: 1 includes 7 viral genomic segments (or gene segments) derived from a first parental virus, and a single complementary viral genomic segment, eg, hemagglutinin or coding neuraminidase, from a second parental virus. A rearranged 6: 2 includes 6 genomic segments, most commonly the 6 internal genes of a first parental virus, and two complementary segments, eg, hemagglutinin and neuraminidase, from a different parental virus. The term "introduced" when referring to a heterologous or isolated nucleic acid refers to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid can be incorporated into the genome of the cell (eg, chromosome, plasmid) , plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (eg, transfected mRNA). The term includes such methods as "infection", "transfection", "transformation" and "transduction". In the context of the invention a variety of methods can be used to introduce nucleic acids into prokaryotic cells, including electroporation, calcium phosphate precipitation, lipid mediated transfection (lipofection), etc. The term "host cell" means a cell which can or has accepted a nucleic acid, such as a vector, and supports the replication and / or expression of the nucleic acid, and optionally the production of one or more encoded products including a polypeptide and / or a virus. The host cells can be prokaryotic cells such as E. coli, or eukaryotic cells, such as yeast, insect, amphibian, bird or mammalian cells, including human cells. Exemplary host cells in the context of the invention include Vero cells (African green monkey kidney), Per.C6 cells. { human embryonic retina cells), BHK cells (baby hamster kidney), primary chick kidney cells (PCK), Madin-Darby Canine Kidney cells. { MDCK), Madin-Darby Bovine Kidney (MDBK) cells, 293 cells (e.g. 293T cells), and COS cells (e.g., COSI, COS7 cells). The term "host cell" includes combinations or mixtures of cells including, for example, mixed cultures of different cell types or cell lines (e.g., Vero and CEK cells). A co-culture of electroporated SF Vero cells is described for example in PCT / US04 / 42669 filed on December 22, 2004, which is incorporated by reference in its entirety. The term "artificially engineered" is used herein to mean that the virus, viral nucleic acid or virally encoded product, eg, a polypeptide, a vaccine, comprises at least one mutation introduced by recombinant methods, eg, mutagenesis. directed to the site, PCR mutagenesis, etc. The expression "artificially modified" when referring to a virus. { or viral component or product) comprising one or more nucleotide mutations and / or amino acid substitutions indicates that the genome or viral genome segment encoding the virus (or component or product) is not derived from naturally occurring sources, such as as a strain of existing laboratory virus that occurs naturally or previously, produced by non-recombinant methods (such as progressive passage at 25 ° C), for example, a strain A / Ann Arbor / 6/60 or B / Ann Arbor / 1/66 of wild type or adapted to the cold. The term "% sequence identity" is interchangeable herein with the term "% identity" and refers to the level of amino acid sequence identity between two or more peptide sequences or the level of nucleotide sequence identity between two or more nucleotide sequences, when they are aligned using a sequence alignment program. For example, as used herein, 80% identity means the same thing as 80% sequence identity determined by a defined algorithm, and means that a given sequence is at least 80% identical to another length of another sequence. Exemplary levels of sequence identity include, but are not limited to, 60, 70, 80, 85, 90, 95, 98% or more sequence identity to a given sequence. The term "% sequence homology" is used interchangeably herein with the term "% homology" and refers to the level of amino acid sequence homology between two or more peptide sequences, or the level of sequence homology of nucleotide between two or more nucleotide sequences, when aligned using a sequence alignment program. For example, as used herein, 80% homology means the same thing as 80% sequence homology determined by a defined algorithm, and therefore, a homolog of a given sequence has more than 80% sequence homology eobre a length of the given sequence. Exemplary levels of sequence homology include, but are not limited to, 60, 70, 80, 85, 90, 95, 98% or more sequence homology to a given sequence.

Exemplary computer programs which can be used to determine identity between two sequences include, but are not limited to, the BLAST program series, eg, BLASTN, BLASTX, and TBLASTX, BLASTP and TBLASTN, publicly available on the Internet at the NCBI web site. See also Altschul et al., 1990, J. Mol. Biol. 215: 403-10 (with special reference to published failure adjustment, ie, parameters w = 4, t = 17) and Altschul et al., 1997, Nucleic Acids Res., 25: 3389-3402. Sequence searches are typically performed using the BLASTP program when evaluating a given amino acid sequence relative to amino acid sequences in the Sequence of Protein GenBank and other public data bases. The BLASTX program is preferred for targeting nucleic acid sequences that have been translated in all reading frames against amino acid sequences in the GenBank Protein Sequences and other public data databases. Both BLASTP and BLASTX are operated using failure parameters of an open gap penalty of 11.0, and an extended gap penalty of 1.0, and use the BLOSUM-62 matrix. See id. A preferred alignment of sequences selected to determine "% identity" between two or more sequences is done using, for example, the CLUSTAL-W program in Mac Vector 6.5 version, operated with failure parameters, including an open gap penalty of 10.0 , an extended gap penalty of 0.1, and a BLOSUM 30 bullet matrix. "Hybridize specifically" or "specific hybridization" or "selectively hybridize" refers to the binding, duplexing, or hybridization of a nucleic acid molecule preferably to a particular nucleotide sequence under stringent conditions when this sequence is present in an RNA or DNA of complex mixture. { for example total cellular). The term "stringent conditions" refers to conditions under which a probe will hybridize preferably to its target subsequence, and to an extent less than, or not in all, other sequences. "Stringent hybridization" and "stringent hybridization wash condition" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are dependent sequences, and are different under different environmental parameters. An extensive guide for nucleic acid hybridization can be found in Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, part I, chapter 2, "Overview of principles of hybridization and the etrategy of nucleic acid probé aeeays ", Elsevier, NY; Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 3rd ed. , NY; and Aueubel et al., ede. Current Edition, Current Protocole in Molecular Biology, Greene Publishing Associates and Wiley Interscience, NY. Generally, highly stringent hybridization and washing conditions were selected to be about 5 ° C lower than the thermal melting point (Tm) for the specific sequence at a defined pH and ionic strength. The Tm is the temperature (low pH and defined ionic strength) at which 50% of the target sequence is hybridized to a perfectly bound probe. Very stringent conditions are selected to be equal to Tm for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids which has more than about 100 complementary re-filters in a filter in a Southern or northern blot is 50% formalin with 1 mg of heparin at 42 ° C, with the hybridization being performs during the night. An example of highly stringent washing conditions is 0.15 M NaCl at 72 ° C for approximately 15 minutes. An example of rigorous washing conditions is a 0.2X SSC wash at 65 ° C for 15 minutes. See Sambrook et al, for a description of SSC shock absorber. A highly rigorous wash can be preceded by a low-level wash to remove the bottom probe signal. A washing of medium rigor € 7 Exemplary for a duplex of, for example, more than about 100 nucleotides, is Ix SSC at 45 ° C for 15 minutes. An exemplary low exemplary wash for a duplex of, for example, more than about 100 nucleotides, is 4-6x SSC at 40 ° C for 15 minutes. In general, a noise ratio signal of 2x (or greater) than that observed by an unrelated probe in the particular hybridization assay indicates the detection of a specific hybridization. The term "approximately", as used herein, unless otherwise indicated, refers to a value that is not more than 10% higher or lower than the value modified by the term. For example, the term "about 5 μg / kg" means a range from 4.5 μg / kg to 5.5 μg / kg. As another example, "about 1 hour" means an interval of 48 minutes to 72 minutes. The term "encoded", as used herein, refers to the property of a nucleic acid, e.g., deoxyribonucleic acid, to transcribe a complementary nucleic acid, including a nucleic acid that can be translated into a polypeptide. For example, a deoxyribonucleic acid can encode an RNA that is transcribed from deoxyribonucleic acid. Similarly, deoxyribonucleic acid can encode a polypeptide translated from a tranecritic RNA from deoxyribonucleic acid.

Nucleic Acids Comprising PolI Canine RNA Regulatory Elements In one embodiment, there are provided nucleic acid nucleic acids which comprise a canine RNA regulatory sequence of the invention (eg, a canine RNA pol L promoter). The regulatory sequence can, for example, be operably linked to a nucleic acid to be transcribed and, in the presence of suitable proteins, can be transcribed in vitro or in vivo. In one embodiment, the nucleic acid operably linked to the regulatory sequence of a piece of influenza vRNA. In certain aspects, the present invention provides an isolated nucleic acid comprising a canine RNA pol L promoter. Preferably, the canine RNA pol L promoter is operably linked to a nucleic acid to be transcribed, such as, for example, an influenza genomic RNA. The introduction of the nucleic acid into a canine cell can result in the transcription of influenza genomic RNA, and, in the presence of suitable influenza proteins, the RNA tranecript or tranexites can be packaged in an influenza virus, for example, a infectious influenza virus. In certain embodiments, the nucleic acid acids of the invention comprise a regulatory sequence of canine RNA pol I or fragment thereof that binds a poly I polypeptide of human, primate, mouse or canine and ee al menoe or about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82% , 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65 %, 64%, 63%, 62%, 61%, or 60% identical to one or more of the nucleotide sequences selected from the group you were associated with: SEQ ID Noe 1-19. In one embodiment, the pol L RNA regulatory sequence or fragment thereof further maintains the ability to initiate transcription of a gene operably linked to the nucleotide sequence. In addition, the nucleic acids of the invention also include versions of nucleic acid derivatives comprising a canine RNA pol L promoter. Such derivatives can be made by any method known to one of skill in the art without limitation of the canine RNA pol L regulatory sequences identified below. For example, the derivatives can be made by site-specific mutagenesis, including substitution, insertion, or suppression of one, two, three, five, ten or more nucleotides, of the nucleic acids. Alternatively, the derivatives can be made by random mutagenesis. A method for randomly mutagenizing a nucleic acid comprises amplifying the nucleic acid in a PCR reaction in the presence of 0.1 M MnCl2 and unbalanced nucleotide concentrations. These conditions increase the poor rate of incorporation of the polymerase used in the PCR reaction and result in random mutagenesis of the amplified nucleic acid. Preferably, the derived nucleic acids maintain the ability to initiate the transcription of a gene operably linked to the nucleotide sequence. In certain embodiments, the nucleic acid of the invention comprises at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 consecutive nucleotides of one or more nucleotide sequences selected from the group consisting of: SEQ ID Nos 1-19. Preferably, the nucleic acid comprises a sequence that can initiate the transcription of a gene operably linked to the nucleotide sequence in canine cells, and subsequently, a functional derivative. In one embodiment, the nucleic acid comprises a sequence that can bind canine polypeptides and initiate (in vitro or in vivo) the transcription of an influenza vRNA in canine cells. In certain embodiments, a nucleic acid sequence of the invention comprises, or alternatively comprises -250 to -1 nucleotides. { in relation to the first transcribed nucleotide of the promoter, also known as the nucleotide +1) of the sequence presented as S? C ID NO: 1, or a functional derivative thereof. The +1 nucleotide for the 18S ribosomal RNA expressed from the canine pol L regulatory sequence found in SEQ ID NO: 1 is the nucleotide at position 1804 of SEQ ID NO: 1. In certain embodiments, the canine polypeptide regulatory sequence of the invention comprises, or alternatively consists of, an isolated nucleic acid (or the complement sequence thereof) that hybridizes under stringent hybridization conditions to a nucleic acid comprising a nucleic acid. selected from the group consisting of: S? C ID Nos 1-19 and can initiate the transcription of a gene operably linked to the regulatory sequence in canine cells. In one embodiment, the canine polypeptide regulatory sequence of the invention comprises a nucleic acid sequence that can bind a canine pol L RNA polypeptide and, in one embodiment, initiate transcription of a gene operably linked to the nucleotide sequence in canine cell In one embodiment, the nucleic acid comprises a sequence that can bind a polyacryl of eukaryotic pol I and initiate (in vitro or in vivo) the transcription of an influenza vRNA. In certain embodiments, the polypeptide binding of canine pol L RNA to a canine pol l regulatory sequence is tested with a nuclease protection assay. In certain embodiments, the polypeptide linkage of canine pol L RNA to a canine pol I regulatory sequence is tested with a BIACORE system to assess protein interactions. { Biacore International AG, Uppsala, Sweden). In certain embodiments, the nucleic acid comprises a sequence that binds canine RNA pol I. In certain embodiments, the sequence is linked to canine RNA pol I with higher affinity than an RNA polymerase selected from the group consisting of: a primate RNA pol I, a human pol I, and a mouse pol I. In certain embodiments, the sequence is linked to canine RNA pol I with higher affinity than canine pol II RNA. In certain embodiments, the sequence is linked to canine pol L RNA with higher affinity than to canine pol III RNA. In certain modalities, the link to a canine regulatory sequence is tested with a BIACORE seven to test protein interactions (Biacore International AG, Uppeala, Sweden). In certain embodiments, the RNA pol I promoter comprises canine, or alternatively consists of, the following nucleotide sequence: TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGT GGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATC GCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGG GGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGT TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGC AGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCT GACA (SEQ ID NO: 2) In certain embodiments, the canine RNA pol L promoter comprises, or alternatively considers, the following nucleotide sequence: GGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGT TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGC AGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCT GACA (SEQ ID NO: 3). In certain modalidade, the canine RNA pol L promoter comprises, or alternatively connexion of, the following nucleotide sequence: GCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGC GGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATG AACATTTTTTGTTGCCAGGTAGGTGCTGACA. { SEQ ID NO: 4). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively consists of, the following nucleotide sequence: TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGC AGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCT GACA (SEQ ID NO: 5). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively considers, the following nucleotide sequence: GTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGA ACATTTTTTGTTGCCAGGTAGGTGCTGACA (SEQ ID NO: 6). In certain modalidadee, the canine pol L RNA promoter comprises, or alternatively consists of, the following nucleotide sequence: AGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCT GACA (SEQ ID NO: 7). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively coneiete of, the following nucleotide sequence: TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGT GGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATC GCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG (SEQ ID NO: 8). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively consists of, the following nucleotide sequence: TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGT GGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATC GCCCCTCCTCCCCTCCCCCCCCCCCCCC. { SEQ ID N0.9). In certain modalidadee, the canine RNA pol L promoter comprises, or alternatively, the following nucleotide sequence: TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCG TC. { SEQ ID NO: 10). In certain modalidade, the canine RNA pol L promoter comprises, or alternatively considers, the following nucleotide sequence: TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGT (SEQ ID NO: 11). In ciertae modalidadee, the RNA pol I promoter comprises canine, or alternatively coneiete of the eiguiente nucleotide sequence: GG TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGT GGCGGCGTGGCGGCGTGGCGGCG GGCGGCGTGGCGTCTCCACGGACCCGTATC GCCCCTCCTCCCCTCCCCCCCCCCCCGCGTTCCCTGGGTCGACCAGATAGCCC GGGCTCCGTGGGGTGGGGGTGOGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGT TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGC AGGCGCGGTTATTTTCTTGCCCGAG. { SEQ ID NO: 12). In certain embodiments, the RNA pol I promoter comprises canine, or alternatively coneiste of, the following nucleotide sequence: GGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGOGTCTCCACCGACCCGTATC GCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGG GGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGT TGGCCGTGTCACGGTCCCGGGAGGTCGGGGTGACCTGTGGCTGGTCCCCGCCGGC AGGCGCGGTTATTTTCTTGCCCGAG. { SEQ ID NO: 13). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively considers, the following nucleotide sequence: GCCCCTCCTCCCC CCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGG GGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGT TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGC AGGCGCGGTTATTTTCTTGCCCGAG. { SEQ ID NO: 14). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively consists of, the following nucleotide sequence: GGGCTCCGTGGGGTGGGGGTGGGGGGGGGCCGTGGGGCAGGTTT GGGGACAG TGGC € GTGTCACGGTGCCGGGAGGTCGCGGTGACCTGTGGCT -GTCCCGGCCGC AGGCGCGGTTATTTTCTTGCCCGAG. { SEQ ID NO: 15) In certain embodiments, the canine RNA pol L promoter comprises, or alternatively considers, the following nucleotide sequence: GCCGTGGGGCAGGTTTTGGGGACAGT GGCCGTGTCACGGTCCGGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTT CTTGCCCGAG (SEQ ID NO: 16). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively consists of, the following nucleotide sequence: TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGC AGGCGCGGTTATTTTCTTGCCCGAG. { SEQ ID NO: 17). In certain embodiments, the RNA pol I promoter comprises canine, or alternatively consists of, the following nucleotide sequence: GGCGTGGCGTCTCCACCGACCCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCG TTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGG CGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCG CGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG (SEQ ID NO: 18). In certain embodiments, the canine RNA pol L promoter comprises, or alternatively considers, the following nucleotide sequence: TCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGGGGTTATTTTCTTGCCCGAG (SEQ ID NO: 19).

