MX2007009174A - METHOD OF QUANTITATIVELY ANALYSING MICROORGANISM TARGETING rRNA. - Google Patents

Abstract

It is intended to provide a method of quantifying/detecting a microorganism whereby a microorganism in a viable state can be highly sensitively and more adequately detected. Namely, a method of quantifying a target microorganism by using the amount of an rRNA of the target microorganism in a test sample as an indication.

Description

METHOD OF QUANTITATIVE ANALYSIS OF MICROORGANISM USING ARNr AS A PURPOSE TECHNICAL FIELD OF THE INVENTION The present invention relates to a method for quantifying or detecting a microorganism, particularly in a living state, using rRNA as a target.

TECHNICAL BACKGROUND As a method for quantifying a microorganism, a method involving culturing a microorganism in a previously estimated selection medium and measuring the number of microbial cells and a method involving culturing a microorganism in a liquid selection medium has conventionally been used in main form. and measuring the optical density or absorbance. The following methods have also been used for the identification operation for a microorganism in the detection of a microorganism in a specimen: for example, a method involving the identification thereof through morphological observation, Gram stain, and microbiological characteristics such as oxygen requirement, sugar assimilation properties and growth condition in a medium; a method that involves the determination of it by a test of DNA-DNA homology; and a detection method using a monoclonal antibody to a microbial surface antigen. However, these methods require time and skill and therefore have presented a problem from the point of view of speed and simplicity. In recent years, gene amplification methods including a PCR method have been used in a wide range of fields as techniques for detecting traces of nucleic acids. These methods have advantages capable of leading to acceleration and simplification, including the absence of the non-mandatory requirement to cultivate a microorganism contained in a specimen and the ability to directly handle a specimen as a sample. Therefore, the methods have been subjected to application research to the quantification and detection of a microorganism. As an example where the PCR method has been applied to the analysis of a microorganism, a method for quantifying a bacterium by a PCR method using the total DNA as an objective sequence and universal primers is known (patent document 1). Methods that use 16S rDNA as an objective have also been achieved. Known examples thereof include a method for quantitative analysis by a PCR method using 16S rDNA as an objective sequence (patent document 2), a method for analysis of an intestinal bacterium by a PCR method using 16S rDNA. as an objective sequence (patent document 3), and a method for the detection of a strain bacterial of the genus Lactobacillus, a bacterium that causes turbidity of beer (patent document 4). However, these methods have had a problem that they can not be used as alternatives to a conventional method that has been conventionally used because the detection sensitivity is not achieved to the extent obtained with the culture method. By way of example, the embodiment of the method for quantitative analysis as described in patent document 2, requires a large amount of template DNA corresponding to a microbial count of 105 / μl or more, which makes the method impractical. The low detection sensitivity is probably due to the low copy number (template amount) of the total DNA or 16S rDNA that is provided as a template for the PCR in the microorganism. Since it is known that DNA remains even after the drying of a microorganism, these methods only quantify and detect dead and living microorganisms together, which has also contributed to a problem that is difficult to quantify and accurately detect a microorganism in a state live (document that is not patent 1 ). As examples of application of a PCR method to the analysis of a microorganism, attempts have also been made to perform methods using mRNA as an objective sequence; Known examples thereof include quantitative analysis of a lactic acid bacterium in feces, using mRNA as an objective sequence (document which is not patent 2). Methods for detecting cancer cells are also known using target mRNAs for cancer cells in specimens as target sequences (patent documents 5 and 6). However, even these methods have not provided detection sensitivity to the extent that they can replace the conventional method as quantification methods. Specifically, the detection limit of the quantitative analysis as shown in patent document 2 is only 1035 or more cells / g of feces; The method of analysis could not be used as an alternative to the conventional culture method in view of detection sensitivity. In addition, these methods target mRNAs of genes unique to microorganisms, and have been unsuitable for detection in a specimen to be tested that contains a wide variety of microorganisms due to problems such as complicated primer design and reduced specificity. . Accordingly, the development of a method that provides detection sensitivity to the same degree as conventional detection methods has been expected while it is a rapid method using a PCR method or the like and which can also accurately quantify and detect a microorganism in a living state. To improve sensitivity, it is possible to change the design of an objective so that the objective can be present more stable or more abundantly in the cells. However, said stable target is probably unfavorable for the purpose of detecting only a live microorganism, considering that it is suspected that it remains very long. also in dead cells of the same. Therefore, it is not easy to simultaneously achieve the detection of only living cells and the detection sensitivity sufficiently high It has also been known that rRNA accounts for approximately 85% of RNA in a cell and has a number of multicopies and that rRNA is stable compared to mRNA because it forms a complex with protein. It is also reported that the rRNA is detected in the order of 48 hours after the microbial death (document that is not patent 3) and therefore it has been commonly believed that it is inadequate for the detection of a microorganism in a living state (document which is not patent 1) Patent Document 1: Japanese patent application open to the public No 2002-238585. Patent document 2: Japanese patent application open to the public No. 2003-259879. Patent document 3: Japanese patent application open to the public No. 2001 -112485. Patent document 4: Japanese patent application open to the public No. 10-210980. Patent document 5: Japanese patent application open to the public No. 10-248600. Patent document 6: international publication WO 00/17395, pamphlet.

Document that is not patent 1: J Food Prot, vol. 67, No.4: 823-832 (2004). Document that is not patent 2: FEMS Microbiology Letters, vol. 231: 125-130 (2004). Document that is not patent 3: Appl. Environ. Microbiol., Vol. 64, No. 1 1: 4264-4268 (1998). An object of the present invention is to provide a method for quantitatively analyzing a microorganism, which can achieve detection sensitivity to the extent of being able to replace a conventional culture method and more accurate detection of the microorganism in a living state.

BRIEF DESCRIPTION OF THE INVENTION As a result of intensive studies, the present inventors have found that rRNA (ie, 5S, 16S, and 23S in bacteria, and 5S, 18S, 26S or 28S in eukaryotic cells), which has been found to be unsuitable for detecting a microorganism alive in terms of stability, can be used unexpectedly as an objective to quantify and accurately detect the number of microbial cells in a living state without the incorporation of dead cells thereof and in addition to using a PCR method in the quantification and Detection can achieve detection sensitivity to the extent of being able to replace a conventional method, and therefore the present invention has been achieved.

