MX2007000404A - Identification and engineering of antibodies with variant fc regions and methods of using the same. - Google Patents

Abstract

The present invention relates to molecules, particularly polypeptides, more particularly immunoglobins (<i>e.g</i>., antibodies), comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, which variant Fc region binds Fc??RIIIA and/or Fc??RIIA with a greater affinity, relative to a comparable molecule comprising the wild-type Fc region. The molecules of the invention are particularly useful in preventing, treating, or ameliorating one or more symptoms associated with a disease, disorder, or infection. The molecules of the invention are particularly useful for the treatment or prevention of a disease or disorder where an enhanced efficacy of effector cell function (<i>e.g</i>., ADCC) mediated by Fc??R is desired, <i>e.g</i>., cancer, infectious disease, and in enhancing the therapeutic efficacy of therapeutic antibodies the effect of which is mediated by ADCC.

Description

IDENTIFICATION AND ENGINEERING OF ANTIBODIES WITH FC VARIANT REGIONS AND METHODS FOR USING THE SAME This application claims priority to the Application of E.U.A. No. 10 / 902,588, which is a continuation in part of the Application of E.U.A. Series No. 10 / 754,922, filed on January 9, 2004, which claims priority of the Provisional applications of E.U.A. Nos. 60 / 439,498; 60 / 456,041; and 60 / 514,549 filed on January 9, 2003; March 19, 2003, and October 23, 2003, respectively; each of which is incorporated herein by reference in its entirety. This application also claims benefit under Title 35, United States Code §119 (e) of the Provisional Application of E.U.A. No. 60 / 587,257 filed July 12, 2004, which is incorporated herein by reference in its entirety. 1. FIELD OF THE INVENTION The present invention relates to molecules, particularly polypeptides, more particularly immunoglobulins (e.g., antibodies), which comprise a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region binds to FcyRIIIA and / or FcyRIIA with a higher affinity, relative to a comparable molecule that comprises the wild-type Fc region. The molecules of the invention are particularly useful for preventing, treating or ameliorating one or more symptoms associated with a disease, disorder or infection. The molecules of the invention are particularly useful for the treatment or prevention of a disease or disorder where improved efficacy of effector cell function (e.g., CCDA) mediated by FcyR, e.g., cancer, disease is desired. infectious and to improve the therapeutic efficacy of therapeutic antibodies, whose effect is mediated by CCDA. 2. BACKGROUND OF THE INVENTION 2. 1 RECEIVERS OF Fc AND ITS ROLE IN THE IMMUNE SYSTEM The interaction of antibody-antigen complexes with cells of the immune system results in a large array of responses, varying effector functions such as cytotoxicity that depends on antibodies, degranulation of mastoid cells and phagocytosis for immunomodulatory signals such as regulation of proliferation of lymphocytes and secretion of antibodies. All these interactions are initiated by binding the Fc domain of antibodies or immune complexes to surface receptors of specialized cells on hematopoietic cells. The diversity of cellular responses activated by antibodies and immune complexes results from the structural heterogeneity of Fc receptors. The Fc receptors share binding domains of structurally related ligands which presumably mediate intracellular signaling. The Fc receptors, members of the protein immunoglobulin gene superfamily, are surface glycoproteins that can bind to the Fc portion of immunoglobulin molecules. Each member of the family recognizes immunoglobulins of one or more isotypes through a recognition domain on the a chain of the Fc receptor. Fc receptors are defined by their immunoglobulin subtype specificity. The Fc receptors for IgG are referred to as FcyR, for IgE as FeR, and for IgA as FcaR. Different accessory cells contain Fc receptors for antibodies of different isotype and the isotype of the antibody determines which accessory cells will be coupled in a given response (reviewed by Ravetch JV et al., 1991, Annu Rev. Immunol., 9: 457-92; Gerber JS et al., 2001 Microbes and Infection, 3: 131-139; Billadeau DD et al., 2002, The Journal of Clinical Investigation, 2 (101): 161-1681; Ravetch JV et al., 2000, Science, 290: 84- 89; Ravetch JV et al., 2001 Annu. Rev. Im unol. 19: 275-90; Ravetch JV 1994, Cell, 78 (4): 553-60). The different Fc receptors, the cells that express them and their Specificity of sotypes are summarized in Table 1 (adapted from Immunobiology: The Immune System in Health and Disease, 4th edition 19999, Elsevier Science Ltd / Garland Publishing, New York). Fc receivers? Each member of this family is an integral membrane glycoprotein, which has extracellular domains related to a C2 group of immunoglobulin-related domains, a domain that extends over a single membrane and a variable length mtracytoplasmic domain.

There are three known FcyRs, designated Fc? RI (CD64), FcyRII (CD32), and FcyRIII (CD16). The three receptors are encoded by different genes; however, the extensive homology among the three family members suggests that they arise from a common progenitor perhaps by gene duplication. Fc? RII (CD32) The FcyRII (CD32), FcyRII proteins are 40 Dka integral membrane glycoproteins that bind only to the IgG that forms a complex due to a low affinity for monomeric Ig (106 M "1). FcyR more widely expressed, present in all hematopoietic cells, including monoliths, macrophages, B cells, AN cells, neutrophils, mastoid cells and platelets FcyRII only has two immunoglobulin-like immunoglobulin-like regions in its immunoglobulin binding chain and therefore a much lower affinity for IgG than Fc? RI. There are three human FcyRII genes (Fc? RII-A, Fc? RII-B, Fc? RII-C), all of which bind to IgG in aggregates or immune complexes. The distinct differences within the cytoplasmic domains of Fc? RII-A and Fc? RII-B create two functionally heterogeneous responses for receptor binding. The fundamental difference is that the isoform A initiates the cell signaling leading to cellular activation such as phagocytosis and respiratory outbreak, while isoform B initiates the inhibitory signals, eg, inhibiting the activation of B cells. Signaling through of FcyRs Both the activation and inhibitory signals are transduced through the FcyRs following the junction. These diametrically opposed functions result from the structural differences between the different receptor isoforms. Two distinct domains within the cytoplasmic signaling domains of the receptor called tyrosine immunoreceptor-based activation motifs (ITAMs) or tyrosine immunoreceptor-based inhibitory motifs (ITIMs) are take into account for the different answers. The recruitment of different cytoplasmic enzymes for these structures dictates the production of cellular responses mediated by Fc? R. FcyR complexes containing ITAM include FcyRI, FcyRIIA, FcyRIIIA, while complexes containing ITIM include only FcyRIIB. Human neutrophils express the FcyRIIA gene. The conglomeration of FcyRIIA via immune complexes or interlacing of specific antibodies serves to add ITAM together with cmasas associated with the receptor which facilitates the phosphorylation of ITAM. The phosphorylation of ITAM serves as a coupling site for Syma cmasa, the activation of which results in activation of substrates downstream (e.g., PI3K). Cell activation leads to the release of proinflammatory mediators. The Fc? RIIB gene is expressed on B lymphocytes; its extracellular domain is 95% identical to FcyRIIA and binds the IgG complexes in an indistinguishable form. The presence of an ITIM in the cytoplasmic domain of FcyRIIB defines its subclass inhibitor of FcyR. Recently, the molecular basis of this inhibition was established. When bound together with an activation FcyR, the ITIM in FcyRIIB is phosphorylated and attracts the SH2 domain of the polyphosphate 5'-phosphatase.

(SHIP, for its acronym in English), which hydrolyses the phosphomositol messengers released as a consequence of the activation of tyrosine kinase mediated by FcyR containing ITAM, thus avoiding the influx of Ca ++ intracellular Therefore, the Fc? RIIB interlacing absorbs the binding activation response of FcyR and inhibits the cellular response. Therefore, B cell activation, B cell proliferation and antibody secretion are aborted. Table 1. Receptors for the Fc Regions of Isotypes of Immunoglobulm.

Table 1. Receptors for the Fc regions of Immunoglobin Isotypes 2. 2 RELEVANCE DISEASES 2. 2.1 CANCER A neoplasm, or tumor, is a neoplastic mass that results from uncontrolled abnormal cell growth which may be benign or malignant. Generally, benign tumors remain localized. Malignant tumors collectively are called cancers. The term "malignant" generally means that the tumor can invade and destroy the surrounding body structures and disperse to distant sites that cause death (for review, see Robbins and Angeli, 1976, Basic Pathology, 2nd Ed., WB Saunders Co. , Philadelphia, pp. 68-122). Cancer can arise in many parts of the body and behave differently depending on its origin. Cancer cells destroy the part of the body in which they originate and disperse to another part (s) of the body where they initiate new growth and cause more destruction. More than 1.2 million Americans develop cancer each year. Cancer is the second leading cause of death in the United States and if current trends continue, cancer is expected to be the leading cause of death in 2010. Lung and prostate cancers are the cancers that kill the most men in the world. the United States. Lung and breast cancer are the cancers that kill more women in the United States. One of two men in the United States will be diagnosed with cancer sometime during his life. One of three women in the United States will be diagnosed with cancer sometime in her life. No cure for cancer has yet been found. Current treatment options, such as surgery, chemotherapy and radiation treatment are sometimes ineffective or have several side effects. Cancer Therapy Currently, cancer therapy may involve surgery, chemotherapy, hormone therapy and / or radiation treatment to eradicate neoplastic cells in a patient (See, for example, Stockdale, 1998, "Principles of Cancer Patient Management" , in Scientific American: Medicine, vol.3, Rubenstem and Federman, eds., Chapter 12, Section IV). Recently, cancer therapy could also involve biological therapy or immunotherapy. All these proposals are important drawbacks for the patient. Surgery, for example, may be contraindicated because of the patient's health or may be unacceptable to the patient. Additionally, surgery may not completely remove the neoplastic tissue. Radiation therapy is only effective when the neoplastic tissue exhibits a greater sensitivity to radiation than in normal tissue, and radiation therapy can also frequently produce side effects. Hormone therapy is rarely given as a single agent and although it may be effective, it is often used to prevent or delay the recurrence of cancer after other treatments have removed most of the cancer cells. Biological / immunotherapy therapies are limited in number and can produce side effects such as rashes or swelling, flu-like symptoms, including fever, chills and fatigue, digestive tract problems or allergic reactions. With respect to chemotherapy, there is a variety of chemotherapeutic agents available for the treatment of cancer. A significant majority of cancer chemotherapeutics act by inhibiting DNA synthesis, either directly or indirectly by inhibiting the biosynthesis of desoxy-nucleotide triphosphate precursors, to prevent DNA replication and the division of concomitant cells (See, for example, Gilman et al., Goodman and Gilman's: The Pharmacological Basis of Therapeutics, Eighth Edition (Pergamom Press, New York, 1990)). These agents, which include alkylating agents, such as nitrosourea, anti-metabolites, such as methotrexate and hydroxyurea, and other agents, such as ethopoxides, campactemas, biomycin, doxorubicin, daunorubicma, etc., although not necessarily specific for the cell cycle, they kill cells during the S phase due to their effect on DNA replication. Other agents, specifically colchicine and vinca alkaloids, such as vinblastine and vincristine, interfere with microtubule assemblies, resulting in mitotic breakdown. Chemotherapy protocols generally involve the administration of a combination of chemotherapeutic agents to increase treatment efficacy. Despite the availability of a variety of chemotherapeutic agents, chemotherapy has many drawbacks (See, for example, Stockdale, 1998, "Principies Of Cancer Patient Management" in Scientific American Medicine, Vol.3, Rubenstein and Federman, eds., Chapter 12, section 10). Almost all chemotherapeutic agents are toxic and chemotherapy causes significant and often dangerous side effects, including severe nausea, bone marrow depression, immunosuppression, etc. Additionally, even with the administration of combinations of chemotherapeutic agents, many tumor cells are resistant or develop resistance to chemotherapeutic agents. In fact, cells resistant to the particular chemotherapeutic agents used in the treatment protocol often prove that they are resistant to other drugs, although those agents that act through mechanisms different from the mechanisms of action of the drugs used in the specific treatment, this phenomenon is called pleyotropic drug or resistance to multiple drugs. Therefore, due to drug resistance, many cancers prove to be refractory to normal chemotherapeutic treatment protocols. There is an important need for alternative cancer treatments, particularly for the treatment of cancer that has proven to be refractory to normal cancer treatments, such as surgery, radiation therapy, chemotherapy, and hormone therapy. A promising alternative is immunotherapy, in which cancer cells are specifically targeted by antibodies specific for antigens. Greater efforts have been directed towards harnessing the specificity of the immune response, for example, hybridoma technology allowed the development of monoclonal antibodies selective for tumors (See Greeen MC et al., 2000 Cancer Treat Rev., 26: 269-286; Weiner LM, 1999 Semín Oncol 26 (suppl 14): 43-51), and in the last five years, the Food and Drug Administration has approved the first MAbs for cancer therapy: Rituxin (ant? -CD20) for non-Hodgkin lymphoma and Herceptm [anti- (c-erb-2- / HER-2)] for breast cancer metastatic (Suzanne A. Eccles, 2001, Breast Cancer Res., 3: 86-90). However, the potency of antibody effector function, e.g., to mediate antibody-dependent cellular cytotoxicity ("CCDA") is an obstacle to such treatment. Therefore methods are required to improve the efficacy of said immunotherapy. 2.2.2 INFLAMMATORY DISEASES AND AUTOIMMUNE DISEASES Inflammation is a process by which the body's white blood cells and chemicals protect our body from infection by foreign substances, such as bacteria and viruses. It is usually characterized by pain, swelling, high temperature and redness of the affected area. The known chemicals are cytokines and prostaglandins that control the process and are released in an orderly and self-limiting cascade in the blood or affected tissues. This release of chemicals increases blood flow to the area of damage or infection and can result in redness and increased temperature. Some of the chemicals cause fluid leakage in the tissues, resulting in swelling. This protective process can stimulate the nerves and cause pain. These changes, when presented for a limited time in the relevant area, work for the benefit of the body. In autoimmune and / or inflammatory disorders, the The immune system triggers an inflammatory response when there are non-extraneous substances to fight and the normally protective immune system of the body causes damage to its own tissues by self-attacking wrongly. There are several different autoimmune disorders that affect the body in different ways. For example, the brain is affected in individuals with multiple sclerosis, the intestine is affected in individuals with Crohn's disease and the synovium, bones and cartilage of several joints are affected in individuals with rheumatoid arthritis. As the autoimmune disorders progress the destruction of one or more types of bodily tissues, the abnormal growth of an organ, or changes in the function of some organ may occur. The autoimmune disorder can affect only one type of organ or tissue or it can affect multiple organs and tissues. Organs and tissues commonly affected by autoimmune disorders include red blood cells, blood vessels, connective tissues, endocrine glands (eg, the thyroid or pancreas), muscles, joints and skin. Examples of autoimmune disorders include, but are not limited to, Hashimoto's thyroiditis, pernicious anemia, Addison's disease, type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosus, dermatomyositis, Sjogren's syndrome, dermatotomyositis, lupus erythematosus, multiple sclerosis, autoimmune disease of the inner ear, myasthenia gravis, Reiter's syndrome, Graves' disease, autoimmune hepatitis, familial adeatosis polyposis and ulcerative colitis. Rheumatoid arthritis (RA) and juvenile rheumatoid arthritis are types of inflammatory arthritis. Arthritis is a general term that describes inflammation in joints. Some types of arthritis, but not all, are the result of poorly directed inflammation. In addition to rheumatoid arthritis, other types of arthritis associated with inflammation include the following: psoriatic arthritis, Reiter's syndrome, arthritis due to ankylosing spondylitis, and gouty arthritis. Rheumatoid arthritis is a type of chronic arthritis that occurs in joints on both sides of the body (such as both hands, wrists, or knees). This symmetry helps distinguish rheumatoid arthritis from other types of arthritis. In addition to affecting the joints, rheumatoid arthritis can occasionally affect the skin, or the lungs, heart, blood or nerves. Rheumatoid arthritis affects about 1% of the world population and is potentially disabling. Approximately 2.9 million cases of rheumatoid arthritis occur in the United States. Women are two to three times more than men. The normal age at which rheumatoid arthritis occurs is between 25 and 50 years. Juvenile rheumatoid arthritis affects 71,000 young people Americans (between eighteen and better), affecting six times both young women and young men. Rheumatoid arthritis is an autoimmune disorder in which the body's immune system inappropriately identifies the smovial membranes that secrete the lubricating fluid in the joints as foreign. It results in inflammation and cartilage and tissues in and around the joints are damaged or destroyed. In several cases, this inflammation spreads to other joint tissues and surrounding cartilage, where it can corrode or destroy bone and cartilage and lead to deformities in the joints. The body replaces the damaged tissue with scar tissue, causing the normal spaces within the joints to become narrow and the bones to fuse together. Rheumatoid arthritis creates stiffness, swelling, fatigue, anemia, weight loss, fever and, often, heartbreaking pain. Some common symptoms of rheumatoid arthritis include stiff joints on waking that last an hour or more; swelling in a specific finger or wrist joints; swelling in the soft tissue around the joints; and swelling on both sides of the joint. The swelling may present with or without pain, and may progressively worsen or remain the same for years before progressing.

The diagnosis of rheumatoid arthritis is based on a combination of factors, including: the specific location and symmetry of painful joints, the presence of joint stiffness in the morning, the presence of protuberances and nodules under the skin (rheumatoid nodules), the results of x-ray tests that suggest rheumatoid arthritis and / or positive results of a blood test called the rheumatoid factor. Many people with rheumatoid arthritis, but not all, have rheumatoid factor antibody in their blood. The rheumatoid factor may be present in people who do not have rheumatoid arthritis. Other diseases can also cause the rheumatoid factor to occur in the blood. That's why the diagnosis of rheumatoid arthritis is based on a combination of several factors and not just the presence of rheumatoid factor in the blood. The normal course of the disease is one of persistent but fluctuating joint symptoms, and after approximately 10 years, 90% of sufferers will show structural damage to the bones and cartilage. A small percentage will have a short illness that heals completely and another small percentage will have very severe disease with deformities in many joints and occasionally many manifestations of the disease. The inflammatory process causes erosion or destruction of bones and cartilage in the joints. In rheumatoid arthritis, there is an autoimmune cycle of persistent antigen presentation, T cell stimulation, cytokine secretion, synovial cell activation and joint destruction. The disease has a greater impact on the individual as society, causing significant pain, damaged function and disability, as well as the cost of millions of dollars in health expenses and loss of wages. (See, for example, the NIH website and the NIAID website). The therapy currently available for arthritis focuses on reducing inflammation of the joints with anti-inflammatory or immunosuppressive medications. The first line of treatment for any arthritis is usually anti-inflammatory, such as aspirin, ibuprofen and Cox-2 inhibitors such as celecoxib and rofecoxib. "Second line drugs" include gold, methotrexate and spheroids. Although these are well-established treatments for arthritis, very few patients are referred to these treatment lines alone. Recent advances to understand the pathogenesis of rheumatoid arthritis have led to the use of methotrexate in combination with antibodies to cytokines or soluble recombinant receptors for TNF-a show clinically important improvement. Many patients remain refractory despite treatment. The aspects of Difficult treatments remain even for patients with rheumatoid arthritis. Many current treatments have a high incidence of side effects or can not completely prevent the progression of the disease. Until now, no treatment is ideal, and there is no cure. Novel therapies are needed that more effectively treat rheumatoid arthritis and other autoimmune disorders. 2. 2.3 INFECTIOUS DISEASES The infectious agents that cause disease fall into five groups: viruses, bacteria, fungi, protozoa and helminths (worms). The notorious variety of these pathogens has caused the natural selection of two crucial aspects of adaptive immunity. In the first place, the advantage of being able to recognize a wide scale of different pathogens has led to the development of receptors in B and T cells of equal or greater diversity. Secondly, the different habitats and life cycles of pathogens will have to be combated by a scale of different effector mechanisms. The characteristic aspects of each pathogen are its form of transmission, its mechanism of replication, pathogenesis or the means by which it causes disease, and the response it produces. The record of human beings suffering and dying from smallpox, cholera, typhus, dysentery, malaria, etc., establishes the eminence of infectious diseases. Despite the outstanding events to control the above through improved sanitation, immunization and antimicrobial therapy, infectious diseases continue to be a common and important problem in modern medicine. The most common disease of humanity, the common cold, is an infectious disease, as is the dreaded modern AIDS disease. Some chronic neurological diseases that were previously thought to be degenerative diseases have proven to be infectious. There is some doubt that the future will continue to reveal infectious diseases as major medical problems. A large number of diseases in humans and animals result from virulent and opportunistic infections of any of the infectious agents mentioned above (see Belshe (Ed.) 1984 Textbook of Human Viroloqy, PSG Publishing, Littleton, MA). A category of infectious diseases are, for example, viral infections. Viral diseases of a wide array of tissues, including the respiratory tract, CNS, skin, genitourinary tract, eyes, ears, immune system, gastrointestinal tract, and skeletal muscle system, affect a vast number of human beings of all ages (see Table 348-2 in: Wyngaarden and Smith, 1988, Cecil Textbook of Medicine, 81st Edition, WB Saunders Ceo., Philadelphia, p. 1750-1753). Although considerable effort has been put into designing effective antiviral therapies, viral infections continue to threaten the lives of millions of people around the world. In general, attempts to develop antiviral drugs have focused on several stages of the viral life cycle (See, for example, Mitsuya et al., 1991, FASEB J. 5: 2369-2381, which deal with HIV). However, a common drawback associated with the use of many current antiviral drugs is their deleterious side effects, such as host toxicity or resistance by certain viral strains. 3. SUMMARY OF THE INVENTION The present invention is based, in part, on the identification of mutant human IgGl heavy chain Fc regions, with altered affinities for FcyR receptors (e.g., activation Fc? R, inhibition Fc? R), using a yeast exposure system. Model and clinical experiments of live animals indicate that the Fc region plays an essential role in determining the result of monoclonal antibody therapy. Current approaches to optimize the function of the Fc region (e.g., antibody-dependent cell-mediated cytotoxicity (CCDA), cytotoxicity activity Complement-dependent (CDC)) monoclonal therapeutic antibodies and soluble polypeptides fused with the Fc regions have focused on a limited number of simple amino acid changes based on structural analyzes and / or computer-aided designs. Alternative approaches to work the Fc regions have focused on the glycosylation of the Fc region to optimize the function of the Fc region. The invention is based, in part, on possible selection mutants for altering one or more Fc functional activities, such as, but not limited to CCDA and CDC, from a non-partial bank of Fc variants. The present invention provides methods for working the Fc regions and the identification and screening of novel Fc variants outside of the expected regions identified by structural studies. Expected regions, as used herein, refer to those regions that are based on structural and / or biochemical studies are in contact with an Fc ligand. The present invention provides a discovery platform for the identification of Fc variants with improvement in one or more Fc effector functions by combining cell-based functional assays and construction of combination banks with modern automation. The present invention assembles complete combination banks saturating regions of interest within the Fc with modifications that they cover all possible amino acid changes. The combination banks will be tested using a binding set and functional analysis to select mutants based on enhanced biological function. Accordingly, the invention relates to molecules, preferably polypeptides, and more preferably immunoglobulins (e.g., antibodies), comprising a variant Fc region, having one or more amino acid modifications (e.g., substitutions, but also including insertions or deletions) in one or more regions, whose modifications alter, e.g., increase or decrease, the affinity of the variant Fc region for a FcyR. Preferably, said one or more amino acid modifications increase (n) the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA. In a preferred embodiment, the molecules of the invention specifically bind more to Fc? RIIB (via the Fc region) with a lower affinity than that of a comparable molecule (ie, having the same amino acid sequence as the molecule of the invention). except for one or more amino acid modifications in the Fc region) comprising the wild-type Fc region that binds FcyRIIB. In some embodiments, the invention encompasses molecules with variant Fc regions, which have one or more amino acid modifications, such modifications increase the affinity of the variant Fc region for 5 Fc? RIIIA and / or FcyRIIA and increase the affinity of the Fc region for Fc? RIIB in relation to a molecule comparable to a wild-type Fc region. In other embodiments, the invention encompasses molecules with variant Fc regions, which have one or more amino acid modifications, such modifications increase the affinity of the variant Fc region for FcγRIIIA and / or FcyRIIA but do not alter the affinity of the regions of Fc variant for Fc? RIIB in relation to a molecule comparable to a wild-type Fc region. A preferred embodiment is a variant Fc region that has increased affinity for Fc? RIIIA and FcyRIIA but reduced affinity for Fc? RIIB relative to a molecule comparable to a wild-type Fc region. The Fc variants of the present invention can be combined with other Fc modifications, including, but not limited to, modifications that alter effector function. The invention encompasses combining an Fc variant of the invention with other modifications of Fc to provide additive, smergistic or novel properties in antibodies or Fc fusions. Preferably, the Fc variants of the invention increase the phenotype of the modification with which they are combined. For example, if an Fc variant of the invention is combined, with a mutant known to bind to FcyRIIIA, with an affinity superior to that of a comparable molecule comprising a Fc region type wild; the combination with a mutant of the invention results in a greater fold increase in affinity of FcyRIIIA. In one embodiment, the Fc variants of the present invention can be combined with other Fc variants known as those described in Duncan et al., 1988, Nature 332: 563-564; Lund et al., 1991, J. Immunol 147: 2657-2663; Lund et al., 1992, Mol I munol 29: 53-59; Alegre et al., 1994, Transplantation 57: 1537-1543; Hutchins et al., 1995, Proc Nati. Acad Sci USA 92: 115-119; Jefferis et al., 1996, Immunol Lett 54: 101-104; Lund et al., 1996, J Immunol 157: 496-3469; Armor et al., 1999, Eur J Immunol 29: 2613-2624; Idusogie et al., 2000, J Immunol 164: 41784184; Reddy et al., 2000, J Immunol 164: 1925-1933; Xu et al., 2000, Cell Immunol 200: 16-26; Idusogie et al., 2001, J Immunol 166: 2571-2575; Shields et al., 2001, J Biol Chem 276: 6591-6604; Jefferis et al., 2002, Immunol Lett 82: 57-65; Presta et al., 2002, Biochem Soc Trans 30: 487-490); USA 5,624,821; US 5,885,573; US 6,194,551; PCT WO 00/42072; PCT WO 99/58572; each of which is incorporated herein by reference in its entirety. The invention encompasses molecules that are homodimers or heterodimers of Fc regions. The heterodimers comprising Fc regions refer to molecules wherein the two Fc chains have the same or different sequences. In some embodiments, in the heterodimeric molecules comprising the variant Fc regions, each chain has one or more different modifications of the other chain. In other embodiments, in the heterodynamic molecules comprising the variant Fc regions, one chain contains the wild-type Fc region and the other chains comprise one or more modifications. Methods for working with heterodimeric molecules containing FC are known in the art and are encompassed within the invention. In some embodiments, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild type Fc region, said variant Fc region does not bind to no FcyR or binds with a reduced affinity, relative to a comparable molecule comprising the wild-type Fc region, as determined by normal analyzes (e.g., in vitro analysis) known to one skilled in the art. In a specific embodiment, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region only attaches to an Fc? R, where said FcyR is Fc? lIIA. In another modality specifically, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region only being linked to an Fc ? R, where said Fc? R is Fc? RIIA. In yet another embodiment, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region only attaches to an Fc? R, wherein said Fc? R is Fc? RIIIB. The affinities and binding properties of the molecules of the invention for an Fc [reg] R are initially determined using in vitro analysis (analysis with biochemical or immunological basis) known in the art to determine interactions of Fc-Fc [gamma] R, Le., Binding specific to a region of Fc to an FcγR including, but not limited to, ELISA analysis, surface plasmotype resonance analysis, immunoprecipitation analysis (See Section 5.2.1). Preferably, the binding properties of the molecules of the invention are also characterized by in vitro functional analysis to determine one or more functions of effector mediating cells of FcγR (See Section 5.2.6). In most preferred embodiments, the molecules of the invention have binding properties similar in vivo models (such as those described and detailed herein) as in vitro-based analyzes. However, the present invention does not exclude molecules of the invention that do not exhibit the desired phenotype in in vitro-based analyzes but do not expose the desired phenotype in vivo. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that the polypeptide is specifically binds Fc? RIIIA with a higher affinity than a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, provided that said variant Fc region does not have only one substitution at any of the positions 329, 331, or 332, and does not include or is not solely a substitution with any of, alanine in any of positions 256, 290, 298, 312, 333, 334, 359, 360, 326, or 430; a lysine at position 330; a threonine at position 339; a methionine at position 320; a serine in position 326; an asparagine at position 326; an aspartic acid at position 326; a glutamic acid at position 326; a glutamine at position 334; a glutamic acid at position 334; a methionine at position 334; a histidine at position 334; a valine at position 334; or a leucma at position 334; a lysine at position 335. In another specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, so that said polypeptide binds specifically to Fc? RIIA, with a higher affinity with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIA, as long as one or more amino acid modifications does not include or they are not solely a substitution with an alanine in any of positions 256, 290, 326, 255, 258, 267, 272, 276, 280, 283, 285, 286, 331, 337, 268,272, or 430; an asparagine at position 268; a glutamine at position 272; a glutamine, sepna or aspartic acid at position 286; a serine in position 290; a methionine, glutamine, glutamic acid, or arginine at position 320; a glutamic acid at position 322; a septa, glutamic acid or aspartic acid at position 326; a lysine at position 330; a glutamine at position 335; or a methiomine at position 301. In a specific preferred embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein the variant Fc region comprises at least one modification of amino acids in relation to a wild-type Fc region, such that said molecule has an altered affinity for an FcγR, provided that said vanishing Fc region does not have a substitution at positions that make direct contact with Fc ? R based on crystallographic acid and structural analysis of Fc-Fc? R interactions such as those described by Sondermann et al., (2000 Nature, 406: 267-273, which is incorporated herein in its entirety by reference). Examples of positions within the Fc region that make direct contact with Fc? R are amino acids 234-239 (axis region), amino acids 265-269 (B / C loop), amino acids 297-299 (C / E loop) , and amino acids 327-332 (F / G loop). In some embodiments, the molecules of the invention comprising the variant Fc regions comprise the modification of at least one residue that does not make direct contact with an FcγR based on structural and crystallographic analysis, e.g., is not within of the Fc-Fc? R binding site. In another preferred embodiment, the invention encompasses a molecule comprising a vanishing Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said molecule is joins an Fc? R with an altered affinity in relation to a molecule comprising a wild-type Fc region, provided when at least one amino acid modification does not include or is not solely a substitution of any of the positions 255, 256, 258, 267, 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289 , 290, 292, 293, 294, 295, 296, 298, 300, 301, 303, 305, 307, 309, 312, 320, 322, 326, 329, 330, 332, 331, 333, 334, 335, 337 , 338, 340, 359, 360, 373, 376, 416, 419, 430, 434, 435, 437, 438, 439. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises at least one modification of amino acids relative to a wild-type Fc region, such that said molecule binds to an FcγR with an altered affinity in relation to a molecule comprising a Fc region type wild, as long as said variant Fc region does not include or are not only a substitution in the wild-type Fc region, as long as said variant Fc region does not include or are not only a substitution in any of positions 255, 258, 267, 270, 276, 278, 280, 283, 285, 289, 292, 293, 294, 295, 296, 300, 303, 305, 307, 309, 322, 329, 332, 331, 337, 338, 340, 373, 376, 416, 419, 434, 435, 437, 438, 439 and does not have an alanma in any of positions 256, 290, 298, 312, 333, 334 , 359, 360, 326, or 430; a lisma at position 330; a threonma at position 339; a metiomna in position 320; a serine in position 326; an asparagine at position 326; an aspartic acid at position 326; a glutamic acid at position 326; an asparagine at position 326; a glutamine at position 334; a glutamic acid at position 334; a methionine at position 334; a histidine at position 334; a value at position 334; or a leucine at position 334; a room at position 335; an asparagm at position 268; a glutamine at position 272; a glutamine, serine or aspartic acid at position 286; a serine in position 290; a methionine, glutamine, glutamic acid or argmin in position 320; a glutamic acid at position 322; a serma, glutamic acid or aspartic acid at position 326; a Plant at position 330; a glutamine at position 335; or a methionine at position 301. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region does not include or does not have only one substitution at any of positions 268, 269, 270, 272, 276, 278, 283, 285, 286, 289, 292, 293, 301, 303, 305, 307, 309, 331, 333, 334, 335, 337, 338, 340, 360, 373, 376, 416, 419, 430, 434, 435, 437, 438, or 439 and does not have a histidine, glutamine or tyrosine at position 280; a serine, glycine, threonine or tyrosine at position 290, a leucine or isoleucine at position 300; an asparagine at position 294, a proline at position 296; a long, asparagine, aspartic acid, or valine at position 298; a lysine at position 295. In yet another preferred embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild type Fc region. , so that said molecule binds to an FcγR with a reduced affinity in relation to a molecule comprising a wild type Fc region provided that said variant Fc region does not have or is not only a substitution in any of the positions 252, 254, 265, 268, 269, 270, 278, 289, 292, 293, 294, 295, 296, 298, 300, 301, 303, 322, 324, 327, 329, 333, 335, 338, 340 , 373, 376, 382, 388, 389, 414, 416, 419, 434, 435, 437, 438, or 439. In yet another preferred embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said Variant Fc region comprises at least one amino acid modification in relation to a Fc-type region vestre, so that said molecule binds to Fc? R with an increased affinity in relation to a molecule comprising a wild-type Fc region as long as said variant Fc region does not have or is not only a substitution in any of the positions 280, 283, 286, 290, 294, 295, 298, 300, 301, 305, 307, 309, 312, 315, 331, 333, 334, 337, 340, 360, 378, 398, or 430.

In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region does not include a substitution or does not have only one substitution at any of positions 330, 243, 247, 298, 241, 240, 244, 263, 262, 235, 269, or 328 and does not have a leucine in position 240, a histidine in position 244, a valine in position 330, or an isoleucine in position 328. In a specific embodiment , the molecules of the invention comprise a vanishing Fc region having one or more amino acid modifications (e.g., substitutions), such modifications increase the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA at least 2 times, in relation to a comparable molecule comprising a wild-type Fc region. In certain embodiments, the molecules of the invention comprise a variant Fc region having one or more amino acid modifications (e.g., substitutions), said modifications increase the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA by more than two times, at least 4 times, at least 5 times, so at least 6 times, at least 8 times, or at least 10 times in relation to a comparable molecule comprising a wild-type Fc region. In other embodiments of the invention, the molecules of the invention comprising a variant Fc region specifically join Fc? RIIIA and / or Fc? RIIA with at least 65%, at least 75%, at least 85%, at least 95%, at least 100%, at least 150%, so less 200% higher affinity in relation to a molecule comprising a wild-type Fc region. Said measurements preferably are in vitro analysis. The invention encompasses molecules with altered affinities for activation and / or Fc? inhibitors. In particular, the invention contemplates molecules with variant Fc regions having one or more amino acid modifications, said modifications increase the affinity of the variant Fc region for Fc? RIIB but decrease the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA, in relation to a molecule comparable to a wild-type Fc region. In other embodiments, the invention encompasses molecules with the variant Fc regions, which have one or more amino acid modifications, such modifications decrease the affinity of the variant Fc region for Fc? RIIB and also decrease the affinity of the variant Fc regions. for Fc? RIIIA and / or Fc? RIIA in relation to a molecule comparable to a wild-type Fc region. In still other embodiments, the invention encompasses molecules with variant Fc regions, said modifications decreasing the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA but does not alter the affinity of the variant Fc region for Fc? RIIB in relation to a comparable molecule having wild-type Fc region. In still other embodiments, the invention encompasses molecules with variant Fc regions, such modifications increase the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA but reduce the affinity of the variant Fc region for Fc? RIIB in relation to a molecule comparable to a wild-type Fc region. In a specific embodiment, the molecules of the invention comprise a variant Fc region, which have one or more amino acid modifications (e.g., substitutions), said one or more modifications increase the affinity of the variant Fc region for Fc • RIIIA and decrease the affinity of the variant Fc region for Fc? RIIB, relative to a comparable molecule comprising a wild-type Fc region that binds to Fc? RIIIA and Fc? RIIB with wild-type affinity. In some embodiment, one or more amino acid modifications are not a substitution with alanine at any of positions 256, 298, 333, or 334. In another specific embodiment, the molecules of the invention comprise a variant Fc region, which have a or more amino acid modifications (e.g., substitutions), said one or more modifications increase the affinity of the variant Fc region for Fc? RIIA and decreases the affinity of the variant Fc region for Fc? RIIB, in relation to a comparable molecule comprising a wild-type Fc region which binds to Fc? RIIA and Fc? RIIB with wild-type affinity. In a certain embodiment, the amino acid modification (s) is not a substitution with arginine at position 320. In more preferred embodiments, the molecules of the invention with altered affinities for activation receptors and / or inhibitors having the regions of Fc variants have one or more amino acid modifications, wherein said amino acid modification is a substitution at position 288 with asparagine, at position 330 with serine and at position 396 with leucine (MgFcIO) (See Table 5); or a substitution at position 334 with glutamic acid, at position 359 with asparagine and at position 366 with serine (MgFcl3); or a substitution at position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid (MgFc42); or a substitution at position 392 with threonine, and at position 396 with leucine (MgFc38); or a substitution at position 221 with glutamic acid, at position 270 with glutamic acid, at position 308 with alanine, at position 311 with histidine, at position 396 with leucine and at position 402 with aspartic acid (MgFc42); or a substitution at position 240 with alanine, and at position 396 with leucine (MgFc52); or one substitution at position 410 with histidine and at position 396 with leucine (MgFc53); or a substitution at position 243 with leucma, at position 305 with isoleucine, at position 378 with aspartic acid, at position 404 with serine and at position 396 with leucine (MgFc54); or a substitution at position 255 with isoleucine, and at position 396 with leucine (MgFc55); or a substitution at position 370 with glutamic acid and at position 396 with leucma (MgFc59). The preferred method for screening and identifying molecules comprising variant Fc regions with altered FcγR affinities (e.g., improved Fc ?RIIIA affinity) is yeast surface exposure technology (for review see Boder and Wittrup, 2000, Methods in Enzymology, 328; 430-444, which is incorporated herein by reference in its entirety). Specifically, surface exposure of yeast) is a genetic method by which polypeptides comprising Fc mutants are expressed in a yeast cell wall in an accessible form to interact with FcγR. The yeast surface exposure of the mutant Fc containing polypeptides of the invention can be made according to any of the techniques known to those skilled in the art or the specific methods described herein. Yeast exposure offers the advantage of using union to a desired receptor to identify variant Fc regions that have enhanced binding to said receptor. One aspect of the invention provides a method for selecting mutant Fc fusion proteins with a desirable binding property, e.g., the ability of the mutant Fc fusion protein to bind to FcγRIIIA with a greater affinity to the that a comparable polypeptide comprising a wild-type Fc region binds to Fc? RIIIA. Yeast cells that display the mutant Fc fusion proteins can be screened and characterized by any biochemical or immunological based assays known to those skilled in the art to evaluate binding interactions. In a specific embodiment, the screening of mutant Fc fusion proteins is performed using one or more biochemical based assays, e.g., an ELISA analysis. In preferred embodiments, screening and identification of molecules comprising variant Fc regions with altered FC7R affinities (e.g., increased Fc? RIIIA) are performed using the yeast exposure technology as described herein in combination with one or more analyzes with a biochemical basis, preferably in a high performance form. One or more biochemical analyzes can be any analysis known in the art to identify the interaction of Fc-Fc? R, is say, specific binding of a Fc region to an FcγR, including, but not limited to, an ELISA analysis, surface plasmotype resonance analysis, immunoprecipitation analysis, affinity chromatography and equilibrium dialysis. In some embodiments, screening and identification of molecules comprising variants of Fc regions with altered Fc? R affinities (eg, increased Fc? RIIA affinity) are performed using the yeast exposure technology as described in present in combination with one or more functionally based analyzes, preferably in a high performance manner. The functional-based analysis can be any analysis known in the art to characterize one or more effector cell functions mediated by FcγR such as those described herein in the non-limiting examples Section 5.2.6. of effector cell functions that can be used according to the methods of the invention, include but are not limited to, antibody-dependent cell-mediated cytotoxicity (CCDA), antibody-dependent phagocytosis, phagocytosis, opsonization, opsonophagocytosis, cell binding, rosette formation, Clq binding, and complement-dependent cell mediated cytotoxicity. In some embodiments, the screening and identification of molecules comprising regions of variant Fc with altered Fc? R affinities (e.g., improved affinity of FcγRIIIA) are performed using yeast exposure technology as described herein in combination with one or more biochemical based analysis in combination or in parallel with one or more functionally based analyzes, preferably in a form of high performance. A preferred method for measuring the interaction of FcγR-Fc according to the invention is an analysis developed by the inventors, which allows the detection and quantification of the interaction, despite the inherently weak affinity of the receptor for its ligand, v .gr., on the micromolar scale for Fc? RIIIB and Fc? RIIIA. The method involves the formation of an FcγR complex (e.g., FcγRIIIA, FcγRIIB) having an enhanced strength for an Fc region, relative to an FcγR that is not forming a complex . In a specific embodiment, the invention encompasses a method for producing a tetrameric complex of FcγR, wherein the tetrameric complex has an increased affinity for an Fc region, relative to the affinity of a monomeric FcγR for the region of Fc, said method comprising: (i) producing a fusion protein, such as an AVITAG sequence of 15 amino acids operably linked to the soluble region of Fc? R; (n) biotinylation of the protein produced using a BirA enzyme from E. coli; (iii) mixing the biotinylated protein produced with streptavidin-phycoerythrin in an appropriate molar ratio, so that a complex is formed Fc? R tetrameric. In a preferred embodiment of the invention, the polypeptides comprising Fc regions bind to the tetrameric FcγR complexes, formed according to the methods of the invention, at least with an affinity greater than 8 times that with the that join the monomeric Fc? R that is not forming a complex. The binding of polypeptides comprising Fc regions to the tetrameric FcγR complexes can be determined using standard techniques known to those skilled in the art, such as, for example, selection of fluorescence activated cells (SCAF), radioimmunoassay, ELISA analysis. , etc . The invention encompasses the use of immune complexes formed according to the methods described above for determining the functionality of molecules comprising an Fc region in cell-based or cell-free assays. In a specific embodiment, the invention provides modified immunoglobulins comprising a variant Fc region with an increased affinity for Fc? RIIIA and / or Fc? RIIA. Said immunoglobulins include IgG molecules that naturally contain FcγR binding regions (e.g., FcγRIIIA and / or FcγRIIB binding regions), or immunoglobulin derivatives that have been treated to contain a binding region of Fc? R (e.g., Fc? RIIIA and / or Fc? RIIB binding regions). The modified immunoglobulins of the invention include any immunoglobulin molecule that binds, preferably, immunospecifically, ie, competes in a non-specific binding as determined by immunoassays well known in the art for the binding of specific antigen-antibody, an antigen. and contains a binding region of Fc? R (e.g., a binding region of Fc? RIIIA and / or Fc? RIIB). Such antibodies include, but are not limited to, polyclonal, monoclonal, bi-specific, multi-specific, human, humanized, chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') re Fvs fragments linked to bisulfide, and fragments containing a VL or VH domain or even a complementary determinant region (RDC) that specifically binds to an antigen, in certain cases, are treated to contain or fuse to an Fc? R binding region. In a certain embodiment, the invention encompasses immunoglobulins comprising a variant Fc region with increased affinity for FcγRIIIA and / or FcγRIIA so that the immunoglobulin has an improved effector function, eg, cell-mediated cytotoxicity. of antibodies. The effector function of the molecules of the invention can be analyzed using some analysis described herein or known to those skilled in the art. In some embodiments, immunoglobulins comprising a variant Fc region with increased affinity for Fc? RIIIA and / or Fc? RIIA have improved CCDA activity relative to the wild type at least 2 times, at least 4 times , at least 8 times, at least 10 times, at least 50 times, or at least 100 times. The invention encompasses treated human or humanized therapeutic antibodies (e.g., tumor-specific monoclonal antibodies) in the Fc region by modification (e.g., substitution, insertion, deletion) of one or more amino acid residues, whose Modifications modulate the affinity of the therapeutic antibody for an FcγR activation receptor and / or an FcγR inhibitor receptor. In one embodiment, the invention relates to the engineering treatment of human or humanized therapeutic antibodies (e.g., tumor-specific monoclonal antibodies) in the Fc region by the modification of one or more amino acid residues, said modifications increase the Affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA. In another embodiment, the invention relates to engineering human or humanized therapeutic antibodies (e.g., tumor-specific monoclonal antibodies) in the Fc region by modification of one or more amino acid residues, said modification increases the affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA and further decreases the affinity of the Fc region for Fc? RIIB. Engineered therapeutic antibodies may also have improved effector function, e.g., improved CCDA activity, phagocytosis activity, etc., as determined by normal assays known to those skilled in the art. In a specific embodiment, the invention encompasses engineering a humanized monoclonal antibody to the Her2 / neu proto-oncogene (e.g., humanized antibody Ab4D5 as described in Carter et al., 1992, Proc. Nati Acad Sci., EUA 89: 4285-9) by modification (e.g., substitution, insertion, deletion) of at least one amino acid residue whose modification increases the affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA. In another specific embodiment, the modification of the humanized monoclonal antibody Her2 / neu can also further decrease the affinity of the Fc region for Fc? RIIB. In yet another specific embodiment, humanized monoclonal antibodies engineered for Her2 / neu may also have improved effector function as determined by normal assays known in the art and are described and exemplified herein. In another specific embodiment, the invention encompasses engineering an anti-CD20 monoclonal antibody human and mouse chimeric, 2H7 by modification (e.g., substitution, insertion, deletion) of at least one amino acid residue whose modification increases the affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA. In yet another specific embodiment, modification of the engineered anti-CD20 monoclonal antibody, 2H7, may further have an improved effector function as determined by standard assays known in the art and described and exemplified herein. In another specific embodiment, the invention encompasses engineering an anti-Fc? RIIB antibody including but not limited to any of the antibodies described in the application of E.U.A. Provisional No. 60 / 403,266 filed on August 12, 2002 and the Application of E.U.A. No. 10 / 643,857 filed on August 14, 2003, which has Case No. 011183-010-999, by modification (e.g., substitution, insertion, deletion) of at least one amino acid residue whose modification increases affinity from the Fc region to Fc? RIIIA and / or Fc? RIIA. Examples of anti-Fc? RIIB antibodies that can be engineered according to the methods of the invention, are monoclonal antibody 2B6 having accession number of ATCC PTA-4591 and 3H7 having accession number of ATCC PTA-4592 (deposited at ATCC, 10801 University Boulevard, Manassas, VA 02209-2011, which are incorporated here 4! by reference. In yet another specific embodiment, the modification of the anti-Fc? RIIB antibody can also further decrease the affinity of the Fc region for Fc? RIIB. In yet another specific embodiment, the engineered anti-Fc? RIIB antibody may also have improved effector function as determined by standard assays known in the art and described and employed herein. in a specific embodiment, monoclonal antibody 2B6 comprises a modification at position 334 with glutamic acid, at position 359 with asparagine and at position 366 with serine (MgFc 13); or a substitution at position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid (MgFc27); or a substitution at position 243 with isoleucine, at position 379 with leucine and at position 420 with valma (MgFc29); or a substitution at position 392 with threonine and at position 396 with leucine (MgFc38); or a substitution at position 221 with glutamic acid, at position 270 with glutamic acid, at position 308 with alanine, at position 311 with histidine, at position 396 with leucine, and at position 402 with aspartic acid (MgFc42 ); or a substitution at position 410 with histidine and at position 396 with leucma (MgFc53); or a substitution at position 243 with leucine, at position 305 with isoleucine, at position 378 with aspatic acid, at position 404 with serine, and in position 396 with leucine (MgFc54); or a substitution at position 255 with isoleucine and at position 396 with leucine (MgFc55); or a substitution at position 370 with glutamic acid, and at position 396 with leucine (MgFc59). The present invention also includes polynucleotides that encode a molecule of the invention including polypeptides and antibodies, identified by the methods of the invention. The polynucleotides encoding the molecules of the invention and the nucleotide sequence of the determined polynucleotides can be obtained by any method known in the art. The invention relates to an isolated nucleic acid encoding a molecule of the invention. The invention also provides a vector comprising said nucleic acid. The invention also provides host cells containing the vectors or polynucleotides of the invention. The invention also provides methods for the production of the molecules of the invention. The molecules of the invention, including polypeptides and antibodies, can be produced by any method known to those skilled in the art, in particular, by recombinant expression. In a specific embodiment, the invention relates to a method for recombinantly producing a molecule of the invention, said method comprising: (i) culturing in a medium a host cell comprising a nucleic acid encoding said molecule, under conditions suitable for the expression of said molecule; and (ii) recovering said molecule from said medium. Molecules identified according to the methods of the invention are useful for preventing, treating, or alleviating one or more symptoms associated with a disease, disorder, or infection. The molecules of the invention are particularly useful for the treatment or prevention of a disease or disorder where improved efficacy of effector cell function (e.g., CCDA) mediated by FcγR, eg, is desired. cancer, infectious disease and to improve the therapeutic efficacy of therapeutic antibodies, said effect is mediated by CCDA. In one embodiment, the invention encompasses a method of treating cancer in a patient having a cancer characterized by a cancer antigen, said method comprising administering a therapeutically effective amount of a therapeutic antibody that binds to the cancer antigen, which has been engineered according to the methods of the invention in a specific embodiment, the invention encompasses a method of treating cancer in a patient having a cancer characterized by a cancer antigen, said method comprising administering a therapeutically effective amount of an antibody Therapeutic that specifically binds said cancer antigen, the therapeutic antibody comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, so that the Therapeutic antibody binds specifically to Fc? RIIIA as long as the variant Fc region does not have a substitution at positions 329, 331, or 332, and does not have an alanine at any of positions 256, 290, 298, 312, 333 , 334, 359, 360, or 430; a lysine at position 330; a threonine at position 339; a methionine at position 320,; a serine in position 326; an asparagine at position 326; an aspartic acid at position 326; a glutamic acid at position 326; a glutamine at position 334; or a leucine at position 334. In another specific embodiment, the invention encompasses a method of treating cancer in a patient having a cancer characterized by a cancer antigen, said method comprising administering a therapeutically effective amount of a therapeutic antibody that binds specifically to a cancer antigen, said therapeutic antibody comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region such that said therapeutic antibody binds specifically to Fc? RIIIA with a greater affinity than a therapeutic antibody comprising a wild-type Fc region linked to FcγRIIIA and said therapeutic antibody is further specifically bound to FcγRIIB with a lower affinity to a therapeutic antibody comprising the wild type Fc region linked to Fc ? RIIB, provided that said Fc variant does not have an alanine in any of positions 256, 298, 333, or 334. The invention encompasses a method of treating cancer in a patient, characterized by a cancer antigen, the method comprising administering a therapeutically effective amount of a therapeutic antibody that specifically binds to the cancer antigen and in therapeutic antibody comprises a variant Fc region such that the antibody has enhanced CCDA activity. The invention encompasses a method for treating an autoimmune disorder and / or inflammatory disorder in a patient in need thereof, the method comprising administering to said patient a therapeutically effective amount of a molecule comprising a variant Fc region, wherein said Fc variant comprises at least one amino acid modification relative to a wild type Fc region, such that the molecule binds specifically to Fc? RIIB with a greater affinity with that a comparable molecule comprising the wild-type Fc region, and said molecule also binds specifically to Fc? RIIIA with a lower affinity with which a comparable molecule comprising the wild type Fc region and said molecule binds to an immune complex (e.g., an antigen / antibody complex). The invention encompasses a method for treating an autoimmune disorder and / or inflammatory disorder further comprising administering one or more additional prophylactic or therapeutic agents, e.g., immunomodulatory agents, anti-inflammatory agents, used for the treatment and / or prevention of said diseases. The invention also encompasses methods for treating or preventing an infectious disease in a subject which comprises administering a therapeutically or prophylactically effective amount of one or more molecules of the invention that bind to an infectious agent or cellular receptor thereof. Infectious diseases that can be treated or prevented by the molecules of the invention are caused by infectious agents including, but not limited to, viruses, bacteria, fungi, protozoa and viruses. According to one aspect of the invention, the molecules of the invention comprising variant Fc regions have an improved antibody effector function towards an infectious agent, e.g., a pathogenic protein, relative to that of a comparable molecule that it comprises a wild-type Fc region. In a specific modality, the molecules of the invention improve the treatment efficacy of an infectious disease by improving phagocytosis and / or opsonization of the infectious agent causing the infectious disease. In another specific embodiment, the molecules of the invention improve the treatment efficacy of an infectious disease by improving CCDA of infected cells causing the infectious disease. In some embodiments, the molecules of the invention can be administered in combination with a therapeutically or prophylactically effective amount of one or more additional therapeutic agents known to those skilled in the art of treating and / or preventing an infectious disease. The invention contemplates the use of the molecules of the invention in combination with antibiotics known to those skilled in the art for the treatment and / or prevention of an infectious disease. The invention provides pharmaceutical compositions comprising a molecule of the invention, e.g., a polypeptide comprising a vanishing Fc region, a immunoglobulin comprising a variant Fc region, a therapeutic antibody that is engineered according to invention, and a pharmaceutically acceptable carrier. The invention further provides pharmaceutical compositions further comprising one or more additional therapeutic agents, including but not limited to anticancer agents, anti-inflammatory agents, immunomodulatory agents. 3. 1 DEFINITIONS As used herein, the term "region of Fc "is used to define a C-terminal region of an IgG heavy chain, although the limits may vary slightly, the heavy chain Fc region of IgG is defined by going from Cys226 to the carboxy terminus. of an igG comprises two constant domains: CH2 and CH3 The CH2 domain of a human IgG Fc region usually extends from amino acid 231 to amino acid 341. The CH3 domain of a human IgG Fc region usually extends the amino acid 342 to 447. The CH2 domain of the human Fc IgG region (also referred to as the "Cy2" domain) usually extends from amino acid 231 to 340. The CH2 domain is unique in that it is not closely matched with another domain. Instead, two chains of carbohydrates bound by N are interposed between the two CH2 domains of an intact native IgG In the present specification, the numbering of the residues in an IgG heavy chain is that present in the Ig ce of the EU as in Kabat et al., Sequences of Proteins of immunological Interest, 5a. Ed. Public Health Service, NHI, MD (1991), expressly incorporated herein by reference. The "EU index as in Kabat" refers to the numbering of the US antibody to human IgG. The "axis region" is generally defined as the elongation from Glu216 to Pro230 of human IgGl. The axis regions of other IgG isotypes can be aligned with the IgGl sequence by placing the first and last residues of cysteine forming S-S junctions of heavy internal chains at the same positions. As used herein, the terms "antibody" and "antibodies" refer to monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, polyclonal antibodies, cameloid antibodies, single chain Fvs (Fvsc ), single chain antibodies, Fab fragments, F (ab ') fragments, disulfide-linked bispecific Fvs (sdFv), intrabodies, and anti-idiopathic (anti-ld) antibodies (including, e.g., antibodies) anti-ld and anti-anti-Id antibodies of the invention), and epitope binding fragments of any of the foregoing. In particular, the antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, Le., Molecules that contain an antigen binding site. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (eg, IgG ?, IgG2, IgG3, IgG4, IgAi and IgA2) or subclass. As used herein, the term "derivative" in the context of polypeptides or proteins refers to a polypeptide or protein that comprises an amino acid sequence that has been altered by the introduction of substitutions, deletions or additions of amino acid residues. The term "derivative" as used herein, also refers to a polypeptide or protein that has been modified, that is, by the covalent attachment of any type of molecule to the polypeptide or protein. For example, but not by way of limitation, an antibody can be modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic separation, binding to a cellular ligand and other protein, etc. A polypeptide or derivative protein can be produced by chemical modifications using techniques known to those skilled in the art, including, but not limited to, specific chemical separation, acetylation, formylation, metabolic synthesis of tunicamycin, etc. In addition, a polypeptide derived or derived from protein has a similar or identical function as the polypeptide or protein from which it is derived.