Vectors and expression vectors In another aspect, the invention provides vectors comprising a nucleic acid of the invention, including vector of expiration useful to recombinantly rescue a virus from cell culture. Generally, expression vectors are useful to rescue any virus known to one skilled in the art which requires the production of RNA with defined ends during its life cycle. For example, as described above, the genomic RNA of the influenza virus would have a 5 'and 3' end defined to be effectively replicated and packaged in a recombinant system. See, also the publication in Neumann et al. (2002), 83: 2635-2662, which is incorporated herein by reference. The following discussions focus on expression vectors suitable for use with influenza; however, it should be noted that other viruses can also be rescued using the vectors of the present invention. According to the present invention, in one embodiment, the viral genomic RNA encoding cDNA corresponding to each of the eight genomic segments of influenza (the segments can be of different influenza viruses, for example, 6 of strain X and 2). of strain Y) can be inserted into a recombinant vector for the manipulation and production of influenza virus. A variety of vectors, including viral vectors, plasmids, cosmid, phage, and chromoeomae artificialee, can be employed in the context of the invention. Typically, to facilitate manipulation, the cDNA is inserted into a plasmid vector, providing one or more genesis of functional replication in eukaryotic and bacterial cells, and, optionally, a convenient marker for sorting or selecting cells that incorporate the plasmid sequence. See, for example, Neumann et al., 1999, PNAS, USA 96: 9345-9350. In one embodiment, the vectors of the invention are bidirectional expression vectors capable of initiating tracification of a viral genomic segment of the cDNA inserted in any direction, i.e., increasing both the strand (+) and strand viral RNA molecules (- ). To perform bidirectional transcription, each of the genomic eegmentoe viralee is inserted into an expression vector having at least two independent promoters, so that copies of viral genomic RNA are transcribed by a first RNA polymerase promoter (e.g. canine RNA pol L promoter), one strand, and viral mRNA are synthesized from a second RNA polymerase promoter. { for example, a canine Pol II RNA promoter or other promoter that can initiate transcription by pol II RNA in canine cells). Accordingly, the two promoters can be arranged in opposite orientations to flank at least one cloning site. { that is, a recognition sequence of the restriction enzyme) preferably a single cloning site, suitable for the inerting of segments of viral genomic RNA. Alternatively, ee may use an "a-sense" expiration vector in which the strand mRNA (+) and the strand viral RNA (-). { as a cRNA) it tranects from the vector strand of the vector. As described above, the pol I promoter for transcribing the viral genomic RNA is preferably a canine pol I promoter. To ensure the correct 3 'end of each expressed vRNA or cRNA, each vRNA or cRNA expression vector may incorporate a ribozyme sequence or appropriate termination sequence. { for example, termination sequence of RNA polymerase I of human, mouse, primate, or canine) upstream of the RNA coding sequence. This may be, for example, the genomic ribozyme sequence of the hepatitis delta virus or a functional derivative thereof, or the murine rDNA terminator sequence. { Accession number of the Genetic Bank M12074). Alternatively, for example, a Pol I termination sequence (Neumann et al., 1994, Virology 202: 477-479) may be employed. RNA expression vectors can be constructed in the same manner as the vRNA expression vectors described in Pleechka et al., 1996, J. Virol. 70: 4188-4192; Hoffmann and Webster, 2000, J. Gen Virol. 81: 2843-2847; Hoffmann et al., 2002, Vaccine 20: 3165-3170; Fodor et al., 1999, J. Virol. 73: 9679-9682; Neumann et al., 1999, P.N.A.S. USA 96: 9345-9350; and Hoffmann et al., 2000, Virology 267: 310-317, each of which is hereby incorporated by reference in its entirety. In other sevenmae, the viral sequences transcribed by the promoters of pol I and pol II can be transcribed from different expiry vectors. In eetae embodiments, vectors encoding each of the genomic and viral segments can be used under the control of a canine regulatory sequence of the invention, for example, a canine pol I promoter ("vRNA expression vector") and vectors that encode one or more viral polypeptides, for example, polypeptides of PA, PBl, PB2 and influenza NP ("protein expreration vectors") under the control of a pol II promoter. In any case, with respect to the pol II promoter, the genome segment of influenza virus to be expressed can be operably linked to an appropriate transcription control (promoter) sequence to direct the mRNA synthesis. A variety of promoters are suitable for use in expression vectors to regulate the transcription of influenza virus genome segment. In certain embodiments, the RNA promoter Polymerase II (Pol II) dependent on cytomegalovirus DNA (CMV) is used. If desired, for example, to regulate conditional expressions, other promoters can be substituted which induce the transcription of RNA under the specified conditions, or in the specified cells or tissues. Numerous viral and mammalian promoters, for example humans are available, or can be isolated according to the specific application contemplated. For example, alternative promoters of the genomes of animal and human viruses are obtained including promoter talents such as adenovirue (such as Adenovirue 2), papilloma virus, hepatitis B virus, and polyoma virus, and several retroviralee promoters. Mammalian promoters include, among many others, the actin promoter, immunoglobulin promoter, heat shock promoter, and the like. In a specific mode, $ 2 the regulatory sequence comprises the last major adenovirus 2 promoter linked to the human adenovirus 2 bound tripartite leader sequence, as described by Berg et al., Bio Techniques 14: 972-978. In addition, bacteriophage promoters can be employed in conjunction with the cognate RNA polymerase, for example, the T7 promoter. Expression vectors used to express viral proteins, in particular viral proteins for the formation of RNP complex, will preferably express viral proteins homologous to the desired virus. Expression of viral proteins by ejection vector can be regulated by any regulatory sequence known to those skilled in the art. The regulatory sequence can be a constitutive promoter, an inducible promoter or a specific tissue promoter. Examples of additional promoters which can be used to control the expression of viral proteins in protein expression vectors include, but are not limited to, the most anticipated SV40 promoter region (Bernoist and Chambon, 1981, Nature 290: 304- 310), the promoter contained in the 3 'long terminal repeat of the Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22: 787-797), the herpes thymidine kinase promoter (Wagner et al., 1981 , Proc. Nati, Acad. Sci. USA 78: 1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296: 39-42); prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Nati, Acad. Sci. USA 75: 3727-3731), or the tac promoter (DeBoer et al., 1983, Proc. Nati, Acad. Sci., USA 80: 21-25); see also "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94; Plant expression vectors comprising the promoter region of nopaline eintetase (Herrera-Estrella et al., Nature 303: 209-213) or the 35S RNA promoter of cauliflower mosaic virus (Gardner et al., 1981, Nucí Acids Res. 9: 2871), and the promoter of the photosynthetic enzyme ribuloea biphosphate carboxylase. { Herrera-Estrella et al, 1984, Nature 310: 115-120); promoter element of yeast or other fungus such as the Gal4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK promoter (foefoglycerol cinnaea), alkaline foefatase promoter, and the following animal transcriptional control regions, which exhibit tissue specificity and have used in transgenic animals: elastaea I gene control region which is active in pancreatic acinar cells (Swift et al., 1984, Cell 38: 639-646; Omitz et al., 1986, Cold Spring Harbor Symp. Biol. 50: 399-409; MacDonald, 1987, Hepatology 7: 425-515); control region of the insulin gene which is active in pancreatic betae cells (Hanahan, 1985, Nature 315: 115-122), control region of the immunoglobulin gene which is active in lymphoid cells (Grosschedl et al., 1984, Cell 38: 647-658; Adames et al., 1985, Nature 318: 533-538; Alexander et al., 1987, Mol. Cell. Biol. 7: 1436-1444), control region of the mammary tumor virus of mouse which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45: 485-495), control region of the albumin gene which is active in the liver (Pinkert et al. , 1987, Genes and Devel.1: 268-276), control region of the alpha-phenoprotein gene which is active in the liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5: 1639-1648; Hammer et al., 1987, Science 235: 53-58, control region of the alpha 1-antitripein gene which is active in the liver (Keleey et al., 1987, Genes and Devel. 1: 161-171), region of control of the beta-glob gene ina which is active in myeloid cells. { Mogram et al., 1985, Nature 315: 338-340; Kollias et al., 1986, Cell 46: 89-94; control region of the myelin base protein gene which is active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 48: 703-712), control region of the light chain of myosin 2 gel which is active in the eelethelic muscle (Sami, 1985, Nature 314: 283-286), and the control region of the gonadotropic releasing hormone gene which is active in the hypothalamus (Maeon et al., 1986, Science 234: 1372-1378). In a specific embodiment, the protein expression vector of the invention comprises a promoter operably linked to a nucleic acid sequence, one or more origins of replication, and, optionally, one or more selectable labeling agents - (e.g. antibiotic resistance). In another embodiment, a protein expreration vector of the invention that is capable of producing the bicistronic mRNA can be produced by inserting the bicistronic mRNA sequence. Certain sequences of internal ribosome entry site (IRES) can be used. Preferred IRES elements include, but are not limited to, mammalian BiP IRES and hepatitis C virus IRES. In one embodiment, a nucleic acid of the invention is inserted into plasmid pAD3000 or a derivative thereof. See, U.S. Patent Application Publication 20050266026 and Figure 10. Accordingly, in certain embodiments, the expression vector is a bi-directional expression vector. In certain embodiments, the expiration vector is a bidirectional expiration vector. In certain embodiments, the expression vector comprises an SV40 polyadenylation signal flanking a segment of the internal influenza virus genome to the two promoters. In certain embodiments, the expiation vector comprises the Pol II RNA promoter dependent on cytomegalovirue DNA (CMV). The vectors containing gene inserts can be identified by, for example, three general procedures: (a) nucleic acid hybridization; (b) presence or absence of functioning of the "marker" gene; and, in the case of expression vectors, (c) expiration of ineequeee eequencee. In a first method, the presence of the viral gene inserted into a vector (s) can be detected by hybridization of nucleic acid using probes comprising sequences that are homologous to the inserted gene (ee). In the second procedure, the recombinant / homologous vector can be identified and selected based on the presence or absence of certain "marker" gene operae (eg, antibiotic resistance or transformation phenotype) caused by the insertion of the gene (ie ) on the vector (s). In the third procedure, expression vectors can be identified by assaying the expressed gene product. Such assays may be based, for example, on the physical or functional properties of the viral protein in in vitro assay systems, for example, which bind viral proteins to antibodies. In a specific embodiment, one or more protein expression vectors encode and express the viralee proteins necessary for the formation of RNP complexes. In another embodiment, one or more protein expiration vectors encode and express the viral proteins necessary to form viral particles. In yet another embodiment, one or more protein expression vectors encode and express all the viral proteins of a particular negative-stranded RNA virus. Tranecription of expression vectors may optionally be increased by including an enhancer sequence. Enhancers are cis-acting DNA elements, typically short, for example, 10-500 bp, which act in concert with a promoter to increase transcription. Many enhancer sequences have been isolated from mammalian gene (hemoglobin, elaetase, albumin, alpha-fetoprotein, and insulin) and eukaryotic cell viruses. The enhancer can bind to the vector at a 5 'or 3' position to the heterologous coding sequence, but typically it is inserted at a 5 'site to the promoter. Typically, the promoter, and if desired, additional transcription enhancer sequences are chosen to optimize expression in the type of cell homeowner in which the heterologous DNA is to be introduced (Scharf et al. (1994) Heat stress promoters and tranecription factore Reeults Probl Cell Differ 20: 125-62; Kriegler et al. (1990) Assembly of enhancers, promoters, and splice signifies to control expression of traneferred genee Methods in Enzymol 185: 512-27). Optionally, the amplimer may also contain a ribosome binding site or an internal ribosome entry site (IRES) for translation initiation. The expression vectors of the invention may also include sequences for the termination of transcription and for stabilizing the mRNA, such as a polyadenylation site or a termination sequence (eg, human, mouse RNA polymerase I termination sequence, primate, or canine). Such sequences are commonly available from the 5 'and occasionally 3' untranslated regions of eukaryotic or viral cDNA or DNA. In some embodiments, the SV40 polyadenylation sequences provide a polyadenylation signal. In addition, as described above, the vectors optionally include one or more selectable marker genes to provide a phenotypic trait for the selection of transformed host cells, in addition to previously generated genes, talee markers such as remyelination to neomycin or dihydrofolate reductase are suitable for selection in eukaryotic cell culture. The expreration vector containing the appropriate DNA sequence as described above, as well as an appropriate promoter or control sequence, can be used to transform a host cell that allows the expression of the protein. Although the expression vectors of the invention can replicate in bacterial cells, it will more often be desirable to introduce them into mammalian cells, for example, Vero cells, BHK cells, MDCK cells, 293 cells, COS cells, more preferably MDCK cells, for the purpose of expression. The expiratory vectors of the invention can be used to direct the expression of corresponding genomic vRNA (s) or corresponding cRNA (e) which have one or more mutations (e.g., removal or inactivation of a polycystic cleavage site in the HA gene). of pandemic strains of particular influenza such as H5N1). A mutagenicity can result in the attenuation of the virus. For example, the vRNA segments may be the vRNA segments of an influenza A virus having an attenuated base pair substitution in a crosslinked duplex promoter region, in particular, for example, base pair attenuation substitution. known from A for C and U for G at position 11-12 'in the duplex region of the specific NA vRNA. { Fodor et al., 1998, J. Virol. 6923-6290). Using the methods of the invention to produce recombinant negative-stranded RNA viruses, a new attenuation mutation can be defined. In addition, any of the expression vectors described in US Patents Nos. 6,951,754, 6,887,699, 6,649,372, 6,544,785, 6,001,634, 5,854,037, 5,824,536, 5,840,520, 5,820,871, 5,786,199 and 5,166,057 and US Patent Application Publications Nos. 20060019350, 20050158342, 20050037487, 20050266026, 20050186563, 20050221489, 20050032043, 20040142003, 20030035814, and 20020164770 can be used according to the present invention. Generally, the vector described in these publications can be adapted for use in accordance with the present invention by introducing a nucleic acid of the invention (eg, a canine regulatory sequence of the invention such as a canine pol II promoter sequence) as ee. is described herein, in expression vectors to direct the synthesis of viralee cRNA or vRNA.