Therefore, the present invention provides a method for quantifying a microorganism of interest, using as an index the amount of rRNA of the microorganism in a specimen to be tested. The present invention also provides a method for detecting a microorganism of interest, using as an index the presence of rRNA of the microorganism in a specimen to be tested. The present invention also provides a fragment of nucleic acid used in the above method, wherein the fragment is a fragment of nucleic acid containing a base sequence described in one of SEQ ID NOS: 2, 3 and 5 A 28 or a sequence of base complementary thereto, or a fragment of nucleic acid containing a base sequence homologous thereto and functionality equivalent thereto. The present invention also provides equipment to perform the above method. The detection method using rRNA in accordance with the present invention can be used to achieve high detection sensitivity compared to that using a conventional objective due to the abundant presence of target while also detecting and quantifying more precisely a target. microorganism in a living state. A PCR method can also be used in detection to achieve detection sensitivity to the extent of being able to replace a conventional culture method. In addition, the method that uses a PCR method can achieve marked speed and simplicity compared to methods conventional methods such as a culture method In other words, the method of the present invention can be used to simultaneously achieve high detection sensitivity, quantification and / or more accurate detection of a living organism, and speed and simplicity. Therefore, the method of the present invention can be used in practical situations where it is required to detect and / or quantify a microorganism, such as intestinal flora analysis and detection and / or quantification of a microorganism living in a specimen derived from a food or an organism BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A-1 C are a set of graphs showing a correlation between the growth of several microorganisms and the amount of rRNA transcription, Figures 2A and 2B are a set of graphs showing a standard curve obtained by an RT method. Quantitative -PCR and the comparison of the detection interval between the method and a quantitative PCR method, figure 3 is a graph showing the detection interval of P aeruginosa from human feces, figure 4 is a graph showing the comparison of quantitative values for human fecal enterobactenaceae when determined by a quantitative RT-PCR method and by a culture method, Figures 5A-5C are a set of graphs showing the detection sensitivity of E coli, S aureus, and B cereus of cow's milk, Figures 6A and 6B are a set of graphs showing the detection sensitivity of P aeruginosa and S. aureus of the blood; and Figure 7 is a graph showing the sensitivity of E coli detection of a fermented milk product DETAILED DESCRIPTION OF THE PREFERRED MODALITY The method for quantifying or detecting an isolate microorganism according to the present invention is characterized by using as an index the abundance or presence of rRNA of the microorganism in a specimen to be tested. The rRNA of an isolate microorganism refers to a RRNA that may have a microorganism to be quantified and detected Examples of rRNA include rRNA of prokaryotic 5S, 16S and 23S and rRNA of eukaryotic 5S, 8S, 18S, 26S and 28S, rRNAs of 16S, 23S, 18S and 26S are particularly preferable since they are mainly used as reliable indices for current microbial classification. The microorganism of interest refers to a microorganism that has to be quantified and detected and is not particularly limited. Examples thereof include microorganisms of the Enterobactenaceae family and the genera Enterococcus, Lactobacillus, Streptococcus, Staphylococcus, Veillonella, Pseudomonas, Clostridium, Bacteroides, Bifidobacterium, Eubacterium, Prevotella, Ruminococcus, Fusobacterim, Propionibacterium, peptostreptococcus; Vibrio, Bacillus, Campylobacter, Acinetobacter, Lactococcus, Pediococcus, Weissella, Leuconostoc, Oenococcus, Helicobacter, Neisseria, Listeria, Haemophillus, Mycobacterium, Gardnerella, Legionella, Aeromonas, Moraxella and Candida, and microorganisms as described in tables 2 and 3 They have to be mentioned. The microorganism of interest according to the present invention is a concept that includes not only a microorganism of a strain but also a group, a genus and a family that are each composed of a population of 2 or more strains that share certain properties. The specimen to be tested refers to an object that is to be examined for the presence, abundance or the like of a microorganism. Examples of the specimen to be tested include specimens of biological origin such as conjunctival sample with swab, dental calculus, dental plaque, expectorated sputum, swab throat scraping, saliva, nasal drainage, bronchioalveolar lavage, pleural effusion, gastric juice, wash gastric, urine, cervical mucus, vaginal discharge, skin lesion, stool, blood, ascites fluid, tissue, spinal fluid, synovial fluid and lavage injury; and objects that potentially contain microorganisms, such as food, medicine, cosmetics, intermediate processed food products, medicines and cosmetics, microbial broth, plants, soil, activated sludge and drainage water. The sample of a specimen that has to be tested refers to a sample taken or prepared from a specimen to be tested, and is not particularly limited so long as it is a sample capable of reflecting the presence or abundance of a microorganism in the specimen. Examples thereof include a mixture containing nucleotides and a mixture containing RNA contained in the specimen to be tested; A mixture containing RNA contained in a specimen that is to be tested in view of using a PCR method is preferred. The sample of a specimen to be tested can be obtained appropriately, for example, from a complete specimen or part thereof that is to be tested by a known method, if necessary, after pre-treatment using methods of extraction, separation and purification. By way of example, the mixture containing RNA can be obtained, for example, by extraction using a universal method such as "an ultracentrifugal method of guanidine-cesium chloride", "a method of guanidine-phenol chloroform acid (AGPC)" , "a magnetic sphere method", and "a silica column method", if necessary after pre-treatment using a known method such as filtration, centrifugation and chromatography; a commercial team (eg, QIAGEN RNeasy Kit, TRIZOL) can also be used for the same. The sample of a specimen to be tested used is preferably RNA in a stabilized state in a microorganism in view of preventing the decomposition thereof to maintain high sensitivity of the microorganism. detection. The stabilization can be carried out using, for example, a commercial stabilization agent (e.g., RNAprotect Bacterial Reagent, RNAIater). Stabilization is preferably performed immediately after the specimen is collected in order to avoid a change in the amount of RNA in the microorganism. The quantification of a microorganism of interest according to the present invention uses as an index the amount of rRNA of the microorganism in a specimen to be tested. Here, the amount of rRNA of a microorganism of interest in a specimen to be tested can be determined, for example, by (1) obtaining the amount of the product amplified by a PCR method using nucleic acid fragments capable of specifically hybridizing to the RRNA of the microorganism of interest and a sample of the specimen, (2) obtaining the hybridization efficiency between the nucleic acid fragments capable of specifically hybridizing to the rRNA of the same microorganism of interest and a sample of the specimen, or (3) using a quantitative method using another known method. Here, in the case (1) of using a PCR method, "nucleic acid fragments capable of specifically hybridizing to the rRNA of a microorganism of interest" can be designed by comparing the base sequence of the microorganism with the base sequence of others microorganisms to select sequences specific to the rRNA that the microorganism of interest may have. Here, the rRNA sequence that the microorganism can have can be obtained, for example, by verifying against a database (DDBJ, GenBank, etc.). Also, the base sequence can be aligned using software (eg, Clustal X) to find specific sequences by a visual method or any other methods. The sequences specific to a microorganism of interest are preferably selected considering the amplitude of a range in which the microorganism ^) to be quantified is included. Specifically, for example, if a strain is to be specifically quantified, the sequences specific to the strain are preferably selected; if a genus is to be specifically quantified, the genre-specific sequences are preferably selected. The selection can be made appropriately using a known method. In addition to the sequences so designed, nucleic acid fragments capable of hybridizing to the rRNA of the microorganism of interest may each be appropriately postulated if it is based on known technical common knowledge; a base sequence complementary to the aforesaid base sequence, a base sequence homologous thereto similarly used to quantify a microorganism of interest and the like may also be used. Examples of the homologous base sequence include a nucleic acid fragment containing (a) the aforementioned base sequence which additionally contains substitution, addition or deletion of one or more bases, preferably 1 to 10, (b) a base sequence having a sequence identity of 90% or more, preferably 95% or more, most preferably 99% or more with the sequence of bases mentioned above, or (c) a sequence of bases capable of hybridizing under stringent conditions to a DNA having a base sequence complementary to the aforementioned base sequence. The nucleic acid fragment may also be part of the nucleic acid fragment to which preferably 100 bases, most preferably 20 bases, most preferably even 10 bases or less are added to both or one end, preferably the 5 'end thereof. The length of the nucleic acid fragment is not particularly limited; however, the fragment preferably comprises 5 to 50, most preferably 12 to 35 bases. The nucleic acid fragment thus designed can be artificially synthesized, for example, in a DNA synthesizer in accordance with the base sequence thereof. The fragment is preferably that whose specificity has been verified. Here, the specificity can be verified, for example, by confirming that the use of rRNA of interest as a template provides a product amplified by specific PCR when compared to an appropriate control. Examples of the nucleic acid fragment include nucleic acid fragments containing the base sequences described in SEQ ID NOS: 1 to 30 or base sequences complementary thereto, or nucleic acid fragments containing base sequences homologous thereto and functionality equivalent to them. Here, examples of nucleic acid fragments containing homologous base sequences the same and functionality equivalent thereto include nucleic acid fragments as shown in (a) to (c) below, which can be used for the quantification and detection of rRNA from an isolate microorganism (a) An acid fragment nucleic containing the base sequence represented by one of SEQ ID NOS. 1 to 30 or a base sequence complementary thereto, wherein the fragment contains deletion, substitution or addition of one or several bases. (b) A nucleic acid fragment having a sequence identity of 90% or more, preferably 95% or more, most preferably 99% or more with the base sequence represented by one of SEQ ID NOS. 1 to 30 or a sequence of bases complementary to it. (c) A fragment of nucleic acid containing a sequence of bases capable of hybridizing under stringent conditions to DNA containing the base sequence represented by one of SEQ ID NOS: 1 to 30 or a base sequence complementary thereto., the identity of base sequences is calculated using the GENETYX (R) homology search program. "Stringent conditions" include, for example, holding conditions, for hybridization, at 42 ° C for 16 to 24 hours in a solution containing 50% formamide, 5 x SSC, 5 x Denhardt's solution and 250 mg / ml of Salmon sperm DNA The nucleic acid fragment usable for quantification and rRNA detection of a microorganism of interest can be obtained, for example, using a PCR method to select a nucleic acid fragment that provides an amplification product when the rRNA of the microorganism is used as a template while not providing the product for another purpose, e.g., rRNA from a different microorganism or MRNA, it is used as a template. Then, (1) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 1 or 2 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous to the same and functionally equivalent thereto can be used to quantitate and specifically detect Bacillus cereus; (2) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 3 or 4 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantitate and specifically detect Clostridium perfringens; (3) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 5 or 6 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantitate and specifically detect Enterobacteriaceae; (4) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 7 or 8 or a base sequence complementary thereto, or a fragment of nucleic acid containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect the genus Staphylococcus; (5) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 9 or 10 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect the genus Pseudomonas; (6) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 1 1 or 12 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect the genus Enterococcus; (7) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 13 or 14 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect the Lactobacillus acidophilus subgroup; (8) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 15 or 16 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence, homologous thereto and functionally equivalent to them can be used to quantify and specifically detect the Lactobacillus subgroup ruminis; (9) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 17 or 18 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect the Lactobacillus plantarum subgroup; (10) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 19 or 20 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent to them can be used to quantify and specifically detect the Lactobacillus reuteri subgroup; (11) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 21 or 22 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect the Lactobacillus sakei subgroup; (12) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 23 or 24 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect the Lactobacillus casei subgroup; (13) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 25 or 26 or a base sequence complementary thereto, or a nucleic acid fragment containing a sequence of bases homologous thereto and functionally equivalent thereto can be used to quantitate and specifically detect Lactobacillus brevis; (14) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 27 or 28 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto and functionally equivalent thereto can be used to quantify and specifically detect Lactobacillus fructivorans; and (15) a nucleic acid fragment containing the base sequence described in SEQ ID NO: 29 or 30 or a base sequence complementary thereto, or a nucleic acid fragment containing a base sequence homologous thereto. and functionally equivalent thereto can be used to quantitate and specifically detect Lactobacillus fermentum. Here, the nucleic acid fragment containing the base sequence in SEQ ID NO: 1 is a fragment of nucleic acid known as described in FEMS Microbiology Letters, vol. 202: 209-213 (2001). The nucleic acid fragment containing the base sequence in SEQ ID NO: 4 is a fragment of nucleic acid known as described in Microbiol. Immunol., Vol. 46, No. 5; 353-358 (2002). The nucleic acid fragment containing the base sequence in SEQ ID NO: 29, or 30 is a fragment of nucleic acid known as described in Japanese Patent Laid-Open No. 1 -151097. On the contrary, fragments of nucleic acid containing the base sequences described in SEQ ID NOS: 2, 3 and 5 to 28 are fragments of nucleic acid found by the inventors herein. The PCR method using the nucleic acid fragments thus prepared and a sample of a specimen to be tested can be performed by "PCR in a reaction system containing the sample, using the nucleic acid fragments as primers and the RRNA of a microorganism of interest as a template ". The PCR method is not particularly limited as long as the reaction specifically amplifies a nucleotide fragment derived from rRNA of a microorganism of interest. A method including the step of using rRNA of the microorganism of interest as a template for preparing cDNA using an enzyme, preferably a reverse transcriptase or the like is preferred. Very preferred is a method that includes, in addition to the previous step, the step of using the cDNA thus prepared as a template to amplify the nucleotide fragment. The PCR method can be carried out using, for example, a known RT-PCR. Here, RT-PCR can be performed using a known method such as a two-step RT-PCR and a one-step RT-PCR; however, the one-step RTPCR is preferably one that is particularly simple and avoids cross-contamination. The one-step RT-PCR method can be carried out using, for example, commercial equipment (e.g., QIAGEN One-Step RT-PCR kit). The enzyme that has a transcription activity that can be used in the RT reaction may be any of several reverse transcriptases such as M-MHV reverse transcriptase. The DNA polymerase used in the PCR that amplifies DNA preferably has a resistance to heat at a temperature of 90 ° C or more. PCR can be conducted by performing one to several cycles of a thermal denaturation reaction to convert double-stranded DNA to single-stranded DNA, a quenching reaction to hybridize primers to template cDNA and an extension reaction to allow DNA Polymerase acts, under temperature conditions of 90 to 98 ° C, 37 to 72 ° C and 50 to 75 ° C, respectively. A preferable example of reaction conditions is thermal denaturation at 95 ° C for 30 seconds, annealing at 60 ° C for 30 seconds, and extension at 72 ° C for 60 seconds. For PCR, two types of initiators are preferably used as a set. Here, the two initiators need to be made to form a combination of an anterior chain and a posterior chain. The nucleic acid fragments provided by the present invention are each fixed to have an approximately constant annealing temperature in the RT-PCR, which allows nucleic acid fragments of a plurality of microorganisms to be tested simultaneously. The nucleic acid fragment of the present invention can also be used as a probe, and can also be used in combination with a different known universal primer, oligonucleotide or the like.