As used in this, the term "derivative" in the context of a non-proteinaceous derivative refers to a second organic or inorganic molecule that is formed based on the structure of a first organic or inorganic molecule. A derivative of an organic molecule includes, but is not limited to, a modified molecule, e.g., by the addition or deletion of a hydroxyl, methyl, ethyl, carboxyl or amine group. An organic molecule can also be esterified, alkylated and / or phosphorylated. As used herein, the terms "disorder" and "disease" are used interchangeably to refer to a condition in a particular subject; the term "autoimmune disease" is used interchangeably with the term "autoimmune disorder" to refer to a condition in a subject characterized by cellular damage, of tissues and / or organs caused by an immunological reaction of the subject to their own cells, tissues and / or organs. The term "inflammatory disease" is used interchangeably with the term "inflammatory disorder" to refer to a condition in a subject characterized by inflammation, preferably chronic inflammation, autoimmune disorders may or may not be associated with inflammation. In addition, the inflammation may or may not be caused by an autoimmune disorder. Therefore, certain disorders They can be characterized as autoimmune and inflammatory disorders. As used herein, the term "cancer" refers to a neoplasm or tumor that results from the uncontrolled abnormal growth of cells. As used herein, cancer explicitly ides, leukemias and lymphomas, in some embodiments, cancer refers to a benign tumor, which has remained localized. In other modalities, cancer refers to a malignant tumor, which has invaded and destroyed surrounding body structures and spread to distant sites. In some modalities, cancer is associated with a specific cancer antigen. As used herein, the term "immunomodulatory agent" and variations thereof, refers to an agent that modulates an immune system of the host. In other certain embodiments, an immunomodulatory agent is a immunostimulatory agent. Immunomodulatory agents ide, but are not limited to, small molecules, peptides, polypeptides, fusion proteins, antibodies, inorganic molecules, mimics, and organic molecules. As used herein, the term "epitope" refers to a fragment of a polypeptide or protein or a non-protein molecule having antigenic or immunogenic activity in an animal, preferably in a mammal and more preferably in a human. An epitope that has Immunogenic activity is a fragment of a polypeptide or protein that produces an antibody response in an animal. An epitope having antigenic activity is a fragment of a polypeptide or protein to which an antibody immunospecifically binds as determined by some method well known to one skilled in the art for example by immunoassay. Antigenic epitopes do not necessarily need to be immunogenic. As used herein, the term "fragment" refers to a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 residues of contiguous amino acids, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, minus 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 amino acid residues contiguous, at least 175 residues of contiguous amino acids, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues of the amino acid sequence of another polypeptide. In a specific embodiment, a fragment of a polypeptide retains at least one function of the polypeptide. As used herein, the terms "nucleic acids" and "nucleotide sequences" ide DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), combinations of molecules of DNA and RNA or hybrid DNA / RNA molecules, and analogs of DNA or RNA molecules. Such analogs can be generated using, for example, nucleotide analogues, which include, but are not limited to, inosine or titrated bases. Such analogs may also comprise DNA or RNA molecules comprising modified base structures that provide beneficial attributes to molecules such as, for example, nuclease resistance or an increased ability to cross cell membranes. Nucleic acids or nucleotide sequences can be single-stranded, two-stranded, can contain single-stranded and double-stranded portions and can contain triple-stranded portions, but preferably is double-stranded DNA. As used herein, "therapeutically effective amount" refers to that amount of therapeutic agent sufficient to treat or manage a disease or disorder. A therapeutically effective amount may refer to the amount of therapeutic agent sufficient to delay or minimize the onset of the disease, e.g., delay or minimize the spread of cancer. A therapeutically effective amount may also refer to the amount of the therapeutic agent that provides a therapeutic benefit in the treatment or management of a disease. In addition, a therapeutically effective amount with respect to a therapeutic agent of the invention means the amount of therapeutic agent alone, or in combination with other therapies, which provides a therapeutic benefit in the treatment or management of a disease. As used herein, the terms "prophylactic agent" and "prophylactic agents" refer to any agent that can be used in the prevention of a disorder, or prevention of recurrence or spread of a disorder. A prophylactically effective amount can refer to the amount of prophylactic agent sufficient to prevent recurrence or spread of the hyperproliferative disease, particularly cancer, or prevent it from occurring in a patient, including, but not limited to, those predisposed to said disease hyperproliferative, for example, those who are genetically predisposed to cancer or who have previously been exposed to carcinogens. A prophylactically effective amount may also refer to the amount of the prophylactic agent that provides a prophylactic benefit in the prevention of the disease. In addition, a prophylactically effective amount with respect to a prophylactic agent of the invention means the amount of prophylactic agent alone, or in combination with other agents, which provides a prophylactic benefit in the prevention of the disease. As used herein, the terms "prevent", "prevent" and "prevention" refer to the prevention of the recurrence or presentation of one or more symptoms of a disorder in a subject as a result of the administration of a prophylactic or therapeutic agent. As used herein, the term "in combination" refers to the use of more than one prophylactic and / or therapeutic agent. The use of the term "in combination" does not restrict the order in which prophylactic and / or therapeutic agents are administered to a subject with a disorder. A first prophylactic or therapeutic agent can be administered before (eg, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours , 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or Subsequent with (eg, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second prophylactic or therapeutic agent to a subject with a disorder. "Effector function" as used herein, is understood as a biochemical case resulting from the interaction of an antibody Fc region with an Fc receptor or ligand. Effector functions include, but are not limited to antibody-dependent cell-mediated cytotoxicity (CCDA), antibody-dependent cell-mediated phagocytosis (ADCP), and complement-dependent cytotoxicity (CDC). Effector functions include both those that operate after the binding of an antigen and those that operate independent of antigen binding. By "effector cell" as used herein, is meant a cell of the immune system that expresses one or more Fc receptors and mediates one or more effector functions. Effector cells include, but are not limited to monocytes, macrophages, neutrophils, dendritic cells, eosinophils, mastoid cells, platelets, B cells, long granular lymphocytes, Langerhans cells, natural killer (AN) cells, and can be of any organism, including but not limited to humans, mice, rats, rabbits and monkeys. "By" Fc ligand "as used herein, is meant a molecule, preferably a polypeptide, of any organism that binds to the Fc region of an antibody to form an Fc ligand complex. Fc ligands include, but are not limited to FcRs, RcyRs, Fc? Rs, FcRn, Clq, C3, staphylococcal protein A, streptococcal G protein and viral Fc? R Fc ligands may include undiscovered molecules that bind to Fc. 4. BRIEF DESCRIPTION OF THE DRAWINGS FIGURE 1. SDS-PAGE ANALYSIS OF RECOMBINANT Fc.sub.R SOLUBLE The purity of soluble recombinant Fc? R proteins was evaluated by 10% polyacrylamide gel electrophoresis. The gels were stained with Coomassie blue. Line 1: Fc? RIIIA purified recombinant recombinant; line 2: molecular weight marker; Line 3: molecular weight marker; Line 4: Fc? Soluble recombinant RIIB purified. The stripes refer to the molecular weight of the markers, from top to bottom, correspond to a molecular weight of 98, 50, 36, and 22 kDa respectively.

FIGURE 2.. RECOMBINANT Fc.sub.R ELISA ELISA ANALYSIS Direct binding of recombinant soluble Fc? RIIIA purified for aggregates and monomeric IgGs was determined using an ELISA analysis. Union of (A) IgG added with 3G8; () Biotylated IgG; (•) Added IgG; (X) IgG added with mouse IgGl.

FIGURES 3A and B. CHARACTERIZATION OF TETRAMERIC COMPLEX OF FcyRIIIA USING ELISA ANALYSIS A. The soluble tetrameric FcγRIIIA complex binds specifically to soluble monomeric human IgG. The binding of soluble tetrameric Fc? RIIIA to human IgG is blocked by 3G8 (*), a mouse anti-Fc? IIA monoclonal antibody; the monoclonal antibody 4-4-20 harboring the D265 mutation was not able to block the binding of soluble tetrameric Fc? RIIIA to the added human IgG (?). B. The binding of soluble tetrameric FcγRIIIA complex with soluble monomeric human IgG ()) is compared to the binding of soluble monomeric Fc ?RIIIA to soluble monomeric human IgG (i).

FIGURES 4A AND B. CHARACTERIZATION OF COMPLEX TETRAMERIC OF FcyRIIIA USING AN ANALYSIS OF MAGNETIC PEARLS A. Complex of Fc? RIIIA: Two Fc? RIIIA (filled configuration) are joined by a monoclonal antibody DJ130c (row Ab), in f (ab) 2 anti-mouse conjugated to PE (circle). B. The SCAF Analysis of Fc? RIIIA bound to Fc-coated beads; (a) pearls alone; (b) complex without Fc? RIIIA; (c) complex with Fc? RIIIA; (d) complex with Fc? RIIIA and LNK16.

FIGURE 5. ESCHEMATIC PRESENTATION OF CONSTRUCTS CONTAINING Fc A schematic diagram of the Fc domains of IgGl cloned in pYDI is presented. The open box represents the domains of the CH2-CH3-axis; the parallel vertical lines represent the CHI domain. In the case of the constructions of GIF206 and 227; the N-terminal amino acids are shown. The indicated residuals correspond to the axis region, the * represents the explicit epitope mark; the hidden boxes represent the Gly4-Ser linker, and the dotted boxes represent the Aga2p gene.

FIGS. 6A-H SCAF ANALYSIS OF Fc FUSION PROTEINS IN THE CELLULAR WALL OF YEASTS Cells were incubated with a polyclonal goat anti-human Fc antibody conjugated with PE (Figs 6A-D) or with HP6017 (Sigma), a monoclonal antibody specific for mouse anti-human IgG Fc (CH3) (Figs 6E-H). A and E represent the vector alone; panels B and F represent the construction CH1-CH3; panels C and G represent GIF227; and panels D and H represent the construction of GIF 206.

FIGS. 7A-C. UNION OF FCERIIIA TETRAMERIC SOLUBLE TO THE FUSION PROTEINS OF Fc UNFOLDED SUPERFICIALLY Cells containing pYD 1-CHI (A); pYD-CHI-D265 A (B); and vector pYD (C) were developed under conditions to express Aga2p fusion proteins on the cell surface. Cells were incubated with FcγRIIIA at 0.15 mM, 7.5 mM, and 7.5 mM, respectively and analyzed by SCAF.

FIG. CHARACTERIZATION OF THE SOLUBLE TETRAMERIC FcγRIIIA UNION TO THE SUPERFICIALLY FLEXOUS FUSION PROTEINS The binding of the tetrameric FcγRIIIA complex to the Fc fusion proteins on the surface was analyzed yeast cell The tetrameric complexes of FcγRIIIA conjugated with PE were preincubated with different concentrations of 3G8 (*), LNK (A) or an irrelevant isotype control (•) and subsequently incubated with yeast cells. The cells were analyzed by SCAF for PE fluorescence. The percentage of cells that bound to the tetrameric complex of Fc? RIIIA was plotted on the axis FIG. 9. EXAMPLE OF SMALL GATE FOR SELECT Fc MUTANTS WITH INCREMENTED UNION TO FcyRIIIA Cells were stained with tetrameric complexes of FcγRIIIA conjugated with FE (y-axis) and antibody conjugated with anti-Fc-FITC (x-axis). The boxed area represents a gate class configured to select 1.0% of the cell population.

FIGS. 10A-N. SCAF ANALYSIS OF SOME OF THE IDENTIFIED Fc MUTA? TES THAT HAVE AN INCREASED AFFINITY FOR TETRAMERIC COMPLEXES OF FcyRIIIA. Individual clones harboring plasmid pYD-CHI containing independent Fc mutations were amplified in selective media containing glucose, induced for Fc expression in selective media containing galactose and subsequently analyzed by FACs.

Figs. 10A and B represent cells harboring wild-type Fc; Figs. 10C and D represent mutant # 5; Figs. 10E and F represent mutant # 20; Figs. 10G and H represent mutant # 21; Figs. 101 and J represent mutant # 24; Figs. 10K and L represent mutant # 25; Figs. 10M and N represent mutant # 27. Cells were stained with tetrameric complex FcγRIIIA (Figs 10A, C, E, G, I, K and M) or tetrameric complex of FcγRIIB (Figs 10B, D, F, H, J, L and N).

FIGS. 11 A-B. CHARACTERIZATION OF Fc MUTANTS IN THE MONOCLONAL ANTIBODY 4-4-20 BY ELISA The Fc domains of the pYD-CHI plasmids were cloned into the heavy chain in the chimeric monoclonal antibody 4-4-20. Monoclonal antibody 4-4-20 was expressed in 293 cells and the supernatants were harvested. The ELISA plates were coated with fluorescein conjugated GSA to capture the mutant 4-4-20 chimeric antibodies. The FcγRIIIA (A) and FcγRIIB (B) receptors were then coated in ELISA plates for which monoclonal antibodies 4-4-20 were absorbed in order to determine the relative affinities of the variant receptors to the domains of Fc. Mutants # 15 and # 29 were isolated in unities included as controls.

FIG. 12. CCDA ACTIVITY OF MUTANTS IN THE MONOCLONAL ANTIBODY 4-4-20 Antibodies 4-4-20 containing mutant Fc regions were evaluated for their CCDA activity and compared with the CCDA activity of an antibody 4-4 -20 wild type. The mutants analyzed are the following: MGFc-10 (K288N, A330S, P396L), MGFc-26 (D265A), MGFc-27 (G316D, A378V, D399E), MGFc-28 (N315L, A379M, D399E), MGFc-29 (F243I, V379L, G420V), MGFc-30 (F275V), MGFc-31 (P247L, N421K), MGFc-32 (D280E, S354F, A431D, L441I), MGFc-33 (K317N, F423 deleted), MGFc-34 (F241L, E258G), MGFc-35 (R255Q, K326E), MGFc-36 (K218R, G281D, G385R).

FIGS. 13A and B. ACTIVITY OF MUTANTS CCDA IN THE HER2 / NEU HUMANIZED MONOCLONAL ANTIBODY. The humanized HER2 / neu monoclonal antibodies containing mutant Fc regions for their CCDA activity were evaluated and compared with the CCDA activity of an antibody. of Her2 / neu wild type. The mutants analyzed are the following: MGFc-5 (V379M), MGFc-9 (F243I, V379L), MGFc-10 (K288N, A330S, P396L), MGFc-13 (K334E, T359N, T366S), MGFc-27 (G316D) , A378V, D399E). B: The activity of CCDA of additional mutants in the context of the humanized monoclonal antibody Her2 / neu MGFc-37 (K248M), MGFc-39 (E293V, Q295E, A327T), MGFc-38 (K392T, P396L), MGFc-41 (H268N, P396L), MGFc-23 (K334E, R292L), MGFc-44, MGFc-45. Two independent clones were tested for each mutant.

FIG. 14. ANTIBODY CAPTURE 4-4-20 CH OVER BSA-FITC SURFACE 6 μl of antibody was injected at a concentration of about 20 μg / ml at 5 μl / min onto a surface of BSA-fluorescein isothiocyanate (ITCF). The BIAcore sensorimage of the binding of 4-4-20 CH antibodies with the mutant Fc regions on the surface of the BSA-ITCF immobilized sensor ship is shown. The marker was fixed on the response of captured wild-type antibodies.

FIG. 15. SENSOGRAM OF REAL-TIME BINDING OF FCYRIIIA ANTIBODIES TO 4-4-20 CH CARRIERS OF REGIONS OF FAC VARIANT The binding of Fc? RIIIA antibodies to 4-4-20 CH carriers of the variant Fc regions was analyzed at a 200 nM concentration. The responses were normalized to the level of antibody 4-4-20 CH obtained for the wild type. The mutants used were the following: Mut 6 (S219V); Mut 10 (P396L, A330S, K288N); Mut 18 (K326E); Mut 14 (K334E, K288N); Mut 11 (R255L, F243L); Mut 16 (F372Y); Mut 19 (K334N, K246I).

FIGS. 16 A-H. ANALYSIS OF KINETIC PARAMETERS OF THE UNION OF FCYRIIIA TO ANTIBODIES THAT CARRY THE REGIONS OF Fc VARIANT Kinetic parameters were obtained for the binding of Fc? RIIIA to antibodies that carry the variant Fc regions generating separate best fit curves for 200 nM and 800 nM . The solid line indicates an association adjustment that was obtained based on the Kapagado values calculated for the dissociation curves in the range of 32-34 sec. The values of Kd and kapagado represent the average of two concentrations.

FIG. 17. REAL TIME SENSOGRAM OF FUSION PROTEINS JOINT FcyRIIB-Fc A ANTIBODIES CARRYING THE REGIONS OF Fc VARIANT The binding of Fc? RIIB-Fc fusion proteins to antibodies 4-4-20 CH carrying the proteins was analyzed. Fc regions variant at a concentration of 200 nM. The responses were normalized to the antibody level 4-4-20 CH obtained for the wild type.

FIGS. 18 A-C. ANALYSIS OF KINETIC PARAMETERS OF FUSION PROTEINS OF Fc? RID3-Fc A ANTIBODIES THAT CARRY THE REGIONS OF Fc VARIANT Kinetic parameters were obtained for the binding of Fc? RIIB-Fc to antibodies that carry the variant Fc regions generating better curves Separate setting for 200 nM and 800 n. The solid line indicates an association adjustment that was obtained based on the dp gao values calculated for the dissociation curves in the range 32-34 sec. The values of IQ and Kapagaci represent the average of two concentrations. The mutants used are the following: Mut 6 (S219V); Mut 10 (P396L, A330S, K288N); Mut 18 (K326E); Mut 14 (K334E, K288N); Mut 11 (R255L, F243L); Mut 16 (F372Y); Mut 19 (K334N, K246I).

FIG. 19. Relationships of I ^ do (PESO) / Kapagado (MUT) FOR Fc? RIIIA-Fc GRAPHICS AGAINST CCDA DATA Numbers greater than one show a decreased dissociation rate for the binding of Fc? RIIIA and the increased dissociation rate for the binding of Fc? RIIB-Fc in wild type relation. The mutants in the cell have a lower shut off speed for the binding of Fc? RIIIA and a higher shutdown rate for the binding of Fc? RIIB-Fc.

FIG. 20. COMPETENCE WITH NON-MARCHED FcyRIIA A kinetic screen was implemented to identify mutants from the Fc region with Kapagado velocities to bind to Fc? RIIIA. A bank of the variants of the Fc region containing the P396L mutation was incubated with 0.1 μM of biotinylated FcγRIIIA-Ligatin-Abitag for one hour and then washed. Subsequently, 0.8 uM of unlabeled Fc? RIIIA was incubated with the labeled yeast for different time points. The yeast was centrifuged and the unlabeled Fc? RIIIA was removed. The bound yeast receptor was added with EA (streptavidin): FE (phycoerythrin) for analysis of SCAF.

FIGS. 21 A-C SCAF ANALYSIS WITH SCREEN BASE KINETICS Based on the Kapagada of the data presented in Fig. 20, a point of selection of time in minutes was chosen. A 10-fold excess of the bank was incubated with 0.1 μM biotinylated FcγRIIIA-biotinylated Abitag interlacer; the cells were washed and incubated with unlabeled ligand for one minute, then washed and labeled with EA: PE. The cells were then classified for SCAF, selecting 0.3% higher binders. The unselected P396L bank was compared with the selected yeast cells for improved union by SCAF. The histogram shows the percentage of cells containing both goat anti-human Fc? RIIIA / FE and Fc / ITCF.

FIGS. 22 A-B. SELECTION BASED ON SUPPRESSION OF SOLID PHASE OF AGCUTINANTS OF Fc? RIIB-Fc a. The P396L bank was screened based on the deletion of Fc? RIIB and the selection of Fc? RIIIA using magnetic beads. The suppression of Fc? RIIB by magnetic beads was repeated 5 times. The resulting yeast population was analyzed and found to show more than 505 cell staining with goat anti-human Fc and a very small percentage of cells stained with Fc? RIIIA. Subsequently, cells were screened twice by SCAF using avitag, biotinylated FcγRIIIA linker. Yeast cells were analyzed for both the binding of Fc? RIIIA and Fc? RIIB after each sorting and compared with the wild-type binding. B. Fc mutants from the yeast population without Fc? RIIB were selected using avit linker 158F monomer Fc? RIIIA as a ligand. The sorting gateway was configured to select up to 0.25% of the 150F binders of Fc? RIIIA. The resulting enriched population was analyzed by SCAF to bind to different Fc? RIIIA (158F and 158V), Fc? RIIIB and Fc? RIIA (131R).

Fig. 24. RELATIVE SPEEDS OF CELLULAR LYSIS TARGETED TO WHITE SKBR3 MEDIATED BY 4D5 CHEMERIC CONTAINING Fc MUTANTS The relative lysis rates were calculated for each Fc mutant tested. The lysis rates for the 4D5 antibody with Fc mutants were divided by the lysis rate mediated by wild-type 4D5 antibody. Data from at least two independent analyzes were averaged and plotted on the histogram. For each Fc mutant, data from two different concentrations of antibodies are shown. Antibody concentrations were chosen to flank the point along the curve where the lysis was ~ 50%.

FIG. 25. SCHEME FOR BANK PRODUCTION. The strands of DNA were represented. The forward arrows represent primers that contain mutant codons. The reverse arrow represents the oligo-specific inverse gene.

FIG. 26. STRATEGY FOR THE PRODUCTION OF BANKS THROUGH THE CONSTRUCTION OF A GEN PROTOCOL. The rectangular boxes represent the axis domains, CH2 and CH3, respectively. The short black lines represent the double-stranded oligos with 5 'pendants.

FIG. 27. MUTANTS OF Fc NOVEDOSAS THAT IMPROVE CCDA MEDIATED BY PBMC IN SKBR3 CELLS. The graph shows linear regression analysis of a normal CCDA analysis. The antibody was titered in three logs using an effector: blank ratio of 75: 1. % lysis = (experimental release-SR) (MR-SR) YOO.

FIG. 28. Fc NOVEDOSE MUTANTS THAT IMPROVE CCDA MEDIATED BY PBMC IN DAUDI CELLS. The graph shows linear regression analysis of a normal CCDA analysis. The antibody was titered in three logs using an effector: blank ratio of 75: 1. % lysis = (experimental release-SR) (MR-SR) YOO.

FIG. 29. RECEIVER PROFILES OF Fc VIA SCAF AL TREATING MONOCYTES WITH CYTOKIN Monocyte cytokine treatment increases the low affinity of the receptor expression of Fc. The monocytes washed by decantation were cultured using specific cytokines in serum free media. Fc receptor profiles were analyzed using SCAF.

FIG. 30 DEATH OF IMPROVED TUMOR CELLS USING FC MUTANTS IN MONOCYTES DERIVED FROM MACROPHAGES BASED ON CCDA. The concentration of Ch4D5 Mab in two registers was tested using the effector: target ratio of 35: 1. The percentage of lysis was calculated as in Fig. 28.

FIG. 31 FLOW GRAPH OF THE ANALYSIS OF COMPLEMENT DEPENDENT CITOTOXICITY The flow chart summarizes the CDC analysis used FIG. 32 COMPLEMENTARY DEPENDENT CITOTOXICITY ACTIVITY Fc mutants that show enhanced binding to Fc? RIIIA also showed enhanced complement activity. It was titled Anti-CD20 ChMAb in 3 orders of magnitude. The percentage of lysis was calculated as in Fig. 28.

FIG. 33. DECISION TREE FOR SELECTION OF Fc MUTANTS An illustrative protocol for selecting Fc mutants.

FIG. 34. Clq UNION ANTIBODY 2B6 A. The diagram describes the BIAcore format for the 2B6 analysis by joining the first component of the complement cascade. B. The real-time binding sensorimage of antibody 2B6 carrying the variant Fc regions to Clq.

FIGS. 35 A-D. UNION OF Clq A MUTANT ANTIBODY 2B6. Sensogram of real-time binding of mutants of 2B6 to Clq (3.25 nM). Mutants described in MgFc51 (Q419H, P396L); MgFc51 / 60 in Panel A; MgFc55 and MgFc55 / 60 (Panel B), MgFc59 and MgFc59 / 60 (Panel C); and MgFc31 / 60 (panel D).

FIGS. 36 A-D. Fc VARIANTS WITH DECREASED UNION A FcyRIIB FcR binding to ch4D5 antibodies to compare the effect of D270E (60) on the double mutant R255L, P396L (MgF55). The KD was analyzed at different concentrations of FcR, 400nM CD16A 158V; 800 nM CD16A 158F; 200 nM CD32B; 200 nM CD32A 131H. The analysis was carried out using separate KD using the Biacore 3000 software.

FIG. 37 A-C. KINETIC CHARACTERISTICS OF MUTANTS 4D5 SELECTED FROM Fc? RIIB SUPPRESSIONS / Fc? RIIAHl31 SELECTION The binding of FcR to ch4D5 antibodies carrying different Fc mutations selected by suppression of CD32B and screening strategy for CD32A H131. The KD was analyzed at different concentrations of FcR, 400 nM CD16A 158V; 800 nM CD16A 158F; 200 nM CD32B; 200 nM CD32A 13 IH. An analysis was performed using separate KD using Biacore 3000 software.

FIG. 38. DATA GRAPH OF CCDA MDM AGAINST THE Kapagado DETERMINED FOR THE UNION OF CD32A 131H DETERMINED BY BIACORE The mutants are the following: MgFc25 (E333 A, K334A, S298A); MgFc68 (D270E); MgFc38 (K392T, P396L); MgFc55 (R255L, P396L); MgFc31 (P247L, N421K); MgFc59 (K370E, P396L). 5. DESCRIPTION OF THE PREFERRED MODALITIES The present invention relates to molecules, preferably polypeptides and more preferably immunoglobulins (e.g., antibodies), comprising a variant Fc region, which has one or more amino acid modifications (e.g., substitutions, but also including insertions or deletions). In one or more regions, said modifications alter, e.g., increase or decrease the affinity of the variant Fc region for an Fc? R. In some embodiments, the invention provides molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region is linked to Fc ? RIIIA with a higher affinity, relative to a comparable molecule, ie, which is the same as the molecule with a variant Fc region but does not have one or more amino acid modifications, the wild type Fc region comprising as determined by methods known to one skilled in the art for determining the interactions of Fc-FcγR and methods described herein, for example, an ELISA analysis or a surface plasmotype resonance analysis. In still other embodiments, the invention encompasses molecules comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region is linked to Fc? RIIIA with a reduced affinity in relation to a comparable molecule comprising the wild-type Fc region. In a preferred embodiment, the molecules of the invention specifically bind to Fc? RIIB (via the Fc region) with a lower affinity with that a comparable molecule comprising the wild-type Fc region binds to Fc? RIIB. In some embodiments, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild type Fc region, said variant Fc region is linked to Fc ? RIIIA and Fc? RIIB with a higher affinity, relative to a comparable molecule comprising the wild-type Fc region. In other embodiments, the invention encompasses molecules comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild type Fc region, said variant Fc region is linked to Fc ? RIIB with a higher affinity, relative to a comparable molecule comprising the wild-type Fc region. In other embodiments, the invention encompasses molecules comprising the variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region is linked to Fc ? RIIB with reduced affinity, relative to a comparable molecule comprising the wild-type Fc region. In some embodiments, the invention encompasses molecules comprising a variant Fc region wherein said variant Fc region comprises at least one ! amino acid modification in relation to a wild-type Fc region, said variant Fc region does not show a detectable binding to any FcγR (e.g., does not bind to FcγRIIA, FcγRIIB, or FcγRIIIIA , as determined by, for example, an ELISA analysis), in relation to a comparable molecule comprising the wild-type Fc region. In a specific embodiment, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region only attaches to an Fc? R, where said Fc? R is Fc? lIIA. In another specific embodiment, the invention encompasses molecules that comprise a vanishing Fc region, wherein said variant Fc region only binds to an Fc? R, wherein said Fc? R is Fc? RIIA. In yet another embodiment, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said variant Fc region only attaches to an Fc? R, where said Fc? R is Fc? RIIB. The invention particularly relates to the modification of human or humanized therapeutic antibodies (e.g., monoclonal anti-angiogenic or anti-inflammatory antibodies specific to a tumor) to improve the efficacy of therapeutic antibodies improving, for example, the effector function of therapeutic antibodies, e.g., improving CCDA. The affinities and binding properties of the molecules of the invention for an Fc? R are determined micially using m vitro analysis (analysis with biochemical or immunological basis) known in the art to determine Fc-Fc? R interactions, that is, binding specific for a region of Fc to an Fc? R including, but not limited to ELISA analysis, surface plasmotype resonance analysis, immunoprecipitation analysis (Refer to Section 5.2.1). Preferably, the binding properties of the molecules of the invention are also characterized by in vitro functional analysis to determine one or more functions of effector mediating cells of FcγR (Refer to Section 5.2.6.). In the most preferred embodiments, the molecules of the invention have similar binding properties in vivo models (such as those described above and described herein) as those in vitro-based analyzes. However, the present invention does not exclude molecules of the invention that do not expose the desired phenotype in analyzes with a base in vitro but expose the desired phenotype m alive. In some embodiments, the molecules of the invention comprising a variant Fc region comprise at least one amino acid modification in the CH3 of the Fc region, which is defined as extending from amino acids 342-447. In other embodiments, the molecules of the invention comprising a variant Fc region comprise at least one amino acid modification in the CH2 domain of the Fc region, which is defined as the extension of amino acids 231-341. In some embodiments, the molecules of the invention comprise at least two amino acid modifications, wherein one modification is in the CH3 region and one modification is in the CH2 region. The invention also encompasses at least two amino acid modifications, wherein one modification is in the CH3 region and one modification is in the CH2 region. The invention also encompasses an amino acid modification in the axis region. The molecules of the invention with one or more amino acid modifications in the CH2 and / or CH3 domains have altered affinities for an FcγR as determined using methods described herein or known to one skilled in the art. In a particular embodiment, the invention encompasses modification of amino acids in the CHI domain of the Fc region. In particularly preferred embodiments, the invention encompasses molecules comprising a variant Fc region wherein the variant has an increased binding to FcγRIIA (CD32A) and / or increased CCDA activity, measured using methods known to someone skilled in the art and exemplified herein. The CCDA assays used according to the methods of the invention can be AN-dependent or macro-dependent. The Fc variants of the present invention can be combined with other known Fc modifications including, but not limited to, modifications that alter effector function and modification that alters the binding affinity of FcγR. In a particular embodiment, an Fc variant of the invention comprising a first modification of amino acids in the CH3 domain, CH2 domain or the Fc region can be combined with a second modification of Fc so that the second Fc modification does not it is in the same domain as in the first one so that the first modification of Fc confers an additive, synergistic or novel property in the second modification of Fc. In some embodiments, the Fc variants of the invention have no amino acid modification in the CH2 domain. The Fc variants of the present invention can be combined with any of the Fc modifications known in the art such as those described in the following Table 2.

TABLE 2 Replacement (es) V264A V264 L V264 I F241W F24 1L F243W F243L F241L / F2 3L / V262I / V264I F241W / F243W / F243W / V262A / V264A F241L / V262I F243L / V264I F243L / V262I / V264W F241Y / F243 Y / V262T / V244E F241E / F243R / V262E / V264R F241E / F243Q / V262T / V264E F241R / F243Q / V262T / V264R F2 1E / F243Y / V262T / V264R L328M L328E L328F I332E L328M / I332E P244H P245A P247V W313F P244H / P245A / P247V P247G V264I / I332E F241E / F243R / V262E / V264R / I332E F241E / F243Q / V262T / V264E / I332E F241R / F243Q / V262T / V264R / I332E F241E / F243Y / V262T / V264R / I332E S298A S298A / I332E S298A / E333A / K334A S239E / I332E S239Q / I332E S239E D265G D265N S239E / D265G S239E / D265N S239E / D265Q Y296E Y296Q Y296Q Y296Q S298T A297S N297S N297S N297S / I332E N297D / I332E N297E / I332E N297E / I332E D265Y / N297D / I332E D265Y / N29 D / T299L / I332E D265F / N297E / I332E L328I / I332E L328Q / I332E I332N I332Q V264T V264F V240I V263I V266I T299A T299S T299V N325Q N325L N325I S239D S239N S239F S239D / I332D S239D / I332E S239D / I332N S239D / I332Q S239E / I332D S239E / I332N S239E / I332Q S239E / I332Q S239N / I332D S239N / I332E S239N / I332Q S239N / I332Q S239Q / I332D S239Q / I332Q K326E Y296D Y296N F241Y / F243Y / V262T / V264T / N297D / I332E A330Y / I332E V264I / A330Y / I332E A330L / I332E V264I / A330L / I332E L234D L234E L234N L234Q L234T L234H L234Y L234 L234 L235 L235 L235 L235 L235 L235 L235 L235 L235 L235 L235 L235 L235 L233 S239 L233 L233 L235 L235 L235 L V240 V263 V263 V263 V263 N325T N325V N325H L328D / I332E L328E / I332E L328N / I332E L328Q / I332E L328V / I332E L328T / I332E L328H / I332E L328I / I322E I332A L328A I332T I332H I332Y S239E / V264I / I332E S239Q / V264I / I332E S239E / V26AI / A330Y / I332E S239E / V264I / S298A / A330Y / I332E S239D / N297D / I332E S239E / N297D / I332E S239D / D265V / N297D / I332E S239D / D265I / N297D / I332E S239D / D265L / N297D / I332E S239D / D265F / N297D / I332E S239D / D265Y / N297D / I332E S239D / D265H / N297D / I332E S239D / D265T / N297D / I332E Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296D / Y296T / N297D / I332E N297D / T299V / I332E N297D / T299I / I332E N297D / T299L / I332E N297D / T299F / I332E N297D / T299H / I332E N297D / T299E / I332E N297D / T299Y / I332E N297D / S298A / A330Y / I332E S239D / A330Y / I332E S239N / A330Y / I332E S239D / A330L / I332E S239D / A330L / I332E V264I / S298A / I332E S239D / S298A / I332E S239N / S298A / I332E / I332E S239D / V264I / I332E S239D / V264I / S298A / I332E S239D / V26 I / A330L / I332E T256A K290A D312A * K326A S298A E333A K334A E430A T359A K360A E430A K320M K326S K326N K326D K334Q K334Q K334E K334M K334H K334V K334V A330K T335K A339A E333A, K334A T256A, S298A T256A, D280A, S298A, T307A S298A, E333A, K334A, S298A, K334A S298A, E333A T256A K290A K326A R255A E258A S267A E272A N276A D280A E283A H285A N286A P331A S337A H268A E272A E430A A330K R301M H268N H268S E272Q N286Q N286S N286D K290S K320M K320Q K320E K320R K322E K326S K326D K326E A330K T335E S267A, E258A S267A, R255A S267A, D280A S267A, E272A S267A, E293A S267A, E258A, D280A, R255A P238A D265A E269A D270A N297A P329A A327Q S239A E294A Q295A V303A K2 6A H433A N434A H435A Y436A T437A Q438A K439A S440A S442A S444A K447A K246M K248M Y300F A330Q K338M K340M A378Q Y391F In other embodiments the Fc variants of the present invention can be combined with any of the modifications known in the art such as those written in the following tables 3A and B: TABLE 3A TABLE 3B Variant Position Position Position Position Position 334 333 324 286 276 Start Y300I '' K334A, K334R, K334Q, E33A, E333Q, S324A, 286Q, N276Q, K334N, K334S, K334E, E333N, E333S, S324N, N2865, N276A, or K334D, K334M, K334Y, E333K, E333R, S324Q, N286A , or N276K. K334W, K334H, K334V, E333D, or S3 4K, or N286D. or K334 L E333G. S324E Y300L 'K334A, K334R, K334Q, E33A, E333Q, S324A, N286Q, N276Q, K334N, K334S, K33E, E333N, E333S, N286S, N276A, or K334D, K334M, K334Y, E333K, E333R, S324Q, 286A, or N276K. K334W, K334H, K334V, E333D, or S324K, or N 86D. or K334 L E333G. S324E S298N "'K334A, K334R, K334Q, E33A, E333Q, S324A, N286Q, N276Q, K334N, K334S, K334E, E333N, E333S, S324N, N286S, N276A, or K334D, K334M, K334Y, E333K, E333R, S324Q, N286A , or N276K, K334, K334H, K334V, E333D, or S324K, or N286D, or K334 L E333G, S324E S298V 'K334A, K334R, K334Q, E33A, E333Q, S324A, N286Q, N276Q, K334N, K334S, K334E, E333N, E333S, S324N, N286S, N276A, or K334D, K334M, K334Y, E333K, E333R, S324Q, N286A, or N276K, K334, K334H, K334V, E333D, or S324K, or N286D, or K334 L E333G, S324E S298D'1 ' K334A, K334R, K334Q, E33A, E333Q, S324A, N286Q, N276Q, K334N, K334S, K334E, E333N, E333S, S324N, N286S, N276A, or K334D, K334M, K334Y, E333K, E333R, S324Q, N286A, or N276K. K334, K334H, K334V, F.333D, or S324K, or N286D, or K334 L S324E S298P 'K334A, K334R, K334Q, E33A, E333Q, S324A, N286Q, N276Q, K334N, K334, K334E, E333N, E333S, S324N, 286S, N276A, or K334D, K334M, K334Y, E333K, E333R, S324Q, N286A, or N276K, K334W, K334H, K334V, E333D, or S3 4K, or N 86D or K334 L E333G.S324E Y296P K334A, K334R, K334Q, E33A, E333Q, S324A, N286Q, N276Q, K334N, K334S, K334E, E333N, E333S, S324N, 286S, N276A, or K334D, K334M, K334Y, E333K, E333R, S324Q, N286A , or N276K. K334W, K334H, K334V, E333D, or S324K, OR N286D. or K334 L E333G. S324E Variant Position Position Position Position 334 333 324 286 276 Item Q295L + ~ * K334A, K334R, K334Q, E33A, E333Q, S324A, N286Q, N276Q, K334N, K334S, K334E, L333N, L333S, G3¿4N, N286S, N276A, or K334D, R334M, K334Y, E333K, E333R, S324Q , N286A, or N276K. K334, K334H, K334V, E333D, or S324K, or N286D. or K334T F333G. S324F E294n + "K334A, K334R, K334Q, E33A, E333Q, B324A, N286Q, K334N, K334S, K334E, L333N, H333S, 33N4, N2 6, K334D, K334M, R334Y, E3" n?, E333R, 5324Q, N286A , or K334W, K334H, K334V, E333D, or S324K, or N286D. or K334T E333G. S-S2 F ** Note that the table uses EU numbering as in Kabat In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said molecule has a altered affinity for an Fc? R, as long as the variant Fc region does not have a substitution at positions that make direct contact with FqR based on crystallographic and structural analysis of Fc-Fc? R interactions such as those described by Sondermann et al., 2000 (Nature, 406: 267-273 which is incorporated herein by reference in its entirety). Examples of positions within the Fc region that make direct contact with Fc? R are amino acids 234-239 (axis region), amino acids 265-269 (B / C loop), amino acids 297-299 (C 'loop / E) and amino acids 327-332 (F / G loop). In some embodiments, the molecules of the invention comprising regions of variant Fc comprise modification of at least one residue that makes direct contact with an Fc? R based on structural and crystallographic analysis. The interaction domain of Fc? R maps the lower axis region and selects sites within the CH2 and CH3 domains of the IgG heavy chain. The amino acid residues that flank the actual contact positions and the amino acid residues in the CH3 domain play a role in the IgG / Fc? R interactions as indicated by mutagenesis studies and studies using small peptide inhibitors, respectively (Sondermann et al., 2000 Nature, 406: 267-273, Diesenhofer et al., 1981, Biochemistry, 20: 2361-2370, Shields et al., 2001, J. Biol. Chem. 276: 6591-6604; which is incorporated herein by reference in its entirety). The direct contact as used herein, refers to those amino acids that are within at least IA, at least 2, or at least 3 angstroms to each other or within a radius of Van Der Waals 1 A, 1.2 A, 1.5 A, 1.7 A or 2 A. An illustrative list of sites previously identified in the Fc that effect the binding of Fc interaction proteins are listed in the following Table 4. In some embodiments, the invention encompasses Fc variants that they do not have any modification in the sites listed below. In other embodiments, the invention encompasses Fc variants comprising amino acid modifications in one or more sites listed below in combination with other modifications described herein so that said modification has a smergistic or additive effect on the property of the mutant.

TABLE 4. SITES PREVIOUSLY IDENTIFIED IN THE Fc THAT MAKES THE UNION OF PROTEINS THAT INTERACT WITH FAC Table 4 lists sites within the Fc region that have been previously identified as being important for the interaction of Fc-FcR. The columns marked as FcR-Fc identify the Fc chain contacted by the FcR. The letters identify the reference in which the cited data was cited. C is Shields et al., 2001, J. Biol. Chem. 276: 6591-6604; D is Jefferis et al., 1995, Immunol. Lett. 44: 111-7; E is Hmton et al. 2004, J. Biol. Chem, 279 (8): 6123-6; F is Idusogie et al., 2000, J. Immunol. 164: 4178-4184; each of which is incorporated herein by reference in its entirety. In another preferred embodiment, the invention encompasses a molecule comprising a variant Fc region, in 1 wherein said variant Fc region comprises at least one amino acid modification relative to a wild type Fc region, such that said molecule binds to an RcyR with an altered affinity in relation to a molecule comprising an Fc region wild type, as long as said variant Fc region does not have or is not only a substitution in any of positions 255, 256, 258, 267, 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 300, 301, 303, 305, 307, 309, 312, 320, 322, 326, 329, 330, 332, 331, 333, 334, 335, 337, 338, 339, 340, 359, 360, 373, 376, 416, 419, 430, 434, 435, 437, 438, 439. In a specific embodiment, the invention encompasses a molecule comprising an Fc region. variant, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said molecule binds to an FcγR with a altered affinity in relation to a molecule comprising a wild-type Fc region, as long as said variant Fc region does not have or is not only a substitution in any of positions 255, 258, 267, 269, 270, 276, 278 , 280, 283, 285, 289, 292, 293, 294, 295, 296, 300, 303, 305, 307, 309, 322, 329, 332, 331, 337, 338, 340, 373, 376, 416, 419 , 434, 435, 437, 438, 439 and does not have an alanine in any of positions 256, 290, 298, 312, 333, 334, 359, 360, 326, or 430; a lisma in position 330; a threonine at position 339; a methionine at position 320; a serma at position 326; an asparagine at position 326; an aspartic acid at position 326; a glutamic acid at position 326; a glutamine at position 334; a glutamic acid at position 334; a methionine at position 334; a stidine at position 334; a valine at position 334; or a leucine at position 334; a lysine at position 335; an asparagine at position 268; a glutamine at position 272; a glutamine, serine or aspartic acid at position 286; a sepna at position 290; a methionine, glutamine, glutamic acid or arginine at position 320; a glutamic acid at position 322; a serine, glutamic acid or aspartic acid at position 326; a lysine at position 330; a glutamine at position 335; or a methionine at position 301. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region wherein said variant Fc region does not have or is not solely a substitution in any of positions 268, 269, 270 , 272, 276, 278, 283, 285, 286, 289, 292, 293, 301, 303, 305, 307, 309, 331, 333, 334, 335, 337, 338, 340, 360, 373, 376, 416 , 430, 434, 435, 437, 438 or 439 and does not have a histidine, glutamine or tyrosine at position 280; a serine, glycine, threonine or tyrosine at position 290, a leukemia or isoleucine in position 300; an asparagine at position 294, a proline at position 296; a proline, asparagine, aspartic acid or valine at position 298; a lysine at position 295. In yet another preferred embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild type Fc region. , such that said molecule binds to an FcγR with a reduced affinity in relation to a molecule comprising a wild-type Fc region provided that said variant Fc region does not have or is not only a substitution in some the positions 252, 254, 265, 268, 269, 270, 278, 289, 292, 293, 294, 295, 296, 298, 300, 301, 303, 322, 324, 327, 329, 333, 335, 338, 340, 373, 376, 382, 388, 389, 414, 416, 419, 434, 435, 437, 438, or 439. In yet another preferred embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification in relation to an Fc ti region wild type, such that said molecule binds to an FcγR with an increased affinity in relation to a molecule comprising a wild-type Fc region provided that the showering region of variant Fc does not have or is not only a substitution in some of the positions 280, 283, 285, 286, 290, 294, 295, 298, 300, 301, 305, 307, 309, 312, 315, 331, 333, 334, 337, 340, 360, 378, 398, or 430. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein the variant Fc region does not include or is not only a substitution in any of positions 330, 243, 247, 298, 241, 240, 244 , 263, 262, 235, 269, or 328 and does not have a leucine in position 243, an asparagine in position 298, a leucine in position 241, and isoleucine or an alanine in position 240, a histidine in position 244, a valine at position 330, or an isoleucine at position 328. In more preferred embodiments, the molecules of the invention with altered affinities for activation receptors and / or inhibitors having variant Fc regions, have one or more modifications of amino acids, wherein one or more amino acid modifications is a substitution at position 288 with asparagine, in the position 330 with senna and in position 396 with leucine (MgFc 10) (Refer to Table 5); or a substitution at position 334 with glutamic acid, at position 359 with asparagm and at position 366 with sepna (MgFcl3); or a substitution at position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid (MgFc27); or a substitution at position 392 with threonine, and in the position 396 with leucine (MgFc38); or a substitution at position 221 with glutamic acid, at position 270 with glutamic acid, at position 308 with alanine, at position 311 with histidine, at position 396 with leucma and at position 402 with aspartic acid (MgFc42); or a substitution at position 410 with histidine, and at position 396 with leucma (MgFc53); or a substitution at position 243 with leucine, at position 305 with ísoleucma, at position 378 with aspartic acid, at position 404 with serine, and at position 396 with leucine (gFc54); or a substitution in position 255 with ísoleucma and in position 396 with leucine (MgFc55); or a substitution at position 370 with glutamic acid and at position 396 with leucine (MgFc59). In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region wherein the variant Fc region comprises a substitution at position 396 with leucine, at position 270 with glutamic acid and at position 243 with leucine. In another specific embodiment, the molecule further comprises one or more modifications with amino acids such as those described herein. In some embodiments, the invention encompasses molecules comprising a variant Fc region having an amino acid modification in one or more of the following positions: 185, 142, 192, 141, 132, 149, 133, 125, 162, 147, 119 166, 251, 292 290, 291, 252, 288 268, 256, 262, 218, 214 205, 215, 247 275, 202, 289, 258 219, 279, 222, 246, 233, 246, 268, 244 217, 253, 246, 224 298, 280, 255, 218, 281, 284, 216, 223 235, 221, 252, 241 258, 227, 231, 215, 274 r 287, 244, 229 287, 291, 240, 281 232, 269, 225, 246, 246 r 293, 295, 248, 276, 268, 210, 288 227, 217, 261, 210, 241 255, 240, 250 247, 258, 246, 282 219, 225, 270, 263, 272, 292, 233, 247 254, 243, 347, 339 392, 399, 301, 315, 383 r 396, 385, 348 333, 334, 310, 337 371, 359, 366, 359, 379, 330, 318, 395 319, 380, 305, 309 335. 370, 378, 394, 386 r 377, 358, 384 397, 372, 326, 320 375, 327, 381, 354, 385, 335, 387, 353 375, 383, 397, 345 375, 389, 335, 394, 316, 339, 315, 394 382, 390, 369, 377 304, 323, 313, 388, 339, 317, 365, 367 340, 311, 312, 398 343, 352, 362, 303, 308, 327, 307, 344 328, 393, 355, 360 306, 361, 355, 415, 408 409, 407, 424 443, 414, 433, 421 446, 402, 419, 410, 404 427, 417, 433, 436 438, 416. Preferably, said mutations result in molecules having an altered affinity for an FcγR and / or have an altered effector cell-mediated function as determined using methods described and exemplified in the present and known by someone expert in the field. The invention encompasses molecules comprising variant Fc regions consisting of, or comprising any of the mutations listed in the following Table 5. TABLE 5 ILLUSTRATIVE MUTATIONS In still other embodiments, the invention encompasses molecules comprising regions of variant Fc having more than two amino acid modifications. A non-limiting example of such variants is listed in the following table (Table 6). The invention encompasses mutations listed in Table 6 which further comprises one or more amino acid modifications such as those described herein.

Table 6. Illustrative Combination Variants In some embodiments, the molecules, preferably the immunoglobulins of the invention further comprise one or more glycosylation sites, such that one or more carbohydrate moieties are covalently attached to the molecule. Preferably, the antibodies of the invention with one or more glycosylation sites and / or one or more modifications in the Fc region have an improved function of the antibody-mediated effector, e.g., enhanced CCDA activity. In some embodiments, the invention further comprises antibodies comprising one or more amino acid modifications that are directly or indirectly known to interact with a portion of antibody carbohydrates, including, but not limited to, amino acids at positions 241, 243, 244, 245 , 249, 256, 2158, 260, 262, 264, 265, 296, 299, and 301. Amino acids that directly or indirectly interact with a carbohydrate moiety of an antibody are known in the art, see, for example, Jefferis and others, 1995, Immunology Letters, 44: 111-7, which is incorporated herein by reference in its entirety. The invention encompasses antibodies that have been modified by introducing one or more glycosylation sites at one or more sites of the antibodies, preferably without altering the functionality of the antibody, e.g., FcγR binding activity. The glycosylation sites can be enter in the variable and / or constant region of the present invention. As used herein, "glycosylation sites" include any specific amino acid sequence in an antibody to which an oligosaccharide will specifically and covalently bind (ie, carbohydrates containing two or more simple sugars bound together). The oligosaccharide side chains are usually linked to the base-wing structure of an antibody via either of the N or 0 ligatures. O-linked glycosylation refers to the attachment of an oligosacchado portion with a hydroxyamino acid, v.gr ., serine, threonma. The antibodies of the invention may comprise one or more glycosylation sites, including N-linked and O-linked glycosylation sites. Any glycosylation site for N-linked or O-linked glycosylation known in the art may be used in accordance with the present invention. An illustrative N-linked glycosylation site that is useful according to the methods of the present invention is the amino acid sequence: Asn-X-Thr / Ser, where X can be any amino acid and Thr / Ser indicates a treomna or a sepna. Said site or sites can be introduced into an antibody of the invention using methods well known in the art to which this invention pertains. See, for example, "In Vitro Mutagenesis", Recombinant DNA: A Short Course, J.D. Watson, and others, W.H. Freeman and Company, New York, 1983, chapter 8 p. 106-116, which is incorporated herein by reference in its entirety. An illustrative method for introducing a glycosylation site into an antibody of the invention may comprise: modifying or mutating an amino acid sequence of the antibody so that the desired sequence of Asn-X-Thr / Ser is obtained. In some embodiments, the invention encompasses methods for modifying the carbohydrate content of an antibody of the invention by adding or removing a glycosylation site. Methods for modifying the carbohydrate content of antibodies are well known in the art and are encompassed within the invention, see, for example, U.S. Pat. No. 6,218,149; EP 0 359 096 Bl; U.S.A. Publication No. US 2002/0028486; WO 03/035835; Publication of E.U.A. No. 2003/115614; Patent of E.U.A. No. 6,218,149; Patent of E.U.A. No. 6,472,511; all of which are incorporated herein by reference in their entirety. In other embodiments, the invention encompasses methods for modifying the carbohydrate content of an antibody of the invention by suppressing one or more portions of endogenous carbohydrates of the antibody. In a specific embodiment, the invention encompasses the change of the glycosylation site of the Fc region of an antibody, modifying positions adjacent to 297. In a specific embodiment, the invention encompasses modifying the position 296 so that position 296 is glycosylated and not position 297. 5. 1 POLYPEPTIDES AND ANTIBODIES WITH VARIANT Fc REGIONS The present invention is based, in part, on the identification of mutant human IgGl heavy chain Fc regions, with altered affinities for different FcγR receptors, using an exposure system of yeast. Accordingly, the invention relates to molecules, preferably polypeptides and more preferably immunoglobulins (e.g., antibodies), which comprise a variant Fc region, which has one or more amino acid modifications (e.g., substitutions, but also including insertions or deletions) in one or more regions, said modifications alter the affinity of the variant Fc region for an Fc? R. It will be appreciated by one skilled in the art that in addition to amino acid substitutions, the present invention contemplates further modifications of the amino acid sequence of the Fc region in order to generate a variant of the Fc region with one or more altered properties , e.g., altered effector function. The invention contemplates the deletion of one or more amino acid residues from the Fc region in order to reduce binding to an FcγR.

Preferably, no more than 5, no more than 10, no more than 20, no more than 30, no more than 50, residues of the Fc region will be deleted according to this embodiment of the invention. The present Fc region comprising one or more amino acid deletions will preferably retain at least about 80%, and preferably at least about 90% and even more preferably at least about 95%, of the Fc region wild type. In some embodiments, one or more properties of the molecules are maintained as such, for example, without immunogenicity, binding of FcγRIIIA, binding of FcγRIIA, or a combination of these properties. In alternative embodiments, the invention encompasses amino acid insertion to generate variants of the Fc region, said variants having altered properties including altered effector function. In a specific embodiment, the invention encompasses introducing at least one amino acid residue, for example, one to two amino acid residues and preferably no more than 10 amino acid residues adjacent to one or more of the positions of the Fc region identified at the moment. In alternative embodiments, the invention further encompasses introducing at least one amino acid residue, for example, one or more amino acid residues and preferably no more than 10 amino acid residues adjacent to one or more of the amino acid residues. positions in the Fc region known in the art such as the impact on the interaction and / or binding of Fc? R. The invention also encompasses the incorporation of non-natural amino acids to generate the Fc variants of the invention. Such methods are known to those skilled in the art such as those using natural biosthetic machinery to allow the incorporation of non-natural amino acids into proteins, see, for example, Wang et al., 2002 Chem. Comm. 1: 1-11; Wang et al., 2001, Science, 292: 498-500; van Hest et al., 2001, Chem. Com. 19: 1897-1904, each of which is hereby incorporated by reference in its entirety. Alternative strategies focus on the enzymes responsible for the biosynthesis of ammo acyl-tRNA, see, for example, Tang et al., 2001, J. Am. Chem. 123 (44): 11089-11090; Knck et al., 2001, FEBS Lett 505 (3): 465; each of which is incorporated herein by reference in its entirety. The affinities and binding properties of the molecules of the invention for an FcγR are determined micially using m vitro analysis (analysis with biochemical or immunological basis) known in the art to determine the interactions of Fc-FcγR, ie, specific binding of a Fc region to an FcγR including, but not limited to, ELISA analysis, surface plasmotype resonance analysis, immunoprecipitation analysis (See Section 5.2.1). Preferably, the binding properties of the molecules of the invention are also characterized by the functional analysis m vitro to determine one or more functions of effector cells mediating FcγR (See Section 5.2.6). In the most preferred embodiments, the molecules of the invention have similar binding properties in in vivo models (such as those described above and herein) as those analyzes based on n vitro. However, the present invention does not exclude molecules of the invention that do not exhibit the desired phenotype in vitro-based analysis but do not exhibit the desired phenotype in vivo. A representative flow chart for the screening and characterization of molecules of the invention is described in Fig. 33. The invention encompasses molecules comprising a variant Fc region that binds with a higher affinity to one or more Fc? Rs. In this way, the molecules preferably mediate the effector function more effectively as discussed above. In other embodiments, the invention encompasses molecules comprising a variant Fc region that binds with a weaker affinity to one or more FcγRs. The reduction or elimination of effector function is convenient in certain cases, for example, in the case of antibodies whose mechanism of action involves blocking or antagonizing but not killing cells containing a target antigen. The reduction or Elimination of effector function could be desirable in cases of autoimmune disease where Fc [reg] R activation receptors could be blocked in effector cells (this type of function could be present in host cells). In general, increased effector function could target tumor and foreign cells. The Fc variants of the present invention can be combined with other Fc modifications, including, but not limited to, modifications that alter effector function. The invention encompasses combining an Fc variant of the invention with other modifications of Fc to provide additive, synergistic or novel properties in antibodies or Fc fusions. Preferably the Fc variants of the invention increase the phenotype of the modification with which they are combined. For example, if an Fc variant of the invention is combined with a mutant known to bind FcγRIIIA with a higher affinity than an Fc region of a comparable type, the combination with a mutant of the invention results in a greater increase in affinity of Fc? RIIIA at times. In one embodiment, the Fc variants of the present invention can be combined with other known Fc variants such as those described in Duncan et al., 1988, Nature 332: 563-564; Lund et al., 1991, J. Immunol 147: 2657-2662; Lund et al., 1992, Mol Immunol 29: 53-59; Alegre et al., 1994, Transplantation 57: 1537-1543; Hutchms et al., 1995, Proc Nati Acad Sci USA 92: 11980-11984; Jefferis et al., 1995, Immunol Lett. 44: 111-117; Lund et al., 1995, Faseb J 9: 115-119, Eur J Immunol 29: 2613-2624; Idusogie et al., 2000, J Immunol 164: 41784184; Reddy et al., 2000, J Immunol 164: 1925-1933; Xu et al., 2000, Cell Immunol 200: 16-26; Idusogie et al., 2001, J Immunol 166: 2571-2575; Shields et al., 2001, J Biol Chem 276: 6591-6604; Jefferis et al., 2002, Immunol Lett 82: 57-65; Presta et al., 2002, Biochem Soc Trans 30: 487-490); USA 5,624,821; US 5,885,573; US 6,194,551; PCT WO 00/42072; PCT WO 99/58572; each of which is incorporated herein in its entirety by reference. In some embodiments, the Fc variants of the present invention are incorporated into an Fc antibody or fusion comprising one or more engineered glycoforms, ie, a carbohydrate composition, ie, covalently linked to a molecule comprising a Fc region, wherein said carbohydrate composition differs chemically from that of a parent molecule comprising an Fc region. Engineered glycoforms can be useful for a variety of purposes, including, but not limited to, increasing or reducing effector function. Engineered glycoforms can be generated by any method known to someone skilled in the art, for example, using engineered strains or variant expression, by co-expressing with one or more enzymes, for example DI N-acetylglucosaminyltransferase III (GnTIll), expressing a molecule comprising an Fc region in vain organisms or cell lines of various organisms, or modifying carbohydrates after the molecule comprising the Fc region has been expressed. Methods for generating engineered glycoforms are known in the art, and include, but are not limited to, those described in Umana et al., 1999, Nat. Biotechnol 17: 176-180; Davies et al., 2001, Biotechnol Bioeng 74: 288-294; Shields et al., 2002, J Biol Chem 277: 26733-26740; Shinkawa et al., 2003, J Biol Chem 2778: 3466-3473; US 6,602,684; USSN 10 / 277,370; USSN 10 / 113,929; PCT WO 00/61739A1; PCT WO 01/292246 A1; PCT WO 02 / 311140A1; PCT WO 02 / 30954A1; Potillegent ™ technology (Biowa, Inc. Princeton, NJ); glycosylation engineering technology from GlycoMab ™ (Biotechnology from GLYCART AG, Zurich, Switzerland); each of which is incorporated herein by reference in its entirety. See, e.g., WO 00061739; EA01229125; USA 20030115614; Okasakn et al., 2004, JMB, 336: 1239-49 each of which is incorporated herein by reference in its entirety.

