MX2007008219A - Nucleotide sequences encoding ramosa3 and sister of ramosa3 and methods of use for same - Google Patents

Abstract

The invention relates to the isolation and characterization of a maize gene, RAMOSA3 (RA3), responsible for meristem development and inflorescence development including branching. The gene, gene product, and regulatory regions may be used to manipulate branching, meristem growth, inflorescence development and arrangement, and ultimately to improve yield of plants. The invention includes the gene and protein product as well as the use of the same for temporal and spatial expression in transgenic plants to alter plant morphology and affect yield in plants. The invention also includes the gene and protein product for SISTER OF RAMOSA3 (SRA).

Description

SEQUENCES OF NUCLEOTIDES THAT CODIFY FOR RAMOSA3 AND SISTER OF RAMOSA3 AND METHODS OF USE FOR THE SAME FIELD OF THE INVENTION The field of the invention generally refers to the molecular biology of plants, specifically, to the protein and nucleotide sequences and to the genetic techniques that use them to modify the plant architecture and to increase yield and the health of plants.

BACKGROUND OF THE INVENTION Plant architecture is central to performance, for example, in the orchestration of the green revolution, through the reduction of plant height [Peng, J. et al., Nature, 1999. 400 ( 6741): p. 256-611]. Similarly, the morphology of the influences is a major yield factor in many crops, and is determined by the activities of the sprouted meristems. Variations in branching patterns lead to diversity in architectures, and have been studied at physiological, genetic and molecular levels [Sussex, I. M. and Kerk, N.M., Curr Opin Plant Biol, 2001. 4 (1): p. 33-7; Ward, S. P. and Leyser, 0., Curr Opin Plant Biol, 2004. 7 (1): p. 73-8]. Ref .: 183786 Factors that control branch branching The sprouted apical meristem (SAM) is active throughout the life cycle of the plant, and produces axillary leaves and meristems, typically initiated in each leaf axil. The activity patterns of the axillary meristem - where these are produced, whether they suffer from inactivity or growth or when they grow - contribute to the general architecture of the outbreaks. Apical dominance is a major factor in the regulation of the development of axillary meristems, and is regulated by genetic and hormonal factors. The development of axillary meristems can be described in two phases, the beginning and the growth. Genes such as REVOLUTA (REV) and LATERAL SUPPRESSOR (LAS) in Arabidopsis are involved in initiation. The REV mutants often fail to produce axillary meristems during vegetative and reproductive development. REV codes for a homodomain / leucine zipper transcription factor and is expressed in early axillary meristems. On the one hand, in the LAS mutants, defects in the formation of auxiliary meristems occur only during vegetative development. LAS is nonetheless expressed in leaf axils during vegetative and reproductive development. LAS also codes for a transcriptional factor, a member of the GRAS family. Expression patterns suggest that LAS acts in the 5 'direction of REV in the development of axillary meristem. The teosinte branchedi (tbl) locus of corn is another well-characterized regulator of axillary meristem growth. The phenotype of the tbl mutant resembles the ancestor of corn, the teosinte, in the outward growth of the axillary meristem. In QTL analysis, gene structure and expression analysis indicate that TBl is one of the major genes involved in the important change in the architecture of the plant, involved in the development of corn as a crop. The corn orthologist TBl seems to act in the 3 'direction of the rice orthologian, monoculml. The regulation of outward growth of the axillary meristem is complex, and several genes have been implicated, as well as the hormones auxin, cytokinin and abscisic acid (ABA). It is traditionally thought that auxin is an inhibitor of axillary meristem growth, although recent evidence suggests that it also functions during the onset of axillary meristem. The importance of auxin for growth is suggested by the fact that the auxin-resistant mutants (axrl), which have a reduced response to auxin, are highly branched. However, auxin concentrations in axillary meristems after decapitation are sometimes higher than before, and auxin appears to act non-autonomously, in the xylem and the interfascicular sclerenchyma, to suppress the branching. This suggests the existence of second mobile messengers that transmit the auxin signal. A candidate for such a signal is a cytokinin. Cytokinins may promote the growth of axillary meristems after direct application, and axin may sub-regulate the biosynthesis of cytokinin. Additional evidence of a role for cytokinin in axillary meristem growth comes from the analysis of the Arabidopsis hoc and supershoot mutants, which have higher endogenous cytokinin levels and an extremely branched phenotype. The physiological and genetic analysis suggests that the abscisic acid hormone can also regulate the growth of axillary meristems. Genetic analysis is also beginning to identify new branching signals. The mutants ramosus (rms) in pea and the most axillary growth mutants (maxillary growth) (max)) in Arabidopsis have a dense or leafy phenotype and the growth of auxin-resistant shoots. Graft experiments, hormone measurements and the responses of these mutants to auxin, strongly suggested the existence of a new signal of mobile branch inhibition, which functions 3 'of the auxin. The recent cloning of MAX3 and MAX4 has begun to provide some clues as to the nature of this signal. Both genes code for proteins related to dioxygenases, and the hypothesis is that the signal is derived by excision of a carotenoid. The analysis of other rms and max mutants has revealed other genes that are not rescued by the graft, and can function in the reception of the signal dependent on MAXlRMS. The fact that MAX2 codes for a box protein F (F-box) can fit with the hypothesis, since many such proteins are involved in the regulation of hormones.

Control factors in the branching of the inflorescences The internal and environmental stimuli promote the transition from vegetative SAM to the inflorescence meristem (IM), which starts the inflorescence structures. In the pastures, the development of the inflorescence is characterized by the formation of short branches called spikelets. Corn forms two different types of inflorescence; the terminal spike has long branches and develops male flowers, and the axillary ears have a prominent axis that lacks long branches, and develop female flowers. The IM initiates rows of meristems in pairs of spikelets (SPMs), and each SPM in turn produces two spikelet meristems (SMs), which initiates two floral meristems (FMs). In the spike, the IM also initiates several branching meristems (BMs), which are responsible for the long branches at the base of the spike, followed by SPMs, SMs and FMs as in the ear. The architecture of the inflorescence in different species is highly variable, for example in contrast to corn, maize has only one type of bisexual inflorescence formed from apical and axillary meristems. Each MI produces primary branches in a spiral filotaxy, and these elaborate secondary branches and the Sms in a dystic filotaxy. The primary and secondary branching meristems (BMs) in the rice correspond to the SPMs in the maize inflorescences, from the point of view that they initiate the SMs. The IM of the rice degenerates after the elaboration of primary BMs, and the internodos of the primary and secondary branches lengthen to form a panicle architecture, which looks very different from that of the corn, although its structural components are essentially the same . Several genes that regulate the branching and morphology of inflorescence of maize and rice have been identified. BARREN INFLORESCENCE2 (BIF2) and BARREN STALK1 (BAl) in corn, and LAX PANICLE (LAX) in rice control the start of axillary IMs. The spikes of bif2 produce less or no branching and spikes, and the ears have less or no spikelets. Since the BMs, SPMs, SMs and FMs in the weak bif2 mutants are all defective, it seems that BIF2 is required for the start and maintenance of all types of axillary meristems. The bal mutants lack vegetative axillary branches and ears, and have unbranched spikes that lack spikelets. The rice lax mutants, the number of major branches and spikelets is also strongly reduced. These phenotypes indicate that BAl and LAX are required to initiate the axillary meristems of inflorescence. These code for basic orthologous helical-loop-helix transcription factors, and are expressed in the boundaries between pre-existing and newly initiated axillary meristems. These localized expression patterns support the functions of LAX and BAl in the production of axillary meristems, and suggest that the functions of the gene are strongly conserved between rice and corn. The leafy (zfl) mutants of Zea floricavla I in corn, also have fewer spike ramifications and fewer row numbers on the ear, as well as defects during inflorescence transition. Once axillary meristems are initiated, they acquire new identities. RAMOSAl (RAI) in corn, is required in the ear and ear for the transition from the identity of SPM to SM, and the ral mutants have highly branched inflorescences [Postlethwait, S. . and Nelson, 0. E., Characterization of development in maize through the use of mutants. I. The polytypic (Pt) and ramosa-1 (ral) mutants. Am. J. Bot., 1964. 51: p. 238-243; Vollbrecht et al. Nature 436: 11 19-1126]. The Ramosa2 (ra2) mutants have a ra2-like phenotype, except that in ra2 the pedicelled spikelet is converted to a branch. Nickerson, N. H. et al., Tassel modifications in Zea mays. Ann. MO Bot. Gard. 42, 195-211 (1955); Hayes, H., Recent linkage studies in maize. IV. Ramosa ear-2 (ra2). Gentics, 1939. 24: p. 61. Ramosa3 (ra3) is a classic imitator of corn, first described in 1954 [Perry, H. S., Unpubished, http://www.maizegdb.org/. 1954] (see also, Table 1 of Veit et al., Plant Cell 5: 1205-1215 (1993)), but has not yet been characterized in detail. Only the mature inflorescence phenotype has been reported. In the tassel seed4 mutants (ts4), most of the SPMs in the spike and those on the distal part of the ear reiterate the SPMs, therefore TS4 is required for the identity of SM. The FRIZZY PANICLE curly panniculate (FZP) in branched non-silky rice (BRA CHED SILKLESSl) (BDl) in corn, regulates the meristem identity in the transition from SMs to FMs. The fzp and bdl mutants produce branching structures without elaborating flowers, so that these genes are required to regulate the determination of the SMs and / or to establish the identity of the FMs. FZP and BDl code for orthologs in the class of the link factor to the ethylene response element of the transcription factors. These are expressed in analogous patterns in the union of the SMs and the rudimentary glumes in rice, and the SMs and the internal / external glumes in corn. Therefore, some genes that regulate the architecture of the inflorescence in rice and corn are strongly conserved in function and expression pattern. Other genes that regulate the determination of SM include the maize genes REVERSED GERM ORIENTATION (REVERSED GERM (RG01)), INDETERMINATE SPIGUILLA (INDETERMINATE SPIKELET1 (IDS1)), VERTICE FLORAL INDETERMINATE (INDETERMINATE FLORAL APEXI (IFAl)) and SEED OF SPIGA (TASSEL SEED6 (TS6)). In these mutants, SMs become more indeterminate and produce extra flowers. The degree of determination of SPM is one of the characteristic variables in the inflorescence architecture of the pastures, and differs significantly between rice and corn, as described above and in other pastures, for example in wheat, the SMs are indeterminate. Genetic and molecular analyzes in model species have contributed to the understanding of inflorescence branching mechanisms in pastures. Most of the genes that have been isolated encode putative transcription factors, suggesting that they regulate the transcription of the 3 'direction targets.

Biology and signaling of trehalose Trehalose is a disaccharide composed of two glucose units. This is highly resistant to heat and pH, and has a strong stabilizing effect on proteins. In contrast to sucrose, which is present only in the plant kingdom and in some photosynthetic prokaryotes, trehalose is present in all kingdoms and plays a role in the storage of carbohydrates and protection against stress in microbes and invertebrates. See, for example, Goddijn, O. J. and van Dun, K., Trehalose metabolism in plants. Trends Plant Sci, 1999. 4 (8): p. 315-319; Elbein, A. D., The metabolism of a, a-trehalose. Adv. Carbohydr. Chem. Biochem. , 1974. 30 (227-56.); Crowe, J. H., Hoekstra, F.A., and Crowe, L.M., Anhydrobiosis. Annu Rev Physiol, 1992. 54: p. 579-99; Strom, A. R. and Kaasen, I., Trehalose metabolism in Escherichia coli: stress protection and stress regulation of gen expression. Mol Microbiol, 1993. 8 (2): p. 205-10; and Paiva, C. L. and Panek, A. D., Biotechnological applications of the disaccharide trehalose. Biotechnol Annu Rev, 1996. 2: p. 293-314. Until recent years trehalose had not been considered as present in vascular plants with the exception of desiccation tolerant plants (reviewed in Muíler, J., Boller, T., and Wiemken, A., Trehalose and trehalase in plants: recent developments, Plant Sci, 1995. 112: pp. 1-9). However, interest in the application of trehalose metabolism engineering to produce drought tolerant crops led to the discovery of trehalose biosynthetic genes in plants. See, for example, Holmstrom, K. 0., Mantyla, E., Welin, B., Mandal, A., and Palva, E. T., Drought tolerance in tobáceo. Nature, 1996. 379: p. 683-684; Romero, C, Belles, J. M. , Vaya, J. L., Serrano, R., and Cilianez-Macia, A., Expression of the yeast trehalose- 6-phosphate synthase gene in transgenic tobaceous plants: pleiotropic phenotypes include drought tolerance. Plant, 1997. 201: p. 293-297; and Garg, A.K., Kim, J.K., Owens, T.G., Ranwala, A.P., Choi, Y.D., Kochian, L.V., and Wu, R.J., Trehalose accumulation in rice plants confers high tolerance levéis to different abiotic stresses. Proc Nati Acad Sci U S A, 2002. 99 (25): p. 15898-903. See also, for example., Goddijn, J., Verwoerd, T. C, Voogd, E., Krutwagen, RW, Graaf, PT, van Dun, K., Poels, J., Ponstein, AS, Damm , B., and Pen, J., Inhibition of trehalase activity enhancements trehalose accumulation in transgenic plants. Plant Physiol, 1997. 113 (1): p. 181-90; Muller, J., Aeschbacher, R.A., Wingler, A., Boller, T., and Wiemken, A., Trehalose and trehalase in Arabidopsis. Plant Physiol, 2001. 125 (2): p. 1086-93; Vogel, G. , Fiehn, 0., Jean-Richard-dit-Bressel, L., Boller, T., Wiemken, A., Aeschbacher, R.A. , and Wingler, A. , Trehalose metabolism in Arabidopsis: occurrence of trehalose and molecular cloning and characterization of trehalose- 6 -phosphate synthase homologues. J Exp Bot, 2001. 52 (362): p. 1817-26; and Leyman, B. , Van Dijck, P., and Thevelein, J. M., An unexpected plethora of trehalose biosynthesis genes in Arabidopsis thaliana. Trends Plant Sci, 2001. 6 (11): p. 510-3. An N-terminal deletion of the trehalose-6-phosphate synthase of Selaginella lepidophylla ("a resurrection plant") or Arabidopsis thaliana (TPS1) results in a dramatic increase in TPS activity (Van Dijck et al., 2002 , Biochem J. 366: 63-71). This indicates a high potential capacity for synthesis of trehalose in plants, despite the almost universal absence of trehalose. The biosynthesis of trehalose occurs in 2 steps, analogous to that of sucrose. Trehalose-6-phosphate (T6P) is first formed from UDP-glucose and glucose-6-phosphate by trehalose-6-phosphate synthase (TPS). Next, T6P is converted to trehalose-6-phosphate-phosphatase (TPP). The metabolism of trehalose has been analyzed in detail in Saccharomyces cerevisiae and Escherichia coli. In S. cerevisiae, TPSl is responsible for the activity of TPS, and TPS2 of PP activity, and these function in a complex together with regulatory subunits encoded by TPS3 and TSLl [Londesborough, J. and Vuorio, 0., Trehalose- 6-phosphate synthase / phosphatase complex from bakers 1 yeast: purification of a proteolytically activated form. J Gen Microbiol, 1991. 137 (Pt 2): p. 323-30; Bell, W., Sun, W., Hohmann, S., Wera, S., Reinders, A., De Virgil, C, Wiemken, A., and Thevelein, JM, Composition and functional analysis of Saccharomyces cerevisiae trehalose synthase complex . J Biol Chem, 1998. 273 (50): p. 33311-9]. However, in E. coli, OtsA, which has TPS activity, and OtsB, which has TPP activity, acts independently. In arabidopsis, more than ten homologs have been found for the TPS and TPP genes. The functional analysis of plant genes has been concentrated in the TPSl genes of arabidopsis. The tpsl mutants of loss of function are lethal to embryos, and were not rescued by exogenous trehalose. The tpsl mutants can be rescued by an inducible TPSI construct, but have reduced root growth, and continued induction is required for the transition to fluorescence. Plants that over-express AtTPSl had increased tolerance towards dehydration (drought) and were insensitive to glucose and ABA [Avonce, N., Leyman, B., Mascorro-Gallardo, J. 0., Van Dijck, P., Thevelein, JM, and Iturriaga, G., The Arabidopsis trehalose-6-P synthase AtTPSl gene is a regulator of glucose, abscisic acid, and stress signaling. Plant Physiol, 2004. 136 (3): p. 3649-59]. Arabidopsis also codes for a number of PP homologs, which code for proteins with a TPP domain, with highly conserved phosphatase portions, typical of this class of phosphohydrolases [Thaller, M. C, Schippa, S., and Rossolini, GM, Conserved sequence motifs among bacterial, eukaryotic, and archaeal phosphatases that define a new phosphohydrolase superfamily. Protein Sci, 1998. 7 (7): p. 1647-52]. The TPP genes of Arabidopsis were first isolated by their ability to complement the yeast tps2 mutants [Leyman, B., Van Dijck, P., and Thevelein, J. M., An unexpected plethora of trehalose biosynthesis genes in Arabidopsis thaliana. Trends Plant Sci, 2001. 6 (11): p. 510-3; Vogel, G., Aeschbacher, R.A., Muí ler, J. , Bol ler, T., and Wiemken, A., Trehalose-6-phosphate phosphatases from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant. Plant J, 1998. 13 (5): p. 673-83], although no other information about the biological functions of these genes is available.