Additional Expression Elements More commonly, the genome segment encoding the influenza virus protein includes any additional sequences necessary for its expulsion, including translation into a functional viral protein. In another situation, you can use a minigen, or another artificial construct that encodes viral proteins, for example, an HA or NA protein. In this case, it is often necessary to include specific initiation templates which aid in the efficient translation of the heterologous coding sequence. These signals may include, for example, the ATG start codon and adjacent sequences. To ensure translation of the complete insert, the initiation codon is inserted into the correct reading structure relative to the viral protein. The exogenous tranecriptional elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be improved by the inclusion of appropriate improvers for the seventh cell. If desired, polynucleotide sequences encoding additional expressed elements, such as signal sequences, secretion or localization sequences, and the like can be incorporated into the vector, usually, in structure with the polynucleotide sequence of interest, for example, for the expression of target polypeptide to a desired cell compartment, membrane, or organelle, or in the cell culture medium. Such sequences are known to those skilled in the art, and include leading peptides of secretion, sequence targeting the organelle (eg, nuclear localization sequences, ER retention patterns, mitochondrial tranecto eequence), membrane localization / anchor sequences (eg. example, arrest transfer sequences, GPI anchor sequences), and the like.

Expression Vectors for Producing Chimeric Viruses The expression vectors of the invention can also be used to produce chimeric virue expressing heterologous sequences to a viral genome. Expression vectors directing the expression of corresponding vRNA or cRNA are introduced into host cells together with expression vectors that direct the expression of the viral proteins to generate new chimeric viruses or infectious recombinant negative-strand RNA viruses. See, for example, the publication of US patent application no. US20040002061. The heterologous factors that can be engineered into these viruses include antisense nucleic acids and nucleic acid such as a ribozyme. Alternatively, heterologous sequences which express a peptide or polypeptide can be engineered into this. Heterologous sequences encoding the following peptides or polypeptides that can be engineered into these viruses include: 1) antigens that are characteristic of a pathogen; 2) antigens that are characteristic of autoimmune diseases; 3) antigens that are characteristic of an allergen; and 4) antigen that are characteristic of a tumor. For example, heterologous gene sequences that can be engineered into the chimeric viruses of the invention, include, but are not limited to, human immunodeficiency virus epitope.

(HIV) such as gp 160; surface antigens of hepatitis B virus (HBsAg); Herpes virus glycoproteins (for example, gD, gE); VPl of poliovirus; and antigenic determinants of non-viral pathogens such as bacteria and parasites eolo to name a few.

Antigens that are characteristic of autoimmune disease will typically be derived from the cellular surface, cytoplasm, nucleus, mitochondria and the like of mammalian tissues, including antigen characteristic of diabetes mellitus, multiple sclerosis, lupus erythematosus, rheumatoid arthritis, pernicious anemia, Addison, scleroderma, autoimmune atrophic gastritis, juvenile diabetes, and lupue erythematous diecoid. Antigens that are allergenic are usually proteins or glycoproteins, including antigens derived from pollen, dust, molds, spores, caeca, ineects and nutrients. Antigens that are characteristic of tumor antigens will typically be derived from the cell surface, cytoplasm, nucleus, organeloe, and the like of tumor tissue cells. Examples include characteristics of tumor protein antigens, including proteins encoded by mutated oncogens; viral proteins associated with tumors; and glycoproteins. Tumors include, but are not limited to, those derived from the types of cancer: lip, naso-pharyngeal, pharynx and oral cavity, esophagus, stomach, colon, rectum, liver, gall bladder, pancreas, larynx, lung and bronchi, Melanoma of skin, breast, neck, uterus, ovary, gallbladder, kidney, uterus, brain and other parts of the seventh nerve, thyroid, prostate, testicular, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma and leukemia. In a specific embodiment of the invention, the heterologous sequences are derived from the genome of the human immunodeficiency virus (HIV), preferably human immunodeficiency virus 1 or human immunodeficiency virus 2. In another embodiment of the invention, the heterologous coding sequences can be insert into a coding sequence of the negative-stranded RNA virus gene so that a chimeric gene product is expressed which contains the heterologous peptide sequence within the viral protein. In one embodiment of the invention, heterologous sequences can also be derived from the genome of a human immunodeficiency virus, preferably human immunodeficiency virus-1 or human immunodeficiency virus-2. In cases where the heterologous sequences are derived from HIV, sequential talee may include, but are not limited to, sequencing derived from the env gene (ie, sequences encoding all or part of gpl60, gpl20, and / or gp41), the pol gene (ie, sequence encoding all or part of of tranecriptaea, endonuclease, protease, and / or reverse integrase), the gag gene (ie, sequences encoding all or part of p7, p6, p55, pl7 / 18, p24 / 25) tat, rev, nef, vif, vpu, vpr, and / or vpx. One method to construct these hybrid molecules is to insert the heterologous coding sequence into a DNA complement of a negative-stranded RNA virus gene so that the heterologous sequence is flanked by the viral sequences required for the viral polymerase activity; for example, a canine RNA pol L promoter and a polyadenylation site. In an alternative procedure, the oligonucleotides that encode a canine RNA pol L promoter, for example, the complement of the 3'-term or amboe terms of the genomic segments of viruses can be ligated to the heterologous coding sequence to construct the hybrid molecule. The placement of a segment or foreign gene of a foreign gene within an objective sequence was dictated earlier by the presence of appropriate restriction enzyme sites within the target sequence. However, recent advances in molecular biology have greatly diminished this problem. Restriction enzyme sites were easily placed anywhere within an objective sequence through the use of site-directed mutagenesis (for example, see the techniques described by Kunkel, 1985, Proc Nati Acad Sci USA 82: 488) . Variations in polymerase chain reaction technology (PCR), described, also allow the specific insertion of eequences (ie, restriction enzyme sites) and allow the easy construction of hybrid molecules. Alternatively, PCR reactions could be used to prepare recombinant anneals without the need for cloning. For example, PCR reactions could be used to prepare double-stranded DNA molecules containing a DNA-directed RNA polymerase promoter (e.g., bacteriophase T3, T7 or SP6) and the hybrid sequence containing the heterologous gene and a promoter. of RNA pol I canine. The hardened RNA could be transcribed directly from this recombinant DNA. In yet another embodiment, the corresponding recombinant vRNAs or cRNAs can be prepared by ligating RNAs that specify the negative polarity of the heterologous gene and the canine RNA pol L promoter using an RNA ligase using an RNA ligase. The bicistronic mRNA could be constructed to allow internal initiation of the translation of viral sequence and allow the expregation of foreign protein coding sequences from the regular terminal initiation site. Alternatively, a bicistronic mRNA sequence can be constructed in which the viral sequence is translated from the regular terminal-opening reading structure, although the foreign sequence is initiated from an internal eitio. Certain internal ribosome entry site (IRES) sequences can be used. The IRES sequences that are chosen should be eficiently short so as not to interfere with virue packaging limitations. Accordingly, it is preferably that the IR? S chosen for a bicistronic process are not more than 500 nucleotides in length, with less than 250 nucleotides being preferred. Furthermore, it is preferable that the IRES used do not share the structural homology or sequence with picornavirus elements. The preferred IRES elements include, but are not limited to, the mammalian BiP FRES and the hepatitis C virus IRES. Alternatively, a foreign protein can be expressed from an internal tranecriptional unit in which the transcriptional unit has an initiation site and polyadenylation site. In another embodiment, the foreign gene is inserted into a negative-stranded RNA virus gene so that the resulting expressed protein is a fusion protein.

Recombinant Virus Generation Methods The present invention provides methods of generating recombinant negative-strand RNA viruses by introducing protein expression vectors and expression vectors expressing corresponding vRNA or cRNA of the invention in host cells in the absence of helper virus. . Preferably, the host cells are canine cells, for example, MDCK cells. The present invention also provides methods for generating infectious recombinant "negative-strand RNA viruses" by introducing protein expression vectors and expression vectors expressing corresponding vRNA or cRNA of the invention into cells that are hoepeded in the presence of helper virus. Preferably, the host cells are canine cells, for example, MDCK cells. The expression vectors of protein and expression vectors directing the expression of corresponding vRNA or cRNA can be introduced into hoepeting cells using any technique known to those of skill in the art without limitation. For example, the expression vectors of the invention can be introduced into host cells employing electroporation, DEA? -dextran, calcium foefate precipitation, lipoeomae, microinjection, and microparticle bombardment (see, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 ed., 1989, Cold Spring Harbor Preee, Cold Spring Harbor, NY). The expression vectors of the invention can be introduced into a cell homeowner either eimultaneously or sequentially. In a modality, one or more expression vectors directing the expression of corresponding vRNA or cRNA are introduced into skin cells prior to the introduction of expression vectors that direct the expression of viral proteins. In another embodiment, one or more expiratory vectors directing the expression of viral proteins are introduced into host cells prior to the introduction of one or more expression vectors directing the expression of corresponding vRNA or cRNA. According to these embodiments, the expression vectors directing the expression of corresponding vRNA or cRNA can be introduced together or separately in different transfections. In addition, according to these modalities, the expression vectors that direct the expression of the viral proteins can be introduced together or separately in different transfections. In another embodiment, one or more expression vectors directing the expression of corresponding vRNA or cRNA and one or more expression vectors directing the expression of viral proteins and ee introduced into host cells simultaneously. In certain modalidadee, all expression vectors are introduced into host cells using lipoeomae. The appropriate amounts and ratios of the expression vectors for performing a method of the invention can be determined by routine experimentation. As a guide, in the case of liposomal transfection or calcium precipitation of plaemids in the host cells, it is contemplated that each plasmid can be employed at a few μg, for example, 1 to 10 μg, for example, diluted to a concentration of DNA final total of approximately 0.1 μg / ml prior to mixing with transfection reagent in a conventional manner. It may be preferred to use vectors that express RNA and / or NP-dependent RNA polymerase subunits at a higher concentration than those expressing RNAv eegmentoe. One of ordinary skill in the art will appreciate that the quantity and relationship of the expression vectors may vary depending on the host cells. In one embodiment, at least 0.5 μg, preferably at least 1 μg, at least 2.5 μg, at least 5 μg, at least 8 μg, at least 10 μg, at least 15 μg, at least 20 μg, at least 25 μg, or at least 50 μg of one or more protein expression vectors of the invention, are introduced into hoepedadorae cells to generate infectious recombinant negative-stranded RNA viruses. In another embodiment, at least 0.5 μg, preferably at least 1 μg, at least 2.5 μg, at least 5 μg, at least 8 μg, at least 10 μg, at least 15 μg, at least 20 μg, at least 25 μg, or at least 50 μg of one or more expression vectors of the invention that direct the expression of vRNA or cRNA, are introduced into hoepedadorae cells to generate infectious recombinant negative-stranded RNA virus. Lae host cells which can be used to generate the negative strand RNA viruses of the invention include primary cells, cultured or secondary cells, and transformed or immortalized cells (e.g., 293 cells, 293T cells, CHO cells, Vero cells, PK, MDBK, OMK and MDCK cells). Lae-cell homellants are preferably animal cells, more preferably mammalian cells, and more preferably canine cells. In a preferred embodiment, the infectious recombinant negative-strand RNA viruses of the invention are generated in MDCK cells. The present invention provides methods for generating infectious recombinant negative-strand RNA virus in stable host cell lines. The stable transduced host cell lines of the invention can be produced by introducing cDNAs controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, tranecription termination sequence, polyadenylation sites, etc.), and a selectable marker. in host cells. Followed by the introduction of strange DNA, the transduced cells can be allowed to grow for 1-2 days in an enriched medium, and then they are switched to a selective medium. The selectable marker confers resistance to the cells and allows the cells to stably integrate the DNA into their chromosomes. Host cells transduced with the integrated stable DNA can be cloned and expanded into cell lines. . • A number of selection systems can be used, including but not limited to thymidine kinase of the herpes simplex virus. { Wigler, et al., 1977, Cell 11: 223), hypoxanthine-guanine foeforiboeiltransferase (Szybalska &Szybalski, 1962, Proc. Nati, Acad. Sci. USA 48: 2026), and adenosine phosphoribosiltranef rasa genes (Lowy et al. ., 1980, Cell 22: 817) can be used in tk, hgprt or aprt cells, respectively. Also, resistance to antimetabolite can be used as the basis for the selection of dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Nati. Acad. Sci. USA 77: 3567; O'Haré et al., 1981, Proc. Nati, Acad. Sci. USA 78: 1527); gpt, which confer resistance to mycophenolic acid (Mulligan &Berg, 1981, Proc Nati Acad Sci USA 78: 2072); neo, which confers resistance to the aminoglycoeido G-418 (Colberre-Garapin et al., 1981, J. Mol. Biol. 150: 1); and hygro, which confer resistance to hygromycin genes (Santerre et al., 1984, Gene 30: 147). The infectious recombinant negative-strand RNA viruses generated by methods of the invention which are not attenuated, can be attenuated or killed by, for example, classical method. For example, recombinant negative-strand RNA virus of the invention can be killed by heat treatment or formalin, so that the virus is not capable of replication. The recombinant negative-strand RNA viruses of the invention, which are not attenuated, can be attenuated, for example, by passing through non-native hoependoree to produce progeny viruses which are immunogenic, but not pathogenic. The attenuated, live or annihilated viruses produced according to the invention can be incorporated in a conventional manner in a vaccine composition in a conventional manner or used to produce additional viruses, for example, in eggs. Where a virus has a chimeric vRNA segment as described above which encodes a foreign antigen, it can be formulated to achieve vaccination against a pathogen simultaneously. The attenuated recombinant viruses produced in accordance with the invention which have a chimeric vRNA element can also be designated for other therapeutic uses, for example, a gene therapy tool or antitumor agent, in this case the production of the virus will be followed by its incorporation into an appropriate pharmaceutical composition in conjunction with a pharmaceutically acceptable diluent or carrier. The rescue of free cooperating virus according to the invention is particularly favored for the generation of rearranged virue, especially rearranged influenza viruses desired for use in vaccines particularly since selection methods are not necessary to release the cooperating virulent culture. The methods of the present invention can be modified to incorporate aspects of methods known to those skilled in the art to improve the efficiency of rescue of infectious particles and viruses. For example, the technique of inbred genetics involves the preparation of synthetic recombinant viral RNAs containing the non-coding regions of the negative strain virulence RNA which are essential for recognition by viral polymerases and for signal packaging necessary to generate a mature virion . Recombinant RNAs are synthesized from recombinant DNA annealing and reconstituted in vitro with purified viral polymerase complex to form recombinant ribonucleoprotein (RNPs) which can be used for tranefection cells. A more efficient tranefection is achieved when the viral polymerase proteins are present during the transcription of the synthetic RNA either in vitro or in vivo. Synthetic recombinant RNPs can be rescued in infectious virus particles. The foregoing techniques are described in U.S. Patent No. 5,166,057 issued November 24, 1992; in U.S. Patent No. 5,854,037 issued December 29, 1998; in U.S. Patent No. 5,789,229 issued Aug. 4, 1998; in European Patent Publication EP 0702085A1, published February 20, 1996; in the North American Patent Application Serial No. 09 / 152,845; in International Patent Publications WO97 / 12032 published April 3, 1997; W096 / 34625 published November 7, 1996; in European Patent Publication EP-A780475; WO99 / 02657 published January 21, 1999; WO98 / 53078 published November 26, 1998; WO98 / 02530 published January 22, 1998; W099 / 15672 published April 1, 1999; WO98 / 13501 published April 2, 1998; WO97 / 06720 published February 20, 1997; and EPO 780 47SA1 published June 25, 1997, each of which is incorporated herein by reference in its entirety.