The Fc variants of the present invention can be optimized for a variety of properties. Properties that can be optimized include, but are not limited to, increasing or reducing the affinity for an increased or reduced effector function of Fc? R. In a preferred embodiment, the Fc variants of the present invention are optimized to have increased affinity for human activation FcγR, preferably FcγR, FcγRIIA, FcγRIIc, FcγRIIIA and FcγRIIIB, more preferably Fc? RIIIA. In an alternate preferred embodiment, the Fc variants are optimized to have reduced affinity for the human inhibitory receptor of Fc? RIIB. These preferred embodiments are anticipated to provide fusions of antibodies and Fc with improved therapeutic properties in humans, for example, improved effector function and greater anti-cancer potency as described and exemped herein. These preferred embodiments are anticipated to provide antibody and Fc fusions with improved tumor elimination in mice xenograft tumor models. In an alternative embodiment the Fc variants of the present invention are optimized to have reduced affinity for a human Fc? R, including but not limited to Fc? RI, Fc? RIIA, Fc? RIIB, Fc? RIIc, Fc? RIIIA, and Fc? RIIIB. These modalities are anticipated to provide antibody fusions and Fc with improved therapeutic properties in humans, for example, reduced effector function and reduced toxicity. In alternative embodiments the Fc variants of the present invention have increased or reduced affinity for FcγRs from non-human organisms, including but not limited to, mice, rats, rabbits and monkeys. Fc variants that are optimized by joining a non-human Fc? R may find use in experimentation. For example, mouse models are available for a variety of diseases that allow testing the properties such as efficacy, toxicity and pharmacokinetics for a candidate of a given drug. As is known in the art, cancer cells can be grafted or injected into mice to mimic a human cancer, a process termed a xenograft. The test for Fc antibodies or fusions comprising Fc variants that are optimized for one or more FcγRs of mice, can provide valuable information regarding the efficacy of the Fc antibody or fusion, its mechanism of action and the like. While it is preferred to alter the binding to a Fc? R, the present invention further contemplates Fc variants with altered binding affinity to the neonatal receptor (FcRn). Although it is not intended to be linked to a particular mechanism of action, variants of the Fc region with increased affinity for FcRn are anticipated to have half lives of serum and said molecules will have useful applications in methods for treating mammals where it is desired to administer polypeptides of long half-life, e.g., to treat a chronic disease or disorder. Although not intended to be linked to a particular mechanism of action, variants of the Fc region with decreased binding affinity of FcRn, on the contrary, are expected to have shorter half-lives, and said molecules, for example, can be administered to a mammal wherein shortened circulation time may be advantageous, i.e., for live diagnostic imaging or for polypeptides having toxic side effects when allowed to circulate in the bloodstream for extended periods. Variants of the Fc region with decreased binding affinity of FcRn are anticipated to be less likely to cross the placenta, and therefore can be used in the treatment of diseases or disorders in pregnant women. In other embodiments, these variants may be combined with other Fc modifications with altered FcRn affinity such as those described in International Publication Nos. WO 98/23289; and WO 97/34631, and the U.S. Patent. No. 6,277,375, each of which is incorporated herein by reference in its entirety. The invention encompasses any other method known in the art to generate antibodies that have a life media increased in v ue, for example, by introducing one or more amino acid modifications (i.e., substitutions, insertions or deletions) in an IgG constant domain, or FcRn binding fragment thereof (preferably an Fc domain fragment or Fe-axis). See, e.g., International Publications WO 93/15200; WO 92/15200; and WO 01/77137; and European Patent No. EP 413,622, all of which are hereby incorporated by reference in their entirety. The variant (s) described herein may be subject to further modifications, sometimes depending on the intended use of the variant. Such modifications may involve further alteration of the amino acid sequence (substitution, insertion and / or deletion of amino acid residues), fusion to heterologous polypeptide (s) and / or covalent modifications. Such additional modifications may be made prior to, concurrent with, or after, the amino acid modifications described herein that result in altered properties such as an alteration of the Fc receptor binding and / or CCDA activity. Alternatively or additionally, the invention encompasses combining the amino acid modifications described herein with one or more additional amino acid modifications that alter the Clq binding and / or complement dependent cytotoxicity function of the Fc regions. determined in vitro and / or in vivo. Preferably, the starting molecule of particular interest herein is usually one that binds Clq and exhibits complement dependent cytotoxicity (CDC). The additional amino acid substitutions described herein will generally serve to alter the ability of the starting molecule to bind Clq and / or modify its complement-dependent cytotoxicity function, e.g., to reduce and preferably eliminate these effector functions. In other embodiments, molecules that comprise substitutions at one or more of the described positions with improved functions of improved Clq binding and / or complement dependent cytotoxicity (CDC) are contemplated herein. For example, the starting molecule may be unable to bind to Clq and / or mediate the CDC and may be modified according to the teachings present so that it acquires these additional effector functions. In addition, the molecules with pre-existing Clq binding activity, which optionally also have the ability to mediate with CDC, can be modified so that one or both of these activities are altered, e.g., improved. In some embodiments, the invention encompasses variant regions of Fc with altered CDC activity without any alteration in Clq binding. In still other embodiments, the invention encompasses the variant Fc regions with altered CDC activity and altered Clq binding.

To generate an Fc region with altered Clq binding function and / or complement dependent cytotoxicity (CDC), amino acid positions that will be modified are generally selected from positions 270, 322, 326, 327, 329, 331, 333 , and 334, where the numbering of the residues in an IgG heavy chain is that of the EU index as in Kabat et al., Sequences of Proteins of Immunological Interest, 5a. Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (199). These amino acid modifications can be combined with one or more modifications of Fc described herein to provide a smergistic or additive effect on Clq binding and / or CDC activity. In other embodiments, the invention encompasses Fc variants with altered Clq binding function and / or complement dependent cytotoxicity (CDC) comprising an amino acid substitution at position 396 with leucine and at position 255 with leucma; or an amino acid substitution at position 396 with leucma and at position 419 with histidine; an amino acid substitution at position 396 with leucine and at position 370 with glutamic acid; an amino acid substitution at position 396 with leucma and at position 240 with alanine; an amino acid substitution at position 396 with leucine and at position 392 with treomna; an amino acid substitution at position 247 with leucine and at position 421 with lysine. The 13 invention encompasses any known modification of the Fc region that alters the binding function of Clq and / or complement-dependent cytotoxicity (CDC) such as that described in Idusogie et al., 2001, J. Immunol. 166 (4) 2571-5; Idusogie et al., J. Immonol. 2000 164 (8): 4178-4184; each of which is incorporated herein by reference in its entirety. As indicated above, the invention encompasses an Fc region with altered effector function, e.g., modified Clq binding and / or FcR binding and therefore altered CDC activity and / or CCDA activity. In specific embodiments, the invention encompasses regions of variant Fc with enhanced Clq binding and improved FcγRIII binding, v.br., which has both enhanced CCDA activity and enhanced CDC activity. In alternative embodiments, the invention encompasses a variant Fc region with reduced CDC activity and / or reduced CCDA activity. In other embodiments, only one of these activities may be increased and optionally also reducing the other activity, e.g., generating a variant of the Fc region with enhanced CCDA activity, but reduced CDC activity and vice versa.

A. MUTANTS WITH ALTERED IMPROVED AFFINITIES FOR FcRIIIA AND / OR FCTRIIA The invention encompasses molecules comprising a variant Fc region, having one or more amino acid modifications (e.g., substitutions) in one or more regions, wherein said modifications alter the affinity of the variant Fc region for an activation Fc? R. In some embodiments, the molecules of the invention comprise a variant Fc region, which have one or more amino acid modifications (e.g., substitutions) in one or more regions, such modifications increase the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA for more than 2 times, in relation to a comparable molecule comprising a wild-type Fc region. In other embodiments of the invention, one or more amino acid modifications increase the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA at least 3 times, 4 times, 5 times, 6 times, 8 times or 10 times in relation to a comparable molecule comprising a wild-type Fc region. In still other embodiments of the invention, the amino acid modification (s) decreases the affinity of the variant Fc region for FcγRIIIA and / or FcγRIIA at least 3 times, 4 times, 5 times, 6 times, 8 times, or 10 times in relation to a comparable molecule comprising a wild-type Fc region. Said increments of times preferably they are determined by an ELISA or surface plasmotypic resonance analysis, in a specific modality, the amino acid modifications do not include or are not only a substitution in any of positions 329, 331, or 322, with any amino acid. In certain embodiments, one or more amino acid modifications does not include or is not solely a substitution of any with alanine at positions 256, 290, 298, 312, 333, 334, 359, 360, or 430, with lysine at position 330; with treonma at position 339; with methionine at position 320; with serine, asparagma, aspartic acid or glutamic acid at position 326, with glutamine, glutamic acid, methionine, histidine, valma or leucma at position 334. In another specific embodiment, one or more amino acid modifications does not include, or is not only one substitution, in any of the positions 280, 290, 300, 294, or 295. In yet another more specific embodiment, one or more amino acid modifications do not include or are not solely a substitution in the 300 position with leucine or Isoleucma; at position 295 with lysine; in position 294 with asparagma; in position 298 with valma; aspartic acid, prolma, asparagma or valine; at position 280 with histidine, glutamine or tyrosma; in position 290 with serma, glycine, treomna or tyrosma. In another specific embodiment, the invention encompasses a molecule comprising a vanishing Fc region, in wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIA with a higher affinity with that a comparable molecule comprising the Fc region type wild joins Fc? RIIA, as long as said variant Fc region does not have an alamna in any of positions 256, 290, 326, 255, 258, 267, 272, 276, 280, 283, 285, 286, 331 , 337, 268, 272, or 430; an asparagine at position 268; a glutamine at position 272; a glutamine, serma or aspartic acid at position 286; a serine in position 290; a methionine, glutamine, glutamic acid or arginine at position 320; a glutamic acid at position 322; a serine, glutamic acid, or aspartic acid at position 326; a lysine at position 330; a glutamine at position 335; or a methionine at position 301. In a specific embodiment, the molecules of the invention comprise a variant Fc region, which has one or more amino acid modifications (e.g., substitutions) in one or more regions, said modifications increase the affinity of the variant Fc region for Fc? RIIA by more than 2 times, relative to a comparable molecule comprising a wild-type Fc region. In other embodiments of the invention, one or more amino acid modifications increase the affinity of the variant Fc region for Fc? RIIA at less by 3 times, 4 times, 5 times, 6 times, 8 times or 10 times relative to a comparable molecule comprising a wild-type Fc region. In a specific embodiment, the invention encompasses molecules, preferably polypeptides, and more preferably immunoglobulins (e.g., antibodies), comprising a variant Fc region, having one or more amino acid modifications (e.g., substitutions but they also include insertions or deletions), such modifications increase the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA by at least 65%, at least 70%, by at least 75%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, and at least 200%, relative to a comparable molecule comprising a wild type Fc region. In a specific embodiment, one or more amino acid modifications that increase the affinity of the variant Fc region comprise a substitution at position 347 with histidine, and at position 339 with valine; or a substitution at position 425 with isoleucine and at position 215 with phenylalanine; or a substitution at position 408 with isoleucine, at position 215 with isoleucine and at position 125 with leucine; or a substitution at position 385 with glutamic acid and at position 247 with histidine; or a substitution in the position 348 with methionine, in position 334 with asparagine, in position 275 with isoleucine, in position 202 with methionine and in position 147 with threonine; or a substitution at position 275 with isoleucine, at position 334 with asparagine and at position 348 with methionine; or a substitution at position 279 with leucine and at position 395 with septa; or a substitution at position 246 with threonine and at position 319 with phenylalanine; or a substitution at position 243 with isoleucine and at position 379 with leucine; or a substitution at position 243 with leucma, at position 255 with leucine and at position 318 with lysine; or a substitution at position 334 with glutamic acid, at position 359 with asparagus, and at position 366 with septa; or a substitution at position 288 with methionine and at position 334 with glutamic acid; or a substitution at position 334 with glutamic acid and at position 380 with aspartic acid; or a substitution at position 256 with serine, at position 305 with isoleucine, at position 334 with glutamic acid and at position 390 with serine; or a substitution at position 335 with asparagine, at position 370 with glutamic acid, at position 378 with valine, at position 394 with methionine, and at position 424 with leucine; or a substitution at position 233 with aspartic acid and at position 334 with glutamic acid; or a substitution at position 334 with glutamic acid, at position 359 with asparagma, at position 366 with serine and at position 386 with arginine; or a substitution at position 246 with threonine and at position 396 with histidine; or a substitution at position 368 with aspartic acid and at position 318 with aspartic acid; or a substitution at position 288 with asparagus, at position 330 with septa, and at position 396 with leucine; or a substitution at position 244 with histidine, at position 358 with methionine, at position 379 with methionine, at position 384 with lysine and at position 397 with methionine; or a substitution at position 217 with septa, at position 378 with valma and at position 408 with arginine; or a substitution at position 247 with leucine, at position 253 with asparagine and at position 334 with asparagine; or a substitution at position 246 with ísoleucma, and at position 334 with asparagine; or a substitution at position 320 with glutamic acid and at position 326 with glutamic acid, or a substitution at position 375 with cysteine and at position 396 with leucma. Examples of other amino acid substitutions that result in increased affinity for Fc? RIIIA m vitro are described below and are summarized in Table 5. The invention encompasses a molecule comprising a variant Fc region, wherein said Fc region variant comprises a substitution at position 243 with isoleucine and at position 379 with leucine, such that said molecule binds to Fc? RIIIA with approximately an affinity greater than 1.5 times that with which a comparable molecule comprising the wild type Fc region binds to Fc? RIIIA, as it is determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 288 with asparagine, at position 330 with serine, and at position 396 with leucine, such that said molecule binds to Fc? RIIIA with an affinity greater than about 5 times that with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, as determined by an assay of ELISA In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 243 with leucma and at position 255 with leucine so that said molecule binds to Fc RIIIA with 1-fold higher affinity with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 334 with glutamic acid, in the position 359 with asparagine and at position 366 with serine, such that said molecule binds to Fc? RIIIA with an affinity greater than 1.5 times that with which a comparable molecule comprising the wild-type Fc region binds to Fc ? RIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid , so that said molecule binds to Fc? RIIIA with a higher affinity of about 1.5 times than that with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, as determined by an analysis of ELISA In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 315 with isoleucine, at position 379 with methion and at position 399 with glutamic acid, with an affinity greater than about 1 time with which a comparable molecule comprising the wild-type Fc region binds to FcγRIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 243 with isoleucine, at position 379 with leucine and at position 420 with valine, such that said molecule binds to Fc? RIIIA with a higher affinity by approximately 2.5 times than that with which a comparable molecule comprises the wild-type Fc region is linked to Fc? RIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 247 with leucine, and at position 421 with lysine, such that said molecule binds to Fc? RIIIA with an affinity higher than about 3 times that with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein said variant Fc region comprises a substitution at position 392 with threonine and at position 396 with leucine so that said molecule binds to Fc RIIIA with a higher affinity of about 4.5 times comparable with a molecule comprising the wild type Fc region that binds Fc? RIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein the Fc region variant comprises a substitution at position 293 with valine, at position 295 with glutamic acid and at position 327 with threonine, so that the molecule binds to Fc? RIIIA with a higher affinity of approximately 1.5 times than that with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein the variant Fc region comprises a substitution at position 268 with asparagine and at position 396 with leucine, such that the molecule binds to Fc? RIIIA with an affinity greater than about 2 times that with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, as determined by an ELISA analysis. In a specific embodiment, the invention encompasses a molecule comprising a variant Fc region, wherein the variant Fc region comprises a substitution at position 319 with phenylalanine, at position 352 with leucine and at position 396 with leucine, Such a molecule binds to Fc? RIIIA with an affinity greater than about 2-fold to that with which a comparable molecule comprising the wild-type Fc region binds to Fc? RIIIA, as determined by an ELISA analysis.

In a specific embodiment, the invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild type Fc region, such that said polypeptide is specifically binds Fc? RIIIA with a higher affinity than a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 396 with histidine. In a specific embodiment, the invention encompasses an isolated polypeptide comprising a vanishing Fc region, wherein said variant Fc region encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region such that said polypeptide specifically binds FcγRIIIA with a higher affinity than a comparable polypeptide comprising the wild type Fc region, wherein at least one amino acid modification it comprises the substitution at position 248 with methion. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide binds specifically to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 392 with arginme. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 315 with ísoleucma. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild type Fc region, wherein at least one amino acid modification comprises substitution at position 132 with isoleucine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide is linked ! specifically to FcγRIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 162 with valine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 396 with leucma. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild type Fc region, wherein at least one amino acid modification comprises substitution at position 379 with methionine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to FcγRIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 219 with tyrosine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 282 with methionine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild type Fc region, wherein at least one amino acid modification comprises substitution at position 401 with valine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to an Fc region. wild-type, such that said polypeptide specifically binds FcγRIIIA with a similar affinity to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 222 with asparagine . The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 334 with glutamic acid. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at position 337 with phenylalanine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one modification of amino acid relative to a wild-type Fc region, such that said polypeptide binds specifically to FcγRIIIA with a similar affinity to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises the substitution at position 334 with ísoleucma. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild type Fc region, wherein at least one amino acid modification comprises substitution at position 247 with leucine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild type Fc region, wherein at least one amino acid modification comprises substitution at position 326 with glutamic acid. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least minus an amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds FcγRIIIA with a similar affinity to a comparable polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification comprises substitution at the 3t2 position with tyrosine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said polypeptide specifically binds to Fc? RIIIA with an affinity similar to a comparable polypeptide comprising the wild type Fc region, wherein at least one amino acid modification comprises substitution at position 224 with leucine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to FcγRIIIA with a greater affinity than a comparable polypeptide comprising the wild type Fc region, wherein at least said amino acid modification comprises substitution at position 275 with tyrosine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification in relation to a wild-type Fc region, said polypeptide specifically binds FcγRIIIA with a higher affinity than a comparable polypeptide comprising the wild-type Fc region, wherein at least said amino acid modification comprises substitution at position 398 with valine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to FcγRIIIA with a greater affinity than a comparable polypeptide comprising the wild-type Fc region, wherein at least said amino acid modification comprises substitution at position 334 with asparagma. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to FcγRIIIA with a greater affinity than a comparable polypeptide comprising the wild type Fc region, wherein at least said amino acid modification comprises substitution at position 400 with proline. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least an amino acid modification in relation to a wild-type Fc region, said polypeptide specifically binds FcγRIIIA with a higher affinity than a comparable polypeptide comprising the wild-type Fc region, wherein at least said amino acid modification comprises substitution at position 407 with isoleucine. The invention encompasses an isolated polypeptide which comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide is specifically bound to Fc? RIIIA with a higher affinity than a comparable polypeptide • comprising the wild type Fc region, wherein at least said amino acid modification comprises substitution at position 372 with tyrosine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to FcγRIIIA with a greater affinity than a comparable polypeptide comprising the wild type Fc region, wherein at least said amino acid modification comprises substitution at position 366 with asparagine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a region of Fc wild-type, said polypeptide binds specifically to FcγRIIIA with a higher affinity than a comparable polypeptide comprising the wild-type Fc region, wherein at least said amino acid modification comprises substitution at position 414 with asparagine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to FcγRIIIA with a affinity greater than a comparable polypeptide comprising the wild type Fc region, wherein at least said amino acid modification comprises substitution at position 225 with serine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to FcγRIIIA with a affinity greater than a comparable polypeptide comprising the wild-type Fc region, wherein at least said amino acid modification comprises substitution at position 377 with asparagine. In a specific embodiment, the invention encompasses an isolated polypeptide comprising a variant Fc region wherein said variant Fc region comprises at least one amino acid modification relative to a region of Fc wild-type, said polypeptide binds specifically to FcγRIIIA with affinity greater than about 2-fold than a comparable polypeptide comprising the wild-type Fc region as determined by an ELISA analysis, wherein at least said amino acid modification it comprises substitution at position 379 with methion. In another specific embodiment, the invention encompasses at least one amino acid modification comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, so that the polypeptide binds specifically to Fc? RIIIA with an affinity greater than about 1.5 times that of a comparable polypeptide comprising the wild type Fc region as determined by an ELISA analysis, wherein said amino acid modification comprises substitution at the position 248 with methionine. In some embodiments, the molecules of the invention have an altered affinity for Fc? RIIIA and / or Fc? RIIA as determined using m vitro analysis (biochemical or immunological based assay) known in the art to determine Fc-Fc interactions R, that is, the specific binding of a Fc region to an FcγR including but not limited to ELISA analysis, surface plasmotype resonance analysis, immunoprecipitation analysis (Refer to Section 5.2.1). Preferably, the binding properties of these molecules with altered affinities to activate FcγR receptors also correlate with their activity as determined by in vitro functional analyzes to determine one or more functions of effector mediating cells of FcγR (Refer to Section 5.2.6), e.g., molecules with variant Fc regions with increased affinity for Fc? RIIIA have a CCDA activity. In still more preferred embodiments, the molecules of the invention having an altered binding property for an activation Fc receptor, e.g., FcγRIIIA in an in vitro assay also have an altered binding property in in vivo models (such as those described and mentioned herein). However, the present invention does not exclude molecules of the invention that do not exhibit an altered FcγR binding in in vitro-based assays but expose the desired phenotype in vivo.

B. MUTANTS WITH INCREMENTED AFFINITY FOR Fc? RIIIA AND REDUCED OR NULL AFFINITY FOR Fc? RIIB In a specific embodiment, the molecules of the invention comprise a variant Fc region, having one or more amino acid modifications (i.e., substitutions) in a or more regions, said or said modifications increase the affinity of the variant Fc region to Fc? RIIIA and decreases the affinity of the variant Fc region for Fc? RIIIB, relative to a comparable molecule comprising a wild-type Fc region that binds to Fc? RIIIA and Fc? RIIB with wild-type affinity. In some embodiment, one or more amino acid modifications do not include or are not solely a substitution with alanine in any of positions 256, 298, 333, 334, 280, 290, 294, 298, or 296; or a substitution at position 298 with asparagine, valine, aspartic acid or proline; or a substitution 290 with serine. In certain amino modalities, one or more amino acid modifications increases the affinity of the variant Fc region for Fc? RIIIA by at least 65%, by at least 70%, by at least 75%, by at least 85%, by at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400% and decreases the affinity of the variant Fc region for Fc? RIIB at least 65%, at least 70%, at least 75%, at least 85%, at least 90%, at least 99%, at least 100%, at least 200 %, at least 300%, at least 400%. In a specific embodiment, the molecule of the invention comprising a variant Fc region with an increased affinity for FcγRIIIA and a decreased or no affinity affinity for FcγRIIIB, as determined based on an ELISA and / or assay an analysis based on CCDA using antibody 4-4-20 CH carrying the variant Fc region comprises a substitution in any of the following, position 275 with isoleucine, in position 334 with asparagm and in position 348 with methionine; or a substitution at position 279 with leucine and at position 395 with septa; or a substitution at position 246 with treomna and at position 319 with phenylalanine; or a substitution at position 243 with leucine, at position 255 with leucine and at position 318 with lysine; or a substitution at position 334 with glutamic acid, at position 359 with asparagine and at position 366 with septa; or a substitution at position 334 with glutamic acid and at position 380 with aspartic acid; or a substitution at position 256 with serine, at position 305 with ísoleucma, at position 334 with glutamic acid and at position 390 with septa; or a substitution at position 335 with asparagus, at position 370 with glutamic acid, at position 378 with valine, at position 394 with methionine and at position 424 with leucine; or a substitution at position 233 with aspartic acid and at position 334 with glutamic acid, or a substitution at position 334 with glutamic acid, at position 359 with asparagus, at position 366 with serine and at position 386 with arginine; or a substitution at position 312 with glutamic acid, at position 327 with asparagine, and at position 378 with serine; or a substitution at position 288 with asparagma and in position 326 with asparagma, or a substitution in position 247 with leucma and in position 421 with Usina; or a substitution at position 298 with asparagine and at position 381 with arginine; or a substitution at position 280 with glutamic acid, at position 354 with phenylalanine, at position 431 with aspartic acid, and at position 441 with ísoleucma; or a substitution at position 255 with glutamine and at position 326 with glutamic acid; or a substitution at position 218 with arginine, at position 281 with aspartic acid and at position 385 with argmin; or a substitution at position 247 with leucine, at position 330 with threonine and at position 440 with glycine; or a substitution at position 284 with alamine and at position 372 with leucma; or a substitution at position 335 with asparagus, at position 387 with septa and at position 435 with glutamine; or a substitution at position 247 with leucma, at position 431 with valma and at position 442 with phenylalanine. In a specific embodiment, the molecule of the invention comprises a variant Fc region with an increased affinity for FcγRIIIA and a decreased affinity or no affinity for FcγRIIb as determined based on an ELISA analysis and / or an analysis based on CCDA using antibody 4-4-20 CH carrying a variant Fc region comprises a substitution at position 379 with methionine; at position 219 with tyrosine; at position 282 with methionine; at position 401 with valine; at position 222 with asparagma; at position 334 with isoleucine; at position 334 with glutamic acid; at position 275 with tyrosine; at position 398 with valina. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIB with a lower affinity of about 3-fold than a comparable polypeptide comprising the wild-type Fc region as determined by an ELISA analysis, wherein at least said amino acid modification comprises substitution at position 288 with asparagine, at position 330 with serine and in position 396 with leucma. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIB with a lower affinity of about 10-15 fold than a comparable polypeptide comprising the wild-type Fc region as determined by an ELISA analysis, wherein at least said amino acid modification comprises substitution at the position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIB with a lower affinity of about 10-fold than a comparable polypeptide comprising the wild-type Fc region as determined by an ELISA analysis, wherein at least said amino acid modification comprises substitution at position 315 with isoleucine, at position 379 with methionine and in position 399 with glutamic acid. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIB with a lower affinity of about 7-fold than a comparable polypeptide comprising the wild-type Fc region as determined by an ELISA analysis, wherein at least said amino acid modification comprises substitution at position 243 with isoleucine, at position 379 with leucine and in position 420 with valine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIB with a lower affinity of about 3-fold than a comparable polypeptide comprising the region of wild-type Fc as determined by an ELISA analysis, wherein at least said amino acid modification comprises substitution at position 392 with threonine and at position 396 with leucine. The invention encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIB with a lower affinity of about 5-fold than a comparable polypeptide comprising the wild type Fc region as determined by an ELISA analysis, wherein at least said amino acid modification comprises substitution at position 268 with asparagine and at position 396 with Leucine The invention also encompasses an isolated polypeptide comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said polypeptide specifically binds to Fc? RIIB with a lower affinity of about 2-fold than a comparable polypeptide comprising the Fc region wild type as determined by an ELISA analysis, wherein at least said amino acid modification comprises substitution at position 319 with phenylalanine, at position 352 with leucine and at position 396 with leucine.

C. MUTANTS WITH INCREMENTED AFFINITY A FcyRIIIA AND Fc? RIIB The invention encompasses molecules comprising regions of variant Fc, which have one or more amino acid modifications, said modifications increase the affinity of the variant Fc region for Fc? RIIIA and Fc? RIIB by at least 65%, at least 70%, at least 75%, at least 85%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%. In a specific embodiment, the molecule of the invention comprising a variant Fc region with an increased affinity for FcγRIIIA and an increased affinity for FcγRIIB (as determined based on an ELISA analysis and / or a based analysis in CCDA using 4-4-20 CH antibody carrying a variant Fc region as described herein) comprises a substitution at position 415 with isoleucine and at position 251 with phenylalanine; or a substitution at position 399 with glutamic acid, at position 292 with leucine and at position 185 with methionine; or a substitution at position 408 with ísoleucma, in position 215 with isoleucine, and in position 125 with leucine; or a substitution at position 385 with glutamic acid and at position 247 with histidine; or a substitution at position 348 with metiomna, at position 334 with asparagine, at position 275 with ísoleucma, at position 202 with metionma and at position 147 with threonine; or a substitution at position 246 with threonine and at position 396 with histidine; or a substitution at position 268 with aspartic acid and at position 318 with aspartic acid; or a substitution at position 288 with asparagine, at position 330 with septa and at position 396 with leucma; or a substitution at position 244 with histidine, at position 358 with methionine, at position 379 with methionine, at position 384 with lysine and at position 397 with methionine; or a substitution at position 217 with serma, at position 378 with valine and at position 408 with arginine; or a substitution at position 247 with leucine, at position 253 with asparagma and at position 334 with asparagma; or a substitution at position 246 with isoleucine and at position 334 with asparagine; or a substitution at position 320 with glutamic acid and at position 326 with glutamic acid; or a substitution at position 375 with cysteine and at position 396 with leucma; or a substitution at position 343 with serine, at position 353 with leucma, at position 375 with ísoleucma, in position 383 with asparagine; or a substitution at position 394 with methionine and at position 397 with methionine; or a substitution at position 216 with aspartic acid, at position 345 with lysine and at position 375 with isoleucine; or a substitution at position 288 with asparagine, at position 330 with senna and at position 396 with leucine; or a substitution at position 247 with leucma and at position 389 with glycine; or a substitution at position 222 with asparagus, at position 335 with asparagus, at position 370 with glutamic acid, at position 378 with vahna and at position 394 with methionine; or a substitution at position 316 with aspartic acid, at position 378 with valine and at position 394 with methionine; or a substitution at position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid; or a substitution at position 315 with ísoleucma, at position 379 with methionine, and at position 394 with methionine; or a substitution at position 290 with threonine and at position 371 with aspartic acid; or a substitution at position 247 with leucine and at position 398 with glutamine; or a substitution at position 326 with glutamine; at position 334 with glutamic acid, at position 359 with asparagm and at position 366 with serine; or a substitution at position 247 with leucma at position 377 with phenylalanine; or a substitution in the position 378 with valine, at position 390 with isoleucine and at position 422 with isoleucine; or a substitution at position 326 with glutamic acid and at position 385 with glutamic acid; or a substitution at position 282 with glutamic acid, at position 369 with isoleucine and at position 406 with phenylalanine; or a substitution at position 397 with methionine; in position 411 with alanine and in position 415 with asparagine; or a substitution at position 223 with isoleucine, at position 256 with serine and at position 406 with phenylalanine; or a substitution at position 298 with asparagine and at position 407 with arginine; or a substitution at position 246 with arginine, at position 298 with asparagine and at position 377 with phenylalanine; or a substitution at position 235 with proline, at position 382 with methionine, at position 304 with glycine, at position 305 with isoleucine, and at position 323 with isoleucine; or a substitution at position 247 with leucine, at position 313 with arginine and at position 388 with glycine; or a substitution at position 221 with tyrosine, at position 252 with isoleucine, at position 330 with glycine, at position 339 with threonine, at position 359 with asparagine, at position 422 with isoleucine, and at position 433 with leucine; or a substitution at position 258 with aspartic acid, at position 384 with lysine; or a substitution in the position 241 with leucine and in position 258 with glycine; or a substitution at position 370 with asparagine and at position 440 with asparagine; or a substitution at position 317 with asparagine and a deletion at position 423; or a substitution at position 243 with isoleucine, at position 379 with leucine and at position 420 with valine; or a substitution at position 227 with septa and at position 290 with glutamic acid; or a substitution at position 231 with valine, at position 386 with histidine and at position 412 with methionine; or a substitution at position 215 with proline, at position 274 with asparagine, at position 287 with glycine, at position 334 with asparagine, at position 365 with valine and at position 396 with leucine; or a substitution at position 293 with valine, at position 295 with glutamic acid and at position 327 with threonine; or a substitution at position 319 with phenylalanine, at position 352 with leucine and at position 396 with leucine; or a substitution at position 392 with threonine and at position 396 with leucine; in a substitution at position 268 with asparagus and at position 396 with leucine; or a substitution at position 290 with threonine, at position 390 with isoleucine, and at position 396 with leucine; or a substitution at position 326 with isoleucine and at position 396 with leucine; or a substitution at position 268 with aspartic acid and at position 396 with leucine; or a substitution at position 210 with metiomna and at position 396 with leucine; or a substitution at position 358 with proline and at position 396 with leucine; or a substitution at position 288 with arginine, at position 307 with alanine, at position 344 with glutamic acid and at position 396 with leucine; or a substitution at position 273 with isoleucine, at position 326 with glutamic acid, at position 328 with isoleucine and at position 396 with leucine; or a substitution at position 326 with leucine; in position 408 with asparagus and in position 396 with leucine; or a substitution at position 261 with asparagine, at position 210 with methionine and at position 396 with leucine; or a substitution at position 419 with histidine and at position 396 with leucine; or a substitution at position 370 with glutamic acid and at position 396 with leucine; or a substitution at position 242 with phenylalanine and at position 396 with leucine; or a substitution at position 255 with leucine and at position 396 with leucine; or a substitution at position 240 with alanine and at position 396 with leucine; or a substitution at position 250 with septa and at position 396 with leucine; or a substitution at position 247 with serma and at position 396 with leucma; or a substitution at position 410 with histidine and at position 396 with leucine; or a substitution at position 419 with leucine and in position 396 with leucine; or a substitution at position 427 with alanine and at position 396 with leucine; or a substitution at position 258 with aspartic acid and at position 396 with leucine; or a substitution at position 384 with lysine and at position 396 with leucine; or a substitution at position 323 with isoleucine and at position 396 with leucine; or a substitution at position 244 with histidine and at position 396 with leucine; or a substitution at position 305 with leucine and at position 396 with leucine; or a substitution at position 400 with phenylalanine and at position 396 with leucine; or a substitution at position 303 with isoleucine and at position 396 with leucine; or a substitution at position 243 with leucine, at position 305 with isoleucine, at position 378 with aspartic acid, at position 404 with serine and at position 396 with leucine; or a substitution at position 290 with glutamic acid, at position 369 with alanine, at position 393 with alanine and at position 396 with leucine; or a substitution at position 210 with asparagine, at position 222 with isoleucine, at position 320 with methionine and at position 396 with leucine; or a substitution at position 217 with serine, at position 305 with isoleucine, at position 309 with leucine, at position 390 with histidine and at position 396 with leucine; or a substitution at position 246 with asparagine; at position 419 with arginine and in position 396 with leucine; or a substitution at position 217 with alanine, at position 359 with alanine and at position 396 with leucine; or a substitution at position 215 with isoleucine, at position 290 with valine and at position 396 with leucine; or a substitution at position 275 with leucine; at position 362 with histidine, at position 384 with lysine and in position 396 with leucine; or a substitution at position 334 with asparagma, or a substitution at position 400 with proline; or a substitution at position 407 with isoleucm; or a substitution at position 372 with tyrosine; or a substitution at position 366 with asparagma; or a substitution at position 414 with asparagma; or a substitution at position 352 with leucma; or a substitution at position 225 with sepna; or a substitution at position 377 with asparagine; or a substitution at position 248 with methionine.

D. MUTANTS THAT DO NOT BIND TO ANY FcyR In some embodiments, the invention encompasses molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild type Fc region. , said variant Fc region does not bind to any Fc? R, as determined by the normal analyzes known in the art and which are described herein, in relationship with a comparable molecule comprising the wild-type Fc region. In a specific embodiment, one or more amino acid modifications that abolish binding to any of the FcγR comprises a substitution at position 232 with serine and at position 304 with glycine; or a substitution at position 269 with lysine, at position 290 with asparagine, at position 311 with arginine, and at position 433 with tyrosma; or a substitution at position 252 with leucine; or a substitution at position 216 with aspartic acid, at position 334 with argimna, and at position 375 with isoleucine; or a substitution at position 247 with leucine and at position 406 with phenylalanine, or a substitution at position 335 with asparagine, at position 387 with serine, and at position 435 with glutamine; or a substitution at position 334 with glutamic acid, in position 380 with aspatic acid and in position 446 with valma; or a substitution at position 303 with isoleucine, at position 369 with phenylalanine and at position 428 with leucine; or a substitution at position 251 with phenylalanine and at position 372 with leucine; or a substitution at position 246 with glutamic acid at position 284 with methionine and at position 308 with alanine; or a substitution at position 399 with glutamic acid and at position 402 with aspartic acid; or a substitution in the position 399 with glutamic acid and at position 428 with leucine.

D. MUTANTS WITH ALTERATED MEASURED EFFECTIVE FUNCTIONS The invention encompasses immunoglobulin comprising Fc variants with altered effector functions. In some embodiments, immunoglobulins comprising Fc variants mediate effector function more effectively in the presence of effector cells as determined using assays known in the art and exemplified herein. In other embodiments, immunoglobulms comprising Fc variants mediate effector function less effectively in the presence of effector cells as determined using assays known in the art and exemplified herein. In specific embodiments, the Fc variants of the invention can be combined with other known Fc modifications that alter effector function, so that the combination has an additive synergistic effect. The Fc variants of the invention have effector function altered m vitro and / or m vivo. In a specific embodiment, the immunoglobulins of the invention with increased affinity for Fc? RIIIA and / or Fc? RIIA have a mediated effector function for enhanced Fc? R as determined using activity analysis of CCDA described in this. Examples of effector functions that could be mediated by the molecules of the invention include, but are not limited to Clq binding, complement dependent cytotoxicity, antibody dependent cell mediated cytotoxicity (CCDA), phagocytosis, etc. The effector functions of the molecules of the invention can be analyzed using standard methods known in the art, examples of which are described in Section 5.2.6. In a specific embodiment, the immunoglobulins of the invention comprise a variant Fc region with increased affinity for cytotoxicity mediated by antibody-dependent cells (CCDA) mediated by Fc? RIIIA and / or Fc? RIIA in a 2-fold more effective manner, than an immunoglobulin comprising a wild-type Fc region. In other embodiments, the immunoglobulins of the invention comprise a variant Fc region with increased affinity for cytotoxicity mediated by antibody-dependent cells (CCDA) mediated by Fc? RIIIA and / or Fc? RIIA in a manner at least 4 times, at least 8 times, at least 10 times, at least 100 times, at least 1000 times, at least 104 times, at least 105 times more effective, than an immunoglobulin comprising a wild-type Fc region. In another specific embodiment, the immunoglobulins of the invention with increased affinity for Fc? RIIIA and / or Fc? RIIA have activity of Clq binding altered. In some embodiments, the immunoglobulins of the invention with increased affinity for Fc? RIIIA and / or Fc? RIIA have Clq binding activity at least 2 times, at least 4 times, at least 8 times, at least 10 times, at least 100 times, at least 1000 times, at least 104 times, at least 10b times higher, than an immunoglobulin comprising a wild-type Fc region. In yet another specific embodiment, the immunoglobulins of the invention with increased affinity for Fc? RIIIA and / or Fc? RIIA have altered complement dependent cytotoxicity. In yet another specific embodiment, the immunoglobulins of the invention with improved affinity for Fc? RIIIA and / or Fc? RIIA have improved complement-dependent cytotoxicity compared to an immunoglobulin comprising a wild-type Fc region. In some embodiments, immunoglobulins of the invention with increased affinity for Fc? RIIIA and / or Fc? RIIA have higher complement dependent cytotoxicity by at least 2 times, at least 4 times, at least 8 times, at least 10 times, at least 100 times, at least 1000 times, at least 104 times, at least 105 times higher than an immunoglobulin comprising a wild-type Fc region. In other embodiments, the immunoglobulins of the invention with increased affinity for Fc? RIIIA and / or Fc? RIIA have enhanced phagocytosis activity in relation to an immunoglobulin comprising a wild-type Fc region, as determined by normal analyzes known to one skilled in the art and described herein. In some embodiments, the immunoglobulins of the invention with increased affinity for Fc? RIIIA and / or Fc? RIIA have phagocytosis activity greater than at least 2 times, at least 4 times, at least 8 times, at least 10 times in relation to an immunoglobulin comprising a wild-type Fc region. In a specific embodiment, the invention encompasses an immunoglobulin comprising a variant Fc region with one or more amino acid modifications, with an increased affinity for Fc? RIIIA and / or Fc? RIIA so that the immunoglobulin has an improved effector function, e.g., antibody-mediated cell-mediated cytotoxicity, or phagocytosis. In a specific embodiment, one or more amino acid modifications that increase the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA and increases the activity of CCDA of the immunoglobulin comprises a substitution at position 379 with methionine; or a substitution at position 243 with isoleucine and at position 379 with leucine; or a substitution at position 288 with asparagine, at position 330 with septa and at position 396 with leucine; or one substitution at position 243 with leucine and at position 255 with leucine; or a substitution at position 334 with glutamic acid, at position 359 with asparagine, and at position 366 with serine; or a substitution at position 288 with methionine and at position 334 with glutamic acid; or a substitution at position 334 with glutamic acid and at position 292 with leucine; or a substitution at position 316 with aspartic acid, at position 378 with valine, and at position 399 with glutamic acid; or a substitution at position 243 with isoleucine, at position 379 with leucine and at position 420 with valine; or a substitution at position 247 with leucine and at position 421 with lysine; or a substitution at position 248 with methionine; or a substitution at position 392 with threonine and at position 396 with leucine; or a substitution at position 293 with valine, at position 295 with glutamic acid and at position 327 with threonine; or a substitution at position 268 with asparagine and at position 396 with leucine; or a substitution at position 319 with phenylalanine, at position 352 with leucine and at position 396 with leucine. In another specific embodiment, one or more amino acid modifications that increase the CCDA activity of the immunoglobulin is any of the mutations listed below, in Table 7.

TABLE 7 MODIFICATION OF AMINO ACID THAT INCREASES CCDA Alternatively or additionally, it may be useful to combine the above amino acid modifications or any other amino acid modifications described herein with one or more amino acid modifications that alter the Clq binding and / or complement dependent cytotoxicity function of the Fc region. . The starting molecule of particular interest herein is usually that which binds Clq and exhibits complement dependent cytotoxicity (CDC). The additional amino acid substitutions described herein will generally serve to alter the ability of the starting molecule to bind to Clq and / or modify its cytotoxicity function complement dependent, e.g., to reduce and preferably eliminate these effector functions. However, molecules that comprise substitutions in one or more of the positions described above with improved Clq binding and / or complement dependent cytotoxicity (CDC) function are contemplated herein. For example, the starting molecule may not be capable of binding to Clq and / or mediating the CDC and may be modified in accordance with the present teachings so as to acquire these additional effector functions. further, the molecules with pre-existing Clq binding activity, which also optionally have the ability to mediate CDC can be modified so that one or both activities are improved. As described above, an Fc region with altered effector function can be designed, e.g., by modifying Clq binding and / or FcR binding and thereby changing the CDC activity and / or CCDA activity. For example, a variant Fc region with enhanced Clq binding can be generated and enhance the binding of Fc? RIII; e.g., having improved CCDA activity and improved CDC activity. Alternatively, where effector function is desired to be reduced or abolished, a variant Fc region with reduced CDC activity and / or reduced ADCC activity can be engineered. In other modalities, you can increase only one of these adimfMrMd Yptibrialiy and also reduce the other activity, e.g., to generate a variant Fc region with enhanced CCAD activity, but reduced CDC activity and vice versa. The invention encompasses specific variants of the Fc region that have been identified using the methods of the invention of a yeast bank of mutants after the 2nd and 4th round of selection, are listed in Table 8. Table 8 summarizes the different mutants that were identified using the methods of the invention. The mutants were analyzed using an ELISA analysis to determine binding to Fc? RIIIA and Fc? RIIB. The mutants were also tested in a CCDA assay by cloning the Fc variants in a 4-4-20 CH antibody using methods described and exemplified herein. The articles in bold refer to experiments, in which the 4-4-20 CHs were purified before the CCDA analysis. The given antibody concentration was within the range of 0.5 μg / ml-1.0 at least 2 times, at least 4 times, at least 8 times, at least 10 times, at least 100 times, at least 1000 times, at least 104 times, at least 105 times higher.

TABLE 8: MUTATIONS IDENTIFIED IN THE REGION OF FCC oo with co s. 00 co 00 I- "00 or In preferred embodiments, the invention provides modified immunoglobulin molecules (e.g., antibodies) with variant Fc regions, which have one or more amino acid modifications, said amino acid modifications increase the affinity of the molecule for Fc? RIIIA and / o Fc? RIIA. Said immunoglobulins include IgG molecules which naturally contain FcγR binding regions (eg, FcγRIIIA and / or FcγRIIB binding region) or immunoglobulin derivatives that have been engineered to contain an FcyR binding region. (e.g., binding region to FcyRIIIA and / or Fc? RIIB). Modified immunoglobulins of the invention include any immunoglobulin molecule that binds, preferably, immunospecifically, that is, competes outside of the non-specific binding as determined by immunoassays well known in the art to analyze antigen-specific antibody binding, an antigen and contains a binding region A FcyR (e.g., a binding region to FcyRIIIA and / or Fc? RIIB). Such antibodies include, but are not limited to, polyclonal, monoclonal, bispecific, multispecific, human, humanized, chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') 2 fragments. Fvs linked to disulfide and fragments that contain VL or VH domain or even a complementary determinant region (RDC) that binds specifically to an antigen, in certain cases, engineered to contain or fuse to a region binding to FcyR. In some embodiments, the molecules of the invention comprise portions of an Fc region. As used herein, the term "portion of an Fc region" refers to fragments of the Fc region, preferably, a portion with effector activity and / or FcγR binding activity (or a comparable region of a mutant that lacks this activity). The fragment of an Fc region can vary in size from 5 amino acids to the entire Fc region minus an amino acid. The portion of a Fc region may lack up to 10, up to 20, up to 30 amino acids of the N-terminus or the C-terminus. The IgG molecules of the invention are preferably IgGl subclasses of the IgGs, but may also be other subclasses of the IgGs. IgG of given animals. For example, in humans, the class of IgG includes IgG1, IgG2, IgG3, and IgG4, and mouse IgG includes IgG1, IgG2a, IgG2b, IgG2c and IgG3. The immunoglobulins and other polypeptides used herein) may be of animal origin including birds and mammals. Preferably, the antibodies are from humans, rodents (e.g., mice and rats), monkey, sheep, rabbits, goats, guinea pigs, camels, horses, or chickens. As used herein, "human" antibodies 1 4 they include antibodies that have the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulins and do not express endogenous immunoglobulins, as described above, and, for example, in the Patent from the USA No. 5,939,598, by Kucherlapati et al. The antibodies of the present invention may be monospecific, bispecific, trispecific or greater, multispecific. The multispecific antibodies may be specific for different epitopes of a polypeptide or may be specific for heterologous epitopes, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt. And others, J. Immunol. 147: 60-69; 1991; Patents of E.U.A. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol., 148: 1547-1553, 1992. Multispecific antibodies have binding specificities for at least two different antigens. While such molecules would only bind in a normal manner to two antigens (ie, bispecific antibodies, AcsBe), antibodies with additional specificities such as trispecific antibodies are encompassed by the present invention. Examples of BsAbs include without limitation those whose arm is directed towards an antigen of tumor cells and the other arm is directed towards a cytotoxic molecule. Methods for forming bispecific antibodies are known in the art. The traditional production of full-length bispecific antibodies is based on the coexpression of two heavy chain-immunoglobulin light chain pairs, where the two chains have different specificities (Millstein et al., Nature, 305: 537-539 (1963); which is hereby incorporated by reference in its entirety). Due to the random selection of heavy and light chains of immunoglobulins, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule, which is usually done by affinity chromatography steps, is really problematic, and the product yields are low. In WO 93/08829 and Traunecker et al., EMBO J., 10: 3655-3659 (1991), similar procedures are described. According to a different approach, the variable domains of antibodies with desired binding specificities (antibody-antigen combining sites) are fused to the immunoglobulin constant domain sequences. The merger is preferably with a domain heavy chain constant of immunoglobulin, comprising at least part of the regions of e is CH2 and CH3. It is preferred that it has the first heavy chain constant region (CHI) containing the necessary site for light chain binding, present in at least one of the fusions. The DNAs encoding the heavy chain fusions of immunoglobulins and, if desired, the light chain of immunoglobulins, are inserted into separate expression vectors and co-transfected into a suitable host organism. This provides greater flexibility to adjust the mutual proportions of the three polypeptide fragments in modalities when different ratios of the three polypeptide chains in the construct are used to give the optimal yields. However, it is possible to insert the coding sequences for two or all three polypeptide chains into an expression vector when, the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are not of particular significance.

In a preferred embodiment of this approach, bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in an arm 5, and a heavy chain-light chain hybrid immunoglobulin pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, such as the presence of a light chain of immunoglobulin in only one half of the bispecific molecule gives an easy form of separation. This approach is described in 0 WO 94/04690. For further details on the generation of bispecific antibodies, see, for example, Suresh et al., Methods m Enzymology, 121-210 (1986). According to another approach described in WO 96/27011, a pair of antibody molecules can be treated to maximize the percentage of heterodimers that are recovered from the culture of recombinant cells. The preferred interface comprises at least a portion of the CH3 domain of a constant domain of the antibody. In this method, one or more small side chains of amino acids are replaced at the interface of the first antibody molecule with longer side chains (e.g., tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the long side chains are created at the interface of the second antibody molecule by replacing the long side chains of amino acids with smaller ones (e.g., alamine or threonine). This provides a mechanism to increase the yield of 0 of heterodimer on other undesired end products such as homodimers. Specific antibodies include entangled or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled with avidin, the other with biotin, said antibodies, for example, have been proposed to direct cells of the immune system to unwanted cells (US Pat. No. 4,676,980), and for treating HIV infection (WO 5 91/00360, WO 92/200373 and EP 03089). Heteroconjugate antibodies can be made using any convenient entanglement method. Suitable crosslinking agents are well known in the art and are described in the U.S. Patent. No. 4,676,980, together with a number of interlacing techniques. Antibodies with more than two valencies are contemplated.

For example, specific antibodies can be prepared. See, for example, Tutt et al. J. Immunol. 147: 60 (191), which is incorporated herein by reference. Antibodies of the invention include derivatives that are somehow modified, i.e., by the covalent attachment of any type of molecule to the antibody so that covalent attachment does not prevent the antibody from binding to the antigen and / or generating an anti-antibody response. -idiotipica. For example, I am not limited to the way, the antibody derivatives include antibodies that can be, for example, 1 glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protection / blocking groups, proteolytic separation, ligation to a cellular ligand and other protein, etc. Any of the numerous chemical modifications can be carried out by known techniques, including, but not limited to, specific chemical separation, acetylation, formylation, metabolic synthesis of tunicamycin, etc., additionally, the derivative may contain one or more non-classical amino acids. For some uses, including the in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody from different animal species are derived, such as antibodies having a variable region derived from a murine monoclonal antibody and a constant region derived from a human immunoglobulin. Methods for producing chimeric antibodies are known in the art. See, for example, Morrison, Science, 229: 1202, 1985; Oi et al., BioTechniques, 4: 214 1986; Gillies et al., J. Immunol. Methods, 125: 191-202, 1989; Patents of E.U.A. Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their totalities. Humanized antibodies are antibody molecules of non-human species that are bind to the desired antigen having one or more complementarily determining regions (RDC) of non-human species and regions of constant structure and domains of an immunoglobulin molecule. Frequently, the residues of the structure will be substituted with the corresponding residue of the RDC donor antibody to alter, preferably, improve the binding of the antigen. These structure substitutions are identified by methods well known in the art, e.g., by modeling the interactions of the RDC and structure residues to identify structural residues important for the binding of antigens and the comparison of sequences to identify residues of unusual structure in particular positions. See, e.g., Queen et al., U.S. Patent. No. 5,585,089; Riechmann et al., Nature, 332-323; 1988, which are incorporated herein by reference in their entirety. The antibodies can be humanized using a variety of techniques known in the art including, for example, grafting with RDC (EP 239,400, PCT publication WO 91/09967; US Patent Nos. 5,225,539; 5,530,101 and 5,585,089), coating or coating (EP 595,106, EP 30 519-596; Padlan, Molecular Immunology, 28 (4/5); 489-498, 1991; Studnicka et al., Protein Engmeenng, 7 (6): 805-814, 1994; Roguska et al., Proc. Nati. Acad. Sci. USA 91 ,: 969-973, 1994), mixed chains (US Patent No. 5,565,332), all of which they are incorporated herein by reference in their entirety. Humanized antibodies can be generated using any of the methods described in US Patents. Nos. 5,693,762 (Protein Design Labs), and publications of E.U.A. Nos. 20040049014, 200300229208, each of which is hereby incorporated by reference in its entirety.

Fully human antibodies are particularly suitable for the therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using libraries of antibodies derived from human immunoglobulin sequences. See Patents of E.U.A. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645; WO 98/50433; WO 98/24893; WO 98/16654; WO 96/34096; WO 96/33735; and WO 91/10741, each of which is hereby incorporated by reference in its entirety. Human antibodies can also be produced using transgenic mice that are unable to express functional endogenous immunoglobulins but that can express human immunoglobulin genes. For a review of this technology to produce human antibodies, see Lonberg and Huszar, Int. Rev. Immnol. 13: 65-93, 1995. For a detailed discussion of this technology to produce human antibodies and human monoclonal antibodies and protocols for producing said antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; Patents of E.U.A. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are incorporated herein by reference in their entirety. In addition, companies such as Abgenix, Inc. (Feemont, CA), Medarex (NJ) and Genpharm (San Jose, CA) can be coupled to provide human antibodies directed against a selected antigen using technology similar to that described above. Fully human antibodies that recognize a selected epitope can be generated using a technique called "guided selection". In this approach, a selected non-human monoclonal antibody, eg, a mouse antibody, is used to guide the selection of a fully human antibody that recognizes the same epitope (Jaspers et al., Biotechnology, 12: 899-903, 1988). The invention encompasses engineering human or humanized therapeutic antibodies (e.g., tumor specific monoclonal antibodies) in the Fc region by modification (e.g., substitution, insertion, deletion) of at least one amino acid residue, such modification increases the affinity of the Fc region for RcyRIIIA and / or Fc? RIIA. In another embodiment, the invention relates to engineering human or humanized therapeutic antibodies (e.g., tumor-specific monoclonal antibodies) in the Fc region by modification of at least one amino acid residue, said modification increasing the affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA and further decreases the affinity of the Fc region for FcyRIIB. Engineered therapeutic antibodies may also have improved effector function, e.g., improved CCDA activity, phagocytosis activity, etc., as determined by normal assays known to those skilled in the art. In a specific embodiment, the invention encompasses engineering a humanized monoclonal antibody specific for the Her2 / neu proto-oncogene (e.g., the humanized antibody Ab4D5 as described in Carter et al., 19992, Proc. Nati. Acad. Sci. USA 89: 4285-9) by modification (eg, substitution, insertion, deletion) of at least one amino acid residue whose modification increases the affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA In another specific embodiment, modification of the humanized monoclonal antibody Her2 / neu may also decrease the affinity of the Fc region for Fc? RIIB. In yet another specific modality, the humanized monoclonal antibodies treated by specific engineering for Her2 / neu may also have improved effector function as determined by normal analyzes known in the art and described and exemplified herein. In another specific embodiment, the invention encompasses engineering a human or mouse chimeric anti-CD20 monoclonal antibody, 2H7 by modification (e.g., substitution, insertion, deletion) of at least one amino acid residue whose modification increases the affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA. In another specific embodiment, the modification of the anti-CD20 monoclonal antibody, 2H7 can also decrease the affinity of the Fc region for Fc? RIIB. In yet another specific embodiment, the treated anti-CD20 monoclonal antibody, 2H7 may also have improved effector function as determined by normal assays known in the art and described and exemplified herein. In another specific embodiment, the invention encompasses engineering an anti-FcyRIIIB antibody including, but not limited to, any of the antibodies described in the Provisional Application of E.U.A. No. 60 / 403,266, filed August 12, 12002 and the Application of E.U.A. No. 10/643 857 filed on August 14, 2003, which has case No. 011183-010-999, Provisional application of E.U.A. No. 60 / 562,804 (which has the case No. 011183-014-888) that was filed on April 16, 2004; the Provisional Application of E.U.A. No. 60 / 569,882 (which has the case No. 011183-013-888) that was filed on May 10, 2004 and the Provisional Applications of E.U.A. We have Cases Nos. 011183-016-888, 011183-017-888, and 011183-018-888, each of which was filed on June 21, 2004, by modification (eg, substitution). , insertion, deletion) of at least one amino acid residue whose modification increases the affinity of the Fc region for FcyRIIIA and / or Fc? RIIA. Each of the applications mentioned above is incorporated here by reference in its entirety. Examples of anti-Fc? RIIB antibodies that can be treated according to the methods of the invention are monoclonal antibody 2H9 having accession number to ATCC PTA-5962 (all deposited at 10801 Umversity Boulevard, Manassas, VA 02209-2011), which they are incorporated here by reference. In another specific embodiment, the modification of the anti-Fc? RIIB antibody can also further decrease the affinity of the Fc region for FcyRIIB. In yet another specific embodiment, the treated anti? -FC? RIIb antibody, in addition, may have an improved effector function as determined by normal assays known in the art and described and exemplified herein. In a specific embodiment, monoclonal antibody 2B6 comprises a modification at position 334 with glutamic acid, at position 359 with asparagus, and at position 366 with serine (MgFcl3); or a substitution at position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid (MgFc27); or a substitution at position 243 with isoleucine, at position 379 with leucine, and at position 420 with valine (MgFc29); or a substitution at position 392 with threonine and at position 396 with leucine (MgFc38); or a substitution at position 221 with glutamic acid, at position 270 with glutamic acid, at position 308 with alanine, at position 311 with histidine, at position 396 with leucine, and in position 402 with aspartic acid (MgFc42); or a substitution at position 410 with histidine, and at position 396 with leucine (MgFc53); or a substitution at position 243 with leucine, at position 305 with isoleucine, at position 378 with aspartic acid, at position 404 with serine, and at position 396 with leucine (MgFc54); or a substitution at position 255 with isoleucine, and at position 396 with leucine (MgFc55); or a substitution at position 370 with glutamic acid and at position 396 with leucine (MgFc59) (See Table 5). 5. 1.1 POLYPEPTIDE AND ANTIBODY CONJUGATES The molecules of the invention (ie polypeptides, antibodies) comprising regions of variant Fc can be recombinantly fused or conjugated chemically (including covalently and non-covalently conjugated) to heterologous polypeptides (ie, an unrelated polypeptide, or portion thereof, preferably at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids of the polypeptide) to generate fusion proteins. The fusion does not necessarily have to be direct, but can occur through linker sequences. In addition, the molecules of the invention, (ie, polypeptides, antibodies) comprising regions of variant Fc can be conjugated to a therapeutic agent or a portion of drug can modify a given biological response. Therapeutic agents or portions of drugs should not be construed as limited to classical chemical therapeutic agents. For example, the drug position may be a protein or polypeptide having a desired biological activity. Such proteins may include, for example, a toxin such as & abpna, nema A, pseudomonas exotoxma, (i.e., PE-40), or diphtheria toxin, ricin & glone and antiviral protein of grana , a protein such as tumor necrosis factor, interferon including, but not limited to, a-interferon (IFN-a), β-interferon (IFN-β), nerve growth factor (NGF), growth factor derived from platelets (FCDP), activator tissue plasmomogen (APT), an apoptotic agent (e.g., TNF-α, TNF-β, AIM I as described in PCT Publication No. WO 97/33899), AIM II (see, PCT Publication No. WO 97/34911), Ligand Fas (Takahashi et al., J. Immunol., 6: 1567-1574, 1994), and VEGI (PCT Publication No. WO 99/23105), a thrombotic agent or an anti-aging agent. angiogenic (e.g., angiostatma or endostatin), or a biological response modifier such as, for example, a lymphocyte (e.g., methylleukin-1 ("11-1"), etherleuma-2 (" IL-2"), mteleucma-6 (" IL-6"), granulocyte macrophage stimulation factor (" FEC-MG ") and granulocyte colony stimulation factor (" FEC-G "), stimulation factor of macrophage colonies ("FEC-M"), or a growth factor (e.g., growth hormone ("HC")), proteases or ribonucleases The molecules of the invention (ie, polypeptides, antibodies) can be fused to sequences of markers, such as a peptide to facilitate Upon purification in preferred modalities, the amino acid sequence of the marker is a hexa-histidine peptide, such as the label provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others. , many of which are commercially available. As described in Gentz et al., 1989, Proc. Nati Acad. Sci. USA, 86: 821-824, for example, hexa-histidy provides purification convenient of fusion protein. Other peptide tags useful for purification include, but are not limited to, the "HA" hemagglutinin tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell, 37: 767 1984). and the "flag" label (Knappik et al., Biotechmques, 17 (4): 754-761, 1994). Additional fusion proteins can be generated through the techniques of gene blending, mixing of motifs, mixing of esons, and / or codon mixing (collectively referred to as "DNA blending"). The DNA mixing can be used to alter the activities of molecules of the invention (e.g., antibodies with higher affinities and lower dissociation regimes). See, in general, the Patents of E.U.A. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., 1997, Curr. Opinion Biotechnol. 8: 724-33; Harayama, 1998, Trends Biotechnol. 16:76; Hansson, et al., 1999, Mol Biol, 287: 265; and Lorenzo and Blasco, 1998, Bio Techniques 24: 308 (each of these patents and publications are hereby incorporated by reference in their entirety). The molecules of the invention comprising regions of variant Fc, or the nucleic acids encoding the molecules of the invention, can be further altered by subjecting to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods before recombination. One or more portions of a polynucleotide encoding a molecule of the invention can be recombined with one or more components, motifs, sections, parts, domains, fragments, etc., of one or more heterologous molecules. The present invention also encompasses molecules of the invention comprising regions of variant Fc (ie, antibodies, polypeptides) conjugated to a diagnostic or therapeutic agent and any other molecule for which it is desired to increase the serum half-life and / or that is directed to a particular subgroup of cells. The molecules of the invention can be used diagnostically, for example, to monitor the development or progression of a disease, disorder or infection as part of a clinical test procedure to, e.g., determine the effectiveness of a given treatment regimen. . Detection can be facilitated by coupling the molecules of the invention to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emission metals, and non-radioactive paramagnetic metal ions. The detectable substance can be coupled or conjugated either directly to the molecules of the invention or indirectly, through an intermediary (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent. No. 4,471,900 for metal ions that can be conjugated to antibodies for use as diagnostics in accordance with the present invention. Said diagnosis and detection can be achieved by coupling the molecules of the invention to detectable substances including, but not limited to, various enzymes, enzymes including, but not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholmesterase; complexes of the prosthetic group such as, but not limited to, streptavidin / biotin and avidin / biotin, fluorescent materials such as, but not limited to, umbelliferone, fluorescein, fluorescein isothiocyanate, rodamma, fluorescema dichlorotriazinilamma, dansyl chloride or phycoerythron; luminescent material such as, but not limited to, luminol, bioluminescent materials such as, but not limited to, luciferase, luciferma and aquopna; radioactive material such as, but not limited to, bismuth (213Bi), carbon (1C), chromium (51Cr), cobalt (57Co), fluoro (18F), gadolinium (153Gd, i59Gd), gallium (d8Ga, d7Ga), germam (68Ge), holmium (16dHO), indium (115In, 11JIn, 112In, mIn), iodine (i3i ^ 125 ^? 23T / i2iI) f lanthanum ("La), lutemo (17 / Lu), manganese (54Mn) , molybdenum (Mo), palladium (103Pd), phosphorus (32P), praseodium (142Pr), promised (149Pm), rhenium (18dRe, 188Re), rhodium (105Rh), ruthenium (97Ru), samarium (153Sm), scandium , 47, Sc), selenium (° Se), strontium (Sr), sulfur (S), technetium (99Tc), thallium (201 Ti), tin (11 Sn, "7Sn), tritium (3H), xenon (133Xe), ytterbium (189Yb, 1 5Yb), yttrium (T), zinc (° Zn), emitting metals of positrons using various positron emission tomes and non-radioactive paramagnetic metal ions The molecules of the invention (ie, antibodies, polypeptides) comprising a variant Fc region can be conjugated to a therapeutic portion such as a cytotoxin (vgr ., a cytostatic or cytocoidal agent), a therapeutic agent or a radioactive element (eg, alpha emitters, gamma emitters, etc.) Cytotoxins or cytotoxic agents include any agent that is detrimental to cells Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthrazine dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetraca ina, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil descarbazine), alkylating agents (e.g., mechloroethamine, thioepaclorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclotosfamide, busulfan, dibromomannitol, streptozotocin, mitomycin C and cis-dichlorodiammine platinum (II) (DDP), cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin and anthramycin (AMC), and anti-mitotic agents (e.g., vincristine and vinblastine) In addition, a molecule of the invention can be conjugated to therapeutic portions such as radioactive materials or macrocyclic chelants useful for conjugating radiometal ions (see above for examples of radioactive materials.) In certain embodiments, the macrocyclic chelator is 1, 4, 7, 10-tetra-azacyclododecane-N, N ', N "N" -tetraacetic (ADOT) which can be linked to the antibody via a linker molecule Such linker molecules are commonly known in the art and are described in Denardo et al., 1998, Clin Cancer Res. 4: 2483-90; Peterson et al, 1999, Bioconjug, Chem. 10: 553, and Zimmerman et al., 1999, Nuci, Med. Biol. 26: 943-50, each of which is hereby incorporated by reference in its entirety. therapeutic portions for antibodies are well-known, see, e.g., Arnon et al., "Monoclonal Antibodies for Immunotherapy of Drugs in Cancer Therapy," in Monoclonal Antibodies and Cancer Therapy, Reisfeld et al., (Eds.), 1985, p. 243-56, Alan R. Liss. Inc.); Hellstrom et al., "Antibodies for Drug Delivery", in Controlled Drug Delivery (2nd ed.), Robinson et al. (Eds.), 1987, p. 623-53, Marcel Dekker, Inc.), Thorpe, "Antibody Carriers of Cytotoxic Agents in Cancer Therapy: A Review," in Monoclonal Antibodies '84: Biological and Clinical Applications, Pinchera et al., (Eds.), 1983, p. . 4 / 5-306); 'Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy', in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al., (Eds.), 1985, pp. 303-16, Academic Press; Thorpe et al., Immunol. Rev., 62: 119-58, 1982. In one embodiment, wherein the molecule of the invention is an antibody comprising a variant Fc region, it can be administered cone without a conjugated therapeutic portion therefor, administered alone, or in combination with cytotoxic factors and / or cytokines to be used as a therapeutic treatment Alternatively, an antibody of the invention can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in the US Patent No. 4,676,980, which is hereby incorporated by reference in its entirety. antibodies of the invention can also be attached to solid supports, which are particularly useful for immunoassay or purification of the white antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. 5. 2 MOLECULAR SCREENING WITH VARIATIONABLE Fc REGIONS FOR IMPROVING AND CHARACTERIZING Fc RIII REGIONS In preferred embodiments, screening and identification of molecules comprising variant Fc regions with altered FcyR affinities (e.g., Fc affinity) Enhanced RIIIA) are performed using a yeast exposure technology as described herein in combination with one or more biochemical based assays, preferably in a high throughput form. The biochemical analyzes can be any analysis known in the art to identify the interaction of Fc-FcγR, that is, the specific binding of a Fc region to an FcyR, including, but not limited to, an ELISA analysis, of surface plasmotropic resonance, immunoprecipitation analysis, affinity chromatography and equilibrium dialysis. In some modalities, screening and identification of molecules comprising Fc regions variant with altered Fc? R affinities (e.g., improved Fc? RIIIA affinity) are made using the yeast exposure technology as described herein in combination with one or more functionally based analyzes, preferably in a high performance way. Functional-based analysis can be any analysis known in the art to characterize one or more functions of effector cells mediated by FcγR such as those described herein in Section 5.2.7. Non-limiting examples of effector cell functions that can be used according to the methods of the invention, include, but are not limited to, antibody-dependent cell-mediated cytotoxicity (CCDA), antibody-dependent phagocytosis, phagocytosis, opsonization , opsonophagocytosis, cell binding, rosette formation, Clq binding, and cytotoxicity mediated by complement-dependent cells. In some embodiments, screening and identification of molecules comprising variant Fc regions with altered FcγR affinities (e.g., improved FcγRIIIA affinity) are performed using the yeast deployment technology as described in present in combination with one or more biochemical based analyzes in combination or in parallel with one or more functionally based analyzes, preferably in a high performance form.

