MX2007000970A - Process for improved protein expression by strain engineering - Google Patents

Abstract

This invention is a process for improving the production levels of recombinant proteins or peptides or improving the level of active recombinant proteins or peptides expressed in host cells. The invention is a process of comparing two genetic profiles of a cell that expresses a recombinant protein and modifying the cell to change the expression of a gene product that is upregulated in response to the recombinant protein expression. The process can improve protein production or can improve protein quality, for example, by increasing solubility of a recombinant protein.

Description

PROCESS FOR EXPRESSION OF IMPROVED PROTEIN THROUGH CONSTRUCTION OF CEPA Cross Reference with Related Request The present application claims the priority of the North American Provisional Application No. 60 / 591,489, filed on July 26, 2004. Field of the Invention The present invention is within the field of protein production, and in particular is a process for improving levels of production of recombinant proteins or peptides or improving the level of active recombinant proteins or peptides expressed in host cells. BACKGROUND OF THE INVENTION More than 155 recombinantly produced proteins and peptides have been approved by the United States Food and Drug Administration (FDA) for use as biotechnology drugs and vaccines, with 370 other in clinical trials. Unlike the small molecule therapeutics that are produced through chemical synthesis, proteins and peptides are produced more efficiently in living cells. In many cases, the cell or organism has been genetically modified to produce or increase the production of the protein. When a cell is modified to produce large amounts of a target protein, the cell is put under tension and often reacts by inducing or suppressing other proteins. The voltage by which a host cell passes during the production of recombinant proteins may increase the expression, for example, of specific proteins or cofactors that cause the degradation of the over-expressed recombinant protein. Increased expression of compensatory proteins may be counterproductive for the goal of expressing high levels of full-length, active recombinant protein. The diminished expression or lack of adequate expression of other proteins can cause the lack of fold and aggregation of the recombinant protein. When it is known that a cell goes through tension, it will change if protein expression profile, it is not known in any given example that specific proteins will be activated or deactivated. Microformations Microformation technology can be used to identify the presence or level of expression of a large number of polynucleotides in a single assay. See for example, US Patent No. 6,040,138, filed September 15, 1995, US Patent No. 6,344,316, filed June 25, 1997, US Patent No. 6,261,776, filed April 15, 1999, US Patent No. 6,403,957, filed on October 16, 2000, US Patent No. 6,451,536, filed September 27, 2000, US Patent No. 6,532,462, filed August 27, 2001, US Patent No. 6,551,784 , filed on May 9, 2001, US Patent No. 6,420,108, filed on February 9, 1998, US Patent No. 6,410,229, filed on December 14, 1998, US Patent No. 6,576,424, filed on October 25, 1998 January 2001, US Patent No. 6,687,692, filed on November 2, 2000, US Patent No. 6,600,031, filed April 21, 1998 and US Patent No. 6,567,540, pre sitting on April 16, 2001, all assigned to Affymetrix, Inc. US Patent No. 6,607,885 to EI DuPont de Nemours and Co., describes methods for profiling and identifying changes in gene expression after subjecting a bacterial cell to conditions that they alter the expression, comparing a first and a second microformation measure. Wei et al., Used a microformation analysis to investigate the gene expression profiles of E. coli with induction of the lac gene (Wei Y, and associates (2001).) The profiling of gene expression transmitted by high density microformation of Escherichla coli. J. Bacteriol 183 (2): 545-56). Other groups of regulated transcription profiles have also been investigated after mutation of endogenous genes or elimination of regulatory genes (Sabina, J. and associates (2003) Interference with Different Steps of Protein Synthesis Scanned by Transcription Profiling of Escherichia coli K -12 J Bacterium !. 185: 6158-6170; Lee JH (2003) Global analyzes of transcriptomes and proteomes of an origin strain and a mutant strain of overproduction of L-threonine J Bacteriol. 185 (18): 5442-51; Kabir MM, and associates (2003) Genetic expression patterns for metabolic pathway of pgi elimination of Escherichia coli with and without phb genes based on RT-PCR J Biotechnol. 105 (1-2): 11-31; Eymann C, and associates (2002) Functional genomic Bacillus subtilis global characterization of the strict response by analysis of proteome and transcripíoma. J Bacteriol. 184 (9): 2500-20). Gilí and associates, describes the use of microformation technology to identify changes in the expression of genes related to stress in E. coli after the expression of recombinant chloramphenicol acetyl transferase fusion proteins (Gilí et al. (2001) Fermentation Genomic Analysis of Escherichia coli Recombinant High Cellular Density and "Cellular Conditioning" for Recombinanie Protein Field Biotech Enhanced, Bioengin 72: 85-95). The ionic genetic transcription profile, which comprises only 16% of the total genome, in high cell density was used to evaluate "cell conditioning" strategies to alter the levels of caperones, proteases and more intracellular proteins before overexpression. of the recombinant protein. The estraiegies for "conditioning" comprised pharmacological manipulation of the cells, including by treatments with dithiotreitol and ethanol. Asai and associates, described the use of microformation analysis to identify target genes activated by overexpression of certain sigma factors that are normally induced after cell stresses (Asai K., and associates (2003) DNA Microassay Analysis of sigma factors of Bacillus subtilis of the extracytoplasmic function family, FEMS Microbiol Lett, 220 (1): 155-60). Cells that overexpress sigma factors as well as reporter genes to sigma factor promoters were used to show voltage-regulated genetic induction. Choi and associates, discovered the analysis and activation of metabolic genes that are deactivated in high-density cultures of E. coli expressing human insulin-like growth factor (IGF-IF) fusion protein (Choi et al. (2003) Improved Production of Fusion Protein of Insulin I Type Growth Factor in Escherichia coli by Coexpression of Deactivated Genes Identified by Transcriptome Profiling, App. Envir Microbio .. 69: 4737-4742). The focus of this work was the metabolic changes that occur during high density conditions after protein induction. Genes that were deactivated after induction of recombinant protein production during high density growth conditions were identified and metabolic genes that have been inactivated were expressed in cells that produce recombinant IGF-If. The work showed that the increased metabolic production of certain nucleotide and amino acid bases can increase the production of proteins and that the growth rates can be modified, increasing the expression of an inactivated metabolic transporter molecule. These strategies were designed to alter the cellular environment to reduce metabolic stresses associated with protein production generally or with high density culture. Protein Degradation Unwanted degradation of recombinant protein presents an obstacle to the efficient use of certain expression systems. The expression of exogenous proteins often induces stress responses in host cells, which, for example, can be natural defenses to a limited carbon source. All cells contain a large number of genes with the ability to produce degradation proteins. It is not possible to anticipate that proteases will be regulated by a particular host in response to the expression of a particular recombinant protein. For example, the P. fluorescens bacterium contains up to 200 proteases and protease-related proteins. In the cytoplasm of E. coli, proteolysis is usually carried out through a group of proteases and cofactor molecules. The earliest degradation steps are carried out through five ATP-dependent Hsps: Lon / FtsH / HflB, CIpAP, CIpXP and CIpYQ / HslUV (Gottesman S (1996) Proteases and their targets in Escherichia coli. Genet 30: 465-506). Together with FtsH (a protease associated with internal membrane whose active site faces the cytoplasm), CIpAP and CIpXP are responsible for the degradation of proteins modified at their carboxyl terminus through the addition of AANDENYALAA non-polar destabilizing tail (Gottesman S , and associates (1998) CIpXP and CIpAP proteases degrade proteins with added carboxyl terminal peptide tails by the SsrA-tagging system Genes Dev. -12: 1338-1347; Hermán C, y asociados (1998) Degradation of cytoplasmic proteins labeled with carboxy-terminal by HfiB (FtsH) of Escherichia coli protease. Genes Dev. 12: 1348-1355). Several methods have been taken to avoid degradation during the production of recombinant protein. One method is to produce host strains that contain mutations in a protease gene. Baneyx and Georgiou, for example, used a strain with a protease deficiency to improve the production of a protein-ß-lactamase fusion protein (Baneyx F, Georgiou G. (1991) Construction and characterization of strains of Escherichia coli with deficiency in multiple segregated proteases: protease III degrades high molecular weight substrates in vivo J. Bacterio! 173: 2696-2703). Park and associates, used a similar mutation method to improve the activity of recombinant protein by 30%, compared to the strain of E. coli origin (Park S. and associates (1999) Production of recombinant protein cleavage through of a high density culture of negative Protease mutant Escherichia coli strain Biotechnol Progr. 15: 164-167). U.S. Patent Nos. 5,264,365 and 5,264,365 describe the construction of protease deficient E. coli, particularly strains with protease multiplication deficiency, to produce proteolytically sensitive polypeptides. PCT Publication No. WO 90/03438 describes the production of E. coli strains including strains with protease deficiency or strains including a protease inhibitor. Similarly, PCT Publication No. WO 02/48376 describes E. coli strains with deficiency of proteases DegP and Prc. Protein Fold Another important obstacle in the production of recombinant proteins is host cells, is that the cell frequently is not removed in an adequate way to produce either soluble or active protein. Although the primary structure of a protein is defined by its amino acid sequence, the secondary structure is defined by the presence of alpha helices or beta sheets, and the ternary structure by covalent bonds between adjacent protein elongations, such as disulfide bonds. When recombinant proteins are expressed, particularly in large scale production, the secondary and tertiary structure of the protein by itself is of great importance. Any significant change in the structure of the protein can produce a functionally inactive molecule, or a protein with significantly reduced biological activity. In many cases, a host cell expresses fold modulators (FMs) that are necessary for the proper production of active recombinant protein. However, at the high levels of expression generally required to produce economically satisfying, usable biotechnology products, a cell can not produce enough native modulators or fold modulators to process the recombinant protein. In certain expression systems, the overproduction of exogenous proteins may be accompanied by their lack of fold and segregation in insoluble aggregates. In bacterial cells, these aggregates are known as inclusion bodies. In E. coli, the network of modulators / fold chaperones includes the Hsp70 family. The important Hsp70 chaperone, DnaK, efficiently prevents protein degradation and supports the re-folding of damaged proteins. The incorporation of heat impact proteins into protein aggregates can facilitate disaggregation. However, processed proteins for inclusion bodies, in certain cases, can be recovered through further processing of the insoluble fraction. Proteins that are found in inclusion bodies usually have to be purified through multiple steps, including denaturation and renaturation. Typical renaturation processes for targeted proteins with inclusion bodies, comprise attempts to dissolve the aggregate in concentrated denaturants and the subsequent removal of the denaturant by dilution. Aggregates are often formed again at this stage. The additional processing adds cost, there is no guarantee that in vitro re-folding will produce a biologically active product, and the recovered proteins can include large amounts of impurities in fragments. One method for reducing protein aggregation is through construction by fermentation, most commonly, by reducing the temperature of the culture (see Baneyx F publication (1999) In vivo fold of recombinant proteins in Escherichia coli., In the Manual of Industrial Microbiology and Biotechnology, Ed. Davies and associates, Washington, DC: American Society for Microbiology ed. 2: 551-565 and references therein mentioned). The most recent realization that the fold of the protein in vivo is aided by molecular chaperones, which promote the proper isomerization and cellular direction of other polypeptides, interacting temporarily with fold intermediates, and through leaflets, which accelerate the steps that limit the range along the fold path, has provided additional methods to combat the problem of the formation of inclusion bodies (see for example, the publication by Thomas JG and associates (1997).) Molecular chaperones, bending catalysts and Recovery of active recombinant E. coli proteins: for folding or re-bending Appl Biochem Biotechnol, 66: 197-238 In certain cases, the over-expression of chaperones has been found to increase the soluble yields of prone-aggregation proteins (see, for example, Baneyx F. (1999) Recombinant Protein Expression in E. coli Curr Opin. Biotech 10: 411-421 and references therein. there they are mentioned). The process does not appear to comprise the dissolution of previously formed recombinant inclusion bodies, but is related to the improved folding of newly synthesized protein chains. For example, Nishihara and associates, co-expressed groESL and dnaJK / grpE in the cytoplasm to improve the stability and accumulation of recombinant Cryj2 (a Japanese cedar pollen allergen) (Nishihara K, Kanemori M, Kitagawa M, Yanagi H, Yura T 1998. Chaperone co-expression plasmids: Differential and synergistic roles of DnaK-DnaJ-GrpE and GroEL-GroES to assist in the folding of a Japanese cedar pollen allergen, Cryj2, in Escherichia coli. 64: 1694). Lee and Olins also co-expressed GroESL and DnaK and increased the accumulation of human procollagenase by ten folds (Lee S, Olins P. 1992. Effect of overproduction of GroESL and DnaK heat impact chaperones in human procollagenase production in Escherichia. coli, JBC 267: 2849-2852). The beneficial effect associated with an increase in the intracellular concentration of these chaperones appears to be highly dependent on the nature of the over-produced protein, and success is not guaranteed. There is a need for processes for the development of host strains showing improved proteins, production, activity or solubility of protein or recombinant peptide in order to reduce manufacturing costs and increase the production of active products. Brief Description of the Invention Accordingly, it is an object of the present invention to provide processes for improving the expression of recombinant protein in a host. It is a further object of the present invention to provide processes that increase the expression levels in host cells expressing recombinant proteins or peptides. It is another object of the present invention to provide processes for increasing soluble protein levels made in recombinant expression systems. It is still another object of the present invention to provide processes for increasing the levels of active protein made in recombinant expression systems. Summary of the Invention A process for improving the expression of a recombinant protein or peptide is provided, wherein the process comprises: i) expressing the recombinant protein or peptide in a host cell; ii) analyzing a genetic profile of the cell and identifying one or more endogenous gene products that are activated at the time of expression or overexpression of the recombinant protein or peptide; and iii) changing the expression of one or more endogenous gene products identified by the genetic modification of the cell. The process can provide improved expression as measured by improved protein yields, or it can improve the recovery of active protein, for example, increased solubility of expressed recombinant protein, or a related protein or peptide. Using this process, one can determine which of the many cellular proteins are "chosen" by the cell to compensate for the expression of the external recombinant protein, and this information can lead to the development of more effective protein expression systems. For example, it is known that normally a cell selectively activates one or more proteases to degrade an over-expressed recombinant protein. However, it can not be anticipated that protease (s) will activate the cell to compensate for the stress caused by any recombinant protein. The analysis of the genetic profile of the cell by means of microformacíón or equivalent technology, can identify that proteases are activated in a certain cell in response to the production of exogenous protein. This information is subsequently used to genetically modify the cell to decrease the expression of these particular proteases, while reserving other proteins that are useful or even necessary for cellular homeostasis. As another example, a cell can selectively activate one or more fold modulators or cofactors to increase the fold capacity or solubility of the recombinant protein. Again, it can not be anticipated that modulators or fold cofactors will be selected in a given system to aid in the processing of a specific recombinant protein. The analysis of the genetic profile through microformation or equivalent technology allows the identification of the modulators or fold cofactors that have been activated. Based on this information, the cell is genetically modified to increase the expression of selected modulators or fold cofactors preferred by the cell for the determined recombinant protein. This modification may increase the percentage of active protein recovered, while minimizing the deleterious impact on cellular homeostasis. Accordingly, the production and / or activity and / or solubility of the recombinant protein can be increased, by modifying the host organism through either increasing or decreasing the expression of a compensatory protein (eg, a protein that is regulated in response to the tension of a certain cell) in a form that is selective and that leaves all other beneficial mechanisms of the cell. The process can be used interactively until the expression of the active recombinant protein is optimized. For example, using the process described above, the host cell or organism is genetically modified to activate, deactivate, eliminate or incorporate one or more compensating proteins identified. The host cell or organism modified in this manner can then be cultured to express the recombinant protein, or a related protein or peptide, and additional compensating proteins identified by microformation or equivalent analysis. The host cell or modified organism is subsequently genetically modified again to activate, deactivate, eliminate or incorporate the selected or additional compensating proteins. This process can be interacted until a host cell or organism is obtained that exhibits the maximum expression of the active and / or soluble protein without undue weakening of the host organism or the cell. This steps, you can repeat for example, one, two, three, four, five, six, seven, eight, nine, ten or more times. In another embodiment, the process further comprises: iv) expressing the recombinant protein or peptide in a genetically modified cell. In yet another embodiment, the process further comprises: v) analyzing a second genetic profile of the genetically modified cell expressing recombinant protein or peptide and identifying one or more additional genetic products that are differentially expressed in the recombinant protein or peptide that express the modified cell. In a further embodiment, the process further comprises: iv) changing the expression of one or more additional gene products identified to provide a double modified cell. Optionally, the recombinant protein or peptide, or the related protein or peptide can be expressed in the double modified cell. The differentially regulated gene products identified in the modified cell can be activated or deactivated when compared to the host cell or when compared to the modified cell which does not express protein or recombinant peptide. In yet another embodiment, the process further comprises: iv) analyzing a second genetic profile of a genetically modified cell expressing recombinant protein or peptide and identifying one or more additional gene products that are differentially expressed in the modified cell which does not express protein or recombinant peptide. In a further embodiment, the process further comprises: v) changing the expression of one or more additional identified gene products in the modified cell to provide a double modified cell. The differentially regulated gene products identified in the modified cell can be activated or deactivated when compared to the host cell or organism or when compared to the modified cell that does not express protein or recombinant peptide. In a specific embodiment, a process for improving the expression of a recombinant protein or peptide is provided, wherein the process comprises: i) expressing the recombinant protein or peptide in a host cell; I) analyzing a genetic profile of the cell and identifying at least one protease that is activated when the recombinant protein or peptide is expressed; and i) changing the expression of an identified protease, genetically modifying the host cell or organism to reduce the expression of the activated protease. In a further embodiment, the process comprises changing the expression of at least one second protease identified in the modified cell, to provide a cell modified with double protease. In another embodiment, the process further comprises: v) expressing the recombinant protein or peptide, or a related protein or peptide in a protease modified cell. In another embodiment, the process further comprises analyzing a second genetic profile of the modified cell with protease, to identify one or more additional genetic products that are differentially expressed in the modified cell. In another embodiment, a process for improving the expression of a recombinant protein or peptide is provided, wherein the process comprises: i) expressing the recombinant protein or peptide in a host cell; I) analyzing a genetic profile of a cell and identifying at least one activated fold modulator (FM) that is activated after overexpression of the recombinant protein or peptide; and iii) changing the expression of at least one identified bend modulator, genetically modifying the cell to provide an FM modified cell. In a further embodiment, the process comprises changing the expression of at least one second bending modulator identified in the modified cell, to provide a double FM modified cell. In another embodiment, the process further comprises: iv) expressing the recombinant protein or peptide, or a related protein or peptide, in a cell modified by FM. In another embodiment, the process further comprises analyzing a second genetic profile of an FM-modified cell to identify one or more additional genetic products that are differentially expressed in the modified cell. The term "genetic profile" as used in the present invention means that it includes an analysis of genes in a genome, mRNA transcribed from genes in the genome (or the equivalent cDNA), transcription products that have been modified by a cell such as gene division variants in eukaryotic systems, or proteins or peptides translated from genes in a genome, including proteins that are modified by the cell or translated from mRNA division variants translated from the genome. A genetic profile is understood to include more a gene or gene product, and typically includes a group of at least 5, 10, 50, 100 or more genes or gene products that are analyzed. In one embodiment, the analyzed genetic profile can be a transcriptome profile, that is, a profile of the transcription products of genes from the genome. The process may include analyzing the transcriptome profile using a microformation or equivalent technology. In this embodiment, the microformation can include binding portions for at least a portion of the transcriptome of the host cell, and typically includes samples from binding portions for gene products with at least 50% of the organism's genome. More typically, the microformation includes samples of at least 80%, 90%, 95%, 98%, 99% or 100% of binding portions for gene products in the host cell genome.