The sample of a specimen to be tested containing rRNA that provides a template for RT-PCR preferably has a total RNA content of 1 pg to 1 pg, most preferably 10 pg to 0.1 pg- When PCR is conducted properly , there is a correlation typically between "the amount of product amplified by PCR", "the number of PCR cycles", and "the amount of template for PCR". Therefore, the amount of rRNA of a microorganism of interest can be determined if the calculation is performed appropriately considering the amount of the amplified product formed by the PCR thus conducted and the number of PCR cycles. As shown in Figures 1A-1C of the example to be described, it has been shown that there is also a good correlation between "the amount of rRNA of the microorganism of interest" thus determined and "the number of cells of the microorganism of interest". " The number of cells of the microorganism of interest can therefore be determined if the calculation is performed considering "the amount of rRNA of the microorganism of interest" thus determined. Without going through a procedure of calculating "the amount of rRNA of the microorganism of interest", the number of cells of the microorganism of interest can be determined even by appropriate calculation considering "the amount of the amplified product formed by the PCR" and "the number of the PCR cycles "obtained as described above. The amount of product amplified by PCR and the number of PCR nuclei can be learned by any method without particular limitation, for example, by identifying the number of PCR cycles when the DNA reaches a certain arbitrarily chosen amount. Identification can be performed, for example, using "a PCR method that includes labeling a PCR product in combination with a PCR method that includes measuring the marker over time" to identify the number of PCR cycles when a certain intensity of chosen fluorescence is reached. Here, the certain fluorescence intensity is preferably chosen "within the range that the intensity can reach when the amplification product is logarithmically increased In terms of an appropriate correlation therebetween." The range can be appropriately understood using a known method. examples of the labeling include labeling with a fluorescent dye, examples of the measurement of the label include the measurement of the fluorescence intensity, examples of the labeling with the fluorescent dye include labeling with an intercalating fluorescent dye Examples of the intercalating fluorescent dye include SYBR (R) Green I. The intercalating dye has a property in which the fluorescence intensity is increased by intercalating it in a double-stranded nucleic acid, thus resulting in the emission of a fluorescence having an intensity which reflects the quantity of a product of amplified PCR. Labeling with a fluorescent dye can also be done by using a TagMan, Molecular Beacon or similar probe labeled with the fluorescent dye. The TagMan probe or Molecular Beacon is a probe in which a fluorescent dye and an extinguisher bind to an oligonucleotide homologous to an internal sequence of a region amplified by PCR, and is used allowing it to coexist in a PCR system. The interaction of a fluorescent dye and quencher attached to the probe allows the emission of fluorescence in response to a PCR amplification reaction, thus allowing an amplified PCR product to be observed over time by measuring the fluorescence intensity at each PCR step. However, the TagMan probe, Molecular Beacon, or similar, makes it necessary to collect a specific complementary sequence of microbes suitable for the probe, which can be difficult depending on an object. The amount of rRNA can be determined by considering "the amount of product amplified by PCR and the number of PCR cycles" so learned and the result of a suitable comparative experiment Specifically, the amount of rRNA of the isolate microorganism can be calculated using a known method, for example, considering "the results of the comparative experiment performed using a rRNA whose amount is known" to appropriately contrast therewith "the amount of the product amplified by PCR and the number of PCR cycles "learned as described above. Then, the number of cells of an organism of interest can be determined by considering" the amount of rRNA of the microorganism "thus calculated and the results of a comparative experiment. specific, the number of cells of the microorganism of interest can be calculated using a known method, for example, considering "the results of the comparative experiment performed using a sample of a specimen to be tested in which the number of cells of the corresponding microorganism it is known "to properly contrast with it" the amount of rRNA of the microorganism of interest "thus calculated. On the contrary, in view of simplicity, a standard curve is preferably used that shows a correlation between "the number of cells of the microorganism of interest" used as a template for PCR and "the number of PCR cycles" when a certain amount of Product amplified by PCR is reached (hereinafter sometimes referred to as Ct value). The standard curve is typically prepared by plotting the Ct value against the number of cells of a target microorganism (see Figures 2A and 2B). The microorganism used to prepare the standard curve may be a known strain such as the type strain thereof. Without going through the procedure of specifically calculating the amount of rRNA, the number of cells of the microorganism of interest can also be directly calculated by appropriate contrast of the results of a comparative experiment using a specimen sample to be tested, in the which the number of cells of the corresponding microorganism is known "with" the amount of product amplified by PCR and the number of PCR cycles "learned as described above. Specifically, the CT value derived from the sample of the specimen to be tested can be applied to the standard curve described above. As described above, the amount of rRNA of a microorganism of interest in a specimen to be tested can also be determined, for example, by (2) learning the hybridization efficiency between a nucleic acid fragment capable of specifically hybridizing to the rRNA of the microorganism of interest and a sample of the specimen to be tested. Here, the nucleic acid fragment capable of specifically hybridizing to the rRNA of the microorganism of interest, which can be used is, for example, one designed and prepared as described above. The nucleic acid fragment is preferably a fragment of labeled nucleic acid. Here, examples of the label include an enzyme, a paramagnetic ion, biotin, a fluorescent dye, a chromophore, a heavy metal, and a radioisotope; very preferred examples of the marker include an enzyme. Here, examples of the enzyme include horseradish peroxidase and alkaline phosphatase. The marking can be carried out by a known method. The amount of rRNA of a microorganism of interest in a specimen to be tested and / or the number of cells of the microorganism can be learned using a known conversion method that measures the degree of hybridization between a specimen sample that is to be tested and the nucleic acid fragment. The method of measuring the degree of hybridization is not particularly limited and can be carried performed in accordance with a known method; for example, it can be done by measuring the added marker to the nucleic acid fragment. Specifically, for example, the method can be carried out by measuring the fluorescence intensity when the nucleic acid fragment labeled with a fluorescent dye is used. The measurement is preferably performed in parallel with the measurement using a suitable control. Here, examples of suitable control include "a sample that is known not to specifically hybridize to the nucleic acid fragment used," "a sample derived from a specimen to be tested where the specimen contains a known number of cells from a specimen. microorganism of interest ", and" a sample taken or prepared from a specimen to be tested where the specimen contains a known amount of rRNA of a microorganism of interest ". When checking against control, the amount of RNA or the number of cells of the microorganism of interest can be learned using a known conversion method. The number of cells of the microorganism of interest can also be learned using a known method considering the amount of rRNA of the microorganism of interest thus calculated and the results of a suitable comparative experiment. The method of detecting a microorganism of interest according to the present invention uses as an index the presence of rRNA of the microorganism in a sample of a specimen to be tested. Here, the term "detection of a microorganism" includes identifying the microorganism. The term also includes determining the presence of a microorganism to be detected in a specimen or the absence of a microorganism to be detected in a specimen. To determine the presence of rRNA of a microorganism of interest in a specimen to be tested using the detection method of the present invention, the detection described, for example, in (1), (2) or (3) following. (1) Detecting a PCR-amplified product using a nucleic acid fragment capable of specifically hybridizing to the rRNA of the microorganism of interest and a sample of the specimen to be tested. (2) Detect hybridization between the nucleic acid fragment and the sample. (3) Detect the rRNA of the microorganism using a different known method. The methods (1) to (3) can be easily performed considering the methods described above. The presence of rRNA of the microorganism of interest indicates that the microorganism has been present in the specimen to be tested, which allows detection of the microorganism. However, detection is preferably carried out by comparison with a suitable control because non-specific amplification of the PCR product and non-specific hybridization can occur. As shown in the examples described below, has shown that high detection sensitivity can be achieved by the quantitative method using the amount of rRNA as an index and a detection method that uses the presence of rRNA of an index compared to that of conventional methods that use the amount of rDNA as an index. As shown in the examples to be described, it has also been shown that the method using the amount of rRNA as an index can quantify and accurately detect a microorganism in a living state without quantifying and detecting dead cells together with it. thus, the use of the quantification or detection method of the present invention (hereinafter, also referred to as "the method of the present invention") allows a microorganism to be specifically quantified and detected at a higher detection sensitivity than for conventional methods and even in a living state thereof Accordingly, the method of the present invention can be used, for example, in applications described in (1) to (4) below. (1) An application in which a microorganism of interest contained in a specimen to be tested is quantified and detected in a live state at a higher detection sensitivity than for conventional methods. (2) An application in which the number of dead cells of a microorganism contained in a specimen to be tested is quantified and detected at a higher detection sensitivity than for conventional methods. (3) An application in which the ratio of the numbers of dead and living cells of a microorganism is measured at higher detection sensitivity than for conventional methods. (4) An application in which the presence or abundance of a live microorganism is "determined" at higher detection sensitivity than for conventional methods. Here, the determination includes, for example, (a) quantification and detection to ascertain the presence or abundance of a live microorganism when the number of cells of the living microorganism needs to be ascertained more accurately and accurately and (b) when "the number of cells of a living microorganism "has been calculated in another experimental system, the determination to examine the accuracy of the experiment and the accuracy of the calculated numerical values. In this regard, when the number of dead cells is quantified, the measurement of the total number of dead cells and living cells is preferably performed together with it, for example, by a known method for detecting dead cells together with living cells. The number of dead cells can be determined by subtracting the number of living cells calculated by the method of the present invention from the total number. The method of the present invention can also be used as a method to quantify or detect a microorganism difficult to measure by conventional methods, such as a microorganism incapable of forming colonies and a microorganism incapable of growing in liquid culture.