Trehalose-6-phosphate has also recently emerged as a regulator of carbon metabolism, and appears to act as an enhancer of photosynthetic capacity through the interaction of sugar cleavage pathways. Plants that over-express either bacterial or yeast biosynthetic genes of trehalose have altered carbohydrate metabolism and some morphological defects. It is thought that these phenotypes result from changes in carbon assignment between sunken and source tissues, and prompted speculation that trehalose metabolism may be involved in sugar signaling. Paul et al. (Enhancing photosynthesis with sugar signs.) Trends Plant Sci, 2001. 6 (5): p.119-200) reasoned that T6P could be the signal that allows hexokinase to perceive carbon status, as is the case in yeast. However, this is inconsistent with the fact that T6P is not an inhibitor of the AtHXKI and AtHXK2 hexokinases of Arabidopsis in vitro, and the hexokinase-reducing activity did not rescue the growth of Arabidopsis tpsl embryos. However, an analysis of Arabidopsis plants that overexpress OtsA, OtsB and treC (trehalose-phosphate-hydrolase) also confirms an involvement of T6P in carbohydrate utilization and development via glycolysis control. Trehalose signaling also seems to play a similar role in monocotyledons, since transgenic rice over-expressing OtsA and OtsB from E. coli had increased accumulation of trehalose, and this correlated with more soluble carbohydrates and higher capacity for photosynthesis under tension and non-tension conditions. These results are consistent with a role of the trehalose pathway in the modulation of sugar detection and carbohydrate metabolism. In addition to T6P, other signaling steps in the plant trehalose pathway have been proposed. For example, the TPS protein interacts with the 14-3-3 regulatory proteins, and this interaction may depend on the state of the cell sugar. Trehalose itself can also act as a signal, although it is unlikely to act as an osmoprotector as in microbes, since the concentration is very low. However, a possible target of trehalose is ApL3, an ADP-glucose-pyrophosphorylase, which is involved in the biosynthesis of starch. These data suggest that trehalose interferes in the assignment of carbon to sunken tissues, by inducing the synthesis of starch in the source tissues. While the exact roles of trehalose and the related sugars are not clearly understood, it is generally thought that sugars are signaling molecules or that they act as global regulators of gene expression. In addition to their obvious metabolic functions, sugars can act as hormones, or they can modulate hormone signaling pathways.

BRIEF DESCRIPTION OF THE INVENTION The present invention includes: An isolated polynucleotide comprising: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, based on the Clustal V Alignment Method, when compared to SEQ ID No: 19, wherein the expression of said polypeptide in a plant transformed with the isolated polynucleotide results in altering the branching of the ear, the cob, or both, of the transformed plant when compared to a control plant that does not comprise the isolated polynucleotide; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consists of the same number of nucleotides and are 100% complementary. Preferably, expression of the polypeptide results in a decrease in the branching of the spike, the ear, or both, and even more preferably, the plant is corn. An isolated polynucleotide comprising: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99 % or 100% sequence identity, based on the Clustal V Alignment Method, when compared to SEQ ID NO: 19, wherein the expression of said polypeptide in a plant transformed with the isolated polynucleotide results in the altering the pollen dispersion of the transformed plant when compared to a control plant that does not comprise the isolated polynucleotide; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consists of the same number of nucleotides and are 100% complementary. Preferably, expression of the polypeptide results in a decrease in pollen dispersion, and even more preferably, the plant is corn. An isolated polynucleotide comprising: (a) a nucleotide sequence encoding polypeptide associated with the branching of the spike, the cob or both, of a plant (preferably maize) wherein the polypeptide has an amino acid sequence of at least 80% , 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID No: 19, or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consists of the same number of nucleotides and are 100% complementary. An isolated polynucleotide comprising: (a) a nucleotide sequence encoding a polypeptide associated with the pollen dispersion of a plant (preferably maize), wherein the polypeptide has an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V Alignment Method, when compared to SEQ ID No: 19, or (b) a complement of the nucleotide sequence, where the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. An isolated polynucleotide comprising: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99 % or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID No: 19, where the expression of the polypeptide in a plant showing a mutant phenotype of ramosa3 results in a decrease in the branching of the ear, the ear, or both of the plant; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consists of the same number of nucleotides and are 100% complementary. Preferably, the plant is corn. An isolated polynucleotide comprising: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99 % or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID No: 19, where the expression of the polypeptide in a plant showing a mutant phenotype of ramosa3 results in a decrease in pollen dispersion of the plant; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consists of the same number of nucleotides and are 100% complementary. Preferably, the plant is corn. An isolated polynucleotide comprising: (a) a nucleic acid sequence encoding a polypeptide having trehalose-6-phosphate-phosphatase activity, wherein the polypeptide has an amino acid sequence of at least 65%, 70%, 75 %, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to the SEQ ID Nos: 19, 49, 68 or 69; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. Any recombinant DNA construct comprising a polynucleotide operably linked to a promoter that is functional in said plant, wherein the polynucleotide comprises an isolated polynucleotide of the present invention. A vector comprising a polynucleotide of the present invention. A DNA suppression construct comprising a functional promoter in a plant, operably linked to: (a) all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% of sequential identity, or any whole number up to and including 100% sequential identity, based on the Clustal V Alignment Method, when compared to SEQ ID No: 19, 49, 68 or 69, or (ii) a complete complement of the nucleic acid sequence of (a) (i); (b) a region derived from all or part of a strand in the sense or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequential identity, based on the Alignment Method of Clustal V, when compared to all or part of a strand in sense or antisense strand from which the region is derived, and wherein the target gene of interest codes for a RAMOSA3 polypeptide (RA3) or a SERMANA polypeptide FROM RAM0SA3 (BROTHERHOOD OF RAM0SA3) (SRA); or (c) a nucleic acid sequence of at least 50% sequential identity, or any integer up to and including 100% sequential identity, based on the Clustal V Alignment Method, when compared to SEQ ID Nos. : 15, 18, 47, 48, or 67. The DNA deletion construct preferably comprises a co-suppression construct, antisense construct, viral suppression construct, hairpin suppression construction, stem-loop suppression construction, construction that produces double-stranded RNA, RNAi construction or small RNA construct (eg, a siRNA construct or a miRNA construct). A plant comprising in its genome a recombinant DNA construct of the present invention. A plant whose genome comprises a disruption or disruption (eg, an insertion, such as a transposable element, or sequence mutation) of at least one gene (which may be heterologous or endogenous to the genome) that codes for at least one polypeptide selected from the group consisting of a RAM0SA3 polypeptide (RA3) or a SISTER OF RAM0SA3 (SRA) polypeptide. Any progeny of the previous plants, and any seed obtained from the plant or its progeny. Progeny includes subsequent generations obtained by self-pollination or crossing a plant. The progeny also includes hybrids and inbred individuals. A method for altering the branching of the ear, the ear, or both, of a plant, comprising: (a) introducing into a regenerable plant cell, a recombinant DNA construct to produce a transformed plant cell, the construction of recombinant DNA comprises a polynucleotide operably linked to a promoter that is functional in a plant, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V Alignment Method, when compared to SEQ ID NO: 19; and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in the branching of the spike, the cob, or both, when compared to a control plant that does not comprise the construction of recombinant DNA. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome, the construction of recombinant DNA. Preferably, the transgenic plant or the progeny thereof, shows a decrease in the branching of the spike, the ear, or both. A method for altering the pollen dispersion of a plant, comprising: (a) introducing into a regenerable plant cell, a recombinant DNA construct to produce a transformed plant cell, the recombinant DNA construct comprises a polynucleotide operably linked to a promoter that is functional in a plant, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100 Sequential identity%, based on the Clustal V alignment method, when compared to SEQ ID NO: 19; and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in pollen dispersion, when compared to a control plant that does not comprise the construction of recombinant DNA. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. Preferably, the transgenic plant or the progeny thereof shows a decrease in pollen dispersion. A method for altering the activity of trehalose-6-phosphatase in a plant, comprising: (a) introducing into a regenerable plant cell, a recombinant DNA construct to produce a transformed plant cell, the recombinant DNA construct comprises an operably polynucleotide linked to a promoter that is functional in a plant; wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID Nos: 19, 49, 68 or 69; and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA and wherein the transgenic plant shows an alteration in the activity of trehalose-6-phosphate -phosphatase, when compared to a control plant that does not comprise the construction of recombinant DNA. The method may further comprise (c) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. Preferably, the transgenic plant or the progeny thereof shows an increase in the activity of trehalose-6-phosphate-phosphatase. A method for increasing tolerance to environmental stress (preferably drought tolerance) of a plant, comprising: (a) introducing into a regenerable plant cell, a recombinant DNA construct to produce a transformed plant cell, the construction of DNA recombinant comprises a polynucleotide operably linked to a promoter that is functional in a plant; wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID Nos: 19, 49, 68 or 69; and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA and wherein the transgenic plant shows an increase in tolerance to environmental stress, ( preferably drought tolerance), when compared to a control plant that does not comprise the construction of recombinant DNA. The method may further comprise (c) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA.

BRIEF DESCRIPTION OF THE FIGURES The invention can be more fully understood from the following detailed description and the appended figures, and the list of sequences that form a part of this application. Figures 1A-1D show the mature ear and spike phenotypes of the ra3 mutants. Figures 2A-2H show the SEM analysis of the ra3 mutant ears. The wild-type ears (B73) are shown in Figures 2A-2D, and the ears are ra3 in E-H. During the inflorescence transition stage, there is no difference between the ears of B73 (fig 2A) and mutant ra3 (fig 2E). In ears of 2 mm in length, some SPM was converted to BM * (fig 2F, arrow 1). The SMs in B73 produce a pair of glumes, (fig 2C, arrow 2), but in ra3 they produce additional glumes (fig 2G, arrow 2), and FMs were elaborated inside the glumes (arrow 3). The SMs in the wild type ears produce 2 FMs inside the glumes (fig 2D, upper FM marked by arrow 3) and each floret or flower has a motto and a palea (Figure 2D, palea marked by arrow 4) . The SMs in the ra3 mutants elaborate several FMs (arrow 3, H, palea marked by arrow 4) and later they can be converted to BM * that makes glumes (Figure 2H, arrow 2). Scale bars fig. 2A, E 100 μ ??; B, F 500 μp ?; fig. 2C, fig. 2D 100 μp \; fig. 2G, fig. 2H 200 m Figure 3 shows a diagram of the development of the wild type (wt) and ra3 ears. BM * indicates a meristem that elaborates SPMs. SPM * indicates a meristem that elaborates SMs. SM * indicates a meristem that elaborates FMs.

Figures 4A-4B show a map of locus RA3. The position of RA3 and the related SRA locus on clone c0387K01 is given in (Fig. 2A). The marker positions are shown as black dots and the number of recombinants for each is shown. The structure of the RA3 gene is given in (Fig. 2B). The shaded box immediately preceding the ATG start codon and the shaded box immediately following the stop codon each represent UTRs; the shaded boxes between these UTRs indicate the coding sequence; and "TATA" indicates the TATA box predicted. Figures 5A-5B show the predicted RA3 structure and phylogenetic analysis. The structure of the RA3 protein is shown in fig. 5A. The regions of similarity to TPP are marked "2", the phosphatase boxes are marked "3", and the non-conserved regions are marked "1". The neighboring junction tree shown in FIG. 5 B, using phylogenetic analysis using Parsimony ("PAUP"; SWOFFORD D.L., (1993) J Gen Physiol 102: A9) of the conserved part of the TPP region of the RA3-like proteins in maize, rice and Arabidopsis. The corn proteins are the following: RA3, SRA, ZmRA3Ll-8. The rice proteins are the following: gi46390128, gi37806433, gi33146623, 9631.m02649, 9683.m03678, 9634.m01158. The Arabidopsis proteins are the following: At5g51460, Atlg35910, At2g22190, At4g39770, At5gl0100, At5g65140. Figures 6A, 6B, 6C and 6D show a sequence alignment of the following amino acid sequences: (1) SEQ ID No: 19, for the maize RAM0SA3 polypeptide; (2) SEQ ID No: 49, for the corn BROADBAND RAM0SA3 polypeptide; (3) SEQ ID No: 51, for the rice trehalose-6-phosphate phosphatase polypeptide, corresponding to NCBI Gl No. 33146623; (4) SEQ ID No: 52, for the Arabidopsis TPPA polypeptide corresponding to NCBI Gl No. 2944178; (5) SEQ ID NO: 53, for the Arabidopsis TPPB polypeptide corresponding to NCBI Gl NO. 2944180; (6) SEQ ID No: 54, for a corn trehalose-6-phosphate phosphatase polypeptide that is cited as SEQ ID No: 16 in U.S. Patent Publication No. 2004-0229364-A1; (7) SEQ ID No: 55, for a soy trehalose-6-phosphate-phosphatase polypeptide that is cited as SEQ ID No: 20 in U.S. Patent Publication No.; (8) a truncated speed of SEQ ID No: 52, in which the N-terminal 91 amino acids are eliminated; it was shown that this fragment has enzymatic activity (Vogel et al. (1998) Plant J 13 (5): 673-683); and (9) a truncated version of SEQ ID No: 53, in which the N-terminal 91 amino acids have been removed. A consensus sequence of 414 amino acids was generated and numbered below these nine sequences. The amino acid positions for each sequence are given to the left of each row, and to the right of the final row. An asterisk above an amino acid residue indicates that the position is fully conserved between SEQ ID Nos., Given, with respect to the AtTPPB sequence of Arabidopsis thaliana. Below the sequences are shown two domains, A and B, which are conserved among the trehalose-6-phosphate-phosphatases, as described in Vogel et al. (1998) Plant J 13 (5): Q73-683. The sequence given for each conserved domain is taken the amino acid sequence of AtTPPB from Arabidopsis thaliana in these positions. Figures 7A-7B show that the expression of RA3 is the highest in the developing inflorescence. In fig. 7A shows the expression of RA3 in the cob primordia of 1 cm from B73 (lane 1) and the ra3 alleles. In ra3-ref (band 2) and ra3-feal (band 3), very low expression was detected, whereas the expression level of ra3-EV, ra3-NI and ra3-bre (bands 4-6) was normal , except that the ra3-NI transcript is slightly larger, since it has a small insertion (Table 2). The lower panel shows ubiquitin expression (UBI) as a control. In fig. 7B shows the expression of RA3, SRA and ubiquitin during wild-type development (B73). The mRNAs were extracted from the root (R), the vegetative apex (V), young leaves (L) and primordia of ear or ear inflorescence. The triangles represent the size of the growing inflorescence, from the transition stage to spikes and ears of ~ 1.5 cm. The expression of RA3 rises to a maximum in inflorescences of 2-5 mm. Figures 8A-8F show that the expression of RA3 is especially restricted during the development of the ear. RA3 was first expressed in the base of the SPMs (arrows, Fig. 7A). After that, the expression of RA3 was enlarged to a cup-shaped domain at the base of the SPMs and SMs (arrows, Fig. 7B, Fig. 7C and Fig. 7D). The parts (Fig. 7B) and (Fig. 7C) are medium and indirect longitudinal sections, respectively, and (Fig. 7D) is a cross section. In the later stages, RA3 was expressed at the boundary between the upper and lower florets (arrows, Fig. 7E). No transcript of RA3 was detected in an ear of ra3-ref (Figure 7F), in the stage similar to (Figure 7B). Figure 9 shows the release of phosphate, measured as ?? ß ?? after the treatment of various phosphorylated substrates. For each substrate, shown from left to right, respectively, is the activity due to each of the following proteins: 1) His3-labeled full length protein (SEQ ID NO: 61); 2) fragment of the TP3 domain of RA3 marked with (SEQ ID NO: 62); 3) N-terminal fragment of His tagged RA3 (SEQ ID No: 63); 4) TPP of Mycobacterium tuberculosis labeled with His (Edavana et al., Arch Biochem Biophys 426: 250-257 (2004)); 5) shrimp alkaline phosphatase (SAP, Roche Applied Science); 6) without protein. Figure 10 shows the growth of a yeast tps2 mutant (yeast strain YSH6.106.-8C) transformed with an RA3 protein, the fragment of the TPP domain of RA3, a positive control (the trehalose-6-phosphate- gene). Arabidopsis phosphatase, AtTPPB), and a negative control (empty yeast vector). The transformed cells were evaluated for growth on selective media at 40.5SC in the presence of 1M sodium chloride, as well as at 30eC. SEQ ID No: 1 is the nucleotide sequence of the forward primer csu597. SEQ ID No: 2 is the nucleotide sequence of the primer Inverse csu597. SEQ ID No: 3 is the nucleotide sequence of the forward primer umcl412. SEQ ID No: 4 is the nucleotide sequence of the reverse primer umcl412. SEQ ID No: 5 is the nucleotide sequence of the forward primer al4. SEQ ID No: 6 is the nucleotide sequence of the reverse primer al4. SEQ ID No: 7 is the nucleotide sequence of the forward primer n20. SEQ ID No: 8 is the nucleotide sequence of the reverse primer n20 reverse primer. SEQ ID No: 9 is the nucleotide sequence of the forward primer cb.glE. SEQ ID No: 10 is the nucleotide sequence of the reverse primer cb.glE. SEQ ID No: 11 is the nucleotide sequence of the NS346 primer. SEQ ID NO: 12 is the nucleotide sequence of the NS347 primer. SEQ ID NO: 13 is the nucleotide sequence of the primer NS362. SEQ ID NO: 14 is the nucleotide sequence of the primer NS363. SEQ ID NO: 15 is the genomic nucleotide sequence that contains the RAMOSA3 gene. SEQ ID No: 16 is the nucleotide sequence of the forward primer NS432 used to amplify the cDNA containing the open reading structure of RAMOSA3. SEQ ID No: 17 is the nucleotide sequence of the reverse primer NS411 used to amplify the cDNA containing the open reading structure of RAMOSA3. SEQ ID No: 18 is the nucleotide sequence of the region that codes for the protein, deduced from the PCR product using the primers of SEQ ID Nos: 16 and 17 to amplify the corn cDNA. SEQ ID No: 19 is the amino acid sequence of the RAM0SA3 polypeptide. SEQ ID No: 20 is the nucleotide sequence of the forward primer 5 'UTR-exon2. SEQ ID No: 21 is the nucleotide sequence of the reverse primer 5 'UTR-exon2. SEQ ID No: 22 is the nucleotide sequence of the forward primer exon3-exon4. SEQ ID No: 23 is the nucleotide sequence of the reverse primer exon3-exon4. SEQ ID No: 24 is the nucleotide sequence of the forward primer exon5-exon7. SEQ ID No: 25 is the nucleotide sequence of the reverse primer exon5-exon7. SEQ ID No: 26 is the nucleotide sequence of the forward primer exon8-exonl0. SEQ ID No: 27 is the nucleotide sequence of the reverse primer exon8-exonl0. SEQ ID No: 28 is the nucleotide sequence of the forward primer exonll-3 'UTR. SEQ ID No: 29 is the nucleotide sequence of the reverse primer exonll-3 'UTR. SEQ ID No: 30 is the nucleotide sequence of an exon7 region of the ra3-ref mutant gene, which contains a 4 base pair insertion relative to the sequence of SEQ ID No: 15. SEQ ID No: 31 is the deduced amino acid sequence of the RAM3SA3 mutant ra3-ref polypeptide, which has a structural shift after amino acid 249, relative to SEQ ID NO: 19, and a premature stop codon after 305 amino acids. SEQ ID No: 32 is the nucleotide sequence of a transposon element similar to ILS-1 present in the 5'-UTR region of the mutant ra3-feal gene. SEQ ID No: 33 is the nucleotide sequence of an exon7 region in the ra3-feal mutant gene, which contains an insertion of 4 base pairs in relation to the sequence of SEQ ID No: 15. SEQ ID No: 34 is the deduced amino acid sequence of the mutant ra3-feal RAMOSA3 polypeptide, which has a structural shift after amino acid 258 relative to SEQ ID No: 19, and a premature stop codon after 305 amino acids. SEQ ID No: 35 is the nucleotide sequence of an exon6 region of the mutant ra3-EV gene, which contains an insertion of 4 base pairs in relation to SEQ ID No: 15. SEQ ID No: 36 is the sequence deduced from amino acids of mutant RAM0SA3 ra3-EV polypeptide, which has a structural shift after amino acid 224 relative to SEQ ID NO: 19, and a premature stop codon after DE 305 amino acids. SEQ ID No: 37 is the nucleotide sequence of a region of exon 10 of the ra3-NI gene mutant, which contains an insertion of 141 base pairs in relation to SEQ ID No: 15. SEQ ID No: 38 is the deduced sequence of amino acids of the ra3-NI mutant RAMOSA3 polypeptide, having a different amino acid sequence after amino acid 333 relative to SEQ ID No: 19, and a premature stop codon after 335 amino acids. SEQ ID No: 39 is the nucleotide sequence of a region between exon6 and exon7 of the mutant ra3-bre gene, which contains an insertion of 10 base pairs in relation to SEQ ID No: 15. SEQ ID No: 40 is the deduced amino acid sequence of the ra3-mutant RAMOSA3 polypeptide, which has a structural shift after amino acid 241 and a premature stop codon after 243 amino acids. SEQ ID No: 41 is the nucleotide sequence of the exon6 region of the mutant ra3-JL gene, which contains a deletion and rearrangement in relation to SEQ ID No: 15.