The term "specific binding" of a region of Fc to an Fc? R refers to an interaction of the Fc region and a particular Fc? R having a constant affinity of at least about 150 nM, in the case of Fc ? Monomeric RIIIA and at least about 60 nM in the case of dimeric Fc? RIIB as determined using, for example, an ELISA or surface plasmotropic resonance analysis (e.g., a BIAcore ™). The constant affinity of a Fc region for monomeric FcγRIIIA may be 150 nM, 200 nM or 300 nM. The constant affinity of an Fc region for dimeric Fc? RIIB can be 60 nM, 80 nM, 90 nM, or 100 nM. The dimeric RcyRIIB for use in the methods of the invention can be generated using methods known to one skilled in the art. Normally, the extracellular region of Fc? RIIB is covalently linked to a heterologous polypeptide which is capable of dimerization, so that the resulting fusion protein is a dimer, e.g., see, Application of E.U.A. No. 60 / 439,709, filed January 13, 2003 (Case No. 11183-005-888), which is hereby incorporated by reference in its entirety. A specific interaction is generally stable under physiological conditions, including, for example, conditions that occur in a living individual such as a human or other vertebrate or invertebrate, as well as conditions that occur in a cell culture, such conditions as those used to maintain and cultivate mammalian cells or cells of another vertebrate organism or an invertebrate organism. In a specific embodiment, screening and identification of molecules comprising variant Fc regions and altered FcγR affinities comprise: exposing the molecule comprising a variant Fc region on the surface of the yeast; and characterizing the binding of the molecule comprising the variant Fc region to an Fc? R (one or more), using a biochemical analysis to determine the interaction of Fc-Fc? R, preferably, an analysis based on ELISA. Once the molecule comprising a variant Fc region has been characterized for its interaction with one or more of the FcγR and it is determined that it has an altered affinity for one or more FcγR, at least by an analysis with biochemical basis, e.g., an ELISA analysis, the molecule can be engineered into a complete immunoglobulin using standard recombinant DNA technology methods known in the art and immunoglobulin comprising the variant Fc region in mammalian cells for additional biochemical characterization. The immunoglobulin into which the variant Fc region of the invention is introduced (e.g., replacing the Fc region of the immunoglobulin) can be any immunoglobulin, including, but not limited to, polyclonal antibodies, monoclonal antibodies, antibodies bispecific, multi-specific antibodies, humanized antibodies, and chimeric antibodies. In preferred embodiments, a variant Fc region is introduced into an immunoglobulin specific for a cell surface receptor, a tumor antigen, or a cancer antigen. The immunoglobulin in which a variant Fc region of the invention is introduced, can specifically bind to an antigen for cancer or tumor, for example, including, but not limited to, KS 1/4 pan-carcinoma antigen (Perez and Walker, 1990, J. Immunol., 142: 3662-3667, Bumal, 1988, Hybridoma 7 (4): 407-415), antigen for ovarian carcinoma (CA125) (Yu et al., 1991, Cancer Res. 51 (2): 468-475), prostatic acid phosphate (Tailor et al., 1990, Nucí Acids Res 18 (16), 4928), prostate-specific antigen (Henttu and Vinko, 1989, Biochem. Biophys. Res. Comm. 160 (2 ): 903-910; Israeli et al., 1993, Cancer Res 53: 227-230), antigen associated with p97 melanoma (Estin et al., 1989, J. Nati. Cancer Instit. (6): 445-446), melanoma antigen GP 75 (Vijayasardahl et al., 1990. J. Exp. Med. 171 (4): 1375-1380), high molecular weight melanoma antigen (AM-PMA) ( Natali et al., 1987, Cancer 59: 55-63, Milttelman et al., 1990, (Clin. Invest. 86: 2136-2144), prostate-specific membrane antigen, carcinoembryonic antigen (ACE) (Foon et al., 1994, Proc. Am. Soc. Clin. Oncol. 13: 294), antigen of polymorphic epithelial mucin, antigen of fat globules of human milk, antigens associated with colorectal tumors such as: ACE, Tag. -72 (Yokata et al., 1992, Cancer Res. 52: 3402-3408), C017-1A (Ragnahammar et al., 1993, Int. J. Cancer 53: 751-758); GICA 19-9 (Herlyn et al., 1982, J. Clin.Immunol., 2: 135), CTA-1 and LEA, antigen 38.13, of Burkitts lymphoma, CD19 (Ghetie et al., 1994, Blood 83: 1329-1336 ), human B-lymphoma-CD20 antigen (Reff et al., 1994, Blood 83: 435-445), CD33 (Sgouros et al., 1993, J. Nuci, Med. 34: 422-430), specific antigens for melanoma such as GD2 gangliosides (Saleh et al., 1993, J. Nucí, Med. 34: 422-430), specific antigens for melanoma such as GD2 ganglioside (Saleh et al., 1993, J. Immunol, 151, 3390-3398), ganglioside GD3 (Shitara et al., 1993, Cancer Immunol Immunother, 36: 373-380), ganglioside GM2 (Livingston et al., 1994, J. Clin. Oncol. 12: 1036-1044), ganglioside GM3 (Hoon et al., 1993, Cancer Res, 53: 5244-5250), type of transplantation specific for cell surface antigen (ATET) tumor such as virally induced tumor antigens including T-antigen DNA tumor virus and RNA tumor virus envelope antigens , oncofetal antigen- alpha -Fetoprotein such as ACE of colon, oncofetal antigen of bladder tumor (Hellstron et al., 1985, Cancer. Res. 45: 2210-2188), differentiation antigen such as human lung carcinoma antigen L6, L20 (Hellstrom et al., 1986, Cancer Res. 46: 3917-3923),a antigens, T-cell antigen for human leukemia Gp37 (Bhattacharya-Chatterj ee et al., 1988, J. Ofimmun.141: 1398-1403), neoglycoprotein, sphingolipids, antigen for breast cancer such as EGFR (factor receptor epidermal growth), antigen HER2 (pl85HER2), polymorphic EPITHELIAL MUCINE (mep) (Hilkens et al., 1992, Trends in BioChem. Sci. l /: 339), malignant human lymphocyte antigen-APO-I (Bernhard et al., 1989 , Science 245: 301-304), differentiation antigen (Feizi, 1985, Nature 314: 53-57) such as the antigen I found in fetal erythrocytes, primary endodermal antigen I found in adult erythrocytes, preimplant embryos, I (Ma ) found in gastric adenocarcinomas, M 18, M39 found in breast epithelium, SSEA-I found in myeloid cells, VEP8, VEP 9, Myl, VIM-D5, D 156-22 found in colorectal cancer, TRA-1-85 ( blood group H), C 14 found in colonic adenocarcinoma, F3 found in adenocarcinoma lung carcinoma, AH6 found in gastric cancer, and hapten. You? found in embryonal carcinoma cells, TL5 (blood group A), EGF receptor found in A431 cells, Ei & (blood group B) found in pancreatic cancer, FC10.2 found in embryonal carcinoma cells, gastric adenocarcinoma antigen, CO-514 (Led blood group) found in adenocarcinoma, NS-10 found in adenocarcinomas, CO-43 (blood group Leb), G49 found in EGF receptor of A431, MH2 cells (blood group Ale / Le?) found in colonic adenocarcinoma, 19.9 found in colon cancer, mucins of gastric cancer, Tr, A7 found in myeloid cells, R24 found in melanoma, 4.2, G03, DI.l, OFA-I, G "2, OFA-2, Gn ?, and M 1: 22-25: 8 found in embryonal carcinoma cells and SSEA-3 ySSEA-4 found in embryos in stages of 4 to 8. In one embodiment, the antigen is a peptide derived from the T cell receptor of a cutaneous T-cell lymphoma (see, Edelson, 1998, The Cancer Journal 4:62). In some embodiments, a variant Fc region of the invention is introduced into an anti-fluorescein monoclonal antibody, 4-4-20 (Kranz et al., 1982 J. Biol. Chem. 257 (12): 6987-6995; hereby incorporated by reference in its entirety). In other embodiments, a variant Fc region of the invention is introduced into a chimeric mouse-human anti-mouse 2H7 monoclonal anti-CD20 antibody, which recognizes CD20 cell surface phosphoprotein on B cells (Liu et al., 1987, Journal of Immunology , 139: 3521-6, which is incorporated herein by reference in its entirety). In still other embodiments, a variant Fc region of the invention is introduced into a humanized antibody (Ab4D5) against human epidermal growth factor receptor 2 (pi 85 HER2) as described by Carter et al. (1992, Proc. Nati). Acad. Sci. USA 89: 4285-9, which is incorporated herein by reference in its entirety). In still other embodiments, a Fc region variant of the invention is introduced into a humanized anti-TAG_72_antibody (CC49) (Sha et al., 1994 Cancer Biother 9 (4): 341-9). In other embodiments, a variant Fc region of the invention is introduced into Rituxan which is used to treat lymphomas. In another specific embodiment, the invention encompasses treating an anti-Fc? RIIB antibody including, but not limited to, any of the antibodies described in the Provisional Application of E.U.A. No. 60 / 403,266 filed on August 12, 2002; Application of E.U.A. No. 10 / 643,857, filed on August 14, 2003 (which has Case No. 011183-010-999); The Provisional Application of E.U.A. No. 60 / 562,804 (which has Case No. 011183-014-888) that was filed on April 16, 2004; Provisional Application of E.U.A. No. 60 / 569,882 (which has Case No. 011183-013-888) that was filed on May 10, 2004 and the Provisional Applications that have Cases Nos. 011183-016-888, 011183-017-888, and 011183 -018-888 each of which was filed on June 21, 2004, by modification (e.g., substitution, insertion, deletion) of at least one amino acid residue whose modification increases the affinity of the Fc region for Fc? RIIIA and / or Fc? RIIA. Examples of anti-Fc? RIIB antibodies that can be treated in accordance with the methods of the invention are monoclonal antibody 2B6 having accession number of ATCC PTA-4591 and 3H7 having accession number of ATCC PTA-4592, monoclonal antibody 1D5 having accession number of ATCC PTA-5958, monoclonal antibody 1F2 which has accession number of ATCC PTA-5959, monoclonal antibody 2DI 1 having accession number of ATCC PTA-5960, monoclonal antibody 2E1 having accession number of ATCC PTA-5961 and monoclonal antibody 2H9 having accession number of ATCC PTA -5962 (all deposited at 10801 Umversity Boulevard, Manassas, VA 02209-2011), which are incorporated herein by reference. In another specific embodiment, the modification of the anti-Fc? RIIB antibody may also further decrease the affinity of the Fc region for Fc? RIIB. In yet another specific embodiment, the anti-Fc? RIIB antibody may also have improved effector function as determined by normal assays known in the art and described and exemplified herein. In some embodiments, a variant Fc region of the invention is introduced into a therapeutic monoclonal antibody specific for an antigen for cancer or cell surface receptor including, but not limited to, Erbitux ™ (also known as IMC-C225) (ImClone Systems Inc.), a monoclonal antibody chimerized against EGFR, HERCEPTINO) (Trastuzumab) (Genentech, CA) which is a humanized anti-HER2 monoclonal antibody for the treatment of cancer patients metastatic breast, REOPRO © (abciximab) (Centocor) which is an anti-glycoprotein receptor Ilb / IIIa on platelets for the prevention of clot formation; ZENAPAX® (daclizumab) (Roche Pharmaceuticals, Switzerland) which is a humanized anti-CD25 antibody, immunosuppressant, for the prevention of rejection to acute renal allograft. Other examples are a humanized 18F (ab ') 2 anti-CD (Genentech); CDP860 which is an anti-CD18 (humanized F (ab ') 2 (Celltech, UK); Pro542 which is gpl20 anti-HIV antibody fused with CD4 (Progenics / Genzyme Transgenics); C14 which is an anti-CD14 antibody (ICOS Pharm ), a humanized anti-VEGF IgGl antibody (Genentech), OVAREX ™ which is a murine anti-CA 125 antibody (Altarex); PANOREX ™ which is a murine anti-17-lA cell surface IgG2a antigen antibody (Glaxo) Wellcome / Centocor); IMD-C225 which is a chimeric anti-EGFR IgCf antibody (ImClone System); VIT AXIN ™ which is a humanized anti-Vß3 integrin antibody (Applied Molecular Evolution / Medimmune); Campath 1H / LDP-03 which is a humanized anti-CD52 IgGl antibody (Leukosite); Smart M 195 which is a humanized anti-CD33 IgG antibody (Protein Design Lab / Kanebo); RITUXAN ™ which is a chimeric anti-CD20 IgGl antibody (IDEC Pharm / Genetech, Roche / Zettyaku); LIMPHOCIDE ™ WHICH IS AN HUMANIZED IGg ANTI-cd22 ANTIBODY (Immunomedics); Smart BDIO which is an anti radiolabeled murine anti-HLA body (Techniclone); anti-CDlla is an IgG antibody humanized ((Genetrech / Xoma); ICM3 is a humanized anti-ICAM3 antibody (ICOS Pharm); IDEC-114 is a primed anti-CD-80 antibody (IDEC Pharm / Mitsubishi); ZEVALIN ™ is an anti-CD20 antibody of radiolabeled mupno (IDEC / Shepng AG) IDEC-131 is a humanized anti-CD40L antibody (IDEC / Eisai) IDEC-151 is a primed anti-CD4 antibody (IDEC) IDEC-152 is an anti-human antibody. -CD23 (IDEC / Seikagaku); SMART ant? -CD3 is a humanized anti-CD3 IgG (Protein Design Lab); 5G 1.1 is a humanized anti-complement factor 5 (C5) antibody (Alexion Pharm); 151 is a ppmatized anti-CD4 IgGl antibody (IDEC Pharm / SmithKlme Beecham); MDX-CD4 is a human anti-CD4 IgG antibody (Medanex / Elisai (Genmab); CDP571 is a humanized anti-TNF-a IgG4 antibody (Celltech ); LDP-02 is a humanized anti? -a4ß7 antibody (LeukoSite / Genentech); OrthoClone OKT4A is a humanized anti-CD4 IgG antibody (Ortho Biotech), ANTOVA ™ is a humanized anti-CD40L IgG antibody or (Biogen); ANTEGREN ™ is a humanized anti-VLA-4 IgG antibody (Elan); MDX-33 is an antibody (Fc? R anti-human CD64 (Medarex / Centeon); rhuMab-E26 is an antibody IgGl anti-humanized IgE (Genentech / Novartis / Tanox Biosystems); IDEC-152 is an ant? Bodyant? -CD23 ppmatized (IDEC Pharm); ABX-CBL is an IgM anti CD-147 antibody from mupno (Abgenix); BTI-322 is a rat anti-CD2 IgG antibody (Medimmune / Bio Transplant); Orthoclone (OKT3 is a murine anti-CD3 IgG2a antibody (Ortho Biotech); SIMULECT ™ is a chimeric anti-CD25 IgGl antibody (Novartis Pharm); LDP-OI is a humanized IgG anti? -p2-? Ntegrma antibody (LeukoSite); Ant? -LFA-1 is an aF (ab ') ¿ant? -CD18 of murine (Pasteur-Merieux / Immunotech); CAT-152 is a human anti-TGF-β2 antibody (Cambridge Ab Tech); and Corsevm M is a chimeric anti-Factor VII antibody (Centocor). The variant Fc regions of the invention, preferably in the context of an immunoglobulm, can be further characterized using one or more biochemical analyzes and / or one or more functional analyzes, preferably in a high throughput form. One or more biochemical analyzes can be any analysis known in the art to identify Fc-FcγR interactions, including, but not limited to, an ELISA analysis, and surface plasmotype resonance-based analysis to determine kinetic parameters of Fc-Fc? R interaction, e.g., BIAcore analysis. The functional analyzes can be any analysis known in the art to characterize one or more effector cellular functions mediated by FcγR as known to one skilled in the art or as described herein. In specific embodiments, the immunoglobulms comprising the variant Fc regions are analyzed in an ELISA assay to bind to one or more FcγR, e.g., FcγRIIIA, FcRIIA, FcγRIIA, followed by one or more CCDA analysis. In some embodiments, the immunoglobulms comprising the variant Fc regions are analyzed using in addition an analysis based on surface plasmotype resonance, e.g., BIAcore. Analyzes based on surface plasmotype resonance are well known in the art and are discussed further in Section 5.2.7, and are exemplified herein in Example 6.8. An illustrative high throughput analysis for characterizing immunoglobulins comprising the variant Fc regions may comprise introducing a variant Fc region of the invention, eg, by normal recombinant DNA technology methods, into an antibody 4-4- twenty; characterizing the specific binding of the 4-4-20 antibody comprising the variant Fc region to an Fc? R, e.g., FC? RIIIA, Fc? RIIA, Fc? RIIA; followed by an ELISA analysis; characterizing the 4-4-20 antibody comprising the variant Fc region in an ADCC assay (using methods described herein) wherein the target cells are ozonized with the 4-4-20 antibody comprising the variant Fc region, the variant Fc region can then be cloned into a second immunoglobulin, e.g., 4D5, 2H7, and the second immunoglobulin characterized in a CCDA assay, wherein the target cells are opsonized with the second antibody comprising the variant Fc region . The second antibody comprising the variant Fc region is further analyzed using an ELISA-based assay to confirm specific binding to an Fc? R. Preferably, a variant Fc region of the invention binds to Fc? RIIIA and / or Fc? RIIA with a higher affinity than a wild-type Fc region as determined in an ELISA assay. More preferably, a variant Fc region of the invention binds to Fc? RIIIA and / or Fc? RIIA with a higher affinity and binds to Fc? RIIB with a lower affinity than a wild-type Fc region as determined in a ELISA analysis. In some embodiments, the variant Fc region binds to Fc? RIIIA and / or Fc? RIIa with affinity at least 2 times higher, at least 4 times higher, more preferably at least 6 times higher, even more preferably by at least 8 to 10 times higher with which a wild type Fc region binds to Fc? RIIIA and / or Fc? RIIA and binds to Fc? RIIIB with affinity at least 2 times lower, at least 4 times lower, more preferably at least 6 times lower, even more preferably at least 8 to 10 times lower with which a wild-type Fc region binds to Fc? RIIIB as determined in an analysis of ELISA. The immunoglobulin comprising the variant Fc regions can be analyzed at any point using an analysis based on surface plasmotype resonance, e.g., BIAcore, to define the kinetic parameters of the Fc-FcγR interaction, using methods described herein and known to those skilled in the art. Preferably, the Kd of a variant Fc region of the invention for binding to a monomeric Fc? RIIIA and / or Fc? RIIA as determined by the Biacore assay is about 100 nM, preferably about 70 nM, even more preferably of approximately 40 nM; and the Kd of the variant Fc region of the invention for binding to a dimeric Fc? RIIB is about 80 nM, about 100 nM, more preferably about 200 nM. In more preferred embodiments, the immunoglobulin comprising the variant Fc regions are further characterized in an animal model to interact with an FcγR. Preferred animal models for use in the methods of the invention are, for example, transgenic mice expressing human FcγR, e.g., any mouse model described in the U.S. Patent. No. 5,877,397, and 6,676,927 which are hereby incorporated by reference in their entirety. Transgenic mice for use in the methods of the invention include, but are not limited to, pure, knockout Fc? RIIIA mice, which carry human Fc? RIIIA; pure knockout RcyRIIIA mice bearing human Fc? RIIA; pure knocked out Fc? RIIIA mice carrying human Fc? RIIB and human Fc? RIIIA; pure knockout Fc? RIIIA mice carrying human Fc? RIIB and human Fc? RIIA, mice with pure knockout Fc? RIIIA and Fc? RIIA carrying Fc? RIIIA and human Fc? RIIA and mice with pure knockout Fc? RIIIA, Fc? RIIA and Fc? RIIB carrying Fc? RIIIA, Fc? RIIA and Fc? RIIB . 5. 2.1 DESIGN STRATEGIES The present invention encompasses treating methods for generating Fc variants including, but not limited to computational design strategies, bank generation methods and experimental production and screening methods. These strategies can be applied individually or in various combinations to treat the Fc variants of the present invention. In more preferred embodiments, the engineering methods of the invention comprise methods in which the amino acids at the interface between an Fc region and the Fc ligand are not modified. Fc ligands include, but are not limited to Fc? Rs, Clq, FcRn, C3, mannose receptor, protein A, protein G, mannose receptor, and undiscovered molecules that bind to Fc. The amino acids at the interface between an Fc region and an Fc ligand are defined as a direct and / or indirect contact between the Fc region and the ligand, they play a structural role in determining the conformation of the interface, or are within at least 3 angstroms, preferably at least 2 angstroms between them as determined by structure analysis, such as X-ray crystallography and molecular model. The amino acids at the interface between an Fc region and an Fc ligand include those amino acids that create direct contact with an FcγR based on crystallographic and structural analysis of Fc-FcγR interactions such as those described by Sondermann and others (2000, Nature, 406: 267-273, which is incorporated herein by reference in its entirety). Examples of positions within the Fc region to create direct contact with an FcγR based on structural and crystallographic analysis, e.g., are not within the binding site of Fc-FcγR. Preferably, the engineering methods of the invention do not modify any of the amino acids as identified by Shields et al., Which are located in the CH2 domain of an Fc region proximal to the ee region, e.g., Leu234-Pro238.; Ala327; Pro329, and affect the binding of an Fc region to all human Fc? R. In other embodiments, the invention encompasses Fc variants with altered Fc? R affinities and / or altered effector functions, such that the Fc variant does not have an amino acid modification at the position at the interface between an Fc region and the ligand of Fc. Preferably, said Fc variants in combination with one or more modifications of amino acids that are at the interface between an Fc region and the Fc ligand have an additional impact on the altered property in particular, e.g., affinity to altered Fc? R. The modification of amino acids at the interface between Fc and an Fc ligand can be performed using methods known in the art, for example, based on structural analysis of Fc-ligand complexes. For example, but not by way of limitation, by exploring energetically favorable substitutions at Fc positions that impact the binding interface, the variants can be engineered so that new conformations of the array are shown, some of which can improve the binding to the Fc ligand, some of which may reduce the binding of Fc-ligand and some of which may have other favorable properties. Said new conformations of mfafaz could be the result of, for example, the direct interaction with residues of Fc-ligand that form the interface or the indirect effects caused by the amino acid modifications such as the perturbation of conformations of the side chain or structure of base. The invention encompasses engineering the Fc variants comprising any of the amino acid modifications described herein in combination with other modifications in which they are altered the conformation of the Fc carbohydrate at position 297. The invention encompasses conformational and compositional changes in the N297 carbohydrate which can result in a desired property, eg, increased or reduced affinity for an Fc? R. Said modifications can further improve the phenotype of the original modification of the amino acid of the Fc variants of the invention. Although not intended to be linked to a particular mechanism of actions, this strategy is supported by the observation that the structure and conformation of carbohydrates dramatically affect the binding of Fc-Fc? R and Fc / CIq (Umaha et al., 1999 , Nat. Biotechnol 17, 176-180, Davies et al., 2001, Biotechnol Bioeng 74: 288-294, Mimura et al., 2001, J Biol Chem 276: 45539, Radaev et al., 2001, J Biol Chem 276: 16478- 16483; Shield et al., 2002, J Biol Chem 277-26733-26740; Shinkawa et al., 2003, J Biol Chem 278: 3466-3473). Another design strategy is provided to generate Fc variants according to the invention in which the Fc region is engineered again to eliminate the structural and functional dependence on glycosylation. This design strategy involves optimization of the Fc structure, stability, solubility and / or Fc function (e.g., affinity of Fc for one or more Fc ligands) in the absence of the N297 carbohydrate. In an approach, the positions that are exposed to the solvent in Absence of glycosylation is treated in a manner that is stable, structurally consistent with the Fc structure and has no tendency to aggregate. Approaches for optimizing aglycosylated Fc may involve, but are not limited to, designing amino acid modifications that increase the state and / or solubility of aglycosylated Fc by incorporating polar and / or charged residues that face inward toward the Cg2-Cg2 dimer axis. , and designing amino acid modifications that directly increase the agglomerated Fc-FcγR interface or the Fc aglycosylated interface with some other Fc ligand. The Fc variants of the present invention can be combined with other Fc modifications, including, but not limited to, modifications that alter effector function. The invention encompasses combining an Fc variant of the invention with other modifications of Fc to provide additive, smergistic or novel properties in antibodies or Fc fusions. Said modifications may be in the domains CH1, CH2, or CH3 or a combination thereof. Preferably, the Fc variants of the invention improve the property of the modification with which they are combined. For example, if an Fc variant of the invention is combined with a known mutant by binding to FcγRIIIA with a higher affinity than a comparable molecule comprising a wild-type Fc region, the combination with a mutant of the invention results in a several fold increase in the affinity of Fc? RIIIA. In one embodiment, the Fc variants of the present invention can be combined with other known Fc variants such as those described in Duncan et al., 1988, Nature 332: 563-564; Lund et al., 1991, J. Immunol 147: 2667-2662; Lund et al., 1992, Mol Immunol 29: 53-59; Alegre et al., 1994, Transplantation 57: 1537-1543; Hutchins et al., 1995, Proc Nati. Acad Sci E.U.A. 92: 11980-11984; Jefferis et al., 1995, Immunol Lett. 44: 111-117; Lund et al., 1995, Faseb J 9: 115-119; Jefferis et al., 1996, Immunol Lett 54: 101-104; Lun et al., 1996, J Immunol 157: 49634969; Armor et al., 1999, Eur J Immunol 29: 2613-2624; Idusogie et al., 2000, J Immunol 164: 41784184; Reddy et al., 2000, J Immunol 164; 1925-1933; Xu et al., 2000, Cell Immunol 200: 16-26; Idusogie et al., 2001, J Immunol 166: 2571-2575; Shields et al., 2001, J BioChem 276: 6591-6604; Jefferis et al., 2002, Immunol Lett 82: 57-65; Presta et al., 2002, Biochem Soc Trans 30: 487-490); USA 5,624,821; US 5,885,573; US 6,194,551; PCT WO 00/42072; PCT WO 99/58572; each of which is incorporated herein by reference in its entirety. 2 5. 2.2. . Fc? R-Fc BINDING ANALYSIS A binding analysis of Fc? R-Fc was developed to determine the binding of the molecules of the invention comprising regions of variant Fc to Fc? R, which allowed the detection and quantification of the interaction, despite the inherently weak affinity of the receptor to its ligand, e.g., on the micromolar scale for Fc? RIIB and Fc? RIIIA. The method involves the formation of an FcγR complex having an enhanced avidity for an Fc region, relative to an FcγR that has not complexed. According to the invention, the molecular complex is a tetrameric immune complex, comprising: (a) the soluble region of FcγR (e.g., the soluble region of FcγRIIIIA, FcγRIIA or FcΔRIIB); (b) a biotinylated 15 amino acid AVITAG sequence (AVITAG) operably linked to the C terminus of the soluble region of FcγR (e.g., the soluble region of FcγRIIIIA, FcγRIIA or FcΔRIIB); and (c) streptavidma-ficoeritrma (EA-FE); in a molar ratio to form a tetrameric FcγR complex (preferably in a molar ratio of 5: 1). According to a preferred embodiment of the invention, the fusion protein is enzymatically biotinylated, using for example, the Bir A enzyme from E. coll, a biotin ligase that specifically biotinylates a lysine residue in the AVITAG sequence of 15 amino acids . In a specific embodiment of the invention, 85% of the fusion protein it is biotinylated, as determined by normal methods known to those skilled in the art, including, but not limited to, streptavidin change analysis. According to preferred embodiments of the invention, the biotinylated fusion proteins are mixed with EA-FE in a molar ratio of biotinylated soluble Fc? R of IX EA-FE: 5X to form a tetrameric Fc? R complex. In a preferred embodiment of the invention, the polypeptides comprising Fc regions bind to the tetrameric FcγR complexes, formed according to the methods of the invention, with at least an 8 times higher affinity than the FcγR monomeric that does not form complex. The binding of polypeptides comprising Fc regions to the tetrameric FcγR complexes can be determined using standard techniques known to those skilled in the art, such as, for example, fluorescence activated cell selection (SCAF), radioimmunoassay, analysis of ELISA, etc. The invention encompasses the use of immune complexes formed according to the methods described above, to determine the functionality of molecules comprising an Fc region in cell-based or cell-free analysis. For convenience, reagents can be provided in an analytical equipment, that is, a combination packed with reagents to analyze the capacity of the molecules comprising regions of variant Fc that bind to tetrameric complexes of Fc? R. Other forms of molecular complexes to be used in order to determine Fc-FcγR interactions are contemplated for use in the methods of the invention, e.g., fusion proteins formed as described in the Provisional Application of E.U.A. 60 / 439,709 on January 13, 2003 (Case No. 11183-005-888); which is incorporated herein by reference in its entirety. 5. 2.3. MUTAGENESIS AND CONSTRUCTION OF YEAR EXHIBIT BANKS Molecular interactions between Fc IgG and Fc receptors have been previously studied by both structural and genetic techniques. These studies identified amino acid residues that are critical for the functional binding of Fc to different Fc? R. None of these changes has shown that the human Fc [alpha] R mediated efficacy of therapeutic antibodies in animal models is improved. A complete analysis of all potential amino acid changes in these residues or other potentially important residues has not been reported. The platform described herein has the ability to construct mutant banks with all possible amino acid changes, screen banks using multiple functional analyzes and finally analyzes banks in relevant humanized animal models. The present invention encompasses the construction of multiple banks based on genetic and structural data known in the art or being developed. The method described and exemplified herein incorporates the construction of individual libraries containing mutants that test changes in all 20 amino acids between 3-6 residues in the Fc region. The complete set of mutations will congregate in all possible combinations of mutations. The number of independent mutations generated is based on the number of sites that are being saturated during the congregation of the banks (Next Table 9). The size of the bank will determine the choice of the primary screening screen and therefore the choice of vector for initial cloning steps.

TABLE 9. NUMBER OF INDEPENDENT MUTANTS BASED ON THE NUMBER OF SATURATED SITES The present invention encompasses the construction of combinatorial banks, focusing on a limited number of critical residues (e.g., 3-6). Using a randomly mutagenized Fc IgGl bank and the screening analyzes described and exemplified herein, Fc variants were identified, in the initial cycles, the 5 best mutations will be selected based on the FcR binding profile and functional activity . 205 individual mutants will be taken to cover all possible changes of amino acids and their combinations in five places. A bank will be generated with coverage of at least 10 times for each mutant. In addition, regions will be chosen based on available information, eg, crystal structure data, binding differences with mouse / human isotype FcγR, genetic data and additional sites identified by mutagenesis. The major disadvantage of current site-directed mutagenic protocols is the production of prone populations, over-representative variations in some regions and unrepresentative or completely lacking mutations in others. The present invention overcomes this problem by generating non-prone arrangements of desirable Fc mutants using a well-developed gene construct technology to eliminate the propensity introduced in the construction of the bank by means of PCR-based approaches. 24 such as overlapping CPR and inverted CPR. The key distinctions of the approach of the present invention are: 1) Use of equimolar mixture of 20 individual oligos for each codon targeted by the target instead of degenerate primers. In this way each amino acid is represented by a single most used codon, while degenerate primers represent those amino acids encoded by more codons than those encoded by fewer codons. 2) The construction of mutants by a chain replacement approach. This ensures the non-prone introduction of all desirable changes in the final product. An illustrative protocol comprises the following steps: 1) phosphorylated oligos, which represent convenient changes in one or more places, all complementary to the same thread, added to the standard together with a 5 'exonuclease >3 'thermostable deficient, DNA polymerase and ligase (Fig. 25a); 2) the assembled mixture is subjected to a certain number of polymerization / bonding cycles, sufficient to generate the desirable amount of product. Use of a 5 'exonuclease deficient DNA polymerase > 3 'ensures the integrity of the initial sequence and its phosphate residue, when a thermostable ligase gathers extended fragments of the individual initiator into a contiguous single stranded chain. Reaction cycles can continue until the complete set of oligos is unloaded without introducing propensity in the generated combination of the final product (Fig. 25b) 3) of single-stranded mutants is converted to two-strand DNA by adding a specific primer for genes inverse to the reaction (Fig. 25c) 4), the product of double strand can be digested in restriction sites designed at the end and cloned into an appropriate expression vector (Fig. 25 Id). To ensure the quality of the bank, amplified PCR fragments will be analyzed by electrophoresis to determine the length of the final PCR products. The reaction will be characterized as successful if > 99% of the CPR products are of the expected length. The final bank will be cloned into an expression vector. A fraction of the mutant bank will be sequenced to determine the rate of incorporation of the mutant codon. The number of fragments sequenced will be based on the number of target sites mutated and the validation of the bank will be determined by the mutation rate observed in the targeted sites (Table 10). The speed of the vector without inserts should be less than 2%. Mutation velocity in non-directed site should be less than 8%. Banks that contain clones with > 90% of correct inserts will allow us to maintain sieving time lines.

TABLE 10 EXPECTED SPEEDS OF MUTATION FOR BANKS Waste Approximate mutation regimes for bank validation White # Single Double Triple Cuád. Quint. Sext. Reac. Sec. 3 20 42% 43% 15% NA NA NA 4 50 29% 43% 21% 7% NA NA 5 75 18% 35% 32% 11% 4% NA 6 100 12% 20% 40% 20% 6% 2% In other embodiments, the invention encompasses overlap or reverse CPR for bank construction. In order to continue without propensities, the individual primers will be used for each codon instead of degenerative primers. A validation scheme similar to the one described above will be used. More preferably, automatic protocols will be used for the production of high performance banks. Automation allows for improved performance, running operation and a global reduction in experimental error for tasks that require repetitive tedious operations. The oligo synthesis capabilities are based on 2"Mermade" DNA synthesizers (Bioautomation, Inc.) with a total output capacity of 575 60 mer Oligos / 12 Hrs. The software owner handles all aspects of design, synthesis and storage of the final oligonucleotides. Robotic fluid manipulators will be used to establish the oligos for the synthesis of full-length Fc mutants and binding reactions will be established to incorporate the mutant Fes into antibody heavy chain expression vectors. After the union it is estimated that it will take 1-FTE - 10 days to fix the bank's clones and generate -8000 minipreparations, which is equivalent to a combinatorial bank saturated in 3 sites. After the bacterial transformation, an Op? X-2 clone sowing robot will be used to plant colonies in 96 deep wells. The development of cultures will be carried out using a magnetic levitation stirrer, capable of incubating 12 plates and resulting in a dense development in 12-15 hours at 37 ° C. A Mmiprep Qiagen robot will be used to make DNA preparations at the speed of 496 plates in 2.5 hours. Overlapping tasks could create 5 similar banks in 9 months with 1 FTE. Affinity maturation requires the assembly of a new group of combinations of mutations, a set of preselected mutants or members of a family of genes, which can be enriched by a selection protocol. The process was repeated several times until isolation of a mutant with the desired phenotype was achieved. The disadvantage of the current enzymatic approach, DNA mixture, for Achieving this process is the propensity that can be introduced because specific sites within the gene that are hotspots for nucleases, there is dominance of specific mutants in the final regrouped combination and the loss of some of the original mutants in the final combination. With the fm to overcome this inconvenience, a gene construction technology (CUG) will be used to generate a highly complex bank of Fc mutants that contain random amino acid changes at all potential sites that may be important for receptor binding. Groups of degenerate oligos covering specific regions of Fc IgG will be used (See Fig. 26). The oligos will be -30 nt and synthesized degenerate oligos will be constructed to change one (40 oligos) or two AAs (8 oligos). The oligos are designed to overlap without spaces. It takes 200 oligos to accommodate all the changes of a single AA and -2000 to change two AAs per ollgonucleotide. All 2000+ oligos will be used individually and in combination to generate Fc mutant arrangements using the protocol described above (A20). A homemade randomizing program and a robotic liquid manipulator will be used to mix the selected combinations of mutants and wild-type oligos. Large banks will be cloned into vectors that will allow screening using yeast surface exposure. East The approach uses a magnetic bead selection followed by flow cytometry and has been successfully applied to banks with a complexity of > 109 (Feídhaus et al., 2003, Nat. Biotech, 21 (2): 163-170, which is incorporated herein by reference in its entirety). This limits the number of possible tests in a combination 7, resulting in -1.3 x 109 possible mutations / combinations. To ensure the quality of the amplified PCR fragments from the bank, they will be analyzed by electrophoresis to determine the length of the final PCR products. The reaction will be characterized as successful if > 99% of the CPR products have the desired length. A fraction of the mutant bank will be sequenced to determine the rate of incorporation of the mutant codon. The number of fragments sequenced will be based on the number of target sites mutated and the validation of the bank will be determined by the observed rate of mutation in targeted sites (Table 10). The velocity of vectors without inserts could be less than 2%. The mutation rate at sites not targeting the target could be less than 8%. The ability to generate the desired level of mutagenesis efficiency by this approach will be determined by sequencing a subset of clones. The alternative for CUG will be the use of a "DNA blending" protocol. This requires combining all the mutants, single, double, triple, etc. After DNA preparation, the Fc regions will be amplified by PCR using flanking primers that selectively amplify the mutated region of the Fc, -700 bp. The novel mutants are constructed by remixing the mutations in the Fc via the selected DNA treatment of the amplified DNA and the isolation of the 150-200 bp fragments (see, for example, Stemmer et al., 1994, Proc. Nati. Acad. Sci. USA 91: 10747-51). The fragments will be reassembled, PCR will be amplified with nested primers and cloned into the yeast surface exposure vector, pYDI. The recombined bank will be re-selected in the yeast Fc exposure screen as described and exemplified herein. CUG banks will use most of the same equipment as the combinatorial bank. However, cloning will be done in a suitable vector to exhibit the yeast surface and will not require disposing of the individual clones since the yeast surface exposure will initially be used for the enrichment of large banks. Then the appropriate level of the individual enrichment clones will be arranged. An initial bank of molecules comprising regions of variant Fc are produced using any random base mutagenesis technique known in the art. It will be appreciated by someone skilled in the art that the variants of the amino acid sequence of Fc regions can be obtained by any mutagenesis technique known to those skilled in the art. Some of these techniques are briefly described here, however, it will be recognized that alternative procedures can produce an equivalent result. In a preferred embodiment, the molecules of the invention comprising variant Fc regions are prepared by error prone PCR as illustrated in Example 6, above. (See Leung et al., 1989, Technique, 1:11). It is especially preferred to have error rates of 2-3 bp / Kb for use in the methods of the invention. In one embodiment, by using an error-prone PCR, a mutation frequency of 2-3 mutations is obtained (Kb. Mutagenesis can be carried out according to any of the techniques known in the art including, but not limited to a, synthesizing an oligonucleotide having one or more modifications within the sequence of the Fc region of an antibody or a polypeptide comprising an Fc region (e.g., the domain of CH2 or CH3) to be modified. site-specific mutagenesis allows the production of the mutants by using specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides to provide a sequence of primers of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion, the binding being prevented. Normally, an initiator of about 30 to about 45 nucleotides or more in length is preferred to be O, with about 10 to about 25 or more residues altered on both sides of the junction of the sequence. A number of such primers introducing a variety of different mutations in one or more positions can be used to generate a pool of mutants. The site-specific mutagenesis technique is well known in the art, as exemplified by several publications (see, e.g., Kunkei et al., Methods Enzymol 5 154: 367-82, 1987, which is incorporated herein by reference. In its whole) . In general, site-directed mutagenesis is performed by first obtaining a single-stranded vector or by fusing together a double-stranded vector that includes within sequence and a DNA sequence encoding the desired peptide. An ollgonucleotide primer having the desired mutated sequence is prepared, generally synthetically. This initiator then assembles with the single-strand vector 0, is subjected to polymerization of DNA enzymes such as DNA polymerase T7, in order to complete the synthesis of the strand containing the mutation. Therefore, a heteroduplex is formed wherein said strand encodes the original non-mutated sequence and the second strand contains the desired mutation. The heteroduplex vector is then used to transform or transfect the appropriate cells. Such as E. coli cells, and the clones are selected which include recombinant vectors having the skeletal muscle sequence arrangement. As will be appreciated, the technique normally employs a phage vector that exists in the form of a single strand and two strands. Typical vectors useful in site-directed mutagenesis include vectors such as M13 phage. These phages are commercially available and their use is generally well known to those skilled in the art. Double-stranded plasmids are also routinely employed in site-directed mutagenesis which eliminates the step of transferring the gene of interest from a plasmid or phage. Alternatively, the use of RCP ™ whose commercially available thermostable enzymes such as Taq DNA polymerase can be used to incorporate a mutagenic oligonucleotide primer into a DNA fragment amplified so that it can be cloned into an appropriate cloning or expression vector. See, e.g., Tomic et al. Nucleic Acid Res., 18 (6); 1656, and Opender et al., Biotehcniques! 8 (1): 29-30, 32, 1995, for RCPIM 'mediated mutagenesis procedures that are incorporated herein by reference in its entirety. RCP ™ which employs a thermostable ligase in addition to a thermostable polymerase, can also be used to incorporate a phosphorylated mutagenic oligonucleotide into an amplified DNA fragment which can then be cloned into an appropriate cloning or expression vector (see, for example, Michael, Biotechniques, 16 (3): 410-2, 1994, which is incorporated herein by reference in its entirety). Another method for preparing variants for use in the invention is cassette mutagenesis based on the technique described by Wells et al. (1985, Gene, 34; 315). The starting material is the plasmid comprising the desired DNA encoding the protein to be mutated (e.g., the DNA encoding a polypeptide comprising an Fc region). The codon (s) is identified in the DNA sequence that will be mutated; there must be a single endonuclease restriction site on each side of the mutation sites. If there is no such restriction site, it can be generated by oligonucleotide-directed mutagenesis. After the restriction sites have been introduced into the plasmid, the plasmid is cut at these sites and aligned. A double-stranded oligonucleotide that encodes the DNA sequence between the restriction sites but contains the mutation is synthesized using normal procedures known to those skilled in the art. The double oligonucleotide strand is referred to as the cassette. This cassette is designed to have 3 'and 5' ends that are compatible with the ends of the aligned plasmid, such that it can be ligated directly to the plasmid. Other methods known to those skilled in the art can be used to produce sequence variants of the Fc region of an antibody or polypeptides comprising an Fc region. For example, recombinant vectors encoding the amino acid sequence of the constant domain of an antibody or a fragment thereof can be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants. Once a bank of mutants is produced according to the described methods, the mutagenized bank is transformed into a yeast strain, preferably EBYI00 (Invitrogen), MAT to ura3-52 trpl leu2? L his3? 200 pep4 :: HIS3 prbl? L.dR canl GAL :: GAL-AGA1 using a normal lithium acetate transformation protocol known to those skilled in the art ( ref.): It will be appreciated by one skilled in the art, that once the molecules of the invention with desired binding properties have been identified (e.g., molecules with variant Fc regions with at least one amino acid modification) , said modification improves the affinity of the Fc region for Fc? RIIIA in relation to a molecule comparable, comprising a wildtype Fc region) (see Section 5.1 and Table 2) according to the methods of the invention, other molecules (ie, therapeutic antibodies) can be treated using normal recombinant DNA techniques and any other recombinant DNA technique. known mutagenesis, as described in this section to produce treated molecules containing the identified mutation sites. 5. 2.4. EXHIBITION OF YEAST SURFACE The preferred method for screening and identifying molecules comprising variants of Fc regions with altered Fc? R affinities (ie, affinity of Fc? RIIIA and / or Fc? Enhanced RIIA) is surface exposure technology of yeast (for review see Boder and Wittrup, 2000, Methods in Enzymology, 328: 430-444, which is incorporated herein by reference in its entirety) which addresses the deficiency in the prior art for screening modified post-cellular extracellular protein binding interactions. translationally Specifically, exposure of the yeast surface is a genetic method by which polypeptides comprising Fc mutants are expressed in the cell wall of the yeast in an accessible form to interact with FcγR. The yeast surface exposure of the mutant Fc containing polypeptides of the invention can be made according to any of the techniques known to those skilled in the art. See Patents of E.U.A. Nos. 6,423,538; 6,114,147; and 6,300,066, all of which are hereby incorporated by reference in their entirety. See Boder et al., 1997 Nat. Biotechnol. 15: 553-7; Shusta et al., 1997, Mol. Biol. 292: 949-56; Shusta et al., 1999 Curr. Opin. Biotechnol. 10: 117-22; Shusta et al., 200 Nat. Biotechnol. 18: 754-9; Wittrup et al., 1994 Ann Ny, Acad. Sci. 745: 321-30; Wittrup et al., 1994 Cytometry, 16: 206-13; Wittrup, 1995 Curr. Opin, Biotechnol. 6: 203-8; Wittrup, 1999 Trends Biotechnol, 17: 423-4; Wittrup, 2000 Nat. Biotechnol. 18: 1039-40; Wittrup, 2002 Curr. Opin. Biotechnol. 12: 395-9. The yeast surface exposure will be used to enrich banks containing > 107 independent clones. This approach will provide the ability to enrich brandes banks > 20 times in a single classification. Fc mutant banks with > 10,000 independent mutants (4 or more sites) will be cloned into the appropriate vectors to display the yeast surface and enriched by SCAF classification until they can be tested < 8,000 mutants through other biochemical and functional analyzes as described below. The invention provides methods for constructing a mutant Fc library in yeast to display molecules comprising regions of Fc, which have been mutated as described in Section 5.2.2. Preferably, the banks Fc mutants for use in the methods of the invention contain at least 10 7 cells, up to 10 9 cells. An illustrative method for constructing an Fc library for use in the methods of the invention comprises the following nucleic acids encoding molecules comprising Fc regions are cloned into the multiple cloning site of a vector derived from a yeast replication vector, e.g., PCT302; so that the nucleic acids encoding Fc are expressed under the control of GALl galactose inducible promoter and in frame with a nucleotide sequence encoding AGA 2p, the cell wall protein of esterification agglutinin. In a preferred embodiment, the nucleic acids encoding the molecules comprising the Fc regions are C-terminally cloned for the coding region of Aga2? and polypeptides comprising the Fc regions will be extracellularly secreted and displayed on the cell wall via disulfide ligation for the Agalp protein, an integrated cell wall protein, using the preferred construction of the invention. In an alternative embodiment, the constructs may further comprise nucleotide sequences encoding epitope tags. Any nucleotide of epitope tags encoding sequences known to those skilled in the art may be used in accordance with the invention, including, but not limited to, nucleotide sequences that encode hemagglutinin (HA), c-myc Xpress TAG, His-TAG, or B5TAG. The presence of the fusion protein on the surface of yeast cells can be detected using VACS analysis, focal fluorescence microscopy or normal immunostaining methods all of which are known to those skilled in the art. In one embodiment, the presence of the Fc fusion proteins of the invention on the surface of yeast cells are detected using monoclonal antibodies specific for Fc (specific for CH3). Including, but not limited to, monoclonal antibody specific for IgGl Fc, HP6017 (Sigma), JL512 (Immunotech) and any antibody described in Partridge et al., 1986, Molecular Immunology, 23 (12). 1365-72, which is incorporated herein by reference in its entirety. In another embodiment, the presence of the Fc fusion proteins of the invention is detected by immunofluorescent labeling of epitope tags using techniques known to those skilled in the art. It is particularly useful in the methods of the invention to use nucleotide sequences encoding epitope tags to flank the nucleic acids encoding the Fc fusion proteins, as an internal control, to detect whether the fusion proteins are exposed on the wall cellular in a partially proteolyzed form. 5. 2.5 SCREENING OF YEARS EXHIBIT BANKS The invention encompasses sifting the yeast exposure banks using immunological-based assays including, but not limited to, cell-based analysis, solution-based analysis, and solid phase analysis. In some embodiments, the invention encompasses the identification of Fc mutants with altered FcγR affinities using affinity maturation methods that are known to those skilled in the art and are encompassed herein. In summary, affinity maturation creates novel alleles by randomly recombining individual mutations present in a mutant bank, see, for example, Hawkins et al., 1992, J. Mol. Biol. 226: 889-896; Stemmer et al., 1994 Nature, 370: 389-91; both of which are incorporated herein in their entirety by reference. It has been used successfully to increase the affinity of antibodies, T cell receptors and other proteins. The invention encompasses the use of mutations that show increased Fc [beta] R binding as a baseline to construct new pools of mutants with improved phenotypes. Using the methods of the invention, a population of Fc IgGl mutants enriched by exposure of yeast surface for increased binding to an FqR, e.g., Fc? RIIIA, can be selected. After the preparation of DNA, the Fc regions can be amplified by PRC using flanking primers that selectively amplify the mutated region of the Fc, which is about -700 bp using methods known to one skilled in the art and exemplified or described herein. It can then be interpreted that novel mutants mix the mutations in the Fc region for example, via DNAse treatment of the amplified DNA and the isolation of fragments using methods such as those described by Stemmer et al., 1994 Proc. Nati Acad. Sci. USA 91: 10747-51, which is incorporated herein by reference in its entirety. The fragments can then be religated, PCR amplified with nested primers and cloned into the yeast exposure vector, v.gr, pYDI using methods known to one skilled in the art. The recombined bank can be reselected in the yeast Fc exposure screen. As the KD decreases below 10 nM, conditions can be established to allow additional increases in affinity based on the complete reduction of the Fc? RIIIA ligand rate of the Fc receptor using methods known in the art such as those described in Boder et al., 1998, Biotechnol. Prog. 14: 55-62, which is incorporated herein by reference in its entirety. The invention encompasses a synthetic screen of the yeast bank. A kinetic screen can be established by marking the cells that present the Fc up saturation with a labeled ligand, e.g., a fluorescent ligand followed by incubation with an excess of unlabeled ligand for a predetermined period. After finishing the reaction by the addition of excess buffer solution (eg, IX PBS, 0.5 mg / ml BSA) the cells will be analyzed by SCAF and sorting gates for selection will be set. After each enrichment cycle, individual mutants can be tested to increase affinity times and sequence for diversity. The m vitro recombination process can be repeated. In some modalities, the in vitro analysis is repeated at least 3 times. The selection of the Fc variants of the invention can be performed using any FcγR including, but not limited to, polymorphic variants of FcγR. In some embodiments, the selection of Fc variants is performed using a polymorphic variant of FcγRIIIA containing a phenylalanine at position 158. In other embodiments, the selection of Fc variants is performed using a polymorphic variant of Fcα. RIIIA containing a value at position 158. Fc? RIIIA 158V exhibits a higher affinity for IgGl pair than 158F and increased CCDA activity (see, e.g., Koene et al., 1991, Blood 90: 1109-14, Wu et al., 1997, 7, Invest Clin 100: 1059-70, both of which are incorporated herein by reference in its totality); this residue indeed interacts directly with the lower IgG1 axis region as recently shown by co-crystallization studies of IgG1-FcγRIIIA, see, e.g., Sonderman et al., 2000, Nature, 100; 1059-70 which is hereby incorporated by reference in its entirety. Studies have shown that in some cases therapeutic antibodies have improved efficacy in patients homozygous with Fc? RIIIA - 158V. For example, the humanized anti-CD20 monoclonal antibody Rituximab was therapeutically more effective in homozygous patients with Fc? RIIIA-158V compared to homozygous patients with Fc? RIIIA-158F (See, e.g., Cartron et al., 2002, Blood , 99 (3): 754-8). Although not intended to be linked to a particular mechanism of action, the selection of the Fc variants of the invention with the FcγRIIIA-158F allotype can provide variants that were already treated in therapeutic antibodies will be clinically more effective for homozygous patients of Fc? RIIIA - 158F. The invention encompasses screening yeast libraries based on the suppression of FcγRIIB and selection of FcγRIIIA so that the Fc mutants are selected not only by having an increased affinity for FcγRIIIA but also by having a reduced affinity for Fc. ? RIIB. Yeast banks can be enriched for clones that have a reduced affinity for Fc? RIIB by deletion methods sequential, for example, incubating the yeast bank with magnetic beads coated with Fc? RIIB. The deletion of Fc? RIIB is preferably carried out sequentially so that the bank is enriched in clones having a reduced affinity for Fc? RIIB. In some embodiments, the Fc? RIIB deletion step results in a population of cells so that only 30%, preferably only 10%, more preferably only 5%, still more preferably less than 1%, bind to Fc? RIIB. In some embodiments, the suppression of Fc? RIIB is carried out in at least 3 cycles, in at least 4 cycles, at least 6 cycles. The Fc [RIIB] deletion step is preferably combined with a Fc [RIIIA] selection step, for example, using SCAF selection so that Fc variants with increased affinity for Fc [RIIIA] are selected. 5. 2.5.1. ANALYSIS OF SCAF; SOLID PHASE ANALYSIS AND IMMUNOLOGICAL BASED ANALYSIS The invention encompasses the characterization of the mutant Fc fusion proteins that are exposed in the yeast surface cell wall, according to the methods described in Section 5.2.3. One aspect of the invention provides a method for selecting the mutant Fc fusion proteins with a convenient binding property, specifically, the capacity of the Fc fusion protein. mutant to bind to Fc? RIIIA and / or Fc? RIIA with a higher affinity than a comparable polypeptide comprising a wild-type Fc region binds to Fc? RIIIA and / or Fc? RIIA. In another embodiment, the invention provides a method for selecting mutant Fc fusion proteins with a specifically desirable binding property, the ability of the mutant Fc fusion protein to bind to Fc? RIIIA and / or Fc? RIIA with an affinity. greater than a comparable polypeptide comprising a wild-type Fc region binds to FcγRIIIa and / or FcγRIIA and further the ability of the mutant Fc fusion protein to bind to FcγRIIB with a lower affinity to that a comparable polypeptide comprising a wild-type Fc region binds to Fc? RIIB. It will be appreciated by those skilled in the art that the methods of the invention can be used to identify and screen any mutation in the Fc regions of molecules, with any desired binding characteristic. Yeast cells that expose the mutant Fc fusion proteins can be examined and characterized by any biochemical or immunological based analysis known to those skilled in the art to evaluate binding interactions. Preferably, the selection of fluorescence activated cells (SCAF), using any of the techniques known to those skilled in the art, are used for examining the fusion proteins of mutant Fs displayed on the yeast cell surface to bind to FcγRIIIA, preferably the tetrameric complex of FcγRIIIA, or optionally FcγRIIB. Flow sorters are able to rapidly screen a large number of individual cells containing bank inserts (eg, 10-100 million cells per hour) (Shapiro et al., Practicll Flow Cytometry, 1995). Additionally, specific parameters used for optimization that include, but are not limited to, ligand concentration (ie, tetrameric complex of Fc? RIIIA), kinetic competition time, or SCAF restriction may vary in order to select the cells which expose Fc fusion proteins with specific binding properties, eg, higher affinity for FcγRIIIA compared to a comparable polypeptide comprising a wild-type Fc region. Flow cytometries to select and screen biological cells are well known in the art. The known flow cytometries are described, for example, in the Patents of E.U.A. Nos. 4,347,935, 5,464,581, 5,483,469, 5,602,039, 5,643,796 and 6,211,477, all the contents of which are incorporated herein by reference. Other known flow cytometers are the SCAF Vantage ™ system manufactured by Becton Dickinson and DCompany, and the COPAS ™ system manufactured by Union Biometrica.