As shown in the examples described below, it has been shown that the use of a PCR method in the quantification and detection method can achieve detection sensitivity to the same extent as the culture method. Therefore, the method of the present invention invention can also be used as a method of quantifying or detecting a microorganism at detection sensitivity to the same degree or more than the culture method, that is, at a detection sensitivity of 10 cells or more / g of specimen or ° cells or more / ml of specimen A microorganism can also be quantified or detected very quickly and simply when using the PCR method, compared to the culture method In addition, in accordance with the method using the PCR method, the procedure of extracting RNA from a specimen for quantification or detection of the microorganism can be completed within about 6 hours. Therefore, the method of the present invention can also be used as a method capable of detecting a microorganism in a short period (within 6 hours). The use of the method using a PCR method according to the present invention can achieve simultaneously high detection sensitivity, quantification and more accurate detection of a live microorganism and speed and simplicity. Therefore, the method of the present invention can be used, for example, in the application of "the examination of contaminating and dangerous bacteria, pathogenic microorganisms, or the like" in a medical site and food industry where quantification or detection Fast and sensitive is particularly required. The method of the present invention can also be carried out using equipment to perform the method. Here, examples of the equipment for performing the method include a kit containing (1) nucleic acid fragments capable of specifically hybridizing to rRNA of a microorganism of interest, (2) a protocol in which a method of implementation is described, and / or (3) a reagent used for RNA extraction, RNA stabilization, and / or a PCR. However, the equipment of the present invention is not limited thereto, and refers to a collection of all or part of the requirements to perform all or part of the steps of the method. Here, "requirements to perform the steps" can be properly understood when considering the description set forth in this specification.

EXAMPLES The content of the present invention is described below in further detail by way of examples. However, it is not intended that the invention be limited thereto.

EXAMPLE 1 Preparation of initiators For several bacterial strains, sequences were obtained 5 rRNA DNA from 16S and 23S from the DNA data bank of Japan (http: // www. Ddbj.nig.ac.jp/Welcome-j.html). These sequences were aligned using the Clustal W program, followed by the preparation of a phylogenetic tree. The strains were classified by family, gender and subgroup on a phylogenetic tree basis; Initiators were designated for each classification. The sequences IO of the primers prepared and the rRNA species of interest are shown in Table 1. References in which the sequences are described are shown in the column for "references" in Table 1. If the column is blank, this indicates that the sequence is a novel sequence found by the present invention. In this regard, the document that does not 15 is patent 4 represents Microbiol. Immunol., Vol. 46, No.5: 353-358 (2002); document that is not patent 5, FEMS Microbiology Letters, vol. 202, 209-213 (2001); and patent document 7, Japanese patent application open to the public No. 1 1 -151097.