SEQ ID No: 42: is the deduced amino acid sequence of mutant RAM0SA3 polypeptide ra3-JL, which has a different protein sequence after amino acid 217 and a codon of premature arrest after 246 amino acids. SEQ ID No: 43 is the nucleotide sequence of an exon6 region of the mutant ra3-NS gene, which contains an insertion of 2 base pairs in relation to SEQ ID No: 15. SEQ ID No: 44 is the sequence deduced from amino acids of mutant RAM0SA3 ra3-NS polypeptide, which has a structural shift after amino acid 222 and a premature stop codon after 299 amino acids. SEQ ID No: 45 is the amino acid sequence of the conserved phosphatase box of "domain A" as described in Vogel et al. (Plant J. 13: 673-683 (1998)) and in U.S. Patent Publication No. 2004-0229364-Al, the entire contents of which are incorporated by reference herein. SEQ ID No: 46 is the amino acid sequence of the conserved phosphatase box of "B domain" as described in Vogel et al. (Plant J. 13: 673-683 (1998)) and in U.S. Patent Publication No. 2004-0229364-Al. SEQ ID No: 47 is the genomic nucleotide sequence containing the BROADCAST gene of RAM0SA3 (SRA). SEQ ID No: 48 is the nucleotide sequence of the region encoding the SRA gene protein. SEQ ID No: 49 is the amino acid sequence of the SRA polypeptide. SEQ ID No: 50 is a nucleotide sequence contained in clone my. csl. pk0072 d4, which is a cDNA clone that contains a fragment of the SRA gene. SEQ ID No: 51 is the amino acid sequence of the rice trehalose-6-phosphate phosphatase polypeptide, corresponding to NCBI Gl No. 33146623. SEQ ID No: 52 is the amino acid sequence for the AtTPPA polypeptide of Arabidopsis, corresponding to NCBI Gl No. 2944178. SEQ ID No: 53 is the amino acid sequence for the Arabidopsis AtTPPB polypeptide corresponding to NCBI Gl No. 2944180. SEQ ID NO: 54 is the amino acid sequence for a trehalose-6 polypeptide corn phosphate phosphatase which is cited as SEQ ID No: 16 in U.S. Patent Publication No. 2004-0229364-Al, the entire contents of which are incorporated by reference herein. SEQ ID No: 55 is the amino acid sequence for a soy trehalose-6-phosphate phosphatase polypeptide, which is cited as SEQ ID No: 20 in U.S. Patent Publication No. 2004-0229364- Al. SEQ ID No: 56 is the nucleotide sequence of the NS487 primer. SEQ ID No: 57 is the nucleotide sequence of primer NS429. SEQ ID No: 58 is the nucleotide sequence of the NS483 primer. SEQ ID No: 59 is the nucleotide sequence of the NS485 primer. SEQ ID No: 60 is the nucleotide sequence of the NS488 primer. SEQ ID No: 61 is the amino acid sequence of the His-tagged RA3 protein, produced in E. coli. SEQ ID No: 61 consists of the N-terminal region of 37 amino acids containing six consecutive histidine residues, followed by 361 amino acids of the RA3 protein (SEQ ID No: 19). SEQ ID No: 62 is the amino acid sequence of the fragment of the TPP domain of His tagged RA3, produced in E. coli. SEQ ID NO: 62 consists of an N-terminal region of 35 amino acids containing six consecutive histidine residues, followed by amino acid residues 78-361 of the RA3 protein (SEQ ID No: 19). SEQ ID No: 63 is the amino acid sequence of the N-terminal fragment of His tagged RA3, produced in E. coli. SEQ ID No: 63 consists of an N-terminal region of 34 amino acids containing six consecutive histidine residues, followed by amino acid residues 1-78 of the RA3 protein (SEQ ID No: 19). SEQ ID No: 64 is the nucleotide sequence of the NS489 primer. SEQ ID No: 65 is the nucleotide sequence of the NS490 primer. SEQ ID No: 66 is the nucleotide sequence of the NS500 primer. SEQ ID No: 67 is the nucleotide sequence of the DNA fragment that codes for a fragment of the domain TPP of RA3, which showed that rescues the growth of the yeast tps2 mutant, at the non-permissive temperature. The SEQ ID No: 67 consists of an ATG start codon followed by nucleotides 235-1086 of SEQ ID No: 18. SEQ ID No: 68 is the amino acid sequence of the TP3 domain fragment of RA3 encoded by SEQ ID No: 67 SEQ ID NO: 68 consists of an initial methionine residue followed by amino acid residues 79-361 of the SEQ ID No: 19. SEQ ID No: 69 is the amino acid sequence of the fragment of the TPP domain of SRA, and corresponds to amino acids 76-370 of SEQ ID No: 49.

SEQ ID NO: 70 corresponds to amino acids 92-385 of SEQ ID No: 52 (AtTPPA of Arabidopsis); this polypeptide fragment has been shown to have enzymatic activity (Vogel et al. (1998) Plant J 13 (5): 673-683). SEQ ID No: 71 corresponds to amino acids 92-374 of SEQ ID No: 53 (AtTPPB of Arabidopsis). The Sequence Listing contains the one-letter code for the characters of the nucleotide sequence and the three-letter codes for the amino acids as defined in accordance with the IUPAC-IUBMB standards described in Nucleic Acids Res. 13: 3021- 3030 (1985) and in the Biochemical J. 219 (2): 345-373 (1984), which are incorporated by reference herein. The symbols and format used for the nucleotide and amino acid sequence data comply with the rules described in 37 C.F.R. Section 1.822. The sequence descriptions and the Listing of Sequences appended hereto, comply with the rules governing the descriptions of nucleotide and amino acid sequences in patent applications as described in 37 C.F.R. Section 1.821-1.825.

DETAILED DESCRIPTION OF THE INVENTION The description of each reference described herein is incorporated by reference herein in its entirety. As used herein in the appended claims, the singular form "a", "an", "an", and "the", "the" includes the plural reference, unless the context clearly dictates otherwise. mode. Thus, for example, the reference "a plant" includes a plurality of such plants, the reference to "a cell" includes one or more equivalent cells thereof, known to those skilled in the art and so on. As used herein: The term "RAM0SA3 (RA3) gene" is a gene of the present invention and refers to a non-heterologous form of a full-length RAM0SA3 polynucleotide (RA3). In a preferred embodiment, the RAM0SA3 gene comprises SEQ ID No: 15 or 18. "RAM0SA3 (RA3) polypeptide" refers to a polypeptide of the present invention and may comprise one or more amino acid sequences, in glycosylated form or not glycosylated In a preferred embodiment, the RAMOSA3 polypeptide (RA3) comprises SEQ ID No: 19. A "RAMOSA3 (RA3) protein" comprises a RAM0SA3 polypeptide (RA3). "RAMOSA3 BROTHERHOOD (SRA) gene" is a gene of the present invention and refers to a non-heterologous form of a full length RAM0SA3 BROADCAST polynucleotide (SRA). In a preferred embodiment, the BROADBAND gene of RAM0SA3 (SRA) comprises SEQ ID Nos: 47 or 48. The "RAM0SA3 BROTHERAD polypeptide (SRA)" refers to a polypeptide of the present invention and may comprise one or more sequences of amino acids, in glycosylated or non-glycosylated form. In a preferred embodiment, the BROADCASTED OF RAM0SA3 (SRA) polypeptide comprises SEQ ID No: 49. A "RAM0SA3 BROADCAST protein (SRA)" comprises a BROADCASTED OF RAM0SA3 (SRA) polypeptide. "Transgenic" includes any cell, cell line, callus, tissue, part of the plant or plant, the genome of which has been altered by the presence of the heterologous nucleic acid, such as a recombinant DNA construct, including those initially altered transgenic as well as those created by sexual crossings or asexual propagation from the initial transgenic. The term "transgenic" as used herein does not cover, the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods, or by events of natural origin such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