Modalities of the Virus. of Specific Segmented Negative Strand RNA The present invention provides a method for generating infectious recombinant viral particles of an RNA virus in cultured cells. of segmented negative strand having more than 3. genomic vRNA segment, for example an influenza virus such as an influenza A virus, the method comprises: (a) - introducing into a population of cells capable of supporting the growth of the virus; virus a first set of expression vectors capable of expressing vRNA segments in cells. genomic to provide the complete genomic vRNA segments. of the virus; (b) introducing into the cells a second set of expression vectors capable of expressing the mRNA encoding one or more polypeptide of the virus; and (c) culturing the cells whereby the particle and virus are produced. In certain modaidadee, the cells are canine cells. In certain modalidadee, the cells eon cell of MDCK. In certain modalities, the recombinant virulence of influenza virus A or B. In certain embodiments, the first set of expiratory vectors is contained in 1-8 plasmids. In certain embodiments, the first set of expiratory vectors is contained in a plasmid. In certain embodiments, the second set of expression vectors is contained in 1-8 plasmids. In certain embodiments, the second set of expression vectors is contained in a plasmid. In certain embodiments, the first, second, or both sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encode each cRNA segment of an influenza virus. In certain embodiments, the second set of expression vectors encode the mRNA of one or more or all of the influenza polypeptides. In certain embodiments, the first set or second set of expression vectors (or both set) comprise a nucleic acid of the invention, eg, a canine RNA pol L regulatory sequence of the invention (eg, canine RNA pol L promoter). ). In certain embodiments, the first set or second set of expression vectors (or both sets) encode a vRNA and mRNA from a second virus. For example, a set of vectors comprises one or more vectors encoding the RNA and / or RNA of HA and / or NA of a second virus of influenza. In one embodiment, the cooperating virus is used in the method. In one embodiment, the cultured cells used in the method are canine cells. The present invention provides a method for generating in cultured cells. recombinant viral particles infectious of a virus, of segmented negative strand RNA having more than 3 genomic vRNA segments, for example an influenza A virus, the method comprises: (a) introducing into a population of cells capable of supporting growth of the virus, a set of expression vectors capable of expressing in the gen eegmentoe eegmentoe of the genomic vvl to provide the eegmentoe of complete genomic vRNA of the virus and capable of expressing mRNA coding for one or more polypeptides of the virus; (b) Cultivating the cells so that the viral particles are produced. In certain embodiments, the cells are canine cells. In certain embodiments, the cells are MDCK cells. In certain modalities, the virus is influenza A or B virus. In certain modalities, the set of expression vectors is found in 1-17 plaemidoe. In certain embodiments, the set of expression vectors is contained in 1-8 plasmids. In certain embodiments, the set of expression vectors is contained in 1-3 plamididoe. In certain embodiments, the set of expression vectors is contained in a plasmid. In certain embodiments, the sets of expiry vectors are introduced by electroporation. In certain embodiments, the set of expression vectors encode each vRNA element of an influenza virus. In certain modalidadee, the set of expression vectors encode the mRNA of one or more influenza polypeptide. In certain embodiments, the set of expression vectors encode each vRNA segment of an influenza virus and the mRNA of one or more influenza polypeptide. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, eg, a canine RNA pol L regulatory sequence of the invention (eg, a canine RNA pol L promoter). In certain embodiments, the set of expression vectors encode a vRNA or mRNA of a second virus. For example, the set of vectors comprise one or more vectors encoding the vRNA and / or HA and / or NA mRNA of a second influenza virus. In certain modalidadee, the first set or second set of expression vectors (or both sets) encode a vRNA or mRNA of a second virus. For example, a set of vectors comprise one or more vectors encoding the vRNA and / or HA and / or NA mRNA of a second influenza virus. In one embodiment, the cooperating virus is used in the method. In one embodiment, the cultured cells used in the method are canine cells. The present invention provides a method for generating infectious recombinant viral particles of a negative-strand RNA virus in cultured cells, the method comprising: (a) introducing into a population of cells capable of supporting the growth of the virus a first set of vectors of expression capable of expressing genomic vRNA in the cells to provide the full genomic vRNA of the virus; (b) introducing into the cells a second set of expression vectors capable of expressing the mRNA encoding one or more polypeptide of the virus; and (c) culturing the cells by which the viral particles are produced. In certain embodiments, the cells are canine cell. In certain embodiments, the cells are MDCK cells. In certain modalities, the. The virus is influenza B virus. In certain modalities, the first set of expression vectors is contained in 1-8 plasmids. In certain embodiments, the first set of expression vectors is contained in a plasmid. In certain embodiments, the second set of expression vectors are contained in 1-8 plasmid. In certain modalities, the second set of vectors of expression is contained in a plasmid. In certain modalidadee, the first, second, or both sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encode each vRNA segment of an influenza virus. In certain embodiments, the second set of expression vectors encode the mRNA of one or more influenza polypeptides. In certain modaidadee, the first set or second set of expression vectors (or both sets) comprises a nucleic acid of the invention, for example, a canine RNA pol L sequence of the invention (eg, an RNA pol L promoter). canine). In one embodiment, the cooperating virus is used in the method. In one embodiment, the cultured cells used in the method are canine cell. The present invention provides a method for generating in infected cells viral infectious particles of a negative-strand RNA virus, the method comprising: (a) introducing into a population of cells capable of supporting the growth of the virus, a set of expression vectors capable of both expressing genomic vRNA in the cells to provide the full genomic vRNA of the virus and capable of expressing mRNA encoding one or more polypeptides of the virus; (b) cultivate the cells by which the viral particles are produced. In certain modalidadee, the cells are canine cells. In certain embodiments, the cells have MDCK cells. In certain modalities, the virus is influenza B virus. In certain modalities, the expiratory vector set is contained in 1-17 plasmids. In certain embodiments, the set of expression vectors is contained in 1-8 plasmid. In certain modaidadee, the set of expiry vectors is contained in 1-3 plasmids. In certain embodiments, sets of expiry vectors are introduced by electroporation. In certain embodiments, the set of expiration vectors encode each piece of vRNA from an influenza virus. In certain embodiments, the set of expression vectors encode the mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors encode each vRNA segment of an influenza virus and the mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, for example, a canine RNA pol L regulatory sequence of the invention. { for example, a canine RNA pol L promoter). In certain embodiments, the set of expression vectors encode a vRNA or mRNA of a second virus. For example, the set of vectors comprise one or more vectors encoding the RNA and / or RNA of HA and / or NA of a second virus of influenza. In one embodiment, the cooperating partner is used in the method. In one embodiment, the cultured cells used in the method are canine cells. • > The present invention provides a method for generating in cultured canine cells infectious viral particles of a segmented negative strand RNA virus, having more than 3 genomic vRNA segments, for example an influenza virus such as an influenza A virus., the method comprises: (a) providing a first population of canine cells capable of supporting the growth of the virus and having introduced a first set of expression vectors capable of expressing directly into the canine cells genomic vRNA segments to provide the segments of Complete genomic vRNA of the virus, or the corresponding cRNA, in the absence of a helper virus to provide any RNA fragment, canine cells are also capable of providing an RNA and nucleoprotein-dependent RNA polymerase thereby the RNP complexes containing the genomic vRNA segments of the virus can be formed and viral particles can bind within canine cells; and (b) culturing the canine cells so that the viral particles are produced. In certain embodiments, the cells caninae are MDCK cells. The present invention also provides a method for generating infectious virus particles from a strained negative RNA virus cultured in cultured canine cells, the method comprising: (a) providing a first population of canine cells which are capable of supporting the growth of the virus and which are modified to be able to provide (a) the viral genomic vRNA in the absence of a cooperating virus and (b) an RNA-dependent RNA polymerase. nucleoprotein a so that the RNA complexes containing the genomic vRNA can be formed and the viralee particles can bind, the genomic vRNA is directly expressed in the cell under the control of a canine Pol I RNA regulatory sequence, or functional derivative Of the same; and (ii) cultivate canine cells so the viral particles are produced. The present specification also provides a method for generating in cultured cells infectious viral particles of a segmented negative-strand RNA virus, the method comprising: (i) providing a population of canine cells which are capacee. of supporting the growth of the virue and which are modified to be able to provide (a) the genomic vRNA of the virus in the absence of a cooperating virue and (b) an RNA-polymerase dependent on RNA and nucleoprotein so the complex of RNP or complexes containing the genomic vRNA ee can form and the viralee particles can bind, the genomic RNAs are directly expressed in the canine cells under the control of a canine Pol I RNA regulatory sequence or a functional derivative thereof, for example, a canine Pol I RNA promoter as described above; and (ii) culturing the canine cells so that the viralee particles are produced. In a specific embodiment, an infectious recombinant negative-strand RNA virus having at least 4, at least 5, at least 6, at least 7, or at least 8 elements of Genomic vRNA in a canine host cell is generated using the methods described herein. In a specific embodiment, the present invention provides methods for generating infectious recombinant influenza virus in host cells using expression vectors to express vRNA segments or Corresponding cRNA and influenza virus protein, in particular PBl, PB2, PA and NA. According to this embodiment, the cooperating virus may or may not be included to generate the recombinant influenza viruses infectious. The infectious recombinant influenza virus of the invention may or may not be replicated and produce progeny.

Preferably, the infectious recombinant influenza viruses of the invention are attenuated. The attenuated infectious recombinant influenza viruses can have, for example, a mutation in the NS1 gene. In certain embodiments, an infectious recombinant virus of the invention can be used to produce other viruses useful for preparing a vaccine composition of the invention. In one embodiment, the recombinant or rearranged viruses produced by a method of the invention are used for the production of additional virus for use as a vaccine. For example, a population of recombinant or reordered viruses produced by the methods of the invention which incorporate a canine RNA pol L regulatory sequence of the invention. { for example, a. promoter of canine RNA pol I). Subsequently, the virus population ee grows in egg or other culture so that the additional virus is produced for the preparation of vaccines or an immunogenic composition. In certain embodiments, the infectious recombinant influenza viruses of the invention exhibit heterologous and (ie, not influenza) viruses. In another embodiment, the infectious recombinant influenza viruses of the invention express influenza virus proteins from different influenza strains. In yet another preferred embodiment, the infectious recombinant influenza viruses of the invention express fusion proteins.

Introduction of vectors into host cells Vectors comprising influenza genome elements can be introduced (eg, transfected) into host cells according to methods well known in the art (see, for example, US patent application publications). US20050266026 and 20050158342) for introducing heterologous nucleic acids into eukaryotic cells, including, for example, calcium phosphate co-precipitation, electroporation, microinjection, lipofection, and tranefection employing polyamine tranefection reagents. For example, vectors, e.g., plasmids, can be transfected into host cells, such as, for example, MDCK cells, COS cells, 293T cells, or combinations thereof, using the TransIt-LTl polyamine transfection reagent ( Mirus) according to the manufacturer's inetruccione. Approximately 1 μg of each vector to eer introduced into the host cell population can be combined with about 2 μl of TransIT-LTl diluted in 160 μl of medium, preferably serum-free medium, in a total volume of 200 μl. The mixtures of transfection reagent: DNA can be incubated at room temperature for 45 minutes followed by the addition of 800 μl of the medium. The transfection mixture was then added to the host cells, and the cells were cultured as described above. Accordingly, for the production of recombinant or reordered viruses in cell culture, the vectors that incorporate each of the 8 genome segments, (PB2, PB1, PA, NP, M, NS, HA and NA) are mixed with approximately 20. μl of TransIT-LTl and transfected into host cells. Optionally, the serum-containing medium is replaced prior to tranefection with serum-free medium, for example, Opti-MEM I, and incubated for 4-6 hours. Alternatively, electroporation can be used to introduce vectors that incorporate influenza genome segments in host cells. See, for example, the publication of US patent application US20050266026 and 20050158342, which are incorporated herein by reference. For example, vectors of plamidids that incorporate a virus of influenza A or influenza B are introduced into MDCK cells using electroporation according to the following procedure. Briefly, 5 x 10 6 MDCK cells, for example, grown in Modified Eagle's Medium (MEM) supplemented with 10% Fetal Bovine Serum (FBS) were resuspended in 0.4 ml of OptiMEM and placed in an electroporation cuvette. Twenty micrograms of DNA in a volume of 25 μl haeta were added to the cells in the cuvette, which was then mixed lightly by tapping gently. Electroporation was performed in accordance with the manufacturer's ineffectiveness (for example, BioRad Gene Puleer II with Capacitance Extender Plue connected) at 300 volts, 950 microFarads with a time constant of between 38-33 meeg. The cells were remixed by tapping lightly and approximately 1-2 minutes followed by electroporation were added directly to the 0.7 ml cuvette of MEM with 10% FBS. The cells were then transferred to two cavities of a standard 6 cavidadee tissue culture dish containing 2 ml of MEM, 10% FBS or OPTI-MEM without serum. The cuvette was washed to recover any remaining cells and the washed euspension was divided between the two cavities. The final volume was approximately 3.5 mi. The cells were then incubated under controlled conditions for viral growth, for example, at about 33 ° C for strains adapted to cold. Additional guidance in introducing vectors into host cells can be found, for example, in US Patent Nos. 6,951,754, 6,887,699, 6,649,372, 6,544,785, 6,001,634, 5,854,037, 5,824,536, 5,840,520, 5,820,871, 5,786,199, and 5,166,057 and Patent Application Publications. North American Nos. 20060019350, 20050158342, 20050037487, 20050266026, 20050186563, 20050221489, 20050032043, 20040142003, 20030035814, and 20020164770.

Cell Culture Typically, the spread of the virus takes place in the medium composition in which the host cells are commonly cultured. Host cells suitable for replication of influenza viruses include, for example, Vero cells, Per.C6 cells, BHK cells, MDCK cells, 293 cells and COS cells, including 293T cells, C0S7 cells. MDCK cells are preferred in the context of the present invention. The use of non-tumorigenic MDCK cells as host cells is also a modality of the invention. Co-cultures including two of the cellularee lines above, for example, MDCK cells and any of the 293T and COS cells can also be employed in a ratio, eg, 1: 1, to improve replication efficiency. See, e.g., 20050158342. Typically, cells are grown in a standard commercial culture medium, such as Dulbecco's modified Eagle's medium supplemented with serum (eg, 10% fetal bovine serum), or in serum-free medium, low controlled humidity and adequate C02 concentration to keep the buffer pH neutral (for example, at pH between 7.0 and 7.2). Optionally, the medium contains antibiotics to prevent bacterial growth, for example, penicillin, streptomycin, etc., and / or additional nutrients, such as L-glutamine, sodium pyruvate, non-essential amino acids, supplementary euplementae to promote favorable growth characteristics. , for example, trypsin, β-mercaptoethanol, and eimilaree. Procedures for maintaining mammalian cells in culture have been reported extemporaneously, and are known to those skilled in the art. General protocols are provided, for example, in Freshney (1983) Culture of Animal Cells: Handbook of Baeic Technique, Alan R. Liss, New York; Paul (1975) Cell and Tiseue Culture, 5th ed. Livingston,? Dinburgh; Adams (1980) Laboratory Techniques in Biochemistry and Molecular Biology-Cell Culture for Biochemistry, Work and Burdon (ede.) Eleevier, Amsterdam. Additional details relating to tissue culture procedures of particular interest in the production of in vitro influenza viruses include, for example, Merten et al. (1996) Production of influenza virus in cell cultures for vaccine preparation. In Cohen and Shafferman (eds) Novel Strategies in Design and Production of Vaccines, which is incorporated in the present in its entirety. Additionally, variations in such procedures adapted to the present invention are easily determined through routine experimentation. The cells for the production of influenza viruses can be cultured in serum-free or serum-containing medium. In some cases, for example, for the preparation of purified viruses, it is desirable to grow the host cells in serum-free conditions. The cells can be cultured at a smaller scale, for example, less than 25 ml of medium, culture tubes or flasks or in large shakes with agitation, in rotating bottles, or in microcarrier beads (for example, perlae microportadorae of. DEAE- Dextran, such as Dormacell, Pfeifer &Langen; Superbead, Flow Laboratories; styrene-tri-methylamine copolymer beads, such as Hillex, SoloHill, Ann Arbor) in flask, bottle or reactor cultures. Lae perlae microportadorae are small spheres (in the range of 100-200 microns in diameter) that provide a large surface area for the growth of adherent cells per cell culture volume. For example, a single liter of medium can include more than 20 million microcarrier beads that provide more than 8,000 square centimeters of growth surface. For commercial virus production, for example, for vaccine production, it is often desirable to culture the cells in a bioreactor or fermentor. The bioreactors are available in volume from under 1 liter to in excess of 100 liters, for example, Cyto3 Bioreactor (Osmonics, Minnetonka, MN); NBS bioreactors (New Brunswick Scientific, Edison, N.J.); commercial and laboratory bioreactor from B. Braun Biotech. International (B. Braun Biotech, Meleungen, Germany). With respect to the volume of culture, in the context of the present invention, the cultures can be maintained at a temperature less than or equal to 35 ° C, to ensure the efficient recovery of recombinant and / or rearranging influenza virus, particularly viruses. of recombinant influenza and / or rearranged attenuated, temperature-stable, cold-adapted For example, the cells are cultured at a temperature between about 32 ° C and 35 ° C, typically at a temperature between about 32 ° C and about 34 °, usually at about 33 ° C. Typically, a regulator, e.g., a thermostat, or other dietary agent to provide and maintain the temperature of the cell culture system is used to ensure that temperatures do not exceed 35 ° C during the period of virus replication.