In a separate embodiment, the microformation may include a selected sub-group of binding portions for genes or gene products that represent classes of products that are affected by the expression of recombinant protein. Examples without limitation include putative or known proteases, protease cofactors or protease type proteins; fold modulators, cofactors of fold modulators or proteins that can improve the fold or solubility of the protein; transcription factors; proteins involved in nucleic acid stability or translation initiation; kinases; extracellular or intracellular receptors; metabolic enzymes; metabolic cofactors; envelope proteins; sigma factors; proteins bound by membrane; transmembrane proteins; proteins associated with membrane and storage genes. The genetic profile can be analyzed by measuring the binding of the expressed genes of the host cell expressing the recombinant protein or peptide for microformation. The transcriptome profile can also be analyzed using microformation assays such as staining tests, including northern staining tests or columns coated with binding parts. In another embodiment, the genetic profile analyzed can be a proteome profile, that is, a profile of the proteins produced from genes in a given organism. The process may include analyzing the proteome profile using, for example, two-dimensional electrophoresis. Mass spectrometry techniques can also be used in the process in combination with separation tools such as bi-dimensional gel electrophoresis or multidimensional liquid chromatography. In bi-dimensional electrophoresis, the separated proteins can include proteins from at least 10% of the proteome in the organism. More normally, the proteins of at least 20%, 30%, 40%, 60%, 80% or 90% of the proteins in the proteome of the host cell are separated and analyzed by techniques such as protein staining and / or spectrometry of dough. In a further embodiment, the proteome profile is analyzed using mass spectrometry. There are several related techniques that use liquid chromatography (LC) coupled to mass spectrometry (MS) and tandem mass spectrometry (MS / MS) to identify proteins and measure their relative abundance. Frequently, a sample is labeled with a heavy isotope label that allows comparison with another sample without changing the chemical properties. For example, in a sample the amino acid cysteine can be labeled with a label that contains eight hydrogen atoms. The other sample is labeled with a tag that contains eight deuterium atoms ("heavy") instead of (+ 8 Daltons). MS data can be used to find pairs of 8 Dalton peptides to separate and quantify the difference. The MS / MS data of the same peptides provide an approximation of the primary sequence, and the protein ID. Other experiments tag the proteins in vivo by growing cells with "heavy" amino acids. These types of techniques can be used to identify thousands of proteins in a single experiment and estimate relative abundance if found in both samples (see the publication by Goodlett DR and Aebersold RH (2001), Mass Spectrometry in Proteomics, Chem Rev 101: 269-295). ICAT is a type of MS / MS, it stands for Isotope Coded Affinity Tags (see the publication of Gygi SP, Rist B, Gerber SA, Turecek F, Gelb MH and Aebersold RH (1999) .Quantitative analysis of complex protein mixtures using affinity tags encoded by isotope, Nat Biotech 17: 994-999). In another embodiment, the process may include analyzing the proteome profile using, for example, microformation. In this embodiment, the formation can include binding portions for at least a portion of the proteins expressed by the host cell under suitable growth conditions, and usually include binding portions for proteins from at least 10% of the body's proteome. More typically, microformation includes binding portions for proteins of at least 20%, 30%, 40%, 60%, 80% or 90% of the proteins in the host cell proteome. The binding portions can be antibodies, which can be fragments of antibodies such as fragments of single chain antibodies. In a separate embodiment, the microformation can include binding portions for a selected sub-group of proteins derived from proteome, including, for example, putative protease proteins and putative fold modulators. The microformation can also normally include a group of binding portions for proteins that are used as controls. The genetic profile can be analyzed by measuring the binding of the proteins of the host cell expressing the recombinant protein or peptide to the binding sites in the microformation. The proteome profile can also be analyzed in a standard assay format, such as Elisa assay or standard western spot assay. The samples in the genetic profile can be analyzed individually or grouped together. The sets can usually be grouped by similarity in gene expression. In particular modalities, the sets can be grouped as genes that are activated to a similar point or genes that are deactivated to a similar point. The normally identified activated gene is identified by comparing a genetic profile of the host cell expressing the recombinant protein or peptide with a genetic profile of the host cell that does not express the recombinant protein or peptide. In a further embodiment, a host cell expressing a homologous protein for the first recombinete protein is analyzed. The genome of the host cell expressing the recombinant protein or peptide can be modified by recombination, eg, homologous recombination or heterologous recombination. The genome can also be modified by mutation of one or more nucleotides in an open reading frame that encodes a gene, particularly, an identified protease. In another embodiment, the host cell is modified including one or more vectors that encode an inhibitor of a gene or gene product identified, such as a protease inhibitor. In another embodiment, the host cell is modified by inhibition of a promoter, which may be a native promoter. In a separate embodiment, the host cell is modified including one or more vectors encoding a gene, typically a fold modulator or a cofactor of a bend modulator. In another embodiment, the host cell is modified by improving a promoter for an identified bend modulator or a cofactor of a bend modulator, including adding an exogenous promoter to the host cell genome. The host cell can be any cell with the ability to produce recombinant protein or peptide. In one embodiment, the host cell is a prokaryote, such as a bacterial cell that includes, but is not limited to, an Escherichia or Pseudomonas species. A host cell can be a Pseudimonad cell such as a P. fluorescens cell. In other embodiments, the host cell is an E. coli cell. In another embodiment the host cell is a eukaryotic cell, for example, an insect cell, which includes but is not limited to a cell of species Spodoptera, Trichoplusia, Drosophila or Estigmene, or a mammalian cell, which includes but is not limited to to murine cells, hamster cell, monkey cell, primate cell or human cell. In another embodiment, the host cell is a plant cell, including but not limited to, tobacco cell, maize cell, cell of an Arabidopsis species, potato cell or rice. In another modality, the whole organism is analyzed in the process, including but not limited to a transgenic organism. In a modality, the genes or gene activator compensating gene products identified are one or more proteases and / or one or more fold modulators. In certain embodiments, a gene or an identified gene product can also be a subunit of a protease or a fold modulator or a cofactor of a protease or a cofactor of a bend modulator. In one embodiment, the identified gene can be selected from a serine, threonine, cysteine, aspartic or metallo peptidase. In other certain embodiments, the gene or gene product identified can be selected from hslV, hslU, clpA, clpB and clpX. The gene or gene product identified can also be a cofactor of a protease. In another embodiment, the gene or gene product identified is a fold modulator. In certain embodiments, the gene or gene product identified can be identified from a chaperone protein, a foldasa, a peptidyl prolyl isomerase and a disulfide bond isomerase. In another embodiment, the gene or gene product identified can be selected from htpG, cbpA, dnaJ, dnaK and fkbP. In another embodiment, the gene or gene product homologous to the identified activated gene is modified in the host genome. The process can lead to increased production of recombinant protein or peptide in a host cell, for example, increasing the amount of protein per gram of host protein (total cell protein) in a certain amount of time, or increasing the amount or duration of time, in which the cell or organism is producing the recombinant protein. Increased production can optimize the efficiency of the cell or organism, for example, by decreasing energy consumption, increasing the use of available resources, or decreasing growth supplement requirements in growth media. Increased production can also result in an increased level of recoverable protein or peptide, such as soluble protein, produced by recombinant protein or per gram of host cell protein. The present invention also includes an improved recombinant host cell that is produced by the claimed processes. Brief Description of the Drawings Figure 1 is a graph of a growth comparison (optical density with time) or different strains of P. fluorescens. Cells were induced with 0.3 M IPTG at 24 hours after inoculation. The strains are: DC280 which houses the empty vector pDOW1339, DC240 which produces the soluble cytoplasmic nitrilasa enzyme, and DC271 which produces the partially insoluble periplasmic hGH. DC206, the strain of origin of DC280, DC240 and DC271, was included as a control. Samples were taken at 0 and 4 hours after the induction of IPTG for RNA isolation and gene expression profiling, as indicated by the arrows. Figure 2 is a plot of hierarchical clusters of all genes of the P. fluorescens strains DC280, DC240 and DC271 in 12 clusters at 4 hours after IPTG, when compared to the 0 hours of IPTG (indicated in ia lower part of the figure). Based on the value and trend, the genes were grouped and assembled using the hierarchical grouping algorithm of Spotfire DecisionSite. Dashed lines indicate data points that were filtered due to the quality of poor spots or low level of expression. Ax-x represents the comparison of each strain; the y-axis represents the relative expression value 4 hours later until before the IPTG induction. All identified FMs are marked. Group 7 shows 2 FM and 2 sub-unit protease genes that are highly expressed in strain DC271, which over-produces the periplasmic hGH protein. The remaining FM genes are grouped in group 6. Figure 3 is a hierarchical cluster analysis of group 6 of figure 2. In the new group 8, two fold modulators, DnaK and DnaJ, were identified, both of which showed higher expression levels for periplasmic recombinant protein production similar to previously identified HsIVU, CbpA and HtpG. Group 6 shows when the rest of the FMs are grouped. Figure 4 is a Venn diagram showing the activated protease and the FMs of the three groups of experiments in Table 5, 6 and 7. As summarized in Table 5, 6 and 7, the list of genes was organized in the Venn diagram to indicate the overlap of the gene list between the three groups of experiments indicated in the corner. For each gene, the proportion of each experiment was shown with the number 2 as a cut. Figure 5 is a graph of the sequence analysis of the genes hslV (RXF01961) and hslU (RXF019557) of P. fluorescens generated by Artemis. The codon usage trace (upper panel) indicates that the gene boundaries are correct. This is corroborated by the best homologues of the HslV and HslU protein sequences of P. aeruginosa as indicated under the RXF01961 and RXF01957 genes. The Phrap quality rating trace shows that the quality of the sequence is good, that is, the marking line is above the horizontal line indicating a better quality than 1 error in 10hb (middle panel). The white boxes opened below the genes show the location of the waves generated for use in DNA microformation experiments. Figure 6 is a schematic illustration of a mutant hslU construct in which a PCR product of approximately 550 base pairs of hslU (light blue box) was ligated into the cloning factor TOPO TA2.1 (circle). The resulting plasmid was transformed into competent P. fluorescens cells and kanamycin resistant colonies (can), which were analyzed in diagnostic PCR to confirm the construction of an insertion mutation in the hslU gene. Figure 7 is a graph of a growth curve assay comparing a wild-type strain with an hslU mutant strain that over-produces hGH or pbp :: hGH in an agitated leaflet production medium. The arrows indicate the time points where the samples were taken. Figure 8 is an SDS-PAGE analysis image of strains DC271 and DC373 expressing pbp :: hGH. Samples were taken from DC271 (wild type, W) and DC373 (mutant hslU, M) just before protein induction (0 hours) and after 4 hours, 8 hours, 24 hours and 30 hours after the addition of IPTG . Soluble (S) and insoluble (I) fractions were prepared for each sample analyzed. The production of processed and unprocessed hGH is indicated by the arrows. The molecular weight marker (MW) (Ma) is shown on the right side of the gels. Figure 9 is an image of the SDS-PAGE analysis of strains DC369 and DC372 that express hGH in the cytoplasm. Samples of DC369 (wild type, W) and DC372 were taken. { hslU mutant, M) just before protein induction (0 hours) and subsequently 4 hours, 8 hours, 24 hours, 30 hours and 50 hours after the IPTG addition. Soluble (S) and insoluble fractions (1) were prepared for each sample analyzed. The production of hGH is indicated by an arrow. The molecular weight marker (MW) (Ma) is shown on the right side of the gels. Figure 10 is a graph of growth curves of strains expressing the fusion progen hGH :: COP. Strains include DC369 that express hGH only (not fused to COP) as a negative conírol; HJ104, the natural type that expresses hGH :: COP; HJ105, the hslU mutant that expresses hGH :: COP. Figure 11 is a graph of the green fluorescence activity measurements of strains expressing the hGH :: COP fusion protein using the flowmeter. Five OD600 of cell culture were sampled for each strain that contains hGH or hGH :: COP at different time points after IPTG induction. The strains tested include: DC369 that expresses hGH only (not fused to COP) as a negative control; HJ104, the natural type that expresses hGH :: COP; HJ105, the mutant hslU expressing hGH :: COP. The inserted table shows the percentage increase in relative fluorescence in the mutant IPTG compared to the wild type at different time points after IPTG induction. Figure 12 is an illustration of the process to measure the relative abundance of mRNA between two samples. Figure 13 is a representation of the construction of the chromosome deletion of the hslUV gene in the negative strain pyrF. A. Plasmid pDOW2050 contains 505 base pairs and 634 base pairs of DNA fragments flanking the hslUV gene. Since the suicide plasmid pDOW2050 can not be replicated in P. fluorescens, the tetracycline resistant cells will only be generated after a single recombination event in one of the homologous regions that integrates the whole plasmid in the genome. B. Tetracycline resistant cells contain the entire plasmid integrated in the genome. These cells also contain the pyrF gene encoded from the plasmid. The selection of the cells having the second recombinant event occurred by plating cells on agar plates supplemented with FOA, which in positive strains of pyrF, becomes a toxic compound. C. The chromosomal illumination strain was confirmed by sequencing analysis. Figure 14 is a plot of fluorescence relative to time for green fluorescence activity measurements for strains expressing the hGH :: COP fusion protein using a flowmeter. Duplicates were used for both the wild type (HJ104) and hslUV (HJ117) elimination strains. Figure 15 are images of SDS-PAGE gels of strains expressing hGH with or without GrpE-DnakJ fold modulators. Samples were removed at various times after induction by IPTG (0, 4, 8, 24 and 48 hours), normalized to OD600 of 20 and used using EasyLyse. Soluble (S) and insoluble fractions (I) were separated on a Criterion BioRad 15% Tris HCI SDS-PAGE gel and stained with Comasia. Detailed Description of the Invention A process for improving the expression of a recombinant protein or peptide comprising: i) expressing the recombinant protein or peptide in a host cell; ii) analyzing a genetic profile of the cell and identifying one or more endogenous activated gene products, including one or more proteases or fold modulators that are activated at the time of expression of the recombinant protein or peptide; and iii) changing the expression of one or more identified gene products, genetically modifying the cell. In another embodiment, the process further comprises expressing the recombinant protein or peptide in a gene modified cell. In another embodiment, the process further comprises analyzing a second genetic profile of the gene-modified cell to identify one or more additional gene products that are differentially expressed in the modified cell. In a further embodiment, the process comprises changing the expression of at least one second gene product identified in the modified cell to provide a double modified cell. The process can provide improved expression as measured by improved protein productions as measured by improved protein production, or can improve recovery of the active protein, for example, by increasing the solubility of the expressed recombinant protein. More generally, the present invention includes a process for improving the expression of a recombinant protein or peptide in a host cell or organism, wherein the process comprises: i) expressing the recombinant protein or peptide in the host cell or recombinant organism; ii) analyzing a genetic profile of the recombinant cell to identify a gene or compensatory gene product that is expressed at a higher level in the recombinant cell than in either a host cell that has not been modified to express the recombinant protein or a cell recombinant that does not express the recombinant protein; and iii) changing the expression of the gene or compensating gene product identified in the recombinant cell by genetic modification to provide a modified recombinant cell that achieves an increase in the expression, activity or solubility of the recombinant protein. Throughout the present specification, when a range is provided, it should be understood that the components will be independent. For example, a range of 1 to 6 independently means 1, 2, 3, 4, 5 or 6. The steps of the process will be described in more detail later. Step 1: Genetic modification of host cell or organism expressing a recombinant protein or peptide in a host cell In the first step of the process, the host cell is modified to have the ability to express a recombinant protein or peptide. The host cell can be modified using any techniques known in the art. For example, the recombinant protein can be expressed from an expression vector that is exogenous to the genome of the cell and that is transfected or transformed in the cell. The construction of expression vectors, as well as transfection or transformation techniques will be described below. The host cell can also be modified to express a recombinant protein or peptide from a genomic insert such as will be described below. A gene encoding the recombinant protein or peptide can be inserted into the genome of the host cell or organism, by techniques such as homologous or heterologous recombination. These techniques will be described later. The recombinant protein or peptide can be expressed under the control of an element that requires additional manipulation of the cell. For example, chemical treatment of the cell may require starting or increasing the expression of protein, or peptide. The promoter and repressor elements that govern the expression of recombinant proteins or peptides in host cells will be described below and are well known in the art. These include promoter elements based on the "tac" promoter, which respond to IPTG. Selection of a Host Cell or Organism The process of the present invention can be used in any given host system, including either eukaryotic or prokaryotic. The process is usually limited only by the availability of sufficient genetic information for the analysis of a genetic profile to identify an identified gene. Although it is generally normal for sequences representing a large percentage of the genome to be available, for example, at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100% of the sequences expressed or found in the genome, transcriptomy or proteome, the present invention can be practiced using only a part of the sequences in the genome, transcriptomy or proteome. In particular, in cases where the available information includes information from a group of related sequences, such as a linked group in metabolic form, only a small portion of the representative genome sequences can be used for the process of the present invention. The process is also not limited to particular recombinant proteins that are expressed, since a key aspect of the process is the ability to design, in a rational and interactive way, expression systems based on techniques to identify the occurrence of cellular changes in a host cell at the moment of the expression of recombinant proteins or peptides and modulate the host cell using methods known in the art. The host cell can be any cell with the ability to produce recombinant protein or peptide. In a modality, the host cell is a microbial cell, that is, a cell from a bacterium, fungus, yeast or other eukaryotes, prokaryotes and unicellular viruses. The most commonly used systems for producing recombinant proteins or peptides include certain bacterial cells, particularly E. coli, due to their relatively inexpensive growth requirements and potential capacity to produce proteins in large batch cultures. Yeasts are also used to express relevant proteins and peptides in biological form, particularly for research purposes. Systems include Saccharomyces cerevisiae or Pichia pastoris. These systems are well characterized, generally provide acceptable levels of total protein expression and are comparatively fast and inexpensive. Insect cell expression systems have emerged as an alternative to express recombinant proteins in biologically active form. In some cases, correctly folded proteins can be produced that are modified after translation. Mammalian cell expression systems, such as Chinese hamster ovary cells, have also been used for the expression of recombinant proteins. On a small scale, these expression systems are often effective. Certain biological proteins can be derived from mammalian proteins, particularly in animal or human health applications. In another embodiment, the host cell is a plant cell, including but not limited to, tobacco cell, corn, a cell of an Arabidopsis species, potato cell or rice. In another embodiment, a multicellular organism is analyzed or modified in the process, including but not limited to, a transgenic organism. The techniques for analyzing and / or modifying a multicellular organism are generally based on techniques described below to modify cells. In one embodiment, the host cell can be a prokaryote, such as a bacterial cell that includes, but is not limited to, an Escherichia or Pseudomonas species. Typical bacterial cells are described, for example, in the publication "Biological! Diversity: Bacteria and Archaeans", a chapter of the On-Line Biology Book, provided by Dr MJ Farabee of the Star Mountain Community College, Arizona USA at URL: http : //www.emc.maricopa.edu/facultv/farabee/BIOBK/BioBookDiver sitv 2.html. In certain embodiments, the host cell may be a Pseudomonad cell, and it may typically be a P. fluorescens cell. In other embodiments, the host cell can also be an E. coli cell. In another embodiment, the host cell can be a eukaryotic cell, for example, an insect cell that includes, but is not limited to a cell of a Spodoptera, Trichoplusia Drosophila or Estigmene species, or a mammalian cell, which includes but is not it is limited to a murine cell, a hamster cell, a monkey cell, a primate cell or a human cell. In certain embodiments, the host cell is a Pseudomonad cell, and may be, for example, a P. fluorescens organism. In one embodiment, the host cell can be an element of any of the bacterial classification categories. The cell can be, for example, an element of a species of eubacteria. The host can be an element of any of the taxa: Acidobacteria, Actinobacteria, Aquificae, Bacteroidetes, Chlorobi, Chlamydiae, Choroflexi, Chrysiogenetes, Cyanobacteria, Deferribacters, Deinococcus, Dictyoglomi, Fibrobacters, Firmicutes, Fusobacteria, Gemmatimonadetes, Lentisphaerae, Nitrospirae, Planctomycetes, Proteobacteria, Spirochaetes, Thermodesulfobacteria, Thermomicrobia, Thermotogae, Thermus, (Thermales), or Verrucomicrobia. In an embodiment of a eubacterial host cell, the cell can be an element of any species of eubacteria, not including cyanobacteria. The bacterial host can also be an element of any species of Proteobacteria. A proteobacterial host cell can be an element of any of the Alphaproteobacteria taxa, Betaproteobacterla, Gammaproteobacteria, Deltaproteobacteria or Epsilonproteobacteria. In addition, the host may be an element of any of the taxa Alphaproteobacteria, Betaproteobacterla or Gammaproteobacteria, and an element of any species of Gammaproteobacteria. In a Gammaproteobacteriai host modality, the host will be an element of any of the Aeromonadales, Alteromonadales classification categories, Enterobacteriales, Pseudomonadales or Xanthomonadales; or an element of any species of the Enterobacteriales or Pseudomonadales. In one embodiment, the host cell can be of the Enterobacterial order, the host cell will be an element of the Enterobacteriaceae family, or an element of any of the genera Erwinia, Escheruchia or Serratia; or an element of the genus Escherichia. In an embodiment of a host cell of the order of Pseudomonadales, the host cell will be an element of the Pseudomonadaceae family, including the genus Pseudomonas. Gamma proteobacterial hosts include elements of the species Escherichia coli and elements of the species Pseudomonas fluorescens. Other Pseudomonas organisms may also be useful. Pseudomonads and closely related species include Subgroup 1 of Gram (-) Proteobacteria, which includes the group of Proteobacteria that belongs to the families and / or genera that are described in the publication of "Gram-Negative Aerobic Rods and Cocci" from RE Buchanan and N.E. Gibbons (eds.). Bergey's Manual of Determinative Bacteriology, pp. 217-289 (8th ed., 1974) (The Williams &Wilkins Co., Baltimore, MD, USA) (hereinafter "Bergey (1974)"). The table below presents these families of genera and organisms.