"Genome" as it applies to plant cells, encompasses not only the chromosomal DNA found within the nucleus, but also the organelle DNA found within subcellular components (eg, mitochondria, plastids) of the cells. "Plant or vegetable" includes reference to whole plants, plant organs, plant tissues, seeds and plant cells, and their progeny. Plant cells include, without limitation, seed cells, suspension cultures, embryos, meristemic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores. "Progeny" comprises any subsequent generation of a plant. "Transgenic plant" includes the reference to a plant that comprises within its genome, a heterologous polynucleotide. Preferably, the heterologous polynucleotide is stably integrated into the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide can be integrated into the genome alone or as part of a recombinant DNA construct. "Heterologo" with respect to the sequence means a sequence that originates from a strange species or, if it is from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human invention. "polynucleotide", "nucleic acid sequence", "nucleotide sequence", "nucleotide sequence", or "nucleic acid fragment" are used interchangeably and are a polymer of RNA or DNA that are single-stranded or double-stranded , which optionally contain synthetic, non-natural or altered nucleotide bases. Nucleotides (usually found in their 5'-monophosphate form) are referred to by their single-letter designation as follows: "A" for adenylate or deoxyadenylate (for RNA or DNA, respectively), "C" for cytidylate or deoxycytidylate, "G" for guanylate or deoxyguanilate, "U" for uridylate, "T" for deoxythymidylate, "R" for purines (A or G), "Y" for pyrimidines (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and "N" for any nucleotide. "Polypeptide", "peptide", "amino acid sequence" and "protein" are used interchangeably herein, to refer to a polymer of amino acid residues. The terms apply to polymers of amino acids in which one or more amino acid residues are an artificial chemical analogue of a corresponding amino acid of natural origin, as well as polymers of naturally occurring amino acids. The terms "polypeptide", "peptide", "amino acid sequence", and "protein" are also inclusive of the modifications that include, but are not limited to, glycosylation, lipid binding, sulfation, gamma-carboxylation of the glutamic acid residues , hydroxylation and ADP-ribosylation. "Messenger RNA (mRNA)" refers to ribonucleic acid that is without introns and that can be translated into protein by the cell. "cDNA" refers to a deoxyribonucleic acid that is complementary to and synthesized from an mRNA template using the enzyme reverse transcriptase. The cDNA can be single stranded or converted into the double stranded form using the Klenow fragment of DNA polymerase I. "Mature protein" refers to the post-translationally processed polypeptide, for example, one from which any pre- or pro-peptides present in the primary translation product have been removed. The "precursor" protein refers to the main product of the mRNA translation; for example, with pre- and pro-peptides still present. The pre- and pro-peptides may or may not be limited to intracellular localization signaling. "Isolated" refers to materials, such as nucleic acid molecules and / or proteins, that are substantially free or otherwise removed from the components that normally accompany or interact with the materials in an environment of natural origin. The isolated polynucleotides can be purified from a host cell in which they appear naturally. The conventional nucleic acid purification methods, known to those skilled in the art can be used to obtain isolated polynucleotides. The term also encompasses the recombinant polynucleotides and the chemically synthesized polynucleotides. "Recombinant" refers to an artificial combination of two otherwise separated sequence segments, for example, by chemical synthesis or by manipulation of the isolated segments of the nucleic acids by generic engineering techniques. "Recombinant" also includes reference to a cell or vector, which has been modified by the introduction of a heterologous nucleic acid or a cell derived from such a modified cell, but does not encompass alteration of the cell or vector by events of natural origin (for example, spontaneous mutation, natural transformation / transduction / transposition) such as those that appear without deliberate human intervention. "Recombinant DNA construction" refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a recombinant nucleic acid construct can comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a different way than would normally be found In nature . "Regulatory sequences" refer to nucleotide sequences located upstream (non-coding sequences in the 5 'direction) / in or in the 3' direction (3 'non-coding sequences) of a coding sequence, and which influence transcription , RNA processing, or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. "Promoter" refers to a fragment of nucleic acid capable of controlling the transcription of another nucleic acid fragment. "Functional promoter in a plant" is a promoter capable of controlling the transcription of plant cells whether or not their origin is from a plant cell. "Operably linked" refers to the association of nucleic acid fragments in a single fragment, so that the function of one is regulated by the other. For example, a promoter is operably linked to a nucleic acid fragment when it is capable of regulating the transcription of that nucleic acid fragment. "Expression" refers to the production of a functional product. For example, expression of a nucleic acid fragment can refer to the transcription of the nucleic acid fragment (e.g., transcription that results in mRNA or functional RNA) and / or translation of the mRNA into a precursor or mature protein . "Phenotype" means the detectable characteristics of a cell or organism. Introduced "in the context of the insertion of a nucleic acid fragment (e.g., a recombinant DNA construction), within a cell, means" transfection "or" transformation "or" transduction "and includes reference to the incorporation of a nucleic acid fragment within a eukaryotic or prokaryotic cell wherein the nucleic acid fragment can be incorporated into the cell genome (eg, chromosomal, plasmid, plasmid or mitochondrial DNA), converted to an autonomous replicon or transiently expressed (e.g., transfected mRNA) A "transformed cell" is any cell within which a nucleic acid fragment has been introduced (e.g., a recombinant DNA construct.) "Transformation" as used in the present, refers to the stable transformation and transient transformation. "Stable transformation" refers to the introduction of a frag nucleic acid within a genome of a host organism, which results in genetically stable inheritance. Once it is stably transformed, the nucleic acid fragment is stably integrated into the genome of the host organism and any subsequent generation. "Transient transformation" refers to the introduction of a nucleic acid fragment within the nucleus, or organelle containing DNA, of a host organism that results in expression of the gene without genetically stable inheritance. "Allele" is one of several alternative forms of a gene that occupies a given locus on a chromosome. Different alleles of a gene differ in their DNA sequence. When the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant are the same, that plant is homozygous at that locus. If the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant differ, that plant is heterozygous at that locus. If a transgene is present on one of a pair of homologous chromosomes in a diploid plant, that plant is hemizygous at that locus. "Contiguous" refers to a nucleotide sequence that is assembled from two or more constituent nucleotide sequences that share common or overlapping regions of sequential homology. For example, the nucleotide sequences of two or more nucleic acid fragments can be compared and aligned in order to identify common or overlapped sequences. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences (and thus, their corresponding nucleic acid fragments) can be assembled into a single contiguous nucleotide sequence. "Codon degeneracy" refers to the divergence in the genetic code that allows variation of the nucleotide sequence without affecting the amino acid sequence of a coded polypeptide. Accordingly, the present invention relates to any nucleic acid fragment comprising a nucleotide sequence that codes for all or a substantial portion of the amino acid sequence described herein. The person skilled in the art is well aware of the "codon deviation" shown by a specific host cell in the use of the nucleotide codons to specify a given amino acid. Therefore, when a nucleic acid fragment is synthesized for enhanced expression in a host cell, it is desirable to design the nucleic acid fragment such that its codon usage frequency approximates the cell's preferred codon usage sequence. host "Synthetic nucleic acid fragments" can be assembled from oligonucleotide building blocks that are chemically synthesized using methods known to those skilled in the art. These building blocks are ligated and annealed to form larger nucleic acid fragments that can then be enzymatically assembled to construct the desired whole nucleic acid fragment. "Chemically synthesized", as referred to a nucleic acid fragment, means that the nucleotide components were assembled in vitro. Manual chemical synthesis of the nucleic acid fragments can be achieved using well-established procedures, or automated chemical synthesis can be performed using one or more of a number of commercially available machines. Accordingly, the nucleic acid fragments can be designed for optimal expression of the gene, based on the optimization of the nucleotide sequence to reflect the codon deviation of the host cell. The person skilled in the art appreciates the probability of successful expression of the gene if the codon usage is diverted towards those codons favored by the host. The determination of the preferred codons can be based on a monitoring of the genes derived from the host cell, where the sequence information is available. The term "amplified" means the construction of multiple copies of a nucleic acid sequence or multiple copies complementary to the nucleic acid sequence using at least one of the nucleic acid sequences as a template. Amplification systems include the polymerase chain reaction (PCR) system, the ligase chain reaction (LCR) system, the amplification based on nucleic acid sequence (NASBA, Cangene, Mississauga, Ontario), the Replicase Q-Beta systems, the transcription-based amplification system (TAS) , and strand displacement amplification (SDA). See for example, Diagnostic Molecular Microbiology: Principles and Applications, D. H. Persing et al., Ed., American Society for Microbiology, Washington, D.C. (1993). The amplification product is called an amplicon. The term "chromosomal position" includes reference to a length of a chromosome that can be measured by reference to the linear segment of the DNA that it comprises. The chromosomal position can be defined by reference to two unique DNA sequences, for example, the markers. The term "marker" includes reference to a locus on a chromosome, which serves to identify a unique position on the chromosome. A "polymorphic marker" includes reference to a marker that appears in multiple forms (alleles) such that different forms of the marker, when these are present in a homologous pair, allow the transmission of each of the chromosomes in that pair to be followed. . A genotype can be defined by the use of one or a plurality of markers. Sequence alignments and percentage identity calculations can be determined using a variety of comparison methods designed to detect homologous sequences that include, but are not limited to, the Megalign program from the LASARGENE bioinformatics computation site (DNASTAR Inc., Madison , WI). Unless indicated otherwise, the multiple alignment of the sequences provided herein was performed using the Clustal V Alignment Method (Higgins and Sharp (1989) CABIOS 5: 151-153) with the default parameters (PENALTY FOR EMPTY SPACE = 10, PENALTY FOR LENGTH OF EMPTY SPACE = 10). The default parameters for paired alignments and the calculation of the percent identity of the protein sequences using the Clustal Method V are KÁTUPLO = 1, EMPTY SPACE PENALTY = 3, WINDOW = 5 and SAVED DIAGONAL = 5. nucleic acids these parameters are KÁTUPLO = 2, EMPTY SPACE PENALTY = 5, WINDOW = 4 and SAVED DIAGONAL = 4. After the alignment of the sequences, using the Clustal V program, it is possible to obtain the values of "percent identity" and "divergence" when observing the "sequence distance" table on the same program; Unless stated otherwise, the percentage identities and divergences provided and claimed herein were calculated in this manner. Unless indicated otherwise, the "BLAST" sequence identity / similarity values provided herein refer to the value obtained using the BLAST 2.0 program group using the default parameters (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). Software to perform BLAST analyzes is publicly available, for example, through the National Center for Biotechnology Information. This algorithm first involves the identification of high-grade sequence pairs (HSPs) by identifying short words of length W in the search sequence, either matching or satisfying some of the positive value threshold T-ratings, when aligned. to a word of the same length in a sequence of the database. T refers to the neighbor word qualification threshold (Altschul et al., Supra). These initial neighbor word hits act as seeds to initiate searches, to find the HSPs that contain them. Word hits are then extended in both directions along each sequence by as much as the cumulative alignment score that can be increased. The cumulative scores are calculated using, for the nucleotide sequences, the parameters M (reward rating for a pair of residues with agreement, always> 0) and N (penalty rating for residues without concordance, always <0). For the amino acid sequences, a rating matrix is used to calculate the cumulative score. The extension of the word hits in each direction are interrupted when: the cumulative alignment qualification decreases by the amount X from its maximum reached value; the cumulative rating to zero or lower, due to the accumulation of one or more alignments of negative rating residues; or the end of any sequence is reached. The algorithm parameters of BLAST, W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as omissions a word length () of 11, an expectation (E) of 10, a cut of 100, M = 5, N = ~ 4, and a comparison of both strands . For the amino acid sequences, the BLASTP program uses a word length (W) of 3 as an omission, an expectation (E) of 10, and the qualification matrix BLOSUM62 (see Henikoff and Henikoff, Proc. Nati. Acad. Sci USA 89: 10915 (1989)). The standard techniques of recombinant DNA and molecular cloning used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook"). Returning now to the preferred embodiments: The present invention includes the isolated polynucleotides. In a preferred embodiment, an isolated polynucleotide comprises: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V Alignment Method, when compared to SEQ ID No: 19, where the expression of the polypeptide in a plant transformed with the isolated polynucleotide gives as result the alteration of the ramification of the spike, the cob, or both, of the transformed plant when compared to a control plant that does not comprise the isolated polynucleotide; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

Preferably, expression of the polypeptide results in a decrease in the branching of the ear, the ear, or both, and even more preferably, the plant is corn. In another preferred embodiment, an isolated polynucleotide comprises: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V Alignment Method, when compared to SEQ ID No: 19, where the expression of the polypeptide in a plant transformed with the isolated polynucleotide gives as the alteration of the pollen dispersion of the transformed plant results when compared to a control plant that does not comprise the isolated polynucleotide; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. Preferably, expression of the polypeptide results in a decrease in pollen dispersion, and even more preferably, the plant is corn. In another preferred embodiment, an isolated polynucleotide comprises: (a) a nucleotide sequence encoding a polypeptide associated with the branching of the spike, the ear, or both, of a plant (preferably, corn), wherein the polypeptide has an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V Alignment Method, when compare to SEQ ID NO: 19, or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. In another preferred embodiment, an isolated polynucleotide comprises: (a) a nucleotide sequence that encodes a polypeptide associated with the pollen dispersion of a plant (preferably, maize), wherein the polypeptide has an amino acid sequence of at least 80 %, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID No: 19 , or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. A polypeptide is "associated with branching" or "associated with pollen dispersion" since the absence of the polypeptide in a plant results in an increase in the branching or dispersion of pollen from the plant, when compared to a plant that expresses the polypeptide. In another preferred embodiment, an isolated polynucleotide comprises: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID No: 19, wherein the expression of said polypeptide in a plant showing a mutant phenotype of ramosa3 results in a decrease in the branching of the ear, the cob, or both of the plant; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. Preferably, the plant is corn. In another preferred embodiment, an isolated polynucleotide comprises: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID No: 19, wherein the expression of said polypeptide in a plant showing a mutant phenotype of ramosa3 results in a decrease in the pollen dispersion of the plant; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

Preferably, the plant is corn. In another preferred embodiment, an isolated polynucleotide comprises: (a) a nucleic acid sequence encoding a polypeptide having trehalose-6-phosphate-phosphatase activity, wherein the polypeptide has an amino acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V Alignment Method, when compared to SEQ ID Nos: 19, 49, 68 or 69; or (b) a complement of the nucleotide sequence, where the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. Preferably, when compared to SEQ ID Nos: 68 or 69, the polypeptide has an amino acid sequence of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99% or 100% sequential identity, based on Clustal V Alignment Method. The present invention also includes the isolated polypeptides. In a preferred embodiment, an isolated polypeptide comprises an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID No: 19, wherein expression of the polypeptide in a plant transformed with an isolated polynucleotide encoding the polypeptide results in alteration of the spike branching, the cob, or both, of the plant, when compared to a control plant that does not comprise the expressed polypeptide. Preferably, expression of the polypeptide results in a decrease in branching, and even more preferably, the plant is corn. In another preferred embodiment, an isolated polypeptide comprises an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19, wherein the expression of the polypeptide in a plant transformed with an isolated polynucleotide encoding the polypeptide, results in alteration of the pollen dispersion of the polypeptide. plant when compared to a control plant that does not comprise the expressed polypeptide. Preferably, expression of the polypeptide results in a decrease in pollen dispersion, and even more preferably, the plant is corn. In another preferred embodiment, an isolated polypeptide comprises an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the method of Clustal V alignment, when compared to SEQ ID NO: 19, wherein the expression of the polypeptide in a plant showing a mutant ramosa! phenotype results in a decrease in the branching of the spike, the ear or both , of the plant. Preferably, the plant is corn. In another preferred embodiment, an isolated polypeptide comprises an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the method of Clustal V alignment, when compared to SEQ ID NO: 19, wherein the expression of the polypeptide in a plant showing a mutant phenotype ramosa3 results in a decrease in pollen dispersion of the plant. Preferably the plant is corn. Another preferred embodiment included within the present invention is an isolated polypeptide associated with the branching of the ear, the ear or both, of a plant (preferably maize), wherein the polypeptide has an amino acid sequence of at least 80%, %, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19. Another preferred modality is an isolated polypeptide associated with the pollen dispersion of a plant (preferably maize), wherein the polypeptide has an amino acid sequence of at least 80%, 85%, 90%, 95%96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19. Another preferred embodiment is an isolated polypeptide having activity of trehalose-6-phosphate-phosphatase, wherein the polypeptide has an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity , based on the Clustal V alignment method, when compared to SEQ ID NO: 19, 49, 68 or 69. It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment that result in the production of a chemically equivalent amino acid at a given site, but which do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, can be replaced by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine or isoleucine. Similarly, changes that result in a replacement of a negatively charged residue by another, such as aspartic acid with glutamic acid, or a positively charged residue by another, such as lysine by arginine, can also be expected to produce a functionally equivalent product. . The nucleotide changes that result in the alteration of the N-terminal and C-terminal portions of the polypeptide molecule would not be expected to alter the activity of the polypeptide either. Each of the proposed modifications is well within the routine experience in the art, as is the determination of the biological activity retention of the coded products. The present invention also includes a recombinant DNA construct comprising a polynucleotide operably linked to a promoter that is functional in the plant, wherein the polynucleotide comprises an isolated polynucleotide of the present invention, such as a preferred polynucleotide as described above. In a preferred embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to a promoter that is functional in the plant, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 65%, 70%, 75% , 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO : 19, 49, 68 or 69. Preferably, when comparing SEQ ID NO: 68 or 69, the polypeptide has an amino acid sequence of at least 70%, 75%, 80%, 85%, 90%, 95% 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method. In a preferred embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to a promoter that is functional in the plant, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 80%, 85%, 0%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19 The present invention also includes a DNA suppression construct. A deletion construct comprises a promoter functional in a plant, operably linked to (a) all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequential identity, or any whole number up to and including 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19, 49, 68 or 69, or (ii) a full complement of the sequence of nucleic acid of (a) (i); (b) a region derived from all or a part of a strand in the sense or antisense strand of a target gene of interest, the region has a nucleic acid sequence of at least 50% sequential identity, based on the alignment method of Clustal V, when compared to all or part of a strand in sense or antisense strand from which said region is derived, and where the target gene of interest codes for the RAM0SA3 polypeptide (RA3) or a peptide BROTHERAD OF RAMOSA3 (SRA ); or (c) a nucleic acid sequence of at least 50% sequence identity, or any whole number up to and including 100% identity, based on the Clustal V alignment method, when comparing SEQ ID NO: 15, 18, 47, 48 or 67. The DNA suppression construct preferably comprises a co-suppression construct, the antisense construct, the viral suppression construct, the hairpin suppression construct, the stem-loop suppression construct, the double-stranded RNA producing construct, the construction of RNAi, or the construction of small RNA (for example, a siRNA construct or a miRNA construct). As used herein, a "DNA deletion construct" is a recombinant DNA construct that when transformed or stably integrated into the genome of the plant, results in "silencing" of a target gene in the plant . The target gene can be endogenous or transgenic for the plant. "Silencing", as used herein with respect to the target gene, generally refers to the suppression of mRNA levels or protein / enzyme expressed by the target gene, and / or the level of enzyme activity or protein functionality.