TABLE 1-1 it is not patent 5 1 Bacillus cereus 16S S-18 285 2 Bc2R rRNA CCAGCTTATTCAACTAGCACTT 3 Clostpdium perfpngens s-CIper-F GGGGGTTTCAACACCTCC 4 16S CIPER-R rRNA GCAAGGGATGTCAAGTGT 170 Document that is not patent 4 5 Enterobactepaceae 23S En-1 428 6 TGCCGTAACTTCGGGAGAAGGCA its 3F rRNA-1 In its 3 'R 7 16S TCAAGGACCAGTGTTCAGTGTC g-Staph-F TTTGGGCTSACACACGTGCTACAATGGACAA 79 4-- Staphylococcus rRNA g-Staph 8-R AACAACTTTATGGGATTTGCWTGA 9 PSD7F 16S rRNA CAAAACTACTGAGCTAGAGTACG 10 215 Pseudomonas PSD7R TAAGATCTCAAGGATCCCAACGGCT 1 January 16S g-Encoc-F ATCAGAGGGGGATAACACTT 336 12 Enterococcus rRNA g-Encoc-R ACTCTCATCCTTGTTCTTCTC 13 Subgroup Lactobacillus 16S sg-Laci-F GATGCATAGCCGAGTTGAGAGACTGAT 197 acidophilus 14 rRNA sg-Laci-R TAAAGGCCAGTTACTACCTCTATCC Subgroup of Lactobacillus sg-Lrum-F CACCGAATGCTTGCAYTCA 182 rummis 15 16S 16 rRNA sq-Lrum-R GCCGCGGGTCCATCCAAAA 17 Lactobacillus subgroup 16S sg-Lpla-F CTCTGGTATTGATTGGTGCTTGCAT 54 plantarum 18 sg-Lpla-R rRNA GTTCGCCACTCACTCAAATGTAAA 19 Lactobacillus subgroup 16S sg-Lreu-F GAACGCAYTGGCCCAA 290 reutep 20 sg-Lreu-R rRNA TCCATTGTGGCCGATCAGT TABLE 1-2 SEQ Objectives Sequence Names References Sizes ID starters NOS products amplification (Pb) 21 Subgroup Lactobacillus sakei 16S rRNA sg-Lsak-F CATAAAACCTAMCACCGCATGG 303 22 sg-Lsak-R TCAGTTACTATCAGATACRTTCTTCTC 23 Subgroup Lactobacillus casei 16S rRNA sg-Lcas-F ACCGCATGGTTCTTGGC 296 24 sg-Lcas-R CCGACAACAGTTACTCTGCC 25 brevis 16S rRNA s Lactobacillus-lbre ATTTTGTTTGAAAGGTGGCTTCGG-F 289 26-s-lbre Lactobacillus fructivorans R ACCCTTGAACAGTTACTCTCAAAGG 16S rRNA 27 s-Lfru TGCGCCTAATGATAGTTGA-F 452 28-s-Lfru GATACCGTCGCGACGTGAG R 29 Lactobacillus fermentum narrowly defined LFER-1 CCTGATTGATTTTGGTCGCCAAC 414 patent Document 7 30 16S Lfer-2 rRNA ACGTATGAACAGTTACTCTCATACGT Patent Document 7 EXAMPLE 2 Determination of initiator specificity To determine whether or not the initiators of Example 1 actually have specificity, several bacteria were examined for specificity. Specifically, 50 μl of each of several bacterial cultures, as shown in Table 2 (57 species in 28 genera) and Table 3 (60 species in 18 genera), were added in a 2-fold volume of Bacterial RNAprotect Reagent (QIAGEN) and incubated at room temperature for 5 minutes. The suspension was then centrifuged at 5,000 g for 10 minutes and subjected to the removal of the supernatant. To this was added 450 μl of bacteriolytic pH regulator (346.5 μl of pH regulator RLT (QIAGEN), 3.5 μl of β-mercaptoethanol, 100 μl of pH regulator TE) and 300 mg of glass spheres (0.1 mm of pH). diameter), which was then vigorously shown by FastPrep FP120 (Bio 101) at 5,000 rpm for one minute to crush the bacterial cells. To the ground solution, 500 μl of phenol saturated with water was added, which was then incubated at 60 ° C for 10 minutes. To this was added 100 μl of chloroform / isoamyl alcohol (CIA), which was mixed and then subjected to centrifugation at 12,000 rpm for 5 minutes at 4 ° C. To the recovered supernatant was added an equal volume of phenol saturated with water / chloroform, which was then mixed and again centrifuged under the same conditions. An equal volume of CIA was added to the recovered supernatant, which was then stirred and again subjected to centrifugation under the same conditions. To 400 μl of the recovered supernatant was added an equal volume of isopropyl alcohol and a 1/10 volume of 3M sodium acetate, which was mixed by inversion and then subjected to centrifugation at 15,000 rpm for 10 minutes at 4 ° C. The result was subjected to the removal of the supernatant, to which 500 μl of 75% ethanol was added before mixing by inversion, followed by subjecting the mixture to a centrifugation at 15,000 rpm for 2 minutes at 4 ° C. After removing the supernatant and air-drying the inside of the tube, the precipitate was dissolved in 50 μl of RNase-free water to make an extract of total RNA. Quantitative RT-PCR was performed using QIAGEN One-Step RT-PCR Kit (QIAGEN). The composition of the reaction solution (total volume: 25 μl) was: 2 μl of the total RNA solution (equivalent to 2x105 CFU); and pH regulator 1 x QIAGEN One-Step RT-PCR, mixture of 0.5 mM dNTP, a 1/25 volume of QIAGEN One-Step RT-PCR enzyme mix, a volume of 1 / 10,000 times of SYBR (R ) Green I (from Molecular Probes) and 0.75 μM (each) primers (described in Table 1) that were adjusted so that the respective amounts formed final concentrations. The RNA equivalent to 2x105 CFU was used as a template in RT-PCR. The reaction solution was first subjected to a reverse transcription reaction at 50 ° C for 30 minutes, and then heated at 95 ° C for 15 minutes to activate the reverse transcriptase. Subsequently, 40 to 45 cycles of 94 ° C for 20 seconds, 55 ° C or 60 ° C for 20 seconds and 72 ° C for 50 seconds seconds were performed by measuring the amount of an amplification product as a fluorescence intensity of SYBR (R) Green I for each cycle. These series of reactions were performed using the ABI PRISM (R) 7900HT system (Applied Biosystems). As a result, as shown in Table 2, it was shown that only one genus or strain of bacteria of interest can be specifically detected by En-lsu 3F / 3'R (Enterobacteriaceae) .g-Staph-F / R primer (the genus Staphylococcus), PSD7F / R (the genus Pseudomonas), s-CIper-F / CIPER-R (Clostridium perfringens), SS-Bc-200-a-S-18 / BC2R (Bacillus cereus) or g-Encoc F / R (the genus Enterococcus). In addition, as shown in Table 3, it was shown that only one group or strain of interest can be specifically detected by the sg-Laci-F / R primer (Lactobacills acidophilus subgroup), sg-Lsak-F / R (Lactobacillus subgroup) sakei), sg-Lcas-F / R (Lactobacillus casei subgroup), sg-Lrum-F / R ((subgroup Lactobacillus ruminis), sg-Lreu-F / R ((subgroup Lactobacillus reuteri), sg-Lpla-F / R (Lactobacillus plantarum subgroup), s-Lbre-F / R (Lactobacillus brevis), s-Lfru-F / R (Lactobacillus fructivorans) or LFer-l / 2 (Lactobacillus fermentum) In Tables 2 and 3, + indicates that the specific detection can be achieved (Ct value: 1 to 30); - indicates that the C? value was 31 or more or that no amplification product was obtained.