Virus recovery Virue eon typically recovered from the culture medium, in which the infected cells (tranefectadae) have grown. Typically, the crude medium is clarified prior to the concentration of influenza virus. Common methods include filtration, ultrafiltration, barium eulfate adsorption and elution, and centrifugation. For example, the crude medium of infected cultures can be first clarified by centrifugation at, for example, 1000-2000 x g for a sufficient time to remove cellulose residue and other large particulate matter, for example, between 10 and 30 minutes. Alternatively, the medium is filtered through a 0.8 μm cellulose acetate filter to remove intact cells and other large particulate matter. Optionally, the supernatant of the clarified medium is then centrifuged to pellet the influenza virus, for example, at 15,000 x q, for about 3-5 hours. Following the resumption of the virus pellet in a suitable buffer, such as STE (0.01 M Tris-HCl, 0.15 M NaCl, 0.0001 M EDTA) or phosphate buffered saline (PBS) at pH 7.4, the virus is concentrated by density gradient centrifugation in sucrose (60% -12%) or potassium tartrate (50% -10%). Any of the continuous or step gradients, for example, a sucrose gradient between 12% and 60% in four stages of 12%, are suitable. The gradients are centrifuged at a speed, and for a time, enough for the viruels to find in a stable band for recovery. Alternatively, and for more large-scale applications, the virue is ener- gized from gradient of deficiency by a centrifugal zone rotor operating in a continuous mode. Additional details are provided to direct someone of experience through the preparation of influenza viruses from tissue culture, for example, in Furminger. Vaccine Production, in Nicholson et al. (ede) Textbook of influenza pp. 324-332; Merten et al. (1996) Production of influenza virus in cell culture for vaccine preparation, in Cohen & Shafferman (ede) Novel St'rategiee in Deeign and Production of Vaccines pp. 141-151, and North American Patents No. 5,690,937, US applications for publications; 20040265987, 20050266026 and 20050158342, which are incorporated by reference herein. If desired, the recovered viruses can be stored at -80 ° C in the presence of sucroea-foefato-glutamate (SPG) as an enhancer.

Influenza Virus The genome of the influenza virus is composed of eight linear (-) strand ribonucleic acid (RNA) segments, which encode hemagglutinin (HA) and neuraminidase (NA) - immunogenic proteins, and an inner core polypeptide. : Nucleoprotein nucleoprotein (NP); matrix proteins (M); non-structural proteins (NS); and 3 RNA polymerase proteins (PA, PBl, PB2). During replication, genomic viral RNA is transcribed into strand messenger RNA (+) and strand genomic (-) mRNA in the host cell nucleus. Each of the eight genomic segments is packed into ribonucleoprotein complexes that contain, in addition to RNA, NP and a polymerase complex. { PBl, PB2, and PA). Influenza viruses which can be produced by the processes of the invention in the MDCK cells of the invention include, but are not limited to, rearranging viruses that incorporate neuraminidase antigen and / or hemagglutinin selected in the context of a primary strain amenable to the temperature, attenuated, improved. For example, viruses can comprise major strains that are one or more of, for example, temperature-stable (ts), cold-adapted. { for its eiglae in English, ca), or an attenuated one (for its acronym in English, att) (for example, A / Ann Arbor / 6/60, B / Ann Arbor / 1/66, PR8, B / Leningrad / 14 / 17/55, B / 14/5/1, B / USSR / 60/69, B / Leningrad / 179/86, B / Leningrad / 14/55, B / England / 2608/76, A / Puerto Rico / 8/34 (ie, PR8), etc., or antigenic variants or derivatives thereof.

Influenza virus vaccines Historically, vaccines against influenza virus have been produced in embryonated chicken eggs using strains of selected viruses based on empirical predictions of relevant genes. More recently, rearranged viruses incorporating selected hemagglutinin and neuraminidase antigens have been produced in the context of an attenuated, attenuated, temperature-sensitive main strain. Following the culture of the virus through multiple paeajee in chicken eggs, influenza viruses are recovered and, optionally, inactivated, for example, using formaldehyde and / or β-propiolactone. However, the production of influenza vaccine in this manner has several significant disadvantages. Pollutants that remain from chicken eggs are highly antigenic, pyrogenic, and are frequently used in significant laterale effects in administration. More importantly, the strains designated for production should be selected and distributed, typically months in advance of the next influenza season to allow time for production and inactivation of the influenza vaccine. Attempts at the production of recombinant and rearranged vaccines in cell cultures have been hampered by the inability of any of the approved strains for vaccine production for efficient growth under standard cell culture conditions. The present invention provides a vector of compounds, compositions, and methods for producing recombinant and rearranged virue in culture which make it possible to rapidly produce vaccines corresponding to one or many strains of virus antigenic and virus selected. In particular, conditions and cepae that result in efficient production of virue from a multiple plasmid system in cell culture are provided. Optionally, if necessary, viruses can also be amplified in chicken eggs or cell cultures that differ from culture to rescue the virus.

For example, it has been possible to grow the B B / Ann Arbor / 1/66 influenza strain under standard cell culture conditions, for example, at 37 ° C. In the methods of the present invention, multiple plasmids, each of which incorporates a segment of an influenza virus genome, are introduced into suitable cells, and kept in culture at a temperature less than or equal to 35 ° C. Typically, the cultures are maintained at between about 32 ° C and 35 ° C, preferably between about 32 ° C and about 34 ° C, for example, at about 33 ° C. Typically, the cultures are maintained in a system, such as a cell culture incubator, under controlled humidity and C02, at a constant temperature using a temperature regulator, such as a thermostat to ensure that the temperature does not exceed 35 ° C. Reordered influenza viruses can be easily obtained by introducing a subset of vectors comprising cDNA encoding genomic segments of a major influenza virus, in combination with complementary elements derived from strains of interest (e.g., antigenic variants of interest). Typically, the main strains are selected on the basis of desirable properties relevant to the administration of the vaccine. For example, the production of vaccine, for example, for the production of a live attenuated vaccine, the strain of the major donor virus can be chosen for an attenuated, cold-adapted and / or temperature-sensitive phenotype. In this context, the strain of influenza A ca A / Ann Arbor / 6/60; strain of influenza B ca B / Ann Arbor / 1/66; and another strain selected for its desirable phenotype properties, eg, an attenuated, cold-adapted, and / or temperature-sensitive strain, are favorably selected as major donor strains. In one embodiment, plasmids comprising cDNA encoding the six segments of internal vRNA of the major influenza virus strain,. { ie, PBl, PB2, PA, NP, NB, MI, BM2, NS1 and NS2) are transfected into suitable host cells in combination with herraplutinin and neuraminidase vRNA segments encoding cDNA from an antigenically desirable strain, e.g. , a strain predicted to cause significant global or local influenza infection. Followed by replication of the rearranged virus in the cell culture at temperatures appropriate for efficient recovery, for example, equal to or less than 35 ° C, such as between about 32 ° C and 35 ° C, for example between about 32 ° C and Approximately 34 ° C, or approximately 33 ° C, reordered viruses are recovered. Optionally, the recovered viruses can be inactivated using a denaturing agent such as formaldehyde or β-propio lactone.

Methods and compositions for the prophylactic administration of vaccines The recombinant and rearranged viruses of the invention can be administered prophylactically in an appropriate carrier or excipient to stimulate a specific immune response for one or more strains of influenza virus. Typically, the carrier or excipient is a pharmaceutically acceptable carrier or excipient, such as eterile water, aqueous saline solution, aqueous buffered saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, ethanol, allantoic fluid from uninfected hen's eggs (ie. say, normal allantoic fluid, by its acronym in English "NAF") or combinations of the same. The preparation of such solutions which assure sterility, pH, isotonicity, and stability, is carried out according to protocols established in the art. Generally, a carrier or excipient is selected to minimize allergenic effects and other undesirable effects,. and following the particular route of administration, for example, subcutaneous, intramuscular, intranasal, etc. Generally, the influenza virus of the invention is administered in an amount sufficient to stimulate a specific immune reuptake for one or more influenza virus strains. Preferably, administration of the influenza virus leads to a protective immune response. The doses and methods for conducting a protective immune response against one or more strains of influenza are known to those skilled in the art. For example, inactivated influenza viruses in the range of about 1-1000 HID50 (human infectious dose), i.e., about 105-108 pfu (plaque forming unit) per doe administered, are provided. Alternatively, about 10-50 μg, for example, about 15 μg of HA are administered without an adjuvant, with two doses being administered with an adjuvant. Typically, the dose will be adjusted within the range based on, for example, age, physical condition, body weight, sex, diet, time of administration, and other clinical factors. The prophylactic vaccine formulation is administered in a sietemic manner, for example, by ecucutaneous or intra-muscular injection with a needle and syringe, or a needle-free injection device. Alternatively, the vaccine formulation is administered intranasally, either by droplets, large particle aeroeol (greater than about 10 micron), or spray in the upper reepiratory tract. Although any of the above delivery routes result in a protective systemic immune response, intranasal administration confers the added benefit of eliciting mucoeal immunity in the entry site of the influenza virus. For nasal administration, attenuated live virus vaccines are often preferred, for example, a reassortant, recombinant, attenuated, cold adapted and / or temperature sensitive virus. Although the stimulation of an immune response. Protective with a single dose is preferred, they can, administer additional dosages, by the same or different route, to achieve the desired prophylactic effect. Alternatively, an immune response can be stimulated by directing ex vivo or in vivo dendritic cells with influenza virus. For example, proliferating dendritic cells are exposed to virus in a sufficient amount and for a period of time sufficient to allow the capture of influenza antigens by dendritic cells. The cells are then transferred to a subject to be vaccinated by standard intravenous transplantation methods. Optionally, the formulation for prophylactic administration of the influenza virus, or its ubiquity, also contains one or more adjuvants to improve the immune response to the influenza antigens. Suitable adjuvants include: saponin, gels-minerals such as aluminum hydroxide, suetanciae activae on the surface such as lysolecithin, pluronic polyols, polyaninoy, -, peptide, oil or hydrocarbon emulsions, Bacillus Calmette-Guerin (BCG), Corynebacterium 'parvu, and. synthetic adjuvants-QS-21 and MF5. If so, the administration of prophylactic influenza virus vaccines can be carried out in conjunction with the administration of one or more immunoeetimulatory molecules. The immunostimulatory molecule includes several cytokines, lymphokines and chemokines with immunostimulatory, immunopotentiating and proinflammatory activities, such as interleukins. { for example, IL-1, IL-2, IL-3, IL-4, IL-12, IL-13); the growth factors. { for example, colony stimulation factor (for its acronym in English, CSF) of granulocyte-macrophage (GM); and other immunostimulatory molecules, such as macrophage inflammatory factor, ligand Flt3, B7.1; B7.2, etc. The immunostimulatory molecules can be administered in the same formulation as the influenza viruses, or they can be administered separately. Either the protein or an expression vector encoding the protein can be administered to produce an immunostimulatory effect. In another embodiment, the vectors of the invention that include influenza genome elements can be used to introduce the heterologous nucleic acids into a host or host cell, such as a mammalian cell, e.g., cells derived from a human subject, in combination with a suitable pharmaceutical carrier or excipient as described above.

Typically, the heterologous nucleic acid is inserted into a non-essential region of a gene or gene segment, for example, the M gene of segment 7. The sequence. of heterologous polynucleotides can encode a polypeptide or peptide, or an RNA such as a ribozyme or antisense RNA. The heterologous nucleic acid is then introduced into a host or host cells producing recombinant virue incorporating the heterologous nucleic, and. They are administered as described above. In one embodiment, the sequence of heterologous polynucleotides is not derived from an influenza virus. Alternatively, a vector of the invention. which includes a heterologous nucleic acid can be introduced and expressed in a co-trapping cell carrying the vector in a cell infected with an influenza virus. Optionally, the cells are then returned or delivered to the subject, typically to the site from which they were obtained. In some applications, the cells were grafted onto a tissue, organ, or eitium of the target (as discussed above) of interest, using established cell grafting or transfer procedures. For example, stem cells of the hematopoietic lineage, such as hematopoietic stem cells derived from bone marrow, cord blood, or peripheral blood, can be delivered to a subject using standard transfusion or delivery techniques. Alternatively, viruses comprising a heterologous nucleic acid can be delivered to the cells of a subject in vivo. Typically, such methods involve the delivery of vector particles to a target cell population (e.g., blood cells, skin cells, liver cells, neural cells (-which include brain), kidney cells, uterine cells, muscle cells, intestinal cells, cervical cells, vaginal cells, prosthetic cells, etc., as well as tumor cells derived from a variety of cells, tissues and / or organs, The administration can be either systemic, for example, by intravenous administration of viralee particles, or by delivering viral particles directly to a site or sites of interest by a variety of methods, including injection (eg, by using a needle or syringe), euminietration of vaccine in a needle, topical administration, or by pushing into a tissue , the organ or the skin site, for example, the viral vector particles can be delivered by inhalation, oral, intravenous, subcutaneous, subdermal, intradermal, intramuscular, intraperitoneal, intrathecal, by vaginal or rectal administration, or by placing viral particles within a cavity or other site of the body, for example, during surgery.

The methods described above are useful for therapeutically and / or prophylactically treating a disease or disorder by introducing a vector of the invention comprising a heterologous polynucleotide encoding a therapeutically or prophylactically effective polypeptide (or peptide) or RNA (eg, an antisense RNA or ribozyme) in a target cell population in vitro, ex vivo, or in vivo. Typically, the polynucleotide encoding the polypeptide (or peptide), or RNA, of interest is operably linked to appropriate regulatory sequences as described above in the sections entitled "Expression Vectors" and "Additional Expression Elements". Optionally, more than one heterologous coding sequence is incorporated into a single vector or virus. For example, in addition to a polynucleotide encoding a therapeutically or prophylactically active RNA or polypeptide, the vector may also include prophylactic or therapeutic added polypeptides, eg, antigens, co-stimulatory molecules, cytokines, antibodies, etc., and / or markers. , and similar. In one embodiment, the invention provides compositions comprising reordered and recombinant viruses of the invention (or portions thereof) that have been treated with an agent such as benzonase., to eliminate potential oncogenes. Accordingly, an oncogene-free vaccine composition is specifically included within the modalities of the invention. The method and vector of the present invention can be used to therapeutically or prophylactically treat a wide variety of traits, including genetic or acquired traits, for example, as vaccines for infectious diseases, due to viruses, bacteria, and the like.