The term "suppression" includes reduction, reduction, decline, decrement, inhibition, elimination and prevention. "Silencing" or "gene silencing" does not specify the mechanism and is inclusive, and is not limited to antisense, co-suppression, viral suppression, orifice suppression, stem-loop suppression, procedures based in RNAi, and procedures based on small RNA. A deletion DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or the antisense strand) of the target gene of interest. Depending on the procedure to be used, the region may be 100% identical or less than 100% identical (e.g., at least 50% or any integer between 50% and 100% identical) to all or part of the strand in sense (or the antisense strand) of the gene of interest. Deletion DNA constructs are well known in the art, they are easily constructed once the target gene of interest is selected, and include, without limitation, suppression constructs, antisense constructs, viral suppression constructs, hairpin suppression constructs. , stem-loop suppression constructs, double-stranded RNA production constructs, and more in general, RNAi construction (RNA interference) and small RNA constructs such as siRNA constructions (short interfering RNA) and constructs of miRNA (microRNA). "Antisense inhibition" refers to the production of antisense RNA transcripts, capable of suppressing the expression of the target protein. "Antisense RNA" refers to an RNA transcript that is complementary to all or part of an objective primary transcript or mRNA, and that blocks the expression of an objective isolated nucleic acid fragment (U.S. Patent No. 5,107,065). The complementarity of an antisense RNA can be with any part of the specific gene transcript, for example, in the 5 'non-coding sequence, the 3' non-coding sequence, the introns or the coding sequence. "Cosuppression" refers to the production of RNA transcripts in sense capable of suppressing the expression of the target protein. RNA "in sense" refers to the RNA transcript that includes a mRNA and can be translated into protein within a cell or in vi tro. Cosupression constructions in plants have been previously designed by the approach to over-expression of a nucleic acid sequence that has homology to a natural mRNA, in sense orientation, which results in the reduction of all RNA that has homology for the over-expressed sequence (see Vaucheret et al. (1998) Plant J. 76: 651-659; and Gura (2000) Nature 404: 804-808). A number of promoters can be used in the recombinant DNA constructs and the deletion DNA constructs of the present invention. Promoters can be selected based on the desired result, and can include constitutive, tissue-specific, inducible promoters or other promoters for expression in host organisms. The high-level constitutive expression of the candidate gene, under the control of the 35S promoter, can have pleiotropic effects. However, tissue-specific and / or stress-specific expression can eliminate undesirable effects but retain the ability to improve drought tolerance. This effect has been observed in Arabidopsis (Kasuga et al (1999) Nature Biotechnol 17: 287-91). As such, the efficacy of the candidate gene can be tested when driven by different promoters. Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters described in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al., Nature 313: 810-812 (1985)); rice actin (McElroy et al., Plant Cell 2: 163-171 (1990)); ubiquitin (Christensen et al., Plant Mol. Biol. 12: 619-632 (1989) and Christensen et al., Plant Mol. Biol. 18: 675-689 (1992)); pEMU (Last et al., Theor, Appl. Genet, 81: 581-588 (1991)); MAS (Velten et al., EMBO J. 3: 2723-2730 (1984)); the ALS promoter (U.S. Patent No. 5,659,026), and the like. Other constitutive promoters include, for example, those discussed in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611. In the choice of a promoter for use in the methods of the invention, it may be desirable to use a tissue-specific or developmentally regulated promoter. A preferred tissue-regulated or development-regulated promoter is a DNA sequence that regulates the expression of a DNA sequence selectively in cell / tissues of a plant, critical for the development of the spike, the hardening of the seed, or both, and limits the expression of such DNA sequence to the period of development of the spike or the maturation of the seed in the plant. Any promoter identifiable in the methods of the present invention can be used, which causes the desired temporal and spatial expression. Promoters that are seed or embryo specific and may be useful in the invention include the soy Kunitz trypsin inhibitor (Kti3, Jofuku and Goldberg, Plant Cell 1: 1079-1093 (1989)), patatin (tubers of potato) (Rocha-Sosa, M., et al. (1989) EMBO J. 8: 23-29), convicilin, vicilin, and legume (cotyledons of peas) (Rerie, WG, et al. (1991) Mol. Gen. Genet 259: 149-157; Newbigin, EJ., Et al. (1990) Plant 180: 461-470; Higgins, TJV, et al. (1988) Plant Mol. Biol. 11: 683-695) , zein (corn endosperm) (Schemthaner, JP, et al. (1988) EMBO J. 7: 1249-1255), phaseolin (bean cotyledon) (Segupta-Gopalan, C, et al. (1985) Proc. Acad Sci USA 82: 3320-3324), phytohemagglutinin (bean cotyledon) (Voelker, T. et al. (1987) EMBO J. 6: 3571-3577), B-conglycinin and glycinin (soybean cotyledon) (Chen, ZL, et al. (1988) EMBO J. 7: 297-302), glutelin (rice endosperm), hordein (barley endosperm) (Marris, C, et al. . (1988) Plant Mol. Biol. 10: 359-366), glutenin and gliadin (wheat endosperm) (Colot, V., et al. (1987) EMBO J. 6: 3559-3564), and sporamina (tuberose root of sweet potato or sweet potato) (Hattori, T., et al. (1990) Plant Mol. Biol. 14: 595-604). Promoters of seed-specific genes operably linked to the heterologous coding regions in chimeric gene constructions maintain their temporal and spatial expression pattern in transgenic plants. Such examples include the promoter of the 2S seed storage protein gene from Arabidopsis thaliana to express the enkephalin peptides in seeds of Arabidopsis and Brassica napus (Vanderkerckhove et al., Bio / Technology 7: L929-932 (1989)), bean lectin promoters and bean beta-phaseolin to express luciferase (Riggs et al., Plant Sci. 63: 47-57 (1989)), and wheat glutenin promoters to express chloramphenicol acetyl-transferase (Colot) et al., EMBO J 6: 3559-3564 (1987)). Inducible promoters selectively express an operably linked nucleic acid sequence in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical and / or developmental signals. Induced or regulated promoters include, for example, promoters regulated by light, heat, voltage, flood or drought, phytohormones, wounds, or chemicals such as ethanol, jasmonate, salicylic acid, or insurers. Promoters that are intended for strain include the following: 1) the RD29A promoter (Kasuga et al. (1999) Nature Biotechnol. 17: 287-91); 2) the barley promoter, B22E; the expression of B22E is specific for the pedicel in developing corn grains ("Primary Structure of a Novel Barley Gene Differentially Expressed in Immature Aleurone Layers." Klemsdae, SS et al., Mol. Gen. Genet. 228 (1/2 ): 9-16 (1991)); and 3) the corn promoter, Zag2 ("Identification and molecular characterization of ZAGl, the maize homolog of the Arabidopsis floral homeotic gene AGAMOUS", Schmidt, RJ et al., Plant Cell 5 (7): 729-737 (1993 )). The Zag2 transcripts can be detected 5 days before the pollination of 7 to 8 DAP, and direct the expression in the carpel of developing female inflorescences and Ciml that is specific to the nucleus of developing corn grains. The Ciml transcript is detected 4 to 5 days before pollination from 6 to 8 DAP. Other useful promoters include any promoter that can be derived from a gene whose expression is maternally associated with developing female florets. The promoters can be derived in their entirety from a natural gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of the regulatory sequences have not been fully defined, the DNA fragments of some variation may have identical promoter activity. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". The new promoters of various types useful in plant cells are constantly being discovered; numerous examples can be found in the compilation by Okamuro, J. K., and Goldberg, R. B., Biochemistry of Plants 15: 1-82 (1989). Particularly preferred promoters may include: RIP2, mLIPl5, ZmCORl, Rabl7, CaMV 35S, RD29A, SAM-synthetase, ubiquitin, CaMV 19S, nos, Adh, sucrose-synthase, R-allele or root cell promoter. Recombinant DNA constructs and deletion DNA constructs of the present invention may also include other regulatory sequences, including but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In another preferred embodiment of the present invention, a recombinant DNA construct of the present invention further comprises an enhancer or silencer. An intron sequence can be added to the 5 'untranslated region or the coding sequence of the partial coding sequence to increase the amount of mature message that accumulates in the cytosol. The inclusion of a spliceable intron in the transcription unit in the plant and in the animal expression constructs have been shown to increase the expression of the gene at the level of mAR and at the level of the proteins up to 1000 times. Buch an and Berg, Mol. Cell Biol. 8: 4395-4405 (1988); Callis et al., Genes Dev. 1: 1183-1200 (1987). Such an intron increase in gene expression is typically greater when placed near the 5 'end of the transcription unit. The use of corn introns (Adh-lS intron 1, 2 and 6, Bronze intron-1 are known in the art.) See generally, The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, New York (1994) If expression of the polypeptide is desired, it is desirable to generally include a polyadenylation region at the 3 'end of a polynucleotide coding region.The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or T-DNA, the sequence at the 3 'end that is going to be added can be derived from, for example, the genes of nopalin-synthase or octopin synthase, or alternatively of another plant gene, or less preferably of any other eukaryotic gene. A translation leader sequence is a DNA sequence located between the promoter sequence of a gene and the coding sequence. The translation guide sequence is present in the fully processed mRNA with the 5 'address of the translation start sequence. The translation leader sequence may affect the processing of the primary transcript to the mRNA, the stability of the mRNA, or the translation efficiency. Examples of translation guide sequences have been described (Turner, R. and Foster, G.D. (1995) Molecular Biotechnology 3: 225). Any plant can be selected for the identification of regulatory sequences and genes to be used in the creation of the recombinant DNA constructs and deletion DNA constructions of the present invention. Examples of suitable plant targets for the isolation of genes and regulatory sequences could include but are not limited to alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blackberry blue, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, castor bean, cauliflower, celery, cherry, chicory, coriander, citrus, clementine, clove, coconut, coffee, corn, cotton, cranberry, cucumber, Douglas fir, eggplant, endives, escarole, eucalyptus, fennel, figs, garlic, zucchini, grape, grapefruit, honeydew, jicama, kiwi, lettuce, leeks, lemon, lime, loblolly pine, flax seed, mango, melon , mushrooms, nectarine, walnut, oats, oil palm, rapeseed oil, okra, olive, onion, orange, an ornamental plant, palm, papaya, parsley, chiviria, pea, peach, peanut, pear, pepper, persimmon , pine, pineapple, banana, plum, pomegranate, al master white, potato, pumpkin, quince, radiated pine, radiscchio, radish, rapeseed, raspberry, rice, rye, sorghum, southern pine, soybean, spinach, zucchini, strawberry, sugar beet, cane sugar, sunflower , sweet potato, ocozol, tangerine, tea, tobacco, tomato, triticali, turf, turnip, vine, watermelon, wheat, yams, zucchini and zucchini. Particularly preferred plants for the identification of the regulatory sequences are Arabidopsis, corn, wheat, soybeans and cotton. The present invention also includes a plant comprising in its genome a recombinant DNA construct of the present invention (such as a preferred construct discussed above).

Preferably, the recombinant DNA construct is stably integrated into the genome of the plant. The present invention also includes a plant whose genome comprises a disturbance (e.g., an insertion, such as a transposable element, or sequence mutation) of at least one gene (which may be heterologous or endogenous to the genome) that codes for a polypeptide selected from the group consisting of a RAM0SA3 polypeptide (RA3) or a RAM0SA3 BROTHERHOOD polypeptide (SRA).

Also included in the present invention are any progeny of a plant of the present invention, and any seed obtained from such a plant or its progeny. Progeny includes subsequent generations obtained by self-pollination or external cross-breeding of a plant. The progeny also includes hybrids and inbred individuals. Preferably, crops propagated by hybrid seeds, mature transgenic plants can be cross-linked to produce a homozygous inbred plant. The inbred plant produces seeds that contain the newly introduced recombinant DNA construct. These seeds can be developed to produce plants that could show increased tolerance towards drought, or used in a breeding program to produce hybrid seeds, which can be developed to produce plants that could show increased tolerance towards drought. Preferably, the seeds are corn. Preferably, a plant of the present invention is a monocotyledone or dicotyledonous plant, more preferably, a corn or soybean plant, even more preferably a corn plant, such as a hybrid corn plant or an inbred maize plant. The plant can also be sunflower, sorghum, barley, wheat, alfalfa, cotton, rice, barley or millet.

Particularly preferred embodiments of the plants of the present invention include: 1. A plant (preferably maize or soybean, more preferably a plant showing a mutant phenotype of ramosa3) comprising in its genome a recombinant DNA construct comprising an isolated polypeptide which has an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when it is compared to SEQ ID NO: 19, where the plant shows alteration (preferably a decrease) of the branching of the spike, the ear or both, of the plant when compared to a control plant that does not comprise the construction of DNA recombinant. 2. A plant (preferably corn or soybean, more preferably a plant showing a mutant phenotype of ramosa3) comprising in its genome a recombinant DNA construct comprising an isolated polypeptide having an amino acid sequence of at least 80%, %, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19, where the plant shows alteration (preferably a decrease) in pollen dispersion of the plant when compared to a control plant that does not comprise the construction of recombinant DNA. 3. A plant (preferably corn or soybean, more preferably a plant showing a mutant phenotype of ramosa3) comprising in its genome a recombinant DNA construct comprising an isolated polypeptide having an amino acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to the SEQ ID NO: 19, 49, 68 or 69, wherein the plant shows increased activity of trehalose-6-phosphate-phosphatase when compared to a control plant that does not comprise the construction of recombinant DNA. 4. A plant (preferably corn or soybean, more preferably a plant showing a mutant phenotype of ramosa3) comprising in its genome a recombinant DNA construct comprising an isolated polypeptide having an amino acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compares to SEQ ID NO: 19, 49, 68 or 69, wherein the plant shows increased tolerance to environmental stress (preferably drought tolerance) when compared to a control plant that does not comprise the construction of recombinant DNA. 5. A plant (preferably corn or soybean) comprising in its ge: a DNA suppression construct comprising a functional promoter in a plant operably linked to: (a) all or part of (i) a nucleic acid sequence that encodes a polypeptide having an amino acid sequence of at least 50% sequential identity, or any integer up to and including 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19, 49, 68 or 69, or (ii) a complete complement of the nucleic acid sequence of (a) (i); or (b) a region derived from all or part of a strand in the sense or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequential identity, based on the method of alienation Clustal V, when compared to all or part of a strand in sense or antisense strand from which the region is derived, and wherein the target gene of interest codes for a peptide selected from the group consisting of a RAMOSA3 polypeptide ( RA3) or a RAMOSA3 BROTHERHOOD polypeptide (SRA), and wherein the plant shows increased branching of the ear, the ear or both, and / or increased pollen dispersion, and / or reduced activity of trehalose-6-phosphate- phosphatase, compared to a control plant that does not comprise the construction of deletion DNA. The DNA suppression construct preferably comprises a co-suppression construct, antisense construct, viral suppression construct, hairpin suppression construct, stem-loop suppression construct, double-stranded RNA production construct, RNAi construction, or small RNA construction (eg, a siRNA construct or a miRNA construct). 6. A plant (preferably corn or soybean) whose genome comprises a disturbance (e.g., an insertion, such as a transposable element, or sequential mutation) of at least one gene (which may be heterologous or endogenous to the genome) encodes a polypeptide selected from the group consisting of a RAMOSA3 polypeptide (RA3) or a BROTHERHOOD OF RAMOSA3 (SRA), wherein the disturbance results in the plant showing increased branching of the ear, the ear or both, and / or increased pollen diffusion, and / or reduced activity of trehalose-6-phosphate-phosphatase, when compared to a control plant that does not comprise the disturbance. Preferably, with respect to SEQ ID NO: 15, the disturbance comprises any of the inserts shown in SEQ ID NOs: 30, 32, 33, 35, 37, 39 or 43, or the deletion and rearrangement shown in SEQ ID NO: 41. 7. Any progeny of plants 1-6 above, any seeds of plants 1-6 above, any progeny seeds of plants 1-6 above, and cells from any of the plants 1-6 previous and the progeny. The present invention also includes methods for altering the branching of the ear, the ear or both, of a plant; methods to alter the dispersion of pollen from a plant; methods for altering the activity of trehalose-6-phosphate-phosphatase in a plant; and methods to increase tolerance to environmental stress (preferably drought tolerance) in a plant. Preferably, the plant is a monocot or dicot plant, more preferably a corn or soybean plant, even more preferably a corn plant. The plant can also be sunflower, sorghum, barley, wheat, alfalfa, cotton, rice, barley or millet. In a preferred embodiment, a method for altering the branching of the ear, the ear or both of a plant, comprises: (a) introducing into a regenerable plant cell, a recombinant DNA construct to produce transformed plant cells, the construction of Recombinant DNA comprises a polynucleotide operably linked to a promoter that is functional in a plant, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97 %, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19; and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in the branching of the spike, the cob or both, when compared to the control plant that does not include the construction of recombinant DNA. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. Preferably, the transgenic plant or the progeny thereof shows a reduction in the branching of the spike, the ear or both. In another preferred embodiment, a method for altering the pollen dispersion of a plant comprises: (a) introducing into a regenerable plant cell, a recombinant DNA construct to produce transformed plant cells, the recombinant DNA construct comprises an operably polynucleotide linked to a promoter that is functional in a plant, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99 % or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19; and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in pollen dispersion, when compares the control plant that does not include the construction of recombinant DNA. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. Preferably, the transgenic plant or the progeny thereof shows a decrease in pollen dispersion. Another preferred method of the present invention is a method for altering the activity of trehalose-6-phosphate-phosphatase in a plant, comprising: (a) introducing into a regenerable plant cell, a recombinant DNA construct to produce transformed plant cells , the recombinant DNA construct comprises a polynucleotide operably linked to a promoter that is functional in a plant, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19, 49 , 68 or 69; and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in the activity of trehalose-6. phosphate phosphatase when compared to a control plant that does not comprise the construction of recombinant DNA. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. Preferably, the transgenic plant or the progeny thereof shows an increase in the activity of trehalose-6-phosphate-phosphatase. In another preferred embodiment, a method for increasing tolerance to environmental stress (preferably drought tolerance) comprises: when compared to the control plant that does not comprise the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. Preferably, the transgenic plant or the progeny thereof shows an increase in tolerance to environmental stress (preferably drought tolerance), when compared to a control plant that does not comprise the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. In another preferred embodiment, a method for increasing the branching of the spike, the ear or both, and / or for increasing pollen dispersion and / or for reducing the activity of trehalose-6-phosphate-phosphatase in a plant comprises: ( a) introducing into a regenerable plant cell, a DNA suppression construct to produce the transformed plant cells, the DNA construct comprises a functional promoter in a plant operably linked to (i) all or part of (A) a sequence of nucleic acid encoding a polypeptide having an amino acid sequence of at least 50% sequential identity, or any integer up to and including 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19, 49, 68 or 69, or (B) a complete complement of the nucleic acid sequence of (i) (A), or (ii) a region derived from all or a portion of a strand in sense or strand tisentido of a target gene of interest, the region has a nucleic acid sequence of at least 50% sequential identity, based on the Clustal V alignment method, when compared to all or part of a strand in sense or strand antisense from which said region is derived, and wherein the target gene of interest codes for a polypeptide selected from the group consisting of a RAM0SA3 polypeptide (RA3) or a RAM0SA3 BROTHERHOOD polypeptide (SRA); and (b) the regeneration of a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of deletion DNA, and wherein the transgenic plant shows increased branching of the ear, the ear or both , and increased pollen diffusion, and / or reduced activity of trehalose-6-phosphate-phosphatase, when compared to a control plant that does not comprise the construction of deletion DNA. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of deletion DNA. The introduction of the recombinant DNA constructs of the present invention into plants can be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, transfer of Vector-mediated DNA, bombardment, or transformation mediated by Agrobacterium. Preferred techniques are described later in Example 6 for the transformation of maize plant cells, and in Example 7 for the transformation of soybean plant cells. Other preferred methods for transforming dicots, mainly by the use of Agrobacterium tumefaciens, and obtaining transgenic plants, include those published for cotton (U.S. Patent No. 5,004,863, U.S. Patent No. 5,159,135, U.S. Pat. 5,518, 908); soybeans (U.S. Patent No. 5,569,834, U.S. Patent No. 5,416,011, McCabe et al., BiolTechnology 6: 923 (1988), Christou et al., Plant Physiol. 87: 671 674 (1988 )); Brassica (U.S. Patent No. 5,463,174); peanut (Cheng et al., Plant Cell Rep. 15: 653-657 (1996), McKently et al., Plant Cell Rep. 14: 699-703 (1995)); papaya; and pea (Grant et al., Plant Cell Rep. 15: 254258, (1995)). The transformation of monocotyledons using electroporation, particle bombardment and Agrobacterium, have also been reported and are included as preferred methods, for example, transformation and plant regeneration as achieved in asparagus (Bytebier et al., Proc. Nati. Acad. Sci. (USA) 84: 5354, (1987)); barley (Wan and Lemaux, Plant Physiol 104: 37 (1994)); Zea mays (Rhodes et al., Science 240: 204 (1988), Gordon-Kamm et al., Plant Cell 2: 603 618 (1990), Fromm et al., BiolTechnology 8: 833 (1990), Koziel et al. , BiolTechnology 11: 194, (1993), Armstrong et al., Crop Science 35: 550557 (1995)); oats (Somers et al., BiolTechnology 10: 1589 (1992)); orchard grass (Horn et al., Plant Cell Re. 7: 469 (1988)); Rice (Toriyama et al., TheorAppl., Genet., 205: 34, (1986), Part et al., Plant Mol. Biol. 32: 1135-1148, (1996), Abedinia et al., Aust. J. Plant Physiol. 24: 133 141 (1997), Zhang and Wu, Theor, Ap.l Genet, 76: 835 (1988), Zhang et al, Plant Cell Rep. 7: 379, (1988), Battraw and Hall, Plant Sci. : 191 202 (1992); Christou et al., Bio / Technology 9: 957 (1991)); rye (De la Pena et al., Nature 325: 274 (1987)); sugarcane (Bower and Birch, Plant J. 2: 409 (1992)); high canker (Wang et al., BiolTechnology 10: 691 (1992)), and wheat (Vasil et al., Bio / Technology 10: 667 (1992), U.S. Patent No. 5, 631, 152). There are a variety of methods for the regeneration of plants from plant tissue. The particular method of regeneration will depend on the initial plant tissue and the particular plant species to be regenerated. The regeneration, development and cultivation of plants from protoplast transformants of single plants, or from various transformed explants, is well known in the art (Weissbach and Weissbach, in: Methods for Plant Molecular Biology, (Eds.), Academic Press, Inc. San Diego, CA, (1988)). This process of regeneration and growth typically includes the steps of selecting the transformed cells, cultivating those individualized cells through the usual stages of embryonic development through the rooted seedling stage. Transgenic embryos and seeds are similarly regenerated. Thereafter the resulting transgenic rooted shoots are planted in a suitable plant growth medium, such as soil. The development or regeneration of plants containing the isolated, exogenous, foreign nucleic acid fragment encoding a protein of interest is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, the pollen obtained from the regenerated plants is crossed to the plants developed with seed of agronomically important lines. Conversely, pollen from the plants of these important lines is used to pollinate the regenerated plants. A transgenic plant of the present invention that contains a desired polypeptide is cultured using methods well known to a person skilled in the art. Assays to detect proteins can be performed by SDS-polyacrylamide gel electrophoresis or immunological assays. Assays for detecting the levels of substrates or enzyme products can be performed using gas chromatography or liquid chromatography for separation and UV or visible spectrometry, or mass spectrometry for detection, or the like. The determination of the mRNA levels of the enzyme of interest can be achieved using Northern blotting techniques or RT-PCR. Once the plants have been regenerated, and the progeny plants homozygous for the transgene have been obtained, the plants will have a stable phenotype that will be observed in similar seeds in the last generations. The present invention also includes a method for determining whether a plant shows a mutant genotype of ramosa3 comprising: (a) isolating genomic DNA from a subject; (b) performing a PCR on the isolated genomic DNA using the pair of primers consisting of NS432 (SEQ ID NO: 16) and NS411 (SEQ ID NO: 17); and (c) analyzing the results of the PCR for the presence of a larger DNA fragment as an indication that the subject shows the mutant genotype of ramosa3. Also included in the present invention is a method for determining whether a plant shows a mutant genotype of ramosa2 comprising: (a) isolating the genomic DNA of a subject; (b) performing a PCR on the isolated genomic DNA using any of the following primer pairs: SEQ ID NOs: 16 and 17; SEQ ID NOs: 20 and 21; SEQ ID NOs: 22 and 23; SEQ ID NOs: 24 and 25; SEQ ID NOs: 26 and 27 or SEQ ID NOs: 28 and 29; and (c) analyzing the PCR results for the presence of a larger or smaller DNA fragment, relative to a non-mutant fragment, as an indication that the subject shows the mutant genotype of ramosa3. Yet another method included in the present invention is a method for selecting a first maize plant by marker-assisted selection of a quantitative trait locus ("QTL") associated with the branching of the ear, the ear or both, the method comprises: determining the presence of a locus in the first maize plant, wherein the locus hybridizes with a first nucleic acid that is genetically linked to a nucleic acid sequence having at least 90% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 15; and selecting the first maize plant containing the locus that hybridizes with the first nucleic acid; whereby the maize plant containing a QTL associated with the branching of the spike, the ear or both is selected. As described above, the present invention includes, among other things, compositions and methods for modulating (e.g., increasing or decreasing) the level of polypeptides of the present invention in plants. In particular, the polypeptides of the present invention can be expressed at developmental stages, in tissues and / or in amounts that are not characteristic of non-recombinantly engineered plants. In addition to altering (increasing or decreasing) branching, pollen dispersion or trehalose-6-phosphate-phosphatase activity, it is believed that by increasing or decreasing the level of the polypeptides of the present invention in plants, this may also have an impact on yield, by altering the numbers of fruits and seeds produced by the inflorescences (due to extra ramifications) or by making the plants more compact, allowing them to be developed under strict conditions, for example, plants at high density or under of adverse weather, such as drought. Thus, the present invention also provides utility in such exemplary applications as an improvement in performance or growth under stressful conditions. The isolated nucleic acids and proteins, and any embodiments of the present invention can be used in a wide range of plant types, particularly monocotyledons, such as the Graminiae Family species including Sorghum bicolor and Zea mays. The isolated nucleic acid and the proteins of the present invention can also be used in species from the genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisu, Phaseolus, Lolium, Oryza, Oats, Hordeum, Sécale, Triticum, Bambusa, Dendrocalamus, and Melocanna.