Subgroup 1 of "Gram (-) Proteobacteria also includes Proteobacteria that can be classified in this heading according to the criteria used in the classification.The heading also includes groups that were previously classified in this section but are no longer classified, like the genera Acidovorax, Brevundimonas, Burkholderia, Hydrogenophaga, Oceanimonas, Ralstonia and Stenotrophomonas, the genus Sphingomonas (and the genus Blastomonas, derived from it), which was created by regrouping organisms that belong (and previously were called species of) to the genus Xanthomonas, the genus Acidomonas, which was created regrouping organisms belonging to the genus Acetobacter as defined in Bergey (1974). In addition to hosts, cells of the genera Pseudomonas, Pseudomonas enalia (ATCC 14393), Pseudomonas nigrifaciens (ATCC 19375), and Pseudomonas putrefaciens (ATCC 8071) may be included, which have been respectively reclassified as Alteromonas haloplanktis, Alteromonas nigrifaciens, and Alteromonas. putrefaciens Similarly, for example, Pseudomonas acidovorans (ATCC 15668) and Pseudomonas testosteroni (ATCC 11996) have been reclassified as Comamonas acidovorans and Comamonas testosteroni, respectively; and Pseudomonas nigrífaciens (ATCC 19375) and Pseudomonas piscicida (ATCC 15057) have been respectively reclassified as Pseudoalteromonas nigrífaciens and Pseudoalteromonas piscicida. "The subgroup 1 of Gram (-) Proteobacteria" also includes Proteobacteria classified as belonging to any of the families: Pseudomonadaceae, Azotobacteraceae (now frequently referred to by the synonym of "Azotobacter Group" of Pseudomonadaceae), Rhizobiaceae and Methylomonadaceae (now frequently named by the synonym, "Methylococcaceae"). Accordingly, in addition to these genera otherwise described in the present invention, additional proteobacterial genera that are within "Gram (-) Proteobacteria Subgroup 1" include: 1) Bacteria of the Azotobacter group of the genus Azorhizophilus; 2) Bacteria of the Pseudomonadaceae family of the genus Cellvibrio, Oligella and Teredinibacter; 3) Bacteria of the family Rhizobiaceae of the genus Chelatobacter, Ensifer, Liberibacter (also called "Candidatus Liberibacter"), and Sinorhizobium; and 4) Bacteria of the Methylococcaceae family of the genus Methylobacter, Methylocaldum, Methylomicrobium, Methylosarcina and Methylosphaera. In another embodiment, the host cell is selected from "Subgroup 2 of Gram (-) Proteobacteria". The "Subgroup 2 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genus (with the total number of strains deposited publicly available, listed in the catalog of the same indicated in the parentheses, all deposited in the ATCC, unless otherwise indicated): Acidomonas (2); Acetobacter (93); Gluconobacter (37); Brevundimonas (23); Beijerinckia (13); Derxia (2); Brucella (4); Agrobacterium (79); Chelatobacter (2); Ensifer (3); Rhizobium (144); Sinorhizobium (24); Blastomonas (1); Sphingomonas (27); Alkaligenes (88); Bordetella (43); Burkholderia (73); Ralstonia (33); Acidovorax (20); Hydrogenophaga (9); Zoogloea (9); Methylobacter (2); Methylocaldum (1 in NCIMB); Methylococcus (2); Methylomicrobium (2); Methylomonas (9); Methylosarcin (1); Methylosphaera; Azomonas (9); Azorhizophilus (5); Azotobacter (64); Cellvibrio (3); Oligella (5); Pseudomonas (1139); Francisella (4); Xanthomonas (229); Stenotrophomonas (50) and Oceanimonas (4) · The example host cell species of "Subgroup 2 of Gram (-) Proteobacteria", include, but are not limited to the following bacteria (with the ATCC or other strain deposit numbers of examples thereof shown in the parentheses): Acidomonas methanolica (ATCC 43581); Acetobacter aceti (ATCC 15973); Gluconobacter oxydans (ATCC 19357); Brevundimonas diminuta (ATCC 11568); Beijerinckia indica (ATCC 9039 and ATCC 19361); Derxia gummosa (ATCC 15994); Brucella melitensis (ATCC 23456), Brucella abortus (ATCC 23448); Agrobacterium tumefaciens (ATCC 23308), Agrobacterium radiobacter (ATCC 19358), Agrobacterium rhizogenes (ATCC 11325); Chelatobacter heintzii (ATCC 29600); Ensifer adhaerens (ATCC 33212); Rhizobium leguminosarum (ATCC 10004); Sinorhizobium fredii (ATCC 35423); Swimming Blastomonas (ATCC 35951); Sphingomonas paucimobilis (ATCC 29837); Alcaligenes faecalis (ATCC 8750); Bordetella pertussis (ATCC 9797); Burkholderia cepacia (ATCC 25416); Ralstonia pickettii (ATCC 27511); > 4c / c / o \ orax facilis (ATCC 11228); Hydrogenophaga flava (ATCC 33667); Zoogloea ramigera (ATCC 19544); Methylobacter luteus (ATCC 49878); Methylocaldum gracile (NCIMB 11912); Methylococcus capsulatus (ATCC 19069); Methylomicrobium agile (ATCC 35068); Methylomonas methanica (ATCC 35067); Methylosarcina fibrata (ATCC 700909); Methylosphaera hansonii (ACAM 549); Azomonas agilis (ATCC 7494); Azorhizophilus paspali (ATCC 23833); Azotobacter chroococcum (ATCC 9043); Cellvibrio mixtus (UQM 2601); Oligella urethralis (ATCC 17960); Pseudomonas aeruginosa (ATCC 10145), Pseudomonas fluorescens (ATCC 35858); Francisella tularensis (ATCC 6223); Stenotrophomonas maltophilia (ATCC 13637); Xanthomonas campestris (ATCC 33913); and Oceanimonas doudoroffii (ATCC 27123). In another embodiment, the host cell is selected from "Subgroup 3 of Gram (-) Proteobacteria". The "Subgroup 3 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Brevundimonas; Agrobacterium; Rhizobium; Sinorhizobium; Blastomonas; Sphingomonas; Alcaligenes; Burkholderia; Ralstonia; Acidovorax; Hydrogenophaga; Methylobacter; Methylocaldum; Methylococcus; Methylomicrobium; Methylomonas; Methylosarcina; Methylosphaera; Azomonas; Azorhizophilus; Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter; Francisella; Stenotrophomonas; Xanthomonas and Oceanimonas. In another embodiment, the host cell is selected from "Subgroup 4 of Gram (-) Proteobacteria". The "Subgroup 4 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Brevundimonas; Blastomonas; Sphingomonas; Burkholderia; Ralstonia; Acidovorax; Hydrogenophaga; Methylobacter; Methylocaldum; Methylococcus; Methylomicrobium; Methylomonas; Methylosarcina; Methylosphaera; Azomonas; Azorhizophilus; Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter; Francisella; Stenotrophomonas; Xanthomonas and Oceanimonas. In one embodiment, the host cell is selected from "Subgroup 5 of Gram (-) Proteobacteria". The "Subgroup 5 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Methylobacter; Methylocaldum; Methylococcus; Methylomicrobium; Methylomonas; Methylosarcina; Methylosphaera; Azomonas; Azorhizophilus; Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter; Francisella; Stenotrophomonas; Xanthomonas and Oceanimonas. The host cell can be selected from "Subgroup 6 of Gram (-) Proteobacteria. "The" Subgroup 6 of Gram (-) Proteobacteria "is defined as the Proteobacteria group of the following genera: Brevundimonas; Blastomonas; Sphingomonas; Burkholderia; Ralstonia; Acidovorax; Hydrogenophaga; Azomonas; Azorhizophilus; Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter; Stenotrophomonas; Xanthomonas and Oceanimonas. The host cell can be selected from "Subgroup 7 of Gram (-) Proteobacteria. "The" Subgroup 7 of Gram (-) Proteobacteria "is defined as the Proteobacteria group of the following genera: Azomonas; Azorhizophilus; Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter; Stenotrophomonas; Xanthomonas and Oceanimonas. The host cell can be selected from "Subgroup 8 of Gram (-) Proteobacteria. "The" Subgroup 8 of Gram (-) Proteobacteria "is defined as the group of Proteobacteria of the following genera: Brevundimonas; Blastomonas; Sphingomonas; Burkholderia; Ralstonia; Acidovorax; Hydrogenophaga; Pseudomonas; Stenotrophomonas; Xanthomonas and Oceanimonas. The host cell can be selected from "Subgroup 9 of Gram (-) Proteobacteria". The "Subgroup 9 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Brevundimonas; Burkholderia; Ralstonia; Acidovorax; Hydrogenophaga; Pseudomonas; Stenotrophomonas and Oceanimonas. The host cell can be selected from "Subgroup 10 of Gram (-) Proteobacteria". The "Subgroup 10 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Burkholderia; Ralstonia; Pseudomonas; Stenotrophomonas; and Xanthomonas. The host cell can be selected from "Subgroup 11 of Gram (-) Proteobacteria". The "Subgroup 11 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Pseudomonas; Stenotrophomonas; and Xanthomonas. The host cell can be selected from "Subgroup 12 of Gram (-) Proteobacteria". The "Subgroup 12 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Burkholderia; Ralstonia; Pseudomonas. The host cell can be selected from "Subgroup 13 of Gram (-) Proteobacteria". The "Subgroup 13 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Burkholderia; Ralstonia; Pseudomonas; and Xanthomonas. The host cell can be selected from "Subgroup 14 of Gram (-) Proteobacteria". The "Subgroup 14 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the following genera: Pseudomonas and Xanthomonas. The host cell can be selected from "Subgroup 15 of Gram (-) Proteobacteria". The "Subgroup 15 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria of the genus: Pseudomonas. The host cell can be selected from "Subgroup 16 of Gram (-) Proteobacteria". "Subgroup 16 of Gram (-) Proteobacteria" is defined as the Proteobacteria group of the following Pseudomonas species (with the ATCC or other deposit number of the example strain (s) shown in parentheses): Pseudomonas abietaniphila (ATCC 700689 ); Pseudomonas aeruginosa (ATCC 10145); Pseudomonas alcaligenes (ATCC 14909); Pseudomonas anguilliseptica (ATCC 33660); Pseudomonas citronellolis (ATCC 13674); Pseudomonas flavescens (ATCC 51555); Pseudomonas mendocin (ATCC 25411); Pseudomonas nitroreducens (ATCC 33634); Pseudomonas oleovorans (ATCC 8062); Pseudomonas pseudoalcaligenes (ATCC 17440); Pseudomonas resinovorans (ATCC 14235); Pseudomonas straminea (ATCC 33636); Pseudomonas agarici (ATCC 25941); Pseudomonas alcaliphila; Pseudomonas alginovora; Pseudomonas andersonii; Pseudomonas asplenii (ATCC 23835); Pseudomonas azelaica (ATCC 27162); Pseudomonas beijerinckii (ATCC 19372); Pseudomonas borealis; Pseudomonas boreopolis (ATCC 33662); Pseudomonas brassicacearum; Pseudomonas butanovora (ATCC 43655); Pseudomonas cellulosa (ATCC 55703); Pseudomonas aurantiaca (ATCC 33663); Pseudomonas chlororaphis (ATCC 9446, ATCC 13985, ATCC 17418, ATCC 17461); Pseudomonas fragi (ATCC 4973); Pseudomonas lundensis (ATCC 49968); Pseudomonas taetrolens (ATCC 4683); Pseudomonas clssicola ATCC 33616); Pseudomonas coronafaciens; Pseudomonas diterpenlphlla; Pseudomonas elongata (ATCC 10144); Pseudomonas flectens (ATCC 12775); Pseudomonas azotoformans; Pseudomonas brenneri; Pseudomonas cedrella; Pseudomonas corrugata (ATCC 29736); Pseudomonas extremorietantalis; Pseudomonas fluorescens (ATCC 35858); Pseudomonas gessardü; Pseudomonas libanensis; Pseudomonas mandelii (ATCC 700871); Pseudomonas marginalis (ATCC 10844); Pseudomonas migulae; Pseudomonas mucidolens (ATCC 4685); Pseudomonas orientalis; Pseudomonas rhodesiae; Pseudomonas synxantha (ATCC 9890); Pseudomonas tolaasii (ATCC 33618); Pseudomonas veronii (ATCC 700474); Pseudomonas frederiksbergensis; Pseudomonas geniculata (ATCC 19374); Pseudomonas gingeri; Pseudomonas graminis; Pseudomonas grimontii; Pseudomonas halodenitrificans; Pseudomonas halophila; Pseudomonas hibiscicola (ATCC 19867); Pseudomonas huttiensis (ATCC 14670); Pseudomonas hidrogenovora; Pseudomonas jessenii (ATCC 700870); Pseudomonas kilonensis; Pseudomonas lanceolata (ATCC 14669); Pseudomonas lini; Pseudomonas marginata (ATCC 25417); Pseudomonas mephitica (ATCC 33665); Pseudomonas denitrificans (ATCC 19244); Pseudomonas pertucinogen (ATCC 190); Pseudomonas pictorum (ATCC 23328); Pseudomonas psychrophila; Pseudomonas fulva (ATCC 31418); Pseudomonas monteiiii (ATCC 700476); Pseudomonas mosselii; Pseudomonas oryzihabitans (ATCC 43272); Pseudomonas plecoglossicide (ATCC 700383); Pseudomonas putida (ATCC 12633); Pseudomonas reactans; Pseudomonas spinosa (ATCC 14606); Pseudomonas baleárica; Pseudomonas luteola (ATCC 43273); Pseudomonas stutzeri (ATCC 17588); Pseudomonas amygdali (ATCC 33614); Pseudomonas avellanae (ATCC 700331); Pseudomonas caricapapayae (ATCC 33615); Pseudomonas cichorii (ATCC 10857); Pseudomonas ficuserectae (ATCC 35104); Pseudomonas fuscovaginae; Pseudomonas meliae (ATCC 33050); Pseudomonas syringae (ATCC 19310); Pseudomonas viridiflava (ATCC 13223); Pseudomonas thermocarboxidovorans (ATCC 35961); Pseudomonas thermotolerans; Pseudomonas thivervalensis; Pseudomonas vancouverensis (ATCC 700688); Pseudomonas wisconsinensis and Pseudomonas xiamenensis. The host cell can be selected from "Subgroup 17 of Gram (-) Proteobacteria". The "Subgroup 17 of Gram (-) Proteobacteria" is defined as the group of Proteobacteria known in the art as the "Fluorescent Pseudomonads" which include those belonging, for example, to the following species of Pseudomonas: Pseudomonas azotoformans; Pseudomonas brenneri; Pseudomonas cedrella; Pseudomonas corrugata; Pseudomonas extremorientalis; Pseudomonas fluorescens; Pseudomonas gessardii; Pseudomonas libanensis; Pseudomonas mandelii; Pseudomonas marginalis; Pseudomonas migulae; Pseudomonas mucidolens; Pseudomonas orientalis; Pseudomonas rhodesiae; Pseudomonas synxantha; Pseudomonas tolaasii; and Pseudomonas veronii. The host cell can be selected from "Subgroup 18 of Gram (-) Proteobacteria". "Subgroup 18 of Gram (-) Proteobacteria" is defined as the group of all sub-species, varieties, strains and other sub-special units of the species "Pseudomonas fluorescent" including those belonging, for example, to the following (with the ATCC or other deposit numbers of the example strain (s) shown in parentheses): Pseudomonas fluorescens biotype A, also called biovar 1 or biovar I (ATCC 13525); Pseudomonas fluorescens biotype B, also called biovar 2 or biovar II (ATCC 17816); Pseudomonas fluorescens biotype C, also known as biovar 3 or biovar III (ATCC 17400); Pseudomonas fluorescens biotype F, also called biovar 4 or biovar IV (ATCC 12983); Pseudomonas fluorescens biotype G, also called biovar 5 or biovar V (ATCC 17518); Pseudomonas fluorescens biovar VI; Pseudomonas fluorescens Pf0-1; Pseudomonas fluorescens Pf-5 (ATCC BAA-477); Pseudomonas fluorescens SBW25; and Pseudomonas fluorescens subsp. Cellulosa (NCIMB 10462). The host cell can be selected from "Subgroup 19 of Gram (-) Proteobacteria". The "Subgroup 19 of Gram (-) Proteobacteria" is defined as the group of all strains of Pseudomonas fluorescens biotype A. A typical strain of this biotype is the strain P. fluorescens MB101 (see US Patent No. 5,169,760 of Wilcox) and derivatives thereof. An example of a derivative thereof is the P. fluorescens MB214 strain, constructed by inserting into the chromosomal asd locus MB101 (aspartate dehydrogenase gene), a PlacI-lacl-lacZYA construct of native E. coli (e.g. which was removed PlacZ). Additional P. fluorescens strains that can be used in the present invention include Pseudomonas fluorescens Migula and Pseudomonas fluorescens Loitokitok, which have the following ATCC designations: [NCIB 8286]; NRRL B-1244; NCIB 8865 strain COI; NCIB 8866 strain C02; 1291 [ATCC 17458; IFO 15837; NCIB 8917; THE; NRRL B-1864; pyrrolidine; PW2 [ICMP 3966; NCPPB 967; NRRL B-899]; 13475; NCTC 10038; NRRL B-1603 [6; IFO 15840]; 52-1C; CCEB 488-A [BU 140]; CCEB 553 [IEM 15/47]; IAM 1008 [AHH-27]; IAM 1055 [AHH-23]; 1 [IFO 15842]; 12 [ATCC 25323; NIH 11; den Dooren de Jong 216]; 18 [IFO 15833; WRRL P-7]; 93 [TR-10]; 108 [52-22; IFO 15832]; 143 [IFO 15836; PL]; 149 [2-40-40; IFO 15838]; 182 [IFO 3081; PJ 73]; 184 [IFO 15830]; 185 [W2 L-1]; 186 [IFO 15829; PJ 79]; 187 [NCPPB 263]; 188 [NCPPB 316]; 189 [PJ227; 1208]; 191 [IFO 15834; PJ 236; 22/1]; 194 [Klinge R-60; PJ 253]; 196 [PJ 288]; 197 [PJ 290]; 198 [PJ 302]; 201 [PJ 368]; 202 [PJ 372]; 203 [PJ 376]; 204 [IFO 15835; PJ 682]; 205 [PJ 686]; 206 [PJ 692]; 207 [PJ 693]; 208 [PJ 722]; 212 [PJ 832]; 215 [PJ 849]; 216 [PJ 885]; 267 [B-9]; 271 [B-1612]; 401 [C71A; IFO 15831; PJ 187]; NRRL B-3178 [4; IFO 15841]; KY 8521; 3081; 30-21; [IFO 3081]; N; PYR; PW; D946-B83 [BU 2183; FERM-P 3328]; P-2563 [FER -P 2894; FO 13658]; IAM-1126 [43F]; M-1; A506 [A5-06]; A505 [A5-05-1]; A526 [A5-26]; B69; 72; NRRL B-4290; PMW6 [NCIB 11615]; SC 12936; A1 [IFO 15839]; F 1847 [CDC-EB]; F 1848 [CDC 93]; NCIB 10586; P17; F-12; AmMS 257; PRA25; 6133D02; 6519E01; N1; SC15208; BNL-WVC; NCTC 2583 [NCIB 8194]; H13; 1013 [ATCC 11251; CCEB 295]; IFO 3903; 1062 or Pf-5. Other suitable hosts include those classified elsewhere in the reference, such as Gram (+) Proteobacteria. In one embodiment, the host cell is E. coli. The genome sequence for E. coli has been established for E. coli MG1655 (Blattner et al., (1997) .The complete genome sequence of Escherichia coli K-12 Science 277 (5331): 1453-74) and DNA Microformations are commercially available for E. coli K12 (MWG Inc, High Point, NC). E. coli can be cultured either in an enriched medium such as Luria-Bertani (LB) (10 g / L tryptone, 5 g / L NaCl, 5 g / L yeast extract) or a minimal dyeing medium such as M9 (6 g / L Na2HP04, 3 g / L KH2P04) 1 g / L NH4Cl, 0.5 g / L NaCl, pH 7.4), with a suitable carbon source such as 1% glucose. Routinely, a culture of E. coli cells is diluted overnight and inoculated into the enriched or fresh minimum medium either in a shake flask or in a fermenter and grown at a temperature of 37 ° C. A host may also be of mammalian origin, such as a cell derived from a mammal that includes any human or non-human mammal. Mammals may include, but are not limited to, primates, monkeys, pigs, sheep, cattle, rodents, ungulates, pigs, sheep, sheep, goats, cattle, deer, mules, horses, monkeys, chimpanzees, dogs, cats, rats and mice. A host cell can also be of plant origin. Any plant can be selected for the identification of genes and regulatory sequences. Examples of suitable plant targets for gene isolation and regulatory sequences may include, but are not limited to, alfalfa, apple, peach, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, sip, beans, Swiss chard, black cherry , blue cherry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, beaver, cauliflower, celery, cherry, escarole, coriander, sour fruit, clementines, clove, coconut, coffee, corn, cotton, blueberry , cucumber, Douglas fir, eggplant, chicory, bitter lettuce, eucalyptus, fennel, figs, garlic, squash, grape, grape fruit, jicama, kiwi, lettuce, lemon, lime, flaxseed, mango, melon, mushroom, nectarine, walnut, oats, oil palm, okra, olive, onion, orange, ornamental plants, palm, papaya, parsley, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple, potato, squash, radiata pine, radish, monkfish seed, rice, sip, southern pine, bean, pine, spin Here, strawberry, sugar cane, sunflower, sweet potato, tangerine, tea, tobacco, tomato, watermelon, wheat. In some modalities, the plants useful in the process are Arabidopsis, corn, wheat, beans, soybeans and cotton. For the expression of a recombinant protein or peptide, or for the modulation of an identified compensating gene, any plant promoter can be used. The promoter may be an RNA promoter from a polymerase II plant. The elements included in the plant promoters can be a TATA box or a Goldberg-Hogness box normally placed approximately 25 to 35 base pairs upstream (5") from the transcription start site, and the CCAAT box, located between the base pairs 70 and 100 of the updraft., the CCAAT box may have a different consensus sequence to the functionally analogous sequence of the mammalian promoters (Messing et al., In: Genetic Engineering of Plañís, Kosuge et al., associates., pp. 211-227 , 1983). In addition, virtually all promoters include additional upstream activation sequences or enhancers (Benoist and Chambo, Nature 290: 304-310 Gruss et al., Proc. Nat. Acad. Sci. USA 78: 943-947, 1981, and Khoury. and Gruss, Cell 27: 313-314, 1983) ranging from about -100 base pairs to -1000 base pairs or more upstream of the transcription start site. Recombinant protein or peptide expression As will be described below, a host cell or organism can be constructed to express recombinant protein or peptide using standard techniques. For example, the recombinant protein can be expressed from a vector or from an exogenous gene inserted into the genome of the host. Vectors that can be used to express exogenous proteins are well known in the art and are described below. Genes for expressing recombinant protein or peptide can also be inserted into the genome using techniques such as homologous or hetererological recombination as described further below. The recombinant protein or peptide can be expressed after induction with a chemical compound or at the time of the expression of an endogenous gene or product gene. The recombinant protein can also be expressed when the host cell is placed in a particular environment. The specific promoter elements are described below. These include, but are not limited to, promoters that can be induced at the time of cell treatment with chemicals such as IPTG, benzoate or anthranilate. Recombinant Proteins / Preptides.

The host cell has been designed to express a recombinant protein or peptide. These can be of any species and of any size. And yet, in certain embodiments, the recombinant protein or peptide is a therapeutically useful protein or peptide. In some embodiments, the protein may be a mammalian protein, for example a protein from a manu, and may be, for example, a growth factor, a cytosine, a chemosin, or a blood protein. The recombinant protein or peptide can be expressed mainly in an inactive form in the host cell. In certain embodiments, the recombinant protein or peptide is less than 100kD, less than 50kD, or less than 30kD in size. In certain embodiments, the recombinant protein or peptide is a peptide of at least 5, 10, 15, 20, 30, 40, 50, or 100 amino acids. There are expression vectors that allow the production of recombinant proteins in: E. coli. For all these protein expression systems, routine cloning procedures can be carried out, such as those already described above (Sambrook, et al. (200) Molecular cloning: A laboratory manuel, tirad edition Cold Spring Harbor, New York, Cold Spring Harbord Laboratory Press). The Champion ™ pET expression system provides a high level of protein production. Expression is induced from the strong T7lac promoter. This system has the advantage of high activity and specificity of T7 bacteriophage RNA polymerase for high-level transcription of the gene of interest. The lac operator located in the promoter region, provides more compact regulation than traditional 77-based vectors, improving plasmid stability and cell viability (Studier, FW and BA Moffatt (1986) Use of bacteriophage T7 RNA polymerase for direct high-level selective expression of cloned genes, Journal of Molecular Biology 189 (1): 113-30; Rosenberg, and associates. (1987) vectors for selective expression of cloned DNAs by T7 RNA polymerase Gene 56 (1): 125 -35). The T7 expression system uses the T7 promoter and the T7 RNA polymerase (T7 RNAP) for high-level transcription of the gene of interest. High level expression is achieved in expression systems 11 because T7 RNAP can be better processed than the native E. coli RNAP and is dedicated to the transcription of the gene of interest. The expression of the identified gene is induced by providing a T7 RNAP source from the host cell. This is accomplished using a BL21 E. coli host. containing a chromosomal copy of the T7 RNAP gene. The T7 RNAP gene is under the control of the lacUV5 promoter which can be induced by IPTG. T7 RNAP is expressed at the time of induction and transcribes the gene of interest. The pBAD expression system allows titratable, strictly controlled expression of the recombinant protein through the presence of specific carbon sources such as glucose, glycerol and arabinose (Guzmán, et al., 1995). Strict regulation, modulation and high level expression by vectors containing the arabinose pBAD promoter "Journal of Bacteriology 177 (14): 4121-30.) The pBAD vectors are designed solely to give precise control in expression levels. pBAD vectors are initiated in the araBAD promoter.The promoter is regulated in both positive and negative form by the araC gene product.AraC is a transcription regulator that forms a complex with L-arabinose.In the absence of L-arabinose, AraC dimer blocks transcription For maximum transcription activation, two events are required: (i) L-arabinose binds to AraC allowing transcription to start, (ii) The activating protein (CAP) -cAMP complex binds to DNA and stimulates AraC binding to the correct place in the promoter region. The trc expression system allows high level regulated expression in E. coli from the trc promoter. The expression vectors have been optimized for the expression of eukaryotic E. coli genes. The trc promoter is a strong hybrid promoter derived from tryptophan (trp) and lactose (lac). And it is regulated through the lacO operator and the product of the laclQ gene (Brosius, J (1984) Toxicity of an external gene product overproduced in Escherichia coli and its use in plasmid vectors for the selection of transcription terminators Gene 27 (2): 161-12). The present invention also includes the improved recombinant host cell that is produced through the reinvindicated process. In one embodiment, the present invention includes ana cell produced through the described process. In another embodiment, the present invention includes a host cell or organism that expresses a recombinant protein that has been genetically modified to reduce the expression of at least two proteases. In other embodiments, the present invention includes a host cell or organism that expresses a recombinant protein that has been genetically modified to reduce the expression of at least one protease selected from the group consisting of hslV, hslU, clpX, clpA and clpB, and in certain submodalities the cell or organism has been modified to reduce the expression of HslV or HslU. In certain embodiments, the host cell or modified organism expresses a recombinant mammalian derived protein, and can express a recombinant human-derived protein, which may be a human growth hormone. The cell can be modified through any techniques known in the art, for example through a technique wherein at least one protease gene is removed from the genome, or by mutating at least one protease gene to reduce the expression of a protease. , or by altering at least one promoter of at least one protease gene to reduce the expression of a protease. In another embodiment, a host or organism expressing a recombinant protein that is presented as genetically modified to increase the expression of at least one, at least two fold modulators, at least three fold expression modulators. In certain submodalities, bend modulators are not fold modulating subunits. The fold modulator may select to be the group consisting of products of the genes cbpA, htpG, dnaK, dnaJ, fkbP2, groES and groEl, and, in certain submodalities, may be htG or cbpA. The host cell or organism can, in an example without limitation, express a mammalian protein, such as human protein. The protein can be human growth hormone. The modulator or fold modulators can be increased, for example, by including an expression vector in the cell, as described in the present invention. The expression of the bend modulator can also be increased, for example, by mutating a promoter of a bend modulator or a subunit of the bend modulator. A host cell or organism expressing a recombinant protein can also be genetically modified to increase the expression of at least one fold modulator and decrease the expression of at least one protease or protease protein. Organisms comprising one or more cells produced by the process described are also included in the present mention. Step II: genetic profile analysis to identify a gene or compensatory gene product that is expressed at a higher level in the recombinant cells. The process and the present invention includes analyzing a genetic profile of the recombinant cell to identify a gene or reward gene product that is expressed at a higher level in the recombinant cell, than either in a host cell that has not been modified to express the recombinant protein, or a recombinant cell that does not express the recombinant protein. The term "genetic profile" as used in the present invention can include genes in a genome, mRNA, transcribed in genes in the DNA genome derived from mRNA transcribed from genes in the genome. A genetic profile can also include transcription products that have been modified by a cell such as gene division variants in eukaryotic systems, or proteins translated from genes in a genome, including proteins that are modified, by the cell or translated from the split variants of the translated mRNA of the genome. A genetic profile is understood as referring only to the simultaneous analysis of multiple entities, such as in a formation of other multiple systems, including multiple simultaneous spotting analysis or column chromatography with multiple link parts attached to the packet. In accordance with the present invention, 5.10, 25, 50, 70, 80, 90 or 100 or more genes or gene products are analyzed simultaneously. Transcriptome In one modality, the genetic profile analyzed is a transcriptome profile. A complete transcriptome refers to the full set of mRNA transcripts produced by the genome at any time. Unlike the genome, the transcriptome is dynamic and varies considerably in different circumstances due to different patterns of gene expression. Transcriptomics, the study of the transcriptome, is a comprehensible means of identifying patterns of gene expression. The analyzed transcriptome may include the entire known group of transcribed genes, ie the mRNA content of cDNA from a host cell or host organism. The cDNA can be a chain of neoclotides, an isolated polynucleotide, a nucleotide molecule, nucleic acid molecule or any fragment or complement of those that originate in recombinant or synthetic form and which is double-stranded or single-strand, coding or a non-coding, of an exon or of an intron of a genomic DNA molecule, or combined with carbohydrates, lipids, proteins or elements or inorganic substances. The nucleotide chain may be at least 5, 10, 15, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides in length. The transcriptome may also include only a part of the known group of genetic transcripts. For example, the transcriptome may include less than 98%, 95, 90, 85, 80, 70, 60, or 50% known in a host. The transcriptome can also target a specific group of genes. In one embodiment, the classification process can include classification using a formation or a microformation to identify a genetic profile. In another embodiment the profile of the transcriptome can be analyzed using known processes such as hybridization in stain tests such as Northern blotting. In other embodiments, the process may include processes based on copies such as PCR, which can quantify the expression of a particular group of genes. In one embodiment of the present invention, a gene identified, for example, a fold modulator protein (FM) or a protease protein, i.e., a protease, peptidase or associated polypeptide or cofactor is identified through a classification process high perfomance. The process may include analyzing the transcriptome profile using a microform or equivalent technique. In this embodiment, the microform may include at least a portion of the genome transcribed from the host cell, usually including part of the binding for samples of the genes of at least 50% of genes transcribed from the organism. More typically, the microform or equivalent technique includes binding portions of samples of at least 80%, 90%, 95%, 98%, 99%, or 100% of the genes transcribed in the genome of the host cell. However, in a separate embodiment, the microform may include binding portions to a selected subgroup of genes from the genome, including but not limited to putative protease genes or putative fold modulator genes. A microform or equivalent technique can usually also include binding portions for a group of genes that are used as controls, such as storage genes. A microform or equivalent technique can also include genes grouped into groups such as genes that encode degradation proteins, fold modulators and cofactors, metabolic proteins such as proteins involved in glucose metabolism or amino acid or nucleobase synthesis, transcription factors, nucleic acid stabilizing factors, extracellular signal regulated genes such as kinases and receptors or proteins of scaffolding.