Kits To facilitate the use of vectors and vectors of vectors of the invention, any of the vectors, for example, plasmids of consensus influenza viruses, variant influenza polypeptide plasmids, influenza polypeptide bank plasmids, etc., and Additional components, such as, buffer, cells, culture medium, useful for packaging and infection of influenza virus for experimental or therapeutic purposes, may be packaged in the form of a set. Typically, the kit contains, in addition to the above components, additional materials which may include, for example, intructions to perform the methods of the invention, packaging material, and a container.

Manipulation of viral nucleic proteins and acids In the context of the invention, the nucleic acids comprising regulatory sequence of RNA pol, canine or other nucleic acid of the invention, expulsion vector, influenza virus nucleic acid and / or Protein and loe eimilaree are manipulated according to known molecular biological techniques. Detailed protocols for numerous methods, including amplification, cloning, mutagenesis, transformation, and the like, are described, for example, in Ausubel et al. Current Protocols in Molecular Biology (supplemented to 2000) John Wiley & Sons, New York ("Aueubel"); Sambrook et al. Molecular Cloning - A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989 ("Sambrook"), and Berger and Kimmel Guide to Molecular Cloning Techniques, Methode in Enzymology Volume 152 Academic Prees, Inc., San Diego, CA ("Berger"). In addition to the above references, protocols for in vitro amplification techniques, such as polymerase chain reaction (PCR), the ligase chain reaction. { by its acronym in English, LCR), amplification of Qβ-replicase, and other techniques mediated by RNA polymerase (eg, NASBA), useful, for example, to amplify cDNA probes of the invention, are found in Mullis et al. (1987) U.S. Patent No. 4,683,202; PCR Protocole A Guide to Methode and Applicatione (Innis et al., Eds) Academic Preee Inc. San Diego, CA (1990) ("Innie"); Arnheim and Levinson (1990) C & EN 36; The Journal of NIH Reeearch (1991) 3:81; Kwoh et al. (1989) Proc Nati Acad Sci USA 86, 1173; Guatelli et al. (1990) Proc Nati Acad Sci USA 87: 1874; Lomell et al. (1989) J Clin Chem 35: 1826; Landegren et al. (1988) Science 241: 1077; Van Brunt (1990) Biotechnology 8: 291; Wu and Wallace (1989) Gene 4: 560; Barringer et al. (1990) Gene 89: 117, and Sooknanan and Malek (1995) Biotechnology 13: 563. The additional methods useful for cloning nucleic acids in the context of the present invention include Wallace et al. U.S. Patent No. 5,426,039. Improved methods for amplifying large nucleic acids by PCR are summarized in Cheng et al. (1994) Nature 369: 684 and referenced herein. Certain polynucleotides of the invention, for example, oligonucleotides can be synthesized using various solid phase strategies including phosphoramidite coupling chemistry based on mononucleotide and / or trinucleotide. For example, nucleic acid sequences ee can be synthesized by the sequential addition of activated trimers and / or monomers to an elongated polynucleotide strand. See, for example, Caruthers, M.H. et al. (1992) Meth Enzymol 211: 3.

Instead of synthesizing the desired sequences, essentially any nucleic acid can be ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company (mcr @ oligos.com), The Great American Gene Company ( www.genco.com), ExpressGen, Inc. (www.expressgen.com), Operon Technologies, Inc. (www. operon.com), and many others. In addition, the euetitucionee of selected amino acid residues in viral polypeptides can be performed, for example, by site-directed mutagenesis. For example, viral polypeptides with amino acid substitutions functionally correlated with an ethic character of desirable phenotype, for example, an attenuated phenotype, cold adaptation, temperature sensitive, can be produced by introducing specific mutations into a viral nucleic acid segment that encodes the polypeptide. Methods for site-directed mutagenesis are well known in the art, and are described, for example, in Ausubel, Sambrook, and Berger, supra. Numerous kits to perform the mutagenesis directed to the eitio eetán dieponiblee commercially, for example, the Kit for Mutagenesis Directed to the Site Chameleon. { Stratagene, La Jolla), and can be used according to the manufacturer's instructions to introduce, for example, one or more amino acid substitutions, in a genome segment encoding an influenza A or B polypeptide, respectively. - >; Other Viruses The nucleic acids, vectors, and methods of the present invention can also be used for the expreration and purification of other virue recombinants. The following description provides the orientation for important considerations in the adaptation of the vectors to other data. If the target virus comprises a positive strand, segmented RNA genome, a canine RNA pol L promoter is preferably located upstream of the cDNA in the internal transcription unit. { unidirectional system). In this modality, positive-strand RNA is generated for direct incorporation into new viruses. However, modalities in which the target virus comprises negative-strand segmented RNA genomae, are produced using the unidirectional seven-way, are within the scope of the invention. If the target virus comprises a negative-strand RNA-regulated genome, the canine RNA pol L promoter is preferably located downstream of the cDNA in the internal trac-coding unit (the bidirectional subject). In this modality, the negative strand RNA is generated for direct incorporation into virue newe. Lae modalidade wherein the target species comprising positive-strand segmented RNA genome are produced with the bidirectional seventh eethan within the scope of the invention. The present invention can also be used to produce viruses comprising non-segmented, infectious or non-infectious (single-stranded or double-stranded) RNA genomes. In general, the simple introduction of infectious viral genomic RNA into a host cell is sufficient to address the initiation of the viral life cycle within the cell and the eventual production of whole viruses. For example, the simple introduction of pocornaviral genomic RNA into a host cell is sufficient to cause the generation of complete picornaviruses. The initiation of the life cycle of a virus comprising non-infectious genomic RNA, typically, requires the additional introduction of other viral proteins which are usually carried within the viral particle together with the genome. For example, parainfluenza III viruses carry an RNA-dependent RNA polymerase whose presence is required within a recently infected host cell for replication and transcription of viral genomic RNA from viral mRNAs; in the presence of the polymerase, the genomic RNA of parainfluenza III is not infectious. In embodiments of the present invention wherein viruses are generated that comprise unsegmented, infectious genomic RNAs, the simple introduction of a "dual expression" plasmid of the invention, carrying a nucleic acid that includes the viral genome, into a suitable host cell it is enough to cause the generation of complete virus. In embodiments where viruses comprising unsegmented, non-infectious genomic RNA are generated, the additional expression plasmids may also have been introduced into a host cell together with the dual expression plasmid carrying the viral genome. The additional plasmid will express the proteins required for the initiation of the viral life cycle which are normally introduced into an infection host cell (for example, RNA polymerase and RNA dependent). In embodiments wherein the picornavirus, which comprises a non-segmented, infectious RNA genome, is produced, the cDNA comprising the entire viral genome is inserted into a dual promoter expression plasmid of the invention. A 5 'promoter in an external transcription unit, preferably, a pol II promoter, directs the production of a positive-strand mRNA comprising the entire viral genome-a polyprotein is translated from the mRNA and individual proteins are cleaved and released of the polyprotein (for example, by a protease within the polyprotein). I realize that the viral genome comprises the pooled RNA, a second 5 'promoter in an internal transcription unit (seven unidirectional), preferably canine pol L RNA, directs the production of a copy of the positive strand genome. If the viral genome comprises negative-stranded RNA, a second promoter in the 3 'direction, in an internal transcription unit (bidirectional system), preferably canine pol L RNA, could direct the production of a copy of the negative-strand genome. Modalities where the unreached, negative-strand RNA is generated by the unidirectional system is within the scope of the invention. In a similar manner, embodiments in which non-segmented, positive-strand RNA viruses are produced using the bidirectional system are within the scope of the invention. Loe virue what. they comprise non-segmented, non-infectious RNA genomes in which a polyprotein is not produced, they can also be generated with the present invention. For example, the present seventh ee can be used to produce virus rhabdoviridae or paramyxoviridae virus, preferably virue of parainfluenza III, whose life cycle normally includes production of multiple monozytronic mRNA of genomic negative strand RNA by a virally derived RNA-dependent polymerase RNA.; Individual proteins are expressed from monocistronic mRNAs. In these embodiments, an external transcription unit comprising a promoter, preferably a pol II promoter, directs the production of a polyietronic, poorer-strand copy of the viral genome from which, generally, only the first gene (NP ) is translated. Additionally, an internal transcription unit comprising a promoter, preferably a canine pol I promoter, directs the expression of an RNA copy of the genome to incorporate into new virue. Since the viral genome of parainfluenza III comprises negative-stranded RNA, the promoter of the internal transcription unit is preferably located downstream of the cDNA (bidirectional system). If the viral genome comprises positive strand RNA, the promoter of the internal transcription unit is preferably located upstream of the cDNA (unidirectional system). Modalities in which viruses comprising a positive-strand RNA genome are produced by bidirectional and modalidae in which the virus comprising a negative-strand RNA genome produced using the unidirectional system are within the scope of the invention. Additional viral proteins (in addition to the expressed protein of polycistronic mRNA) are required for viral tracification and replication (L and P), and these proteins are provided individually in separate expression plasmids. The invention may also include modalidadee where loe virue comprising double-stranded, segmented RNA genome are generated. In these embodiments, a plasmid comprising each gene in the target viral genome can be inserted into an expulsion plasmid of the dual promoter of the invention. The plasmid can be either a unidirectional plasmid or a bidirectional plasmid. A promoter in an external transcriptional unit, preferably a pol II promoter, directs the expression of a mRNA transcript of each gene which is translated into the encoded protein. A promoter in an internal transcription unit, preferably a canine pol I promoter, directs the transcription of either a positive strand (unidirectional seven) or a negative strand (bidirectional system). Subsequently, the first strand which is produced can act as a template for the production of the complementary strand by viral RNA polymerase. - The double-stranded RNA product is incorporated into a virus. new.

Specific Modalities 1. An isolated nucleic acid comprising a regulatory sequence of canine RNA polymerase I. 2.'. The nucleic acid of the modality I, where the regulatory sequence is a promoter. 3. The nucleic acid of mode 1, where the regulatory effect is an improver. ' - 4.' The nucleic acid of mode 1, wherein the regulatory sequence is both an enhancer and a promoter.-: 5. The nucleic acid of mode 1, wherein the regulatory sequence of RNA polymerase comprises nucleotides 1 to 1804 of SEQ ID NO. NO: a functionally active fragment thereof. 6. The nucleic acid of modality 1, 2, 3, 4, or , wherein the regulatory sequence is operably linked to the cDNA encoding a negative-strand viral genomic RNA or the corresponding cRNA. 7. The nucleic acid of mode 6, where the negative-strand viral genomic RNA is an influenza genomic RNA. 8. The nucleic acid of mode 6 or 7, wherein the nucleic acid further comprises a transcription termination sequence. 9. An expiry vector comprising the nucleic acid of modality 1, 2, 3, 4, 5, 6, 7, or 8. 10. The expiation vector of mode 9, wherein the expression vector comprises a bacterial origin of replication. 11. The expression vector of mode 9, wherein the expression vector comprises a selectable marker that can be selected in a prokaryotic cell. 12. The expulsion vector of mode 9, wherein the expiry vector comprises a selectable marker that can be selected in a eukaryotic cell. 13. The expression vector of mode 9, wherein the expression vector comprises a multiple cloning site. 14. The expression vector of mode 13, wherein the multiple cloning site is oriented with respect to the regulatory sequence of canine RNA polymerase I to allow the expression of a coding sequence introduced into the multiple cloning site of the regulatory sequence . 15. A method for producing an influenza genomic RNA, which comprises transcribing the nucleic acid of mode 7, whereby an influenza genomic RNA is produced. 16. A method for producing a recombinant influenza virus, comprising culturing a canine cell comprising the expression vector of mode 9, 10, 11, 12, 13 or 14 and one or more expreration vectors that express an mRNA that encodes one or more influenza polypeptides selected from the group consisting of PB2, PB1, PA, HA, NP, NA, MI, M2, NS1, and NS2; and isolate the recombinant influenza virus. 17. The method of mode 16, where a cooperating virus is used. 18. The method of mode 16, where the influenza virus produced is infectious. 19. The method of mode 16, 17 or 18, where the method results in the production of at least lx 103 PFU / ml influenza virus. 20. A cell comprising the nucleic acid of modality 1, 2, 3, 4, 5, 6, 7 or 8. 21. A cell- comprising the vector and expression of modality 9, 10, 11, 12, 13 or 14. 22. The cell of mode 20 or 21, where the cell is a canine cell. 23. The canine cell of mode 22, where the canine cell is a kidney cell. 24. The canine kidney cell of mode 23, wherein the canine kidney cell is a MDCK cell. 25. A method for generating in cultured canine cells a recombinant segmented negative strand RNA virus having more than 3 genomic RNA segments, the method comprising: (a) introducing into a population of canine cells a first set of expression vectors capable of expressing in the cells the genomic vRNA segments to provide the complete genomic RNAV eegment of the virue; (b) introducing into the cells a second set of expression vectors capable of expressing the mRNA encoding one or more polypeptides of the virus; and (c) culturing the cells whereby the viral particles are produced. 26. The method of mode 25, where viral particles of infectious influenza are produced. 27. The method of mode 25 or 26, where the cooperating virus is used. 28. A method to generate in cultured canine cells, viral particles of infectious influenza, the method comprises: (a) introducing into a population of canine cells a set of expresion vectors capable of expressing in i cells genomic vRNA segments to provide the complete genomic vRNA elements of the virus and (ii) mRNA encoding one or more polypeptides of the virus; (b) cultivate the cells so that the viral particles are produced. 29. A method for tranecting an influenza virus vRNA element, comprising contacting a canine polymerase polyperase polypeptide with a polynucleotide comprising a nucleic acid selected from the group consisting of: SEQ ID Nos 1-19, wherein the nucleic acid is operably linked to a cDNA molecule that encodes the vRNA segment of the negative strand virus; and isolate a transcribed vRNA segment. 30. The method of mode 29, wherein the vRNA is transcribed into a host cell. '31. The method of mode 16, 17, 18, 19, 25, 26, 27 or 28, wherein each expression vector is a separate plasmid. 32. A composition comprising a plurality of vectors, wherein the plurality of vectors comprises a vector comprising a canine pol I promoter operably linked to an influenza virus PA cDNA linked to a transcription termination sequence, a vector comprising a canine pol I promoter operably linked to an influenza virus PBl cDNA linked to a transcription termination sequence, a vector comprising a canine pol I promoter operably linked to a PB2 cDNA of the influenza virus bound to a transcription termination sequence, a vector comprising a canine pol I promoter operably linked to an influenza virus HA cDNA linked to a transcription termination sequence, a vector comprising a canine pol I promoter operably linked to an influenza virus NP cDNA linked to a transcription termination sequence, a vector comprising a canine pol L promoter operably linked to an influenza virus NA cDNA linked to a transcription termination sequence, a vector comprising a canine pol I promoter operably linked to an influenza virus M cDNA linked to a transcription termination sequence, and a vector comprising a canine pol I promoter operably linked to an influenza virus NS cDNA linked to a tracification termination sequence. 33. The composition of mode 32 which further comprises one or more expression vectors expressing an mRNA encoding one or more influenza polypeptides selected from the group consisting of: PB2, PBl, PA, HA, NP, NA, Mi, M2, NSl and NS2. 34. A host cell comprising the composition of modes 32 or 33. 35. A vaccine comprising a virus produced by the method of mode 16, 17, 18, 19, 25, 26, 27 or 28. 36. A vaccine comprising an immunogenic composition prepared from a virus produced from the method of the modality 16, 17, 18, 19, 25, 26, 27 or 28. 37. The composition of the mode 35 or 36, wherein each Expression vector is in a spaced plasmid.