EXAMPLES The present invention is further illustrated in the following Examples, in which the parts and percentages are by weight, and the degrees are Celsius, unless otherwise indicated. It should be understood that these examples, while indicating the preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these examples, a person skilled in the art can find out the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to the various uses and conditions. Thus, various modifications of the invention in addition to those shown and described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.

EXAMPLE 1 Phenotypic analysis of the ra3 mutants A mutant line with branched inflorescences was isolated in a non-targeted Mutator (Mu) transposon marker family, and was found to be an allele of ramosa3 (ra3). Although ra3 is a classical maize mutant, first described in 1954 by H. S. Perry (see also, Table 1 of Veit et al, Plant Cell 5: 1205-1215 (1993)), it had not been characterized in detail. Only the mature inflorescence phenotype had been reported, and there was some confusion regarding the position of the map, as explained later in Example 2. To analyze the ra3 mutant phenotypes, the reference allele plants ra3 (ra3-re £ "Maize Genetics CoOp Stock Center) were introgressed in B73 for at least 3 generations.During the vegetative development, no differences were observed in the ra3 plants compared to the wild type relatives.In the inflorescence stage, the ra3 mutants had long, irregular branches on the ears, while the wild-type relatives had a more compact and organized rachis, and rows of irregular seeds were present in contrast to the neatly organized rows on the wild-type ears. 1D As shown in Figures 1A-1D, the wild type ear (Fig. 1A) has perfectly arranged rows and does not it has long branches, whereas the ra3 mutant ears (fig. IB) have long branches and irregular rows of grain. Occasionally, the ra3 ears are covered in long branches (Figure IB, right). The wild-type spikes usually have long branches at their base (Figure 1C), and the spikes of the ra3 mutant (Figure ID) have more branches. The ra3 maize cobs also had "mouth to bottom" or inverted embryo orientations, which may indicate indeterminacy on the spikelet axis. These defects in ra3 ears were usually observed only at the base, although occasionally the ears were irregularly branched along their entire length (Figure IB). As in the ear, the spikes of ra3 had more ramifications than the spikes of wild type, although in general the defects in the development seemed to be milder than in the ears.

To determine how these defects arise in mature inflorescences, scanning electron microscopy (SEM) was used to follow the early development of the ear and ear. The development of the ears is described as follows. During the stage of vegetative transition to inflorescence, there was no difference between ra3 and the wild type (Figure 2A, 2E), and the meristem of the ra3 inflorescence (IM) initiated the meristems in spikelet pairs (SPMs) as in the wild type (Figure 2B, 2F). The first defects that were observed in the immature rag pods were the enlarged SPMs of irregular size, when the primordia of the ear were around 1.5 mm in length. A little later in the development, when ear primordia were around 2 m in length, the conversion of SPMs to indeterminate meristems that produce additional SPMs was observed (Figure 2F, arrow 1). Because of this the SPM produced additional SPMs, which we chose to call it "branching meristem *" (BM *), to reflect its similarity to the BMs at the base of the normal spikes. As the ear development proceeded, the ra3 SPMs elaborated 3 to 4 glumes before conversion to a BM * (Figure 2G, arrows 2), whereas the wild type SMs elaborated only 2 glumes that subtended the SM (arrows 2, Figure 2C). Sometimes, the floral meritems (FMs), instead of the SMs, were produced within these extra glumes in the ra3 mutants (Figure 2G). In summary, the SPMs that became BM * in ra3 ears had two possible identities, SPM * or a mixture of SPM and SM (SPM * + SM *). In this scheme, SPM * produced several glumes that contained only SPMs and SMs, while "SPM * + SM *" produced several glumes that subtend the FMs. The SMs of the ra3 mutant also showed other types of identity defects. For example, these often produced multiple FMs (arrows 3, Figure 2H), while wild type SMs produced only two FMs. The SMs of the ra3 mutant can even be converted to BM * identity after elaborating several FMs. As in the mature ears (Figures 1A-1D), usually only the meristems in the lower half of the ear showed these defects. In spikes of ra3, similar developmental defects were observed as in ra3 ears. For example, these also produced more indeterminate SPMs. This resulted in approximately double the number of long branches in the spikes of ra3 (wild type 6.8 ± 1.4; ra3 13.6 ± 2.8 branches). In summary, ra3 ears and ears showed a range of phenotypic defects; A summary for the cob is presented in Figure 3. The analysis of the development showed that ra3 generally works to impose the determination and identity on different types of meristem in the inflorescences. Although the IMs are normal, the SPMs, SMs and FMs are all more indeterminate in the ra3 mutants compared to the wild type.

EXAMPLE 2 Mapping and Isolation of ra3 According to the genetic map of available maize, in 2004, in Maize Genetics and Genomics Datábase, (Data Base of Genetics and Genomics of Maize) ra3 was listed as mapped to chromosome 4; however, we were unable to reproduce those results. To address this discrepancy, the ra3 and relative DNAs were provided for analysis by the Missouri Maize Mapping Project [Coe, E., Cone, K., McMullen, M., Chen, SS, Davis, G., Gardiner, J., Liscum, E., Polacco, M., Paterson, A., Sanchez-Villeda, H., Soderlund, C, and Wing, R., Access to the maize genome: an integrated physical and genetic map. Plant Physiol, 2002. 128 (1): p. 9-12.]. Using bulk segregating analysis, ra3 was mapped to chromosome 7, tray 4. For more detailed mapping studies, larger mapping populations were constructed using the ra3-ref allele and one allele ("ra3-feal") that was isolated of a Mu line that carries a cob mutant with fringe (feal.

[Jackson, D. and Hake, S. (The genetics of ear fasciation in maize, Maize Genetics Cooperation Newsletter, 1999. 73: p.2]). The ra3 and feal mutations were separately segregated in this line, indicating that these mutations are in different genes. F2s from each ra3 allele crossed to B73 were performed, and high-resolution mapping was conducted using single-sequence repeat (SSR), restriction fragment length polymorphism (RFLP), cleaved amplified polymorphic sequences (CAPS) and the derived CAPS markers (dCAPS) (Figure 4). By analysis of the 74 mutants ra3-ref in F2, a recombination between the marker csu597 (SEQ ID NOs: 1 and 2) and ra3 and two recombinants in different individuals between marker umcl412 (SEQ ID NOs: 3 and 4) and ra3 were identified, placing the ra3 locus between these two markers. To further delimit the ra3 region (a larger number of recombinants was selected, and new CAPS markers, al4 (SEQ ID NOs: 5 and 6) and n20 (SEQ ID NOs: 7 and 8) were created using the BAC extreme sequences that They cover part of the ra3 region DNA amplified from ra3-ref and B73 using these groups of primers gave polymorphisms when they were digested with Fokl for al4 and Hindi for n20.New recombinants of the 873 mutants of ra3 between al4 and ra3, and 10 recombinants between n20 and ra3 were obtained The number of crosses indicated that the genetic distance between ra3 and al4 was 0.7 ± 0.2 cM and the genetic distance between ra3 and n20 was 0.6 ± 0.2 cM This region of the corn genome was covered by three clones BAC, C0387K01, D0505C08 and B0063D15 [Cone, KC et al., Genetic, physical, and informatics resources for maize, On the road to an integrated map, Plant Physiol, 2002. 130 (4): p. 1598-605] New markers were elaborated from these BACs through the selection of non-repetitive DNA fragments. Southern Blot analyzes were performed on each BAC clone digested with several restriction enzymes, and the blot was first probed with corn genomic DNA, and after imaging, probed again with the BAC DNA. After comparison of the two images of the transfer, the bands that had a signal with the hybridization were identified, but not with the hybridization of the total genomic DNA. These bands were classified as non-repetitive, and designated as "cold bands" (see Figures 4A-4B). These cold bands were used either as RFLP probes or, after sequencing, were converted to d-CAPS markers. The d-CAPS marker, cb.glE, was made from the cold band sequence e; the forward and reverse primers for cb.glE are given as SEQ ID NO: 9 and SEQ ID NO: 10 respectively. Using these additional markers, it was determined that the ra.3 locus was placed on BAC c0387K01 (Figures 4A-4B). The nucleotide sequence of BAC c0387K01 was determined and this sequence information was used to design primers for DNA amplification from the early identified recombinants. NS346 (SEQ ID NO: 11) and NS347 (SEQ ID NO: 12) were a pair of primers; NS362 (SEQ ID NO: 13) and NS363 (SEQ ID NO: 14) was a second primer pair. These two pairs of primers were used to generate PCR product length polymorphisms, which were used to delineate the ra3 locus to a single predicted gene (Figure 4).