A microformation is generally formed by linking a large number of independent binding portions, which may include polynucleotides, aptamers, chemistries, antibodies or other proteins or peptides to even support such as a microchip, glass slide or the like in a defined pattern. By contacting the microformation with a sample obtained from a cell of interest and detecting the binding of the binding portions expressed in the cell that hybridize to sequences on the chip, the pattern formed by the hybridization polynucleotides allow the identification of genes or groups of genes that are expressed in the cell. In addition, when each element linked to the solid support is known, the identity of the hybridization portions can be identified from the nucleic acid sample. A microformation technology force is one that allows the identification of differential genetic expression, simply comparing hybridization patterns. Examples of high throughput classification processes include hybridization of host cell mRNA or substantially corresponding cDNA for a hybridizable formation (s) or microformation (s). The formation or microformation can be one or more nucleic acid formations or nucleic acid oligomers or analog polymers. In one embodiment, the formation (s) or microformion (s) is given independently or collectively a microformation (s) or broad host-cell-genone formation (s), which contains a population of nucleic acid or oligomers or polymers nucleic acid analogs whose nucleotide sequence is hybridizable to representative portions of all genes known to encode or which are anticipated as FMs encoding the host cell strain or all genes known to encode or anticipate protein coding or coding proteases. protease of the host cell strain. A wide-genome microformation includes sequences that link to a representative portion of all known or anticipated open reading structure (ORF) sequences, such as mRNA, or corresponding host cDNA. Neuklotide sequences or analogs in the array generally hybridize to the mRNA or corresponding cDNA sequences of the host cell, and typically comprise a nucleotide sequence complementary to at least a portion of the mRNA or host cDNA sequence, or a homologous sequence to the bone mRNA sequence of host cDNA. Strands of simple DNA with complementary sequences can match each other and form double-stranded molecules. Microformations generally apply the principle of hybridization in a highly parallel format. Instead of an identified one, thousands of different identified potentials can be formed on a solid miniature stand. Instead of a single labeled DNA probe, a complex mixture of labeled DNA molecules, prepared from RNA of a particular cell type or tissue, is used. The abundances of molecules individually labeled in this complex probe usually reflect the expression levels of the corresponding genes. In a simplified process, when they hybridize for the formation, the abundant sequences will generate strong signals and the rare sequences will generate weak signals. The strength of the signal can represent the level of genetic expression in the original sample. In one modality, a formation or microformation of the width of a genome will be used. In one modality, the training represents more than 50% of the open reading structures in the host genome, or more than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the open reading structures known in the genome. The formation may also represent at least a part of at least 50% of the known sequences for encoding proteins in the host cell. In separate modes, the formation represents more than 50% of the genes or putative genes of the host cell or more than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92% , 93%, 94%, 95%, 96% or, 97%, 98%, 99%, or 100% of the known genes or putative genes. In one embodiment, more than one oligonucleotide or analog may be used for each gene with putative gene sequence or open reading structure. In one embodiment, these oligonucleotides or multiple analogs represent different parts of a known gene or putative gene sequence. For each gene or putative gene sequence, they may occur in the formation from about 1 or up to about 10000 or from about 1 or up to about 100 or from about 1 or up to about 50, 45, 40, 35, 25, 20, 15, 10 or less or oligonucleotides or analogues. A microformation or a formation or microformation of the full genome width can be prepared according to any process known in the art, based on the sequence (s) of the host cell genome, or the proposed coding sequence in the genome, or based on the knowledge of the mRNA sequences, expressed in the host cell or host organism.

For different types of host cell, the same type of microformation can be applied. Types of microformations include complementary DNA microformations (cDNA) (Schena, M. and associates. (1995) Quantitative monitoring of gene expression patterns with complementary DNA microformation Science 270: 467-70) and oligonucleotide microformations (Lockhart , and associates (1996) Expression monitoring by hybridization for high density oligonucleotide formations Nat. Biotechnol 14: 1675-80). For cDNA microformations the DNA fragment of a partial or total open reading structure is printed on the slides. Hybridization characteristics may be different along the slice, because different parts of the molecules can be printed in different places. For the oligonucleotide formations, 20 ~ 80mer oligos can be synthesized either in situ (on chip) or by conventional synthesis followed by chip immobilization, however, in general the probes were all designed to be similar with respect to temperature Hybridization and link affinity (Butte, A. (2002) Use and analysis of microformation data Nat Rev Drug Discov 1: 951-60). In the analysis of the profile of the transcriptome, the nucleic acid or oligomers or polymers of nucleic acid analogs can be RNA, DNA or an RNA or DNA analogue. Such nucleic acid analogs are known in the art, and include, for example: peptide nucleic acids (PNA); arabinose nucleic acids; Altritol nucleic acids; bridged nucleic acids, for example: nucleic acids bridged with (BNA), and nucleic acids bridged with 2'-0,4'-C-ethylene and nucleic acids bridged with 2'-0,4'-C-methylene nucleic acid with cycloexenyl; Nucleic acids based on nucleotide linked with -2 ', 5'; morpholino nucleic acids (nucleobase-substituted morpholino units connected, for example, by aminate phosphorus ligations); nucleic acid analogue substituted with backbone, for example, substituted nucleic acids, -2 '; wherein at least one of the 2'-carbon atoms of an oligo- or poly-saccharide-like nucleic acid or analog, is substituted independently with, for example, any of a halo, thio, amino, aliphatic, oxyliphatic group , thiolophosphate or aminoliphatic (where aliphatic is normally Ci-C 0 aliphatic). The oligonucleotides or oligonucleotide analogues in the array can be uniform in size and in one embodiment, can have from about 10 to about 1000 nucleotides, from about 20 to about 1000, from about 20 to about 500, from about 20 to about 100, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 nucleotides in length. The formation of oligoneuclotic probes can be a high density formation comprising more than about 100 or more than about 1000, or more different oligoneuclotic probes. Such high density arrays may comprise a probe density greater than about 60, more generally greater soon, more generally greater than about 600, often greater than about 1000, more frequently greater about 5000, most frequently greater about 10000, usually greater about 40,000 , more usually greater than about 100000, and in certain cases it is greater than about 400000, oligoneuclotic probes per cm2 (wherein the term "different oligonucleotides" refers to oligonucleotides having different sequences). Oligonucleotide probes range from about 5 to about 500, or about 5 to about 50, or from about 5 to about 45 nucleotides, or from about 10 to about 40 nucleotides and most typically from about 15 to about 40 nucleotides in length. Particular formations contain probes ranging from about 20 to about 25 oligonucleotides in length. The particular formations may comprise more than 10 or more than 50, or more than 100, and usually more than 1000 oligonucleotide probes specific for each identified gene. In one embodiment the formation comprises at least 10 different oligonucleotide probes for each. In another embodiment, the formation has 20 or fewer complementary ologonucleotides with each gene. Although a flat forming surface is normal, the formation can be fabricated on a surface having virtually any shape or even on multiple surfaces. The training may further comprise non-matching control probes. When said non-matching controls are found, the quantization step may correspond to calculating the correspondence in the intensity of the hybridization signal between the oligonucleotide probes and their non-matching control probe. When such non-matching controls are found, the quantization step may comprise calculating the difference in the intensity of the hybridization signal between each of the oligonucleotide probes and its corresponding non-corresponding control probe. The quantification may further comprise calculating the average difference in hybridization signal strength between each of the oligonucleotide probes and its corresponding non-corresponding control probe for each gene.