TABLE 2-1 Objective Reactions with the following primers En-Lsu 3F / 3'R g-Encoc-F / R g-Staph-F / R s-CIper-SS-Bc-200-a-PSD7F / RF / CIPER-R S-18 / BC2R Escherichia coli + Citrobacter freundü + Citrobacter koseri + Citrobacter amalonaticus + Enterobacter cloacae + Enterobacter aerogenes + Enterobacter sakazakii + Enterobacter + cancerogenus Enterobacter amnigenus + Klebsiella pneumoniae + Klebsiella oxytoca + Serratia marcescens + Proteus mirabilis + Proteus vulgaris + Proteus penneri + Hafnia alvei + Edwardsiella tarda + Providencia alcalifaciens + Providencia rettgeríi + Morganella morganii + Salmonella choleraesuis + Yersinia enterocolitica + - - - - - Pseudomonas -. . . . + Pseudomonas aeruginosa -. . . + fluorescens Pseudomonas putida -. . . . + Acinatebacter -. . . . calcoaceticus Bacteroides ovatus - - - Bacteroides vulgatus -. . . . Prevotella -. . . . melaninogenic TABLE 2-2 Reactions with the following primers Objective En-Lsu 3F / 3'R g-Encoc-F / R g-Staph-F / R s-CIper-SS-Bc-200-a-PSD7F / RF / CIPER-R S-18 / BC2R Collinsela aerofaciens Eggerthella slow Bifidobacterium catenulatum Bifidobacterium longum Ruminococcus productus Ruminococcus obeum Clostridium orbisciendens Clostridium perfringens Streptococcus intermedius Streptococcus bovis Staphylococcus aureus - - + Staphylococcus - - + epidermidis Staphylococcus - - + haemolyticus Staphylococcus - - + lugdunensis Staphylococcus - - + saprophyticus Staphylococcus schleiferi - - + ss. coagulans Bacillus cereus + Bacillus subtilis Enterococcus faecalis + Enterococcus faecium + Enterococcus hyrae + Enterococcus gallinarum + Enterococcus flavescens Enterococcus durans + Lactobacillus acidophilus Lactobacillus casei Campylobacter jejuni Candida albícans 4- r TABLE 3-1 Reactions with the following initiators Objective sg-Laci-sg-Lsak-sg-Lcas-sg-Lrum-sg-Lreu- sg-Lpla-s-Lbre-s-Lfru-s-Lfer- F / RF / RF / RF / Lactobacillus acidophilus + Lactobacillus gasseri + Lactobacillus crispatus + Lactobacillus jensenni + Lactobacillus helveticus + johnsonii Lactobacillus johnsonii + Lactobacillus delburueckii + ss. delburueckii Lactobacillus delburueckii + ss. lactis 4-- Lactobacillus delburueckii ss. bulgaris Lactobacillus amylovorus + -Lactobacillus gallinarum + -Lactobacillus intestinalis + -Lactobacillus hamsteri - + Lactobacillus sakei - + Lactobacillus curvatus - + Lactobacillus vitulinus - + Lactobacillus graminis - -1-Lactobacillus casei -1- Lactobacillus rhamnosus + Lactobacillus zeae + Lactobacillus ruminis + Lactobacillus mupnus + Lactobacillus salivapus ss + sahvapus Lactobacillus salivapus ss sahcinius Lactobacillus animalis -t- ~ -Lactobacillus mali + - -Lactobacillus reutep - + -Lactobacillus vaginalis - + -Lactobacillus ons - + -Lactobacillus pañis - + -Lactobacillus plantarum - - + -1 ^ Lactobacillus pentosus - - + -C-. Lactobacillus brevis + Lactobacillus frustivorans 4-Lactobacillus fermentum + TABLE 3-2 Reactions with the following initiators Objective sg-Laci-sg-Lsak-sg-Lcas-sg-Lrum-sg-Lreu- sg-Lpla-s-Lbre-s-Lfru-s-Lfer- F / RF / RF / RF / RF / RF / RF / RF / R 1/2 Escherichia coli. . . -. - -. - Pseudomonas aeruginosa. . . . . Pseudomonas fluorescens - - - Pseudomonas putida - - - Acinatebacter. . . . . . . . -calcoaceticus Bacteroides ovatus -. -. . . . . . Bacteroides vulgatus. . . . . . . . . Melaninogenic pre-bottle . . . . . . . . 4-.

Collinsella aerofaciens - - - -. . . . or.

Eggerthella lento - - - Bifidobacterium. . . . . . . . . Bifidobacterium longum catenulatum. . . . . . . . . Ruminococcus productus. . . . . Ruminococcus obeum - - - Clostridium orbiscindens. . . . . . . . . Clostridium perfringens. . . . . . . . . Streptococcus intermedius. . . -. . . . . Streptococcus bovis. . . -. . . . . Staphylococcus aureus. . . . . . . . . Bacillus cereus. . . . . . . . .

Bacillus subtilis Enterococcus faecalis Lactococcus lactis lactis Campylobacter jejuni Candida albicans EXAMPLE 3 Examination of a relationship between the growth status of various microorganisms and the amount of rRNA transcription Using Escherichia coli, S. aureus and P. aeruginosa cells from different culture phases, we examined a relationship between the number of live bacterial cells measured using a culture method and the number of bacterial cells that have the ability to form colonies, derived from the amount of rRNA transcription measured by a quantitative RT-PCR method. Specifically, after the start of aerobic culture of each bacterium with agitation at 37 ° C in BHI medium, bacterial cultures were harvested over time, followed by the use of cultures to measure the number of bacterial cells by a method culture medium using BHI agar medium (37 ° C, 24 hours). On the other hand, RNA was extracted from samples collected in a similar manner and subjected to quantitative RT-PCR analysis. The number of bacterial cells in each sample was calculated on a basis of the standard curve prepared in the manner described in example 4, using RNA extracted from the bacterial strain in the late logarithmic growth phase, the number of cells of which was known. In this regard, total RNA extraction and quantitative RT-PCR were performed as described in Example 2. The results are shown in Figures 1A-1C. In Figures 1A-1C, the black circle ( •) indicates the number of bacterial cells calculated from the amount of rRNA transcription, and the white circle (o), the number of bacterial cells determined by the culture method. For all the bacterial strains subjected to analysis, from the logarithmic growth phase to the death phase, a strong relationship was observed between the various curves of the number of live bacterial cells determined by the culture method in the bacterial solution and the number of bacterial cells calculated from the amount of rRNA transcription. This demonstrated that the number of cells of a living microorganism can be determined under any condition by measuring the amount of rRNA transcription.