EXAMPLE 3 Structure of the RA3 and SRA Gene and Phylogenetic Analysis The nucleotide sequence shown in SEQ ID NO: 15 was deduced from BAC C038K01, and it codes for the RA3 gene with 3 kb of the sequence with the 5 'direction of the start codon ATG, and 7.5 kb with 3 'direction of the TGA stop codon. Note that the exons in SEQ ID NO: 15 are shown only for the region from the start codon to the stop codon, and are not shown for the 5 'or 3' untranslated regions (5'- and 3'- U Rs). The cDNA sequence corresponding to the RA3 region was isolated by reverse transcription of poly (A) -RNA followed by PCR. The Quiagen QneStep RT-PCR equipment was used according to the manufacturer's specifications. The group of primers used was NS432 (SEQ ID NO: 16) and NS411 (SEQ ID NO: 17). SEQ ID NO: 18. SEQ ID NO: 18 is the nucleotide sequence of the region encoding the protein, deduced from the PCR product obtained using the primers NS432 and NS411. The corresponding amino acid sequence of the RAM0SA3 polypeptide is shown in SEQ ID NO: 19. The RA3 gene codes for a predicted protein of 361 amino acids with significant similarity to trehalose-6-phosphate-phosphatases (TPPs). The predicted polypeptide has a non-conserved N-terminal region of -80 amino acids, followed by the TPP domain containing two "phosphatase boxes" (see Figure 5, part A, region marked "3") [Goddijn, OJ and van Dun , K., Trehalose metabolism in plants. Trends Plant Sci, 1999. 4 (8): p. 315-319; Thaller, M. C, Schippa, S., and Rossolini, G. M., Conserved sequence motifs among bacterial, eukaryotic, and archaeal phosphatases that define a new phosphohydrolase superfamily. Protein Sci, 1998. 7 (7): p. 1647-52; Vogel, G., Aeschbacher, R.A., Muller, J., Boller, T., and Wiemken, A., Trehalose-6-phosphate-phosphatases from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant. Plant J, 1998. 13 (5): p. 673-83]. Figure 5, A contains a "domain A" (SEQ ID N: 45) and a "B domain" (SEQ ID NO: 46), as designated by Vogel et al. (1998) Plant J 13 (5): 673-83. RA3 is very similar in the TPP domain to the functional TPPs, AtTPPA and AtTPPB, of Arabidopsis, and the A and B doniins of RA3 and AtPPB are identical. In a comparison of TPP proteins from plants to the corresponding yeast protein, RA3 is effectively more similar to yeast TPS2 than it is to Arabidopsis AtTPPA (20% versus 16% identity). Adjacent to RA3, there was a highly similar gene, which was designated HERMANDAD DE RAMOSA3 (sister of RAMOSA3) (SPA). The genomic DNA sequence containing the SRA gene is shown in SEQ ID NO: 47. The nucleotide sequence of the region encoding the SRA gene protein is shown in SEQ ID NO: 48, and the corresponding amino acid sequence of the SRA polypeptide is shown in SEQ ID NO: 49. A cDNA clone, my.csl.pk0072.d4, was prepared from RNA isolated from the leaf and sheath of plants of Zea ays L. of 5 weeks of age, and contains a fragment of the S.RA. Part of the nucleotide sequence of the cDNA insert of clone my. csl. pk0072 d4 is presented in SEQ ID NO: 50. In the region of synteny conserved in rice, only a single rice TPP gene, gi33146623 (SEQ ID NO: 43), is found. RA3 and SRA have 60.4 and 59.3% general sequential identity, respectively, with TPP of rice (Table 1). Genbank and the root sequence assemblies available from Maize Genetics and Genomics Datábase and at The Institute for Genomic Research Maize Datábase were examined for the presence of homologs closely related to RA3 and SRA. Because the corn proteins are not yet annotated, we will call them "Similar to ZmRA3" ("ZmRA3L"). A phylogenetic analysis of the TPP genes of Arabidopsis, rice and maize are shown in the neighboring union tree (Figure 5, part B) [Swofford, D., PAUP-A COMPUTER-PROGRAM FOR PHYLOGENE IC INFERENCE USING MAXIMUM PARSIMONY. JOURNAL OF GENERAL PHYSIOLOGY, 1993. 102: p. A9]. The tree indicates that RA3, SRA and gi33146623 (SEQ ID NO: 43) are more closely related, and RA3 and SRA are probably paralogs. TPPB, a functional TPP of Arabidopsis (Atlg78090; SEQ ID NO: 53 corresponding to NCBI Gl NO. 2944180) is the most closely related Arabidopsis protein. Figures 6A-6D show sequence alignment of the amino acid sequence for the following trehalose-6-phosphate-phosphatases: RA3 (SEQ ID NO: 19); SRA (SEQ ID NO: 49); Rice TPP (SEQ ID NO: 51); Arabidopsis TPPA (SEQ ID NO: 52); TPPB of Arabidopsis (SEQ ID NO: 53); Corn TPP (SEQ ID NO: 54); and soybean TPP (SEQ ID NO: 55). Also shown are the alignments with two truncated forms of TPPA and TPPB of Arabidopsis, in which the N-terminal 91 amino acids have been removed each. An asterisk above an amino acid residue indicates that the position is fully conserved between the SEQ ID NOs, given, with respect to the AtTPPB sequence of Arabidopsis thaliana. Below the sequences are shown two domains, A and B, which are conserved among the trehalose-6-phosphate-phosphatases, as described in Vogel et al. (1998) Plant J 13 (5): 673-683. The sequence given for each conserved domain is taken from the amino acid sequence of AtTPPB of Arabidopsis thaliana at these positions. Figures 6A-6D indicate that regions of high sequence similarity are located at 70% carboxyl-terminal of the consensus sequence. Vogel et al. have noted that the AtTPPA and AtTPPB proteins have high sequence conservation toward each other except for the 100 amino-terminal amino acids, which they noticed have features in common with the chloroplast transit peptides. Vogel et al. have shown enzymatic activity for AtTPPA, AtTPPB and a truncated AtTPPA polypeptide that is lacking the first 91 amino acids. The data in Table 1 show the percent identity for each pair of amino acid sequences of the group consisting of SEQ ID NOs: 19, 49, 51, 52, 53, 54, 55, an enzymatically active fragment of SEQ ID NO. : 52 (AtTPPA) in which the first 91 amino acids are missing (Vogel et al. (1998) Plant J 13 (5): 673-683), and a corresponding, truncated AtTPPB polypeptide, in which the first 91 amino acids have been removed. From this comparison of percentage identities, it was found that the RA3 and SRA polypeptides have a high percent identity to the truncated AtTPPB polypeptide, that the truncated polypeptide AtTPPA.

Table 1 Percent of the Sequence Identity of the Amino Acid Sequences of Trehalose-6-Phosphate-Plant Phosphatases, One with the Other SEQ Percentage of Identity to the SEQ ID NO: NO: 19 49 51 52 53 54 55 52t * 53t * * 52t refers to the truncation of the AtTPPA polypeptide (SEQ ID NO: 52), in which 91 amino acids have been removed from the amino terminus. ** 53t refers to the truncation of the AtTPPB polypeptide (SEQ ID NO: 53), in which 91 amino acids have been removed from the amino terminus.

EXAMPLE 4 Sequence Analysis of the ra3 mutant alleles To confirm that the predicted locus encodes for RA3, seven alleles of ra3 were sequenced. These alleles of ra3 were either pre-existing alleles or were isolated from targeted selections. Each one had a lesion in the candidate gene, indicating that it codes for RA3 (Table 2). The coding regions of the mutant alleles ra3-ref, ra3-feal, ra3-EV, ra3-NI, ra3-bre, ra3-JL and ra3-NS were sequenced after amplification using the following primer sets: the primers forward and reverse 5'UTR-exon2 (SEQ ID NO: 20 and 21, respectively); the forward and inverse primers exon3-exon4 (SEQ ID NO: 22 and 23, respectively); the forward and reverse primers exon5-exon7 (SEQ ID NO: 24 and 25, respectively); the forward and reverse primers exon8-exonl0 (SEQ ID NO: 26 and 27, respectively); and the forward and inverse primers exonll-3'UTR (SEQ ID NO: 28 and 29, respectively). The mutant allele of ra3-ref has an insertion of 4 base pairs in exon7 (SEQ ID NO: 30). This results in a structural shift after amino acid 429 and a premature stop codon after 305 amino acids. The predicted ra3-ref polypeptide is shown in SEQ ID NO: 31. The mutant ra3-feal allele contains the following two mutations: 1) an insertion of a transposon element similar to ILS-1 in the 5 '-UTR region of the mutant ra3-feal gene (SEQ ID NO: 32); and 2) an insertion of 4 base pairs in the coding sequence of exon7 (SEQ ID NO: 33), which leads to a structural shift after amino acid 258 and a premature stop codon after 305 amino acids. The predicted amino acid sequence of ra3-feal polypeptide is shown in SEQ ID NO: 34. The mutant ra3-EV allele carries an insertion of 4 base pairs in exon6 (SEQ ID NO: 35). This results in a structural shift after amino acid 224 and a premature stop codon after 305 amino acids. The predicted amino acid sequence of the ra3-EV polypeptide is shown in SEQ ID NO: 36. The ra3-NI mutant allele has an insertion of 141 base pairs in the exonlO (SEQ ID NO: 37), which leads to a sequence of different proteins after amino acid 333 and a codon of premature arrest after 335 amino acids. The predicted amino acid sequence of the ra3-NI polypeptide is shown in SEQ ID NO: 38. The mutant allele ra3-¿> re has an insertion of 10 base pairs between exon6 and exon7 (SEQ ID NO: 39), which leads to a structural shift after amino acid 241 and a premature stop codon after 243 amino acids. The predicted amino acid sequence of the ra3-bre polypeptide is shown in SEQ ID NO: 40. The ra3-JL mutant allele has a deletion and rearrangement in exon6 (SEQ ID NO: 41), which leads to a different protein sequence after of amino acid 217 and a codon of premature arrest after 246 amino acids. The predicted amino acid sequence of the ra3-J1 polypeptide is shown in SEQ ID NO: 42. The mutant allele ra3-NS has a 2 base pair insertion in exon6 (SEQ ID NO: 43), which leads to a shift structural after amino acid 222 and a codon of premature arrest after 299 amino acids. The predicted amino acid sequence of the ra3-NS polypeptide is shown in SEQ ID NO: 44. The nature of some alleles was unusual, for example some alleles obtained from transposon selections had insertions of only a few nucleotides, reflecting possibly the abortive transposition events. ra3-ref and ra3-feal had an insertion of 4 base pairs in exon7, in different positions, and ra3-feal also contained a transposon in the 5 'region. In each allele the mutation caused a structural shift, and a codon of premature arrest.

TABLE 2 Seven Ra3 Alleles Have Mutations in the Candidate Locus Each mutant allele has a stop codon before the second phosphatase box, except for ra3-NI, which has a stop codon after the second phosphatase box. This correlates with the phenotype, since the ra3-NI mutants have the milder phenotype.

EXAMPLE 5 Expression Profile of the RA3 Gene The RT-PCR analysis was used to determine where and when they are expressed during RA3 and SRA development. First, the RT-PCR primers were tested on the ra3 alleles. In the mAR isolate of cob primordia of 1 cm long, a transcript was detected in the wild type ear (B73) and ra3-EV, ra3-NI and ra3-bre. However, no transcript was detected in the mRNA from immature ra3-feal ears, indicating the specificity of these primers for RA3 (Figure 7A). During development, RA3 was expressed most strongly during the early development of female and male inflorescences, and peaked around 2 to 5 mm in the development of the ear and ear. In this stage, SPM and SM are being initiated on the inflorescences in development. Very low levels of the RA3 transcript were detected in the root or in the vegetative apex, and were not detected in the leaf (Figure 7B). On the other hand, SRA was expressed more evenly throughout the development, with slightly higher root expression and larger spike primordia (Figure 7B). In addition, in situ hybridization was used to determine if the expression of RA3 was spatially regulated during the early development of the inflorescence. The expression of RA3 was observed in ear primordia in a cell-shaped group at the base of the SPMs, SMs and FMs, and at the boundary between the upper and lower florets (Figure 8). This specific expression for RA3, since it was not observed in cobs of ra3-ref. Along with the developing analysis, the highly restricted expression pattern suggests an important role in the development of RA3 in the development of corn inflorescence. In summary, the maize RA3 gene is preferentially expressed in restricted domains in early stages of inflorescence development. The phenotypic analysis suggests that RA3 acts in this stage to restrict the determination and identity of different types of meristem in the inflorescence.

EXAMPLE 6 Prophetic Example Recombinant DNA Expression in Monocotyledon Cells A recombinant DNA construct comprising a cDNA encoding the present polypeptides in sense orientation with respect to the 27 kD corn zein promoter that is located 5"to the fragment of cDNA, and the 3 'end of 10 kD zein that is located 3' to the cDNA fragment, can be constructed.The cDNA fragment of this gene can be generated by the PCR polymerase chain reaction of the cDNA clone using primers Suitable oligonucleotides The cloning sites (Ncol or Smal) can be incorporated into the oligonucleotides to provide adequate orientation of the DNA fragment when they are inserted into the digested vector pML103 as described below.The amplification is then performed in a standard PCR The amplified DNA is then digested with Ncol and Smal restriction enzymes and fractionated on a n agarose gel The appropriate band can be isolated from the gel and combined with a 4.9 kb Ncol-Smal fragment of plasmid pMLl03. Plasmid pML103 has been deposited under the terms of the Budapest Treaty at the ATCC (American Type Culture Collection, 10801 University Blvd., Manassas, VA 20110-2209), and carries the accession number ATCC 97366. The DNA segment from pMLl03 contains a 1.05 kb Sall-Ncol promoter fragment of the 27 kD corn zein gene and a 0.96 kD Smal-Sall fragment from the 3 'end of the 10 kD corn zein gene in the vector pGem9Zf (+) (Promega) The vector and insert DNA can be ligated at 15 ° C overnight, essentially as described (Maniatis). The ligated DNA can then be used to transform E. coli XLl-Blue (Epicurian Coli XL-1 Blue ™; Stratagene). Bacterial transformants can be selected by restriction enzyme digestion of the plasmid DNA, and limited analysis of the nucleotide sequence using the dideoxy chain termination method (Sequenase ™ DNA Sequencing Kit, U.S. Biochemical). The construction of the resulting plasmid could comprise a recombinant DNA construct encoding, in the 5 'to 3' direction, the 27 kD corn zein promoter, a cDNA fragment encoding the present polypeptides, and the 3 'region of 10 kD zein. The recombinant DNA construct described above can then be introduced into maize cells by the following procedure. Immature maize embryos can be dissected from developing cariopses derived from crosses of inbred corn lines H99 and LH132. Embryos are isolated 10 to 11 days after pollination when they are 1.0 to 1.5 mm in length. The embryos are then placed with the side of the shaft facing down, and in contact with the N6 medium solidified with agarose (Chu et al. (1975) Sci. Sin. Peking 18: 659-668). The embryos are kept in the dark at 27 ° C. Friable embryogenic callus consisting of undifferentiated masses of cells with somatic pre-embryoids and embryoids carried on suspensory structures, proliferates from the scutellum of these immature embryos. The embryogenic callus isolated from the primary explant can be cultured on N6 medium and subcultured on this medium every 2 to 3 weeks. Plasmid p35S / Ac (obtained from Dr. Peter Eckes, Hoechst Ag, Frankfurt, Germany) can be used in the transformation experiment in order to provide a selectable marker. The plasmid contains the Pat gene (see European Patent Publication 0,242,236) which codes for phosphinotrisine acetyl transaminase (PAT). The enzyme PAT confers resistance to inhibitors of the herbicide glutamine synthetase, such as phosphinothricin. The p35S / Ac pat gene is under the control of the 35S promoter from the mozaic cauliflower virus (Odell et al (1985) Nature 313: 810-812) and the 3 'region of the nopalin synthase gene of the T -ADN of the Ti plasmid of Agrobacterium turnefaciens. The particle bombardment method (Klein et al. (1987) Nature 327: 70-73) can be used to transfer genes to callus culture cells. According to this method, the gold particles (1 μp diameter) are coated with the DNA using the following technique. Ten pg of the plasmid DNAs are added to 50 μ? of a suspension of gold particles (60 mg per ml). Calcium chloride (50 μl of a 2.5 M solution) and spermidine free base (2 μl of a 1.0 M solution) are added to the particles. The suspension is vortexed during the addition of these solutions. After 10 minutes, the tubes are briefly centrifuged (5 seconds at 15,000 rpm) and the supernatant is removed. The particles are resuspended in 200 μ? of absolute ethanol, centrifuged again and the supernatant removed. A rinse with ethanol is performed again and the particles are resuspended in a final volume of 30 μ? of ethanol. An aliquot of 5 μ? of gold particles coated with DNA can be placed in the center of a Kapton ™ flying disc (Bio-Rad Labs). The particles are then accelerated into the corn tissue with a Biolistic ™ PDS1000 / He (Bio-Rad Instruments, Hercules CA), using a helium pressure of 70.3 kg / cm2 (1000 psi), a gap of 0.5 cm and a flight distance of 1.0 cm. For the bombardment, the embryogenic tissue is placed on filter paper on a N6 medium solidified with agarose. The tissue is accommodated as a thin layer and covered a circular area approximately 5 cm in diameter. The petri dish containing the fabric can be placed in the camera of the PDS1000 / He approximately 8 cm from the mesh detention. The air in the chamber is then evacuated to a vacuum of (28 inches) Hg. The macrocarrier is accelerated with a helium shock wave using a rupture membrane that bursts when the helium pressure in the reserve tube reaches 70.3 kg / cm2 (1000 psi). Seven days after the tissue bombardment can be transferred to an N6 medium containing bialophos (5 mg per liter) and lacks casein and proline. The tissue continues to grow slowly on this medium. After an additional 2 weeks the tissue can be transferred to fresh N6 medium containing bialophos. After 6 weeks, the areas of approximately 1 cm diameter of the actively growing callus can be identified on some of the plates containing the medium supplemented with bialophos. These calluses can continue to grow when they are subcultured on the selective medium. Plants can be regenerated from the transgenic callus first by transferring tissue clusters to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks, the tissue can be transferred to the regeneration medium (Fromm et al (1990) Bio / Technology 8: 833-839).