In some assay formats, the oligonucleotide probe can be ligated, for example, by covalent adhesion to a solid support. Oligonucleotide formations can be synthesized chemically by polymer synthesis processes immobilized in parallel or by light-directed polymer synthesis processes, such as, for example, on substrates of po I i-L-1 isine, such as slices . Formations synthesized in chemical form are convenient since the preparation of the probe does not require cloning, a step of nucleic acid amplification or enzymatic synthesis. The formation includes test probes which are oligonucleotide probes each of which has a sequence that is complementary to a subsequence of one of the genes (or the mRNA or the corresponding antisense cRNA), whose expression will be detected. In addition, the training may contain normalization controls, non-matching controls and expression level controls, as described in the present invention. A formation could be designed to include a hybridization oligonucleotide per known gene in a genome. Oligonucleotides or equivalent binding sites can be modified with 5'-animo to support the covalent bond to epoxy-coated slices. Oligonucleotides can be designed to reduce cross-hybridization, such as, for example, by reducing the sequence identity to less than 25% between the oligonucleotides. Generally, the melting temperature of the oligonucleotides is analyzed prior to the design of the formation to ensure consistent GC content and Tm, and the secondary structure of the oligonucleotide linkage and parts is optimized. For the profiling of the transcriptome, the secondary structure is usually minimized. In one embodiment each oligonucleotide is printed in at least two different places on the slice to increase accuracy. The control oligonucleotides can also be designed based on sequences from different species to that of the host cell or organism, to show a support link. The samples in the genetic profile can be analyzed individually or in groups in sets. The sets can usually be grouped by similarity in gene expression. In one embodiment, pools can be grouped individually as genes that are regulated to a similar point in a host cell. The sets may also include groups of genes that are up-regulated in a similar host cell, for example, genes that are activated and deactivated to a similar extent as compared to a host cell or a modified or unmodified cell. The sets can also include related groups by gene or protein structure, function, or in the case of a transcriptome formation, by placing or grouping binding portions for genes in the host genome. The groups of linkages or groups of genes or proteins analyzed may include genes selected from, but not limited to: genes encoding putative proteases or known proteases, protease co-factors or protease-like proteins; fold modulators, co-factors of fold modulators or proteins that can improve the fold or solubility of the protein; transcription factors: proteins involved in nucleic acid stability or translation initiation; kinases; cellular or intracellular receptors; metabolic enzymes; metabolic co-factors; envelope proteins; sigma factors; membrane binding proteins; transmembrane protein; proteins associated with membrane and storage genes. Proteome In another modality the genetic profile analyzed is a proteome profile, the proteome of a host is the group of complete proteins produced by the genome at any time. The proteome is generally much more complex than either the genome or the transcriptome because each protein can be chemically modified after synthesis. Many proteins have been dissociated during production, they are phosphorylated, acetylated, methylated or have carbohydrate groups adhered to them, depending on the host cell. The proteome can also be very dynamic. The protomimics, the study of the proteome, can cover a number of different aspects of the structure of the protein, protein expression and fusion of the protein. The techniques for the analysis of the proteome are not as strict as that used in transcriptomics. However, one advantage of proteomimics is that the functional molecules of the cells are studied. The process may include techniques that measure the levels of protein expression, protein-protein interactions, protein-small molecule interactions, or enzymatic activities. In an embodiment, the protome is analyzed by selecting a classification process that includes measuring the size of certain proteins, usually using mass spectrometry. In one embodiment, the technique for analyzing the profile of the proteome includes hybridization of an antibody to a protein of interest. For example, the process may include Western spotting processes as is known in the art or may include column chromatography. The process may also include standard processes such as Elisa classification known in the art. The process may also include modified binding sites with nucleic acid, which may be aftamers or may be proteins or chemical binding sites for protein or peptide fragments in the proteome and a classification process may include the amplification of the nucleic acids. The process can also include chemical compounds that bind proteins or protein fragments in a proteome, and the process can include measuring the bond through chemical means. The measurement may also include the measurement of reaction products in a chemical reaction, or by activation of a fluorophore. In mass spectrometry techniques in combination with separation tools, such as two-dimensional gel electrophoresis or multidimensional liquid chromatography, they can also be used in the process. Normally, the process includes a high-performance classification technique. The process of the present invention may include analyzing the profile of the proteome, using, for example, two-dimensional electrophoresis. This is a method for the separation and identification of proteins in a sample, moving in two dimensions oriented at right angles to each other. This allows the sample to be separated into a larger area, increasing the resolution of each component. The first dimension is usually based on the charge of a particular molecule while the second dimension can be based on the size of a molecule. In the first dimension, the proteins are resolved according to their isoelectric points using electrophoresis equivalent to immobilized pH (IPGE), isoelectric focus (IEF) or degrádente electrophoresis at equilibrium pH. Under standard conditions of temperature and urea concentration, the observed focus points of the vast majority of proteins closely approximate the anticipated isoelectric points calculated from the amino acid compositions of the proteins. Generally, the first step after the preparation of a host sample includes running the sample against a pH gradient, a process known as isoelectric focusing. The pH variants can be generated by adding ampholytes to an acrylamide gel. These are a mixture of amphoteric species with a range of values of pl. The pH gradients can also be generated by adding Immobilins that are similar to the ampholytes but have been immobilized within the polyacrylamine gel producing an immobilized pH variant that does not need to be previously focused. The second dimension in two-dimensional electrophoresis can be the separation by size of proteins. The proteins can be separated according to their molecular weight using sodium acrylamide poly-acrylamide electrophoresis (SDS-PAGE). The technique is widely used and known in the art. The basic idea is to coat proteins with a detergent (SDS), which covers all the proteins in a sample and loads them in a negative way. The proteins are then subjected to gel electrophoresis. The gels can usually be acrylamide gels and can be in a density gradient. The charge imposed on the gel pushes the proteins through the gel based on size. In two-dimensional electrophoresis, the separated proteins can include proteins of at least 10% of the body's proteome. More typically, the proteins of at least 20%, 30%, 40%, 60%, 80% or 90% of the proteins in the proteome of the host cell are separated and analyzed by techniques such as protein staining and spectrometry of dough. The process of the present invention also includes analyzing the profile of the proteome using a microformation. In this embodiment, the microform may include binding portions for at least a portion of the proteins expressed by the host cell under suitable growth conditions, and typically includes binding portions for proteins from at least 5% of the organism's proteome. More typically, the microform includes protein binding portions of at least 10%, 20%, 30%, 40%, 60%, 80% or 90% of the proteins in the host cell proteome. The binding portions can be antibodies, which can be fragments of antibodies such as single chain antibody fragments. The linking portions may also include aptamers, which are molecules that include nucleic acids that bind to specific proteins or portions of proteins. In a separate embodiment, the microform may include binding portions for a selected subset of proteome proteins, including, for example, putative protease proteins or putative double modulators. The microform normally can also include a group of binding portions for proteins that are used as controls. The genetic profile can be analyzed by measuring the binding of the proteins of the host cell expressing the recombinant protein or peptide to the binding sites in the microformation. The simplest protein formation format generally consists of a large number of reagents that capture proteins bound to defined points in a flat support material. Subsequently, this formation is exposed to a complex protein sample. The binding of proteins for specific analyzes to individual points can be monitored later using different methods. In cases where the materials for analysis have been previously labeled with a fluorescent ink, the link can be directly monitored using a fluorescence scanner. The classic antibody sandwich type format is often used, in which two protein binding reagents simultaneously bind to the same antigen: one antibody is immobilized on the surface, and the other is labeled in fluorescent or conjugated form for an enzyme that can produce a fluorescent, luminescent or colored product when supplied with the proper substrate. Monoclonal antibodies or their antigen binding fragments are normally a choice for capture agents due to their high specificity, affinity and stability. They have been used in a variety of protein-profile assay assays for simple analyzes, such as enzyme-linked immunosorbent assays (ELISA), since the 1970s. Additionally, the phage display libraries of the antibody fragments offer the potential for antibody production at proteomic scales. These libraries can be used to isolate high affinity binding agents against identified protein in a time structure significantly shorter than what is possible with immunization-based processes. The deployment of Ribosome and the deployment of mRNA are additional, completely in vitro processes that depend on the physical linkage of the library proteins to their mRNA encoding sequences. These processes have been successfully used to select high affinity binding reagents to identified proteins (Wilson.DS and associates (2001)).Use of mRNA deployment to select high affinity protein binding peptides Proc Nati Acad Sci USA 98: 3750-3755). Several groups have carried out a different method to develop high affinity protein capture reagents for protein biochips. For example, aptamers have been used, which are single-stranded RNA or DNA molecules that originate from in vitro selection experiments (called SELEX: systematic evolution of ligands by exponential enrichment) with high affinities for proteins. An additional development in aptamer technologies is also called photoaptamers. These molecules have an additional attribute that increases their usefulness as protein capture reagents. They carry the 5'-bromodexosiuridine activation photo crosslinking group, which, when activated by UV light, can cause covalent crosslinking with linked identified proteins (Petach, H & amp;; Gold, L (2002) Dimension capacity aspect: use of photoaptamers in microformations of Curr Opin protein Biotechnol 13: 309-314). The case of photo-crosslinking provides a second dimension of specificity similar to the binding of a secondary detection antibody in an immuno sandwich assay. A wide variety of surface substrates and adhesion chemistries have been evaluated for the immobilization of capture agents in protein microformations. One way to immobilize proteins in a solid support, is based on non-covalent interactions based on hydrophobic interactions or vander Waals, hydrogen bonding or electrostatic forces. Examples of electrostatic immobilization include the use of materials such as nitrocellulose and glass slides coated with poly-lysine or aminopropylsilane. Microformations of protein were also manufactured by means of physical absorption on plastic surfaces in plates of 96 tanks. An example of covalent adhesion of proteins to the surface has been described by MacBeath and Schreiber (MacBeath, G &Schreiber, SL (2000) The printing of proteins in the form of microformations for high performance function determination Science 289: 1760 -1763). Due to the very high affinity of streptavidin to biotin, the immobilization of biotinylated proteins on streptavidin surfaces can be considered almost covalent (Peluso, P Asociados. (2003) Optimization of antibody immobilization strategies for the construction of protein microformations. Anal Biochem 312: 13-124). Additional strategies have been described (Ruiz-Taylor, LA, and Associates (2001) X-ray photoelectron spectroscopy and radiometry studies of monolayers of polyolefins (.ethylene glycol) grafted with poly (L-lysine) derived with biotin on oxides of metal (Langmuir) 7313-7322; Ruiz-Taylor, LA Associates, (2001) Monolayers of poly (ethylene glycol) grafted poly (L-lysine) derivative in metal oxides as a class of biomolecular interfaces Proc Nati Acad Sci USA 2001, 98: 852-857; Mirror A, Bedford MT. (2004) Microform processes of protein-domain Mol Biol. 264: 173-81; Zhu, H Associates (2001) Global analysis of protein activities using protomated chips Science Express). The samples in the genetic profile can be analyzed individually or in groups in sets. The sets can usually be grouped by similarity in gene expression. In one embodiment, pools can be grouped individually as proteins that are regulated to a similar point in a host cell. The pools may also include groups of proteins that are regulated to a similar extent in a recombinant host cell, such as, for example, which are activated or deactivated to a similar extent as compared to a host cell or a modified or unmodified cell. The sets can also include related groups by structure, function or protein processing. The groups of protein binding sites in a formation, or group of proteins analyzed in a different assay such as two-dimensional electrophoresis may be selected, for example, from but not limited to: putative or known proteases, co-factor protease or protein type proteases; modulators of doubles, co-factors of doubles modulators or proteins that can improve protein doubling or solubility; transcription factors, proteins involved in nucleic acid stability or translation initiation; kinases; extracellular or intracellular receptors; metabolic enzymes; metabolic cofactors; Wrap proteins and storage genes. Metaboloma Proteomic analysis processes allow the abundance and distribution of many proteins to be determined simultaneously. However, the functional consequences of changes to the protoma are reported only indirectly. Another method is to measure the levels of these small molecules or metabolites. A genetic profile analyzed in the process of the present mention, can therefore include a metabolomic profile. The processes to analyze the metabolome of a specific host include in gas chromatography, high pressure liquid chromatography and capillary electrophoresis to separate metabolites according to various chemical and physical properties. The molecules can subsequently be identified using processes such as mass spectrometry. The process includes analyzing a genetic profile to identify a compensating gene or a gene product that is expressed at a higher level in the recombinant cell. In general, this step includes monitoring the expression (eg, detection and / or quantification of expression) of a plurality of genes or gene products. The expression is generally monitored by detecting the binding of the gene products of the host cell to a transcriptome, proteome or metabolome profile as described above. Linkage analysis may involve a linkage comparison between a recombinant protein or peptide that expresses recombinant host cell and a host cell na'i've or a recombinant host cell that does not express the protein or peptide. Detection This step includes the monitoring of expression (for example, by detecting and / or quantifying the expression) of a progeny of genes or gene products. Expression is generally monitored by detecting the binding of host cell gene products to a transcriptome, proteome or metabolome profile, as transcribed above. Normally at least about 10 genes can be tested, or at least about 100, or at least about 1,000 and / or at least about 10,000 different genes at a time. The process may involve providing a set of identified nucleic acids comprising RNA transcripts from one or more of said genes, or nucleic acids derived from RNA transcripts.; hybridizing the set of nucleic acids to a formation of oligonucleotide probes immobilized on a surface, wherein the formation comprises more than 100 different oligonucleotides and each different oligonucleotide is located at a previously determined region of the surface, each different oligonucleotide is adhered to the surface through at least one covalent bond, and the oligonucleotide probes are complementary to transcripts of RNA or nucleic acids derived from RNA transcripts; and quantifying the hybridized nucleic acids in the formation. A pictorial representation of a technique for monitoring the expression of a gene product between the two samples is illustrated in FIG. 12. The process may also involve providing a set of cellular proteins. These can be derived from cell phones that are made by lysing cells using detergents or surfactants; using osmotic lysis; using thermal changes such as freeze-thaw cycles; use mechanical means or use pressure changes. Normally chemicals are included in the process to lyse a cell or cellular system that inhibits certain proteins, such as proteases, particularly non-specific proteases, to limit protein degradation. In addition, cell phones are usually maintained at a temperature of 4 ° C or less, and can be maintained at a temperature of 0 ° C or lower, or at a temperature of 20 ° C or less, during processing. The Cells used can be separated before further processing, for example by size exclusion chromatography, ion exchange or affinity matrix chromatography, such as using HPLC. Normally, the identified genetic product, mRNA, cDNA, protein or metabolite is labeled with a detectable label or probe. The tag or probe may be one or more fluorescent or fluorophores. These may include commercially available molecules such as Cy3 and Cy5 linked, for example, to particular nucleotides that can be incorporated into a reverse transcribed cDNA to provide detectable molecules for classification. In one embodiment, a first fluorophore is incorporated into a sample from a host and a second fluorophore is incorporated into a sample from a host expressing recombinant protein or peptide. In one embodiment, the first fluoroflor and the second fluorophore emit different wavelengths of light. In this embodiment, the binding of the host samples and the recombinant protein expressing the host can be monitored in the same assay. In another embodiment, the fluorophores are excited at different wavelengths of light. In another embodiment, the first and second fluorophore are excited or emit light at the same wavelength. In this embodiment, samples of the host and the recombinant protein expressing the host are normally monitored in different assays. The process may also include a step to quantitate the hybridization of the identified nucleic acids or proteins or chemical metabolites. Quantification may include measuring the transcription levels of one or more genes. Normally the set of identified nucleic acids, for example, is one in which the concentration of the identified nucleic acids (pre-mRNA transcripts, mRNA transcripts or nucleic acids derived from the mRNA transcripts), is proportional to the expression levels of the genes that encode said identified nucleic acids. For transcriptome analysis, the set of nucleic acids can be labeled before, during or after hybridization, although normally the nucleic acids are labeled before hybridization. Fluorescence tags are normally used, often with a single fluorophore, and when fluorescence labeling is used, the quantification of the hybridized nucleic acids can be by fluorescence quantification from the labeled nucleic acid in hybridized fluorescent form. This quantification is facilitated through the use of a confocal laser scanner or fluorescence microscope, such as a confocal fluorescence microscope, which can be equipped with an automatic cover to allow the automatic exploration of the formation, and which can be equipped with a data acquisition system for the measurement registration and subsequent automatic processing of the fluorescence intensity information. Devices for reading such formations include the CloneTracker ™, ImaGene ™, GeneSight ™ and the GeneDirector ™ database available from Biodiscovery, Inc., El Segundo, Calif., Or the Gene Chip ™ reader available from Affymetrix, Inc. Santa Clara, California. In one embodiment, hybridization occurs with low stringency (at a temperature of about 20 ° C to about 50 ° C, or about 30 ° C to about 40 ° C, or about 37 ° C). Hybridization may include subsequent washes with progressively increasing stringency until a desired level of hybridization specificity is achieved. The quantification of the hybridization signal can be by any means known to one skilled in the art. However, in one modality, quantification is achieved through the use of a confocal florescence scanner. The data is usually evaluated by calculating the difference in hybridization signal strength between each oligonucleotide probe and its corresponding non-matching control probe. Normally, this difference can be calculated and evaluated for each gene. Certain analytical processes are provided in the present invention. Techniques for preparing suitable bacterial hybridization probes have been developed (see for example the publication of Cho et al. (2003) App. Envir Microbio 69: 4737-4742). For example, the cells can be stored in an RNA stabilizing agent such as RNAIater (Ambion, Austin, TX). The RNA is generally purified from 3 steps (1) isolation of total RNA, (2) deletion of contaminating DNA and (3) cleaning of total RNA. The total RNA can be isolated and subsequently, mixed with random hexamer primers and reverse transcriptase to make Cadn. Normally, at least one fluorescent zone is incorporated in the Cadn. In one embodiment, a fluorescent probe is incorporated, in another mode more than one probe, for example, 2, 3, 4, 5 or more fluorescent probes are incorporated in the same sample or different samples of Cadn. In a eukaryotic host, the set of identified nucleic acids may be the m polyA + RNA isolated from a biological sample, or c DNA made by reverse transcription of the RNA or c second-strand DNA or RNA transcribed from the double stranded DNA intermediary. Fluorescent tapes are usually incorporated into DNA molecules during the reverse transcription reaction. Due to the different structure of m RNA between prokaryotes (bacteria) and eukaryotes (yeast, mammalian cells, etc.) different primers can be used, however random primers can be used in both cases, and oligo-dT primers can be used in eukaryotes which have polyA tails. An alternative process is amino-allyl labeling to increase the signal intensity. This process incorporates nucleotide analogues that present a chemically reactive group to which a fluorescent ink can adhere after the reverse reaction transcription (Manduchi, E. et al. (2002) Comparison of different labeling processes for high microformation experiments. density of two channels Physiol Genomics 10: 169-79 The set of identified nucleic acids can be treated to reduce the complexity of the sample, and thus reduce the background signal obtained in the hybridization. or "background signal" refers to hybridization signals that result from non-specific binding, or other interactions, between the labeled labeled nucleic acids and the components of the oligonucleotide formation (e.g., oligonucleotide probes, control probes, the formation substrate, etc). In one method, a set of m RNAs, derived from a biological sample, is hybridized with a set of oligonucleotides comprising the oligonucleotide probes found in the array. Subsequently, the set of nucleic acids hybridized with RNase A is treated, which digests the single-stranded regions. The remaining double-stranded hybridization complexes are often denatured and the oligonucleotide probes are removed, leaving a set of m improved RNAs for the m complementary RNAs for the oligonucleotide probes in the array. In another method for background reduction, a set of mRNAs derived from a biological sample are hybridized with specific specific oligonucleotides identified in pairs, wherein the specific oligonucleotides identified in pairs are complementary to the regions flanking the complementary sub sequences. of the m RNAs to the oligonucleotide probes in the formation. The set of hybridized nucleic acids is treated with RNase H, which digests the hybridized nucleic acid sequences (double stranded). The nucleic acid sequence is a single strand remaining, which have a length of approximately equivalent to the region flanked by the specific oligonucleotides identified in pairs, are subsequently isolated (by electrophoresis) and used as the set of nucleic acids to monitor gene expression. A third method for background reduction comprises eliminating or reducing the representation in the set of previously selected individual selected mRNA messages (e.g., messages that are characteristically over-expressed in the sample). This process involves hybridizing an oligonucleotide probe that is complementary to the identified mRNA message previously selected to the set of po! And A + mRNAs derived from a biological sample. The hybrid oligonucleotide probe with the particular polyA + mRNA selected previously for which it is complementary. The set of hybridized nucleic acids is treated with RNase H which digests the double-stranded region (hybridized) thus separating the message from its polyA + tail. The isolation or amplification (for example, using an oligoDT column) of the m RNA polyA + in the set subsequently provides a set that has a reduced representation or does not have representation of the identified mRNA message previously selected. Analysis The identified gene is usually identified by comparing a genetic profile of the host cell expressing the recombinant protein or peptide to a genetic profile of the host cell that does not express the recombinant protein or peptide. In interactive modalities, the identified gene that will be modified, is identified by comparing a genetic profile of the cell that will be modified (the second cell) for the cell which was modified from it (the first cell). The identified gene is identified by comparing a genetic profile of the second cell with a genetic profile of the first cell, identifying one or more genes whose expression is increased in the second cell. The microformations of c DNA measure the abundance of m relative RNA between two samples. A series of point-in-time samples after induction can be compared to the previous induction sample for the same strain (temporal expression profile) or samples can be compared after induction with different strains at the same time point. The comparison can be through the use of a computer program, such as GeneSightTM. For example, when a microformation using a fluorescent label is used, the intensity of a point can be measured for each sample due to the formation (e.g., a DNA sequence). Subsequently the intensity point can be corrected for the background and the intensity ratio for the samples from the host versus the host expressing the protein or peptide and recombinant, or for the host expressing the protonein or peptide and recombinant as compared to the modified host expressing the recombinant protein or peptide can be measured. The proportion provides a measure to identify which genes are activated or the expression of which increases at the time of expression of the recombinant protein or peptide, or at the time of modification of the host cell to allow the identification of an Identified gene. To identify whether a gene is activated, a standard or "cut" ratio is established. The cut-off ratio can be designed to overcome the effects of background noise associated with a particular test. In general, any proportion greater than one between the measurements can designate an activated gene. However, the variation between trials may require a ratio greater than 1, for example, 1.5 or more than 2, or more than 2.5, or more than 3 or more than 3.5 or more than 4 or more than 4.5 or more than 5 or more than 6 or more than 7 or more than 8 or more than 9 or more than 10. The standard may be established before the process, depending on standards known in the art, or may be established as they compare proportions of control gene levels gene products, such as storage genes. Step III: change of expression of the compensating gene or gene product identified, genetically modifying the cell to provide a modified recombinant cell that achieves an increase in the expression, activity or solubility of the recombinant protein. Identified Compensator Genes The genes or product of compensating genes that are identified in step ii), or analog homologs, cofactors or subunits thereof, are used to design strategies to genetically modify cellulase either to increase, decrease, eliminate or incorporate the expression of one or more identified genes. The sequences of genes identified in public databases can be used to design strategies, particularly for designing constructs to modulate the expression of a gene by the techniques described above. These techniques are well known. In one embodiment, the gene or genes identified is at least one putative protease, a protease type protein, a cofactor or subunit of a protease. In other embodiments, the gene or genes identified are at least one doubles modulator, a putative double modulator, a cofactor or subunit of a doubles modulator. In certain embodiments, an identified gene is a subunit of a protease. In one embodiment, the gene or genes identified can be serine, theorine, cysteine, aspartic or metallopeptidase. In one embodiment, the identified gene or genes can be selected from hslV, hslU, clpA, club and clpX. The identified gene can also be the cofactor of a protease. In another embodiment, the gene or genes identified is a doubles modulator. In some embodiments, the identified gene or genes may be selected from a chaperone protein, a foldase, a prolyl peptidyl isomerase, and a disulfide bond filler. In some embodiments, the identified gene or genes can be selected dehtpG, cbpA, dnaJ, dnaK and fbkP. The bacterial genes organize into operons, which are sets of genes that encode the proteins necessary to carry out the coordinated function, such as biosynthesis of a given amino acid. Therefore, in one embodiment, the identified gene is part of an operon. In a particular embodiment, the identified gene is an operon that encodes one or more proteins with protease activity alone or in combination, or is an operon that encodes one or more proteins with doubles modulating activity, including foldases, chaperones and shampoos. Proteases In one embodiment of the present invention, the host cell is modified by reducing the expression of, inhibiting or eliminating at least one protease from the genome. The modification can also be more than one protease in some embodiments. In a related mode, the cell is modified by reducing the expression of a protease cofactor or protease protein. In another embodiment, the host cell is modified by Inhibiting a promoter for a related protein protease, which may be a native promoter. The gene modification can be to modulate a protein homolog to the identified gene. In the MEROPS database, peptidases are grouped into clans and families. Families are groups of functionally similar peptidases closely related. Families are grouped by their catalytic type: S, serine; T, threonine; C, cistern; A, aspartate; M, metallo and U, unknown. We have identified about 20 families (denoted from S1 to S27) of serine proteases being grouped into 6 clans (SA, SB, SC, SE, SF and SG) based on structural similarity and other functional evidence. The structures are known for 4 of the clans (SA, SB, SC and SE). The threonine peptidases are characterized by a threonine nucleotide at the N-terminus of the mature enzyme. The type example of this clan is the beta component of archaean proteazoma of filium acid termoplasma. Cisterna peptidases have characteristic molecular technologies and are peptidases in which the nucleophile is the sulfhydryl group of a cistern residue. The proteases of cisterns are divided into clans (proteins which are related in evolutionary form) and are further subdivided into families, on the basis of the architecture of their dyad or catalytic triad. The CA clan contains the families of papain (C1) calpain (C2) estretopain (C10) and the specific peptidases ubiquitin (C12 and C19), as well as many families of viral cistern endopeptidases. The CD clan contains the families of clostripaine (C11) gingipain R (C25), legume (C13), caspase- (C14) and separina (C50). These enzymes have specificities dominated by the interactions of the S1 subsite. The CE clan contains the adenaine (C5) families from adenoviruses, the eukaryotic Ulp1 protease (C48) and the bacterial YopJ proteases (C55). The CF clan contains only pyroglutamyl peptidase I (C15). The PA clan contains picornains (C3), which have probably been implicated in serine peptides and form the majority of the enzymes in this clan. The PB and CH clans contain the analytic cysteine peptidases. Aspartic endopeptidases of vertebrate origin, fungi with their retrovirals have been characterized. Aspartate peptidases are named in this way because the Asp receipts are the ligands of the activated water molecule in all the examples, where catalytic residues have been identified, although it is considered that at least one viral enzyme has an Asp and Asn in his catalytic dyad. All or almost all aspartate peptidases are endopeptidases. These enzymes have been assigned to clans (proteins that are related in evolutionary form) and further subdivided into families, largely on the basis of their tertiary structure. Metalloproteases are the most diverse types of the four major types of protease, with more than thirty families identified to date. In these enzymes, a divalent cation, usually zinc, activates the water molecule. The metal ion is held in place by amino acid ligands, usually three. The known metal ligands are His, Glu, Asp or Lys and at least one other residue is required for catalysis, which can play an important role in the electrophilic role. Of the known metalloproteases, about half contain an HEXXH motif, which has been shown in crystallographic studies to be part of the metal binding site. The HEXXH motif is relatively common, although it can be defined more strictly for metalloproteases such as abXHEbbHbc, where 'a' is most often valine or threonine and is part of subsite S1 'in thermolysin and neprilysin,' b ', is a unloaded residue, and 'c' is a hydrophobic residue. Proline is never found in this site, possibly because it can break the helical structure adopted for this reason in the metalloproteases. The peptidases associated with the U- clan have a catalytic mechanism known as the protein fold of the active site domain and no active site residues have been reported. Certain proteases (eg, OmpT) can adsorb the surface of inclusion bodies and can degrade the desired protein, being redoubled at the same time. Accordingly, certain proteins identified can be proteases or protease proteins that adhere to inclusion bodies and these can be modified, for example, to reduce adhesion. Proteases or protease proteins can also be classified as Aminopeptidases; Dipeptidases; Dipeptidyl Peptidases and Tripeptidyl Peptidases; Peptidyl dipeptidases; Serine type carboxypeptidases; Metalocarboxypeptidases; Carboxypeptidases type cysteine; Omegapeptidases; Serine proteinases; Cysteine proteinases; Aspartic proteinases; Metallo proteinases; o Proteinases of an unknown mechanism. Aminopeptidases include cytosol aminopeptidase (leucyl aminopeptidase), membrane alanyl aminopeptidase, cystinyl aminopeptidase, tripeptide aminopeptidase, prolyl aminopeptidase, arginyl aminopeptidase, glutamyl aminopeptidase, x-pro aminopeptidase, bacterial leucyl aminopeptidase, thermophilic aminopeptidase, clostridial aminopeptidase, alanyl cytosol aminopeptidase, lysyl aminopeptidase, x-trp aminopeptidase, tryptophanyl aminopeptidase, methionyl aminopeptidase, stereospecific aminopeptidase-d, aminopeptidase ey. Dipeptidases include x-his dipeptidases, x-arg dipeptidases, x-methyl-hispe di-peptidases, cis-gly dipeptidase, glu-glu dipeptidase, pro-x dipeptidase, x-pro dipeptidase, meth dipeptidase -x, non-stereospecific dipeptidase, non-specific cytosol dipeptidase, membrane dipeptidase, beta-ala-hispe dipeptidase. Dipeptidyl peptidases and tripeptidyl peptidases include dipeptidyl peptidase i, dipeptidyl peptidase ii, dipeptidyl peptidase iii, dipeptidyl peptidase iv, dipeptidyl dipeptidase, tripeptidyl peptidase I, tripeptidyl II peptidase. The peptidyl dipeptidases include peptidyl dipeptidases a and peptidyl dipeptidases b. Serine-type carboxypeptidases include pro-x lysosomal carboxypeptidase, carboxypeptidase D-ala-D-ala serine type, carboxypeptidase C, carboxypeptidase D. Metalocarboxypeptidases include carboxypeptidase a, carboxypeptidase B, lysine carboxypeptidase (arginine), carboxypeptidase of gly-X, alanine carboxypeptidase, muramoylpentapeptide carboxypeptidase, carboxypeptidase h, glutamate carboxypeptidase, carboxypeptidase M, carboxypeptidase muramoyltetrapeptide, zinc carboxypeptidase d-ala-d-ala, carboxypeptidase A2, membrane carboxypeptidase pro-x, tubipole l-tyr carboxypeptidase, carboxypeptidase t. Omegapeptidases include acylaminoacyl peptidase, peptidyl glycinamide, pyroglutamyl peptidase I, beta-aspartyl peptidase, pyroglutamyl II peptidase, n-formylmethionyl peptidase, pteroylpoly [gamma] -glutamate carboxypeptidase, gamma-glu-carboxypeptidase , acylmuramoyl-ala peptidase. Serine proteinases include chymotrypsin, chymotrypsin c, metridine, trypsin, thrombin, coagulation factor Xa, plasmid, enteropeptidase, acrosin, alpha-lytic protease, glutamyl, endopeptidase, cathepsin G, coagulation factor viia, coagulation factor xa, cucumisi, prolyl oligopeptidase, coagulation factor xia, braqiurin, plasma kallikrein, tissue kallikrein, pancreatic elastase, luecocyte elastase, coagulation factor xiia, chymase, complement component c1r55, complement component c1s55, classic complement of convertase trajectory c3 / c5, complement factor I, complement factor D, alternative complement of trajectory convertase c3 / c5, cerevisin, hypodermin C, lysyl endopeptidase, la endopeptidase, gama-reni, venombin ab, leucyl endopeptidase, tryptase, escutelarina, quexina, subtilisina, orizina, endopeptidasa k, termomicolina, termitasa, endopeptidasa SO, activator of plasminogen-T, protein C, pancreatic endopeptidase E, pancreatic elastase ii, serine-specific endopeptidase-IGA, U-plasminogen, activator, venombin A, furin, myeloblastin, semenogelase, granzyme A or cytotoxic T lymphocyte-1 proteinase, granzyme B or lymphocyte proteinase- Cytotoxic t 2, streptogrisin A, treptogrisin B, glutamyl II endopeptidase, oligopeptidase B, limulus c coagulation factor, limulus coagulation factor, limulus coagulation enzyme, omptin, lexa repressor, bacterial leader peptidase, togavirin, flavirin . Cysteine proteinases include captesin B, papain, ficin, chemopapain, asclepain, clostripain, streptopain, actinide, cathepsin 1, cathepsin H, calpain, cathepsin t, glycillin, endopeptidase, cancer procoagulant, cathepsin S, picornain 3C, picornain 2A, caricana, ananaine, trunk bromelain, fruit bromelain, legume, histolysine, interleukin 1-beta conversion enzyme. Aspartic proteinases include pepsin A, pepsin B, gastricsin, chymosin, cathepsin D, neopentesin, renin, retropepsin, pro-opiomelanocortin conversion enzyme, aspergillopepsin I, aspergillopepsin II, penicillopepsin, rizopuspepsin, endotiapepsin, mucoropepsin, candidapepsin, sacaropepsin, rodotorulapepsin, fisaropepsin, acrocylindropepsin, polyoropepsin, picnoporopepsin, escitalidopepsin a, escitalidopepsin b, xanthomonapepsin, cathepsin e, barrier pepsin, bacterial leader peptidase I, pseudomonapepsin, plasmepsin. Metalloproteinases include atrolisin a, microbial collagenase, leucolysin, interstitial collagenase, neprilysin, envelisin, iga-specific metalloendopeptidase, procollagen N-endopeptidase, thimet oligopeptidase, neurolysin, stromelysin 1, meprin A, C-procollagen endopeptidase, peptidyl metalloendopeptidase -lis, astacin, stromelysin 2, matrilysin gelatinase, aeromonolysin, pseudolysin, thermolysin, bacilolysin, aureolysin, coccolysin, micolysin, beta-lytic metallopendopeptidase, peptidyl-asp metalloendopeptidase, neutrophil collagenase, gelatinase B, leismanolysin, saccharolysin, autolysin, deuterolysin, serralysin, atrolisin B, atropinase C, atroxase, atropinase E, atropinisin F, adamalysin, horrilisin, ruberlisin, botropasin, botrolisin, opiolysin, timerelisin I, timerelisin II, mucrolisin, pitrilysin, insulinsin, O-sialoglycoprotein endopeptidase, ruselisin, mitochondrial, intermediary, peptidase, dactylisin, nardilisin, magnolysin, meprin B, mitochondrial processing peptidase, macrophage elastase, coriolysin, toxilisin. Proteinases of unknown mechanism include thermopsin and multicatalytic endopeptidase complex. Certain proteases of P. fluorescens are described in Table A.

Certain proteases of E. coli origin are described in Table B.

Certain proteases of S. cerevisiae origin are described in Table C. Bending Modulators The identified gene or gene products can be one or more fold modulators. The fold modulators can be for example HSP70 proteins, HSP1 0 / SSE proteins, HSP40 proteins (related-DNAJ), GRPE-like proteins, HSP90 proteins, CPN60 and CPN10 proteins, cytosolic chaperonins, HSP100 proteins, Small HSPs, Calnexlna and calreticulin. , proteins related to PDI and thioredoxin, Peptidyl-proyly isomerases, binding proteins Ciclofilin PPIases, FK-506, PPIases Parvulina, individual Chaperonins, protein-specific chaperones, chaperones or intramolecular. Bending modulators are generally described in the "Guidebook to Molecular Chaperones and Protein-Folding Catalysts" (1997) ed. M. Gething, Melbourne University, Australia. The best characterized molecular chaperones in the cytoplasm of E. coli are the DnaK-Dna J-GrpE and GroEL-GroEs systems dependent on ATP. Based on in vitro studies and homology considerations, a number of additional cytoplasmic proteins have been proposed to function as molecular chaperones in E. coli. These include ClpB, HtpG and IbpA / B, which like DnaK-DnaJ-GrpE and GroEL-GroES, are heat impact proteins (Hsps) that belong to the voltage regu- lation. The trans conformation of the X-Pro bonds is left to be said in energetic form in nascent protein chains; however, -5% of all prolyl peptide bonds are in a cis conformation in native proteins. The trans isomerization to cis of the X-Pro bonds is a limiting range in the fold of many polypeptides and is catalyzed in vivo by cis / trans prolyl peptidyl isomerases (PPIases). Three cytoplasmic PPIases, SlyD, S1pA and trigger factor (TF), have been identified in E. coli to date TF, a 48 kDa protein associated with 50S ribosomal subunits that have been postulated to cooperate with E. coli chaperones, guarantee the adequate folding of recently synthesized proteins. At least five proteins (thioredoxins 1 and 2, and glutaredoxins 1, 2 and 3, the products of the genes trxA, trxC, grxA, grxB and grxC, respectively) are involved in the reduction of disulfide bridges that arise temporarily in cytoplasmic enzymes . Therefore, identified can be disulfide bond forming proteins or chaperones that allow for adequate disulfide bond information. Certain fold modulators in P. fluorescens are illustrated in Table D.

Certain modulators of doubles in E. coli are described in Table E.