In accordance with a preferred embodiment of the invention, yeast cells were analyzed by fluorescence activated cell selection (SCAF). In most preferred embodiments, the analysis of SCAF from the yeast cells is performed interactively, at least twice, at least three times, or at least five times. Between each selection cycle the cells are again developed and induced so that the Fc regions are exposed to the maximum number of yeast cell surfaces. Although not intended to be linked to a particular mode of action, this interactive process helps to enrich the population of cells with a particular phenotype, e.g., high binding to FcγRIIIA. In the preferred embodiments, the sieving of the Fc vanantes of the invention comprises a selection process having multiple sieving cycles, eg, at least two sieving cycles. In one embodiment, screening of Fc variants having an increased affinity for FcγRIIIA may comprise the following steps in the first screening cycle, a bank of yeast cells, eg, a native bank of 10 7 cells is enriched by SCAF, preferably in an interactive manner, using for example, labeled tetrameric Fc? RIIIA to select Fc variants having an increased affinity for Fc? RIIIA; the variant Fc region that is selected with the desired phenotype, e.g., enhanced binding to FcγRIIIA, is then introduced into an antibody, e.g., antibody 4-4-20a, and the treated antibody is analyzed using a secondary screening, e.g. , ELISA to join an Fc? R. In the second screening cycle, a single mutation bank can be generated based on the first screening so that the Fc region hosts the variant that shows the increased affinity for Fc? RIIIA; and is enriched by SCAF using, for example, monomeric FcγRIIIA labeled both in the presence and absence of the unlabeled receptor; and the variant Fc region is then introduced into an antibody, e.g., a 4-4-20 a antibody, and the treated antibody is analyzed using a secondary screen, e.g., ELISA to bind to an Fc? R. In some embodiments, the secondary screen may further comprise characterizing the antibodies comprising the Fc variants in a CCDA or analysis based on BIAcore using methods described herein. An illustrative method for analyzing yeast cells expressing mutant Fc fusion proteins with SCAF restricts the cells with the tetrameric FcγRIIIA complex which has been labeled with a fluorescent tag such as, FE and an anti-Fc antibody, such as F (ab) 2 anti-Fc that has been fluorescently labeled. Fluorescence measurements of a yeast bank produced according to the methods of the invention preferably involve comparisons with controls; for example, yeast cells lacking the coding molecules of inserts comprising an Fc region (negative control). The flow sorter has the ability not only to measure fluorescent signals in cells at a rapid rate, but also to collect cells that have specific fluorescent properties. This aspect will be employed in a preferred embodiment of the invention to enrich the initial bank population for cells expressing Fc fusion proteins with specific binding characteristics, e.g., higher affinity for FcγRIIIA compared to a comparable polypeptide it comprises a wild-type Fc region. In a preferred embodiment of the invention, yeast cells are analyzed by SCAF and sorting gates are established to select cells that show the highest affinity for FcγRIIIA relative to the amount of Fc expression on the surface of yeast cells . According to a preferred embodiment, four consecutive classifications were established, where the floodgates for each successive classification are 5.5%, 1%, 0.2% and 0.1%. It is preferred that the bank showing the yeasts formed according to the methods of the invention be over-displayed at least 10 times to improve the probability of isolating rare clones (e.g., analyzing ~ 108 cells from a bank of 107). clones). Alternatively, it They established 2-5 classes to select the cells of the desired phenotype. Selection gates can be established empirically by someone skilled in the art. In other preferred embodiments, the mutant Fc fusion proteins displayed on the surface of yeast cells are screened using solid phase based assays, for example, magnetic bead analysis, e.g., supplied by Dynal, preferably in a form high performance to join an Fc? R, v.gr., Fc? RIIIA. In one embodiment, magnetic bead analyzes can be used to identify mutants with increased affinity for Fc? RIIIA and / or reduced affinity for Fc? RIIB. An illustrative analysis to identify mutants with increased affinity for Fc? RIIIA and reduced affinity for Fc? RIIB can comprise selecting mutants for sequential solid phase suppression using magnetic beads coated with Fc? RIIB followed by selection with magnetic beads coated with Fc? RIIIA. For example, an analysis can comprise the following steps: incubation of the bank of yeast cells generated according to the methods of the invention with magnetic beads coated with Fc? RIIB, separating yeast cells bound to beads from the non-bound fraction by placing the mix in a magnetic field, removing the unbound yeast cells and placing them in a fresh medium, binding the yeast cells to the wings beads coated with FcγRIIIA, separation of yeast cells bound to beads from the unbound fraction by placing the mixture in a magnetic field, removing the unbound yeast cells, removing the bound cells by vigorous vortex, developing the coated cells in medium containing glucose, re-inducing in selective media containing galactose. The selection process is repeated at least once. The inserts containing the Fc domain are then amplified using common methodologies known in the art, e.g., RCP, and introduced into an antibody by methods already described for further characterization. In an alternative embodiment, a system that is not based on yeast is used to characterize the binding properties of the molecules of the invention. An illustrative system for characterizing the molecules of the invention comprises a mammalian expression vector containing the heavy chain of the anti-fluorescein monoclonal antibody 4-4-20, in which the nucleic acids encoding the molecules of the invention are cloned with the regions of Fc variant. The resulting recombinant clone is expressed in a line of mammalian host cells (ie, human kidney 293H cell line), and the resulting recombinant immunoglobulin is analyzed to bind to FcγR using any normal assays known from experts in the field, including, but not limited to, ELISA and SCAF. The molecules of the present invention (e.g., antibodies, fusion proteins, conjugated molecules) can be characterized in a variety of ways. In particular, molecules of the invention comprising modified Fc regions can be analyzed for the ability to immunospecifically bind to a ligand, e.g., tetrameric complex of FcγRIIIA. Said analysis can be carried out in solution (e.g., Houghten, Bio / Techniques, 13: 412-421, 1992), on beads (Lam, Nature, 354: 82-84, 1991, in microcircuits (Fodor, Nature, 364 : 555-556, 1993), in bacteria (US Patent No. 5,223,409), in spores (US Patents Nos. 5,571,698, 5,403,484, and 5,223,409), in plasmids (Culi et al., Proc. Nati. Acad. USA, 89: 1865-1869, 1992) or phage (Scott and Smith, Science, 249: 386-390, 1990; Devlin, Science, 249-404-406, 1990; Cwirla et al., Proc. Nati. Acad. Sci. USA, 87: 6378-6382, 1990, and Felici, J. MOI, Biol. 222: 301-310, 1991) (each of these references is incorporated herein by reference in its entirety). identified that bind immunospecifically to a ligand, e.g., FcγRIIIA can then be analyzed for their specificity and affinity for the ligand.

The molecules of the invention that have been treated to comprise modified Fc regions (e.g., therapeutic antibodies) or have been identified in the yeast exposure system by having the desired phenotype (see Section 5.1) can be analyzed for binding Immunospecific antigen and cross-reactivity include, but are not limited to, competitive and non-competitive analysis systems using techniques such as Western radio-immunoassay, ELISA (enzyme-linked immunosorbent assay), "sandwich" immunoassay ", immunoprecipitation analysis, precipitation reactions, gel diffusion precipitation reactions, immunodiffusion analysis, agglutination analysis, complement fixation analysis, radiommunometric analysis, fluorescent immunoassay, protein immunoassay, to name a few. Such analyzes are routine and well known in the art (see, e.g., Ausubel et al., Eds. 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley &Sons, Inc., New York Incorporating here in its entirety by reference). The binding affinity of the molecules of the present invention comprises Fc regions modified for a ligand, e.g., tetrameric complex of FcγR and the decreased rate of interaction can be determined by competitive union analysis. An example of a competitive binding assay is a radioimmunoassay comprising the incubation of the labeled ligand, such as tetrameric FcγR (e.g., 3H or 123I) with a molecule of interest (e.g., molecules of the present invention). invention comprising modified Fc regions) in the presence of increasing amounts of unlabeled ligand, such as tetrameric FcγR and detection of the molecule bound to the labeled ligand. The affinity of the molecule of the present invention for the ligand and the rate of binding can be determined from the saturation data by analyzes that can be run rapidly. In a preferred embodiment, the BIAcore kinetic analysis is used to determine the rates on and off of the binding of the molecules of the present invention to a ligand such as FcγR. The BIAcore kinetic analysis comprises analyzing the binding and dissociation of a microcircuit ligand with immobilized molecules (e.g., molecules comprising modified Fc regions) on its surface. 5. 2.6. MUTANT SEQUENCING Any variety of sequencing reactions known in the art can be used to directly sequence the molecules of the invention comprising the variant Fc regions. Examples of reactions of sequencing includes those based on techniques developed by Maxim and Gilber (Proc. Nati. Acad. Sci. USA 74: 560, 1977) or Sanger (Proc. Nati. Acad. Sci. USA, 74: 5463, 1977). It is also contemplated that any of a variety of automatic sequencing procedures may be used (Bio / Techmques, 19: 448, 1995), including sequencing by mass spectrometry (see, e.g., PTC Publication No. WO 94 / 16101, Cohen et al., Adv. Chromatogr., 36: 127-162, 1996, and Griffin et al., Appl. Biochem. Biotechnol., 38: 147-159, 1993). 5. 2.7. FUNCTIONAL ANALYSIS OF MOLECULES WITH VARIANT Fc REGIONS The invention encompasses the characterization of the molecules of the invention (e.g., an antibody comprising a variant Fc region identified by yeast exposure technology described above, or therapeutic monoclonal antibodies. treated according to the methods of the invention using analyzes known to those skilled in the art to identify the function of effector cells of the molecules In particular, the invention encompasses the characterization of the molecules of the invention for the function of effector-mediated cells by Fc? R. Examples of effector cell functions that can be analyzed according to the invention include, but are not limited to, cell-mediated cytotoxicity-dependent antibody, phagocytosis, opsonization, opsonophagocytosis, Clq binding, and cell-mediated cytotoxicity-dependent complement. Any cell-based or cell-free assays known to those skilled in the art can be used to determine effector cell function activity (For analysis of effector cells, see Perussia et al., 2000, Methods Mol Biol. 121: 179- 92; Baggiolini et al., 1998 Experientia, 44 (10): 841-8; Lehmann et al., 2000 J. Immunol. Methods, 243 (1-2): 229-42; Brown Ex. 1994, Methods Cell Biol., 45: 147-64; Munn et al., 1990, Exp. Med., 172: 231-237, Abdul-Majid et al., 2002 Scand., J. Immunol., 55: 70-81; Ding et al., 1998, Immunity 8 : 403-411, each of which is incorporated herein by reference in its entirety In one embodiment, the molecules of the invention can be analyzed for FcγR-mediated phagocytosis in human monocytes, Alternatively, Fcγ-mediated phagocytosis. R of the molecules of the invention can be analyzed in other phagocytes, e.g., neutrophils (polymorphonuclear leukocytes; PMN); peripheral blood monocytes. to human monocyte-derived macrophages, which can be obtained using normal procedures known to those skilled in the art (e.g., see Brown Ex. 1994, Methods Cell Biol., 45: 147-164). In one modality, the function of The molecules of the invention are characterized by measuring the ability of THP-1 cells to phagocytose sheep red blood cell (CGRO) cells opsonized with fluorescence IgG by previously described methods (Tridandapani et al., 2000, J. Biol. Chem., 275: 20480-7). For example, an illustrative assay for measuring phagocytosis of the molecules of the invention comprises regions of variant Fc with increased affinities for FcγRIIIA, comprises treating THP-I cells with a molecule of the invention or with a control antibody that does not bind to Fc? RIIIA, comparing the activity levels of said cells, wherein a difference in the activities of the cells (e.g., rosette formation activity (the number of THP-I cells joining CGRO coated with IgG ), adhesion activity (the total number of CGROs bound to THP-I cells), and phagocytic rate) could indicate the functionality of the molecule of the invention. It can be appreciated by one skilled in the art that this illustrative analysis can be used to analyze any of the molecules identified by the methods of the invention. Another illustrative analysis to determine the phagocytosis of the molecules of the invention is an antibody-dependent opsonophagocytosis (OFDA) analysis which may comprise the following: coating a white bioparticle such as ITCF labeled with Escherichia coli (Probes) Molecular) or ITCY labeled with Staphylococcus aureus with (i) wild-type 4-4-20 antibody, an antibody to fluorescein (See Bedzyk et al., 1989, J. Biol. Chem, 264 (3): 1565-1569, which is incorporated herein by reference in its entirety), as the control antibody for OFDA dependent on Fc? R; or (ii) antibody 4-4-20 that hosts the D65A mutation that blocks Fc? RIII binding, as a structure control for Fc? R-dependent OFDA, (iii) antibody 4-4-20 that carries the variant Fc regions identified by the methods of the invention and produced as exemplified in Example 6.6; and forming the opsonized particle; adding any of the opzonized particles described (i-iii) to RHP-I effector cells (a line of available monocytic cells from ATCC) in a ratio of 60: 1 to allow FcγR-mediated phagocytosis to occur; preferably by incubating the cells and E. coli-ITCF / antibody at 37 ° C for 1.5 hours; adding tryptophan blue after incubation (preferably at room temperature for 2-3 minutes) so that the cells mitigate the fluorescence of the bacteria adhering to the outside of the cell surface without entering; transferring cells in a buffer solution of SCAF (e.g., 0.1% BSA in PBS, 0.1% sodium azide), analyzing the fluorescence of the THP-I cells using SCAF (e.g., SCAF BD Calibur). Preferably, the THP-I cells used in the analysis were analyzed by SCAF for expression of Fc? R on the cell surface. THP-I cells express CD32A and CD64. CD64 is a high affinity Fc? R that is blocked to drive the OFDA analysis according to the methods of the invention. THP-I cells are preferably blocked with 100 μg / ml soluble IgGl or 10% human serum. To analyze the extent of OFDA, the gate preferably is fixed in THP-I cells and the mean fluorescence intensity is measured. The activity of OFDA for individual mutants is calculated and reported as a normalized value for chMab 4-4-20 wild type obtained. The opsonized particles were added to THP-I cells so that the ratio of the opsonized particles to the THP-I cells is 30: 1 or 60: 1. In more preferred embodiments, the OFDA analysis is carried out with controls, such as E. coli-ITCF in medium, E. coli-ITCF and THP-I cells (to serve as an OFDA activity independent of FcγR), E. coli-ITCF and THP-I cells and 4-4-20 wild-type antibody (to serve as an OFDA-dependent activity of Fc? R), E. coli-ITCF and THP-I cells, D265A 4-4-20 (to serve as the basic control for the OFDA activity that depends on Fc? R). In another embodiment, the molecules of the invention can be analyzed for CCDA activity mediated by FcγR in effector cells, eg, natural killer cells, using any of the normal methods known to the experts in the field (See, e.g., Perussia et al., 2000, Methods Mol. Biol. III: 179-92). An illustrative analysis to determine the activity of CCDA of the molecules of the invention is based on an analysis of release of oCr comprising: labeling the target cells with [51Cr] Na2Cr04 (this molecule permeable in the cell membrane is commonly used for marking since it binds cytoplasmic proteins and although it is spontaneously released from cells with low kinetics, it is released massively following white cell necrosis); opsonizing the target cells with the molecules of the invention comprising variant Fc regions; combining the radiolabeled white opsonized cells with effector cells in a microtiter plate at an appropriate ratio of target cells to effector cells; incubating the cell mixture for 16-18 hours at 37 ° C, collecting supernatants; and analyzing radioactivity. The cytotoxicity of the molecules of the invention can then be determined, for example, using the following formula:% lysis = (experimental cmp - white leak cpm) / (detergent lysis cmp - white leakage cmp x 100% lysis = (CCDA-AICC) / (maximum release-spontaneous release) The specific lysis can be calculated using the formula: specific lysis =% lysis with the molecules of the invention -% lysis in the absence of the molecules of the invention. it can be generated by varying either the target: effector cell or antibody concentration ratio. In yet another embodiment, the molecules of the invention are characterized by antibody-dependent cellular cytotoxicity (CCDA), see, for example, Ding et al., Immunity, 1998, 8 403-11; which is incorporated herein by reference in its entirety. Preferably, the effector cells used in the CCAD analysis of the invention are peripheral blood mononuclear cells (PBMC) that are preferably purified from normal human blood, using normal methods known to one skilled in the art, e.g., using Ficoll-Paque density gradient centrifugation. Preferred effector cells for use in the methods of the invention express different FqR activation receptors. The invention encompasses, effector cells, THO-I, expressing FqRI, FqRIIA and FqRIIB, and primary macrophages derived from monocytes, derived from whole human blood expressing FqRIIIA and Fc? RIIB to determine whether mutants of Fc antibodies show increased activity of CCDA and phagocytosis in relation to wild type IgGl antibodies. The human monocyte cell line, THP-I, activates phagocytosis through the expression of the high affinity receptor Fc? RI and the low affinity receptor Fc? RIIA (Pleit et al., 1991, J. Leuk, Biol. 49: 556). THP-I cells do not constitutively express Fc? RIIA or Fc? RIDB. Stimulation of these cells with cytokines effects the pattern of FcR expression (Pricop et al., 2000 J. Immunol., 166: 531-7). The development of THP-I cells in the presence of the cytokine IL4 induces the expression of FqRIIB and causes a reduction in the expression of FqRIIA and FqRI, the expression of FqRIIB can also be increased by increased cell density (Tridandapani et al., 2002, J. Biol. Chem. 277: 5082-9). In contrast, it has been reported that IFNy can lead to the expression of FqRIIIA (Pearse et al., 1993 PNAS USA 90: 4314-8). The presence or absence of receptors on the cell surface can be determined by SCAF using common methods known to one skilled in the art. The cytokine-induced expression of FqR on the cell surface provides a system for testing both activation and inhibition in the presence of FqRIIB. If the THP-I cells are not capable of expressing FqRIIB, the invention also encompasses another human monocyte cell line, U937. It has been shown that these cells are strictly differentiated into macrophages in the presence of IFNy and TNF (Koren et al., 1979, Nature 279: 328-331). FcγR dependent on fatal tumor cells is mediated by macrophages and AN cells in tumor models in mice (Clynes et al., 1998, PNAS USA 95: 652- 656). The invention encompasses the use of purified monocytes from donors as effector cells to analyze the efficiency of Fc mutants to drive cell cytotoxicity to target cells in phagocytosis and CCAD analysis. The expression patterns of Fc? RI, Fc? RIIIA and Fc? RIIB are affected by different growth conditions. Expression of FcγR of frozen purified monocytes, fresh purified monocytes, monocytes maintained in 10% FBS and monocytes cultured in FBS + Gm-CSF and in human serum can be determined using common methods known to those skilled in the art. For example, cells can be stained with antibodies specific for FcγR and analyzed by SCAF to determine FcR profiles. Conditions that best mimic the expression of FcγR in vivo in macrophages are then used for the methods of the invention. In some embodiments, the invention encompasses the use of mouse cells, especially when human cells with the correct FcγR profiles can not be obtained. In some embodiments, the invention encompasses the mouse macrophage cell line RAW264.7 (ATCC) which can be transfected with human FcγRIIIA and stable transfectants isolated using methods known in the art, see, for example, Ralph et al., J. Immunol. 119: 950-4). Transfectants can be quantified for expression of Fc? RIIIA by FACS analysis using experimentation of routine and high expressors can be used in the CCDA assays of the invention. In other embodiments, the invention encompasses the isolation of human basal periprodal macrophages expressing human FcγR from transgenic blocking mice such as those described herein. Blood samples from donor peripheral blood (MSP) can be cultured using a Ficoll-Paque gradient (Pharmacia). Within the mononuclear population isolated from cells, most of the activity of CCDA occurs via natural killer (AN) cells that contain Fc? RIIIA but not Fc? RIIB on their surface. The results with these cells indicate the effectiveness of the mutants in activating the CCDA of AN cells and establish the reagents that will be tested with purified monocytes. The target cells used in the CCDA assay of the invention include, but are not limited to, breast cancer cell lines, e.g., KD-BR-3 with accession number to ATCC HTB-30 (see, for example, Tremp et al., 1976, Cancer Res. 33-41); B-lymphocytes, cells derived from Burkitts lmoma, e.g., Ra i cells with ATCC accession number CCL-213 (see, eg, Klein et al., 1968, Cancer Res. 28: 1300-19). The target cells should be recognized by the antigen binding site of the immunoglobulin that will be analyzed.

The analysis is based on the ability of AN cells to mediate cell death via an apoptotic pathway. AN cells mediate cell death in part by the recognition of FcγRIIIA of IgG bound to an antigen on a cell surface. The CCDA assays used according to the methods of the invention can be radioactive based assays or fluorescence based assays. The CCDA analysis used to characterize the molecules of the invention comprising variant Fc regions comprises marking target cells, eg, SK-BR-3, MCF-7, 0VCAR3, Ravi, Daudi cells, opsonizing target cells with an antibody which recognizes a cell surface receptor in the target cell via its binding site in the antigen; combine labeled opsonized target cells and effector cells in an appropriate ratio, which can be determined by routine experimentation; cultivate cells; detect the mark in the supernatant of the white lysed cells, use an appropriate detection scheme based on the brand used. The target cells may be labeled with a radioactive label or a fluorescent label, using standard methods known in the art. For example, the marks include, but are not limited to, [5iCr] Na2Cr04; and the acetoxymethyl ester of the fluorescence enhancer ligand, 6-6"-dicarboxylate 2, 2 ': 6', 2" -ter? r? dma (DAT).

In a specific preferred embodiment, a fluorimetric analysis is used that resolves with time to measure CCDA activity against target cells that have been labeled with the acetoxymethyl ester of the fluorescence enhancer ligand, 6-6"-dicarboxylate 2.2 ': 6', 2"-terpyridine (DAT). Such fluorimetric analyzes are known in the art, e.g., see Blomber et al., 1996, Journal of Immunological Methods, 193: 199-206; which is incorporated herein by reference in its entirety. Briefly, the target cells are labeled with the membrane permeable acetoxymethyl diester of DAT (bis (acetoxymethyl) of 6,6"-dicarboxylate of 2, 2 '-6', 2" -terpyridine (BADAT), which diffuses rapidly through the cell membrane of viable cells intracellular esterases to divide the ester groups and the DAT molecule impermeable to the regenerated membrane is trapped inside the cell After the incubation of the effector cells and target, v.gr ., at least two hours, up to 3.5 hours, at 37 ° C, under 5% CO2, the DAT released from the target cells is chelated with Eu3 + and the fluorescence of the formed Europium-DAT chelates is quantified in a time-controlled resolution fluorometer (e.g., Victor 1420, Perkin Elmer / Wallac) In another specific embodiment, the CCDA analysis used to characterize the molecules of the invention comprising regions of variant Fc, comprise the following Steps: preferably 4-5? l06 target cells (eg, SK-BR-3, MCF-7, 0VCAR3, Ra? cells) are labeled with bis (acetoxymethyl) of 6, 6"-d? carbox? lato of 2,2'-6 ', 2"-terpipdma (BADAT Reagent from DELFIA, Perkin Elmer / Wallac). For optimum labeling efficiency, the number of target cells used in the CCAD analysis should preferably not exceed 5xlOd. The BADAT reagent is added to white cells incubated at 37 CC preferably under 5% C02, for at least 30 minutes. The cells are then washed with physiological buffer, e.g., PBS with 0.125 mM sulfapirazole, and medium containing 0.125 mM sulfapirazole. The labeled white cells are then opsonized (coated) with a molecule of the invention comprising a variant Fc region, ie, a immunoglobulin comprising a variant Fc region of the invention, including, but not limited to, a polyclonal antibody , a monoclonal antibody, a bispecific antibody, a multi-specific antibody, a humanized antibody, or a chimeric antibody. In preferred embodiments, the immunoglobulin comprising a variant Fc region used in the CCDA assay is specific for a cell surface receptor, a tumor antigen, or a cancer antigen. The immunoglobulin in which a variant Fc region of the invention is introduced, can specifically bind to any cancer or tumor antigen, such as those listed in Section 5.4. Additionally, the immunoglobulin in which a variant Fc region of the invention is introduced, can be any cancer-specific antigen-specific therapeutic antibody, such as those listed in section 5.4. In some embodiments, the immunoglobulin comprising an Fc region. variant used in the CCDA assay is an anti-fluorescein monoclonal antibody, 4-4-20 (Kranz et al., 1982, J. Biol. Chem. 257 (12): 6987-6995) a chimeric anti-CD20 monoclonal antibody of mouse-human 2H7 (Liu et al., 1987, Journal of Immunology, 139: 3521-6); or a humanized antibody (Ab4D5) against the human epidermal growth factor receptor 2 (pi 85 HER2) (Carter et al. (1992, Proc. Nati. Acad. Sci. USA 89: 4285-9). CCDA analyzes are chosen according to the immunoglobulin in which the vanishing Fc region of the invention has been introduced so that the immunoglobulin binds to a cell surface receptor specifically of the target cell. The invention is carried out using more than one engineered antibody, e.g., anti Her2 / neu, 4-4-20, 2B6, Rituxan, and 2H7, harboring the Fc vanants of the invention. more preferred, the Fc5 variants of the invention are introduced into at least 3 antibodies and their CCDA activities are tested, although it is not intended to be linked to a As a particular mechanism of action, examination of at least 3 antibodies in these functional analyzes will decrease the opportunity to erroneously remove a viable Fc mutation. The opsonized target cells are added to the effector cells, e.g., CMSP, to produce effector ratios: target of about 50: 1, 75: 1, or 100: 1. In a specific embodiment, when the immunoglobulin comprising a variant Fc region has the variable domain of 4-4-20, the effector: target ratio is 75: 1. The effector and target cells are incubated for at least two hours, up to 3.5 hours, at 3 ° C, under 5% C02. Cell supernatants are cultured and added to a solution of europium acid (e.g., Europium DELFIA Solution, Perkin Elmer / Wallac). The fluorescence of the formed Europium-DAT chelates is quantified in a time-controlled resolution fluorometer (e.g., Victor, 1420, Perkin Elmer / Wallac). Maximum release (LM) and spontaneous release (LE) are determined by incubation of target cells with 1% TX-100 and medium alone, respectively. The antibody-independent cell cytotoxicity (CCIA) is measured by incubation of the target and effector cells in the absence of antibody. Each analysis is preferably carried out in triplicate. The average percentage of specific lysis is calculated as: experimental release (CCDA) - (CCIA) / (LM-LE) x 100. The invention encompasses characterization of the Fc variants in ANC-dependent and macrophage-dependent CCDA analysis. The Fc variants of the invention have altered phenotypes such as an altered effector function as analyzed in AN-dependent or macrophage-dependent assays. The invention encompasses assays known in the art and are exemplified herein, to bind to Clq and mediate complement-dependent cytotoxicity (CDC). To determine the binding of Clq, a Clq binding can be carried out with ELISA. An illustrative analysis may comprise the following: overnight analysis plates may be coated at 4 ° C with variant polypeptide or starting polypeptide (control) in coating buffer. The plates can then be washed and blocked. After washing, an aliquot of human Clq can be added to each well, and incubated for 2 hours at room temperature. After an additional wash, 100 ul of an anti-sheep complement Clq peroxidase conjugate antibody can be added to each well and incubated for 1 hour at room temperature. The plate can again be washed with washing buffer and 100 ul of buffer can be added to each well. substrate containing DOF (O-phenylenediamine dihydrochloride (Sigma)). The oxidation reaction, observed by the appearance of a yellow color, can be allowed to proceed for 30 minutes and stopped by the addition of 100 ul of 4.5 NH2S0. The absorbance can then be read at (492-405) nm. A preferred variant according to the invention is one that exhibits a significant reduction in Clq binding, as detected and measured in this analysis or a similar analysis. Preferably, the molecule comprising an Fc variant exhibits a reduction of about 50 times, about 60 times, about 80 times, or about 90 times at the binding of Clq compared to a control antibody having a non-IgGl Fc region. mutated In the most preferred embodiment, the molecule comprising an Fc variant does not bind to Clq, i.e., the variant exhibits approximately 100 times or more reduction in Clq binding compared to the control antibody. Another illustrative variant is one that has a better binding affinity for human Clq than the molecule comprising wild-type Fc region. Said molecule can exhibit, for example, an improvement of about two times or more, and preferably about five times or more, in binding to human Clq compared to the mother molecule comprising the wild-type Fc region. For example, the Human Clq binding can be from about twice to about 500 times and preferably from about twice or from about five times to about 1000 times increased compared to the molecule comprising the wild-type Fc region. To evaluate complement activation, a complement dependent cytotoxicity (CDC) analysis can be performed eg, as described in Gazzano-Santoro et al., J. Immunol. Methods 202-163 (1996), which is incorporated herein by reference in its entirety. In summary, various concentrations of the molecule can be diluted comprising a region of variant Fc and human complement with buffer solution. Cells expressing the antigen to which the molecule comprising a variant Fc region is attached can be diluted to a density of about 10 x 10 6 cells / ml. Mixtures of the molecule comprising a variant Fc region, the diluted human complement and the cells expressing the antigen can be added to a 96 well plate for flat bottom tissue culture and allowed to incubate for 2 hours at 37 ° C. and 5% C02 to facilitate complement-mediated cell lysis. 50 uL of alamar blue (Accumed International) can then be added to each well and incubated overnight at 37 ° C. Absorbance is measured using a 96-well fluorometer with excitation at 530 nm and emission at operation of 590. Results can be expressed in units of relative fluorescence (UFR). The concentrations of the sample can be calculated by a standard curve and the percentage activity compared to the non-variant molecule, ie, a molecule comprising the wild-type Fc region, is reported for the variant of interest. In some embodiments, an Fc variant of the invention does not activate the complement. Preferably, the variant does not appear to have any CDC activity in previous CDC analysis. The invention also pertains to a variant with improved CDC compared to a parent molecule (a molecule comprising wild-type Fc region), e.g., exhibiting approximately twice to about 100-fold an improvement in CDC activity in vitro or in vivo (e.g., at the IC 50 values for each molecule being compared). Complement tests can be performed in guinea pigs, rabbit serum or human. Lysis of the complement of target cells can be detected by monitoring the release of intracellular enzymes, such as lactate dehydrogenase (LDH), as described in Korzeniewski et al., 1983 Immunol. Methods 64 (3): 313-20; and Decker et al., 1988 J. Immunol Methods, 115 (1): 61-9, each of which is incorporated herein by reference in its entirety; or the release of an intracellular label such as europium, chromium 51 or indium 111 in the which target cells are labeled as described herein. 5. 2.8. OTHER ANALYSIS The molecules of the invention comprising variant Fc regions can also be analyzed using any surface plasmotype resonance-based analysis known in the art to characterize the kinetic parameters of the Fc-FcγR interaction binding. Any commercially available MMR instrument can be used in the present invention including, but not limited to, BIAcore Instruments, available from Biacore AB (Uppsala, Sweden); IAsys instruments available from Affinity Sensors (Franklin, MA); IBIS system available from Windsor Scientific Limited (Berks, UK); SPR-CELLIA systems available from Nippon Laser and Electronics Lab (Hokkaido, Japan); and SPR Detector Spreeta available from Texas Instruments (Dallas, TX). For a review of SPR-based technology see Mullet et al., 2000, Methods 22: 77-91; Dong et al., 2002, Review in Mol. Biotech., 82: 303-23; Fivash et al., 1998, Current Opinion in Biotechnology 9: 97-101; Fich et al., 2000, Current Opinion in Biotechnology 11: 54-61; all of which are incorporated herein by reference in their entirety. Additionally, any of the SPR instruments and SPR-based methods for measuring protein interactions protein described in the Patents of E.U.A. Nos. 6,373,577; 6,289,286; 5,322,798; 5,341,215; 6,268,125, are contemplated in the methods of the invention, all of which are hereby incorporated by reference in their entirety. Briefly, SPR-based analyzes involve immobilizing a member of a binding pair on a surface, and monitoring its interaction with the other member of the binding pair in real-time solution. SPR is based on the measurement of the base in the measurement of the change in the refractive index in the solvent near the surface that occurs by the formation or dissociation of the complex. The surface on which the immobilization occurs is the sensor microcircuit, which is at the heart of the SPR technology; It consists of a glass surface coated with a thin layer of gold and forms the basis for a scale of specialized surfaces designed to optimize the binding of a molecule to the surface. A variety of sensor microcircuits are commercially available especially from the companies listed above, all of which may be used in the methods of the invention. Examples of sensor microcircuits include those available from BIAcore AB, Inc., e.g., Microcircuit Sensor CM5, SA, NTA, and HPA. A molecule of the invention can be immobilized on the surface of a sensor microcircuit using any method and immobilization chemical known in the art, including, but not limited to, direct covalent coupling via amine groups, direct covalent coupling via sulfhydryl groups, binding of biotin to surface coated with avidin, coupling of aldehyde to carbohydrate groups and binding through the histidine tag with NTA microcircuits. In some embodiments, the kinetic parameters of the binding of molecules of the invention comprising variant Fc regions, eg, immunoglobulins comprising vanishing Fc region, to an FcγR can be determined using a BIAcore instrument (v. .gr., BIAcore 1000 Instrument, BIAcore Inc., Piscataway, NJ). Any of FcγR can be used to evaluate the interaction with the molecules of the invention comprising variant Fc regions. In a specific embodiment the Fc? R is Fc? RIIIA, preferably a soluble monomeric Fc? RIIIA. For example, in one embodiment, the soluble monomeric Fc? RIIIA is the extracellular region of Fc? RIIIA bound to the linker-A-VITAG sequence (see, U.S. Provisional Application No. 60 / 439,498, filed January 9, 2003 (Case No. 11183-004-888) and US Provisional Application No. 60 / 456,041 filed March 19, 2003, which are hereby incorporated by reference in their entirety). In another specific embodiment, the Fc? R is Fc? RIIB, preferably a soluble dimeric Fc? RIIB. For example, in one embodiment, the soluble dimeric Fc? RIIB protein is prepared in accordance with the methodology described in the Provisional Application of E.U.A. No. 60 / 439,709 filed January 13, 2003, which is hereby incorporated by reference in its entirety. An illustrative analysis to determine the kinetic parameters of a molecule comprising a variant Fc region wherein the molecule is the 4-4-20 antibody, to an FcγR using a BIAcore instrument comprises the following: BSA-ITCF is immobilized at one of the four flow cells of a sensor microcircuit surface, preferably through the amine coupling chemistry such as about 5000 response units (UR) of BSA-ITCF is immobilized on the surface. Once a suitable surface is prepared, the 4-4-20 antibodies carrying the Fc mutations are passed over the surface, preferably by one minute injections of a 20 μg / ml solution at a flow rate of 5μUmL. The level of 4-4-20 antibodies bound to the surface varies between 400 and 700 UR. Then, the receptor dilution senes (Fc? RIIA and Fc? RIIb-Fc fusion protein) in HBS-P buffer (20 mM HEPES, 150 mM NaCl, 3 mM EDTA, pH 7.5) are injected onto the surface at lOOμl / min. The regeneration of antibodies between different dilutions of receptors is preferably carried out by injections alone every 5 seconds of 100 nM NaHCOj pH 9.4; 3M NaCl.

Any regeneration technique known in the art is contemplated in the method of the invention. Once all the data were collected, the resulting binding curves are globally adapted using computer algorithms supplied by the SPR instrument manufacturer, v.gr, BIAcore, Inc. (Piscataway, NJ). These algorithms calculate the Konconcudo and apaddo from which the apparent equilibrium binding constant IQi is deduced as the ratio between the two constants (ie, quenched / Kpn) • The more detailed treatments of the way in which the constant constants are derived individual speeds can be found in the BIAevaluation Software Handbook (BIAcore, Inc., Piscataway, NJ). The analysis of the generated data can be carried out using any method known in the art. For a review of the different methods of interpellation of the generated kinetic data, see Myszka, 1997, Current Opinion m Biotechnology 8: 50-7; Fisher et al., 1994, Current Opinion In Biotechnology 5: 389-95; O 'Shannessy, 1994, Current Opinion? N Biotechnology, 5: 65-71; Chalken et al., 1992, Analytical Biochemistry, 201: 197-210; Morton et al., 1995, Analytical Biochemistry 227; 176-85; O 'Shannessy et al., 1996, Analytical Biochemistry 236: 275-83; all of which are incorporated herein by reference in their entirety. In preferred embodiments, the kinetic parameters determined using an SPR analysis, e.g., BIAcore, can be used as a predictive measure of how a molecule of the invention will function in a functional analysis, e.g., CCDA. An illustrative method for predicting the efficacy of a molecule of the invention based on kinetic parameters obtained from a SPR analysis may comprise: determining the Kdpagado values for binding a molecule of the invention to Fc? RIIIA and Fc? RIIB, plotting (1 ) Kdp qrldü (weight) / K Kdp g do (mut) for Fc? RIIIA; (2) Kapagado (mut) / Kapagado (weight) for Fc? RIIB against CCDA data. Numbers greater than one show a decreased dissociation rate for Fc? RIIIA and an increased dissociation rate for Fc? RIIB relative to the wild type; and they have an improved CCDA function. 5. 3 METHODS FOR RECOMBINANT PRODUCTION OF MOLECULES OF THE INVENTION 5. 3.1. POLINUCLEOTIDES THAT CODIFY THE MOLECULES OF THE INVENTION The present invention also includes polynucleotides that encode the molecules, including the polypeptides and antibodies of the invention identified by the methods of the invention. The polynucleotides encoding the molecules of the invention can be obtained the nucleotide sequence of the polynucleotides can be obtained and determined by any method known in the art. Once the nucleotide sequence of the molecules (e.g., antibodies) that are identified by the methods of the invention is determined, the nucleotide sequence can be manipulated using methods well known in the art, e.g., techniques of recombinant DNA, site-directed mutagenesis, PCR, etc., (see, for example, the techniques described in Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor , NY, and Ausubel et al., Eds 1998, Current Protocols in Molecular Biology, John Wiley &Sons, NY, which are incorporated herein by reference in their entirety), to generate, for example, antibodies that have an amino acid sequence different, for example, generating substitutions, deletions, and / or amino acid insertions. In a specific embodiment, when the nucleic acids encode antibodies, one or more of the RDCs are inserted into the regions of the structure using routine recombinant DNA techniques. The structure regions may be present naturally or in the consensual structure region (see, Chothia et al., 1998, J. Mol. Biol. 278: 457-479 for a list of human framework regions). In another embodiment, human banks or any other libraries available in the art can be screened by standard techniques known in the art to clone the nucleic acids that they encode the molecules of the invention. 5. 3.2. RECOMBINANT EXPRESSION OF MOLECULES OF THE INVENTION Once the sequence encoding the molecules of the invention (ie, antibodies) has been obtained, the vector of the production of the molecules can be produced by recombinant DNA technology using techniques well known in the art. The matter. The methods of which are well known to those skilled in the art and can be used to construct expression vectors containing the coding sequences for the molecules of the invention and the appropriate trans-transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques and in vivo genetic recombination. (See, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2 nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., Eds. 1998, Current Protocols in Molecular biology, John Wiley & Sons, NY). An expression vector comprising the nucleotide sequence of a molecule identified by the methods of the invention (ie, an antibody) can be transferred to a host cell by conventional techniques (e.g., electroporation, liposomal transfection and phosphate precipitation). and calcium) and the transfected cells are then cultured by conventional techniques to produce the molecules of the invention. In specific embodiments, the expression of the molecules of the invention is regulated by a constitutive, inducible or tissue-specific promoter. The host cells used to express the molecules identified by the methods of the invention can be bacterial cells such as Escherichia coli, or, preferably, eukaryotic cells, especially for the expression of the complete recombinant immunoglobulin molecule. In particular, mammalian cells such as Chinese hamster ovary (CHO) cells, together with a vector such as the initial intermediate promoter element of human cytomegalovirus core is an effective expression system for immunoglobulins (Foecking et al., 1998 , Dine 45: 101; Cockett et al., 1990, Bio / Technology 8: 2).

A variety of host expression vector systems can be used to express the molecules identified by the methods of the invention. Said host-expression systems represent vehicles by which the coding sequences of the molecules of the invention can be subsequently purified, but also represent cells that when transformed or transfected with the appropriate nucleotide coding sequences, can express the molecules of the invention in situ. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and B. subtilis) transformed with the expression vectors of recombinant bacteriophage DNA, plasmid DNA or cosmid DNA containing coding sequences for the molecules identified by the methods of the invention, yeast ( e.g., Saccharomyces pichia) transformed with recombinant yeast expression vectors containing sequences encoding the molecules identified by the methods of the invention; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the sequences encoding the molecules identified by the methods of the invention; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus) (VMCo) and tobacco mosaic virus (VMT) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing sequences encoding the molecules identified by the methods of the invention; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 293T, 3T3 cells), lymph cells (see EUA 5,807,715), Per C.6 cells (human retinal cells developed by Crucell) harboring expression constructs recombinant containing promoters derived from the genome of mammalian cells (eg, metallothionine promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus promoter of 7.5K). In bacterial systems, a number of expression vectors may advantageously be selected depending on the intended use for the molecule being expressed. For example, when a large amount of said protein is to be produced, for the generation of pharmaceutical compositions of an antibody, vectors that direct the expression of high levels of fusion protein products that are already purified may be desirable. Such vectors include, but are not limited to, the E. coli expression vector PUR278 (Ruther et al., 1983, EMBO J 2: 1791), in which the sequence encoding the antibody can be ligated individually in the vector at the base with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye &Inouye, 1985, Nucleic Acids Res. 13: 3101-3109, Van Heeke &Schuster, 1989, J. Biol. Chem. 24: 5503-5509); and the like, pGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, said fusion proteins are soluble and can be easily purified from cells used by adsorption and binding to a matrix of glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or XA protease factor separation sites so that the cloned gene product directed to the site can be released from the GST portion. In a viral system, Autographa californica nuclear polyhedrosis virus (VPNAc) is used as a vector to express foreign genes. The virus grows in Spodoptera frigiperda cells. The antibody coding sequence can be cloned individually into non-essential regions (e.g., the polyhedrin gene) of the virus and placed under the control of a VPNAc promoter (e.g., the polyhedrin promoter. of mammals, a number of viral-based expression systems can be used.

In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest can be ligated to an adenovirus transcription / translation control complex, e.g., the last promoter and leader tripartite sequence. This chimeric gene can then be inserted into the adenovirus genome by in vivo or in vivo recombination. Insertion into a non-essential region of the viral genome (eg, El region or E3) will result in a recombinant virus that is viable and capable of expressing the immunoglobulin molecule in infected hosts (e.g., see Logan & Shenk, 1984, Proc. Nati Acad. Sci. USA 81: 355-359). Specific initiation signals may also be required for the efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. In addition, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These signals of exogenous translational control and initiation codons can have a variety of origins, both natural and synthetic. The efficiency of expression can be improved by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (See Bittner et al., 1987, Methods in Enzymol, 153: 51-544). 5 In addition, a host cell strain can be chosen which modulates the expression of the inserted sequences or modifies and processes the gene product in the specific manner desired. Such modifications (eg, glycosylation) and processing (eg, separation) of protein products may be important for the function of the protein. Different host cells have specific characteristics and mechanisms for the post-translational process and modification of proteins and gene products. Appropriate cell lines or host systems may be chosen to ensure correct modification and processing of the foreign protein expressed. For this purpose, eukaryotic host cells having the cellular machinery for the appropriate processing of the primary transcript, glycosylation and phosphorylation of the gene product can be used. Said mammalian host cells include, but are not limited to, CHO; VERY, VHK, Hela, COS, MDCK, 293, 293T, 3T3, WI38, BT483, Hs578T, HTB2, BT20 and T47D, CRL7030 and Hs578Bst. For the long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express an antibody of the invention can be engineered. Instead of using expression vectors that contain viral origins of replication, host cells can be transformed with DNA controlled by the appropriate expression control elements (v.gr, promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. After the introduction of the foreign DNA, the treated cells can be allowed to develop for 1-2 days in an enriched medium, and then they are exchanged to a selective medium. The selectable marker in the recombinant plasmid confers resistance to selection and allows the cells to stably integrate into the plasmid within their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can be used advantageously to treat cell lines expressing the antibodies of the invention. Said treated cell lines may be particularly useful for screening and evaluating compounds that interact directly or indirectly with the antibodies of the invention. A number of selection systems may be used, including, but not limited to, thymidine c genes from herpes simplex virus (Wigler et al., 1991, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska &Szybalski, 1992). , Proc. Nati, Acad. Sci. USA 48: 202), and adenine phosphobosiltransferase (Lowy et al., 1980, Cell 22: 817) which can be used in tk, hgprt, or aprt, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Proc. Nati, Acad. Sci. USA 77: 357, O'Hara et al. , 1981, Proc. Nati, Acad. Sci. USA 78: 2072); neo, which confers resistance to the aminoglycoside G-418 Clinical Pharmacy 12: 488-505; Wu and Wu, 1991, 3: 87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol 32: 573-596; Mulligan, 1993, Science 260: 926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191-217; May, 1993, TIB TECH 11 (5): 155-215). Methods commonly known in the art of recombinant DNA technology that can be used are described in Ausubel et al. (Eds.), 1994, Current Protocols in Molecular Biology, John Wiley & Sons, NR; Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and in Chapters 12 and 13, Dracopoli et al. (eds.), 1994, Current Protocols in Human Genetics, John Wiley & Sons, NY: Colverre-Garapin et al., 1981, J. Mol, Biol. 150: 1; and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30: 147). The expression levels of an antibody of the invention can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3 (Academic Press, New York, 1987). When a marker can be amplified in the vector system that expresses an antibody, increasing the level of inhibitor present in cultures of host cells will increase the copy number of the marker gene. Since the amplified region is associated with the nucleotide sequence of the antibody, the production of the antibody will also be increased (Crouse et al., 1983, Mol. Cell. Biol. 3: 257). The host cells can be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derivative polypeptide and the second vector encoding a light chain derivative polypeptide. The two vectors may contain identical selectable markers that allow for equal expression of heavy and light chain polypeptides. Alternatively, a single vector can be used which encodes heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, 1986, Nature 322: 52, Kihler, 1980, Proc. Nati, Acad. Sci. USA 77: 2197) . The coding sequences for the heavy and light chains can comprise cDNA or genomic DNA. Once a molecule of the invention (ie, antibodies) has been recombinantly expressed, it can be purified by any method known in the art. for the purification of polypeptides or antibodies, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after protein A, and size of column chromatography), centrifugation, solubility difference, or by any other standard technique for the purification of polypeptides or antibodies. 5. 4. PROPHYLACTIC AND THERAPEUTIC METHODS The present invention encompasses administering one or more of the molecules of the invention (e.g., antibodies) to an animal, preferably, a mammal, and more preferably a human, to avoid treating or decreasing one. or more symptoms associated with a disease, disorder or infection. The molecules of the invention are particularly useful for the treatment or prevention of a disease or disorder wherein improved efficacy of effector cell function (e.g., CCDA) mediated by FcγR is desired. The methods and compositions of the invention are particularly useful for the treatment or prevention of primary or metastatic neoplastic disease (ie, cancer), and infectious diseases. Molecules of the invention can be provided in pharmaceutically acceptable compositions as is known in the art or as described herein. As discussed in detail below, the molecules of the invention can used in methods to treat or prevent cancer (particularly in passive immunotherapy), autoimmune disease, inflammatory disorders or infectious diseases. The molecules of the invention can also be advantageously used in combination with other therapeutic agents known in the art for the treatment or prevention of autoimmune disease, inflammatory disorders or infectious diseases. In a specific embodiment, the molecules of the invention can be used in combination with monoclonal or chimeric antibodies, lmfocmas, or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), which, for example, serve to increase the number or activity of effector cells that interact with the e-molecules, increase the immune response. The molecules of the invention can also be advantageously used in combination with one or more drugs used to treat a disease, disorder or infection, such as, for example, anti-cancer agents, anti-inflammatory agents or anti-viral agents, v.gr ., as detailed in sections 5.4.1.2. and 5.4.2.1. next. 5. 4.1. CANCERES The invention encompasses methods and composition for the treatment or prevention of cancer or metastasis in a subject which comprises administering to the subject a therapeutically effective amount of one or more molecules comprising a variant Fc region. The molecules of the invention (ie polypeptides, antibodies) comprising the variant Fc regions can be used to prevent, inhibit or reduce the growth of primary tumors or cancer cell metastases. In one embodiment, the molecule of the invention comprises a variant Fc that binds Fc? RIIIA and / or Fc? RIIA with a higher affinity with which a comparable polypeptide comprising a wild type Fc region binds to Fc? RIIIA and / or Fc? RIIA and / or said variant Fc region has an improved effector function, e.g., CCDA, CDC, phagocytosis, opsonization, etc. Said molecules can be used alone to treat or prevent cancer. In another embodiment, the molecule of the invention comprises a variant Fc region that binds to Fc? RIIIA and / or Fc? RIIA with a higher affinity with which a comparable polypeptide comprising a wild-type Fc region binds to Fc ? RIIIA and / or Fc? RIIA, and further binds Fc? RIIB with a lower affinity with which a comparable polypeptide comprising a wild-type Fc region binds to Fc? RIIB, and / or said variant Fc region it has an improved effector function, e.g., CCDA, CDC, phagocytosis, opsonization, etc. Said molecules can also be used alone to treat or prevent cancer.