EXAMPLE 7 Prophetic Example Expression of Recombinant DNA in Dicotyledonous Cells An expression cassette composed of the promoter of the B-conglycinin or glycine genes (Chen, ZL, et al. (1988) EMBO J. 7: 297-302), 5 '- to the cDNA fragment, can be constructed and can be used for the expression of the present polypeptides in transformed soybeans. The pinll terminator can be placed 3 'to the cDNA fragment. Such a construct can be used to over-express the current polypeptides. It is found that a person skilled in the art could employ different promoters and / or sequences with 3 'end to achieve comparable expression results. The cDNA fragment of this gene can be generated by the polymerase chain reaction (PCR) of the cDNA clone using appropriate oligonucleotide primers. The cloning sites can be incorporated into the oligonucleotides to provide adequate orientation of the DNA fragment, when inserted into the expression vector. The amplification is then performed as described above, and the isolated fragment is inserted into a vector pUC18 carrying the expression cassette in the seed. The soybean embryos can then be transformed with the sequences comprising the expression vector, which code for the present polypeptides. To induce somatic embryos, the cotyledons, 3-5 mm in length dissected from the surface of sterilized, immature seeds of the soybean crop A2872, can be grown in light or dark at 26 ° C on a medium of appropriate agar for 6 to 10 weeks. Somatic embryos, which produce secondary embryos, are then excised and placed in a suitable liquid medium. After repeated selection for the somatic embryo clusters which multiplied as early globular stage embryos, the suspensions are maintained as described below. Soybean embryogenic suspension cultures can be maintained in 35 ml of liquid medium on a rotary shaker, 150 rpm, at 26 ° C with fluorescent lights in a day / night scheme of 16: 8 hours. The cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue from 35 ml of liquid medium. Soybean embryogenic suspension cultures can be transformed by the particle gun bombardment method (Klein et al. (1987) Nature (London) 327: 70-73, United States Patent No. 4, 945, 050). A DuPont Biolistic ™ PDS1000 / HE instrument (helium retrofit) can be used for these transformations.

A selectable marker gene that can be used to facilitate the transformation of soybeans is a chimeric gene composed of the 35S promoter of the cauliflower mosaic virus (Odell et al. (1985) Nature 373: 810-812), the the hygromycin phosphotransferase of plasmid pJR225 (from E. coli, Gritz et al (1983) Gene 25: 179-188) and the 3 'region of the nopalin synthase gene of the T-DNA of the Ti plasmid of Agrobacterium turnefaciens. The seed expression cassette comprising the 5 'region of phaseolin, the fragment encoding the present polypeptides and the 3' region of phaseolin can be isolated as a restriction fragment. This fragment can then be inserted into a restriction site unique to the vector, which possesses the marker gene. At 50 μ? from a suspension of gold particles of 1 μp \, to 60 mg / ml, are added (in order): 5 μ? of DNA (1 μg / μl), 20 μ? of spermidine (0.1 M), and 50 μ? of calcium chloride (2.5 M). The particle preparation is then stirred for three minutes, centrifuged in a microcentrifuge for 10 seconds and the supernatant is removed. The particles coated with DNA are then washed once in 400 μ? of 70% ethanol and resuspended in 40 μ? of anhydrous ethanol. The DNA / particle suspension can be sonicated three times for one second at a time. Five μ? of the gold particles coated with DNA are then loaded onto each macro-carrier disk. Approximately 300 to 400 mg of a two-week old suspension culture are placed, in an empty petri dish of 60 x 15 mm, and the residual liquid is removed from the tissue with a pipette. For each transformation experiment, approximately 5 to 10 tissue plates are normally bombarded. The rupture pressure of the membrane is adjusted to 77.33 kg / cm2 (100 psi) and the chamber is evacuated to a vacuum of 711 mmHg (28 inches of mercury). The fabric is placed approximately 8.89 cm (3.5 inches) from the retention mesh, and bombarded three times. After bombardment, the tissue can be divided in half and placed back in liquid and cultured as described above. Five to seven days after the bombardment, the liquid medium can be exchanged with fresh medium, and eleven to twelve days after the bombardment with fresh medium containing 50 mg / ml hygromycin. This selective medium can be refreshed weekly. Seven to eight weeks after the bombardment, the green transformed tissue can be observed growing from necrotic, non-transformed embryogenic clusters. The isolated green tissue is removed and inoculated in individual flasks to generate new embryogenic suspension cultures, transformed, clonally propagated. Each new line can be treated as an independent transformation event. These suspensions can then be subcultured and maintained as immature or regenerated embryo clusters in whole plants by maturation and germination of individual somatic embryos.

EXAMPLE 8 Prophetic Example Expression of Recombinant DNA in Microbial Cells The cDNAs encoding the present polypeptides can be inserted into the expression vector pBT430 of E. coli T7. This vector is a derivative of pET-3a (Rosenberg et al (1987) Gene 56: 125-135) which employs the T7 RNA polymerase system of bacteriophage / T7 promoter. Plasmid pBT430 is constructed primarily by destroying the EcoRI and H ndIII sites in pET-3a at their original positions. An oligonucleotide adapter containing the EcoRI and Hind III sites is inserted into the BamHI site of pET-3a. This creates pET-3aM with additional unique cloning sites for the insertion of genes into the expression vector. Then, the Ndel site in the starting position of the translation is converted to a Ncol site using oligonucleotide-directed mutagenesis. The DNA sequence of pET-3aM in this region, 5'-CATATGG, is converted to 5'-CCCATGG in pBT430.

The plasmid DNA containing cDNA can be appropriately digested to release a nucleic acid fragment encoding the protein. This fragment can then be purified on a 1% low melting point agarose gel. The buffer and the agarose contain 10 vg / ml of ethidium bromide for visualization of the DNA fragment. The fragment can then be purified from the agarose gel by digestion with GELase ™ (Epicenter Technologies, Madison, Wl) according to the manufacturer's instructions, precipitated with ethanol, dried and resuspended in 20 μ? of water. Suitable oligonucleotide adapters can be ligated to the fragment using T4 DNA ligase (New England Biolabs (NEB), Beverly, MA). The fragment containing the ligated adapters can be purified from the excess adapters using low melting point agarose as described above. The vector pBT430 is digested, dephosphorylated with alkaline phosphatase (NEB) and deproteinized with phenol / chloroform as described above. The pBT 430 vector prepared and the fragment can then be ligated at 16 ° C for 15 hours, followed by transformation into DH5 electrocompetent cells (GIBCO BRL). Transformants can be selected on agar plates containing LB medium and 100 g / ml ampicillin. Transformants containing the gene encoding the present polypeptides are then selected for correct orientation with respect to the T7 promoter by restriction enzyme analysis. For high level expression, a plasmid clone with the cDNA insert in the correct orientation, relative to the T7 promoter can be transformed into E. coli strain BL21 (DE3) (Studier et al (1986) J. Mol. Biol. 789: 113-130). Cultures are grown in LB medium containing ampicillin (100 mg / ml) at 25 ° C. At an optical density of 600 nm of about 1, IPTG (isopropyl-D-galactoside, the inducer) can be added to a final concentration of 0.4 mM, and the incubation can be continued for 3 hours at 25 ° C. The cells are then harvested by centrifugation and resuspended in 50 μ? of 50 mM Tris-HCl at pH 8.0 containing 0.1 mM DTT and 0.2 mM phenyl-methylsulfonyl fluoride. A small amount of 1 mm glass spheres can be added and the mixture sonicated 3 times for about 5 seconds each time with a microprobe sonicator. The mixture is centrifuged and the protein concentration of the supernatant is determined. One g of protein from the soluble fraction of the culture can be separated by SDS-polyacrylamide gel electrophoresis. The gels can be observed for the protein bands that migrate to the desired molecular weight.

EXAMPLE 9 Protein RAM0SA3-Trehalose-6-phosphate-phosphatase activity in vi tro Protein expression and phosphatase assays in vi tro. To produce recombinant proteins for in vitro phosphatase assays, E. coli expression vectors were constructed containing the polynucleotides that encode either the full length RA3 protein, the TP3 domain fragment of RA3 or the N-terminal fragment of RA3. The DNA fragments encoding either the full-length RA3 protein, the TP3 domain fragment of RA3 or the N-terminal fragment of RA3 were amplified, respectively, using the following primer pairs: Full Length Protein RA3: NS487 (SEQ ID NO: 56): CGAGCCATGACGAAGCAC and NS429 (SEQ ID No. 57): ATAAGCGCCTCTTTGCTGTTG; Fragment of Domain RA3 TPP: NS483 (SEQ ID NO: 58): GGCGACTGGATGGAGAAGCA and NS429 (SEQ ID NO: 57): ATAAGCGCCTCTTTGCTGTTG. N-terminal Fragment of RA3: NS485 (SEQ ID NO: 59): GTGCGCGGATCCAGCCATGACGAAGCACGCCGCCTACTC and NS488 (SEQ ID NO: 60): CTTCTCGAATTCTCAGCCGTGCTCGGCGTCGGCG.

The PCR fragments were cloned into the pCR vector T7 / NT-T0P0, which introduces an N-terminal histidine tag into the recombinant protein (Invitrogen). The His-tagged recombinant proteins were expressed in E. coli and purified by a batch purification method (Qiagen). The proteins were used at a concentration of 70 ng / μ? for phosphatase assays using sugar phosphates (Sigma) at a concentration of 2 mM, or phosphoptide to be / thr as described (Klutts, S. et al. "Purification, cloning, expression, and properties of mycobacterial trehalose-phosphate phosphatase "J Biol Chem 278: 2093-2100 (2003)). The sugar phosphate phosphatase activity was measured using the following four sugar phosphates: trehalose-6-phosphate, glucose-6-phosphate, fructose-6-phosphate and sucrose-6-phosphate. Phosphate release was measured as OD6oo (serine / threonine phosphatase assay system, Promega). The full-length protein His tagged RA3 (SEQ ID NO: 61), the fragment of the TPP domain of His tagged RA3 (SEQ ID NO: 62) and the trehalose-6-phosphate-phosphatase of Mycobacterium tuberculosis marked with His ( Edavana et al., Arch Bxochem Biophys 426: 250-257 (2004)), each catalyzed the release of phosphate from trehalose-6-phosphate (T6P) but not from the other phosphates of sugar or the phosphopeptide of ser / thr used as a reporter of protein phosphatase activity (Figure 9). The N-terminal fragment of His tagged RA3 (SEQ ID NO: 63) had no phosphatase activity and the non-specific phosphatase, shrimp alkaline phosphatase (SAP, Roche Applied Science), showed phosphatase activity against all substrates ( Figure 9). The in vitro activity data support the assignment of the T6P phosphatase activity to the RA3 protein. The fragment of the TPP domain of His tagged RA3 (SEQ ID NO: 62) consists of an N-terminal region of 35 amino acids containing six consecutive histidine residues, followed by amino acid residues 78-361 of the RA3 protein (SEQ ID NO: 19). In vitro activity data (Figure 9) indicate that amino acid residues 78-361 of the RA3 protein are sufficient to transfer T6P phosphatase activity.

EXAMPLE 10 RAM0SA3 protein - Trehalose-6-phosphate-phosphatase activity in vivo Complementation of the yeast tps2 mutant: To complement the yeast mutant deficient in trehalose-6-phosphate-phosphatase, the DNA fragments encoding the RA3 protein Full-length or fragment of the TPP domain of RA3 were each cloned into a yeast expression vector. The DNA fragments encoding either the full length protein RA3 or the fragment of the TPP domain of RA3 were amplified, respectively, using the following pair of primers: Full Length Protein RA3: NS489 (SEQ ID NO: 64): AAGGAAAAAAGCGGCCGCGCCATGACGAAGCACGCCGCCTACTC and NS490 (SEQ ID NO: 65): ACGAGGTCGTGCCTGCCGCTCATGGTTGGCGCGCCCCCTTCT; o Fragment of the TPP Domain of RA3: NS490 (SEQ ID NO: 65): ACGAGGTCGTGCCTGCCGCTCATGGTTGGCGCGCCCCCTTCT and NS500 (SEQ ID NO: 66): CGCGCCGCCGGCGGCCGCGACATGGACTGGATGGAGAAGCACCCGTC. The DNA fragments encoding the full length RA3 protein and the fragment of the TPP domain of RA3 were cloned into a yeast shuttle vector, pFL6, in which high level expression is driven by the phosphoglycerate kinase promoter. (Minet, M., Dufour, ME and Lacroute, F. "Complementation of Saccharomyces cerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs" Plant J 2: 417-422 (1992)). The TPP gene from Arabidopsis was used as a positive control. The empty and transformed yeast vector within the yeast mutant served as a negative control. The constructs were transformed into the yeast strain YSH6.106. -8C, which has a deletion of the tps2 gel and therefore lacks TPP activity. This mutant strain is sensitive to high temperature and high salt concentrations (De Virgilio, C. et al. "Disruption of TPS2, the gene encoding the 100-kDa subunit of the trehalose-6-phosphate synthase / phosphatase complex in Saccharomyces cerevisiae, causes accumulation of trehalose-6-phosphate and the loss of trehalose-6-phosphato-phosphatase activity" Eur. J. Bioche 212: 315-323 (1993)). The yeast TPP mutant normally develops at 30 ° C, but has very slow growth at high temperature (40 ° C), especially in the presence of an osmotic stress such as 1 M sodium chloride. Transformed cells were evaluated for growth on the selective medium at 40.5 ° C, the non-permissive temperature, in the presence of 1 M sodium chloride, as well as at 30 ° C. The full length RA3 protein (SEQ ID NO: 19) and the fragment of the TPP domain of RA3 (SEQ ID NO: 68) each rescued growth at the non-permissive temperature (Figure 10). Accordingly, the functional RA3 protein as a T6P phosphatase in vivo. The fragment of the TPP domain of RA3 (SEQ ID NO: 68) expressed in the yeast mutant consists of an initial methionine residue followed by amino acid residues 79-361 of the RA3 domain (SEQ ID NO: 19). The data in Figure 10 indicates that amino acid residues 79-361 of the RA3 protein are sufficient to transfer the T6P phosphatase activity in vivo. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Claims (18)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. An isolated polynucleotide, characterized in that it comprises: (a) a nucleotide sequence coding for a polypeptide associated with the branching of the ear, the ear or both, of a plant, wherein the polypeptide has an amino acid sequence of at least 80% , 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

2. An isolated polynucleotide, characterized in that it comprises: (a) a nucleotide sequence encoding a polypeptide associated with the pollen dispersion of a plant, wherein the polypeptide has an amino acid sequence of at least 80%, 85%, 90 %, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

3. An isolated polynucleotide, characterized in that it comprises: (a) a nucleic acid sequence encoding a polypeptide having trehalose-6-phosphate-phosphatase activity, wherein the polypeptide has an amino acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequential identity, based on the Clustal V alignment method, when compared to SEQ ID NO: 19, 49, 68 or 69; or (b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

4. A recombinant DNA construct, characterized in that it comprises the polynucleotide according to claim 1, operably linked to a promoter that is functional in a plant.

5. A recombinant DNA construct, characterized in that it comprises the polynucleotide according to claim 2, operably linked to a promoter that is functional in a plant.

6. A recombinant DNA construct, characterized in that it comprises the polynucleotide according to claim 3, operably linked to a promoter that is functional in a plant. A method for altering the branching of the ear, the ear or both, of a plant, characterized in that it comprises: (a) introducing into a regenerable plant cell the recombinant DNA construct according to claim 4, to produce a transformed plant cell; and (b) regenerating the transgenic plant of the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in the branching of the spike, the ear or both, when compared to a control plant that does not comprise the construction of recombinant DNA. The method according to claim 7, characterized in that it further comprises (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. 9. The method according to claim 7, characterized in that the transgenic plant shows a decrease in the branching of the spike, the ear or both. A method for altering the pollen dispersion of a plant, characterized in that it comprises: (a) introducing into a regenerable plant cell the recombinant DNA construct according to claim 5, to produce a transformed plant cell; and (b) regenerating a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in pollen dispersion, when compared to a control plant that does not comprise the construction of recombinant DNA. The method according to claim 10, further characterized in that it comprises (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. 12. The method according to claim 10, characterized in that the transgenic plant shows a decrease in pollen dispersion. 13. A method for altering the activity of trehalose-6-phosphate-phosphatase in a plant, characterized in that it comprises: (a) introducing into a regenerable plant cell the recombinant DNA construct according to claim 6, to produce a cell transformed vegetable; and (b) regenerating a transgenic plant of the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an alteration in the activity of trehalose-6-phosphate-phosphatase, when compared to a control plant that does not comprise the construction of recombinant DNA. The method according to claim 13, characterized in that it further comprises (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. 15. The method according to claim 13, characterized in that the transgenic plant shows an increase in the activity of trehalose-6-phosphtho-phosphatase. 16. A method for increasing tolerance to environmental stress of a plant, characterized in that it comprises: (a) introducing into a regenerable plant cell the recombinant DNA construct according to claim 6, to produce a transformed plant cell; and (b) regenerating a transgenic plant from the transformed plant cell, wherein the transgenic plant comprises in its genome the construction of recombinant DNA, and wherein the transgenic plant shows an increase in tolerance to environmental stress, when compare to a control plant that does not include the construction of recombinant DNA. 1

7. The method of compliance with the claim 16, characterized in that it further comprises (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the construction of recombinant DNA. 1

8. The method of compliance with the claim 16, characterized in that the environmental stress is drought, and where the transgenic plant shows an increase in tolerance to drought.