Some double-blind mod ers of S. cervisia are shown in Table F. Table F Access ID Source GO Annotation Family Uniprot Uniprot GroES / EL P19882 HS60 YEAST GOA: Inteipro Heat Impact Protein 60, Hsp60 M38 P12228 Mitochondrial Precursor TC62_YEAST GOA: interpro Chaperon mitochondrial TCM62 Hsp60 P3891Ü CH10 YEAST UÜA: interpro Heat Impact Protein 10 kDa Hsp 10 mitochondrial Hsp70 (DnaK / J P25491 MAS5JYÉAST GOA: interpro Protein MAS5, Ydjl of Hsp40 import of mitochondrial protein P10591 HS71_YEAST PMID: 9789005 Protein heat impact SSA1 Hsp70 P10592 HS72JYEAST PMDD: 9448096 Protein heat impact SSA2 Hsp70 P11484 HS75_YEAST Protein impact of heat SSB1 Hsp70 P40150 HS76_YEAST Heat impact protein SSB2 Hsp70 P09435 HS73_YEAST PMID: 7867784 Heat impact protein SSA3 Hsp70 P22202 HS74_YEAST Heat impact protein SSA4 Hsp70 P25294 SISIJfEAST GOA: interpro Protein SIS1 Hsp40 P32527 ZUOIJYEAST GO: 0003754 Zuotina Hsp40 P35191 DJ1 YEAST GOA: interpro Protein DJ1, mitochondrial precursor Hsp40 P12398 HS77_YEAST PM1Ds: 8654364 Protein heat impact SSC1, Hsp70 mitochondrial precursor P38523 GRPE_YEAST GOArinterpro protein homologue GrpE, GrpE mitochondrial precursor, MGE1 P14906 SC63_YEAST GOA: spk Protein translocation Sec63 Hsp40 P16474 GR78_YEAST GRP 78, BIP, KAR2 Hsp70 P25303 SCJ1_YEAST GOA: I interpro Protein related to DnaJ SCJ1 Hsp40 P39101 CAJ1 YEAST GOA: interpro Protein CAJ1 Hsp40 P48353 HLJ1_YEAST GOA: interpro Protein HLJ1 Hsp40 P39102 XDJ1_YEAST GOA: interpro Protein XDJ1 Hsp40 P52868 YGM8 YEAST GOA: interpro Protein of hypothetical 41.0 kDa Hsp40 in the endogenous region CEG1-SOH1 P53940 and H7_YEAST GOA: interpro Protein of 58.9 kDa hypothetical Hsp40 in region ¡ ether TPM1-MKS1 P38353 SSH1_YEAST Protein counterpart of sixty-one Sec. Hsp70 P36016 LHS 1_YEAST GOA: spkw Heat impact protein homologue 70 Hsp70 LHSl. SSIl P38788 YHM4 YEAST PMID.-l 1054575 Homologue heat shock protein 70 Hsp70 YHR064C HspllO / Sse P32589 HS78_YEAST PMID: 10480867 Heat impact prolein homologo SSEl SSE P32590 HS79_YEAST Heat impact prolein homolog SSE2 SSE HsplOO (CIp / Hsl) P31539 H104_YEAST GOAnnterpro Heat impact protein HsplOO P33416 HSP7 YEAST GOA: spkw Heat impact protein HsplOO M38 P12323 MCX1_YEAST GOA: interpro Chaperon MCX1 clpX type mitochondrial HsplOO Heat Impact Protein Small P15992 HS26 YEAST PMID: 10581247 Protein of heat impact 26 Small Hsp Prefoldina P48363 PFD3_YEAST GOA: interpro Probable prefoldine subunit 3 Prefoldina Q04493 PFD5_YEAST GOAnnterpro Prefoldin subunit 5 Prefoldin P43573 YFC3 YEAST GOA: nterpro Hypothetical 91.4 kDa protein in Prefoldin endogenous region STE2-FRS2 P46988 PFD1_YEAST jGOAíspkw Prefoldin subunit · 1 E2 P40005 PFD2_YEAST GOA: spkw Prefoldin subunit 2? 2 P53900 PFD4_YEAST GOA : spkw Prefoldin subunit 4 E2 P52553 PFD6_YEAST GOA: spkw Prefoldin subunit 6 KE2 Hsp90 P02829 HS82_YEAST GOA: interpro Heat shock protein HSP82 Hsp90 P15108 HS83_YEAST GOAnnterpro Protein cognate heat shock Hsp90 HSC82 P06101 CC37_YEAST GOA: spkw Co-chaperon Cdc37 Hsp90 Cdc37 P33313 CNS1_YEAST GOA: spkw Suppressor 1 of cyclophilin seven CNS1 P15705 STIIJYEAST PMID: 8972212 Heat impact host STI1 Calnexin P27825 CALX_YBAST GOA: spkw Calnexin homologous precursor Calnexin Cytosolic Chaperonins T-complex P12612 TCPA_YEAST GOArinterpro Protein 1 T-complex, subunit TCP-1, Hsp60 alpha P39076 TCPB_YEAST GOA: inteipro Proíeína 1 T-complex, beta subunit TCP-1, Hsp60 P39078 TCPD YEAST GOArinterpro Protein 1 T-complex, subunit TCP-1, Hsp60 delta P40413 TCPE_YEAST GOA: interpro Protein 1 T-complex, subunit TCP-1, Hsp60 epsilon P39077 TCPG_YEAST GOA: interpro Protein 1 T-complex, subunit TCP-1 , Hsp60 range P42943 TCPH_YEAST GOArinterpro Protein 1 T-complex, tanity eta TCP-1, Hsp60 P47079 TCPQ_YEAST GOArinterpro Protein 1 T-complex, subunit TCP-1, Hsp60 theta P39079 TCPZ_YEAST GOA: interpro Protein 1 T-complex, subunit zeta TCP- 1, Hsp60 Protein Specific P48606 TBCAJTEAST GOA: spkw Properon-specific tubulin-specific chaperon A P53904 TBCB_YEAST GOA: spkw Protein-specific tubulin-specific chaperon B P46670 CIN2_YEAST GOA: spkw Prolein-specific tubulin C Cin2 bending coffin P40987 CIN1_YEAST Bending factor tubulin D P39937 specific protein kin PAC2_YEAST GOA: spkw Tubulin bending factor E PAC2 specific prolein PAC2 CBP3 YEAST GOA: spkw CBP3 protein, specific precursor of mitochondrial prolein Q12287 COXS_YEAST GOA: spkw Copper protein cytochrome specific oxidase chaperon c P40202 LYS7_YEAST 'GOArinterpro Copper superoxide dismutase chaperone 1 Q02774 SH 3_YEAST PMED: 10564255 Protein specific protein segregation component SHR3 P38293 UMPIJflEAST GOA: spkw Protein specific proteasome maturation factor UMP1 P38784 VM22 YEAST PMID: 7673216 Protein VMA22 assembly vacuolar specifi prolein co ATPase P38072 SC02_YEAST GOA: spkw Protein SC02, precursor specific mitochondrial protein P53266 SHY1_YEAST PMID: 11389896 Protetna SHY1 specific protein P40046 VTC1_YEAST GOA: spk Chaperon 1 of vacuolar protein carrier specific P38958 PTOO_YEAST PMID: 11498004 Protein PET100, precursor protein specific mitochondrial Disulfide Link Isomerases P17967 PDI_YEAST PMID: 11157982 Precursor of disulfide isomerase Oxidoreductase of protein disulfide bond P32474 EUG1_YEAST PMID: 11157982 Disulfide isomerase precursor Protein oxidoreductase EUG1 disulfide bond Q12404 MPD1_YEAST PMID: 11157982 Disulfide isomerase precursor Oxidoreductase PDI disulfide bond Q99316 PD2_YEAST ??? : 11157982 Precursor (EC 5.3.4.1) of isomerase Protein disulfide oxidoreductase MPD2 disulfide bond Q03103 E OT_YEAST PMID: 9659913 Precursor (EC 1.8.4.) Of oxidoreducine Endoplasmic oxidoreductase 1 disulfide bond (Protein 1 of endoplasmic oxidoreductase). P38866 FM01_YEAST PMTO: 10077572 Thiol specific onooxygenase Oxidoreductase (flavin disulphide bond dependent monooxigenase) (EC 1.14.13.-) Peptidyl-prolyl cis-trans isomerases P14832 CYPH .YEAST GOA: interpro Ciclofilin cyclophilin isomerase cyclophilin Peptidyl-prolyl type PPIase: A / Cprl / Cypl / CPHl / Scol P23285 CYPB_YBAST GOA: interpro Cyclophilin cyclophilin isomerase cyclophilin cyclophilin Peptidyl-prolyl type PPIase: B / Cpr2 / Cyp2 P25719 CYPC_YEAST GOA: interpro cis-trans peptidyl isomerase - Cyclophilin Type prolyl C / CYP3 / CPR3, PPIase: mitochondrial P25334 CYPRJYEAST GOAnnterpro cis-trans isomerase of peptidyl- Cyclophilin PPIase type: prolyl CPR4 / Scc3 P35176 CYPD_YEAST GOA: interpro cis-trans isomerase of peptidyl- Cyclophilin Type prolyl DC pD / Cpr5 PPIase: CYP6_YEAST PME > : 10942767 Peptidyl cis-trans isomerase - Cyclophilin type: prolyl CPR6 PPIase CYP7_YEAST PMTO: 10942767 Peptidyl cis-trans isomerase - Cyclophilin type: prolyl CYP7 PP! Asa CYP8_YEAST GOA: interpro Cisidyl cis-trans isomerase - Cyclophilin type: prolllo CYP8 PPIase Q02770 GOA: interpro Ypl064cp Cyclophilin type: PPIase F BP_YEAST GOA: interpro Protein 1 link FK506 FKBP type: FKB1RBP1 PPIase FKB2_YEAST GOA: interpro Protelna 2 link FK506, F BP-FKBP type: 13 / FKBP-15 / F B2, FPR2 PPIase F B3_YEAST GOA: mterpro Nuclear binding protein FK506 FKBP type: F BP-70Npi46Fpr3 / PPIase FKB YEAST GOAnnterpro Link protein FK506- 4 FPR4 FKBP type: PPIase ESS1 YEAST GOA: spkw ESS1 protein Parvulin type: PPIase Miscellaneous characterized in form deficient P27697 ABC1_YEAST GOA: spkw ABC1 protein, mitochondrial ABC1 precursor P53193 YGB8_YEAST GOA: interpro Hypothetical 21.8 kDa protein Hsp20 intergenic region CKB1-ATE1 P28707 YKL7_YEAST PMID: 963 2755 Protein 24.1 kDa p23 / wos2 intergenic region V A12-APN1 P38932 VP45_YEAST PMID: 11432826 Protein 45 associated with SEC1 type vacuolar protein classification Q12019 MDN1_YEAST GOA: spkw Midasin Genetic Manipulation In step ij), the process includes changing the expression of the compensating gene or gene product identified in the recombinant cell by genetic modification to provide one. modified recombinant cell. After the identification of one or more genes, proteins or activated metabolic processes, the genome of the host can be modified. Certain genes or gene products, although identified as activated, may not be available for modulation, because they are essential for the cell or are known to perform other processes that may be essential for the cell or organism. The genome can be modified by including an exogenous gene or promoter element in the genome or host with an expression vector, increasing the ability of an identified gene to produce mRNA or protein, or by removing or interrupting a gene or promoter element, or reducing the ability of a gene to produce mRNA or protein. The genetic code can be altered, thus affecting the transcription and / or translation of a gene, for example through substitution, elimination ("knock-out"), joint expression or insertion ("knock-in"). Additional genes for a desired protein or regulatory sequence that modulate the transcription of an existing sequence can also be inserted. Recombination The genome of the host cell that expresses a recombinant protein or peptide, it can be modified through an event of genetic direction, which can be by insertion or recombination, for example homologous recombination. Homologous recombination refers to the process of DNA recombination based on sequence homology. Homologous recombination allows site-specific modifications of endogenous genes and therefore novel alterations in a genome can be constructed. A step in homologous recombination is DNA exchange which involves the pairing of a DNA duplex with at least one strand of DNA containing a complementary sequence to form an intermediate recombination structure containing heteroduplex DNA (see for example the publication of Radding, CM (1982) Ann. Rev. Genet. 16: 405: North American Patent No. 4,888,274). The heteroduplex DNA can take several forms including the strand of three DNAs containing a triple form where a single complementary strand invades the DNA duplex (Hsieh, et al., Genes and Development 4: 1951 (1990)).; Rao, et al., (1991) PNAS 88: 2984)) and, when two complementary strands of DNA are paired with a DNA duplex, a recombination junction Holliday classical or chi structure can be formed (Holliday, R., Genet Res. 5: 282 (1964)) or a double-D circuit ("Double-D Link Formation Diagnostic Applications" North American Series No. 07 / 775,462, filed on September 4, 1991. once formed, a heteroduplex structure can be resolved by breaking or exchange of strand so that all or part of an invasion DNA strand is divided into a duplex of receptor DNA, adding or replacing a segment of the receptor DNA duplex, Alternatively, a heteroduplex structure may result in a gene conversion, where a sequence of an invasion strand is transferred to a duplex of recipient DNA, by rematching the unpaired bases using the invasion strand as a template (Genes, 3rd Edition. (1987) Lewin, B., John Wiley, New York, N.Y .; López, et al., Nucleic Acids Res. 15: 5643 (1987)). If the performance and assembly mechanism or by the gene conversion mechanism (s), heteroduplex DNA formation in the paired unions in homologous form can serve to transfer the genetic sequence information from one DNA molecule to another. In homologous recombination, incoming DNA interacts and integrates into a site in the genome that contains a substantially homologous DNA sequence. In non-homologous integration ("random" or "illicit"), incoming DNA is not integrated into a homologous sequence in the genome, but anywhere, in a large number of potential locations. A number of publications describe the use of homologous recombination in mammalian cells. Several constructs can be prepared for homologous recombination at an identified location. Typically, the construct can include at least 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 70 bp, 100 bp, 500 bp, 1kpb, 2kp, 4kpb, 5kpb, 10kpb, 15kpb, 20kpb, or 50kpb counterparts of sequence with the identified place. Various considerations may be involved in determining the degree of homologies of identified DNA sequences, such as, for example, the size of the identified site, sequence availability, relative efficiency of double cross-events at the identified location and the similarity of the identified sequence with other sequences. The targeting DNA may include a sequence in which the substantially isogenic DNA flanks the desired sequence modifications with a corresponding identified sequence in the genome to be modified. The substantially isogenic sequence can be at least 95%, 97-98%, 99.0-99.5%, 99.6-99.9%, or 100% identical with the corresponding identified sequence (except for the desired sequence modifications). The target DNA and the identified DNA can share DNA stretch of at least 10, 20, 30, 50, 75, 150 or 500 base pairs that are 100% identical. The DNA constructs can be designed to modify the endogenous gene product, identified. The homologous sequence for identifying the construct may have one or more deletions, insertions, substitutions or combinations thereof designed to interrupt the function of the resulting gene product. In one embodiment, the alteration may be the insertion of a selectable marker gene fused into the reading frame with the upstream sequence of the identified gene. The genome can also be modified using insertion elimination. In this embodiment, the genome is modified by recombining a sequence in the gene that inhibits the formation of the gene product. This insertion may already be interrupted by inserting a separate element or removing an essential part of the gene, in one embodiment, insertion elimination includes the insertion of a gene that codes for resistance to a particular stressor, such as an antibiotic, or for growth in a particular medium. For example for production of an essential amino acid. The genome can also be modified through the use of transposons, which are genetic elements with the ability to insert into sites in prokaryotic genomes through independent mechanisms of homologous recombination.The transposons can include, for example, Tn7 in Tn554 in S aureus, IS900 in M. paratuberculosis, IS492 from Atlantic Pseudomonas, 1S116 from Streptomyves and IS900 from M. paratuberculosis The steps considered to be involved in transcription include dissociation of the end of the transposon to produce 3?; strand transfer, wherein the transposase carries together the exposed end 3? of the transposon and the identified sequence; and a single pass transesterification reaction APRA to produce a covalent binding of the transposon to the identified DNA. The key reaction carried out by the transposase is usually through the nick or exchange of strand, the rest of the process is performed by host enzymes. In one embodiment, a process is provided for increasing the level of an identified gene or homolog thereof by incorporating a genetic sequence encoding the gene or homologue in the genome, by recombination. In another embodiment, a promoter is inserted into the genome to increase expression of the identified homolog gene. In a separate embodiment, a process is provided to decrease the expression of a gene identified or homologous thereof, by recombination with an inactive gene. In another embodiment, a gene encoding a different gene, which may have a separate function in the cell, may be a reporter gene such as a resistance marker or a otherwise detectable marker gene, inserted into a genome through recombination In yet another embodiment, a copy of at least a portion of the identified gene that has been mutated in one or more locations is inserted into the genome through recombination. The mutated version of the identified gene can not encode a protein, or the protein encoded by the mutated gene can become inactive, the activity can be modulated (either increased or decreased), or the mutant protein can have a different activity when compared to the native protein. There are strategies to eliminate genes in bacteria, which have been generally exemplified in E. coli. One route is to clone a DNA fragment of genetic internment into a vector containing a gene with antibiotic resistance (eg, ampicillin). Before the cells are transformed by conjugation transfer, chemical transformation or electroporation (Puchler, and associates, (1984) Advanced Molecular Genetics New Cork, Heidelberg, Berlin, Tokyo, Springer Verlag), the origin of a replica is cut, such as the replication of vegetative plasmid (the original site) and the remaining DNA fragment is again ligated and purified (Sambrook, et al. (2000) Molecular cloning: Laboratory manual, third edition Cold Spring Harbor, New Cork, Cold Spring Harbor Laboratory Press). Alternatively, antibiotic resistant plasmids having a DNA replication origin can be used. After transformation, the cells are plated, for example, on LB agar plates containing the appropriate antibiotics (for example 200pg / ml_ ampicillin). The colonies that grow on the plates containing the antibiotics have presumably passed through a simple recombination event (Snyder, L., W. Champness, and associates. (1997) Molecular Genetics of Bacteria Washington DC, ASM Press) leading to the integration of the entire DNA fragment into the genome in the homologous place. Further analysis of the antibiotic resistant cells to verify that it has occurred in the removal of the desired gene at the desired location, for example, by diagnostic PCR (McPherson, MJ, Quirke P., and associates. (1991) PCR: A Practical Approach New York, Oxford University Press).

Here, at least two PCR primers are designed: one that hybridizes out of the region of DNA that was used for the construction of the gene deletion; and one that hybridizes within the skeleton of the remaining plasmid. Successful PCR amplification of the correct size DNA fragment followed by DNA sequence analysis will verify that the gene has been removed in the correct place on the bacterial chromosome. The phenotype of the recently constructed mutant strain can be analyzed, for example, by SDS polyacrylamide gel electrophoresis (Simpson, R. J. (2003) Protein and Proteomics-Laboratory Manual, Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press). An alternative route to generate a gene deletion is through light or a temperature-sensitive replica, such as replication pSC101 to facilitate gene replacement (Hamilton et al., 1989) .New processes to generate deletions and gene replacements in Escherichia coli, Journal of Bacteriology 171 (9): 4617-22). The process proceeds by homologous recombination between a gene on a chromosome and homologous sequences carried on a temperature-sensitive plasmid for DNA replication. After transformation of the plasmid in the appropriate host, it is possible to select the integration of the plasmid in the chromosome at a temperature of 44 ° C. The subsequent growth of these cointegrants at a temperature of 30 ° C, leads to a second case of recombination, resulting in their resolution. Depending on when the second recombination event takes place, the chromosome opens after a gene replacement or retains the original copy of the gene. Other strategies have been developed to inhibit the expression of particulate gene products. For example, RNA interference (RNA), particularly using small interfering RNA (siRNA), has been extensively developed to reduce or even eliminate the expression of a particular gene product. The siRNAs are short, double-stranded RNA molecules that can direct complementary mRNAs for degradation. RNAi is the phenomenon in which the introduction of a double-stranded RNA suppresses the expression of the homologous gene. The dsRNA molecules are reduced in vivo to 21.23 nt siRNAs which are the transmitters of the RNAi effect. At the time of introduction, the double-stranded RNAs were processed in 20-25 nucleotide siRNAs through an RNase III-type enzyme called Dicer (start step). Possibly, the siRNAs assemble in the complexes containing endoribonuclease known as RNA-induced silencing complexes (RISCs), unrolling in the process. The siRNA strands subsequently guide the RISCs to complementary RNA molecules, where they dissociate and destroy to connote RNA (effector step). The dissociation of the cognate RNA takes place near the middle part of the region bound by the siRNA strand. RNAi has been used successfully to reduce gene expression in a variety of organisms including zebrafish cells, nematodes, (C, elegans), insects (Drosophila melanogaster), planaria, cnidaria, trypanosomes, and mice and mammals. Mutation The genome can also be modified by mutation of one or more nucleotides in an open reading frame that encodes an identified gene, particularly an identified protasease. Techniques for genetic notation, for example site-directed mutagenesis are well known in the art. Some methods focus on the generation of random mutations in chromosomal DNA, such as those induced by X-rays and chemicals. Mutagenesis directed to a defined region of DNA includes many techniques, some more popular than others. In Vitro methods for site-directed mutagenesis can generally be grouped into three categories: i) processes that restructure DNA fragments such as tape mutagenesis; I) localized random mutagenesis; and iii) oligonucleotide directed mutagenesis. The oligonucleotide-directed mutagenesis is based on the concept that an oligonucleotide encoding a desired mutation (s) hardens on a strand of the DNA of interest and serves as a primer for the initiation of DNA synthesis. In this form, the mutagenic oligonucleotide is incorporated into the newly synthesized strand. The mutagenic oligonucleotides are incorporated at least one base change but can be designed to generate substitutions, insertions or multiple deletions. Examples include PCR-based processes and virtually all processes that are not based on PCR that are currently used. These techniques include selection of positive antibiotics (Lewis, MK and Thompson, DV (1990) Nucí Acids Res. 18, 3439; Bohnsack, RN (1996) Meth. Mol. Biol. 57, 1; Vavra, S. and Brondyck, WH (1996) Promega Notes 58, 30; Altered Sites® II in vitro Mutagenesis Systems Technical Manual # TM00.1, Promega Corporation), single restriction site selection (Deng, WP and Nickoloff, JA (1992) Anal. Bicchem. 200, 81), incorporation of uracil (Kunkel, TA (1985) Proc. Nati, Acad Sci USA 82, 488, Kunket, TA Roberts, JD and Zakour, RA (1987) Meth Enzymol 154, 367), and incorporation of phosphorothiato (Taylor, JW, Ott, J. and Eckstein, F. (1985) Nucí.Aids Res. 13, 8764; Nakamaye, K and Eckstein, F. (1986) Nucí.Aids Res. 14, 9679). The oligonucleotides can also encode a library of mutations by randomizing the base composition at sites during chemical synthesis resulting in the degeneration or "dis-migration" of oligonucleotides. The ability to locate and specify mutations is greatly enhanced through the use of synthetic oligonucleotides that hybridize to the plasmid vector containing the DNA insert.

The general format for site-directed mutagenesis: denaturation of the plasmid DNA containing the template of interest (cDNA, promoter, etc.) to produce regions of a single strand; hardening of a synthetic mutant oligonucleotide to the identified strand; synthesis a new complementary strand using, for example, T4 DNA polymerase; and sealing the resulting nick between the end of a new strand and the oligonucleotide, for example using T4 DNA ligase. The resulting heteroduplex is propagated by transformation, for example in E. coli. The processes of selection and enrichment have been incorporated in mutagenesis processes to greatly improve the efficiency of the recovery of the muíante strand and are possible ranges that reach 80-90%. There are numerous processes to generate different types of mutation and to increase the selection of the muan. Examples of processes to increase the selection of the mutein include selection of positive antigenic agents of the mutein strand, using a strand of DNA that contains uracil which can be selectively degraded in vivo, and analogous dNTP incorporation, which can make a strand of DNA heteroduplex insensitive to digestion. Some methods may be combined, such as ribbon mugenesis and the use of "diminished" oligonucleotides to create a library of random mutations in a defined and small region. One of the processes called "siandard" of site-directed mutagenesis includes those that depend on DNA amplification, specifically the polymerase chain reaction (PCR). Most common in site-directed mutagenesis is the use of a mutagenic oligonucleotide. The mutagenic oligonucleotide must hybridize efficiently to the template. For efficient hybridization, there is for example, a base pairing of 100% at either end of the identified sequence without a secondary structure formation, but also with less than 100% identification, such as 98%, 95%, 92%, 90%, 85%, 80%, 70% or only a part of the sequence can be identical. For small substitutions, 10 to 15 bases that hybridize to either side of the non-correspondence are normally sufficient. The composition of the 3 'of the primer is particularly important since the polymerases do not normally extend from a 3' end hybridized in a deficient or non-correspondent manner. The basis for site-directed mutagenesis by selection of positive antibiotics is that a selection of the oligonucleotide or oligonucleotides harden simultaneously, with the mutagenic oligonucleotide to repair an antibiotic resistance gene (10.13). The selection of the mutant strand is made possible by antibiotic resistance of the mutated DNA and the sensitivity of the non-mutated strand. This method offers a very efficient means to generate an undefined number of desired mutations with little time.