In some embodiments, the invention encompasses methods and compositions for the treatment or prevention of cancer in a subject with FcγR polymorphisms such as homozygotes for the FyRIIIA-158V or FcγRIIIA -158F alleles. In some embodiments, the invention encompasses treating therapeutic antibodies, e.g., tumor-specific monoclonal antibodies according to the methods of the invention such that engineered antibodies have improved efficacy in patients homozygous for the low allele. Affinity of Fc? RIIIA (158F). In other embodiments, the invention encompasses engineering the therapeutic antibodies, e.g., tumor-specific monoclonal antibodies according to the methods of the invention such that engineered antibodies have improved efficacy in patients homozygous for the allele. high affinity of Fc? RIIIA (158V). In some embodiments, the engineered antibodies of the invention are particularly effective in treating and / or preventing non-Hodgkin's lymphoma (NHL). The treated antibodies of the invention are therapeutically more effective than the current therapeutic regimens for NHL, including, but not limited to chemotherapy, and immunotherapy using anti-CD20 mAb, Rituximab. However, the effectiveness of antibodies monoclonal anti-CD20 depends on the RcyR polymorphism of the subject (Carton et al., 2002, Blood, 99: 754-8, Weng et al., 2003 J Clin Oncol. 21 (21): 3940-7 both are incorporated herein by reference in its entirety). These receptors are expressed on the surface of the effector cells and mediate the CCDA. High affinity alleles of low affinity activation receptors improve the ability of effector cells to mediate CCDA. The methods of the invention make it possible to treat anti-CD20 antibodies by harboring Fc mutations to improve their affinity for FcγR on effector cells via their altered Fc domains. The engineered antibodies of the invention provide better immunotherapy reagents for patients regardless of their FcγR polymorphism. An illustrative method for determining the efficacy of treated anti-CD20 antibodies in a subject can include the following: plasmids harboring chimeric anti-HER2 / neu heavy chain genes with Fc mutations that show substantially increased death in CCDA can be used as a base structure for transferring the variable domain from the heavy chain gene Rituximab. The variable region of the anti-HER2 / neu Fc variant is replaced with the variable region of Rituximab. Plasmids containing wild-type Fc domains or a D265A mutation to override FcR binding, or Fc variants Anti-CD20 are cotransfected temporarily with the light chain gene of Rituximab in 293H cells, conditioned medium and the antibody is purified on a G protein column using routine methods. The anti-CD20 mAbs harboring the Fc variants are tested by CCDA using a B cell line to determine the ability of the Fc mutations to improve CCDA. Normal CCDA is carried out using methods described herein. Lymphocytes are harvested from peripheral blood using a Ficoll-Paque gradient (Pharmacia). The Daudí white cells, a line of B cells expressing CD20, are loaded with Europium (Perkin Elmer) and incubated with effectors for 4 hours at 37 ° C. The released Europium is detected using a fluorescent plate reader (Wallac). The resulting CCDA data indicate the efficacy of the Fc variants to drive the AN cell-mediated cytotoxicity and establish which of the Fc ant? -CD20 variants can be tested with both patient samples and purified monocytes. The Fc variants that show the greatest potential for improving the efficacy of the anti-CD20 antibody are tested in a CCDA analysis using PBMC from patients. PBMCs from healthy donors are used as effector cells. In vitro CCDA assays using anti-CD20 and Rituximab variants are carried out in primary lymphoma cells of patients with follicular lmmphoma. He FcγR specific polymorphism of the donors is determined and cataloged using methods known in the art. The analysis of CCDA by effector cells of patients with different genotypes of Fc? RIIIA and Fc? RIIA was carried out. According to one aspect of the invention, the molecules (e.g., antibodies) of the invention comprising variant Fc regions increase the efficacy of cancer immunotherapy by increasing the potency of the antibody effector function relative to a molecule that it contains the wild type Fc region, e.g., CCDA, CDC, phagocytosis, opsonization, etc. In a specific embodiment, the cellular toxicity that depends on antibodies and / or phagocytosis of tumor cells is increased using the molecules of the invention with variant Fc regions. The molecules of the invention can improve the effectiveness of cancer treatment with immunotherapy by increasing at least one antibody-mediated effector function. In a particular embodiment, a molecule of the invention comprising a variant Fc region increases the efficacy of immunotherapy treatment by improving the complement dependent cascade. In another embodiment of the invention, the molecule of the invention comprising a variant Fc region increases the efficacy of the immunotherapy treatment by increasing the phagocytosis and / or opsonization of the targeted tumor cells. In another form of invention, the molecule of the invention comprising a variant Fc region increases the treatment efficiency by increasing the antibody-dependent cell-mediated cytotoxicity ("CCDA") in the destruction of tumor cells directed to the target. The invention further contemplates engineering the therapeutic antibodies (e.g., tumor-specific monoclonal antibodies) to improve the therapeutic efficacy of the therapeutic antibody, for example, by improving the effector function of the therapeutic antibody (e.g., CCDA). Preferably the therapeutic antibody is a cytotoxic and / or opsonization antibody. It will be appreciated by one skilled in the art that once the molecules of the invention have been identified with desired binding proteins (e.g., molecules with variant Fc regions with at least one amino acid modification, said modification increases the affinity of the variant Fc region for Fc? RIIA and / or Fc? RIIA in relation to a comparable molecule, comprising a wild-type Fc region) (See Section 5.2 and Table 8) according to the methods of the invention. Invention, therapeutic antibodies can be treated using normal recombinant DNA techniques and any known mutagenesis technique, as described in Section 5.2.2. to produce engineered therapeutic agents that carry the mutation sites identified with the desired binding proteins. Any of the therapeutic antibodies listed in Table 9 which has utility in cancer treatment, can be engineered according to the methods of the invention, for example, by modifying the Fc region to have an increased affinity for Fc? RIIIA and / or Fc? RIIA compared to a therapeutic antibody having a wild-type Fc region and used for the treatment and / or prevention of a cancer characterized by an antigen for cancer. Other therapeutic antibodies include those against pathogenic agents such as those against serotype 6B of Streptococcus pneumoniae, see, e.g., Sun et al., 1999, Infection and Immunity, 67 (3): 1172-9. The Fc variants of the invention can be incorporated into therapeutic antibodies such as those described herein or other clinical Fc fusion candidates, i.e., a molecule comprising an Fc region that has been approved in clinical trials or any other molecule that can benefit from the Fc variants of the present invention, humanized, mature affinity, modified or engineered versions thereof. The invention also encompasses engineering any other polypeptide comprising an Fc region having therapeutic utility, including, but not limited to, ENBREL, according to the methods of the invention. invention, for the purpose of improving the therapeutic efficacy of said polypeptides, for example, by improving the effector function of the polypeptide comprising an Fc region. TABLE 9. THERAPEUTIC ANTIBODIES THAT CAN BE TREATED THROUGH ENGINEERING ACCORDING TO THE METHODS OF THE INVENTION Company Product White Illness Abgenix ABX-EGF Cancer Receptor EGF Altarex OvaRex Anticancer cancer ovarian tumor CA125 Bravarex Cancers Antigen metastatic tumor MUC1 Antibody Theragyn Antigen Cancer PEM (pemtumomabytrium- ovaries 90) Therex Breast Cancer Antigen PEM Boehringe Blvatuzumab Cancer of CD44 Ingelheim head and neck Centocor / J &J Panorex Cancer 17-1A colorectal ReoPro CAPT Gp I Hb / II Ia ReoPro MI acute Gp I Hb / II Ia ReoPro Shock Gp I Hb / II Ia ischemic Corixa Bexocar NHL CD20 CRC Technology MAb, 105AD7 G1 72 idiotypic colorectal cancer vaccine Crucell Anti-EpCAM cancer Ep-CAM Cytoclonal MAb, cancer of NA lung non-small cell lung Company Product White Disease Genentech Herceptin Breast cancer HER-2 metastatic Herceptin Breast cancer in HER-2 early stage Rituxan Or. CD20 Retained / low-grade refractor or follicular NHL Rituxan NHL Intermediate and CD20 high-grade Mab-VEGF NSCLC, metastatic VEGF Mab-VEGF Colorectal cancer, metastatic VEGF AMD Fab Age-related macular CDI8 degeneration E-26 (2nd gene. , Rhinitis and asthma IDE Zevalin allergic IgE (Tituxan + CD20-CD20? Tpo-90 low grade) refractory or delayed positive, follicular, B cell NCL and refractory NHL ImClone Cetuximbmab + innotecan Carcinoma Refractory EGF colorectal Cetuximab + Cancer head and Receiver cisplatma and neck newly EGF radiation diagnosed or recurrent Cetuximab + Carcinoma Receptor pancreatic gemcitabine newly diagnosed EGF metastatic Cetuximab + Head cancer and Cisplatme receptor + 5FU or recurrent neck or EGF Taxol methotic Cetuximab + Lung carcinoma Cisplatma + cell receptor EGF small paclitaxel newly diagnosed Companys Product White Disease Cetuximab + Cepuximab Receptor Cancer head and EGF neck (incurable local and regional stenxive disease and distant metastasis) Cetuximab + Receptor Carcinoma of raciation head and EGF locally advanced neck BEC2 + Bac? Llus Carcinoma of Imita Calmette lung of ganglioside Guerin small GD3 cells BEC2 + melanoma Imita Bacillus gangkiosic Calmette GC3 Guepn IMC-ICII Cancer Recipient of colorectal VEGF conmetástasis of liver ImmonoGen nuC242-DMI Cancer colorectal, gastric and pancreatic muC242 ImmunoMedics LymphoCide LmfM non-CD22 is from Hodgkins LymphoCide Y- Lmfoma qu eno CD22 90 is from Hodgkins CEA-Cide CEA-Cide metastatic solid tumors CEA-Cide Y-90 CEA metastatic pain tumors CEA-Sean CEA cancer (colorectal arcitumomab Tc-99m- ( radioimaging) marked) Company Product White Disease CEA-Scan Breast cancer CEA (arcitumomab (radioimagen) Tc-99m-marca¡ CEA-Scan CEA cancer (arcitumomab lung Tc-99m marked) (radioimaging) CEA-Scan CEA tumors (arcitumomab intraoperative Tc-99m -marking) (radioimaging) LeukoScan CD22 infection (sulesomab Tc- 99m-labeled white tissue) (radioimaging) AFP-SCaN (Tc- AFP cancers 99m-labeled germ cells 7 of the liver (radio magen) Intracel HumaRAD-HN Cancer of NA (+ yttrium-90) head and neck HumaSPECT Image NA colorectal Medarex MDX-101 (CTLA- Cancers of CTLA-4 4) prostate and other MDX-210 (her-2 Cancer of HER-2 overexpression) prostate MDX-210 / MAK Cancer HER-2 Medlmmune Vitaxin Cancer Aß? 3 Merck KGaA MAb 425 Various cancers EGF receptor IS-IL-2 Various cancers Ep-CAM Millennium Campath Leukemia CD52 (alemtuzumab) chronic lmfocitica NeoRx CD20- Non-CD20 lymphoma Streptavidin is hodgkins (+ biotina-90th) Avidincina Cancer NA (albúmin a + metastatic NRLU13) Peregrine Oncolym (+ iodine Lmofma that does not HLA-DR-10 131) is from Hodgkins beta Cotrara (+ iodine-malignant Glioma Proteins 131) non-retractable associated with DNA Company Product White Disease Pharmacia C215 Cancer NA Corporation (Staphylococcal pancreatictermotoxicum) MAb, Cancer of NA cancer lung / kidney and lung kidney Nacolomab Cancer of NA tafenatox colon and (C242 + enterotoxin, pancreas, staphylococcal) Protein Nuvion Malignancies CD3 Design Labs T-cell SMART M195 AML CD33 SMART IDIO NHL Antigen HLA-DR Titan CEAVac Colorectal cancer, advanced TriGem Cancer of GD2- ganglioside lung metastatic and small cell melanoma TRiAb Cancer of MUC-1 metastatic breast Trilex CEAV ac Cancer Advanced colorectal CEA TriGem Cancer of GD2- ganglioside melanoma metast 'tatico and small cells TriAb Cancer of MUC-1 metastatic breast Viventia NovoMAb-G2 Lymphoma that radiolabelled NA Biotech is not Hodgkins Monopharm C Carcinoma Colorectal and pancreatic SK-1 Antigen Company Product White Disease GlioMAb-H Glioma, melanoma and NA (+ tox? Na neuroblastoma Gelonina) XOma Rituxan NHL de Orí. CD20 Retained / refractory low-grade or follicular Rituxan adenocarcinoma Ep-CAM ING-1 Malignancies of CD3 T cells Accordingly, the invention provides methods for preventing or treating cancer characterized by a cancer antigen, using a therapeutic antibody that binds to a cancer antigen and is cytotoxic and has been modified at one or more sites in the Fc region, according to with the invention, to bind to Fc? RIIIA and / or Fc? RIIA with a higher affinity than the mother therapeutic antibody and / or more effectively mediate effector function (e.g., CCDA, phagocytosis). In another embodiment, the invention provides methods for preventing or treating cancer characterized by an antigen for cancer, using a therapeutic antibody that binds to an antigen for cancer and is cytotoxic, and has been treated according to the invention to bind to Fc. RIIA and / or Fc? RIIA with a higher affinity and bind to Fc? RIIB with a lower affinity than the parent therapeutic antibody, and / or more effectively mediate effector function (e.g., CCDA, phagocytosis). The therapeutic antibodies that have been engineered according to the invention are useful for the prevention or treatment of cancer, since they have improved cytotoxic activity (e.g., improved tumor cell death and / or, for example, enhanced CCDA activity or CDC activity). Cancers associated with a cancer antigen can be treated or prevented by administering a therapeutic antibody that binds to the antigen of the cancer and is cytotoxic and has been engineered according to the methods of the invention to have, for example, an improved effector function. In a particular embodiment, the therapeutic antibodies engineered according to the methods of the invention improve the antibody-mediated cytotoxic effect of the antibody directed to the antigen for a particular cancer. For example, but not by way of limitation, cancers associated with the following antigens for cancer can be treated or prevented by the methods and compositions of the invention: antigen for KS l / 4pan carcinoma (Pérez and Walker, 1990, J. Immunol 142: 32-37; Bumal, 1988, Hybridoma 7 (4): 407-415), antigen for ovarian carcinoma (CA 125) (Yu et al., 1991, Cancer Res 51 (2): 48-475), prostatic acid phosphate (Tallor et al. , 1990, Nucí Acids Res. 18 (1): 4928), specific antigen for prostate (Henttu and Nihko, 1969, Biochem, Biophys, Res. Comm. 10 (2)): 903-910; Israeli et al., 1993, Cancer Res. 53: 227-230), antigen associated with melanoma p97 (Estin et al., 1989, J. Nati, Cancer Institute 81 (6): 445-44), gp75 melanoma antigen (Vijayasardahl et al., 1990, J. Exp. Med. 171 (4): 1375-1380) , hmolecular we melanoma antigen (AMA-APM) (Natali et al., 1987, Cancer 59: 55-3; Mittelman et al., 1990, J. Clin. Invest. 86: 2136-2144)), membrane antigen Specific for prostate, carcinoembryonic antigen (ACE) (Foon et al., 1994, Proc. Am. Soc. Clin. Oncol. 13: 294), antigen of polymorphic epithelial mucin, antigen of fat globules of human milk, antigens associated with colorectal tumors such as ACE, TAG-72 (Yokata et al., 1992, Cancer Res. 52: 3402-3408); C017-1A (Ragnhmmar et al., 1993, Int. J. Cancer 53: 751-758); GICA 19-9 (Herlyn et al., 1982, J. Clin Immunol.2: 135), antigen-CD20 for human B-lymphoma (Reff et al., 1994, Blood 83: 435-445); CD33 (Sgouros et al., 1993, J. Nucí, Med. 34: 422-430), specific antigens for melanoma such as GD2 ganglioside (Saleh et al., 1993, J. Immunol., 151, 3390-3398), ganglioside GD3 (Shitara et al., 1993, Cancer Immunol Immunother, 36: 373-380), ganglioside GM2 (Livingston et al., 1994, 7, Clin.Oncol.12: 1036-1044), ganglioside BM3 (Hoon et al., 1993 Cancer Res. 53: 5244-5250), transplantation type specific for cell surface antigen tumor (TSTA) such as virally induced tumor, antigens including T-antigen virus of DNA tumor and cover antigen of RNA tumor virus, antigen oncofetal-alpha-fetoprotein such as ACE of colon, oncofetal antigen of bladder tumor (Hellstrom et al., 1985, Cancer, Res. 45: 2210-2188), differentiation antigen such as antigen of human lung carcinoma L6, L20 ( Hellstrom et al., 1986, Cancer Res. 46-3917-3923), fibrosarcoma antigens, human leukemia T-cell antigen-Gp37 (Bhattacharya-Chatterjee et al., 1988, 7. opimmun. 141: 1398-1403), neoglycoprotein , sphingolipids, antigen for breast cancer such as EGFR (epidermal growth factor receptor), HER2 antigen (pl85I1ER2), polymorphic epithelial mucin (MEP) (Hilkens et al., 1992, Trens in Bio. Chem. Sci. 17: 359 ), malignant human lymphocyte antigen - APO-1 (Bernhard 245: 301-304), differentiation antigen (Feizi, 1985, Nature 314: 53-57) such as the antigen found in fetal erythrocytes and primary endoderm, I (Ma ) found in gastric adenocarcinomas, MI8 and M39 found in breast epithelium, SSEA-I found in cé myeloid cells, VEP8, VEP9, Myl, VIM-D5 and DI 56-22 found in colorectal cancer, TRA-1-85 (blood group H), C14 found in colonic adenocarcinoma, F3 found in lung adenocarcinoma, AH6 found in cancer gastric, And hapten, Le? found in embryonal carcinoma cells, TL5 (blood group A), EGF receptor found in A431 cells, E series (blood group B) found in pancreatic cancer, FC10 2 found in embryonal carcinoma cells, gastric adenocarcinoma, C0-514 (Led blood group) found in adenocarcinoma, NS-10 found in adenocarcinomas, CO-43 (blood group Leb), G49, EGF receptor, (blood group Aleb / Ley) found in colon adenocarcinoma, 19.9 found in colon cancer, mucins of gastric cancer, T5A7 found in myeloid cells, R24 found in melanoma, 4.2, G03, DI.l, OFA-1, GM2, OFA-2, MI: 22-25: 8 found in embryonal carcinoma cells and SSEA-3, SSEA-4 found in cell stage embryos 4-8. In another embodiment, the antigen is a peptide derived from the T cell receptor of a cutaneous T-cell lymphoma (see Edelson, 1998, The Cancer Journal 4:62). Cancers and disorders that can be treated or prevented by methods and compositions of the present invention include, but are not limited to the following: Leukemias including, but not limited to, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia such as myeloblastic leukemia, promyelocytic, myelomonocytic, monocytic, erythroleukemia and myelodysplastic syndrome, chronic leukemias such as, but not limited to, chronic myelocytic leukemia (granulocytic), chronic lymphocytic leukemia, hairy cell leukemia, olicitaemia vera; lymphomas such as, but not limited to, Hodgkins disease, non-Hodgkins disease, multiple myelomas such as, but not limited to, myeloma latent multiple, non-secreting myeloma, myeloma to osteoskelectomy, plasma cell leukemia solitary plasmacytoma and extramedullary plasmacytoma, Waldensttrom macroglobulmia, monoclonal gammopathy of undetermined importance; benign monoclonal gammopathy, heavy chain disease, bone sarcomas and connective tissue, such as but not limited to, bone sarcoma, osteosarcoma, chondrosarcoma, Ewing's sarcoma, malignant giant cell tumor, bone fibrosarcoma, chordoma, peposal sarcoma, sarcomas of white tissue, angiosarcoma (Hemangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lmfoangiosarcoma, neuplemoma, rhabdomyosarcoma, sarcoma synovia; brain tumors including, but not limited to, glima, astrocytoma, brain stem glima, ependymoma, oligodendroglioma, nonglial tumor, acoustic neunnoma, craniopharyngioma, medulloblastoma, menmgioma, pineocitoma, pmeoblastoma, primary brain lymphoma; breast cancer including, but not limited to, adenocarcinoma, lobular carcinoma (small cells), mtraductal carcinoma, medullary breast cancer, mucosal breast cancer, tubular breast cancer, papillary breast cancer, Paget's disease, and cancer of the breast inflammatory breast; adrenal cancer, including but not limited to, pheochromocytoma and adrenocortical carcinoma; thyroid cancer such as, but not limited to, papillary or follicular tiopdal cancer, medullary thyroid cancer and anaplastic thyroid cancer; pancreatic cancer including, but not limited to, insulinoma, gastrinoma, glucagonoma, vipoma, somatostostin secreting tumor, and scarce or islet cell tumor; pituitary cancers including, but not limited to, Gushing's disease, prolactin-secreting tumor, acromegaly, and diabetes insipient; eye cancers including, but not limited to, ocular melanoma such as iris melanoma, choroidal melanoma and ciliary body melanoma, and retinoblastoma; vaginal cancers, including, but not limited to, squamous cell carcinoma, adenocarcinoma, and melanoma; vulvar cancer, including, but not limited to, squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget's disease; cervical cancers, including but not limited to, squamous cell carcinoma and adenocarcinoma; uterine cancers, including but not limited to, endometrial carcinoma and uterine sarcoma; ovarian cancers including, but not limited to, ovarian epithelial carcinoma, peripheral tumor, germ cell tumor and stromal tumor; esophageal cancers, including but not limited to, squamous cell carcinoma, adenocarcinoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, verrucous carcinoma, and oat cell carcinoma (small cells); stomach cancers, including but not limited to, adenocarcinoma, fungal (polypoid), ulcerative, superficial dissemination, diffuse dissemination, malignant lymphoma, liposarcoma, fibrosarcoma, and carcinosarcoma, colon cancers; rectal cancers; liver cancers including, but not limited to, hepatocellular carcinoma and hepatoblastoma; bladder cancers including but not limited to, adenocarcinoma; cholangiocarcinomas including, but not limited to, papillary, nodular and diffuse; lung cancers, including but not limited to, non-small cell lung cancer, squamous cell carcinoma (squamous cell carcinoma), adenocarcinoma, large cell carcinoma, and small cell carcinoma; testicular cancers, including, but not limited to, terminal tumor, seminoma, anaplastic, classic (typical), spermatocytosis noseminoma, non-embryonal carcinoma, teratoma carcinoma, choriocarcinoma (yolk sac tumor); prostate cancers including, but not limited to, adenocarcinoma, leiomyosarcoma and rhabdomyarcoma; criminal cancers; oral cancers including but not limited to, squamous cell carcinoma; basal cancers; salivary gland cancers including but not limited to, adenocarcinoma, mucoepidermoid carcinoma, and adenoidecistic carcinoma; pharyngeal cancers including but not limited to, squamous and warty cell cancer; skin cancers including but not limited to, basal cell carcinoma, squamous cell carcinoma and melanoma, melanoma of superficial dissemination, nodular melanoma, malignant melanoma lentigo, lentiginous acral melanoma; kidney cancers, including but not limited to, renal cell cancer, adenocarcinoma, hypernephroma, fibrosarcoma, transient cell cancer (renal pelvis and / or ureter); Wilms tumor; bladder cancers including, but not limited to, transient cell carcinoma, squamous cell cancer, adenocarcinoma, carcinosarcoma. In addition, the cancers include myxosarcoma, osteogenic sarcoma, enteliosarcoma, lymphangioendotheliosarcoma, mesothelioma, synovium, hemangioblastoma, epithelial carcinoma, cystadenocrcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma and papillary adenocarcinomas (for a review of said disorders , see Fishman et al., 1985, Medicine, 2nd Ed., JB Lippincott Co., Philadelphia and Murphy et al., 1997, Informed Decisions: The Complete Book of Cancer Diagnosis, Treatment, and Recovery, Viking Penguin, Penguin Books USA, Inc., United States of America). Accordingly, the methods and compositions of the invention are also useful for the treatment or prevention of a variety of cancers or other abnormal proliferative diseases, including, but not limited to, the following: carcinoma, including that of bladder, breast, colon, kidney , liver, lung, ovary, pancreas, stomach, prostate, cervix, thyroid and skin; including squamous cell carcinoma; hemotopoietic tumors of lymphoid lineage, including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Burketts lmoma, hematopoietic tumors of myeloid lineage, including acute and chronic myelogenous leukemias and promyelocytic leukemia; tumors of mesenchymal origin, including fibrosarcoma and rhabdomyosarcoma; other tumors, including melanoma, seminoma, tetratocarcinoma, neuroblastoma and glioma; tumors of the central and peripheral nervous system, including astrocytoma, neuroblastoma, glioma, and schwannomas; tumors of mesenchymal origin, including fibrosarcoma, rhabdomyosarcoma, and osteosarcoma; and other tumors, including melanoma, xenoderma pegmentosum, keratoactantoma, semmoma, thyroid follicular cancer, and tetratocarcinoma. Also contemplated are cancers caused by aberrations in apoptosis that could also be treated by the methods and compositions of the invention. Such cancers may include, but are not limited to, follicular neoplasms, carcinomas with mutations in p53, tumors that depend on mammary hormones, prostate and ovaries, and precancerous lesions such as familial adenomatous polyposis, and myelodysplastic syndromes. In specific modalities, malignant or disproliferative changes (such as metaplasia and dysplasia), or disorders hyperproliferatives, are treated or prevented by the methods and compositions of the invention in the ovary, bladder, breast, colon, lung, skin, pancreas or uterus. In other specific embodiments, sarcoma, melanoma or leukemia are treated or prevented by the methods and compositions of the invention. In a specific embodiment, a molecule of the invention (e.g., an antibody comprising a variant Fc region, or a therapeutic monoclonal antibody treated according to the methods of the invention) inhibits or reduces tumor growth or metastasis of cancer cells by at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20% , or at least 10%, in relation to tumor growth or primary metastasis in the absence of said molecule of the invention. 5. 4.1.1. COMBINATION THERAPY The invention further encompasses administering the molecules of the invention in combination with other therapies known to those skilled in the art for the treatment or prevention of cancer, including, but not limited to, current and experimental chemotherapies, hormonal therapies, biological therapies, immunotherapies, radiation therapies or surgery. In some embodiments, the molecules of the invention can be administered in combination with a therapeutically or prophylactically effective amount of one or more anticancer agents, therapeutic antibodies (e.g., antibodies listed in Table 9), or other agents known to the skilled artisan. in the art for the treatment and / or prevention of cancer (See Section 5.4.1.2). In certain embodiments, one or more molecules of the invention is administered to a mammal, preferably a human, concurrently with one or more therapeutic agents useful for the treatment of cancer. The term "concurrently" is not limited to the administration of prophylactic or therapeutic agents at exactly the same time, but it is understood that a molecule of the invention and another agent are administered to a mammal in a sequence and within a time in such a manner that the molecule of the invention can act together with the other agent to provide an increased benefit to what they would have if administered in another way. For example, each prophylactic or therapeutic agent (e.g., chemotherapy, radiation therapy, hormonal therapy or biological therapy) can be administered at the same time or sequentially in any order at different times; however, if they are not administered at At the same time, they should be administered with a sufficiently narrow time in order to provide the desired therapeutic or prophylactic effect. Each therapeutic agent can be administered separately, in any appropriate form and by any suitable means. In various embodiments, the prophylactic or therapeutic agents are administered with less than 1 hour of separation, in about 1 hour of separation, in about 1 hour to about 2 hours apart, in about 2 hours to about 3 hours apart, in about 3 hours to about 4 hours apart, in about 4 hours to about 5 hours apart, in about 5 hours to about 6 hours apart, in about 6 hours to about 7 hours apart, in about 7 hours to about 8 hours apart, in about 8 hours to about 9 hours apart, in about 9 hours to about 10 hours apart, in about 10 hours to about 11 hours apart, in about 11 hours at about 12 hours apart, no more than 24 hours apart or no more than 48 hours apart. In preferred embodiments, two or more components are administered within the same patient visit.

In other embodiments, the prophylactic or therapeutic agents are administered with about 2 to 4 days apart, with about 4 to 6 days apart, 1 week apart, with about 1 to 2 weeks apart or more than 2 weeks apart. In preferred embodiments, the prophylactic or therapeutic agents are administered at a time when both agents are still active. Someone skilled in the art could be able to determine the time if it determines the half-life of the agents administered. In certain embodiments, the prophylactic or therapeutic agents of the invention are cyclically administered to a subject. Cyclic therapy involves the administration of a first agent for a time, followed by the administration of a second agent and / or a third agent for a time and repeating this sequence administration. Cyclic therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and / or improve the effectiveness of the treatment. In certain embodiments, the prophylactic or therapeutic agents are administered in a cycle of less than about 3 weeks, about once every two weeks, about once every 10 days or about once every week. A cycle may include administration of a therapeutic or prophylactic agent by infusion for approximately 90 minutes each cycle, approximately 1 hour each cycle, approximately 45 minutes each cycle. Each cycle can include at least 1 week of rest, at least 2 weeks of rest, at least 3 weeks of rest. The number of cycles administered is from about 12 to about 12 cycles, more typically from about 2 to about 10 cycles and more typically from about 2 to about 8 cycles. In still other embodiments, the therapeutic and prophylactic agents of the invention are administered in metronomic dosing regimens, either by continuous infusion or frequent administration without extended rest periods. Said metronomic administration may involve dosing at constant intervals without rest periods. Normally, therapeutic agents, in particular cytotoxic agents, are used at lower doses. Said dosing regimens encompass chronic target administration of relatively low doses for extended times. In preferred embodiments, the use of lower doses can minimize toxic side effects and eliminate rest periods. In certain embodiments, the therapeutic and prophylactic agents are delivered by chronic low doses or continuous infusion ranging from about 24 hours to about 2 days, to about 1 week, at about 2 weeks, at about 3 weeks, at about 1 month, at about 2 months, at about 3 months, at about 4 months, at about 5 months, at about 6 months. The programming of such dose regimens can be optimized by an expert oncologist. In other embodiments, the courses of treatment are administered concurrently to a mammal, i.e. individual doses of the therapeutics are administered separately even within a time such that the molecules of the invention can work together with the other agent or agents . For example, a component can be administered once a week in combination with the other components that can be administered once every two weeks or once every three weeks. In other words, dosing regimens for therapeutics are carried out concurrently even if the therapeutics are not administered simultaneously or within the same patient visit. When used in combination with other prophylactic and / or therapeutic agents, the molecules of the invention and the prophylactic and / or therapeutic agent may act additively, or more preferably, synergistically. In one embodiment, a molecule of the invention is concurrently administered with one or more therapeutic agents in the same pharmaceutical composition. In another modality, a The molecule of the invention is administered concurrently with one or more therapeutic agents in separate pharmaceutical compositions. In yet another embodiment, a molecule of the invention is administered before or after the administration of another prophylactic or therapeutic agent. The invention contemplates the administration of a molecule of the invention in combination with other prophylactic or therapeutic agents by the same routes of administration or different ones, eg, oral and parenteral. In certain embodiments, when a molecule of the invention is administered concurrently with another prophylactic or therapeutic agent that potentially produces adverse side effects including, but not limited to, toxicity, the prophylactic or therapeutic agent can be advantageously administered at a dose that falls below the threshold. to which the adverse side effect occurs. The amounts of doses and frequencies of administration provided herein are encompassed by therapeutically effective and prophylactically effective terms. Doses and frequency will normally vary according to the specific factors for each patient depending on the specific therapeutic or prophylactic agents administered, the severity and type of cancer, the route of administration, as well as age, body weight, response and the latest medical history of the patient. Appropriate regimens can be selected by someone skilled in the matter considering these factors and for the following, for example, doses reported in the literature and recommended in the Physician's reference (56th ed., 2002). 5. 4.1.2. OTHER THERAPEUTIC / PROPHYLACTIC AGENTS In a specific embodiment, the methods of the invention encompass the administration of one or more molecules of the invention with one or more therapeutic agents used for the treatment and / or prevention of cancer. In one embodiment, angiogenesis inhibitors can be administered in combination with the molecules of the invention. Inhibitors of angiogenesis that can be used in the methods and compositions of the invention include, but are not limited to: Angiostatma (plasminogen fragment); angiogenic antithrombin III; Angiozyme; ABT-627; Bay 12-9566; Benefm; Bevacizumab; BMS-275291; cartilage-derived inhibitor (CD1); CAÍ; fragment of complement CD59; CEP-7055; Col 3; Combretastatin A-4; Endostatma (fragment of collagen XVIII); fragment of fibronectm; Gro-beta; Halofuginone; Heparinases; hepapne hexasaccharide fragment; HMV833; human gonadotropin (hCG); IM-862; Inferred alpha / beta (gamma) inducible interferon protein (BP-10), Interleukin-12, Kringle 5 (fragment of plasminogen), Marimastat, inhibitors of metalloproteinase (TIMP), 2-methox? Estrad? Ol, MMI 270 (CGS 27023A); MoAb IMC- 1C11; neovastat; NM-3; Panzem; PI-88; Placental ribonuclease inhibitor; inhibitor of activated plasmogen; Platelet factor 4 (FP4); Ppnomastat; 16 kD fragment of prolactm; protein related to prolifenna (PRP); PTK 787 / ZK 222594; Retmoids; Solimastat; Squalamin; SS 3304; SU 5416; SU6668; SUI 1248; Tetrahydrocortisol-S; tetrathiomolybdate; thalidomide; Thrombospondma-1 (TSP-1); TNP-470; growth factor beta transformation (FCT-b); Vasculostatm; Vasostatm (fragment of calreticulin); ZD6126; ZD 6474; inhibitors of farmesyl transferase (IFT); and bisphosphonates. Anticancer agents that can be used in combination with the molecules of the invention in the various embodiments of the invention, including pharmaceutical compositions, dosage forms and kits of the invention, include, but are not limited to: acivicin; aclarubicma; Codazole hydrochloride; Acronine; adozelesma; aldesleucma; altretamma; ambomicma; ametantrone acetate; aminoglutethimide; to sacrma; anastrozole; anthramic; asparaginase; asperlina; azacitidine; azetepa; azotomicma; batimastat; benzodepa; bicalutamide; bisantrene hydrochloride; binafide dimesylate; bizelesma; bleomicma sulfate; brequinar sodium; biririmma; busulfan; cactomyomycin; calusterona; caracemide; carbetimer; carboplatma; carmustma; carubicin hydrochloride; carzelesin; cedefingol; chlorambucil; Corylemycin; cisplatin; cladribine; crisnatol mesylate; cyclophosphamide; citrabine; Dacarbazine; Dactinomycin; caunorubicin hydrochloride; decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate; diazicuone; docetaxel; doxorubicin; Doxorubicin hydrochloride; droloxifene; Droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate; eflornithine hydrochloride; elsamitrucin; enloplatin; enpromato; epopropidin; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine sodium phosphate; etanidazole; etoposide; etoposide phosphate; etoprin; fadrozole hydrochloride; fazarabine; fenretinide; floxuridine; Fludarabine phosphate; fluorouracil; fluorocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; 'ifosfamide; ilmofosin; interleukin II (including recombinant interleukin II or rIL2), interferon alfa-2a; interferon alfa-2b; interferon alfa-nl; interferon alfa n3; interferon beta la; interferon gamma-Ib; iproplatin; Irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride; masoprocol; maytansina; Mechloroetheramide hydrochloride; Megestrol acetate; melengestrol acetate; melphalan; menogaril; 4 mercaptopurine; methotrexate; sodium methotrexate; metopin; meturedepa; mitinomide; mitocarcin; mitochromin; mitogilin; mitomalcin; mitomycin; mitospera; mitotane; mitoxantrone hydrochloride; mycophenolic acid; nocodazole; nogalamycin; ormaplatin; oxisuran; paclitaxel; pegaspargasa; Peliomycin; pentamustine; pyrromycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone hydrochloride; plicamycin; pentamethane; porfimero sodium; porphyromycin; Prednimustine; procarbazine hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; safingol hydrochloride; semustine; simtrazeno; sodium esparfosato; sparzomycin; Spirogermanium hydrochloride; spiromustine; Spiroplatin; streptonigrin; streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride; temoportin; teniposide; Teroxirone; testolactone: tiamiprin; thioguanine; thiotepa; thiazofurine; tirapazamine; Toremifene citrate; trastolone acetate; triciribine phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; mustard uracil; uredepa; vapretid; Verteporfin; vinblastine sulfate; vincristine sulfate; vindesine; vindesine sulfate; vinepidin sulfate; vinglicinate sulfate; vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate; vinsolidine sulfate; vorozole; zipiplatine; zinostatin; Zorubicin hydrochloride. Other anticancer drugs include, but are not limited to: 20-epi- 1.25 5 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acilfulveno; adecipenol; adozelesina; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid, amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; inhibitors of angiogenesis; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein-1; antiandrogen; prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; afidicolin glycinate; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; Asinastatin 3; azasetrot; azatoxin; azathirosine; Baccatin III derivatives; balanol batimastat; BCR / ABL antagonists; benzoclorins; benzoyl tauroesporin; betalactam derivatives; beta-aletine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylpermine; bisnafida; bistratene A; bizelesin; breflato; biririmine; budotiatano; sulfoximine butionine; calcipotriol; Calphoestin C; Campotecin derivatives; canaripox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaREst M3; CARN 700; inhibitor derived from cartilage; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorines; chloroquinozaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomiphene analogues; clotrimazole; colismicin A; colismicin B; combretastatin A4; Combinstatin analogue; conagenina; crambescidin 816; crisnatol; cryptophycin 8; Cryptophycin A derivatives; Curacin -A; cyclopentantraquinones; Cycloplatam; cipemycin; cytarabine octiophosphate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin 25B; deslorelin; dexamethasone; Desiphosphamide; desrazoxane; dexverapamil; diaziquone; diderminin B; didox; diethylnospermine; dihydro-5-azacytidine; dihydrotaxol; 9-dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmicin SA; ebselen; ecomustine; edelfosin; Edrecolomab; eflomitin; elemeno; emitefur; epirubicin; epristerida; estramustine analogue; estrogen agonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastima; Finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; flurodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfame; heregulina; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifen; idramantone; ilmofosin; ilomastat, imidazbacridones; imiquimod; immunostimulatory peptides; Insulin-1-like growth factor receptor inhibitor; interferon agonists; interferons; interleukins; lobenguan; iododoxorubicin; ipomeanol; 4-iroplact; irsogladine; isobengazol; isohomohalicondrine B; itasetron; jasplaquinolide; kahalida F; lamelarin-N triacetate; landed; leinamycin; lenograstima; Lentine sulfate; leptoistatin; letroxol; Leukemia inhibitory factor; leukocyte alpha interferon; leuprolide + estrogen + progesterone; leuprorelin; levamisole; liarozole; linear polyamine analog; lipophilic disaccharide peptide; lipophilic platinum compounds; lisoclimamide 7; lobaplatin; lonbricina; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecano; lutetium texaphyrin; Lyophilin: Uptic peptides; Maytansine; Handstatin A; marimastat; masoprocol; maspina; matrilysin inhibitors; inhibitors of metalloproteinase matrix; menogarilo; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; mitefosine; minimostima; Odd double-stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; fibroblast growth factor mitotoxin-saporin; mitoxantrone; mofarotene; molgramostimo; monoclonal antibody; human chorionic gonadotropin; lipid monophosphoryl with cell wall sk of myobacterium sk; mopidamol; drug resistance gene inhibitor multiple, therapy based on multiple tumor suppressor -1; anticancer agent of mustard; micaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone + pentazocine; napavina; nafterpina; nartograstimo; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; Nitric oxide modulators; nitroxide antioxidant; nitrulin; 06-benzylguanine; byte; ocicenona; oligonucleotides; onapristone; ondansetrone; ondansetrone; oracine; oral cytokine inducer; ormaplatin; osaterone; Oxaliplatin; oxaunomycin; paclitaxel; Paclitaxel analogues; paclitaxel derivatives; pegaspargasa; peldesina; pentosan sodium polysulfate; ptenstatin; pentrozole; perfluobron; perfosfamide; perilic alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plaminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimero de sodio; porphyromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; immune modulator based on protein S; inhibitor of protein kinase C; protein kinase C inhibitors; microalgal; inhibitors of protein tyrosine phosphatase; purine inhibitors nucleoside phosphorylase; purpurins; pyrazolacridine; pyridoxylate hemoglobin-polyoxyethylene conjugate; Raf antagonists; raititrexed; ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; dimethylated reteliptin; rhenium etidronate Re 186; rhizoxin; ribozymes; Retinamide II; rogledimide; rohitukina; romurtida; roquinimex; Rubiginone Bl; ruboxyl; safingol; saintopine; SarCNU; sarcofitol A; argramostima; imitation of Sdi 1; semustine; inhibitor of senescence derivative 1; sense oligonucleotides; inhibitors of signal transduction; modulators of signal transduction; single chain antigen binding protein; sizofiran; Sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; Somatormedin binding protein; sonermin; Esparfosic acid; Spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stem cell inhibitor; inhibitors of stem cell division; stihadid; stromelysin inhibitors; Sulfinosine; superactive vasoactive intestinal peptide antagonists; suradista suramin; Esvainsonin; synthetic glycosaminoglycans; tali ustina; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafu; telurapyrilio; telomerase inhibitors; temoporfin; themosomomy; teniposic; tetrachloro decaoxide; tetrazomine; Taliblastine; thiocoraline; thrombopoietin; imitation of thrombotopetin; timalfasin; agonist thymopoietin receptor; thymotrinan; thyroid stimulating hormone; ethyl etiopurpurine tin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; Translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turoesteride; tyrosine kinase inhibitors; Tyrphostins; UBC inhibitors; ubenimex; growth inhibitory factor derived from the urogenital sinus; Urokinase receptor antagonists; vapretid; variolin B; vector system; erythrocyte gene therapy; velaresol; veramina; verdinas; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; annotate; zipiplatine; zilascorb; and zinostatin stimulator. The preferred additional cancer drugs are 5-fluorouracil and leucovorin. Examples of therapeutic antibodies that can be used in methods of the invention include, but are not limited to ZENAP AX® (daclizumab) (Roche Pharmaceuticals, Switzerland) which is a humanized, immunosuppressant, anti-CD25 monoclonal antibody for the prevention of allograft rejection acute renal; PANOREX ™ which is an anti-17lA murine cell surface antigen IgG2a antibody (Glaxo Wellcome / Centocor); BEC2 which is an anti-idiotypic murine IgG (epitope CG3) antibody (ImClone System); IMC-C225 which is a chimeric anti-EGFR IgG antibody (ImClone System); VITAXIN ™ which is a humanized anti-aVß3 integrin antibody (Applied Molecular Evolution (Medimmune); Smart M195 which is a humanized anti-CD33 IgG antibody (Protein Design Lab / Kanebo); LYMPHOCIDE ™ which is a humanized anti-CD22 IgG antibody (Immunomedics) ICM3 is a humanized anti-ICAM3 antibody (ICOS Pharm) IDEC-114 is a primatized anti-CD80 antibody (EDEC Pharm / Mitsubishi) IDEC-131 is a humanized anti-CD40L antibody (EDEC / Eisai); IDEC-151 is a primatized anti-CD4 antibody (IDEC), IDEC-152 is a primatized anti-CD23 antibody (EDEC / Sikagaku), SMART anti-CD3 is a humanized anti-5CD3 IgG (Protein Design Lab); is an antibody (C5) anti-humanized factor complement (Alexion PKarrh), D2E7 is a humanized anti-TNF-a antibody (CAT / BASF), CDP870 is a humanized anti-TNF-a Fab fragment (Celltech); 151 is a primatized anti-CD4 IgGl antibody (EDEC Pharm / SmithKline Beecham); MDX-CD4 is a human anti-CD4 IgG antibody (Med arex / Eisai / Genmab); CDP571 is a humanized anti-TNF-a IfG4 antibody (Celltech); LDP02 is a humanized anti-a4ß7 antibody (LeukoSite / Genentech); OrthoClone 0KT4A is a humanized anti-CD4 IgG antibody (Ortho Biotech); ANTOVA ™ is a humanized anti-CD40L IgG antibody (Biogen); ANTEGREN ™ is a humanized anti-VLA-4 IgG antibody (Elan); and CAT-152 is a human anti-TGF-β2 antibody (Cambridge Ab Tech). Others Examples of therapeutic antibodies that can be used according to the invention are presented in Table 9. 5. 4.2. AUTOIMMUNE DISEASE AND INFLAMMATORY DISEASES In some embodiments, the molecules of the invention comprise a variant Fc region, having one or more amino acid modifications in one or more regions, said modification increasing the affinity of the variant Fc region for Fc? RIIB but decreases the affinity of the variant Fc region for Fc? RIIIA and / or the Fc region variant for Fc? RIIB but decreases the affinity of the variant Fc region for Fc? RIIIA and / or Fc? RIIA. The molecules of the invention with said binding characteristics are useful for regulating the immune response, e.g., to inhibit the immune response in relation to autoimmune diseases or inflammatory diseases. Although not intended to be linked to some mechanism of action, the molecules of the invention with increased affinity for Fc [gamma] RIIB and a decreased affinity for Fc [gamma] RIIIA and / or Fc [gamma] RIIA can lead to a decrease in the activation response to Fc? R and the inhibition of cellular responses. In some embodiments, a molecule of the invention comprising a variant Fc region is not an immunoglobulin, and comprises at least one modification of amino acids, said modification increases the affinity of the variant Fc region for Fc? RIIB in relation to a molecule comprising a wild-type Fc region. In other embodiments, said molecule further comprises one or more amino acid modifications, said modifications decreasing the affinity of the molecule for an activating FcγR. In some embodiments, the molecule is a soluble Fc region. The invention contemplates other amino acid modifications within the soluble Fc region which modulates its affinity for several Fc receptors, including those known to one skilled in the art as described herein. In other embodiments, the molecule (e.g., the Fc region comprising at least one or more amino acid modifications) is modified using techniques known to one skilled in the art and as described herein to increase life media in vivo of the Fc region. Said molecules have therapeutic utility to treat and / or prevent an autoimmune disorder. Although not intended to be linked to any mechanism of action, said molecules with increased affinity for Fc? RIIB will lead to a decrease in activation receptors and therefore a decrease in the immune response and have therapeutic efficacy to treat and / or prevent an autoimmune disorder In certain embodiments, one or more amino acid modifications, which increase the affinity of the variant Fc region for Fc? RIIB but decreases the affinity of the variant Fc region for Fc? RIIIA comprises a substitution at position 246 with threonine and in position 396 with histidine; or a substitution at position 268 with aspartic acid and at position 318 with aspartic acid; or a substitution at position 217 with serine, at position 378 with valine and at position 408 with arginine; or a substitution at position 375 with cysteine and at position 396 with leucine; or a substitution at position 246 with isoleucine and at position 334 with asparagine. In one embodiment, one or more amino acid modifications, which increases the affinity of the variant Fc region for Fc? RIIB but decreases the affinity for the variant Fc region for Fc? RIIIA comprises a substitution at position 247 with leucine. In another embodiment, one or more amino acid modifications, which increases the affinity of the variant Fc region for Fc? RIIB but decreases the affinity of the variant Fc region for Fc? RIIIA comprises a substitution at position 372 with tyrosine. In yet another embodiment, one or more amino acid modifications, which increases the affinity of the variant Fc region for Fc? RIIB but decreases the affinity of the variant Fc region for Fc? RIIIA comprises a substitution at position 326 with glutamic acid . In one embodiment, one or more amino acid modifications, which increases the affinity of the variant Fc region for Fc? RIIIB but decreases the affinity of the variant Fc region for Fc? RIIIA comprise a substitution at position 224 with leucine. Variant Fc regions that have an increased affinity for Fc? RIIB and a decreased affinity for Fc? RIIIA and / or Fc? RIIA relative to a comparable molecule comprising a wild-type Fc region, can be used to treat or prevent diseases autoimmune or inflammatory diseases. The present invention provides methods for preventing, treating, or managing one or more symptoms associated with an autoimmune or inflammatory disorder in a subject, comprising administering to said subject a therapeutically or prophylactically effective amount of one or more molecules of the invention with Fc regions. variant having an increased affinity for Fc? RIIB and a decreased affinity for Fc? RIIIA and / or Fc? RIIA relative to a comparable molecule comprising a wild-type Fc region. The invention also provides methods for preventing, treating or managing one or more symptoms associated with an inflammatory disorder in a subject further comprising administering to said subject a therapeutically or prophylactically effective amount of anti-inflammatory agents. The invention also provides methods for preventing, treating or managing one or more symptoms associated with an autoimmune disease which further comprises administering to said subject a therapeutically or prophylactically effective amount of one or more immunomodulatory agents. Section 5.4.2.1. provides non-limiting examples of anti-mflamatory agents and immunomodulatory agents. Examples of autoimmune disorders that can be treated by administering the molecules of the present invention include, but are not limited to, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, Addison autoimmune disease, autoimmune diseases of the adrenal gland, autoimmune hemolytic anemia, autoimmune hepatitis , oophoritis and autoimmune orchitis, autoimmune thrombocytopenia, Beshet's disease, pemphigoid blistering, cardio-myopathy, celiac sprue dermatitis, chronic fatigue immune dysfunction syndrome (CPSDF), chronic inflammatory demyelinating polymeuropathy, Churg-Strauss syndrome, pemphigoid scarring, CREST syndrome, cold agglutinin disease, Crohn's disease, discoidal lupus, mixed to essential cryoglobulinemia, fibromyalgia-fibromyositis, glomerulonephritis, Graves disease, Guillain-Barre, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenia purpura (PTl), Ig neuropathy A, juvenile arthritis, lichen planus, lupus erythematosus, meniere's disease, mixed connective tissue disease, multiple sclerosis, type 1 or mediated diabetes mellitus, immune, myasthenia gravis, penfigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulmemia , primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynauld's phenomenon, Reiter's syndrome, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, rigidity syndrome, systemic lupus erythematosus, lupus erythematosus, Takayasu arteritis, temporal arteritis, giant cell arteritis , ulcerative colitis, ureitis, vasculitis such as vasculitis due to dermatitis herpetiformis, vitiligo and Wegener's granulomatosis. Examples of inflammatory disorders include, but are not limited to, asthma, encephalitis, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), allergic disorders, septic shock, pulmonary fibrosis, undifferentiated spondyloarthropathy, undifferentiated arthropathy, arthritis, inflammatory osteolysis and chronic inflammation that results from viral or bacterial chronic infections. As described herein, in Section 2.2.2, some autoimmune disorders are associated with an inflammatory condition. Therefore, there is an overlap between what is considered a disorder autoimmune and an inflammatory disorder. Therefore, some autoimmune disorders can also be characterized as inflammatory disorders. Examples of inflammatory disorders that can be prevented, treated or managed according to the methods of the invention include, but are not limited to, asthma, encephalitis, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), allergic disorders, septic shock, fibrosis pulmonary, undifferentiated spondyloarthropathy, undifferentiated arthropathy, arthritis, inflammatory osteolysis, and chronic inflammation resulting from viral or bacterial chronic infections. The molecules of the invention with variant Fc regions that have an increased affinity for FcγRIIB and decreased affinity for FcγRIIIA relative to a comparable molecule comprising a wild-type Fc region, can also be used to reduce the inflammation experienced by animals, particularly mammals, with inflammatory disorders. In a specific embodiment, a molecule of the invention reduces inflammation in an animal by at least 99%, by at least 95%, by at least 90%, by at least 85%, by at least 80% , at least 75%, at least 70%, or at least 60%, at least 50%, at least 45%, at least 40%, at least 45% , at least 35%, at least 30%, for at least 25%, at least 20%, or at least 10% in relation to the inflammation in an animal to which said molecule has not been administered. Molecules of the invention with variant Fc regions that have an increased affinity for Fc? RIIB and a decreased affinity for Fc? RIIIA relative to a comparable molecule comprising a wild-type Fc region can also be used to prevent rejection of transplants The invention further contemplates engineering any of the antibodies known in the art for the treatment and / or prevention of autoimmune disease or inflammatory disease, such that the antibodies comprise a variant Fc region comprising one or more amino acid modifications, which they have been identified by the methods of the invention to have an increased affinity for Fc? RIIB and an affinity will decrease for Fc? RIIIA relative to a comparable molecule comprising a wild-type Fc region. A non-limiting example of the antibodies that are used for the treatment or prevention of inflammatory disorders that can be treated by engineering according to the invention is presented in Table 10A, and a non-limiting example of the antibodies that are used for the treatment or Prevention of autoimmune disorder is presented in Table 10B.

TABLE 10A: ANTIBODIES FOR INFLAMMATORY DISEASES AND AUTOIMMUNE DISEASES THAT CAN BE TREATED IN ACCORDANCE WITH THE INVENTION TABLE 10B. ANTIBODIES FOR AUTOIMMUNE DISORDERS THAT CAN BE TREATED THROUGH ENGINEERING ACCORDING TO THE INVENTION 5. 4.2.1. IMMUNOMODULATOR AGENTS AND ANTI-INFLAMMATORY AGENTS The present invention provides methods for treating autoimmune diseases and inflammatory diseases comprising administration of the molecules with variant Fc regions, which have an increased affinity for FcyRIIB and a decreased affinity for Fc? RIIIA and / or FcyRIIA together with other treatment agents . Examples of immunomodulatory agents include, but are not limited to, methotrexate, ENBREL, RE ICADE ™, leflunomide, cyclophosphamide, cyclosporin A, and macrolide antibiotics (e.g., FK506 (tacrolimus)), methylprednisolone (MP), corticosteroids, steroids, mycophenolate mofetil, rapamycin (sirolimus), mizoribine, deoxyspergualin, brequinar, malonitriloamides (e.g., leflunamide), modulators of T cell receptors and modulators of cytokine receptors.

Anti-inflammatory agents have exhibited success in the treatment of inflammatory and autoimmune disorders and are now a common and normal treatment for such disorders. Any anti-inflammatory agent well known to one of skill in the art can be used in the methods of the invention. Non-limiting examples of anti-inflammatory agents, nonsteroidal anti-inflammatory drugs (NSAIDs), steroidal anti-inflammatory drugs, beta-agonists, anti-cholinergic agents, and methyl xanthines. Examples of NSAIDs include, but are not limited to, aspirin ibuprofen, celoxib (CELEBREX ™), diclofenac (VOLTAREN ™), etodolac (LODINE ™), fenoprofen (NALFON9, idometacin 5 (INDOCIN ™), cetoralac (TORADOL ™), oxoprozine (DAYPRO ™), nabumentone (RELAF ™), sulindac (CLINORIL ™), tolmentine (TOLECTIN ™), rofecoxib (VIOXX ™), naproxen (ALEVE ™, NAPROSYN ™), ketoprofen (ACTRON ™) and nabumetone (RELAFEN ™). Said NSAIDs function by inhibiting a cyclooxygenase enzyme (e.g., COX-1 and / or COX-2) Examples of steroidal anti-inflammatory drugs include, but are not limited to, glucocorticoids, dexamethasone (DECADRON ™), cortisone, hydrocortisone, prednisone (DELTASONE ™), prednisolone, tnamcmolone, bluefidine, and eicosanoids such as prostaglandmas, thromboxanes and leukotrienes. 5. 4.3. INFECTIOUS DISEASE The invention also encompasses methods for treating or preventing an infectious disease in a subject which comprises administering a therapeutically or prophylactically effective amount of one or more molecules of the invention. Infectious diseases that can be treated or prevented by the molecules of the invention are caused by infectious agents including, but not limited to, viruses, bacteria, fungi, protozoa and viruses. Viral diseases that can be treated or prevented using the molecules of the invention together with the methods of the present invention include, but are not limited to, those caused by hepatitis type A, hepatitis B, hepatitis C, influenza, varicella, adenovirus , herpes simplex type I (VES-I), herpes simplex type II (VES-II), nnderpest, to movirus, ecovirus, rotavirus, respiratory syncytial virus, papilloma virus, papovavirus, cytomegalovirus, equinovirus, arbovirus, huntavirus, coxaquie virus , mumps virus, measles virus, rubella virus, polio virus, small pox virus, Epstein Barr virus, human immunodeficiency virus type I (HIV-I), human immunodeficiency virus type II (HIV-II), and agents of viral diseases such as viral meningitis, encephalitis, dengue or small poxvirus. Bacterial diseases that can be treated or prevented using the molecules of the invention together with the methods of the present invention, which are caused by bacteria include, but are not limited to, mycobacteria, rickettsia, mycoplasma, neiseria, S. pneumonia, Borrelia burgdorferi ( Lyme disease), Bacillus anthracis (anthrax), tetanus, streptococci, staphylococci, mycobacteria, tetanus, pertussis, cholera, plague, diphtheria, chlamydia, S. aureous and legionella. Diseases caused by protozoa that can be treated or prevented using the molecules of the invention together with the methods of the present invention, which are caused by protozoa include, but are not limited to, leishmania, coccyidia, trypanosome or malaria. The parasitic diseases that can be treated or prevented using the molecules of the invention together with the methods of the present invention, which are caused by parasites include, but are not limited to, chlamydia and riches. According to one aspect of the invention, the molecules of the invention comprising the variant Fc regions have an improved antibody effector function towards an infectious agent, e.g., a pathogenic protein, in relation to a comparable molecule comprising a wild-type Fc region. Examples of infectious agents include, but are not limited to, bacteria (e.g., Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, Enterococcus faecalis, Candida albicans, Proteus vulgaris, Staphylococcus viridans, and Pseudomonas aeruginosa), a pathogen such as papovavirus, for example. lymphotropic (PVL); Bordatella pertussis; Borna disease virus (EBV); bovine coronavirus; Choriomeningitis virus; Dengue virus; a virus, E. coli; Ebola; Ecovirus 1; Ecovifrus-11 (VE); Endotoxin (LPS); enteric bacteria; enteric virus Orpah, Enterovirus; feline leukemia virus; foot and mouth disease virus; leukemia virus in Gibbon monkeys (VLMG); Gram negative bacteria; Helicobacter pylori; hepatitis B virus (HBV); herpes simplex virus; HIV-I; human cytomegalovirus; human coronavirus; Influenza A, B and C; legionella, leishmania mexicana; monocytogenes of listeria; measles virus; meningococcus; Morbid viruses; mouse hepatitis virus; murine leukemia virus; herpes virus range of murine; murine retroviruses; murine coronavirus; mouse hepatitis virus; Mycobacterium avium-M; Neisseria gonorrhoeae; Newcastle disease virus; Parvovirus B 19; Plasmodium falciparum; Pox Virus; Pseudomonas; Rotavirus; Salmonella typhimurium; Shigella, Streptococci; T1 cell lymphotropic virus; Vaccinia virus. In a specific embodiment, the molecules of the invention increase the treatment efficacy of an infectious disease by improving the phagocytosis and / or opsonization of the infectious agent causing the infectious disease. In another specific embodiment, the molecules of the invention improve the treatment efficacy of an infectious disease by increasing the CCDA of infected cells that cause the infectious disease. In some embodiments, the molecules of the invention can be administered in combination with a therapeutically or prophylactically effective amount of an additional therapeutic agent known to those skilled in the art for the treatment and / or prevention of an infectious disease. The invention contemplates the use of the molecules of the invention in combination with antibiotics known to those skilled in the art for the treatment and / or prevention of an infectious disease. Antibiotics that can be used in combination with the molecules of the invention include, but are not limited to, macrolides (e.g., tobramycin (Tobi®)), a cephalosporin (e.g., cephalexin (Keflex®), cephradine). (Velosef ©), cefuroxime (Ceftin®), cefprozil (Cefzil®), cefaclor (Ceclor®), cefixime (Suprax®) or cefadroxil (Duricef ©), a clarithromycin (e.g. claptromicma (Biaxm®)), an entromycin (e.g., eptromicma (EMyein®)), a penincilma (e.g., penincilma V (V-Cillm K® or Pen Vee K®)), or a qumolone ( v.gr., Ofloxacma (Floxm®), ciprofloxacma (Cipro®) or norfloxacma (Noroxm®), ammoglycoside antibiotics (e.g., apramycin, arbekrazine, banbermicmas, but rosma, dibekacma, neomicma, neomicma, undecylenate, methylmicham, paromomicma, pbostamycin, sisomycin, and spectomyomicum), amphenicol antibiotics (e.g., azidamphenicol, chloramphenicol, florfenicol, and triamfenicol), ansamycin antibiotics (e.g., rifamide and pfampma), carbacephems (e.g., loracarbef) , carbapenems (e.g., biapenema and imipenema), cephalosporins (e.g., befaclor, cefadroxil, cefamandole, cefatrizine, cefazedone, cefozopran, cefpimizole, cefpyramide and cefpirome), defamicmas (e.g., cefbuperazone, cefmetaxol, and cefminox), monolactams (e.g., astreonam, caru onam, and tigemonam), oxacefemas (vr, flomoxef and oxalactam), penicillins (e.g., amidmocil) ma, amidmocillin pivoxil, amoxicilma, bacampicilma, benzylpemncilinic acid, sodium benzylpenicillin, epicilma, fenbenicilma, floxacillin, penamicilma, penetamate iodide, penincilma o-benetamina, pemncillin 0, penmcilma V, penmcilma V benzatma, penicillin B hydrabamine, penimepiciclma, and potassium fenicillin), lmcosamides (e.g., clindamycin and lincomycin), ampomicma, bacitracin, caproomycin, colistin, enduracidin, enviomycin, tetracyclines (e.g., apicicline, chlortetracycline, clomocycline, and demeclocycline), 2,4-diaminopyrimidines (e.g., brodimoprim), nitrofurans (e.g., furaltadone, and furazolium chloride) , quinolones and analogs thereof (e.g., cinoxacin, cinafloxacin, flumequine, and grepagloxacin), sulfonamides (e.g., acetyl sulfamethoxypyraxine, benzylsulfamide, noprilsulfamide, phthalylsulffacetamide, sulfacryoidine, and sufacitin), sulfones (v. ., diatimosulfone, sodium glucosulfone and solasulfone), cycloserine, mupirocin and tuberin. In certain embodiments, the molecules of the invention may be administered in combination with a therapeutically or prophylactically effective amount of one or more antifungal agents. Antifungal agents that can be used in combination with the molecules of the invention include, but are not limited to amphotericin B, itraconazole, ketoconazole, fluconazole, intrathecal, flucytosine, miconazole, butoconazole, clortrimazole, nystatin, terconazole, thioconazole, cyclopirox, exonazole, haloprogrin , naftifine, terbinafine, undecylenate, and grayofuldine. In some embodiments, the molecules of the invention can be administered in combination with. a therapeutically or prophylactically amount of one or more antiviral agents. The useful antiviral agents that can be used in combination with the molecules of the invention include, but are not limited to, protease inhibitors, reverse transcriptase nucleoside inhibitors, non-nucleoside reverse transcriptase inhibitors, and nucleoside analogs. Examples of antiviral agents include, but are not limited to, zivovudine, acyclovir, gangciclovir, vidarabine, idoxuridma, trifluridma, and pbavipna, as well as fosvarnet, amantadma, rimantadma, saquinavir, indinavir, amprenavir, lopmavir, ritonavir, alpha-interferon, adenfovir , clevadma, entecavir, pleconapl. 5. 5 VACCINE THERAPY The invention further encompasses the use of a composition of the invention to induce an immune response against an antigenic or immunogenic agent, including but not limited to cancer antigens and infectious disease antigens (examples of which are described above) . The vaccine compositions of the invention comprise one or more antigenic or immunogenic agents for which an immune response is desired, wherein one or more antigenic or immunogenic agents are coated with a variant antibody of the invention having an increased affinity for Fc? RIIIA. Although not intended to be linked to a particular mechanism of action, the coating of an antigenic or immunogenic agent with an antibody variant of the invention having an increased affinity to Fc? RIIIA, increases the immune response to the desired antigenic or immunogenic agent by inducing humoral and cell-mediated responses. The vaccine compositions of the invention are particularly effective in eliciting an immune response, preferably a protective immune response against the antigenic or immunogenic agent. In some embodiments, the antigenic or immunogenic agent in the vaccine compositions of the invention comprises a virus against which an immune response is desired. The viruses can be recombinant or chimeric, and are preferably attenuated. The production of recombinant, chimeric and attenuated viruses can be carried out using normal methods known to one skilled in the art. The invention encompasses a live recombinant viral vaccine or a recombinant viral vaccine which will be formulated according to the invention. A live vaccine may be preferred because the multiplication in the host leads to a prolonged stimulus of a kind and magnitude similar to that which occurs in natural infections, and therefore, confers substantial lasting immunity. The production of said live recombinant virus vaccine formulations can be achieved using conventional methods involving virus propagation in cell cultures or in chicken embryo allantois followed by purification.