Examples The following examples are only to illustrate the invention and are not intended to limit the invention in any way. • _ Example 1; Growth of Influenza Strains in MDCK Cells This example describes the characterization of several cell lines to culture influenza. Several different cell lines and primary cells were evaluated for the production of both genetic rearrangement and wild-type (sue eiglae in English, wt) derivatives of influenza strains adapted to the laboratory, for example, adapted to the cold (by its initials in English). , ca), type A and type B, including MRC-5, WI-38, FRhL-2, PerC6, 293, NIH 3T3, CEF, C? K, DF-1, Vero, and MDCK. Although many of the cell types support the replication of some influenza strains adapted to the cold to a limited extent, only MDCKs consistently produce titre altae of both type A and type B virue. For example, the PerC6 cells were found to support the replication of a certain B-type virus ca and wt at a similar level as this ee obeys in MDCK cells although the growth kinetics are different (see Figure 1). In contrast, PerCo was unable to withstand the replication of a type A virue number ca. Figure 2 shows the growth curve for virus A / Sydney / 05/97 and A / Beijing / 262/95 ca and wt. In both cases, the AC strain does not replicate well in PerC6 cells. Similarly, Figure 3 shows growth curves for A / Ann Arbor / 6/60 ca and wt showing that the ca strain does not replicate efficiently in PerC6 cells and] replicates in A / Ann Arbor / 6 / 60 wt is not as strong as in MDCK cells. Real-time PCR analysis of influenza virus replication in PerC6 cells shows that the viral RNA (vRNA) of both strains of influenza A, wt and ca viruses increases during the first 24 hours after infection, however, only the strains ts contained to increase outward to 120 hours, the strains ca no. In contrast, both the wt and ca RNAv increase and reach meeeta on day 3 in MDCK cells. See Figure 4. MDCK cells were also tested for their ability to support the replication of a potential pandemic vaccine, A / Vietnam / 1203/2004 ca. The MDCK cells were infected at a low multiplicity of infection with A / Vietnam / 1203/2004 ca and virus in the eobrenadante was quantified in varioe tiempoe poet-infection. For 48 hours post infection, the titers of A / Víetnam / 1203/2004 ca reached approximately 8 logio TCID50 / ml and remained stable for the next 3 to 4 days. See Figure 5. In the experiment, MDCK cells obtained from the ATCC (Accession No. CCL-34) were expanded to a limited number in time and in the medium containing 10% fetal bovine serum of Eetadoe United origin or in an appropriate serum free medium (for example SFMV 100). to produce mother of pre-stem cells for initial characterization studies. Appropriate serum free media are described in US Provisional Application No. 60 / 638,166, filed on December 23, 2004; Provisional Application No. 60 / 641,139, filed on January 5, 2005; and North American Application No. 11 / 304,589 filed on December 16, 2005, each of which is hereby incorporated by reference in its entirety. Cells were easily grown in both types of media and both cell motors evoke the replication of pandemic strain and vaccine strains adapted to the cold as shown in Table 1, below, and in Figure 5, respectively.

Table 1 Comparison of the productivity of cold-adapted influenzae strains in MDCK cell growth in serum and free of serum.

To investigate the responeable gene segments of the cell-restricted growth PerCd, the eight-plamid reagent technique was used to generate a 7: 1 rearrangement for each gene segment of the influenza strain A / AA / 6/60. See, for example, US Pat. No. 6,951,754 for a repreeentative decree of the eight plaemid influenza rescue system. Figure 6 shows a schematic diagram and the naming strategy for each reordered 7: 1. The resultant rearrangements were then tested for their capacity for replication in PerCd cells. See Figure 7. The growth restriction phenotype appears to form a map for the PB2 and PBl gene segments. The formation of fine detailed maps of the exact location responsible for this phenotype can be musing methods well known in the art. For example, the sequence comparison of strains ca and wt in the identified gene segments will allow the identification of specific differences which can be mutated again in either a wt or a ca strain. Such mutations are then analyzed by their ability to grow in PerC6 cells. Any mutation that either prevents the growth of a wt strain or allows the growth of a ca is identified as one that contributes to the growth of the restriction phenotype.

Example 2; Tumorigenicity of MDCK cell lines The potential tumorigenicity of the two stock solutions of pre-stem cells of MDCK cells, a growth in media containing serum and the other in serum free media, were evaluated in the nude mouse model in a stage that could represent 5 cells passed after they are expected to be used for the production of vaccines. To evaluate tumorigenicity, 107 cells were injected subcutaneously into groups of 10 mice and after 84 days the animals were euthanized and examined. - Neoplasms were observed in 10 of the animals inoculated with the cells passed in serum-free medium. In contrast, there was no evidence of neoplasia in any of the animals inoculated with cells passed in media supplemented with 10% fetal bovine serum; although some fibrosarcomas were observed at the site of inoculation, the paired cells in serum were not tumorigenic as shown in Table 2. Table 2 Tumorigenicity and Cell Cariology MDCK passed in two different media * TP5o: Number of cells required to induce tumors in 50% of animals ND: Not given As. In Table 2, the karyotype analysis was also carried out in the ee-tae doe mother of pre-mother cells in both the fourth and the twenty-fifth passage in respective media. The non-tumorigenic cells paeadae in 10% FCS had an average number of 78 metaphase chromosomes with relatively limited dielectricity of cells with other numbers of chromosomes. { 70 to 82). Although the cells in a serum-free medium also had an average number of 78 chromoeomae of metaphase, more cells were observed with a number of aneuploid chromosomes ranging from 52 to 82 metaphase chromosomes. In both cases, the cariology does not change followed by the paeaje.

Example 3: Adaptation of MDCK Cells to Grow in Serum-Free Media ATCC MDCK cells are paean in media containing gamma irradiated FBS. Eetae cells then passed a limited number of vecee in a free-form protein formulation chosen to support cell bank production. The serum free medium is described in the North American Provisional Applications Noe. 60 / 638,166 and 60 / 641,139, and US Patent Application 11 / 304,589. These are additional features that can be performed at either 37 ° C or 33 ° C. The paeaje of lae cells MDCK in three media containing supplemente derived from plantae máe that cells produced in serum with karyotypes eimilaree to that of cell and MDCK paeadas in media containing FCS (data not shown).

Example 41 Cloning of MDCK Cells The cells were cloned biologically by limiting the dilution to ensure that the production cells are derived from a single genetic constellation. The clones were selected for various phenotypic properties including bending time and relative tumorigenicity, as well as viral production. In an initial trial of concept experiment, fifty-four clones of MDCK were obtained in media containing FCS. These clones were passed and each was infected with a low multiplicity of infection of A / New Caledonia / 20/99 ca. Several days after infection, the supernatant was removed and the amount of virus in the supernatant was measured by TCID50. A minority of the clones produce relatively high titers of virus, greater than what occurred in the non-cloned parental cells. Clones with superior biological and physical properties are needed to establish a Stem Cell Bank (as in English) (MCB) as described below.

Example 5: Testing and Characterization of a Stem Cell Bank The MCB is extensively tested to ensure that there is no evidence of adenovirus agents. For example, one or more of several specific antibody tests and / or PCR for available viral agents were conducted, as shown in Table 3, below.

Table 3 Test regimen for the MCB General Tests PCR + / specific Ab Sterility Types AAV 1 &2 Mycoplasma HCMV In vitro adventitious agent EBV (multiple cell line) Adventitious agents in vivo HSV PERT Hepatitis B, C and E Co-cultivation HHV 6, 7 and 8 HIV 1 and 2 cariology HPV electron microscope intact HTLV I and II cells tumorigenicity (TP5p) cellular DNA oncogeneity Polioma (BK and JC virus) cellular lysato oncogenicity Circovirus Bovine Virus by 9CFR Canine Parvovirus Porcine Virus by 9CFR Canine Disease Adenovirue SV40 Example 6: Preclinical Characterization of Influenza Virus Derived from Cell Culture This example describes the characterization of influenza strains produced from cell culture as well as eggs and compares the virue produced from the eietemae. Generally, influenza viruses are capable of use as vaccines in humans, and have biological properties that make viruses suitable for such use. In this example, influenza viruses are adapted to cold (ca, have the ability to replicate efficiently at low temperatures), sensitive to temperature (ts, have restricted in vitro replication at high temperatures), and attenuated (att; not detectable in lung tissue of ferrets), and are referred to herein as catsatt strains. The comparison includes: biochemical, antigenic and genetic (sequential) evaluation of the viral product; biological and biochemical characterization of the virue followed by replication in humanae cells; replication in a permieive animal model; and immunogenicity in a permieivo animal model.

Genetic, biochemical and antigenic comparability Lae cepae ca ts att type A / HlNl, A / H5N1, A / H3N2 and B replicate at relatively high titers in MDCK cells. In addition, the passage of these strains ca ts att in MDCK cells does not alter their genomic sequence. Tree cepae ca te att, A / Sydney / 05/97 ca, A / Beijing / 262/95 ca, and B / Ann Arbor / 1/94 ca ee passed once or twice in MDCK cells and lae regions of complete coding of all 6 internal genes were sequenced and compared for the starting material. Non-nucleotide changes were observed, which demonstrate that this step is taken through this project does not change the genetic composition of these strains. Additional sequence characterizations were performed on different vaccine strains produced in MDCK cells under conditions that are expected to be equal to the production processes that include the composition of medium, input dose (moi), incubation temperature and collection time . Based on the preliminary data, it is hoped that there will be no change in the genomic sequence of viruses produced in MDCK. Because the genome was genetically stable and followed up in the MEDCK cell, the biological characteristics of the vaccine produced in egg cells or MDCK cells are expected to be indietinguishable. However, the primary viral product of the cell culture may have some differentiates compared to the product at egg level, particularly with respect to the modification of poet-translation of viral proteins including HA and NA, or composition of lipids in the cell culture. viral membrane; both of which could potentially change the complete physical properties of the virion. The preliminary preclinical data on the antigenicity of cell culture produced and vaccines produced in eggs demonstrate that no differences were detectable in this important parameter. The egg mother solutions of various vaccine strains were passed through the MDCK cell and the antigenicity of both products was determined by measuring HAI titer using reference antiserum. As shown in Table 4, all HAI titers were within 2 times of each other, indicating that the replication of the vaccine in cells does not change the antigenicity of the vaccine compared to the egg-derived material. Table 4 HAI titre of strains produced in eggs and MDCK cells Example 7; Infection of Human Epithelial Cells in Culture In a modality, to evaluate the biochemical, biological and strcturalee similitudee followed by replication of vaccines produced in eggs and MDCK in cells of human origin, vaccines can be passed once in human diploid cells relevant, such as normal human bronchial epithelial cells (NHBE). This passage will serve to equalize a single case of infection in the human respiratory tract and then the comparison of the progeny virus, the virus that is ultimately responeable to obtain an effective immune response, becomes feasible. The studies of the neuraminidase and haemagglutinin (linkage and fire) activities of the vaccines can be measured in this materiae as well as other biochemical and structural studies including electron microscopy, total infectious particle and infection ratios, and viral genome equivalents can be evaluated. . Overall, these comparisons will serve to demonstrate the comparability of the vaccine derived from cells with the vaccine produced in eggs effective and safe. A summary of analytical studies is described in Table 5. Table 5 Preclinical studies to compare vaccine produced in cells and eggs * Comparison of primary products and after a passage in humanae cells Example 8: Preclinical Animal Models The ferret is a large animal model used to evaluate the attenuation and immunogenicity of attenuated influenza vaccines and strains for component vaccines. The functioning of influenza strains derived from cells produced from the MCB is compared to the miemae strains produced in eggs. The head-to-head comparison of these materials in controlled studies capable of a high level of assurance of the comparability of this viralee product. To evaluate the ability of two vaccines to infect or achieve a "take" in the ferret, the animals are killed and inoculated intranasally with any of the viral preparations produced in cells or eggs. points of time followed by inoculation and the amount of virus evaluated by one of several methods available to evaluate the kinetics and extent of viral replication in the upper respiratory tract of animals.The experiments are performed with a range of doeie and include cepae multiple and different trivalent mixtures to generalize the relative infectivity of strains growing in cell culture to strains produced in egg.These same studies are also used to evaluate the immunogenicity of influenza strains, a property that is inherently linked to the capacity of the virus. To start the infection, the animals are eangradoe and the nasalee washes collect in varioe puntoe (eemanae) post inoculation; eetoe eepecimenee ee uean to assure the response to infection of nasal IgA and serum antibody. The culmination of these data, infectivity, response to mucosal antibody and serum antibody, will be used to compare and evaluate the relative infectivity of the vaccine produced by cells to the vaccine produced in eggs. The most similar result is predicted to be that strains of vaccines produced in eggs or cells have similar infectivity and immunogenicity. If the vaccine derived from cells seems to be more infective or more immunogenic than the product derived from eggs, additional studies can be made that evaluate the lower doebility. A number of immunogenicity and replication studies are performed in the ferret model to evaluate the vaccine derived from cell culture with a human doeie. single unit. Infection with cepae ca ts att generally produces strong antibody responses and rapid ferrets. In addition, the strains ca ts att individualee se | they routinely test and show to express the attenuated phenotype (att) replicating to relatively high titers in the nasopharynx but at a level not detectable in the lung of animal animals. The impact of cell culture growth on this biologic character is also assessed. NeverthelessIt is unlikely that any differences will be observed, since the att phenotype is an integral part of the genetic makeup of these strains. The kinetics of growth and cross-reactivity of eetae cepae are evaluated following the administration of a single human dose in eetoe animalee. This produces serum antibodies that cross-react with multiple strains within a genetic lineage; and a vaccine derived from cells is expected to have the same capacity. These comparability evaluations will provide significant penetration of biochemical differences and / or potent biophysics of the primary virus product and demonstrate the impact of this epigenetic difference in the functioning of the strains ca ts att measured first by first passing the virus in studies in animals or human cells . Based on the sequence information to date, there is no expected impact on the functioning of the strains ca ts att resulting from production in MDCK cells. Ferrets are a well-documented animal model for influenza and are routinely used to evaluate the attenuation and immunogenicity phenotype of ca ts att strains. In general, animals of 8-10 weeks of age are used to assess attenuation; typically study design evaluates n = 3-5 animalee per test or control group. Immunogenicity studies are evaluated in animals 8 weeks to 6 months old and generally require n = 3-5 animals per test item or control group. These numbers provide enough information to obtain statistically valid or observationally important comparisons between groups. For more studies signs similar to influenza may be noticed, but they probably are not. Ferrets do not exhibit signs of decreased appetite and weight, nasal or ocular discharge; observing signs of illness similar to influenza is a necessary part of the study and interactions such as analgesics are not authorized. Other malignancies, such as open ulcers or loss of peignifying effluent, may result in appropriate disposition of the next exposure of the animal to the attending veterinarian.

Example 9: Development of Mother Virus Seeds (MVS) Currently, the influenza vaccine strain is generated per bird cell co-infected with a wild type virus and either type A or MDV virus. type B and that the progeny are isolated and selected for the desired 6: 2 genetic constellation. This procedure requires several virus strains through bird cell cultures and / or SPF eggs. Recently, plasmid rescue has been introduced for the production of influenza viral preparation. In this process, Vero cells (African green monkey) from a bank of cells characterized and extemally tested are electroporated with, for example, 8 plasmid DNA, each containing a cDNA copy of one of the 8 eegmentoe of influenza RNA. . Several days after electroporation, the supernatant of these electroporated cells contains influenza virus. The eobrenants are then inoculated into APF eggs to amplify and biologically clone the vaccine strains. Both of these procedures re-form in a vaccine strain that is inoculated into SPF eggs to produce the MVS. Although the rescue of plasmids has several advantages that include more reliable synchronization, more genetically accurate gene segments and less potential contamination with individual MVS adventitious agents isolated from the wild type, generated by these two methods are indistinguishable from each other and can be used to Start production of vaccines at volume. Using the methods and composition of the invention, this method is adapted to carry out MDCK cells instead of Vero cells for the rescue of plasmids. The final amplifications of the vaccine strain are conducted in cells derived from MDCK cell banks. This final amplification can be achieved with small-scale cultures (<20 L) of MDCK cells. The supernatant of eetae membranae is collected, concentrated and characterized / tested to produce the MVS.