Site-directed mutagenesis through the use of a single restriction site is based on the Deng and Nickoloff process (Deng, W.P. and Nickoloff, J.A. (1992)] Anal. Biochem., 200, 81). In this method, a selection of oligonucleotides containing a mutated sequence for a single restriction site, with a mutagenic oligonucleotide, is hardened simultaneously. The oligonucleotide selection towards the non-essential site immune to restriction through the corresponding enzyme; the selection of the mutant strand is improved by digesting the resulting plasmid pool with the single restriction enzyme. The digestion linearizes the plasmid of origin, effectively decreasing its capacity to transform bacteria. Site-directed mutagenesis by deoxyuridine incorporation depends on the ability of a host strain to degrade the template DNA containing uracil (U) in place of thymidine (T). A small number of dTUPs are incorporated into the template strand in place of dTTP in a host that lacks dUTPase (dut-) and uracil N-deglucosidase (ung-) activities. (Uracil by itself is not mutagenic and makes base pairs with adenine). Usually, dUTPase degrades to deoxyuridine and the N-deglucosidase of uracil eliminates any incorporated uracil. Replication after mutation in a dut + ung + strain is subsequently used to degrade the unidentified strand DNA. This method requires the use of single-stranded DNA so that only one strand contains the Us that are susceptible to degradation. The phosphorothiorate incorporation method for site-directed mutagenesis relies on the ability of a dNTP analog containing a thiol group to render the heteroduplex DNA resistant to restriction enzyme digestion. The mutant strand extends from the mutagenic oligonucleotide and is synthesized in the presence of dCTPalphaS. The unused template DNA is removed by digestion with an exonuclease. Theoretically, only the heteroduplex, circular DNA remains. The heteroduplex is subsequently nicked, but not cut, in the restriction sites. Exonuclease III is used to digest the nicked strand and subsequently the remaining fragment acts as a primer for repolymerization, creating a mutant homoduplex. In the method based on polymerase chain reaction (PCR) to generate a mutation in the DNA, a template is amplified using a group of oligonucleotide primers specific for the gene, except that an oligonucleotide, or more in pro-isolates that use multiple amplifications, confers the desired mutation. Variations include aligning the hybridization site of the oligonucleotides to produce multiple fragmentation PCRs with the mutation in the overlap and the "mega-primer" method which uses three oligonucleotides and two amplification turns where one strand of product from the first Amplification serves as a primer in the second amplification. In the overlap extension method, complementary oligodeoxyribonucleotide (oligo) primers and the polymerase chain reaction are used to generate two DNA fragments having overlap ends. These fragments are combined in a subsequent "fusion" reaction in which the ends of the overlap are hardened, allowing the 3 'overlap of each strand to serve as a primer for the 3' extension of the complementary strand. The resulting fusion product is further amplified by PCR. Specific alterations in the nucleotide sequence can be introduced incorporating nucleotide changes in the overlap oligocerators. Vector Constrictions In a separate embodiment, the host cell is modified including one or more vectors encoding an identified gene, typically a fold modulator or a cofactor of a bend modulator. In another embodiment, the host cell is modified by increasing a promoter for a bend modulator or a cofactor for a bend modulator, including adding an exogenous promoter to the host cell genome. In another embodiment, the host cell is modified including one or more vectors encoding an inhibitor of an identified compensating gene, such as a protease inhibitor. Said inhibitor can be an antisense molecule that limits the expression of the identified compensatory gene, a cofactor of the identified gene or a homolog of the identified gene. The antisense is usually used to refer to a nucleic acid molecule with a sequence complementary to at least a part of the identified gene. In addition, the inhibitor can be an interfering RNA or a gene encoding an interfering RNA. In eukaryotic organisms, said interfering RNA may be an interfering RNA or a small ribisima, as described for example in the publication of Fire, A. and associates. (1998) Nature 391: 806-11, Elbashir and associates. (2001) Genes & Development 15 (2): 88-200, Elbashir and associates. (2001) Nature 411 (6836): 494-8, U.S. Patent Nos. 6,506,559 to Carnegie Institute, 6,573,099 to Benitec, U.S. Patent Application No. 2003/0108923 to Whitehead Inst., And 2003/0114409, PCT Publications Nos. WO03 / 006477, WO03 / 012052, WO03 / 023015, WO 03/056022, WO 03/064621 and WO 03/070966. The inhibitor can also be another protein or peptide. The inhibitor may, for example, be a peptide with a consensus sequence for the protease or protease protein. The inhibitor can also be a protein or peptide that produces a direct or indirect inhibitory molecule for the protease or protease protein in the host. Protease inhibitors may include Amastatin, E-64, Antipain, Elastinal, APMSF, Leupeptin, Bestatin, Benzamidine, 1. 10. Phenanthroline, Chymostatin, Phosphoramidon, 3,4-dichloroisocoumarin, TLCK, DFP, TPCK. Approximately 100 naturally occurring protein protease inhibitors have been identified. They have been isolated in a variety of organisms from bacteria, animals and plants; they behave as reversible or pseudo-irreversible inhibitors of tight binding of proteases that prevent the access of subtracts to the active site through hydration. Its size is also extremely variable, from 50 residues (for example BPTI: bovine pancreatic trypsin inhibitor) to 400 residues (for example alpha-1PI: alpha-proteinase inhibitor). They are strictly class specific, except proteins of the alpha-macroglobulin family (for example macroglobulin alpha-2) which binds and inhibits the majority of proteases through a mechanism of molecular atropamiento. An exogenous DNA or vector construct can be transfected or transformed into the host cell. Cells for transfecting and transforming eukaryotic and prokaryotic cells respectively with exogenous nucleic acids are well known in the art. These may include lipid vesicle-transmitted uptake, calcium phosphate-transmitted transfection (calcium phosphate co-precipitation / DNA), viral infection, particularly using modified viruses such as, for example, modified adenoviruses, microinjection and electroporation. For prokaryotic transformation, techniques may include heat-transmitted capture, fusion of bacterial protoplast with intact cells, microinjection and electroporation. Techniques for plant transformation include transfer transmitted by Agrobacterium, tai as by A. tumefaciens, tungsten or rapid-propellant gold microprojectiles, electroporation, microinjection and uptake transmitted by polyethylene glycol. The DNA can be single or double stranded DNA, linear or circular, relaxed or super-curly. For several mammalian cell transfection techniques see for example the publication of Keown and associates. (1990) Processes in Enzymology Vol. 185, pp. 527-537. For recombination events, the constructs may include one or more insertion sequences, which may insert or transpose one or more nucleic acid sequences in a different sequence. However, the construct can be designed for exogenous expression of a condenser gene identified or homologous thereof without incorporation into the existing cellular-genome DNA. Constructs may contain one or more internal ribosome entry sites (IRES). The construct also contains a promoter linked in operable form to the nucleic acid sequence encoding at least a portion of the identified gene, or a cofactor of the identified gene, or a mutant version of at least a portion of the identified compensating gene, or in the case of proteases, an inhibitor of the identified gene. As an alternative, construction may be less promotora. In cases where the construct is not designed to be incorporated into the cellular DNA-genome, the vector normally contains at least one promoter element. In addition to the nucleic acid sequences, the expression vector may contain selectable marker sequences. The expression constructs may additionally contain sites for initiation, termination and / or transcription and / or ribosome binding sites. The identified constructs can be inserted and can be expressed in any prokaryotic or eukaryotic cell, including but not limited to bacterial cells, such as P. fluorescens or E. coli, yeast cells, mammalian cells such as CHO cells or plant cells. . Cloning vectors may include, for example, the plasmid pBR322 (Bolivar, Rodríguez and associates, 1997), the pUC plasmid series (Vieira and Messing 1982), pBluescript (Short, Fernández and associates, 1988), pACYC177 and pACYC184 (Chang and Cohen 1978). Exogenous promoters for use in such constructs, include but are not limited to, the phage lambda PL promoter, E. coli lac, E. coli trp, E. coli phoA, E. coli tac promoters, SV40 early genes, SV40 late genes , retroviral LTRs, PGKI, GALI, GALIO genes, CYCI, PH05, TRPI, ADHI, ADH2, forglimaldeido phosphate dehydrogenase, hexosinase, pyruvate decarboxylase, phosphofructosinase, triose phosphate isomerase, phosphoglucose isomerase, correspondence factor pheromone of alpha glucokinase, PRBI promoter, GUT2, GPDI, metallothionein promoter, and / or viral promoters of mammals such as those derived from adenovirus and vaccinia virus. Other promoters will be known to those skilled in the art. Promoters for exogenous vectors, or exogenous promoters designed to be inserted into the genome can be based on specific response elements in a cell. For example, promoters can respond to chemical compounds, for example to anthranilate or benzoate, as described in PCT Publication No. WO 2004/005221. The constructions may include one or more promoters. These can be independent, they can be tandem. For example, the promoters may be designed so that an identified compensating gene is activated or deactivated in a particular time structure with the recombinant protein or peptide. For example, in a case in which the identified gene is a bending modulator, the bending modulator or cofactor can be induced short before the induction of the recombinant peptide protein. Promoters can include, but are not limited to the following: Constructs may include selection markers to identify modified cells. Suitable selectable marker genes include, but are not limited to: genes that confer the ability to grow in certain medium sub-types, such as the tk gene (thymidine kinase) or the hprt gene (hypoxanthine phosphoro-rifaciltraserase) which confers the ability to grow on a HAT medium (hypoxanthine, aminoptirin and thymidine); the bacterial gpt gene (guanine-xanthine phosphorociltransferase) that allows growth on a MAX medium (mycophenolic acid, adenine and xanthine). See for example the publication of Song, K-Y., Et al (1987) Proc.Na'l Acad. Sci. U.S. A. 84: 6820-6824; Sambrook, J., et al. (1989) Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, Chapter 16. Other examples of selected markers include: genes that confer resistance to compounds such as antibiotics, genes confer the ability to grow on their treatments selected, genes encoding proteins that produce detectable signals such as luminescence, such as green fluorescent protein, green enhanced fluorescent protein (Egfp). A wide variety of such markers are known and available, including for example, antibiotic resistance genes such as neomiscence gene to neomiscin (neo) and (Southern, P., and P.Berg, (1982) J.Mol. Genet, 1: 327-341); and gene for resistance to hydromycin (hyg) ((1983) Nucleic Acids Research 11: 6895-6911, and Te Riele, H., et al. (1990) Nature 348: 649-651). Other selected marker genes include: acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), beta galactoside (LacZ), beta glucuronodate (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein ( RFP), yellow fluorescent protein (YFP) fluorescent cyan protein (CFP), horseradish proxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selected markers are available that confer resistance to ampicillin, bleomycin, chloromfenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracycline.

Additional selected marker genes utilize the present invention, for example, numbers 6,319,669 are described in US Pat. 6,316,181; 6,303,373; 6,291,177; 6,284,519; 6,284,496; 6,280,934; 6,274,354; 6,270,958; 6,268,201; 6,265,548; 6.261, 760; 6,255,558; 6,255,071; 6,251, 677; 6.25, 602; 6,251, 582; 6,251,384; 6,248,558; 6,248,550, 6,548,543; 6,232,107; 6,228,639; 6,225,082; 6,221,612; 6,218,185; 6,214,567; 6,214,563; 6,210,922; 6,210,922; 6,210,910; 6,203,986; 6,197,928; 6,180,343; 6,172,188; 6,153,409, 6,150,176; 6,146,826; 6,140,132; 6,136,539; 6,136,538; 6,133,429; 6,130,313; 6,124,128; 6,110,711; 6,096,865; 6,096,717; 6,093,808; 6,090,919; 6,083,690; 6,077,707; 6,066,476, 6,060,247; 6,054,321; 6,037,133; 6,027,881; 6,025,192; 6,020,192; 6,013,447; 6.00, 557; 5,994,077; 5,994,071; 5,993,778; ,989,808; 5,985,577; 5,968,773; 5,968,738; 5,985,713; ,952,236; 5,948,889; 5,948,681; 5,942,387; 5,932,435; 5,922,576; 5,919,445; and 5,914,233. The deletions may have at least 5 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, commonly with at least 100 bp, and more generally not more than about 20 kbp, where the deletion may normally include at least a part of the coding region that it includes a part of one or more sections, a part of one or more introns, and may or may not include a part of the regions without flanking coding, particularly the region without 5 'coding (transcription regulatory region). Therefore, the homologous region can extend beyond the coding region in the non-coding region 5? alternatively in the non-coding region 3 \ Insertions generally do not exceed 10kpb, normally they do not exceed 5kpb, generally being at least 50pb, more usually at least 200bp. The homology region (s) may include mutations, wherein the mutations may additionally deactivate the identified gene, providing a change in structure, or changing a key amino acid, or the mutation may correct a dysfunctional allele, etc. Normally, the mutation may be a subtle change, which does not exceed approximately 50% of the homologous flanking sequences. The construction can be prepared according to processes known in the art, several fragments can be brought together, inserted in suitable vectors, cloned, analyzed and subsequently manipulated in additional form until the desired construction has been achieved (see for example the figures of 5 to 11). Several modifications can be made to the sequence, to allow the analysis of restriction, cutting, division, identification of probes, etc. Silent mutations can be introduced, as desired. In several stages, restriction analysis, sequencing, amplification with the polymerase chain, primer preparation, in vitro mutagenesis, etc. can be used. The processes for the incorporation of. Antibiotic resistance genes and negative selection factors will be familiar to those skilled in the art (see for example WO 99/15650: U.S. Patent No. 6,080,576; U.S. Patent No. 6,136,566; the publication of Niwa and associates J.Biochem. 113: 343-349 (1993); and Yoshida, and associates Transgenic Research, 4: 277-287 (1995)). The construct can be prepared a bacterial vector, which includes a prokaryotic replication system, for example, an origin that can be recognized by a prokaryotic cell such as P.fluorescens or E. coli. A marker, the same or different from the marker that will be used for the insertion, can be used, which can be eliminated before the introduction in the identified cell. Once the vector that continues the construction has been completed, it can be further manipulated, such as by the elimination of certain sequences, linearization or introduction of mutations, deletions or other decencies in the homologous sequence. After the final manipulation, the construction can be induced in the cell. The process can be interactive. In one embodiment, after modification of the host and expression of the recombinant protein in the modified host, a genetic profile of the modified host cell is analyzed to identify one or more identified genes whose expression is changed in the modified host cell . In particular, compensating genes may be those that show increased expression in the recombinant protein expressing the modified host, when compared to a modified host cell that does not express the recombinant protein or proton, or when compared to a non-host cell. modified. The process also includes changing the expression of the gene or genes additionally identified, and expressing the protein or peptide in the modified cell in double form. These steps can be interacted to improve the expression of the protein can be repeated one, two, three, four, five, six, seven, eight, nine or at least ten times. Production of proteins The process of the present invention optimally leads to the increased production of recombinant protein or peptide in a host cell. Increased production may include an increased amount of protein per gram of host protein in a given amount of time, or may include an increase in the length of time of the host cell that is producing recombinant protein or peptide. Increased production may also include an improvement in the requirements for the growth of the recombinant host cell. Increased production can be an increased production of total length protein or peptide. If the improvement is in increased protein levels, the protein or peptide can be produced in one or more inclusion bodies in a host cell. The increased production may alternatively be an increased protein or active peptide level per gram of protein produced, or per gram of host protein. Increased production may also be an increased level of recoverable protein or peptide, such as soluble protein, produced per gram of recombinant protein or per gram of host cell protein. Increased production can also be any combination of an increased total level and increased soluble active level of protein. Increased production is usually measured by comparing the level of production after a certain period of induction in a modified cell with the same induction in the unmodified cell.

Soluble / Insoluble The improved expression of recombinant protein may be an increase in the solubility of the protein. The recombinant protein or peptide can be produced and recovered from the cytoplasm, periplasm or extracellular medium of the host cell. The protein or peptide can be soluble or insoluble. The protein or peptide may include one or more targeting sequences or sequences that aid purification. In certain embodiments, the present invention provides a process for improving the solubility of a recombinant protein or peptide in a host cell. The term "soluble" as used in the present invention means that the protein is not precipitated by centrifugation between about 5,000 and 20,000 gravity when rotated for 10 to 30 minutes in a buffer under physiological conditions. Active, soluble proteins have the ability to exhibit function, and are not part of an inclusion body or other precipitated mass.

The present invention can also improve the recovery of active recombinant proteins or peptides. For example, the interaction between an identified polypeptide, and a polypeptide of origin, variant polypeptide, polypeptide substituted with segment and / or polypeptide substituted with residue, can be measured by any convenient in vitro or in vivo assay. Therefore, in vitro assays can be used to determine any detectable interaction between an identified and a polypeptide, for example between enzyme and substrate, between hormone and hormone receptor, between antibody and antigen, etc. Said detection may include the measurement of colorimetric changes, changes in radioactivity, changes in solubility, changes in molecular weight as measured by gel electrophoresis and / or gel exclusion processes, etc. In vivo assays include, but are not limited to, tests for physiological effects, eg, weight gain, change in electrolyte balance, change in blood coagulation time, changes in clot dissolution, and induction of unsanitary response. Generally, any in vivo assay can be used as long as there is a variable parameter to thereby detect a change in the interaction between the identified polypeptide and the polypeptide of interest. See, for example, U.S. Patent No. 5,834,250. C i p p i m e / peri plasm / segregat In certain embodiments, the protein can also be secreted in the periplasm if it is fused to a suitable signal secretion sequence. In one embodiment, the signal sequence may be a phosphate binding protein, a Lys-Arg-Orn binding protein signal secretion signal peptide (LAObp or KRObp), an outer membrane Porin E secretion signal peptide. (OprE), or a signal peptide secreting bluein, or an iron (III) binding protein secretion signal peptide [Fe (l 11) bp] or a signal peptide secreting Ipoprotein B (LrpB ). In one protein, no additional disulfide binding promotion conditions or agents are required, in order to recover the identified polypeptide containing disulfide bond in active, soluble form from the modified host cell or a modified cell in double or multiple form . In one embodiment, the transgenic peptide, polypeptide, protein or fragment thereof has an intramolecular conformation doubled in its active state. It has been found that cytoplasmic soluble mammalian proteins can be appropriately configured with the proper placement of the theol groups for the formation of posterior disulfide bond in the periplasm. In one embodiment, the transgenic peptide, polypeptide, protein or fragment containing at least one intramolecular disulfide bond in its active state; and possibly up to 2, 4, 6, 8, 10, 12, 14, 16, 18, or 20 or more disulfide bonds. In one embodiment, more than 50% of the expressed, transgenic peptide, polypeptide, protein or fragment thereof produced is produced as polypeptides, proteins, functional, simple peptides or fragments thereof in soluble, active or in a renatured form easily insoluble in the cytoplasm or periplasm. In another embodiment, approximately 60%, 70%, 80%, 85%, 90%, 95% of the expressed protein is obtained or easily renatured in active form.

EXAMPLES The bacterial strains used in the normal study are described in table 1. Strains of P.fluorescens species were grown in shaking flasks at a temperature of 30 ° C. The OD575 was recorded for each strain at several time points. Table 1. Shows strains of bacteria The plasmids used in the following experiments are described in Table 2.

Table 2: Plasmid sample Sample Collection and RNA Isolation. All sample experiments were collected in standard 200ml shake flasks. The samples were taken at different time points, as indicated in the figures. Each dot time, 10ml of cell culture was collected from the shake flasks, and mixed with 10ml of RNAIater reagent (Ambion, Austin, TX) to stabilize the RNA. Microformation Hybridization and Data Analysis For each RNA sample, fluorescent nucleotides Cy3-dUTP and Cy5-dUTP (Amersham Pharmacia, Piscataway, NJ) were incorporated into cDNA in a reverse transcription (RT) reaction using a hexameter primer (Amersham ). The two labeled cDNA sets were combined and applied to a microformation slide. Microformation sliders contain oligodexyribonucleotides modified with 50mer amino (oligos), each representing the ORF of P.fluorescens. Each oligo was printed twice for spots to duplicate in different places using the SHCD-2 robot (Virtek, Toronto, Canada, now distributed by Bio-Rad Laboratories, Hercules, CA) and SMP3 pins (TeleChem International Inc. Sunnyvale, CA) the microscope slides used were coated with an epoxy resin positively charged for efficient DNA binding (MWG's Inc., Alameda, AC). After printing, the slides were subsequently processed according to the specifications of MWG's. A software package from BioDiscovery Inc. (El Segundo, CA) was used to facilitate data analysis. This package consists of the modules, CloneTracker ™, ImaGene ™, GeneSigth ™, and the GeneDirector ™ database. Each hybridized slide was screened using ScanArray 5000 (Packard BioScience, Billerica, MA) to measure the fluorescence of the Cy3 and Cy5 labeled cDNA bound in the microformation. The images acquired in ImaGene ™ were quantified, and the raw data was processed in GeneSigth ™. During the preparation of the data the intensity of the spot of each gene was corrected with the background; the Cy5 channel signal was normalized to the Cy3 channel using the total signal strength for the entire array; the normalized ratio of Cy3 and Cy5 for each gene was transformed with log2 and the replicas were combined. Analysis of protein expression by SDS-PAGE Culture aliquots were harvested at various time points after IPTG induction, normalized to OD600 of 10. Cells were separated into soluble and insoluble fractions by centrifugation at 11000 g for 5 minutes . Aliquots of 2.5 ul were combined with 5 micraL of NuPAGE LDS sample buffer (Invitrogen, San Diego, CA), 50 micraM DTT, or H20 for 10 micraL, then heated to a temperature of 95 ° C for 5 minutes. The proteins were separated and visualized on 12% nupage gels stained with Coomassie Blue using Simply Blue Safestain (Invitrogen, San Diego, CA). Measurement of Fluorescence Activity. The protein production was also measured by fluorescence activity of the fusion of the green fluorescent protein (COP) and the human growth hormone (hGH). The hgh :: COP fusion construct was transformed into wild type or hslU mutant strains and selected on the glucose agar plate without uracil. Cell culture induced with IPTG was normalized to OD6oo of 5. Relative fluorescence (RF) activity was measured using the microplate fluorimeter spectrum (Molecular Devices, Sunnyvale, CA) under the appropriate setting (Ex485, Em538530 bandpass filter ). Example 1: Analysis of gene expression of strains that produce cytoplasmic and periplasmic proteins -Comparison of different time points. To study the FMs and protease gene expression during heterologous protein production, strains of P.fluorescens DC206, 280, 240 and 271 were used in the initial micriformation experiments. DC206 is the strain used as a control for cell growth; DC280 has a vector-only plasmid and was used as a control for microformation experiments; DC240 is DC206 with a plasmid encoding the soluble cycloplasmid nitylase enzyme; DC271 is with DC206 with a plasmid encoding the human growth hormone periplasmid (pbp :: hGH) which is partially insoluble. Strains were grown in 200ml of a medium in the shake flask, and cell growth was monitored by measuring OD575. The IPTG induction was carried out 24 hours after the inoculation. All strains grew in a similar fashion and culture samples were taken just before (0 HR) and 4 hours after the induction of RNA isolation and transcription profiling (TxP) using RNA microformations (Figure 1). The genetic profiles, ie the transcription profiles were based on the comparison of the four hours after the sample of the induction time with that of the sample of zero hours, the two samples were labeled with fluorescent inks, either Cy3dUTP or Cy5 -dTUP and hybridized together for the same slide for each strain. Each hybridization was doubled with ink-exchange experiments (ie the samples were labeled with either Cy3dUTP or Gy5-dTUP) (Table 3, slides 1 to 6). The hybridized slides were scanned using a laser scanner with focal. The signal intensity for each gene was determined and processed using the Microformation software package of Biodiscovery (El Segundo, CA) the expression ratio of the two time points for each-gene was calculated and the proportions of all the genes to The strains were calculated based on the value of the proportion and the trend between the three strains (DC280, DC240 and DC271) (Figure 2) Table 3. Summary of microformation experiments carried out in examples 1 to 3 .

The focus on FM and protease gene expression in P. fluorescens under the stress imposed by the production of high-level recombinant protein, a list of FM and protease genes was compared with the analysis of the sets. After the hierarchical clustering analysis of all genes DC280, DC240 and DC271, FMs and proteases were identified in two sets (lines in sets 6 and 7, Figure 2). Four genes in the set showed a significantly higher expression in DC271 which expresses mainly soluble periplasmic human growth hormone compared to DC240 which produces insoluble cytoplasmic nitrilase, or DC280 which does not overproduce any protein. The four genes are rxf01961 that encodes Hs1V, rf01957 that encodes Hs1U, rxf03987 that encodes CbpA and rxf05455 that encodes HtpG. The HslV (CIpQ) and Hs1U (CIpY) of E. colli together form a cytoplasmic protease. The small subunit, HslV is a peptidase related to the proteasomal alpha-subunits of eukaryotes. The large unit is an ATPase unit with homology to other family ATPases such as CIpA and CIpX. CbpA of E. colli is an analog of the well-characterized DnaJ co-chaperon, as can be seen not only from its structure but also from its function. The lesion phenotype, such as the temperature sensitivity for growth, are restored at the time of introduction of the cbp > 4 in a multiple plasmid. HtpG from E. colli functions as an ATP-independent molecular chaperone in vitro. It temporarily recognizes and links non-native bending intermediaries by reducing their free concentration in solution and thus avoiding non-specific aggregation. The genes of group 6 in figure 2 were again grouped using hierarchical clustering to identify less pronounced effects. As figure 3 shows that FMs and proteases were identified in two main sets (lines in set 6 and 8). The two FMs in set 8 are DnaK and DnaJ, two important chaperones, which are well known to work together to fold numerous proteins. The additional analysis of the gene expression values of set 6 were identified in an additional FM, CIpX that is expressed, in higher level in DC271 that produces pbp :: hGH compared to DC240 that produces nitrilasa or DC280 which does not overproduce any protein The CIpX heat shock protein from E. colli is homologous to a family member of prokaryotic or eukaryotic ATPases. CIpX of E. colli was isolated as a specific component of the ATP-dependent CIpP proteases, which keep certain polypeptides in a competent form for propeolysis by subunit of protease CIpP. CIpX can act as a molecular chaperone, in the absence of CIpP, by activating the start of proteins involved in DNA replication. The identified FMs and proteases important for periplasmic hGH production are shown in Table 4. Table 4. List of FM and protease genes whose mRNA levels of constant state are higher in DC271 compared to DC240 and DC281. The values described are the proportion at 4 hours after IPTG at 0 hours.