In a specific embodiment, the recombinant virus is non-pathogenic for the subject to which it is administered. In this regard, the use of viruses genetically treated for vaccine purposes may require the presence of attenuation characteristics in these strains. The introduction of appropriate mutations (eg, deletions) in the patterns used for transfection can provide novel viruses with attenuating characteristics. For example, specific nonsense mutations are associated with temperature sensitivity or cold adaptation that can be done in deletion mutations. These mutations could be more stable than the point mutations associated with cold-sensitive or temperature-sensitive mutants and the reversion frequencies should be extremely low. Recombinant DNA technologies for treating recombinant viruses are known in the art and are encompassed by the invention. For example, techniques for modifying negative-strand RNA viruses are known, see, for example, U.S. Pat. No. 5,165,057, which is incorporated herein by reference in its entirety. Alternatively, chimeric viruses with "suicidal" characteristics can be constructed for use in the formulations of the mdermal vaccines of the invention. Such viruses could only undergo a cycle or few replication cycles within the host. When used as a vaccine, the recombinant viruses could undergo limited replication cycles and induce a sufficient level of immune response but might not continue in the human host and cause disease. Alternatively, the inactive (dead) virus could be formulated according to the invention. Inactive vaccine formulations can be prepared using conventional techniques to "kill" chimeric viruses. Vaccinated vaccines are "dead" in the sense that their infectious capacity has been destroyed without affecting their immunogenicity. In order to prepare mactivated vaccines, the chimeric virus can be grown in the cell culture or in the allantois of the chicken embryo, purified by zonal ultracentrifugation, activated by formaldehyde or β-propiolactone, and combined. In certain embodiments, completely foreign epitopes, including antigens derived from other viral or non-viral pathogens, can be treated in the virus for use in the formulations of mderdermic vaccines of the invention. For example, unrelated virus antigens such as HIV (fpldO, gpl20, gp41), parasite antigens (e.g., malaria), bacterial or fungal antigens or tumor antigens, can be treated in the attenuated strain. Virtually any heterologous gene sequence can be constructed in the chimeric viruses of the invention for use in formulations of intradermal vaccines. Preferably, the sequences of heterologous genes are portions and peptides that act as biological response modifiers. Preferably, the epitopes that induce a protective immune response for any of them that binds to neutralizing antibodies can be expressed by, or as part of, the chimeric viruses. For example, sequences of heterologous genes that can be constructed in the chimeric viruses of the invention include, but are not limited to, influenza neuraminidase haemagglutinin and parainfluenza and fusion glycoproteins such as the human VPI3 HN and F genes. In yet another embodiment, the sequences of heterologous genes that can be treated in the chimeric viruses include those that encode proteins with immunomodulatory activities. Examples of immunomodulatory proteins include, but are not limited to, cytokines, interferon type 1, interferon gamma, colony stimulation factors, interleukin 1, 2, 4, 5, 6, 12, and antagonists of these agents. In still other embodiments, the invention encompasses pathogenic cells or viruses, preferably attenuated viruses, that express the variant antibody on their surface. In alternative embodiments, the vaccine compositions of the invention comprise a fusion polypeptide wherein an antigenic or immunogenic agent is ligated. operatively to a variant antibody of the invention having an increased affinity for Fc? RIIIA. The genetic treatment of the fusion polypeptides for use in the vaccine compositions of the invention is carried out using routine recombinant DNA technology methods and is within the level of common practice. The invention further encompasses methods for inducing tolerance in a subject by administering a composition of the invention. Preferably, a composition suitable for inducing tolerance in a subject, comprises an antigenic or immunogenic agent coated with a variant antibody of the invention, wherein the variant antibody has a higher affinity for FcγRIIIB. Although not intended to be linked to a particular mechanism of action, said compositions are effective to induce tolerance by activating the inhibitory pathway mediated by Fc? RIIB. 5. 6. COMPOSITIONS AND METHODS OF ADMINISTRATION The invention provides methods and pharmaceutical compositions comprising molecules of the invention (ie, antibodies, polypeptides) comprising regions of variant Fc. The invention also provides methods of treatment, prophylaxis, and alleviation of one or more symptoms associated with a disease, disorder or infection by administering to a subject an effective amount of a fusion protein or a conjugated molecule of the invention, or a pharmaceutical composition comprising a fusion protein or a conjugated molecule of the invention. In a preferred aspect, an antibody, a fusion protein, or a conjugated molecule, is substantially purified (ie, it is substantially free of substances that limit its effect or produce undesired side effects). In a specific embodiment, the subject is an animal, preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) and a primate (e.g., monkey such as, a cynomologo monkey and a human being). In a preferred embodiment, the subject is a human being. In yet another preferred embodiment, the antibody of the invention is of the same species as the subject. Several delivery systems are known and can be used to administer a composition comprising molecules of the invention (ie, antibodies, polypeptides), comprising regions of variant Fc, e.g., encapsulation in liposomes, microparticles, microcapsules, cells recombinants capable of expressing the antibody or fusion protein, receptor-mediated endocytosis (See, e.g., Wu and Wu, 1987, J. Biol. Chem. 262: 4429-4432), construction of a nucleic acid as part of a retroviral or other vector, etc. Methods for administering a molecule of the invention include, but are not limited to, parenteral (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural and mucosal administration (e.g., intranasal and oral routes). In a specific embodiment, the molecules of the invention are administered intramuscularly, intravenously or subcutaneously. The compositions can be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous coatings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and can be administered together with other biologically active agents. The administration can be systemic or local. In addition, pulmonary administration can also be used, e.g., by the use of an inhaler or nebulizer and the formulation with an aerosol agent. See, e.g., US Patents. Nos. 6,019,968, 5,985,320; 5,985,309; 5,934,272; 5,874,064; 5,855,913; 5,290,540; and 4,880,078; and PCT Publications Nos. WO 92/19244, WO 97/32572; WO 97/44013; WO 98/31346; and WO 99/66903, each of which is incorporated herein by reference in its entirety. The invention also provides that the molecules of the invention (ie, antibodies, polypeptides) comprising regions of variant Fc, are packaged in a hermetically sealed container such as a vial or sack, indicating the amount of antibody. In one modality, The molecules of the invention are supplied as a freeze-dried dry sterilized powder or water-free concentrate in a hermetically sealed container and can be reconstituted, eg, with water or saline, at the appropriate concentration for administration to a subject. Preferably, the molecules of the invention are supplied as a dry sterile lyophilized powder in a hermetically sealed container at a unit dose of at least 5 mg, more preferably at least 10 mg, at least 15 mg, at least 25 mg , at least 35 mg, at least 45 mg, at least 50 mg, or at least 75 mg. The lyophilized molecules of the invention should be stored at 2 to 8 ° C in their original container and the molecules should be administered within 12 hours, preferably within 6 hours, within 5 hours, within 3 hours or within 1 hour after of being reconstituted. In an alternative embodiment, the molecules of the invention are supplied in liquid form in a hermetically sealed container indicating the amount and concentration of the molecule, fusion protein or conjugated molecule. Preferably, the liquid form of the molecules of the invention are supplied in a hermetically sealed container at least 1 mg / ml, more preferably at least 2.5 mg / ml, at least 5 mg / ml, at least 8 mg / ml, at least 10 mg / ml, at least 15 mg / ml, at least 25 mg / ml, at least 50 mg / ml, so at least 100 mg / ml, at least 150 mg / ml, at least 200 mg / ml of the molecules. The amount of the composition of the invention that will be effective in the treatment, prevention or alleviation of one or more symptoms associated with a disorder can be determined by normal clinical techniques. The precise dose that will be used in the formulation will also depend on the route of administration, and the seriousness of the condition and should be decided according to the judgment of the medical practitioner and the circumstances of each patient. Effective doses of dose response curves derived from animal model or m vitro test systems can be extrapolated. For antibodies encompassed by the invention, the dose administered to a patient is normally 0.0001 mg / kg to 100 mg / kg of the patient's body weight. Preferably, the dose administered to a patient is between 0.0001 mg / kg and 20 mg / kg, 0.0001 mg / kg and 10 mg / kg, 0.0001 mg / kg and 5 mg / kg, 0.0001 mg / kg and 2 mg / kg, 0.001 mg / kg and 1 mg / kg, 0.0001 mg / kg and 0.75 mg / kg, 0.0001 mg / kg and 0.5 mg / kg, 0.0001 mg / kg and 0.25 mg / kg, 0.0001 mg / kg and 0.15 mg / kg, 0.0001 mg / kg and 0.10 mg / kg, 0.001 mg / kg and 0.5 mg / kg, 0.01 mg / kg and 0.25 mg / kg or 0.01 mg / kg and 0.10 mg / kg of the patient's body weight. Generally, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Therefore, lower doses of human antibodies and less frequent administration is frequently possible. In addition, the dose and frequency of administration of antibodies of the invention or fragments thereof can be reduced by increasing the absorption and tissue penetration of the antibodies by modifications such as, for example, lipidation. In one embodiment, the dose of the molecules of the invention administered to a patient is, 0.01 mg to 1000 mg / day, when used as a single agent therapy. In another embodiment, the molecules of the invention are used in combination with other therapeutic compositions and the dose administered to a patient is lower than when said molecules are used as a single therapy agent. In a specific embodiment, it may be convenient to administer the pharmaceutical compositions of the invention locally to the area in need of treatment, this can be achieved, for example, and not by way of limitation, by local infusion, by injection, or as an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as elastic membranes, or fibers. Preferably, when administering a molecule of the invention, care must be taken to use materials that the molecule can not absorb.

In another embodiment, the compositions can be delivered in a vesicle, in particular a liposome (See Langer, Science 249: 1527-1533 (1990)); Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, p. 353-365 (1989), Lopez-Berestein, ibid, pp. 317-327; see generally ibid. ). In yet another embodiment, the compositions may be delivered in a controlled release or sustained release system. Any technique known to one skilled in the art can be used to produce sustained release formulations comprising one or more molecules of the invention. See, e.g., U.S. Patent. No. 4,526,938; PCT publication WO 91/05548; PCT publication WO 96/20698; Ning et al., 1996, "Intratumoral Radioimmunotheraphy of a Human Colon Cancer Xenograft Using a Sustained-Release Gel," Radiotherapy & Oncology 39: 179-189, Song et al., 1995, "Antibody mediated Lung Targeting of Long-Circulating Emulsions", PDA Journal of Pharmaceutical Science & Technology 50: 372-397, Cleek et al, 1997, "Biodegradable Polymeric Carriers for a bFGF Antibody for Cardiovascular Application", Pro. InVI Symp. Control. I laughed Bioact. Mater. 24: 853-854; and Lam et al., 1997, "Microencapsulation of Recombinat Humanized Monoclonal Antibody for Local Delivery", Proc. Int. Symp. Control Reí Bioact. Mater, 24: 759-760, each of which is incorporated herein by reference in its entirety. In one embodiment, a pump can be used in a controlled release system (see Langer, supra, Sefton, 1987, CRC Crit Ref Biomed, Eng 14:20, Buchwald et al., 1980, Surgery 88: 507; Saudek et al., 1989, N. Engl. J. Med. 321: 574). In another embodiment, polymeric materials can be used to achieve controlled release of antibodies (see, e.g., Medical Applications of Controlled Relay, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (Eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol Sci. Rev.

Macromol Chem, 23:61; see also Levy et al., 1985, Science 228: 190; During and others, 1989, Ann Neurol, 25: 351; Howard et al., 1989, J. Neurosurg. 71: 105); Patent of E.U.A. No. 5,679,377; Patent of E.U.A. No. 5,916,597; Patent of E.U.A. No. 5,912,015; Patent of E.U.A. No. 5,989,463; Patent of E.U.A. No. 5,128,326; PCT Publication No. WO 99/15154; and PCT Publication No. WO 99/20253). Examples of polymers used in sustained release formulations include, but are not limited to, poly (2-hydro? I ethyl methacrylate), poly (methyl methacrylate), poly (acrylic acid), poly (ethylene vinyl acetate), poly ( methacrylic acid), polyglycolides (PLG), polyanhydrides, poly (N- vinyl pyrrolidone), polyvinyl alcohol, polyacrylamide, poly (ethylene glycol), polylactides (PLA), poly (lactide co-glycolides), (PLGA), and polyorthoesters. In yet another embodiment, a controlled release system may be placed near the therapeutic target (eg, the lungs), thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in medical applications of Controlled Relay, supra, vol 2, pp. 115-138 (1984)). In another embodiment, polymeric compositions useful as controlled release implants are used according to Dunn et al. (See U.S. Patent 5,945,155). This particular method is based on the therapeutic effect of the controlled release in situ of the bioactive material of the polymer system. The implant can be presented generally in any stop within the body of the patient in need of therapeutic treatment. In another embodiment, a nonpolymetric sustained delivery system is used, whereby a non-polymeric implant is used in the subject's body as a drug delivery system. When implanted in the body, the organic solvent of the implant will dissipate, disperse or leave the composition in the surrounding tissue fluid, and the non-polymeric material will coagulate or gradually precipitate to form a solid microporous hue (See, US Pat. No. 5,888,533).

Controlled release systems are discussed in the review by Langer (1990, Science 249: 1527-1533). Any technique known to one skilled in the art can also be used to produce sustained release formulations comprising one or more therapeutic agents of the invention. See, e.g., US patent. No. 4,526,938, International Publication Nos. WO 91/05548 and WO 96/20698; Ning et al., 1996, Radiotherapy & Oncology 39: 179-189; Song et al., 1995, PDA Journal of Pharmaceutical Science & Technology 50: 372-397; Cleek et al., 1997, Pro. InVI Symp. Control Reí Bioact. Mater. 24: 853-854; and Lam et al., 1997, Proc. Int'l Symp. Control Reí. Bioact. Mater. 24: 759-760, each of which is incorporated herein by reference in its entirety. In a specific embodiment wherein the composition of the invention is a nucleic acid encoding an antibody, the nucleic acid can be administered in vivo to promote the expression of its encoded antibody, constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by the use of a retroviral vector (See U.S. Patent No. 4,980,286), or by direct injection, or by the use of microparticle bombardment (e.g., a gun of genes, Biolistic, Dupont), or by coating with lipids or cell surface receptors or 7 transfectants, or administering them as a ligation to a box-like peptide known to enter the nucleus (See, for example, Joliot et al., 1991, Proc. Nati, Acad. Sci. USA 88: 1864-1868), etc. Alternatively, a nucleic acid can be introduced intracellularly and incorporated into the DNA of host cells for expression by homologous recombination. For antibodies, the therapeutically or prophylactically effective dose administered to a subject is normally 0.1 mg / kg to 200 mg / kg of the subject's body weight. Preferably, the dose administered to a subject is between 0.1 mg / kg and 20 mg / kg of the subject's body weight and more preferably, the dose administered to a subject is between 1 mg / kg to 10 'mg / kg of the body weight of the subject. subject. The dose and frequency of administration of antibodies of the invention can be reduced by increasing the absorption and penetration into the tissue (v. Gr, in the lung) of the antibodies or fusion proteins by modifications such as, for example, lipidation. The treatment of a subject with a therapeutic or prophylactically effective amount of molecules of the invention may include a single treatment or, preferably, may include a series of treatments. In a preferred example, a subject is treated with molecules of the invention in the range of between about 0.1 to 30 mg / kg of body weight, once a week for between about 1 to 10 weeks, preferably between 2 to 8 weeks, more preferably between about 3 to 7 weeks, and even more preferably for about 4, 5, or 6 weeks. In other embodiments, the pharmaceutical compositions of the invention are administered once a day, twice a day or three times a day. In other embodiments, the pharmaceutical compositions are administered once a week, twice a week, once every two weeks, once a month, once every six weeks, once every two months, twice a year or once a week. once a year It will also be appreciated that the effective dose of the molecules used for treatment can be increased or decreased according to the course of a particular treatment. 5. 6.1. PHARMACEUTICAL COMPOSITIONS Compositions of the invention include bulky drug compositions useful in the manufacture of pharmaceutical compositions (e.g., impure or non-sterile compositions) and pharmaceutical compositions (i.e., compositions that are suitable for administration to a subject or patient ) that can be used in the preparation of unit dosage forms. Said compositions comprise a prophylactic or therapeutically effective amount of a prophylactic agent and / or therapeutic described herein or a combination of the agents and a pharmaceutically acceptable carrier. Preferably, the compositions of the invention comprise a prophylactically or therapeutically effective amount of one or more molecules of the invention and a pharmaceutically acceptable carrier. In a particular embodiment, the pharmaceutical composition comprises a therapeutically effective amount of one or more molecules of the invention comprising a variant Fc region, wherein said variant Fc region binds to FcyRIIIA and / or Fc? RIIA with a higher affinity that a comparable molecule comprising a wild-type Fc region that binds Fc? RIIIA and / or Fc? RIIA and / or said variant Fc region mediates an effector function at least 2 times more effectively than a comparable molecule comprising a wild-type Fc region and a pharmaceutically acceptable carrier. In another embodiment, the pharmaceutical composition comprises a therapeutically effective amount of one or more molecules of the invention comprising a variant Fc region, wherein said variant Fc region binds to FcγRIIIA with a higher affinity than that with which a comparable molecule comprising a wild type Fc region binds to FcyRIIIA and said variant Fc region binds to Fc? RIIB with a lower affinity than that with which a comparable molecule which comprises a region of wild type Fc binds to Fc? RIIB, and / or said variant Fc region mediates an effector function at least 2 times more effectively than a comparable molecule comprising a wild type Fc region and a pharmaceutically acceptable carrier . In another embodiment, said pharmaceutical compositions further comprise one or more anticancer agents. The invention also encompasses pharmaceutical compositions comprising a therapeutic antibody (e.g., tumor-specific monoclonal antibody) that is specific for a particular cancer antigen, comprising one or more amino acid modifications in the Fc region as determined from according to the present invention and a pharmaceutically acceptable carrier. In a specific modality, the term "Pharmaceutically acceptable" means approved by a regulatory agency of the federal or state government or is listed in the Pharmacopeia of E.U.A. or another Pharmacopeia generally recognized for use in animals and more particularly in humans. The term "vehicle" refers to a diluent, adjuvant (e.g., Freund's adjuvant) (complete and incomplete), excipient or vehicle with which the therapeutic is administered. Said pharmaceutical vehicles can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred vehicle when the pharmaceutical composition is administered intravenously. Saline and aqueous dextrose solutions and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talcum, sodium chloride, dry skim milk, glycerol, propylene, glycol , water, ethanol and the like. The composition, if desired, may also contain minor amounts of wetting agents or emulsifiers, or pH regulating agents. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. Generally, the ingredients of the compositions of the invention are supplied either separately or mixed in a unit dosage form, for example, as a freeze dried dry powder or concentrate free of water in a hermetically sealed container such as a vial or sack. indicating the amount of active agent. When the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing water grade 92 Sterile pharmaceutical or saline solution. When the composition is administered by injection, a vial of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration. The compositions of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include, but are not limited to, those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, hydroxides, ammonium, calcium, ferric, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc. 5. 6.2. GENE THERAPY In a specific embodiment, nucleic acids comprising sequences encoding molecules of the invention, are administered to treat, prevent or alleviate one or more symptoms associated with a disease, disorder or infection, in the form of gene therapy. Gene therapy refers to therapy carried out by the administration to a subject of an expressed or expressible nucleic acid. In this embodiment of the invention, the acids nucleic acids produce their coded antibody or fusion protein that mediates a therapeutic or prophylactic effect. Any of the methods for gene therapy available in the art can be used in accordance with the present invention. The illustrative methods are described below. For general reviews of gene therapy methods, see Goldspiel et al., 1993, Clinical Pharmacy 12: 488-505; Wu and WU, 1991, Biotherapy 3: 87-95; Toilstoshev, 1993, Ann. Rev. Pharmacol. Toxicol 32: 573-596; Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191-217; May 1993, TIBTECH 11 (5): 155-215. Methods commonly known in the art of recombinant DNA technology that can be used are described in Ausubel et al., (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). In a preferred aspect, a composition of the invention comprises nucleic acids encoding an antibody, said nucleic acids being part of an expression vector that expresses the antibody in a suitable host. In particular, said nucleic acids have promoters, preferably heterologous promoters, operably linked to the antibody coding region, said promoter being inducible or constitutive, and, optionally specific for tissue. In another particular embodiment, nucleic acid molecules are used in which the antibody coding sequences and any other desired sequence are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing interchromosomal expression of the antibody which encodes nucleic acids (Koller and Smithies, 1989, Proc. Nati, Acad. Sci. USA 86: 8932-8936; and Zijistra et al., 1989, Nature 342: 435-438). In another preferred aspect, a composition of the invention comprises acids encoding the fusion protein nucleic acids being a part of an expression vector that expresses the fusion protein in a suitable host. In particular, said nucleic acids have promoters, preferably heterologous promoters, operably linked to the coding region of a fusion protein, said promoter being inducible or constitutive, and, optionally, tissue-specific. In another particular embodiment, nucleic acid molecules are used, in which the coding sequence of the fusion protein and any other desired sequence are flanked by the regions that promote homologous recombination at a desired site in the genome, thereby providing the intrachromosomal expression of the fusion protein.

The delivery of the nucleic acids in a subject can be either direct, in which case the subject is exposed directly to the nucleic acid or vectors carrying the nucleic acid, or indirectly, in which case, the cells are first transformed with the nucleic acids in vitro, then transplanted into the subject. These two approaches are known, respectively, as gene therapy in vivo or ex vivo. In a specific embodiment, the nucleic acid sequences are administered directly in vivo, where it is expressed to produce the encoded product. This can be accomplished by any numerous method known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using retroviral vectors or other virals that are defective or attenuated (see, U.S. Patent No. 4,980,286), or by direct injection of pure DNA, or by the use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or are coated with lipids or cell surface receptors or transfectant agents, encapsulation in liposomes, microparticles or microcapsules, or by administering them in a ligature to a peptide that is known to enter the nucleus, administering it in a ligature to a ligand subjected to endocytosis mediated by recipient (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262: 4429-4432) (which can be used to target the cells that specifically express the receptors), etc. In another embodiment, nucleic acid-ligand complexes can be formed, in which the ligand comprises a fusogenic viral peptide to interrupt endosomes, allowing the nucleic acid to prevent lysosomal degradation. In yet another embodiment, the nucleic acid can be directed to the specific uptake and expression for cells in vivo, by targeting a specific receptor (See, e.g., PCT Publications WO 92/0618, WO 92/22635, WO 92 / 20316; WO 93/14188; WO 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incorporated into the DNA of the host cell for expression, by homologous recombination (Koller and Smithies, 1989, Proc. Nati, Acad. Sci. USA 86: 8932-8935; and Zijistra et al., 1989 , Nature 342: 435-438). In a specific embodiment, viral vectors containing nucleic acid sequences encoding a molecule of the invention (e.g., an antibody or a fusion protein) are used. For example, a retroviral vector can be used (See Miller et al., 1993, Methj. Enzymol, 217: 581-599). These retroviral vectors contain the necessary components for the correct packaging of the viral genome and its integration into the DNA of the host cells. The nucleic acid sequences that encode the antibody or a fusion protein for use in gene therapy are cloned into one or more vectors, which facilitates the delivery of the nucleotide sequence in a subject. More details about retroviral vectors can be found in Boesen et al., (1994, Biotherapy 6: 291-302), which describes the use of a retroviral vector to deliver the mdr 1 gene to hematopoietic stem cells in order to make that stem cells are more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., 1994, 7, Clin. Invest. 93: 644-651; Klein et al., 1994, Blood 83: 1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4: 129-141; and Grossman and Wilson, 1993, Curr. Opin, in Genetics and Deve. 3: 110-114. Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are particularly attractive vehicles for delivering genes to the respiratory epithelium. Adenoviruses naturally infect the respiratory epithelium where they cause moderate disease. Other targets for adenovirus-based delivery systems are liver, central nervous system, endothelial cells and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson (Current Opinion in Genetics and Development 3: 499-503, 1993), present a review of gene therapy based on adenovirus. Bout et al., (Human Gene Therapy, 5: 3-10, 1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelium of rhesus monkeys. Other cases of adenovirus use in gene therapy could be found in Rosenfeld et al., 1991; Science 252: 431-434; Rosenfeld et al., 1992, Cell 68: 143-155; Mastrangeli et al., 1993, 7. Clin. Invest. 91: 225-2649; and Wang et al., 1995, Gene Therapy 2: 115-123. In a preferred embodiment, the adenovirus vectors are used. Associated adenoviruses have also been proposed (AVA) for use in gene therapy (see, e.g., Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204: 289-300 and U.S. Patent No. 5,436,146). Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection or viral infection. Usually, the transfer method includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells they have acquired and then expressed the transferred gene. These cells are delivered to a subject. In this embodiment, the nucleic acid is introduced into a cell prior to in vivo administration of the resulting recombinant cell. This introduction can be made by any method known in the art, including, but not limited to, transfection, electroporation, microjection, infection with a viral or bacteriophage vector, containing nucleic acid sequences, cell fusion, gene transfer mediated by chromosomes, mediated gene transfer by microcells, spheroplastic fusion, etc. Numerous techniques are known in the art for the introduction of foreign genes into cells (See, e.g., Loeffler and Behr, 1993, Meth. Enzimol 217: 599-618, Cohen et al., 1993, Meth. Enzimol. : 618-644; and Clin. Pharma Titer, 29: 69-92, 1985) and can be used according to the present invention, provided that the necessary development and physiological functions of the recipient cells are not interrupted. The technique should provide stable transfer of the nucleic acid to the cell, so that the nucleic acid can be expressed in the cell and preferably be inherited and expressed by its cell line. The resulting recombinant cells can be delivered to a subject by various methods known in the art. Recombinant red blood cells (e.g., stem cells or hematopoietic progenitors) are preferably administered intravenously. The number of cells that are expected to be used depends on the desired effect, patient status, etc. And it can be determined by someone skilled in the art. 40 Cells into which a nucleic acid can be introduced for gene therapy purposes, encompasses any type of available cell, and includes, but is not limited to, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes, cells blood samples such as T-lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megacapocytes, granulocytes, various stem or progenitor cells, in particular hemoatopoietic progenitor or stem cells, e.g., obtained from the bone marrow, of umbilical cord blood, peripheral blood, fetal liver, etc. In a preferred embodiment, the cell used for gene therapy is autologous to the subject. In an embodiment in which recombinant cells are used in gene therapy, nucleic acid sequences encoding an antibody or a fusion protein are introduced into cells such as those that can be expressed by cells or their progeny, and Recombinant cells are used in gene therapy, the nucleic acid sequences encoding an antibody or a fusion protein are introduced into the cells so that they can be expressed by the cells or their progeny and the recombinant cells are administered live to therapeutic effect. In a specific modality, the stem cells or progenitors. Any stem and / or progenitor cell that can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (See e.g., PCT Publication WO 94/08598; Ste ple and Anderson, 1992, Cel 71 : 973-985; Rheinwald, 1980, Meth., Cell., Bio 21A: 229, and Pittelkow and Scott, 1986, Mayo Clinic Proc. 61: 771). In a specific embodiment, the nucleic acid to be introduced for gene therapy purposes comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid can be controlled by controlling the presence or absence of the appropriate transcription inducer. 5. 6.3. EQUIPMENT The invention provides a package or pharmaceutical equipment comprising one or more containers filled with the molecules of the invention (ie, antibodies, polypeptides comprising regions of variant Fc). Additionally, one or more other prophylactic or therapeutic agents useful for the treatment of a disease may also be included in the package or equipment. The invention also provides a pharmaceutical package or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. invention. Optionally associated with said containers, there may be a notification in a form prescribed by a government department that regulates the manufacture, use or sale of pharmaceutical or biological products, said notification reflects the approval by the department of manufacturing, use or sale for administration. human The present invention provides equipment that can be used in the above methods. In one embodiment, a kit comprises one or more molecules of the invention. In another embodiment, a kit further comprises one or more therapeutic agents useful for the treatment of cancer, in one or more containers. In another embodiment, a kit further comprises one or more cytotoxic antibodies that bind to one or more cancer antigens associated with cancer. In certain embodiments, the other prophylactic or therapeutic agent is chemotherapeutic. In other embodiments, the prophylactic or therapeutic agent is a biological or hormonal therapeutic. 5. 7. CHARACTERIZATION AND DEMONSTRATION OF UTILITY THERAPEUTICS Various aspects of the pharmaceutical compositions, prophylactic or therapeutic agents of the invention, were preferably tested in vito, in a cell culture system and in an animal model organism, such as a rodent animal model system, for the desired therapeutic activity before being used in humans. For example, the assays that can be used to determine if the administration of a specific pharmaceutical composition is desired, includes analysis of cell cultures in which a tissue sample of a patient is grown in the culture and exposed to, or otherwise put in contact with, a pharmaceutical composition of the invention and the effect of said composition on the tissue sample is observed. The tissue sample can be obtained from the patient by means of biopsy. This test shows the identification of the prophylactic or therapeutic molecules that are therapeutically most effective for each individual patient. In several specific embodiments, in vitro assays can be performed with representative cells or cell types involved in an autoimmune or inflammatory disorder (e.g., T cells), to determine whether a pharmaceutical composition of the invention has a desired effect on said types. of cells. Combinations of prophylactic and / or therapeutic agents that can be tested in suitable animal model systems before use in humans. Such animal model systems include, but are not limited to, rats, mice, chickens, cows, monkeys, pigs, dogs, rabbits, etc. Any well-known animal system can be used inue. In a specific embodiment of the invention, combinations of prophylactic and / or therapeutic agents are tested in a mouse model system. Such model systems are widely used and are well known to one skilled in the art. The prophylactic and / or therapeutic agents can be administered repeatedly. Various aspects of the procedure may vary. Said aspects include the temporary regimen of administration of the prophylactic and / or therapeutic agents, and when said agents are administered separately or as a mixture. Preferred animal models for use in the methods of the invention are, for example, transgenic mouse effector cells expressing human FcγR on mice, for example, any mouse model described in E.U.A. can be used in the present invention. 5,877,396 (which is incorporated herein by reference in its entirety). Transgenic mice for use in the methods of the invention include, but are not limited to, mice that carry human FcyRIIIA, mice that carry human Fc? RIIA; mice that carry human Fc? RIIB and human Fc? RIIIA; mice carrying human FcyRIIB and human FcyRIIA; mice that carry human Fc? RIIB and human Fc? RIIIA; mice that carry human Fc? RIIB and human Fc? RIIA. Preferably, mutations that show higher levels of activity in the functional analysis described above were tested for use in animal model studies before being used in humans. In animal models it is preferred to use the antibodies harboring the Fc mutants identified using the methods of the invention and tested in CCDA analysis, including ch4D5 and ch520C9, two anti-Erb-B2 antibodies, and chCC49, an anti-human antibody. ? -TAG_72_, since they have previously been used in xenograft mouse models (Hudsiak et al., 1989, Mol.Cell.St. Biol. 9: 1165-72, Lewis et al., 1993, Cancer Immunol, Immunother, 37: 255- 63; Bergman et al., 2001 Clin Cancer Res. 7: 2050-6; Johnson et al., 19095, Anticancer Res. 1387-93). Sufficient amounts of antibodies can be prepared for use in animal models using methods described above, for example, using mammalian expression systems and IgG purification methods described and exemplified herein. A typical experiment requires at least about 5.4 mg of mutant antibody. This calculation is based on average amounts of wild-type antibody required to protect 8-10 mice of 30 g after a dose load of 4 μg / g and a weekly maintenance dose of 2 μg / g for 10 weeks. The invention encompasses tumor cell lines as a source of xenograft tumors, such as SK-BR-3, BT474 and HT29 cells that are derived from patients with breast adenocarcinoma. These cells have both Erb-B2 and prolactone receptors on its surface. SK-BR-3 cells have been used successfully in both CCDA and tumor models of xenograft. In other assays, OVCAR3 cells derived from a human ovarian adenocarcinoma can be used. These cells express the TAG_72_antigen on the cell surface and can be used together with the chCC49 antibody. The use of different antibodies and multiple tumor models will contain the loss of any specific mutation due to an incompatibility of Fc mutant specific for an antibody. Xenograft models of mice can be used to examine the effectiveness of antibodies from mice generated against a specific tumor target based on the affinity and specificity of the CDR regions of the antibody molecule and the ability of the Fc region of the antibody to generate an immune response (Wu et al., 2001, Trends Cell Biol. 11: S2-9). Transgenic mice expressing human FcγR in mouse effector cells are unique and are animal models made to test the efficacy of human Fc-FcγR interactions. The pairs of transgenic Fc? RIIIA, Fc? RIIIB and Fc? RIIA transgenic mice generated in the laboratory of Dr. Jeffrey Ravetech (through a license agreement with Reckefeller U, and the Sloan Kettering Cancer Center) can be used such as listed in the following Table 11.

TABLE 11. MOUSE STRAINS Preferably, Fc mutants that show both increased binding to FcγRIIIA and reduced binding to FcγRIIB, increased activity in CCDA and phagocytosis analysis are tested in animal model experiments. The animal model experiments examine the increase in efficacy of the Fc mutant containing the antibodies in pure mCDldA blocked mice, transgenic for FcγRIIIA, compared to a control that has been administered to the native antibody. An illustrative animal model experiment may comprise the following steps: in a breast cancer model, ~ 2xl0d SK-BR-3 cells were injected subcutaneously on day 1 with 0.1 ml PBS mixed with Matrigen (Becton Dickinson). Initially a chimeric wild-type antibody and isotype control were administered to establish a curve for the predetermined therapeutic dose, intravenous injection of 4D5 on day 1 with an initial dose of 4 μg / g followed by weekly injections of 2 μg / g. The volume of the tumor was monitored for 6-8 weeks to measure the progress of the disease. The volume of the tumor should be increased linearly with time in animals injected with the isotype control. In contrast, there should be a very slight growth in the tumor in the group injected with 4D5. The results of the normal dose study are used to establish an upper limit for experiments testing the Fc mutants. These studies are performed using sub-therapeutic doses on the antibodies containing Fc mutants. A tenth dose was used in xenograft models in the experiments performed on mice blocked with FcyRIIB, see, Clynes et al., 2000, Nat. Med. 6; 443-6, with a blockage resulting in the growth of the tumor cells. Since the mutants of the invention preferably show an increase in Fc [gamma] RIIIA activation and reduction in the binding of Fc [gamma] RIIB, the mutants are examined in a tenth therapeutic dose. Examination of the tumor size at different intervals indicates the effectiveness of the antibodies in the lower dose. The statistical analysis of the data using t-tests provides a way to determine if the dice are significant. Fc mutants that show increased efficacy are tested at increasingly lower doses to determine the smallest dose possible as a measure of their efficacy. The anti-inflammatory activity of the combination therapies of the invention can be determined using various experimental animal models of inflammatory arthritis known in the art and described in Crofford L. J. and Wilder R.L. "Arthritis and Autoimmunity in Animáis", in Arthritis and Allied Conditions; A Textbook of Rheumatology, McCarty et al. (Eds.), Chapter 30 (Lee and Febiger, 1993). The experimental and spontaneous animal models of inflammatory arthritis and autoimmune rheumatic diseases can also be used to evaluate the anti-inflammatory activity of the combination of therapies of the invention. The following are some analyzes provided as examples and not by limitation. The main animal models for arthritis or inflammatory diseases known in the art and widely used include; rat models with adjuvant-induced arthritis, models of rats and mice with collagen-induced arthritis and models of rats, rabbits and hamsters with antigen-induced arthritis, all described in Crofford LJ and Wilder RL, "Arthritis and Autoimmunity in Animáis", in Arthritis and Allied Conditions: A Textbook of Rheumatology, McCarty et al., (Eds.), Chapter 30 (Lee and Febiger, 1993), incorporated herein by reference in its entirety. The anti-inflammatory activity of the combination therapies of the invention can be evaluated using a rat model with carrageenin-induced arthritis. Arthritis Carrageenan induced also has been used in rabbits, dogs and pigs in studies of arthritis or chronic inflammation. The quantitative histomorphometric evaluation is used to determine the therapeutic efficacy. Methods for using such a model of carrageenin-induced arthritis were described in Hansra P. et al., "Carrageenan-induced Arthritis in the RAt", Inflammation, 24 (2): 141-156.; (2000). Animal models with zymosan-induced inflammation are also commonly used as is known and described in the art. The anti-inflammatory activity of the combination therapies of the invention can also be evaluated by measuring the inhibition of leg edema induced by carrageenan in the rat, using a modification of the method described in Winter CA et al., "Carrageenan-induced Edema in Hind Paw of the Rat as an Assay for Anti-inflammatory Drugs ", Proc. Soc. Exp. Biol. Med. III, 544-547; (1962). This analysis has been used as a primary in vivo screen for the anti-inflammatory activity of most NAINS and is considered predictive of efficacy in humans. The anti-inflammatory activity of the prophylactic test or therapeutic agents is expressed as the percentage of inhibition in the weight of hind paws of the test group relative to the control group dosed with vehicle. Additionally, animal models for inflammatory bowel disease can also be used to evaluate the efficacy of the combination therapies of the invention (Kim et al., 1992, Scand, J. Gastroentrol, 27: 529-537; Strober, 1985, Dig. Dis. Sci. 30 (12 Suppl): 3S ~ 10S ). Ulcerative colitis and Crohn's disease are human inflammatory bowel diseases that can be induced in animals. Sulfated polysaccharides, including but not limited to amylopectin, carrageenan, amylopectin sulfate, and dextran sulfate or chemical irritants including, but not limited to, trinitrobenzenesulfonic acid (TNBS) and acetic acid, can be orally administered to animals to induce disease of the inflammatory bowel. Animal models for autoimmune disorders can also be used to evaluate the efficacy of the combination therapies of the invention. Animal models have been developed for autoimmune disorders such as type 1 diabetes, thyroid autoimmunity, systemic lupus erythematosus and glomerulonephritis (Fianders et al., 1999, Autoimmunity 29: 235-246; Krogh et al., 1999, Biochimie 81: 511-515 Foster, 1999, Semin, Nephrol 19: 12-24). In addition, any assays known to those skilled in the art can be used to evaluate the prophylactic and / or therapeutic utility of the combinatorial therapies described herein for autoimmune and / or inflammatory diseases.

The toxicity and efficacy of the prophylactic and / or therapeutic protocols of the present invention can be determined by normal pharmaceutical procedures in cell cultures or experimental animals, e.g., to determine the LD50 (lethal dose at 50% of the population) and Therapeutic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. Prophylactic and / or therapeutic agents that exhibit high therapeutic indices are preferred. While prophylactic and / or therapeutic agents that exhibit toxic side effects may be used, care must be taken to designate a delivery system that directs said agents to the affected tissue site in order to minimize potential damage to the affected tissue. uninfected cells and, therefore, reduce side effects. The data obtained from cell culture analysis and animal studies can be used to formulate a dose scale of prophylactic and / or therapeutic agents for use in humans. The dose of said agents preferably falls within a range of circulating concentrations that include ED50 with little or no toxicity. The dose may vary within this scale depending on the dosage form used and the route of administration used. For any agent used in the method of the invention, the therapeutically effective dose is You can calculate initially from the cell culture analysis. A dose can be formulated in animal models to achieve a plasma concentration scale that includes the IC50 (ie, the concentration of the test compound that achieves maximum mean inhibition of symptoms) as determined in cell culture. Such information can be used to more precisely determine useful doses in humans. Plasma levels can be measured, for example, by high performance liquid chromatography. The anticancer activity of the therapies used in accordance with the present invention can also be determined using various experimental animal models for the study of cancer such as the transgenic mouse or mouse model or pure mouse with human xenografts, animal models, such as hamsters, rabbits, etc., known in the art and described in Relevance of Tumor Models for Anticancer Drug Development (1999, eds. Fiebig and Oncology (1999, Karger); The Nude Mouse in Oncology Research (19991, eds Boven and Winograd); and Anticancer Drug Development Guide (19997 ed. Teicher), incorporated herein by reference in its entirety. The preferred animal models for determining the therapeutic efficacy of the molecules of the invention are mouse xenograft models. Tumor cell lines that can be used as a source for tumors of Xenograft include but are not limited to, SKBR3 and MCF7 cells, which can be derived from patients with adenocarcinoma of the breast. These cells have ErbB2 and prolactin receptors. SKBR3 cells have been used routinely in the art as CCDA and models of xenograft tumors. Alternatively, 0VCAR3 cells derived from a human ovarian adenocarcinoma can be used as a source for xenograft tumors. The protocols and compositions of the invention are preferably tested in vitro, and then in vivo, for the desired therapeutic or prophylactic activity, before being used in humans. The therapeutic agents and methods can be screened using cells from a tumor or malignant cell line. Many normal analyzes in the art can be used to evaluate such survival and / or development; for example, cell proliferation can be analyzed by measuring the incorporation of 3H-thymidine, by direct cell counting, by detecting changes in the transcriptional activity of known genes such as proto-oncogenes (e.g., fos. cell cycles; cell viability can be assessed by tryptophan blue staining, the differentiation can be evaluated visually based on changes in morphology, decreased growth and / or formation of soft agar colonies or formation of tubular network in 41 three-dimensional base membrane or preparation of extracellular matrix, etc. Compounds for use in therapy can be tested in suitable animal model systems before being tested in humans, including, but not limited to, rats, mice, chickens, cows, monkeys, rabbits, hamsters, etc., for example. , the animal models described above. The compounds can then be used in the appropriate clinical trials. In addition, any assay known to those skilled in the art can be used to evaluate the prophylactic and / or therapeutic utility of the combinatorial therapies described herein for the treatment or prevention of cancer, inflammatory disorder or autoimmune disease. 6. EXAMPLES Using a yeast display system, the mutant human IgGl heavy chain Fc regions were screened for modified affinity for different Fc receptors. In particular, a mutant Fc bank was generated by error prone PCR (Genemorph; Stratagene) and then the mutant Fc proteins were fused to the Aga2p cell wall protein, which allowed the fusion protein to be secreted extracellularly and It will show on the cell wall of the yeast.

The soluble forms of human receptors (FcγRIIIA and FcγRIIB) were cloned. However, the detection of Fc IgGl domains on the yeast cell surface was concealed due to the low affinity of FcγR for its ligand. } in order to overcome this limitation, tetrameric soluble Fc? R complexes were formed using a VITAG sequence which could be biotinylated enzymatically and subsequently reacted with streptavidin conjugated to phycoerythrin (EA-FE; Molecular Probes) to form Fc? R complexes. soluble tetramerics. ELISA analyzes confirmed that the soluble tetrameric Fc? R complexes had a higher propensity for human IgGl relative to the monomeric Fc? R. The Fc fusion proteins on the yeast cell surface also bind to the tetrameric complexes of soluble FcγR as assessed by SCAF analysis. The differential binding of the Fc fusion proteins expressed on the yeast cell surface to the soluble tetrameric Fc? R complexes was monitored by an SCAF analysis. The Fc fusion proteins with altered affinities for one or more complete tetrameric soluble FcγR were then identified and incorporated into a complete immunoglobulin and expressed in mammalian cells. The expressed product of mammals was used in ELISA analysis to confirm the results obtained in the yeast surface display system. Finally, the mutant Fc regions were sequenced to confirm the altered residues. 6. 1 CLONING, EXPRESSION AND PURIFICATION OF FcyRIIIA MATERIALS and soluble Fc? RIIB and Fc? RIIIA METHODS were cloned as follows. The cDNA clones were obtained for the human FcγR genes (FcγRIIB and FcγRIIIA) (given by Ravetch lab). The soluble region of the FcγRIIIA gene (amino acids 7-203) was amplified by PCR (Table 12), digested with BamHI / HindIII and ligated into the vector pET25 (Novagen). This vector was digested with Sall / Notl and a secondary fragment 370 was isolated gel. The hu3A vector (given by J. Ravetch) was digested with BamHI / Sall and a sub fragment 270 containing the N terminus of Fc? RIIIA was isolated. Both fragments were ligated together in pcDNA 3.1, cut with BamH / Notl to create pcDNA3-Fc? RIIIA (amino acids 1-203). The soluble region of Fc? RIIB (amino acids 33-T80) was amplified by PCR (Table 12), digested with BglII / HindIII and ligated into pET25b (+) (Novagen). This vector was digested with BamHI / Notl and an N-terminal Fc? RIIB fragment of 440 bp was isolated. Both of these fragments were co-ligated into pcDNA3.1 cut with BamHI / Notl to create pcDNA3-Fc? RIIB (amino acids 1-180). Recombinant clones were transfected into 293H cells, recovered supernatants from cell cultures and recombinant soluble proteins FcγR (iFcγR) were purified and purified for homogeneity FcγRIB recombinant soluble (rFcγRIIB).

RESULTS Fc? RIIIA (r Fc? RIIIA) soluble recombinant te and Fc? RIIIB (r Fc? RIIIB) soluble recombine priformed homogeneity Subsequent to the expression and purification of soluble recombinant Fc? R proteins on a sepharose IgG column , the purity and apparent molecular weight of recombinant purified receptor proteins were determined by SDS-PAGE. As shown in Fig. 1, soluble rFc? RHIA (Fig. 1, line 1) had the expected apparent molecular weight of ~ 20KDa. As shown in Fig. 1, rFc? Soluble RUIA migrates as a "fuzzy" diffuse band which has been attributed to the high degree of glycosylation normally found in Fc? RIIIA (Jefferis, et al., 1995 Immunol., Lett. 111-117). 6. 1.1 CHARACTERIZATION OF FCyRIIIA PURIFIED RECOMBINANT SOLUBLE MATERIALS AND METHODS The purified soluble rFc? RIIIA, which was obtained as described above, was analyzed for direct binding against monomeric or added human IgG using an ELISA analysis. The plate was coated with 10 ng of soluble rFc? RIIIA overnight in IX PBS. After coating, the plate was washed three times in IX PBS / 0.1% Tween 20. Human IgG, either biotinylated monomeric IgG or biotinylated IgG, was added to the wells at a concentration ranging from 0.03 mg / ml to 2 mg / ml and allowed to bind to the soluble rFc? RIIIA. The reaction was carried out for one hour at 37 ° C. The plate was washed again three times with 1 x PBS / 0.1% Tween 20. The binding of human IgG to soluble rFc? RIIIA was detected using streptavidin radish peroxidase conjugate by monitoring the absorbance at 650 nm. The absorbance at 650 nm is proportional to the bound aggregated IgG. In a blocking ELISA experiment, the ability of a FcγRIIIA monoclonal antibody, 3G8, a mouse anti-FcγRIIIA antibody (Pharmingen), is monitored to block the binding of the receptor to the added IgG. The washing and incubation conditions were the same as described above, except that before the addition of IgG, a 5-fold molar excess of 3G8 was added and allowed to incubate for 30 minutes at 37 ° C.

RESULTS The purified recombinant Fc? RIIIA, purified, binds specifically to added IgG. The direct binding of purified recombinant soluble Fc? RIIIA to the aggregated and monomeric IgG was tested using an ELISA analysis (Fig. 2). At a concentration of 2 μg / ml, a strong binding to the aggregated IgG was observed. However, at a similar concentration, no binding to monomeric IgG was detected. Aggregation to the aggregated IgG was blocked by 3G8, an anti-FcγRIIIA monoclonal antibody that blocks the ligand binding site, indicating that the binding of aggregated IgG is through the normal FcαRIIIA ligand binding site. (Fig. 2). rFc? soluble RIIB was also characterized and showed its binding to IgG with characteristics similar to those of soluble rFc? RIIIA (damages not shown).FORMATION OF TETRAMERIC COMPLEXES OF SOLID FcRs MATERIALS AND METHODS Construction of plasmids for the expression of Fc? RylIIA and FcRylIB sol ubles fused with the peptide gone AVI TAG.

To generate tetrameric complexes of soluble VcyR, the soluble region of the human FcRgIIIA gene (amino acids 7-203) was amplified by PCR (Table 12), digested with BamH / HindIII and ligated into pET25b. { +) (Novagen). This vector was digested with Sall / Notl, and a 370 bp fragment was isolated by agarose gel electrophoresis. The hu3A vector, (given by J. Ravetch) was digested with BamHi / Sall, and a fragment of 270 bp containing the N terminus of FcγRIIIA was isolated. Both fragments were co-ligated into pcDNA3.1 (Invitrogen), which was digested with BamH / Notl to create pcDNA3-FcRglIIA (amino acids 1-203). The soluble region of Fc? RIIB (amino acids 33-180) was amplified by PCR (Table 1), digested with BglII / HindIII and ligated into pET25b (+) (Novagen). This vector was digested with BamI / Notl and a 140 bp fragment was isolated by agarose gel electrophoresis. The huRIIBI vector (given by J. Raavetch) was digested with Ba HI / EcoRI, and an N-terminal fragment of Fc? RIIB of 440 bp was isolated. Both of these fragments were co-ligated into pcDNA3.1 which had been digested with BamHI / Notl to create pcDNA3-FcRyIIB (amino acids 1-180). Subsequently, the interlayer-AVITAG sequence was fused to the C-terminus of Fc? RIIIA and Fc? RIIB. To generate the constructs Fc? RIIIA-interlacer, Avitag and Fc? RIIB-interlacer-avitag, the constructions of pcDNA3.1 Fc? RIIIA and Fc? RIIB were digested with Notl and Xbal (both cut in the vector sequence) and a double-stranded oligonucleotide with 86 base pairs consisting of the Notl site at the 5 'end and Xbal at the 3' end, was ligated into the vector. This 86 base pair fragment was generated by annealing two reverse phosphorylated 5 'reverse complement oligonucleotides (shown in Table 12 as 5' and 3 'avitag initiators) with the restriction sites for Notl and Xbal designed previously. Equal volumes of each primer were mixed at 100 ng per ul and the DNA was heated at 90 ° C for 15 minutes and cooled to room temperature for one hour for annealing. This created a double-stranded DNA fragment ready to be ligated to PCDNA3.1-Fc? RIIIA and the Fc? RIIB constructs were digested with the respective enzymes. Therefore, we constructed? DCNA3.1-Fc? RIIIA-interlacer-AVITAG and pcDNAS 1-Fc? RIIB-interlacer-AVITAG.

TABLE 12. INITIATORS USED FOR CONSTRUCTION OF FcyR and IgG VECTORS Oligomer Sequence Linker GGCCGCAGGTGGTGGTGGTCTGGTGGTGGTGGTTCTGGTCTGA AviTAG_5_'(SEQ ID NO ACGACATCTTCGAGGCTCGAAAATCGAATGGCAGGAATGAT. 1) Linker CTGATCATTCGTGCCATTCGATTTTCTGAGCCTCGAAGATGTCG AviTAG_3_' 'TTCAGACCAGAACCACCACCACCAGAACCACCACCACCTGC SEQ ID NO. 2) FcRIIIA G TTG GAT CCT CCA ACT GCT CTG CTA CTT CTA Left (SEC GTT T ID NO.3) FcRIIIA RiGAA AAG CTT AAA GAA TGA TGA GAT TGA CAC (SEQ ID NO 4) T FcRIIB RiGAA GTC GAC AAT GAT CCC CAT TGG TGA AGA G (SEQ ID NO 5) ) FcRIIB G TTA GAT CTT GCT GTG CTA TTC CTG GCT CC left (SEQ ID NO 6) IgG! RiATA GTC GAC CAC TGA TTT ACC CGG AGA (SEQ ID NO 7 'IgGl left GGAA TTC AAC ACC AAG GTG GAC AAG AAA GTT (SEQ ID NO 8; Mcr025; chl AAA GGATTC GCG AGC TCA GCC TCC ACC AAG G (f) (SEQ ID NO: 9) H021 GTCTGCTCGAAGCATTAACC (SEQ ID NO.? o; Biotinylation by BirA Soluble Fc receptors (Fc? R) were fused to the AVITAG sequence of 15 amino acids (Avidity, CO) (Schatz P.J. 1993, Biotechnology, 11: 1138-1143) on the C-terminus of the protein cloned in pcDNA3.1 were generated by transfection of 293H cells using Lipofectamine 2000 reagent (Invitrogen, CA). The supernatants of the cultures and soluble FcR proteins were purified by passing the supernatants through a column of IgG sepharose. The concentration of the FcR-AVITAG fusion protein was quantified by absorbance at 280 nm. The AVITAG present in the soluble FcR proteins was biotinylated according to the manufacturer's protocol (Avidity, CO) with the enzyme BirA of E. coli, a biotin ligase. Final dilution To: 100 of a combination of protease inhibitors (Sigma catalog # P8849) and a final concentration of 1 mg / ml of Leupeptin (Sigma L-8511) was added to the mixture to prevent degradation of the proteins. The BirA reaction was incubated at room temperature overnight, following which said solution was concentrated using a Biomax 10K ultrafiltration device (Millipore) by centrifugation at 35000 rpm at 4 ° C. The protein was loaded onto a column of CLPF Superdex 200 HR 10/30 (Pharmacia Biotech) in tris-HCl (20 mM, pH 8.0), 50 mM NaCl to remove the labeled soluble FcγR from the free biotin.

Determination of the degree of biotinylation by streptavidin change analysis Approximately 80-85% of the protein was biotinylated by the enzyme BirA (Avidity, CO). The streptavidin change analysis was used to determine the degree of biotinylation of the protein. The biotinylated protein is incubated with espreptavidin (MW 60,000 Daltons) in different proportions. Non-biotinylated protein alone and streptavidin alone were included as controls to determine the degree of biotinylation. Incubation was carried out either on ice for 2 hours or overnight at 4 ° C. Samples were analyzed on a 4-12% Bis-TRIS SDS-PAGE (Invitrogen, CA) with reducing agent and without boiling the samples. The biotinylated protein bound to streptavidin migrates to a high molecular weight band. The degree of biotinylation is calculated by the amount of monomeric protein left in the sample. The absence of monomeric low molecular weight species and the presence of a complex with a higher molecular weight than streptavidin alone indicates a high degree of biotilation.

Formation of Fc? R Tetrameric Complexes The formation of tetrameric complexes of Fc? R was carried out according to the previously established methodologies for MHC class I tetramers (See Bush, DH and bulls, 1998 Immumty 8: 353-362; Altman, JD and others, 1996, Science 21A: 94-96). The concentration of the biotinylated monomeric Fc? R was calculated based on absorbance at 280 nm. A molecule of streptavidin-dicoeritpna (EA-FE) (Molecular Probes, OR) has the ability to bind 4 molecules of biotin. A 5: 1 molar ratio of biotylated Fc? R monomeric to EA-FE (5 times Fc? R monomeric biotinylated: 1 time EA-FE) was used to ensure an excess of biotinylated protein. The calculated molecular weight of EA-FE is 300,000 Daltons, therefore 303 ml of a 1 mg / ml streptavidin-FE solution has 1 mmol of EA-FE, which is added to 5 mmol of protein. Efficient tetrameric protein formation requires EA-FE to be added in staggered increments. Half the amount of EA-FE was added at the beginning, and the rest of EA-FE was added in small aliquots every 20-30 minutes at 4 ° C in the dark. The intervals of the remaining EA-FE addition are flexible. After the addition of EA-FE was completed, the solution was concentrated and loaded onto a size exclusion column for CLFF as above in phosphate buffered saline, at pH 7.4. The fraction that was eluted in the empty volume with a molecular weight higher than that of EA-FE alone was collected. The protease inhibitors were filled in to prevent protein degradation. The solution was concentrated and additional protease inhibitors were added to the final storage complex. The final concentration of the tetrameric complex of soluble Fc? R was calculated based on the starting concentration of the biotinylated monomeric protein. For example, if 500 μg of biotinylated protein was used to form the tetrameric complex and the final concentrated tetramers reached a volume of 500 μl, the concentration is estimated to be approximately 1 mg / ml (The losses incurred during the concentration are not taken into account since it is difficult to determine precisely how much was lost during each step of the tetramer formation. an absorbance at 280 nm to measure the concentration due to the interference of the FE). The soluble tetrameric FcγR complexes were dispensed in small aliquots at -80 ° C for long term storage with protease inhibitors. No sodium azide was added to these preparations since the tetramers were used to screen a yeast display bank. Upon thawing an aliquot, the tetramers were stored at 4 ° C for up to 1 week.

ELISA analysis to characterize the complexes of Fc? R Tetraméri co. An ELISA analysis was used to characterize the tetrameric Fc? R complexes. A 96-well Maxisorb F plate (Nunc) was coated with 25 ng of human IgG in pH buffer of PBS, and incubated overnight at 4 ° C. Plates were washed with PBS (0.5% BSA / 0.1% Tween 20 (as diluent) before adding the FcγRIIIA tetramer combination and the antibodies were tested for blocking with 3G8, an anti-human FcγRIIIA antibody. of the mouse as described below: the step of Blocking was carried out in the following manner: tetramers of soluble Fc? RIIIA were preincubated to a final fixed concentration of 0.5 mg / ml with antibodies for 1 hour at room temperature in buffer, PBS / 0.5% BSA (0.1% Tween 20 The final concentrations of the antibodies ranged from 60 mg / ml to 0.25 mg / ml, and 3G8 is a mouse anti-human FcγRIIIA antibody, and for the purposes of this experiment, a chimeric version was used, ie the The variable region of the antibody is a mouse anti-human FcγRIIIA and the constant region of the heavy and light chains comes from the human IgGl region.D265A 3-3-20 was also used in this experiment, which is an anti-human antibody. Fluorescein such that the Fc region contains a mutation at position 265, wherein an aspartic acid is substituted with alanine in human IgGl, which results in reduced binding to FcγR. previously (See Clynes and other s, 2000, Nat. Med. 6. 443-446; Shields et al., 2001, J. Biol. Chem. 276: 6591-6604). This antibody was used as a negative isotype control. The antibodies were allowed to bind to FcγRIIIA tetramers by preincubation for 1 hour at room temperature. The mixture was added to the IgG in the washed plate and incubated for an additional hour at room temperature. The plate was washed with pH buffer and DJ was added 130c (a mouse anti-human FcγRIIIA antibody available from DAKO, Denmark, its epitope is different from that of the 3G8 antibody) at a dilution of 1: 5000 and incubated for 1 hour at room temperature in order to detect the Fc? RIIIA tetramers bound. Unbound antibodies were washed with buffer and DJ130c bound with goat anti-mouse peroxidase (Jakson laboratories) was detected. This reagent will not detect human Fc. After washing the unbound peroxidase-conjugated antibody, the substrate, TMB reagent (BioFx), was added to detect the degree of blocking with 3G8 against the isotype control and the developed color was read at 660 nm. For direct binding of tetrameric Fc? RIIIA to IgG by ELISA, Maxisorb plates were coated with 25 ng IgG as described above. The soluble tetrameric Fc? RDIA from 20 mg / ml to 0.1 mg / ml was added and biotinylated monomeric soluble tetrameric Fc? RIIIA was added at concentrations ranging from 20 mg / ml to 0.16 mg / ml. Detection was the same as before with DJ 130c, followed by goat anti-mouse peroxidase antibody. The color developed with the TMB reagent and the plate was read at 650 nm.