EXAMPLE 4 Preparation of standard curves and comparison with a quantitative PCR method Standard curves were prepared by the method of the present invention (quantitative RT-PCR method) using cultured cells, in the late logarithmic growth phase, of P aeruginosa YIT6108T (type strain) and S. aureus YIT6075T (type strain) The curves standards were also prepared by a quantitative PCR method to be compared with those prepared by the method of the present invention. Axenic cells from each strain grown in BHI medium were separated to provide cell numbers of 105, 104, 103, 102, 101 and 10 °, and subjected to RNA extractions as described in Example 2 The extracts were each subjected to quantitative RT-PCR according to example 2 using primers as described in Table 1. A correlation was examined between the resulting CT value and the number of cells determined by the culture method described in Example 3. Using a method described below, the DNAs obtained from the samples were also examined each one for the quantification thereof by a PCR method using rDNA as an objective sequence. Specifically, 1 ml of PBS was added to each of the separate bacterial solutions to provide the cell numbers of 105, 104, 103, 102, 101 and 10 °, which was stirred and then centrifuged at 15,000 rpm for 5 hours. minutes at 4 ° C, followed by removal of the supernatant. An operation was repeated twice in which 1 ml of PBS was added to the precipitate, which was then stirred and centrifuged before removing the supernatant. To the resulting pellet was added 300 μl of bacteriolytic pH buffer (100 mM Tris-HC1, 40 mM EDTA, 1% SDS, pH: 9.0), 500 μl of phenol saturated with TE, and 300 mg of glass spheres (0.1 mm in diameter), which was then vigorously shaken in FastPrep FP120 at 5,000 rpm for 30 seconds to crush the bacterial cells. The trituration solution was centrifuged under conditions of 15,000 rpm, 4 ° C and 5 minutes, followed by recovery of the supernatant. Phenol was added (saturated / TE) / chloroform / isoamyl alcohol to the supernatant, which was vigorously stirred in FastPrep FP120 at 4,000 rpm for 45 seconds and then subjected to a centrifugation operation under conditions of 15,000 rpm, 4 ° C and 5 minutes. Alcohol precipitation was performed using the separated and recovered supernatant, followed by dissolution of the precipitate in 50 μl of pH regulator TE to make a DNA solution. Subsequently, a PCR was conducted using the resulting DNA solution as a template. PCR was performed in 25 μl total of a reaction solution containing 2 μl of the DNA solution and 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 2.5 mM MgCl2, 0.45% Triton X-100, 200 μM of dNTP mixture, a volume of 1 / 10,000 times of SYBR (R) Green I, 1 1 ng / μl of TaqStart (R) antibody (from ClonTech), 0.5 U / μl of Taq DNA polymerase (from Takara) and 0.25 μM (each) of primers (PSD7F / R or g-Staph-F / R) as final concentrations. The reaction solution was heated at 94 ° C for 5 minutes, then subjected to 40 cycles of 94 ° C for 20 seconds, 60 ° C for 20 seconds and 72 ° C for 50 seconds, and subsequently reacted at 72 ° C. C for 10 minutes. The amount of the amplification product was measured for each cycle as a fluorescence intensity of SYBR (R) Green I. These series of reactions were carried out using ABI PRISM (R) 7900HT. In this regard, 1/25 the amount of extraction of each RNA and DNA was subjected to the reaction. As a result, as shown in Figures 2A and 2B, both methods showed an extremely good correlation between the logarithmic number of bacterial cells and the Ct value. In Figures 2A and 2B, the CT value is plotted against the number of cells / extract as measured by the culture method for each bacterial strain that serves as a sample. The black circle (•) indicates the case of quantitative RT-PCR, and the white circle (o), the case of quantitative PCR. In the approximate curve obtained through of the quantitative RT-PCR method, the correlation coefficient (R2 value) was 0.9995 for P. aeruginosa and 0.9961 for S. aureus. This showed that the standard curves allow the calculation of the number of bacterial cells from Ct values. In addition, the quantitative RT-PCR method was able to detect 10 bacterial cells in the samples, indicating that the method had a sensitive detection comparable with the conventionally used culture method. This demonstrated that the method can be used for the quantification or detection of a microorganism as an alternative to the culture method. The method of the present invention had a sensitivity of about 1, 000 times that of the PCR method using rDNA as an objective sequence, which shows that it had a marked detection sensitivity compared to a previously studied means to quantify a microorganism using a method of gene amplification.

EXAMPLE 5 Quantitative detection of bacteria in stool Various concentrations of P. aeruginosa were each added to human feces to compare the detection range of a quantitative PCR method with that of a method of the present invention. Fecal samples added to P. aeruginosa were prepared in each of which P. aeruginosa cells equivalent to 101, 102, 103, 04, 105, 106, 107, or 108 cells per 20 mg of human feces were added. The total RNA extracted from each one of the fecal samples added to P aerugmosa and used as a template to perform the quantitative RT-PCR of the present invention. DNA was also extracted from each of the same samples and used as a template to perform the quantitative PCR. In addition, the same samples were subjected to the measurement of the number of bacterial cells using a culture method. The total RNA extraction and the quantitative RT-PCR method were carried out as described in example 2, the culture method, as in example 3, and DNA extraction and quantitative PCR method, as in example 4. In this regard, 1 / 2,500 total RNA and total DNA quantities obtained were subjected to quantitative RT-PCR and PCR quantitative, respectively As a result, as shown in Figure 3, the method of the present invention showed linearity in an approximate curve obtained from measurements in the range of 102 9 to 1010 cells / g of stool in fecal samples added to P aeruginosa Figure 3, the Ct value is plotted against the number of cells / g of feces measured by the culture method for P aerugmosa that serves as a sample The black circle (ß) indicates the case of RT-PCR, quantitative and the white circle (o), the case of quantitative PCR In human feces, the quantitative limit of the method of the present invention was 102.9 cells or more / g of feces, and was almost comparable with that of the method of culture, it was 102 cells or more / g of feces. The culture method took a day, while the method of the present invention was completed from the stabilization of RNA of the specimen.

Quantification of approximately 6 hours. On the other hand, in the analysis by the quantitative PCR method, linearity was observed in an approximate curve obtained from measurements in the range of 105.8 to 1010 cells / g of feces, and the limit of detection was approximately 1. , 000 times lower than that of the quantitative RT-PCR method.

EXAMPLE 6 Analysis of human fecal enterobacteria by quantitative RT-PCT and a culture method Human fecal flora was analyzed by a quantitative RT-PCR using Enterobacteria specific primers En-lsu 3F / 3'R. Freshly excreted feces were collected from 38 adults and diluted by 1/10 under anaerobic conditions with a transport medium (10% glycerin, 5% cistern, 1% lemco lab powder, 0.045% NaCl, 0.0225% KH2P04, 0.0225 % K2HP04, 0.0225% (NH4) 2S0, 0.00225% CaCl2, 0.00225% MgSO4). An aliquot of 200 μl (20 mg as feces) was taken from the diluent and subjected to total RNA extraction using a quantitative RT-PCR method. The quantitative RTPCR was carried out using 1 / 2,500 the amount of the total RNA as a template. An aliquot of the same diluent was also subjected to quantification of CFU by a culture method (DHL selection medium). RNA stabilization, total RNA extraction, and quantitative RT-PCR were in accordance with Example 2, and the culture method was compliance with a conventional method. Total RNA extracted from E. coli YIT 6044t (type strain) was used to prepare a standard curve for calculating the number of bacterial cells by quantitative RT-PCR. As a result, as shown in Figure 4, it was demonstrated that the quantitative RT-PCR method which targets rRNA in accordance with the present invention and the culture method showed an extremely strong correlation (correlation coefficient: 0.9255). In Figure 4, the axis of the ordinates represents the quantification results by the culture method, and the abscissa axis represents the quantification results by the method of the present invention. For the culture method, it took 2 days to achieve all the operations, while for the method of the present invention, all the operations were carried out in approximately 6 hours.

EXAMPLE 7 Examination of microorganisms in cow's milk Various concentrations of E. coli, S. aureus, and B. cereus were each added to commercial cow's milk to compare the quantitative value of a culture method of casting plate with that of the method of the present invention. E. eoli or S. aureus was added to commercial cow's milk to provide microbial numbers of 10 °, 101, 102, 103, 104, 105, and 106 per ml to make samples. For each sample, 1 ml was subjected to the extraction of Total RNA, and 1 ml to the culture method of casting plate (E. co; deoxycholate agar medium, S. aureus and B. cereus: conventional agar medium, 37 ° C, 20 ± 2 hours). Total extracted RNA was analyzed by a quantitative RTPCR method using primers as described in Table 1 to determine a correlation between the resulting Ct value and the number of microbial cells obtained by the cast plate culture method. In this regard, the total RNA extraction and the quantitative RT-PCR method were performed by the method described in example 2; 1/25 the amount of total RNA extracted was subjected to quantitative RT-PCR. As a result, as shown in Figures 5A-5C, CT values correlated with the number of microbial cells in the range of 10 ° to 10 6 cells per ml of milk for any of the strains. In Figures 5A-5C, the CT value is plotted against the number of cells / ml of milk measured by the culture plate method of emptying to quantify E. co (Figure 5A), S. aereus (Figure 5B) and B. cereus (figure 5C) serving as a sample. The quantitative limit of the method of the present invention was 10 ° cells or more / ml of the milk and was comparable with that of the cast plate culture method. This demonstrates that the method of the present invention was able to provide an alternative to the culture method of casting plate using the official culture medium (deoxycholate agar medium or conventional agar medium) as described in the ministerial decree concerning the standard of composition, etc., for milk and dairy products. In addition, the emptying culture method took one day, while the The method of the present invention was completed from the stabilization of RNA of the specimen to the quantification in about 6 hours.