* For dnaK two probes are found on the microformation chip and therefore two gene expression values are provided. Example 2- Analysis of gene expression of strains that produce cytoplasmic and periplasmic proteins-Direct comparison of different strains. In order to confirm the results obtained previously, microformation experiments with additional information were carried out by direct comparison of two strains DC271 and DC240 (Slides 7 to 10 in Table 3). Comparison of the two strains at four hours after the induction point time confirmed that an almost identical set of FM protease genes was activated in cells expressing pbp :: hGH partially soluble (table 5). All the genes described in Table 5 are expressed in significantly higher form (_2-ss) in strains that produce partially insoluble hGH compared to cells that produce completely soluble nitrilase. In the direct comparison of DC271 with DC240, some additional proteins were identified as compared to the comparison time point (see Table 4) which showed significantly higher gene expression values during the production of partially insoluble hGH. Genes included rxf08347 encoding CIpB, rxf04587 that encodes CIpA and rxf05753 that encodes FkbP. The CIpB homologous of E. colli is involved in the reactivation of inclusion bodies together with DnaKL-GrpE. Cipa of E. colli has a chaperone function or when it is together with DnaKJ-GrpE it degrades proteins. In E. colli, FkbP functions as a peptidyl-proly isomerase. Table 5. List of FM genes of protesa whose steady state mRNA levels are higher in DC271 compared to DC240. The values described are the ratio of DC271 with DC240 to Ias4 hours after IPTG induction.

* For dnaK, two probes are found on the microformation chip and therefore two gene expression values are provided. Example 3: Analysis of gene expression of a strain that produces an insoluble cytoplasmic protein. Since DC271 expresses partially periplasmic human growth hormone (pbp :: hGH), it was investigated whether FMs and similar or different protease genes were activated in a strain that mainly expresses hGH. Insoluble cytoplasmic DC369 was used. At 4 hours after induction, the sample was compared with the zero-hour time sample and microformation experiments were carried out as shown in table 3 (slides 11 and 12). Again, similar FM and protein genes were found to be activated, indicating that the genes identified are involved in the cytoplasmic fold rather than the periplasmic fold and protein degradation (Table 6). A summary of which genes were identified in said experiment along with fold activation, the Venn diagram of Figure 4 is shown. Table 6. List of Protease Fm and genes whose constant mRNA and steady state levels are higher in DC369 a 4 hours later compared to time zero. The values described are the proportion of 4 hours after induction IPTG at zero hours (moments before induction).

* For dnaK, two probes are found on the microformation chip and therefore two gene expression values are provided. Example 4: Generation of a mutant strain HslU in P.fluorescens DC206 It was discovered that the two hsIVU genes are among the most highly-identified genes. Hs1U is a cytoplasmic ATPase. The homologous protein in E. coli can act in combination with a second protein to promote protein degradation of energy in E. coli. HslU interacts with Hs1V, a protein with homology to the proteasome alpha subunits. The HsIVU homologs of E. coli were reported to be involved in proteolysis generating proteins without bending in the publication by Missiakas, D., and associates (1996) Identification and characterization of HslV HslU proteins (CIpQ CIpY) involved in general protein proteolysis not bent in Escherichin coli. Embo J 15: 6899-909. DNA sequence analysis suggested that P. fluorescens hsIVU genes will likely be part of a unique bi-toned operon (Figure 5) In order to verify that HsIVU is in fact involved in the degradation of hGH, an elimination strain hslU was constructed. Said strains were generated by deactivation of hslU insertion (figure 6). A DNA fragment of approximately 550 base pairs was cloned into the hslu in the vector pCR2.1-TOPO resistant to kanamycin. Since this vector has an origin of replication (Co1E1) that is functional for E.coli but not in P.fluorescens, the constructed plasmids will be integrated into the chromosome of DC206 through homologous recombination, in order to confer kanamycin resistance . The correct insertion site for kanamycin resistant colonies was conformed by diagnostic colony PCR using primers that hybridize to the outside of the originally amplified region and within the plasmid backbone (table 3). The constructed hslU mutant strain was designated DC370. The primers were designed so that they could amplify an internal region of -550 base pairs of the hs1U gene (table 7), the internal fragment was amplified using Taq Polymerase (Promega), purified and cloned into a pCR2.1-TOPO vector (Invitrogen , San Diego, CA). The plasmids were transformed into competent P.fluorescens DC206 and selected on M9 glucose agar plates supplemented with 250ug / ml and 50ug / ml karamycin.

Table 7. Primers.

Comparison of protein expression by SDS-PAGE analysis. To study the effect of elimination of the hs1U gene, two expressions of exogenous protein were compared between the strain of origin DC206 and the mutant strain DC370 recently constructed. Plasmids harboring the gene encoding pbp :: hGH (pDOW1323) and hGH (pDOW1426) were each transformed into competent cells and resulted in strains DC373 and DC372, respectively. Experiments were carried out in standard agitation flasks, with 4 strains. Figure 7 shows that the wild type and mutant strains have similar growth ranges. Samples were run in gels (Figure 8 and 9) the results follow that the highest amounts of proteins produced by mutants was due to an elinination of the protease subunit Hs1U. Comparison of protein expression by fluorescence activity. Since the effect observed in the lack of Hs1U in the production of is difficult to quantify using hGH analysis, the profile of protein production was monitored by fluorescence by the fusion protein between green fluorescent protein COP and hGH. A plasmid containing a fusion was constructed and transformed into the hGH :: COP protein strain and the hs1U gene knockout strain DC370 yielded strains HJ104 and HJ105 (Table 1). Experiments were carried out in standard shaking flasks and the samples were taken at various time points for the fluorescence mediates (Figure 10). The readings of the fluorimeter clearly showed that the mutant protease strain had significantly higher expression levels than those of the original strain (Figure 11). This discovery corroborates the results obtained by SDS-PAGE analysis. Compared to the muíante strain hsOJ, 33.05% of the relative florescence increased 24 hours after induction (see insert in figure 11). Example 5: Construction of an hslUV clearance elimination strain The Hsl protease consists of two subunits: a binding unit encoded by hs1U and a protease unit encoded by hs! V, the protease elimination strain is an activation insert of the hs1V gene. The previously constructed protease elimination strain is an insertion inactivation of the hslUV gene. To eliminate the appearance that Hs1V can still function as a protease having the ability to couple with an ATP binding subunit, in another protease a deletion strain was constructed that had the hs1U and hs1 V genes removed from the chromosome. As shown in Figure 13, plasmid pDOW2050 was constructed by PCR of the two DNA fragments flanking the region, the two fragments were subsequently fused using the PCR method (SOE) (See Ho, SN (1991) Method for dividing gene by overlapping using the polymerization chain reaction Application: North American patent 89-3920955023171). Subsequently, the fused DNA fragments were ligated into the Srf site of vector pDOW1261-2. The elimination plasmid was named pDOW2050 after the graft was confirmed by DNA. The plasmid was electroporated into pDOW2050 and plated on agar plates, increased with 1% glucose and 15pg / ml tetracycline. The tetracycline resistance of the baby to an integration event that recombines the whole plasmid in chromosome in one of two homologous regions within the genome (figure 13). To select the cells that have a deletion of the hslUV genes that result from a second homologous recombination between the integrated plasmid and the homologous DNA in the chromosome, tetracycline-resistant colonies were created in stationary phases in LB medium in medium of 250ug-ml supplemented with uracil. Subsequently, the cells were plated on LB agar plates supplemented (5-FOA) with 5-floorotic acid. Cells that lost the integrated plasmid by a second recombination event have also lost the pyrF gene, therefore they are resistant to 5-FOA, resulting in the desired chromosomal designation hslUV called DC417. Phenotypic analysis of the hslUV elimination strain. SDS-PAGE analysis of hslUV deletion expressing the hGH protein (strain HJ115) showed a much higher protein production than the wild-type DC369 strain, similar to that previously observed using the DC372 insertion mutant strain (data not shown) . Protein production was also measured by potency of the HGH fusion using the method described above. Plasmid pDOW1349 containing the hGH :: COPP fusion was transformed into wild-type strains and mutants resulting in strains HJ104 and HJ117, respectively. Standard shake flask experiments were carried out and the samples were taken at various time points for relative fluorescence measurements (Figure 14). Fluorimeter readings indicated that the protease removal strain had significantly higher protein expression levels (approximately 50% increase in production) compared to that of the wild-type strain. This result is similar to that previously observed with the production hs1U elimination strain. Example 6: Interactive target identification using DNA microformation technology To investigate whether a new group of proteases is activated in the hslUV protease elimination strain, DNA microformation experiments were carried out. Standard agitation flask experiments were carried out using the wild-type strain (DC369 and mutant (HJ115) expressing hGH.) For each strain, the samples were compared 4 hours after induction with those of the zero time point sample. , (just before the induction of hetere- gogic protein) and DNA microformation experiments were carried out, comparing the production of the two time points between wild-type and mutant strains, a new list of protease genes was identified. are activated in the protease elimination strain hslUV (Table 8) .These newly identified genes encoding protease can now be targeted for a second round of gene deletion events to further improve the yield of hetere- rous protein production. Table 8: Protease genes whose mRNA production levels of constant states are greater than the protease elimination strain hslUV and (HJ115) compared to the wild-type strain (DC369) based on the proportion of 4 hours after induction IPTG at zero hours (just before induction).

Protease rxf0191 zinc atgagtgatcgcaaaaacagccgcctgatcctgcccggcctgatcgccgtcaccctgatggcg (ec 3.4.99.-) gccagcgccgtttacttcttgcgccccagcgagtcggtcgccagccaggccctggacaaggc tcaaacggccagcaccctgcaatccctggcggaactggatggcaaggcaccgaccaaccgc aagctcgacgtacaaacctggaccaccgccgaaggcgccaaggtgctgttcgtcgaagccca tgagttgccgatgttcgacatgcgcctgctgttcgccgccggcagcagccaggatggcgacgt gccaggcctggcgctgatgaccaacgccatgctcaacgaaggcgtgccgggcaaggacgtc agccagatcgccagtggcttcgaaggcctgggggccgactttggcaacggcgcctaccgcg acatggcgctggtgaccctgcgcagcctgagcgacagcgccaagcgcgacgccgccctgtc actgttcaaccaggtgatcggccagccgactttcccggcagactcactggcacgcatcaagaa ccagatcctggccggtttcgagtaccagaagcagaaccccggcaaactggcgagcatcgaac tgttcaagcgcctgtacggcgaccacccttacgcacacccgagcgaaggcacccccgagag cgtgccgaagattaccctggcgcagttgcaggcgttccacgccaaggcctatgcagcgggta acgcggtgattgcagtggtgggcgacctgacccgcgccgaagctgaagccatgacggccaa ggtgtccgcgtcgctgcccaaaggcccggctatggccaagatcgcccagccgaccgagcca aaagccggcctgagccgtatcgagttcccgtccaagcaaacccacctgctgtttgcgcagttg ggcat cgaccgtgccgacccggattacgcagccttgtccctgggtaaccagatcctcggcgg cggtggcttcggcacccgcttgatgagcgaagtgcgtgaaaagcgcggcctgacctacggc gtgtattccggtttctcaccaatgcaggcgcgcggcccgttcatgatcaacctgcagacccgcg ccgaaatgagcggtggcaccttgcgcctggtggaggacgtactggctgactacctcaagacc ggcccgacgcaaaaggaactggatgacgccaagcgcgagctggccggcagcttcccgctgt ccaccgccagcaacgccgatatcgtcgggcagttgggcgccatgggtttctacaacctgccg ctgagctatctggaagatttcatgaaacaatcccaggccctgaccgtcgatcaggtcaaggctg caatgaataaacacttgagcgccgacaagatggtcatcgtgaccgccggcccgacgattgcg caaaagccactaccgccccccactgataaacctgccgagcagccgctcggggttccggagc attaa ixfD268 microsomal dipeptidase ttgtcgtggattgacgctttcggcaattcccctgtcgtttttgcacccggctccgtcggtgcctgg 9 gcatatgctggccccaaagcgccggcagacgattcggcgcatgaatcgccaataaggggac (ec 3.4.13.19) gcctgatgagcccagccgagttgcacgccgacagcatcgttatcgacggtctgattattgccaa gtggaaccgcgacctgttcgaagacatgcgcaaaggtggcctcaccgccgccaattgcacgg tgtcggtgtgggaaggcttccaggccacgatcaataacatcgttgccagccagaccctgatcc gcgaaaacagcgacctggtgatcccggtgaaaaccaccgccgacatccgc cgcgccaagg agctgggcaagactggcatcatcttcggcttccagaatgcccatgcctttgaggaccagctcgg ctatgtcgagatcttcaagcagctcggcgtgggcgtggtgcagatgtgctacaacacccagaa cctggtgggcaccggttgctacgagcgcgatggcggcctgtcgggtttcgggcgtgagatcg tcggcgagatgaaccgcgtcggcatcatgtgcgacctgtcccacgtgggctccaagaccagc gaagaggtcatcctcgaatcgaaaaagccggtgtgctactcccactgtctgccgtccgggctta aagagcacccgcgcaacaagtccgatgaagagctgaagttcatcgccgaccatggcggattt gtcggtgtgaccatgttcgcgccgtttttggccaagggcatcgactcgactatcgacgactatgc cgaagccatcgaatacaccatgaacatcgtcggcgaagacgccatcggcatcggcaccgact tcacccagggccatggccaggatttcttcgaaatgctcacccatgacaagggctacgcccgcc gcctgaccagcttcggcaagatcatcaacccgctgggcatccgcaccgtgggtgagttcccca acctcaccgagaccctgctcaagcgcggccacagcgagcgcgtggtgcgcaagatcatggg cgagaactgggtcaacgtgctcaaggacgtctggggcgaataa Example 7: Co-overexpression of fold modulators that increase the solubility of the hGH target. Based on the transcription profiling data shown in Figure 4, the expression of the fold modulators (FMs) DnaK and DnaJ was increased in strains that produce recombinant protein with control strains (see Tables 4 and 5) A strain that is co-overproduced GrpE, DnaK and DnaJ together with hGH was produced and tested to identify if this results in the accumulation of increased levels of soluble hGH. Construction of plasmid containing gfpE-dnaKJ for co-overexpression with hGH P. fluorescens grpE-dnaKJ genes were amplified using chromosomal DNA isolated from MB214 (Dneasy; Qiagen, Valencia, CA) as a template, (5'-ATATACTAGTAGGAGGTAACTTATGGCTGACGAACAGACGCA-3 ' ) and RC200 (5'-ATATTCTAGATTACAGGTCGCCGAAGAAGC-3 ') as primers, was used after the manufacturer's recommendations. The resulting PCR product was digested with Sperl and Xbal (restriction sites underlined previous primers and ligated into pDOW2236 to create containing genes under the control of the tac promoter.) The plasmid was targeted with Spel and Hindi and the resulting DOW2236 containing the 4.0 kb fragment was gel purified using Qiaquick (Qiagen) and ligated to pDOW2247 also digested with Spel and Hindlll., pDOW351 containing grpE-dnaKj under the control of the mannitol promoter, was transformed into DC388 by selecting on M9 glucose plates supplemented with 250 uG / ml uracil. Finally, pDOW1426 was electroporated into the previous strain and selected on M9 glucose plates resulting in strain DC463 with two induced plasmids: 1) pDOW1426 carrying PtachGH e 2) pDOW3501 carrying PiacgrpE-dna-KJ. Agitation bottle fermentation, sample collection and analysis Cultures were grown in duplicate of DC463 in shake flasks. Protein induction was achieved by adding 0.1mM IPTG for hGH and 0.05% mannitol for GrpE-DnaKJ 24 hours after inoculation. Samples were collected at 0, 4, 8, 24 and 48 hours after induction. At each time point, 20 OD600 cells, normalized in 1 mL were harvested, used, using EasyLyse ™ (Epicenter, Madison, Wl) and separated into soluble and insoluble fractions by centrifugation at 14000 rpm for 30 minutes. Equal volumes of samples were combined with BioRad buffer (Hercules, CA) 2x Laemmli, heated at a temperature of 95 ° C for 5 minutes with 30uL loaded on a BioRad 15% Tris HCI Criterion gel using 1x Tris Glycine SDS run buffer ( BioRad). The proteins were visualized with Simply Blue Safestain (Invitrogen, Carlsbad, CA) as shown in Figure 15. The resulting Coomassie-stained gels were scanned using a Molecular Devices Personal Desitometer (Molecules, Devices, Sunnyvale, CA) with analyzes carried out using ImageQuant and Excel. As shown in Figure 15, the co-overexpression of GrpE, -DnaKJ significantly increased the solubility of hGH, converting almost 100% of the target protein into the soluble fraction, despite a total protein production. lower. Additional experiments that repeat the growth and induction of DC463 using the simultaneous addition of IPTG and mannitol, closely mimicked the results shown here, although with a different degree of solubility (between 50-100%).; data not shown), when GrpE DnaKJ was co-overproduced. These findings further demonstrate that the target strain constructed on the basis of transcription profiling can lead to a rational strain design to increase solubility / or produce a recombinant cell. The present invention has been described with reference to certain modalities and non-limiting examples. It will be clear to one skilled in the art that other embodiments of the present invention are also possible.

Claims (53)

1. R E I V I N D I C A C I O N E 1. A process for improving the expression of the recombinant protein or peptide in a host cell or organism, wherein the process comprises: i) expressing the protein in the recombinant host cell; ii) analyzing a genetic profile of the recombinate cell to identify one or more compensating genes or product of genes that are expressed at a higher level in the recombinant cell than either in a host cell that has not been modified to express the recombinant protein, or a recombinant cell that does not express the recombinant protein; iii) changes the expression of the compensating gene or gene product identified in the recombinant cell by genetic modification to provide a modified recombinant cell that achieves an element in the expression, activity or solubility in the recombinant cell.
2. 2. The process as described in claim 1, characterized in that it further comprises expressing the protein or peptide in the modified recombinant cell.
3. 3. The process as described in claim 1, characterized in that it further comprises: a) expressing the recombinant protein or peptide in the modified recombinant cell; b) analyzing a genetic profile of the modified recombinant cell to identify at least one second gene (s) or gene product (s) that are differentially expressed in the modified recombinant cell; c) changing the expression of the second gene product identified in the modified recombinant cell provided to identify a doubly modified cell; d) expressing the protein or peptide in the doubly modified cell.
4. 4. The process as described in claim 3, characterized in that it also comprises repeating steps a) to d).
5. 5. The process as described in claim 4, characterized in that it also comprises repeating steps a) through d) until cell viability is effected by changing the expression of the gene (s) or product (s) of the identified gene.
6. The process as described in claim 4, characterized in that repeating steps a) to d), until the expression of the recombinant protein or peptide reaches a targeted endpoint.
7. The process as described in claim 1, characterized in that the genetic profile is analyzed by comparing a genetic profile of the recombinant cell with a second genetic profile of the host cell.
8. 8. The process as described in claim 1, characterized in that the genetic profile is a transcriptome profile.
9. 9. The process as described in claim 8, characterized in that the profile of transcriptomes is determined through microformation.
10. 10. The process as described in claim 1, characterized in that the genetic profile is a proteome profile.
11. The process as described in claim 10, characterized in that the proteome profile is determined by two-dimensional gel electrophoresis, ICAT or LC / MS.
12. 12. The process as described in claim 10, characterized in that the proteome profile is determined through a peptide formation.
13. 13. The process as described in claim 12, characterized in that the peptide formation is an antibody formation.
14. The process as described in claim 1, characterized in that the identified gene product is a protease, a subunit of a protease, a cofactor of a protease, a genetic cellular modulator that affects the expression of a protease.
15. 15. The process as described in claim 14, characterized in that the identified gene product is a protease.
16. 16. The process as described in claim 14, characterized in that the identified gene product is a protease subunit.
17. 17. The process as described in claim 14, characterized in that the identified gene product is a cofactor of a protease.
18. 18. The process as described in claim 14, characterized in that the identified gene product is a cellular or genetic modulator that affects the expression of a protease.
19. 19. The process as described in claim 14, characterized in that the identified gene product is selected from the group consisting of D-analil-meso-deaminopimelate endopeptidase, zinc pototease, microsomal dicroptidase, professed extracellular precursor, protein of cellular division ftsH, and genetic products derived from the genes hslV, hslU, clpX, clpA and clpB.
20. The process as described in claim 14, characterized in that the product at the mRNA level of the identified gene product is activated when the protease or recombinant peptide is expressed in the host cell.
21. The process as described in claim 14, characterized in that the identified gene product is removed from a host cell genome.
22. 22. The process as described in claim 21, characterized in that the identified gene product is eliminated by homologous recombination.
23. 23. The process as described in claim 1, characterized in that the identified gene product is a bending modulator, a subunit of a bending modulator, a cofactor of a bending modulator, or a cellular or genetic modulator that affects the expression of a bending modulator.
24. 24. The process as described in claim 23, characterized in that the identified gene product is a bend modulator.
25. 25. The process as described in claim 23, characterized in that the identified gene product is a subunit of a bending modulator.
26. 26. The process as described in claim 23, characterized in that the identified gene product is a cofactor of a bending modulator.
27. 27. The process as described in claim 23, characterized in that the identified gene product is a cellular or genetic modulator that affects the expression of a bend modulator.
28. 28. The process as described in claim 23, characterized in that the bend modulator is a chaperone protein.
29. 29. The process as described in claim 23, characterized in that the bend modulator is selected from the group consisting of the gene product of the genes cbpA, htpG, dnaK, dnaJ, fkbP2, groES and groEL.
30. 30. The process as described in claim 23, characterized in that the expression of the identified gene is changed by increasing the expression of the identified gene, a cofactor of an identified gene or a cellular or genetic modulator of the identified gene.
31. 31. The process as described in claim 30, characterized in that the increased expression is by the inclusion of a DNA encoding the identified gene product.
32. 32. The process as described in claim 30, characterized in that the increased expression is by the insertion of a promoter into a host cell genome.
33. 33. The process as described in claim 30, characterized in that the increased expression is by the inclusion of an exogenous vector in the host cell.
34. 34. The process as described in claim 1, characterized in that the host cell is a microbial cell.
35. 35. The process as described in claim 1, characterized in that the host cell is a Pseudomonad.
36. 36. The process as described in claim 1, characterized in that the host cell is a cell P.fluorescens.
37. 37. The process as described in claim 1, characterized in that the host cell is an E. coli cell.
38. 38. The process as described in claim 1, characterized in that the host cell is selected from the group consisting of an insect cell, a mammalian cell, a yeast cell, a fungus cell and a plant cell.
39. 39. The process as described in claim 9, characterized in that the microformation comprises samples of binding portions at least 50% of a genome of the host cell.
40. 40. The process as described in claim 9, characterized in that the microformation technique comprises samples of binding portions at least 80% of a genome of the host cell.
41. 41. The process as described in claim 9, characterized in that the microformment comprises samples of binding portions at least 90% of a genome of the host cell.
42. 42. The process as described in claim 9, characterized in that the microformation comprises samples of binding portions at least 95% of a genome of the host cell.
43. 43. The process as described in claim 1, characterized in that the improved expression is an increase in the amount of protein or recombinant peptide.
44. 44. The process as described in claim 1, characterized in that the improved expression is an increased solubility of the recombinant protein or peptide.
45. 45. The process as described in claim 1, characterized in that the improved expression is an increased solubility of a recombinant protein or peptide
46. 46. The process as described in claim 1, characterized in that the genetic profile is a gene profile of a family of genes.
47. 47. The process as described in claim 1, characterized in that the profile comprises proteases and fold modulators.
48. 48. The process as described in claim 46, characterized in that the profile consists essentially of proteases.
49. 49. A host cell or organism expressing a recombinant organism that has been genetically modified to reduce the expression of at least two proteases.
50. 50. A host cell or organism expressing a recombinant organism that has been genetically modified to reduce the expression of at least one protease selected from a group consisting of a -ananyl-deaminopeneteate endopeptidase, zinc protease, microsome dipeptidase, procursor of cellular metatopease, cell division protein ftsH and genetic products derived from the genes hslV, hslU, clpX, clpA and clpB.
51. 51. A host cell or organism expressing a recombinant mammalian derived protein that has not been genetically modified to at least reduce the expression of a protease.
52. 52. A host cell or organism as described in claim 51 characterized in that the recombinant protein is human growth hormone.
53. 53. A host cell or organism that has been genetically modified to increase the expression of at least two fold modulators that are not fold modulators. R E S U M N N The present invention is a process for improving levels of production of recombinant proteins or peptides, or for improving the level of active recombinant proteins or peptides expressed in host cells. The present invention is a process for comparing two genetic profiles of a cell expressing a recombinant protein and modifying the cell to change the expression of a gene product that is activated in response to the expression of recombinant protein. The process may improve protein production or may improve the quality of the protein, for example, by increasing the solubility of a recombinant protein.