Example 10; Cloning of regulatory sequences of canine Pol I RNA This example describes the cloning of the canine 18S riboeomal AKN gene and the 5 'sequence of nucleic acid for this gene. First, the genomic DNA of the MDCK cells (Access No. CCL-34, ATCC) was isolated by using a kit Purification of DNA MasterPure (EPICENTRE Biotechnologies; Madieon, Wl). The alignment of the sequence indicates that the 18S rRNA gene is approximately 90% identical in dog, human, mouse, rat, and chicken. A pair of primers is indicated in the region conserved near the 5 'end of the 18S rRNA gene for PCR to amplify a 500 bp region of MDCK genomic DNA as a probe to detect the digestion fragment in the membrane which has complementary sequences through Southern hybridization. A single restriction fragment was identified in genomic DNA digested separately with BamH I (~ 2.2 kb) and EcoR I (-7.4 kb). Both fragments were cloned in the pGEM7 vector (Promega Corp, Madison, Wl) for -additional- analysis.

The plasmid containing the EcoR I fragment was submitted for deposit with the American Type Culture Collection on April 19, 2006, and was assigned Access A.T.C.C.

Do not. . The two clones obtained by restriction digestion analysis were aligned and the orientation of the two clones was confirmed by sequencing both ends of the two clones. A restriction map of the Eco Rl fragment is present as Figure 8. Next, the entire nucleic acid sequence of the fragment between the 5 'EcoR I site and the next BamH site in the 3' direction was determined and assembled in a nucleotide sequence containing about 3530 bases. This sequence is presented as Figures 9A-C (SEQ ID NO: 1). Next, the primer extension experiments were performed to identify the initial nucleotide of transcripts expressed from the regulatory elements of canine RNA pol I. In summary, the total RNA was isolated from MDCK cells. A labeled oligonucleotide primer was fortified for RNA and used to prime DNA synthesis towards the 5 'end of 18s rRNA. To identify the first nucleotide in the tranecrit, the same primer was used to sequence the rRNA using a standard dideoxynucleotide-based protocol. By comparing the length of the nucleic acid obtained in the extension of the primer to the varioe nucleic acid obtained in the sequencing reaction, the first bae of the 18s rRNA could be identified. The first tranecritic nucleotide (the +1 poem) is in the bale 1804 of the nucleotide sequence presented as Figures 9A-C. To confirm that the sequences upstream of this nucleotide contain regulatory elements to direct transcription of genes in the 5 'direction, a construct comprising an EGFP gene under the control of regulatory sequences was constructed using standard techniques. The EGFP gene in this construct is the EGFP gene described in Hoffmann et al. (2000) "Ambisense" approach for the generation of influenza A virus: vRNA and mRNA eyntheeie from one témplate Virology 15: 267 (2): 310-7). This construct was then transfected into MDCK cells using conventional techniques. After 24 hours followed the tranefection, the RNA was isolated from the transfected cells and emitted a Northern blot analysis with a labeled DNA encoding an EGFP gene. The detection of appropriately modified tranecritises confirms that the traenematoeans in the MDCK cells contain regulatory sequences that direct the transcription of the 3 'sequences to the regulatory elements.

Example 11; Identification of the Canine RNA Polymerase I Regulatory Elements This example describes the identification and characterization of a canine RNA polymerase I regulatory element, the canine RNA polymerase I promoter. Canine RNA pol L promoters and other regulatory regions are identified by inspecting sequentially 5 'to the initiation of 18s rRNA transcription for canonical promoter sequences. In addition, simple deletion experiments are performed to identify the sequences required for the initiation of efficient transcription. In a deletion experiment, a restriction site is introduced into or identified in a plasmid encoding the nucleotide sequence of Figures 9A-C by site-directed mutagenesis. To the restriction site about 50 nucleotides 3 'are introduced from nucleotide +1 identified above, nucleotide 1804 in the sequence is presented as Figures 9A-C. Another restriction site 5 'to the nucleotide sequence of Figures 9A-C relative to the +1 position is identified or introduced by mutagenesis directed to the eitium. The vectors containing these restriction sites are linearized by digethion with the appropriate restriction enzyme. Next, an appropriate nuclease (for example, Exonucleaea I, Exonuclease III, and similar) can be used to digest linear nucleic acids. By stopping the reaction at different time points, different sizes of deletions can be obtained in the 5 'regions at the start of transcription. Next, the linear plasmids are recirculated and transformed into appropriate host cells, then screened to identify plasmids containing the desired deletions. Alternatively, the appropriate oligonucleotides can be synthesized and they often contain flanking a deletion to be introduced. Such oligonucleotides are then used to make derivatives containing off-circuit deletions using standard techniques. Oligonucleotides can also be used to make site-directed replacements using standard techniques. The ability of different deletion or substitution mutants to initiate transcription is determined by transfecting the plasmids into MDCK cells and detecting RNA transcribed from the plasmids by Northern Blot as described above. By comparing the plasmid sequences that allow tracification with those that do not allow tracification, the sequence of the canine RNA polymerase I promoter is identified. Conventional techniques are then used to clone a nucleic acid encoding this sequence.

Alternatively, the canine RNA pol L promoter can be mapped from the nucleic acid provided as SEQ ID NO: 1 by other methods known in the art, for example, using a minigenome method. See, for example, the North American application 20050266026 published for an influenza minigenome reporter designated pFlu-CAT, which contains the negative sense CAT gene cloned under the control of the pol I. promoter. Also, see, minigenome? GFP in Hoffmann et al. (2000) "Ambisense" approach for the generation of influenza A virus: vRNA and mRNA syntheeie from one témplate Virology 15: 267 (2): 310-7); and the CAT minigeome system pPOLI-CAT-RT in Pleschka et al. (1996) J. Virol. 70 (6): 4188-4192. To use these systems to identify and characterize the sequences required for efficient transcriptional initiation, the different deletion / deletion mutants described above or other subeequences of SEQ ID NO: 1 are introduced into the selected reporter plasmid (eg, PFlu-CAT, EGFP minigenome) such that the transcription of a negative copy of the reporter gene depends on the initiation of tranecription by the deletion or substitution mutant. The EGFP-containing construct described above can be conveniently used to make such deletion or substitution mutants. ThenRNA-dependent polymerase RNA synthesizes positive-strand RNA from negative-strand RNA transcribed from the reporter plasmid. This positive-strand mRNA is then translated by the cellular machinery so that the activity of the reporter protein (either EGFP or CAT) can be detected. In the assays, a set of expression plasmids containing the cDNAs of PBl, PB2, PA and NP or PBl, PA, NP (-PB2 as a negative control) is transfected into MDCK cells together with a plasmid comprising a minigene of EGFP of influenza A virus or reporter pFlu-CAT under the control of a putative canine Pol I regulatory sequence. The cells are cultured, then under the conditions that allow the transcription and translation of the reporter sequence. The activity of the reporter protein is detected using conventional techniques. In the case of EGFP, the transfected cells are observed under a phase contrast microscope or fluorescent micro-scope at 48 hours post-tranefection. Alternatively, it uses flow cytometry to detect the expiration? GFP. In eneayoe with a minigenome comprising the CAT gene, pFlu-CAT is used to measure the activity of polymerase. In one assay, CAT expression is measured by detecting the CAT protein directly (e.g., by ELISA), detecting CAT that encodes mRNA. { for example, by Northern blot), or by detecting CAT activity (for example, detecting the traneference of radiolabeled acetyl groups to an appropriate euettra) as an indicator of reporter activity. For example, DNA fragments of the MDCK clone which have exhibited promoter activity (see above tranecification assays and primer extension) were cloned in the 5 'direction of an insert which contains 5' and 3 'untranslated regions fused to the 5 'and 3' ends, respectively, of a negative sense EGFP gene followed by a murine Pol I terminator (See, Figure 11). Three separate constructs were made which differ in the sequences of MDCK inserted: sequences of MDCK 1-1802 (-1), 1-1803 (+1) and 1-1804 (+2) of SEQ ID NO: l. Each of these constructs are combined separately with expulsion plasmids for influenza replication proteins (PB1, PB2, PA and NP) and are electroporated into MDCK cells. At 24 hours from the electroporation, the cells were examined by fluorescent microscopy. As shown in Figure 12, all three fragments of MDCK, -1, +1 and +2 (upper left, middle and right, respectively) result in fluorescence of EGFP while the construct lacking promoter activity exhibits only fluorescence background (bottom left). The 1-1803 (+) fragment results in the highest level of fluorescence. A plasmid with a CMV promoter that drives the expression? GFP is used as a positive control (lower right). Influenza replication proteins will only replicate true influenza viral vRNA ends. The EGFP signal from each of the plasmids containing a sequence of MDCK pol I indicates that the fragment of canine regulatory sequence contains promoter activity which produces an RNA with influenza virus termini corrected and capable of replicating influenza replication. Other useful assays for identifying and characterizing the canine RNA pol L sequences include RNA fingerprint experiments. In such procedures, the RNA molecules comprising, for example, the sequence presented in Figures 9A-C, are contacted to one or more subunits of canine RNA polymerase I. One or more canine RNA polide subunit ee binds to appropriate RNA sequences according to their particular affinities. Next, an RNAse, e.g., RNAse I, is used to degrade unprotected RNA by one or more subunit of canine RNA polymerase. The RNAse are then inactivated and the protected RNA fragments are protected from the protection of one or more subunits of RNA polymerase I. The isolated fragments contain sequences linked by one or more subunits of RNA polymerase I and are excellent candidates for sequencing that have promoter / enhancer activity. furtherThis footprint impression experiment can be performed on the preemption of different canine RNA polymerase I subunits to identify which subunit is linked to which RNA sequence. These experiments can help to determine the activity of different binding sequences, for example, by comparing the sequences of the eubunidade of polymerase Pol I canine different from eubunidadee of RNA polymerase I of other species with known sequences and binding specificities. Also, in vitro techniques can be used to observe the tranecritization of putative canine pol l regulatory sequences. In this technique, the different deletion / substitution mutants described above or other subeequences of SEQ ID NO: 1 are operably linked to a specific tranexe. The set of canine RNA polymerase I protein required for tracification is then added to the tranexes. Effective transcription is detected by detecting the RNA transcript made by canine RNA polymerase I proteins, for example, by Northern blotting. Similar assays can be used to identify other regulatory elements of canine RNA pol I, for example, enhancer, repreeor, or other elements that affect transcription by RNA pol I. Generally, in such assays, the levels of expression of constructoe reporter comprising Deletions, substitutions, or subsequences of SEQ ID NO: 1 are compared to expression levels of a minimum RNA pol L promoter identified as described above. By comparing the levels of expression, the presence of an element associated with improved or decreased transcription can be identified.

Example 12: Rescue of Influenza in MDCK Cells This example describes the use of canine RNA pol L-regulatory elements cloned in Example 10 to rescue influenza virus in MDCK cell culture. Expression vectors encoding the viral genomic RNAs under the control of the canine RNA pol L promoter and / or other nucleic acids of the invention present upstream of the 18 rRNA gene are constructed using conventional molecular biology techniques. Talee constructs are used to rescue the influenza virus in MDCK cells. Additional guidance can be found in protocols for using expulsion plasmids to express influenza proteins and genomic RNA to obtain viral RNA associated with proteins that produce infectious viral particles when introduced into appropriate cells, for example, in US Patent Nos. 5,578,473, 5,576,199 , 5,820,871, 5,854,037, International Patent Publication No. WO00 / 60050, and US Patent Publications Nos. 2002/0164770 and 2004/01422003, each of which are hereby incorporated by reference in their entirety. Although the foregoing invention has been described in some detail for the purposes of clarity and comprehension, it will be clear to a person skilled in the art from a reading of this ecription that various changes in form and detail can be made without departing from the true scope of the invention. the invention. For example, all the techniques and apparatuses described above can be used in various combinations. All publications, patents, patent applications, or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other document was individually indicated. to be incorporated as a reference for all purposes. In addition, the US Provisional Patent Applications Nos .: U.S. 60 / 793,522, filed April 19, 2006; U.S. 60 / 793,525, filed April 19, 2006; U.S. 60 / 702,006, filed July 22, 2005; U.S. 60 / 699,556, filed July 15, 2005; U.S. 60 / 699,555, filed July 15, 2005; U.S. 60 / 692,965 filed on June 21, 2005; and U.S. 60 / 692,978 filed on June 21, 2005, are incorporated as a reference in their entirety for all propóeitoe. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (20)

CLAIMS Having described the invention as above, the contents of the following claims are claimed as property:

1. Isolated nucleic acid characterized in that it comprises a regulatory sequence of canine RNA polymerase I.

2. Nucleic acid according to claim 1, characterized in that the regulatory sequence is a promoter-.

3. Nucleic acid according to claim 1, characterized in that the regulatory sequence of RNA polymerase I comprises nucleotides 1 to 1803 of SEQ ID NO: 1 or a functionally active fragment thereof.

4. Nucleic acid according to claim 1, 2 or 3, characterized in that the regulatory sequence is operably linked to cDNA encoding a negative-strand viral genomic RNA or the corresponding cRNA.

5. Nucleic acid according to claim 4, characterized in that the nucleic acid further comprises a tracification termination sequence.

6. Nucleic acid according to claim 5, characterized in that the negative-strand viral genomic RNA is an influenza genomic RNA.

7. Expression vector characterized in that it comprises the nucleic acid according to claim 6.

8. Method for producing an influenza genomic RNA, characterized in that it comprises tranectaring the nucleic acid according to claim 6, so that an RNA is produced genomic influenza.

9. A method for producing a recombinant influenza virus, characterized in that it comprises culturing a canine cell comprising the expression vector of claim 7 and one or more expression vectors expressing an mRNA encoding one or more influenza polypeptides selected from the group that consiete of: PB2, PBl, PA, HA, NP, NA, Mi, M2, NSl, and NS2; and strain the virue of recombinant influenza.

10. Method according to claim 9, characterized in that the virus produced is infectious.

11. Method according to claim 9, characterized in that the method results in the production of at least 103 PFU / ml of influenza virus.

12. Cell characterized in that it comprises the expiry vector according to claim 7.

13. Cell according to claim 12, characterized in that the cell is a canine cell.

14. Cell according to claim 13, characterized in that the canine cell is a kidney cell.

15. Canine kidney cell according to claim 14, characterized in that the canine kidney cell is a MDCK cell.

16. Method for generating recombinant segmented negative strand RNA virus in cultured canine cells having more than 3 genomic vRNA segments, characterized in that it comprises: (a) introducing into a population of canine cells a first set of capable expression vectors expressing genomic vRNA segments in the cells to provide the complete genomic vRNA segments of the virus; (b) introducing into the cells a second set of expression vectors capable of expressing mRNA encoding one or more virue polypeptides; and (c) culturing the cells so that the viral particles are produced. Method according to claim 16, characterized in that the viral particles of influenza infectious are produced. 18. A method for generating infectious influenza virus particles in cultured canine cells, characterized in that it comprises: (a) introducing into a population of canine cells a set of expresion vectors capable of expressing in the cells i) genomic vRNA segments to provide the complete genomic vRNA segments of the virus and (ii) mRNA encoding one or more virue polypeptides; (b) cultivate lae cells so the viral cells are produced. 19. Virus characterized in that it is produced by the method according to claim 16. 20. Method according to claim 16, 17 or 18, characterized in that a cooperator virus is used.