EXAMPLE 8 Examination of bacteria in the blood Various concentrations of S. aureus or P. aeruginosa are each added to human blood to compare the quantitative value of a culture method of casting plate (blood culture method) with that of the method of the present invention. S. aureus or P. aeruginosa was added to provide bacterial numbers of 10 °, 101, 102, 103, 104, and 105 per ml, to human blood to which a 1/10 volume of sodium citrate solution 3.8% was added as an anticoagulant to make samples. Of each sample, 0.5 ml was subjected to the extraction of total RNA, and 0.5 ml to the culture method of casting plate (BHI agar medium). The total RNA extracted was analyzed by a quantitative RT-PCR method to determine a correlation between the resulting CT value and the number of bacterial cells obtained by the culture method of casting plate. The total RNA extraction and the quantitative RT-PCR method was performed by the method described in example 2. In this regard, 1/25 the amount of total RNA was subjected to the quantitative RT-PCR. As a result, as shown in Figures 6A and 6B, the number of bacterial cells was correlated with the CT value in the range of 10 to 105 cells / 0.5 ml for each of the strains. In Figures 6A and 6B, the CT value is plotted against the number of cells / 0.5 ml of the blood as measured by the culture plate culture method to quantify P. aeruginosa (FIG. 6A) or S. aureus (FIG. 6B). ) that serves as a sample. The quantitative limit of the method of the present invention was 10 ° cell or more / 0.5 ml of blood and was comparable with the culture method of casting plate. This demonstrated that the method of the present invention was able to provide an alternative to the cast plate culture method. In addition, the culture method of casting plate took a day while the method of the present invention was completed from the stabilization of RNA of the specimen to the quantification in about 6 hours.

EXAMPLE 9 Examination of E. coli in fermented milk product E. coli was added to commercial Yakult (from Yakult Onza Co., Ltd.) to provide the bacterial numbers of 10 °, 101, 102, 103, 104 and 105 per mL to make samples. From each sample, 1 ml was subjected to the extraction of total RNA, and 1 ml to a culture method of casting plate using deoxycholate agar medium (37 ° C, 20 ± 2 hours). Total extracted RNA was analyzed by a quantitative RT-PCR method using Enterobacteria specific primers En-lsu 3F / 3? to examine a correlation between the resulting CT value and the number of microbial cells obtained by the method of cultivation of casting plate. The total RNA extraction was carried out as described in example 2 except for the trituration of bacterial cells by addition of glass spheres and the quantitative RTPCR method was performed as described in example 2. In this regard, / 25 the amount of total RNA extracted was subjected to quantitative RT-PCR. As a result, as shown in Figure 7, the CT value strongly correlated with the number of microbial cells in the range of 10 ° to 10 5 cells per ml. In Figure 7, the Ct value is plotted against the number of logio cells / ml Yakult measured by the culture plate method of emptying to quantify E. coli which serves as a sample. The quantitative limit of the method of the present invention was 10 ° cell or more / ml of Yakult and was comparable with that of the cast plate culture method. This demonstrated that the method of the present invention was able to provide an alternative to a cast plate culture method using the official culture medium (deoxycholate agar medium) as described in ministerial decree concerning compositional standard, etc. , for milk and dairy products. In addition, the method of culture of emptying plate took a day while the method of the present invention was completed from the stabilization of RNA of the specimen to the quantification in approximately 6 hours.

EXAMPLE 10 Analysis of lactobacilli and enterococci in human feces by quantitative RT-PCR and a culture method The numbers of bacteria cells of the genera Lactobacillus and Enterococcus in human faeces was compared by a quantitative RT-PCR method using primers as described in Table 1 and by a culture method. Freshly excreted feces were harvested from 48 healthy adults, treated using the method described in Example 6, and subjected to RNA stabilization, total RNA extraction and quantitative RT-PCR by the methods described in Example 2 In this regard, 1 / 2,000 to 1 / 200,000 the amount of total RNA obtained was subjected to the quantitative RTPCR. An aliquot of the same fecal diluent was also subjected to quantification of CFU by a culture method (the genus Lactobacillus: LBS medium, the genus Enterococcus medium COBA, 37 ° C for 48 hours in both cases). The culture method agreed with a conventional method; Obvious colonies were subjected to the identification of bacterial species by a biochemical property test (Gram stain, catalase test, API Stpp). The number of bacterial cells of the genus Lactobacillus by the quantitative RT-PCR method was calculated by combining the number of bacterial cells obtained by the quantitative RT-PCR methods using the sg-Laci-FIR primers (Lactobacills acidophilus subgroup), sg -Lsak-F / R (Lactobacillus sakei subgroup), sg-Lcas-FIR (Lactobacillus casei subgroup), sg-Lrum-F / R (Lactobacillus ruminis subgroup), sg-Lreu-F / R (Lactobacillus reuteri subgroup), sg-Lpla-F / R (Lactobacillus plantarum subgroup), s-Lbre-F / R (Lactobacillus brevis), s-Lfru-F / R (Lactobacillus fructivorans) and LFer-1/2 (Lactobacillus fermentum). As a result, as shown in Table 4, the numbers of bacteria cells of the genus Lactobacillus and the genus Enterococcus in human faeces were almost comparable between the method of the present invention and the culture medium. Conversely, the frequency of detection was high in both genders in the method of the present invention compared to the culture method. This seemed to be due to the following reason: (a) Bacteria belonging to the genus Lactobacills or Enterococcus, now used as a target, were present but could not grow because the selection medium had a stronger selectivity than required; or (b) the weak selectivity of the selection medium used led to the growth, in the medium, of bacterial genera abundantly present other than the target, which did not allow the detection of the targeted bacterial genera. The above-described results suggest that the method of the present invention not only allows the number of bacterial cells comparable to that of the culture method to be obtained, but also that it can detect or quantify bacteria that previously have not been able to be detected by the cultivation method. In addition, for the culture method, it took seven days to achieve all operations including the identification of bacterial species, while for the method of this invention, all operations were completed in approximately 20 hours.

TABLE 4 RT-PCR method Quantitative culture method Genus logio Frequency logio Frequency cell / g «feces (%) CFU / g« feces (%) Lactobacillus 5.2 ± 1.2 44/46 (96) 5,511 .4 37/46 (80) Enterococcus 6,211.0 46/46 (100) 6,211 .9 23/46 (50)

Claims (10)

NOVELTY OF THE INVENTION CLAIMS

1. - A method of quantifying a microorganism of interest, using as an index a quantity of rRNA of a microorganism of interest in a specimen to be tested.

2. The method according to claim 1, further characterized in that the method comprises measuring a product amplified by a PCR performed using nucleic acid fragments capable of specifically hybridizing to the rRNA of the microorganism of interest and a sample of the specimen to be tried.

3. The method according to claim 2, further characterized in that the measurement of the amplified product comprises identifying the number of PCR cycles when the amplified product reaches a certain amount.

4. The method according to claim 2 or 3, further characterized in that the method comprises measuring the amplified product over time.

5. A method for detecting a microorganism of interest, which uses as an index the presence of rRNA of a microorganism of interest in a specimen to be tested.

6. The method according to claim 5, further characterized in that the method comprises detecting a product amplified by a PCR performed using nucleic acid fragments capable of specifically hybridizing to the rRNA of the microorganism of interest and a sample of the specimen to be tested.

7. The method according to claim 6, further characterized in that the detection of the amplified product comprises identifying the number of PCR cycles when the amplified product reaches a certain amount.

8. The method according to claim 6 or 7, further characterized in that the method comprises measuring the amplified product over time.

9. The method according to any of claims 1 to 8, further characterized in that the specimen to be tested is a specimen derived from faeces, a food or an organism.

10. The method according to any of claims 1 to 9, further characterized in that the rRNA of the microorganism of interest in the sample of the specimen to be tested is stabilized in the microorganism. 1. The method according to any of claims 2 to 4 or 6 to 10, further characterized in that the fragments of nucleic acid capable of specifically hybridizing to the rRNA of the microorganism of interest are each a nucleic acid fragment that comprises a base sequence described in one of SEQ ID NOS 2, 3 and 5 to 28 or a base sequence complementary thereto, or a nucleic acid fragment comprising a base sequence homologous thereto and functionally equivalent to those same. 12 - A fragment of nucleic acid used in the method of any of claims 2 to 4 or 6 to 11, wherein the nucleic acid fragment is a fragment of nucleic acid comprising a sequence of bases described in one of SEQ ID NOS : 2, 3 and 5 to 28 or a base sequence complementary thereto, or a nucleic acid fragment comprising a base sequence homologous thereto and functionally equivalent thereto. 13 - A device for performing the method of any of claims 1 to 1 1. The device according to claim 13, further characterized by comprising (1) fragments of nucleic acid capable of specifically hybridizing to rRNA of a microorganism of interest and / or (2) a reagent used for RNA extraction, RNA stabilization, and / or a PCR.