RESULTS The complex or tetrameric of soluble Fc? RIII binds to monomeric human IgG via its normal binding site.

Ligands Soluble Fc? RIIIA-AVITAG fusion proteins were generated, isolated and analyzed as described in the Materials and Methods section using an ELIA analysis and shown to have properties similar to the soluble Fc? RIIIA protein without AVITAG (data not revealed) . The fusion proteins were biotylated and tetrameric complexes were generated as described above. The tetrameric complex of soluble Fc R was then evaluated to bind its ligand, monomeric human IgG, using an ELISA analysis. ELISA analysis showed that soluble tetrameric Fc? R complexes bind specifically to monomeric human IgG. As shown in Fig. 3A, the binding of soluble tetrameric Fc? RIIIA to monomeric human IgG is blocked by 3G8, a mouse anti-human Fc? LIA monoclonal antibody, as monitored by absorbance at 650 nm. On the other hand, the monoclonal antibody 4-4-20 harboring the D265 A mutation could not block the binding of the soluble tetrameric Fc? RIIIA to the monomeric human IgG (Fig. 3A). This experiment therefore confirms that the binding of the soluble tetrameric FcRIIIA complex occurs through the binding site of the native ligand.

The complex or tetrameric of Fc? RIIIA sol uble binds to monomeric human IgG with a greater avidity than Fc? RIIIA sol uble monomeric co. The direct binding of the soluble tetrameric Fc? RIIIA to the added human IgG was evaluated using an ELISA analysis and compared to the direct binding of soluble monomeric Fc? RIIIA to the monomeric human IgG. As shown in Fig. 3B, the soluble tetrameric Fc? RIIIA binds to human IgG with a higher avidity (8-10 times) than the soluble monomeric receptor, as monitored by the absorbance at 450 nm. The soluble Fc? RIIIA tetrameric complex binding was also analyzed using magnetic beads coated with purified Fc fragment of IgGl (Fig. 4). The tetrameric complex of soluble Fc? RIIIA binds to beads coated with IgGl Fc under conditions in which the monomeric binding is not detected. Specifically, the binding was shown by preincubation of the receptor complex, with an anti-FcγRIIIA monoclonal antibody, LNK16, which blocks Fc binding. This analysis further confirms that the tetrameric FcγRIIIa complex binds to the monomeric IgG through its normal ligand binding site and the avidity of the receptor increases due to the multiple binding sites within the complex. 6. 3 CONSTRUCTION OF YEAST STRAIN TO EXHIBIT MUTATING IgG Fc DOMAINS. MATERIALS AND METHODS The pYDI vector (Invitrogen) is derived directly from a yeast replication vector pCT302 (Shusta, et al., 2000 Nat. Biotechnol.18: 754-759), which has been successfully used to display T cell receptors. and a number of scFV. This plasmid is centromepic and hosts the TRPI gene which allows a relatively constant copy number of plasmids 1-2 per cell in a strain of yeast trpl. The directional cloning in the polylinker places the gene of interest under the control of the GALI promoter and in frame with AGA2. The fusion of the Fc IgG domain of the yeast Aga2p results in the extracellular secretion of the Aga2-Fc fusion protein and subsequently exhibits the Fc protein of the cell wall via the disulfide bond to the yeast protein Aga Ip, which is an integral cell wall protein. In order to optimize the levels of exposure, different fragments of the IgGl heavy chain were amplified where it is amplified by PCR and cloned in pYDI. Specifically, the heavy chain region of IgGl (IGIm allotype (a), amino acids 206-447) was amplified by PCR (Table 1) of clone IMAGE 182740, digested with EcoRI / Sall and ligated into the vector pYDI (Invitrogen). The initial clone of IMAGE contained a deletion of a single nucleotide at position 319 that was corrected by site-directed mutagenesis to construct pYD-GIF206 (Quickchange, Stratagene). The CH1-CH3 fragment (amino acids 118-447) of the MAb B6.2 heavy chain clone was amplified in the pCINEO vector using a 5 'oligo (mcr025; chi (f)) and a 3' oligo (H021) (see Table 8). The fragment was digested withBamHI / NotI and ligated into the pYDI vector to construct pYD-CHI. Fig. 5 shows a schematic presentation of the constructions. The construction of CH1-CH3 contains the CH1 domain in addition to the CH2-CH3 axis domain of the heavy chain, GIF206 contains 6 amino acid residues upstream of eey GIF227 initiated within the axis region at an endogenous proteolytic cleavage site (Jendeberg and others, 1997 J. Immunol., Meth. 201: 25-34). 6. 4 IMMUNOLOCALIZATION AND CHARACTERIZATION OF Fc DOMAINS IN THE CELLULAR WALL OF MATERIAL YEASTS AND METHODS The constructions containing the fusion proteins of Aga2p-Fc and a control vector, pYDI, lacking any insert, were transformed into the yeast strain EBYIOO (Invitrogen), MATa ura3-52 trpl leu2? Lh? S3? 200 pep4 :: HIS3 prbl? 1.6r canl GAL :: GAL-AGAI, using a transformation protocol of yeast of lithium acetate normal (Gietz et al., 1992 Nucleic Acids 20: 1425). Subsequently, tryptophan prototrophs were selected in the defined medium. The amplification of independent cell populations and the induction of Agalp and the fusion proteins of Aga2p-Fc were achieved by the development in glucose, followed by development in galactose-containing media as the primary carbon source for 24-48 hours at 20 ° C. The development in galactose induces the expression of the Aga2-Fc fusion proteins via the GALI promoter, which subsequently leads to the display of the Fc fusion proteins on the yeast cell surface.

RESULTS SCAF Analysis of Fc Fusion Proteins The expression of Fc fusion proteins on the yeast cell surface was analyzed by immunostaining using a Fc? R anti-human F (ab)? polyclonal conjugate with PE and HP6017 antibody (Sigma) (Jackson Immunoresearch Laboratories, Inc.). Fluorescence microscopy shows peripheral staining for the three Fc fusion proteins. The control strain, which hosts the vector alone, shows little or no staining (data not shown). The analysis of SCAF was used to quantify the staining (Fig. 6). The yeast strain that contains the fusion of CH1-CH3, showed the highest percentage of cells stained with both antibodies (Fig. 6B and F). The construction of GIF 227 showed the highest average fluorescence intensity (Fig. 6, panels C and G).

Characterization of the Union of Fc Fusion Proteins Expressed on the Yeast Cell Surface The natural context of the Fc and Fc? R proteins places the receptor on the cell surface and the Fc as the soluble ligand; however, the Fc surface of yeast exhibits the inverse geometry of the natural interaction. The detection of Fc IgGl proteins on the surface of the yeast cell wall is complicated by both the low affinity of FcγR for its ligand and the inverse geometry inherent in the display system. Although the last point can not be altered, the avidity of the ligand improved as explained above, forming tetrameric complexes of soluble FcγR, which allows the detection of FcγR binding to the Fc fusion proteins expressed on the surface of the yeast cell wall. To characterize the binding of soluble tetrameric Fc? R complexes to Fc fusion proteins displayed on the surface, yeast cells expressing different Fc constructs were incubated with the soluble rFc? RIIIA tetramer complex and analyzed through SCAF. The yeast cells harboring pYD.CHI, which exhibit the wild-type CH1-CH3 construct, were joined by the soluble rFc? RIIIA tetramer complex as shown by the SCAF analysis. However, strains of GIF206 and GIF 227, showed little or no binding to the soluble rFc? RIIIA tetramer complex as shown by SCAF analysis (data not shown). In the Fc region, mutations have been defined that block binding to FcγR (Shields et al., 2001, J. Biol. Chem. 276: 5491-6604). One of these mutations, D266A, was incorporated into pYD-CHI and this mutant was expressed on the surface of the yeast cells. These cells were incubated with the soluble tetrameric FcγRIIIA complex using a high concentration of ligand (0.15 M Fc, 7.5 mM D265A). SCAF analysis indicated that the soluble Fc? RIIIA tetrameric complex bound to wild-type Fc (Fig. 7A) but the soluble Fc? RIIIA tetrameric complex did not bind to mutant D266 A-Fc indicating that Fc? R interacts with the normal FcR binding site in the lower CH2-axis region (Fig. 7B). Antibodies to the binding site of the Fc? RIIIA ligand blocked the binding of the soluble Fc? RIIIA tetrameric complex to the wild-type Fc protein which is shown on the wall of the yeast cell surface as analyzed by SCAF (Fig. 9). The Union of The tetrameric soluble Fc? RIIIA complex was blocked by the 3G8 antibody, as well as the LNK 16 antibody, another anti-Fc? RIIIA monoclonal antibody (Advanced Immunological) (Tam et al., 1996 J. Immunol. 157: 1576-1581) and it was not blocked by an irrelevant isotype control. Therefore, the binding of the tetrameric complex of soluble Fc? RIIIA with the Fc proteins exhibited on the yeast cell surface occurs through the normal ligand binding site. The limited binding of the tetrameric complex of Fc? RIIIA indicates that it indicates that a subpopulation of cells has a correctly folded Fc, which is accessible for Fc? R. There are numerous reasons why only a subpopulation of cells can bind to the ligand, for example, they may be in different stages of the cell cycle or the fusion proteins may not have been exported. In order to determine the dissociation constant of the Fc? RIIIA-tetramer binding to the Fc fusion proteins on the yeast cell surface, the binding of a tetrameric complex scale Fc? RIIIA was analyzed using SCAF. The tetrameric FcγRIIIA complex was titrated at concentrations of 1.4 μM to 0.0006 μM. Using the mean fluorescence intensity as a measure of binding affinity and linear regression analysis, it was determined that the KD is 0.006 μM (+/- 0.001) (data not shown). 6. 5 CONSTRUCTION OF Fc MUTANT BANK A mutant Fc bank was constructed using primers that look towards the Fc fragment in the Fc-CHI construct and error-prone PCR (Genemorph).; Stratagene). The insert of CH1-CH3 in the vector pYD-CHI was amplified using a mutagenic PCR (Genemorph, Stratagene). Five reactions were carried out using pYD-upstream and pYD-downstream (Invitrogen). The resulting amplified fragment was digested with XHO / BamHI and ligated into pYDI. The ligation reaction was then transformed into ultracompetent XLIO Stratagene cells, which resulted in ~ lxl06 transformants, 80% of the transformants containing inserts. Sequence analysis of 28 randomized plasmids in the bank indicated a mutation frequency 2-3 mutations / kb with a 40% failure that retained nucleotide changes and 60% of the mutations resulted in amino acid changes. The bank was transformed into the yeast strain EBY100, MATa ura3-52 trp 1 Leu2? L his3? 200 pep4 :: HIS3 prbl? L.ßR canl GAL GAL-AGA 1:: URA3 at a high efficiency, -3.3xl05 transformants / ug in 30 independent transformation reactions to create a total of -107 yeast transformants (Gietz, et al., 1992, Nucleic Acids Res. 20: 1425). The bank was combined and amplified by the development in glucose. 6. 6 SELECTION AND ANALYSIS OF Fc MUTANTS MATERIALS AND METHODS ELISA analysis to screen for Fc mutants ELISA plates (Nunc F96 MaxiSorp Immunoplate) were coated with 50 ml / well of 0.5 mg / ml BSA-ITCF in buffer solution. carbonate at 4 ° C and allowed to incubate overnight. Plates were washed with lx PBS / 0 1% Tween 20 (PBST) 3 times. 200 ml / well of PBST / 0.5% BSA were added and the plates were incubated for 30 minutes at room temperature. The plates were washed three additional times with PBST. 50 ml / well of antibody 4-4-20 1.4 diluted (approximately 3 mg / ml that could lead to a final concentration of 0.7-0-8 mg / well) either wild type or containing an Fc mutant, was added of the conditional medium in PBST / 0.5% BSA and allowed to incubate for 2 hours at room temperature. The plates were washed with PBST three times. Purified monomeric FcγRIIIa, biotinylated at 3 mg / m (in PBST / 0.5% BSA) (50 μl / well) was added to the plates and allowed to incubate for 1.5 hours at room temperature. The plates were washed with PBST three times. 50 ml / well of a 1: 5000 dilution of Streptavidin-HRP (Pharmacia, RPN 123v) in PBST / 0.5% BSA was added and the plates were incubated for 30 minutes at room temperature. The plates were washed with PBST three times. Then 80 ml / well of TMB reagent (BioFX) was added, and incubate for 10-15 minutes at room temperature on a dark plate. The reactions were finally stopped by adding 40 ml / well of brake solution (sulfuric acid 0.18;). The plates were then monitored for absorbance at 450 nm. After the first screening, interested candidates were further confirmed by serial titration of 4-4-20-Fc mutants in the immuno-complex which is based on binding to ELISA. Few modifications were made in this ELISA. To cover the plates, 2 mg / ml of BSA-ITCF was used. Based on the results of IgG quantitation, mutants of the conditional medium were added to a final concentration of 1, 0.5, 0.25, 0.125, 0.063 and 0 mg / ml in PBST / 0.5% BSA.

SCAF Screen for Fc Proteins Displayed on the Cell Surface Cells were grown in at least 10 ml of HSM-Trp-Ura pH 5.5 with glucose for 16-24 hours or until the DOeoo was greater than 2.0. The cells were centrifuged at ~ 2000 rpm for 5 minutes. The cells were resuspended in an equal volume of HSM-Trp-Ura, pH 7.0 with galactose. Into a 125 ml flask, 36 ml of galactose medium was added and inoculated with 9 ml of culture, which was incubated at 20 ° C with shaking for 24-48 hours. The development was monitored by measuring DO600 at intervals 8-16 hours. The cells are collected at 2k rpm for 5 minutes and resuspended in an equal volume of Ix PBS, pH 7.4. Equilibrium screen: an appropriate amount of cells was incubated while maintaining an excess of ligand. For example, it is preferred to start with a number of cells needed to ensure 10-fold coverage of the bank. For the first class with a bank that contains 107 transformants. 108 cells should be used. In fact, it is best to start with 109 cells to compensate for the loss during the starting protocol. Incubation is usually done in a 1.5 ml tube in volumes of 20-100 ml for 1 hour at 4 ° C in the dark on a rotator (incubation buffer, 1XPBS pH7, 4.1 mg / ml BSA). The cells were washed once in 500 ml of pH buffer and centrifuged at 4K rpm for 2.5 minutes. The cells were resuspended in 100 ml of incubation buffer and incubated with the second staining reagent. For Fc-CHI, goat F (Ab) 2 (Jackson Immunoresearch Laboratories, Ine) anti-hFc F (ab) 2-ITCF antibody can be used to stain CHI expression. The staining was carried out with 1 ml for 30 minutes. The cells were further washed in 500 ml of incubation pH buffer and centrifuged at 4 k rpm for 2.5 minutes, resuspended in 1 ml IX PBS 1 mg / ml. BSA and were analyzed by SCAF.

The normal equilibrium sieve sorting gates and number of cells collected are shown in Table 13.

TABLE 13. CLASSIFICATION GATES AND NUMBER OF SELECTED CELLS After the third and fourth classification, cells were plated directly on plates with trp-ura to identify individual mutants. Normally 200 to 400 colonies are recovered per plate. After collection, the cells were placed in 10 ml of glucose medium in a 50 ml conical tube and developed at 30 ° C. The whole process was repeated interactively.

RESULTS Analysis of SCAF of Fc mutants After induction in galactose medium, the cells were harvested and co-stained with tetrameric complex of soluble Fc? RIIIA-FE and labeled with F (ab) 2 of anti-human Fc. of mouse-ITCF (Jackson Immunoresearch Laboratories, Inc.). The cells were analyzed by SCAF and sorting gates were used to select the cells that showed the highest affinity for the tetrameric complex of soluble FcγRIIIA in relation to the amount of Fc expression on the cell surface (Fig 9). For example, a cell containing a mutant Fc that binds better to the tetrameric complex of soluble FcγRIIIA may express fewer Fc fusion proteins on the yeast cell surface and this cell will be in the lower left corner of the selection gate . Four consecutive selections were made to enrich the mutants that showed the highest affinity for the tetrameric FcγRIIIA complex. The floodgates for each successive classification were 5.5%, 1%, 0.2% and 0.1%. After the last selection, the cells were plated in selective medium and individual colonies were isolated. Each individual colony represented a clonal population of cells harboring a single Fc mutant within the fusion protein of Aga2-Fc. Initially, 32 independent colonies were picked and tested by SCAF to bind to the tetrameric soluble Fc? RIIIA complex (Fig. 10). Eighteen mutants showed an increase in binding intensity as measured by the percentage of cells bound by tetramer complex of soluble FcγRIIIA and the mean fluorescence intensity of the bound cells.

Mutations showing an increase in binding to FcγRIIIA were also tested to bind to the tetrameric complex of soluble FcγRIB (Fig. 10). The majority of the mutations that led to an increase in binding to the tetrameric complex of soluble Fc? RIIIA also resulted in the detection of the tetrameric complex staining of Fc? RIIB (Fig. 10). Based on previous physical and genetic data, some mutations are expected that increase the binding to Fc? RIIIA to also increase binding to Fc? RIIB (Shields et al., 2001, J Bil. Chem. 276: 6591-6604; Sondermann et al. , 2000, Nature 406: 267,273).

Analysis of mutants in a 4-4-20 MAb produced in a human cell line. The isolation and analysis of mutations in the yeast system allows the rapid identification of novel mutant alleles. The use of the heterologous system to isolate mutations, could result in the identification of mutations that improve the binding through an alteration that results in the mistake or alteration in glycosylation that is specific for yeast. To analyze Fc mutations in an immunoglobulin molecule that is produced in human cells, the mutants were subcloned into a mammalian expression vector, containing the antibody heavy chain monoclonal anti-fluorescein. 4-4-20 (Kranz et al., 1982, J. Biol. Chem. 257 (12) 6987-6995). Heavy chains of 4-4-20 mutants were co-expressed temporarily with the light chain clones in the human kidney cell line (293H). The supernatants were collected and analyzed by ELISA (Fig. 11). According to the ELISA analysis, most of the mutants that were identified as having an improved affinity for the soluble monomeric complex of Fc? RIIIA, in the secondary FAC analysis, also showed an increase in the tetrameric complex binding of soluble Fc? RIIIA when present in the Fc region of the monoclonal antibody 4-4-20 produced in the human cell line (Fig. 1 ( A) However, two mutants, number 16 and number 19, showed a decrease in the binding to the soluble Fc? RIIIA monomeric complex.Step 14 summarizes the mutations that have been identified and their corresponding binding characteristics for Fc? RIIIA and Fc? RIIB, as determined by an analysis based on yeast exposure and ELISA In Table 14, the symbols represent the following: • corresponds to an increase in affinity of 1 time; + corresponds to an increase in affinity of 50%; - corresponds to a decrease in affinity of 1 time; ? it corresponds to that there is no change in affinity compared to a comparable molecule comprising a wild-type Fc region. TABLE 14: IDENTIFIED MUTATIONS AND UNION CHARACTERISTICS 4 Analysis of the binding of the soluble Fc? RIIB tetrameric complex shows that 7 of 8 mutants that showed an increase in binding to the tetrameric complex of Fc? RIIIA also had an increased binding to the tetrameric complex of soluble Fc? RIIB (Fig. 1 IB). A mutant, number 8, showed a decrease in binding to the tetrameric complex of soluble Fc? RIIB. Three of the mutants showed no difference in binding to either the tetrameric complex of soluble Fc? RIIIA or the tetrameric complex of soluble Fc? RIIB, possibly due to mutations that result in specific alterations. 6. 7 CCDA ANALYSIS OF Fc MUTANTS Preparation of effector cells: Peripheral blood mononuclear cells (PBMC) were purified by Ficoll-Paque (Pharmacia, 17-1440-02), Ficoll-Paque density gradient centrifugation. normal peripheral human blood (Biowhittaker / Poietics, 1W-406). The blood was shipped on the same day at room temperature and diluted 1: 1 in PBS and glucose (1 g / 1) and layered on Ficoll in 10 ml conical tubes (3 ml Ficoll; 4 ml PBS / blood) or 50 ml conical tubes (15 ml; Ficoll; 20 ml PBS / blood). Centrifugation was performed at 150 rpm (400 ref) for 40 minutes at room temperature. The CMSP layer was removed (approximately 4-6 ml of the 50 ml conical tube) and diluted 1:10 in PBS (not containing CA2 + or Mg2 +) in a 50 ml conical tube, and centrifuged for an additional ten minutes at 1200 rpm (250 ref) at room temperature. The supernatant was removed and the pellets were resuspended in 10-12 ml of PBS (which do not contain CA2t or Mg21"), were transferred to 15 ml conical tubes and centrifuged for another 10 minutes at 1200 rpm at room temperature, the supernatant was removed and the pellets were resuspended in a minimum volume (1-2 ml. ) of medium (Isocove medium (IMDM) + 10% fetal bovine serum (SFB), 4 mM Gln, Penicillin / Streptomycin (PE)) The PBMC were diluted to the appropriate volume for the CCDA analysis, two dilutions were made in a 96-well plate with ELISA (Nunc 196 MaxiSorp Immunoplate) The yield of CMSP was approximately 3-5xl07 cells per 40-50 ml of whole blood Preparation of target cells: the target cells used in the analysis were SK -BR-3 (ATCC Accession Number HTb-30; Trempe et al., 1976; Cancer Res. 33-41), Raji (Accession Number ATCC CCL-86; Epstein et al., 1965, J. Nati. Cancer Inst. 34: 231-40) or Daudi cells (Accession number to ATCC CCL-213, Klein et al., 1968, Cancer Res 28: 1300-10) (resuspend 0.5 ml of IMDM medium) and labeled with europium chelate 6,6 '-dicarboxylate of bis (acetoxymethyl) -2,2": 6', 2" -terpyridine (BATDA reagent, Perkin Elmer DELFIA reagent; C 136-100). K562 cells (ATCC accession number CCL-243) were used as control cells for AN activity. The Daudi and Raji cells were centrifuged; SK-BR-3 cells were trypsinized for 2-5 minutes at 37 ° C, 5% C02 and the medium was neutralized before centrifuged at 200-350 G. The number of target cells used in the analyzes was approximately 4-5xl06 cells and did not exceed 5xl0d since the efficiency of labeling was better with as few as 2xl06 cells. Once the cells were centrifuged, the media was aspirated to 0.5 ml in 10 ml Falcon tubes. 2.5 μl of BATDA reagent was added and the mixture was incubated at 37 ° C, 5% C02 for 30 minutes. The cells were washed twice in 10 ml of PBS and 0.125 of sulfinylpyrazole ("SP"; SIGMA S-9509); and twice in 10 ml of analysis medium (cell medium + 0.125 mM sulfinylpyrazole). The cells were resuspended in 1 ml of analysis medium, counted and diluted. When SK-BR-3 cells were used as target cells after the first wash of PBS / SP, PBS / SP was aspirated and 500 μg / ml of ITCF (PIERCE 46110) was added in IMDM medium containing SP, Gln and P / S and incubated for 30 minutes at 37 ° C, 5% C02. The cells were washed twice with analysis medium, resuspended in 1 ml of the analysis medium, counted and diluted. Antibody Opsonization: Once the target cells were prepared as described above, they were opsonized with the appropriate antibodies. In the case of Fc variants, 50 μl of lxl0b cells / ml was added to a 2x concentration of the antibody containing the Fc variant. The final concentrations were as follows: final concentration of Ch-4-4-20 was 0.5-1 μg / ml, and final concentration of Ch4D5 was 30 ng / ml-1 ng / ml. The opsonized target cells were added to the effector cells to produce an effector: target ratio of 75: 1 in the case of 4-4-20 antibodies with Fc variants. In the case of Ch4D5 antibodies with Fc variants, the ratio of 50: 1 or 75: 1 of effector: white was achieved. The effective CMSP gradient for the analysis varies from 100: 1 to 1: 1. Spontaneous release (LE) was measured by adding 100 μl of analysis medium to the cells; the maximum release (LM) was measured by adding 4% Tx-100. The cells were centrifuged at 200 rpm in a Beckman centrifuge for 1 minute at room temperature at 57 G. The cells were incubated for 3-3.5 hours at 37 ° C, 5% CO? . After incubation, the cells were centrifuged at 1000 rpm in a Beckman centrifuge (approximately 220xg) for five minutes at 10 ° C. 20 μl of supernatant was collected, 200 μl of Eu solution was added and the mixture was stirred for 15 minutes. minutes at room temperature at 120 rpm on a rotary shaker The fluorescence was quantified in the resolution fluorometer with time (Victor 1420, Perkin Elmer).

RESULTS As described above, the Fc regions variant were subcloned into a mammalian expression vector, containing the heavy chain of the anti-fluorescein monoclonal antibody, 4-4-20 (Kranz et al., 1982 J. Biol. Chem. 257 (12): 6987-6995). The heavy chains of 4-4-20 variant were co-expressed temporarily with the light gray clones in the human kidney cell line (293H). The supernatants were collected and analyzed using the CCDA analysis. Fig. 12 shows that the CCDA activity of the mutants depends on the concentration. As summarized in Table 8, five immunoglobulins with variant Fc regions had an improved CCAD activity relative to the wild type 4-4-20 ch. The five mutants are as follows: MGFc-27 (G316D, A378V, D399E); MGFc-31 (P247L, N421K); MGFC-10 (K288N, A330S, P396L); MGFc-28 (N3151, V379M, 7394M); MGFc-29 (F243I, V379L, G420V). Additional 4-4-20 immunoglobulms with variant Fc regions were analyzed for their CCDA activity in relation to an immunoglobulin 4-4-20 with a wild-type Fc region. These results are summarized in Table 15. The CCDA analyzes were also carried out using the same protocol as previously described for the 4-4-20 antibody, however, the variant Fc regions were cloned into a humanized antibody ( Ab4D5) that is specific for the growth factor receptor 2 human epidermal (HER2 / neu). In this case, SK-BR-3 cells were used as the target cells that were opsonized with an HER2 / neu antibody carrying a variant Fc region. HER2 / neu is endogenously expressed by SK-BR-3 cells and therefore are present on the surface of these cells. Fig. 13 shows the CCDA activity of HER2 / neu antibodies carrying the variant Fc regions. Table 16 summarizes the results of CCDA activity of the mutant in the context of the HER2 / neu antibody. Normalization was performed by comparing the concentration of the mutant to the wild type antibody required for a specific value of percent cell lysis. As shown in Fig. 13A, the mutants MGFc-5 (V379M), MGFc-9 (P243I, V379L), MGFc-10 (K288N, A330S, P396L), MGFc-13 (K334E, T359N, T366), and MGFc-27 (G316D, A378V, D399E) that were cloned into the humanized anti-HER2 / neu antibody exhibited a higher specific percentage of lysis of SK-BR-3 cells relative to the wild type antibody.

TABLE 15. SUMMARY OF ACTIVITY OF CCDA DE MUTANTES CCDA Variant of Fc 1 ug / ml 0.5 ug / ml Brand Ref Amino Acid Variation% specific lysis Normalized% specific% MGFc- -27 2C4 G316D, A378V, D399E 33% 2 2..2244 2 222 %% 3.60 Lp MGFc- -31 3B9 P247L, N421 K 30% 2 2..0055 1 177 %% 2.90 cp MGFc- -10 IEI K288N, A330S, P396L 24% 1 1..6666 1 100 %% 1.67 FGc- -28 2C5 N315I, V379M T394M 20% 1 1..3377 1 100 %% 1.69 GFc- -29 3DI IF243I, V379L, G420V 20% 1 1..3355 7 7 %% 1.17 ch4-4-2C (P54008) 15% 1 1..0000 6 6 %% 1.00 GFc-35 3D2 255Q K326E 11% 0 0..7799 3 3 %% 0.53 MGFc- - 36 3D3 K218R, G281D, G385R 15% 0 0..6677 5 5 %% 0.78 GFc- -30 3A8 F275Y 9% 0 0..6644 2 2% 7- C.37 MGFc- -32 3C8 D28D ?, S354F, A431D, L4411 9% 0 0..6622 4 4 %% 0.75 MGFc- -33 3C9 K317N, F423 deleted 3% 0 0..1188 - ll ?? .. -0.22 MGFc- -34 3 3BB11C F241L, E258G - 1% - 00..0088 --44 %% -0.71 GFc- -26 D265A 1% 0 0..0088 - 33 %% -0.45 TABLE 16: SUMMARY OF MUTANTS 4 ^ c-p s *.

The kinetic parameters of ch-4-4-20 antibody construction containing mutants of Fc to Fc? RIIIa and Fc? RIIB were analyzed using a BIAcore analysis (BIAcore Instrument 1000, BIAcore Inc. Piscataway, N.J.). The Fc? RIIIA used in this analysis was a soluble monomeric protein, the extracellular region of FcyRIIIA was linked to the AVITAG linker sequence as described in Section 6.2 above. The Fc? RIIB used in this analysis was a soluble dimeric protein prepared according to the methodology described in the provisional application of E.U.A. No. 60 / 439,709 filed January 13, 2003, which is incorporated herein by reference. In summary, the Fc? RIIB used was the extracellular domain of FcyRIIB fused to the human IgG2-CH2-CH3 axis domain. BSA-ITCF (36 μg / ml in 10 mM acetate buffer at pH 5.9) was immobilized on one of the four flow cells (flow cell 2) of a sensor microcircuit surface through amine coupling chemistry (by modification of carboxymethyl groups with NHS / ED mixture) so that approximately 5000 response units (UR) of BSA-ITCF were immobilized on the surface. Following this, the unreacted active esters were "uncovered with an injection of IM Et-NH2." Once the appropriate surface was prepared, the ch-4-4-20 antibodies containing the Fc mutations were passed over the surface by one minute of injections of a solution at 20 μg / ml at a flow rate of 5 μl / ml. The antibody level of ch-4-420 bound to the surface varied between 400 and 700 RU. Then, the receptor dilution series (FcyRIIIA and Fc? RIIB-Fc fusion protein) in buffer solution of Vd.-P (10 mM HEPES, 150 mM NaCl, 005% P20 surfactant, 3 mM EDTA, pH 7.4 ) were injected on the surface at 100 μl / min. Regeneration of antibody between different dilutions of receptors was carried out by 5 second injections of 100 M NaHCO3 pH 9.4; 3M NaCl The same dilutions of the receptor were also injected onto a surface of BSA-ITCF without antibody ch-4-420 at the beginning and end of analysis as reference injections. Once all the data were recovered, the resulting binding curves were globally adapted using computer algorithms supplied by the manufacturer, BIAcore, Inc. (Piscataway, NJ). These algorithms calculate the K on and K off, from which the apparent equilibrium binding constant, KD, is derived as the ratio of the two rate constants (ie Kapagada Kncendida) • More detailed treatments of how they are derived individual velocity constants can be found in BLAevaluatin Software Handbook (BIAcore, Inc., Piscataway, NJ).

Binding curves for two different concentrations (200 nM and 80 nM fusion protein for FcyRIIIA and 200 nM and 400 nM for Fc? RIIB) were aligned and the responses were adjusted to the same level of captured antibodies and the reference curves were subtracted of the experimental curves. The phases of association and dissociation were adapted separately. The constant dissociation regime was obtained by intervals of 32-34 seconds of the dissociation phase, an association phase was obtained by a 1: 1 Langmuir model and the adapted base was selected on the basis criterion of Rmax and chi2.

RESULTS Fig. 14 shows the capture of ch 4-4-20 antibodies with mutant Fc regions in the BSA-ITCF immobilized sensor microcircuit. In μl of antibodies at a concentration of approximately 20 μg / ml were injected at 5 μl / min on the surface of BSA-ITCF. Fig. 15 is a real-time binding sensogram of FcyRIIIA to ch-4-4-20 antibodies carrying the variant Fc regimens. The binding of FcyRIIIA was analyzed at a concentration of 200 nM and the responses of resonance signals were normalized to the level of the response obtained for the ch-4-4-20 wild-type antibody. The kinetic parameters of the binding of FcyRIIIA to ch-4-4-20 antibodies were obtained by adapting the data obtained at two different concentrations of FcyRIIIA, 200 and 800 nM (Fig. 16). The solid line represents the adaptation adaptation that was obtained based on the K off values calculated for the dissociation curves in intervals of 32-34 seconds. KD and Kapagado represent the calculated average of the two different concentrations of FcyRIIIA used. FIG. 17 is a real-time binding sense sensor of the fusion protein of Fc? RIIB-Fc to ch-4-4-20 antibodies having the variant Fc regions. The binding of the FcyRIIB fusion protein was analyzed at a concentration of 200 nM and the resonance signal responses were normalized to the level of response obtained for the ch-4-4-20 wild-type antibody. The kinetic parameters for the binding of the fusion protein of Fc? RIIB-Fc to antibodies ch-4.-4-20 was obtained by adapting the data obtained in two different concentrations of the fusion protein of Fc? RIIB-Fc, 200 and 800 nM (Fig. 18). The solid line represents the adaptation of association that was obtained based on the Kapagadl calculated for the dissociation curves in intervals of 32-34 seconds. KD and Kapagada represent the average of two different concentrations of Fc? RIIB-Fc fusion proteins used. The kinetic parameters (KenCendido and Kapagad0) that are determined from the BIAcore analysis correlate with the binding characteristic of the mutants as determined by an ELISA analysis and the functional activity of the mutants as determined in a CCDA analysis. Specifically, as seen in Table 17, the mutants that had increased CCDA activity relative to the wild-type protein and had an enhanced binding for Fc? RIIIA as determined by an ELISA analysis, had an off K for FcyRIIIA (that is, a lower Kapagada). Therefore, a lower Kapagada value pair Fc? RIIIA for a mutant Fc protein relative to a wild-type protein will likely have an enhanced CCDA function. On the other hand, as seen in Table 18, the mutants that had improved CCDA activity relative to the wild-type protein and had a reduced binding to the Fc? RIIB-Fc fusion protein as determined by an ELISA analysis. , observed an upper kapagada for the Fc? RIIB fusion protein. Therefore, the Kapaqada values for Fc? RIIIA and FcyRIIB can be used as predictive measures of how the mutant will behave in a functional analysis such as an ADCC analysis. In fact, the ratios of the quenched values for Fc? RIIIA and Fc? RIIB-Fc fusion protein of the wild-type protein mutants were plotted against CCDA data (Fig. 19). Specifically, in the case of Kapagada values for FcyRIIIA, the ratio of Kapagada (weight) / Kdpagacja (mutant) was plotted against the CCDA data; Y in the case of Kapagada values for Fc? RIIB, the ratio of Kapagada (Mut) / Kapagada (weight) to the CCDA data was plotted. Numbers greater than (1) show a decreased dissociation rate for Fc? RIIIA and an increased dissociation rate for Fc? RIIB-Fc relative to the wild type. Mutants that are within the indicated cell have a lower rate of decrease for Fc? RIIIA binding and a higher regimen for Fc? RIIB-Fc binding, and have improved CCAD function.

TABLE 17. KINETIC PARAMETERS OF FTRIIIa UNION CH4-4- 20Ab OBTAINED BY "SEPRADA ADAPTATION" OF UNION CURVES OF 200 Nm and 800Nm The highlighted mutants are not adapted to the group by ELISA or ADCC data.

TABLE 18. FcRIIB-FC KINETIC PARAMETERS THAT JOINS CH4- 4-20AB WILD AND MUTANT TYPE OBTAINED FROM THE "SEPARATE ADAPTATION" OF 200 NM AND 800 MM UNION CURVES. 6. 9 SCREENING FOR FC MUTANTS THAT USE MULTIPLE ENRICHMENT CYCLES USING A SOLID PHASE ANALYSIS The following mutant screens were made to identify additional groups of mutants that show enhanced binding to FcyRIIIA and reduced binding of Fc? RIIB. He Secondary screening of selected Fc variants was carried out by ELISA followed by the test for CCDA in the 4-4-20 system. Mutants were selected primarily based on their ability to mediate with CCDA via 4-4-20 using fluorescein-coated SK-BR2 cells as targets and PBMC from human donors as the effector cell population. Fc mutants that showed a relative increase in CCDA, for example, an increase by a factor of 2, were cloned into anti-HER2 / neu or anti-CD20 chABS and tested in a CCDA analysis using the appropriate tumor cells as targets . The mutants were also analyzed by Biacore and their relative Kapagada was determined.

Sieve 1: The deletion of sequential solid phase and selection using magnetic beads coated with Fc? RIIB followed by the magnetic beads coated with Fc? RIIa. The aid to this screen was the identification of Fc mutants that do not bind to Fc? RIIB or show reduced binding of Fc? RIIb. A 10-fold excess of the native bank (~ 10; cells) was incubated with magnetic beads ("My One", Dynal) coated with Fc? RIIB. The yeast bound to the beads is separated from the bound fraction by placing the tube containing the mixture in a magnetic field, the yeast cells that were not attached to the beads were removed and placed in fresh medium. Then you have to join pearls that were coated with Fc? RIIIa. The yeasts bound to the beads were separated from the unbound fraction by placing the tube containing the mixture in a magnetic field. The unbound yeasts were removed and the bound cells were removed by vigorous shaking. The recovered cells were grown in medium containing glucose and resuscitated in selective media containing galactose. The selection process is repeated. The final culture was used to collect DNA. The inserts containing the Fc domain were amplified by PCR and cloned into 4-4-20. Approximately 90 Fc mutants were screened by ELISA 4-4-20 and the CCDA analyzes are shown in Table 19.

TABLE 19. MUTANTS SELECTED BY SUPPRESSION OF SEQUENTIAL SOLID PHASE AND SELECTION USING MAGNETIC PEARLS COVERED WITH FCyRIIB FOLLOWED BY SELECTION WITH MAGNETIC PEARLS COVERED WITH FCyRIIIA, CHANGES OF MUTATING AMINO ACIDS Mutant Changes in amino acids MgFc37 K248M MgFc38 K392T, P396L MgFc39 E293V, Q295E, A327T MgFc41 H268N, P396LN MgFc43 Y319F, P352L, P396L D221E, D270E, V308A, Q311H, P396L, MgFc42 G402D 4 Screens 2 and 3: Mutants Selected by SCAF, Equilibrium and Sifted Kinetics: the first bank sieving identified a mutation at position 396, changing the amino acid from proline to leucine (P396L). This variant of Fc showed increased binding to FcyRIIIIa and Fc? RIIB. A second bank was built using P396L as a baseline. The mutagenesis by RC was used to generate ~ 107 mutants each of which contained mutation of P396L and additional nucleopéptidos changes. The P396L bank was sieved using two groups of conditions. An equilibrium sieve was made using biotinylated FcyRIIIA-interlayer-avitag as a monomer, using methods already described. Approximately a 10-fold excess of the bank (108 cells) was incubated in 0.5 ml of FcyRIIIA at approximately 7 nM for 1 hour. The mixture was classified tested SCAF, selecting up to 1.2% binders. The selected yeast cells were grown in selective medium containing glucose and reinserted into a galactose-containing selective medium. The equilibrium screening was repeated a second time and the classification gate was established to recover 0.2% of binders. The yeast cells were grown under selective conditions in glucose. This culture was used to collect DNA. The inserts containing the Fc domain were amplified by PCR and were cloned into the nucleotide sequence encoding 4-4-20 variable domain using methods already described. Approximately 90 Fc mutants were screened by ELISA 4-4-20 and CCDA and the resulting positive mutants are shown in Table 20.

TABLE 20. MUTANTS SELECTED BY SCAF USING AN EQUILIBRIUM SIZE WITH FcRIIIA CONCENTRATIONS OF APPROXIMATELY 7 NM.

Mutant Changes in amino acids MgFc43b K288R, T307A, K344E, P396L MgFc44 K334N, P396L MgFc46 P217S, P396L MgFc47 K210M P396L MgFc48 V379M, P396L MgFc49 K261N, K210M P396L MgFc60 P217S, P396L A kinetic screen was also implemented to identify mutants with Kapagad0 at the junction of FcyRIIIA. Conditions were established to screen the P396L bank using a strain with the P396L Fc variant shown on the yeast surface. The cells were briefly developed under inducing conditions where they were incubated with biotinylated Fc? RIIIA-interlacer-avitag O.lμM monomer for 1 hour. The cells were washed to remove the labeled ligand. The labeled cells were incubated for Different times with Fc? RIIIA-interlayer-unlabeled avitag O.lμM monomer were washed and then stained with EA: FE for SCAF analysis (Fig. 20). The cells were also stained with goat anti-human Fc to show that the Fc display was maintained during the experiment. Based on the competition study, it was determined that 1 minute of incubation resulted in approximately 50% loss of cell staining. This point in time was chosen for the kinetic sieve using the P396L bank. An approximately 10-fold excess of the bank (108 cells) was incubated with biotinylated Fc? RIIIA-interlacer-avitag O.lμM monomer in a volume of 0.5 ml. The cells were washed and then incubated for 1 minute with unmachined ligand. Subsequently, the cells were washed and labeled with EA: FE. The mixture was classified by SCAF, selecting 0. 3% of the binders at most. Yeast cells • selected were developed in selective media containing glucose and reinserted into selective media containing galactose. The kinetic screen was repeated a second time and the classification gate was established to recover 0.2% binders. The yeast cells were grown under selective conditions in glucose. This culture was used to collect DNA. Inserts containing the Fc domain were amplified by PCR and cloned into the nucleotide sequence encoding 4-4- variable domain. 20 using methods already described. Approximately 90 Fc mutants were screened by ELISA 4-4-20 and CCDA and the resulting positive mutants are shown in Table 21.

TABLE 21: MUTANTS SELECTED USING A KINETIC SIZE USING EQUIMAL QUANTITIES OF CD16A NOT MARKED FOR 1 MINUTE.

Mutant Changes in amino acids MgFc50 P247S, P396L MgFc51 Q419R, P396L MgFc52 V240A, P396L MgFc53 L410H, P396L MgFc54 F243L, V305I A378D, F404S, P396L MgFc55 R2551, P396L MgFc57 L242F, P396L MgFc59 K370E, P396L Screens 4 and 5: Combination of the Suppression Step Solid phase Fc? RIIIB with selection of Fc? RIIIA by Classification of SCAF using the 158V allele of Fc? RIIIA Analysis of Fc variants of Screen 1 showed that selected mutations of the secondary screen had enhanced binding for FcyRIIIa and Fc? RIIB . Therefore, the data suggested that sequential suppression and selection using magnetic beads (solid phase) under the established conditions did not efficiently select the differential binding of Fc? RIIIA and Fc? RIIB. Therefore, in order to more effectively sift the mutants that bind to FcyRIIA, while having reduced or no binding to Fc? RIIB, the depletion step of solid phase Fc? RIIB was combined with the selection of Fc? RIIIA by SCAF classification. This combination identified variants of Fc that bind to Fc? RIIIA with greater or equal affinity than Fc wild type. A 10-fold excess of the native bank (YO7) was incubated with magnetic beads coated with Fc? RIIB. The yeasts that are attached to the beads were separated from the unbound fraction by placing the tube containing the mixture in a magnetic field. The cells that were not attached to the beads were removed and placed in fresh medium and re-induced in galactose-containing medium. The depletion step of Fc? RIIB by magnetic beads was repeated 5 times. The resulting yeast population was analyzed and found to show more than 50% cell staining with goat anti-human Fc and a very small percentage of cells were stained with FcγRIIIA. These cells were screened twice by an SFAC classification using biotinylated Fc? RIIIA-interlayer-avitag O.lμM (data not shown). The Fc? RIIIA was the 158V allotype. The yeast cells were analyzed for Fc? RIIIA and Fc? RIIB by joining after each sorting and compared by binding to the wild-type Fc domain (Fig. 22 A-B).

The yeast cells selected from the second classification developed either ba or selective conditions in glucose. This culture was used to collect DNA. The inserts containing the Fc domain were amplified by PCR and cloned into the nucleotide sequence encoding the variable domain 4-4-20. Approximately 90 Fc mutants were screened by ELISA 4-4-20 and the CCDA analyzes are shown in Table 22. (mutants 61-66).

TABLE 22. MUTANTS SELECTED BY EXHAUST OF PEARLS MAGNETICS USING PEARLS COATED WITH CD32B AND SELECTION FINAL FOR SCAF USING FcyRIIIA, 158 VALINA OR 159 PHENYLALANIN Mutant Changes of amino acids MgFc61 A330V MgFc62 R292G MgFc63 S298N, K360R, N361D MgFc64 E233G MgFc65 N276Y MgFcdβ A330V, V427M MgFc67 V284M, S298N, K334E, R355, R416T Screening of Fc mutants using the 158F allele of Fc? RIIIA: there are two different Fc? RIIIA receptor alleles that have different binding affinities for the Fc IgGl domain (Koene et al., 1997, Blood 90: 1109-1114; Wu et al., 1997, J. Clin, Invest, 100: 1059-70). Allele 158F binds to the Fc domain with a binding constant 5-10 fold lower than the 158V allele. Previously all the screens of Fc using yeast display were performed using the 158V allele as a ligand. In this experiment, the Fc mutants were selected from the depleted yeast population of FcγRIIIB using biotinylated FcγRIIIA monomer 158F, interlacer-avitag as a ligand. The selection gate was established to select up to 0.25 percent of Fc? RIIIA 158F binders. The resulting enriched population was analyzed by SCAF (Fig. 22B). Then individual clones were isolated and their binding to different FcyRs were analyzed by SCAF (Fig. 22B). Analysis of individual clones of the population resulted in the identification of a single mutant having 5 MgFc67 mutations (V284M, S298N, K334E, R355W, R416S) that had an increased binding for Fc? RIIIA and a reduced binding for Fc? RIIB .

Secondary Mutant Screening for a CCDA Analysis for Sieves 1, 2, and 3: The mutants that were selected in the previous sieves were then analyzed using a normal CCDA analysis to determine the relative lysis regimes mediated by ch4-4- 20 containing the Fc mutants, Ch4-4-20 antibodies containing the Fc variants were constructed as the methods already described above. The SK-Br3 cells were used as targets and the effector cells were CMSF that were isolated from donors using a Ficoll gradient, as described above (Section 6.7). The results of CCDA activity for the mutants are summarized in Table 23. As seen in Table 23, mutants isolated using the previous primary and secondary screens based on the depletion of FcyRIIB and Fc? RIIIA showed increased CCDA activity in relationship with the wild type.

TABLE 23: ANALYSIS OF CCDA MEDIATED BY ANTIBODY ANTI-FLUORESCEIN 4-4-20 IN SKUBR3 CELLS COATED WITH FLUORESCEIN Mutant Changes in Relative Regimen of Amino Acids Lysis MgFc37 K248M 3.83 MgFc38 K392T P396L 3.07 MgFc39 E293V Q295E, A327T 4.29 MgFc 1 H268N P396LN 2.24 MgFc43 Y319F P353L, P396L 1.09 D221E D270E, V308A, Q311H P396L, MgFc42 G402D 3.17 MgFc43b K288R T307A, K344E, P396L 3.3 MgFc44 K334N P3961 2.43 MgFc46 P217S P396L 2.04 MgFc47 K210M 0396L 2.02 MgFc48 V379M P396L 2.01 MgFc49 K261N K210M, P396L 2.06 MgFc50 P247S P396L 2.1 MgFc51 Q419R P396L 2.24 MgFc52 V240A P396L 2.35 MgFc53 L410H P396L 2 MgFc54 F243L V305I, A378D, F404S P396L 3.59 MgFc55 R2551 P396L 2.79 MgFc57 L242F P396L 2.4 MgFc59 K370E P396L 2.47 MgFcdO P217S P396L 1.44 Mutants 37, 38, 39, 41, 43 were analyzed using 0.5 μg / ml ch4-420. All other antibodies were tested for 1 μg / ml. Regimens were normalized for IgGl ch4-4-20 wild type.

The mutants were additionally cloned into the heavy chain of anti-tumor monoclonal antibody 4D5 (anti-HER2 / neu) and anti-CD20 2H7 monoclonal antibody by replacing the Fc domain of these monoclonal antibodies. These chimeric monoclonal antibodies were expressed and purified and tested in a CCDA analysis using normal transfection methods in 293 H cells and purification on a protein G column. Chimeric 4D5 antibodies were tested in a CCDA assay using SK-BR3 cells as targets (Fig. 23), while 2H7 chimeric antibodies were tested in a CCDA analysis using Daudi cells as targets (Fig. 24).

Secondary Screening of Mutants via BIAcore: The mutants that were selected in the previous screens were analyzed by BIAcore to determine the kinetic parameters to bind Fc? RIIIA (158V) and FcyRIIB. The method used was similar to that described in Section 6.8 above. The data shown are Kapdgada values relative to wild-type quenched rates of experiments using the Fc mutants in the monoclonal antibody ch4-4-20.

Relative numbers greater than one indicate a decrease in Kapaga velocity a. Numbers less than one indicate an increase in the speed off. Mutants showing a decrease in off rates for FcyRIIIa were MgFc38 (K392T, P396L), MgFc43 (Y319F, P353L, P396L), MgFc42 (D221E, D270E, V308A, Q311H, P396L, G402D), MgFc43b (K288R, T30A, K344E , P396L), MgFc44 (K334N, P396L), MgFc4β (P217S, P396L), MgFc49 (K261N, K210M, P396L). Mutants that showed a decrease in off-rate for FqRIIIB were MgFc38 (K392T, P396L), MgFc 39 (E293V, Q295E, A327T); MgFc43 (Y319F, P353L, P396L), MgFc44 (K334N, P396L). The BIAcore data is summarized in Table 24.

TABLE 24: BIAcore DATA Fc Residues of Fc? RIIIA 158V Fc? RIIB Mutant amino acids (Kapagada / PeSO / (Kapaqada / Peso / Mut) Mut) MgFc37 K248M 0.977 1.03 MgFc38 K392T P396L 1.64 2.3 MgFc39 E293V Q295E, A327T 0.86 1.3 MgFc41 H268N P396LN 0.92 1.04 MgFc43 Y319F, P353L, P396L 1.23 2.29 D221E D270E, V308A, Q311H, P396L, MgFc42 G402D 1.38 MgFc43b K288R, T307A, K344E, P396L 1.27 0.89 MgFc44 K334N, P3961 1.27 1.33 MgFc46 P217S, P396L 1.17 0.95 MgFc47 K210M, 0396L MgFc 8 V379M, P396L MgFc49 K261N K210M, P396L 1.29 0.85 MgFc50 P247S P396L MgFc51 Q419R P396L MgFc52 V2 0A P396L MgFc53 L410H P396L MgFc54 F243L V305I, A378D, F404S P396L MgFc55 R2551 P396L MgFc57 L242F P396L MgFc59 K370E P396L MgFc60 P217S P396L MgFcdl A330V 1 0.61 MgFc62 R292G 1 0.67 MgFc63 S298N K360R, N361D 1 0.67 MgFc64 E233G 1 0.54 MgFc65 N276Y 1 0.64 MgFc66 A330V V427M 1 0.62 MgFc67 V284M S298N, K334E, R355W. R416T 6. 10 MIDDLE CCDA ANALYSIS BY CMSF MATERIALS AND METHODS Fc variants that show enhanced binding for Fc? RIIIA were tested by CCDA based on CMSF using an effector: target ratio of 60: 1. Two different tumor model systems were used as targets, SK-BR3 (anti-HER2 / neu) and Daudi (anti-CD20). The specific lysis was quantified for each mutant. Linear regression analysis was used to graph the data that establish the maximum percentage of lysis at 100%. CCDA was activated in effector cells of the immune system via a signal transduction pathway that is driven by an interaction between low affinity FcyR and an immune complex. The effector cell populations were derived from primary blood or activated monocyte-derived macrophages (MDM). The target cells were loaded with europium and incubated with chimeric MAb and subsequently incubated with effector cell populations. The europium works in the same way as 51Cr but is not radioactive and the europium released is detected in a fluorescent plate reader. Lymphocytes cultured from donor peripheral blood (MSF) using a Ficoll-Paque gradient (Pharmacia) contain primarily natural killer (NA) cells. most of CCDA activity will occur via the ANs that contain Fc? RIIIA but not Fc? RIIB on their surface. Experiments were performed using two different white cell populations, SK-Br-3 and Daudi, expressing HER2 / neu and CD20, respectively. The CCDA analyzes were established using ch4-4-20 / ITCF coated with SK-BR-3, Ch4D5 / SKBr3, and Rituxan / Daudi (data not shown). The chimeric MAbs were modified using identified Fc mutations. The Fc mutants were cloned into Ch4D5. Purified Ab was used to opsonize SK-Br-3 cells or Daudi cells. The Fc mutants were cloned into Ch4D5.

RESULTS The Fc mutants showed enhanced CMSF-mediated CCDA activity in SK BR3 cells (Fig. 27). The graph shows linear regression analysis of a normal CCDA analysis. The antibody was titrated on 3 graphs using an effector-to-white ratio of 75: 1,% lysis = (experimental release-SR) / (MR-SR) * 100. The Fc mutants showed improved CMSF-mediated CCDA activity in Daudi cells (Fig. 28). 6. 11 CCAD ANALYSIS BASED ON MACROPHATES DERIVED FROM MONOCYTES (MDM) The death of tumor cells dependent on FcyR is mediated by macrophages and AN cells in tumor mouse models (Clynes et al., 1998, PNAS USA, 95: 652-6) . The purified monocytes from donors were used as effector cells to analyze the efficiency of Fc mutants to drive the cell cytotoxicity of target cells in CCDA analysis. The expression patterns of Fc? RI, FqR3A and Fc? R2b are affected by different growth conditions. Expression of FcyR from frozen monocytes cultured in media containing different combinations of cytokines and serum was not examined by SCAF using FcR specific MAbs. (Fig. 29). The cultured cells were stained with FcyR-specific antibodies and analyzed by SCAF to determine FcyR profiles of MDM. Conditions that better mimic the expression of FcγR vivo of macrophages, i.e., showed the highest fraction of cells expressing 16 CDs and CD32B were used in a CCDA analysis based on monocyte-derived macrophages (MDM). For the experiment in Fig. 29, purified frozen monocytes were developed for 8 days in DMEM and 20% FBS containing M-CSF (Condition 1) or M-CSF (Condition 2). For the experiment in Fig. 30, purified monocytes were cultured for two days in DMEM and 20% FBS containing GM- CSF, IL-2 and IFNy before the analysis with CCDA. Serum-free conditions were also developed which allowed higher levels of CD16 and CD32B expression (data not shown). Briefly, purified monocytes were grown for 6-8 days in Macrophage-SFM (Invitrogen) containing GM-CSF, M-CSF, IL-6, IL-10, and IL-lβ. While the incidence of CD32B + / CD16 + cells in these cultures is higher using a mixture of cytokines, combinations of two or more cytokines will also improve the expression of FcyR (M-CSF / IL-6, MCSF / IL-10; -CSF (IL-lß) For analysis of CCDA, IFNr is added during the final 24-48 hours CCDA based on MDM required incubation times of> 16 hours to observe the death of target cells White cells were loaded with indium-111 which is retained for long incubations within the target cells Indium release was quantified using a gamma counter The other reagents, Abs and white cells were similar to CMSF based on CCDA analysis. CCDA due to Fc? RI can be efficiently blocked using the anti-FcRI blocking antibody (M21, Ancell) .The analysis conditions differ slightly from the analysis based on CMSF.With effector 20: 1; 18-14 hours of incubation at 37 ° C. Mutants were analyzed of Fc showing CCDA enhanced CMSF, increased binding to Fc? RIIIA or decreased binding to Fc? RIIB. (Fig. 30). 6. 12 EFFECT OF Fc MUTANTS ON COMPLEMENTARY ACTIVITY Fc mutants were originally identified based on their increased binding to FcyRIIIA. These mutants were subsequently validated for their improved affinity for all low affinity receptors and in many cases enhanced activity in CCAD mediated by CMSF. In vivo antibody mediated cytotoxicity can occur by multiple mechanisms. In addition to CCDA, other possible mechanisms include complement-dependent cytotoxicity (CDC) and apoptosis. The binding of Clq to the Fc region of an immunoglobulin initiates as a cascade resulting in cell lysis by CDC. The interaction between Clq and Fc has been studied in a series of Fc mutants. The results of these experiments indicate that Clq and the low affinity of FcR join to overlap regions of Fc, however, the exact contact residues vary within the Fc. Mutants that showed enhanced CCDA in the analysis based on CMSF were examined for their effect in CDC. Antibodies were analyzed in anti CD20 Ch-mAb. 2H7. We detected improved CDC for each mutant ch-mAb tested. Interestingly, although these mutants were selected for their enhanced CCAD they also show enhanced CDD.

MATERIALS AND METHODS CDC analysis was used to test the Fc mutants using anti-CD290 and Daudi cells as targets. Guinea pig serum from India was used as the source of complement (US Biological). The analysis . of CDC was similar to CCDA based on CMSF. The white cells were loaded with europium and ossified with ChjMab. However, the serum of guinea pigs was added complement instead of effector cells. Fig. 31 shows a flow graph of the analysis. It was titled antiCD20 ChMab about 3 orders of magnitude. , the% lysis was calculated, the Daudi cells (3xl06) were labeled with BADTA reagent, aliquots of lxlO4 cells were taken to place them in wells in a 96-well plate. The antibodies were titrated in the wells using 3 dilutions. The osonization reaction was allowed to proceed for 30-40 minutes at 37 ° C, at 5% C0. Subsequently, 100 uis of cell medium was added to the reaction and the cells were centrifuged. For detection, 20 uis of the supernatant was added to 200 uis of the europium solution and the plates were read in Victor 2 (Wallac).

RESULTS All mutants that show improved binding for Activating FcR or Clq were placed in the CDC analysis (Fig. 22). Fc mutants that showed improved binding to FcyRIIIa also showed enhanced complement activity. Each of the mutants shows enhanced complement activity compared to the wild type. The mutants tested are double mutants. In each case, one of the mutations present is P396L. To determine whether the increase in CDC correlates with the increased binding of Clq to IgGl, the Fc binding between the two proteins was measured in real time using surface plasmotropic resonance. In order to examine the binding between Clq and Fc IgGl, Fc variants were cloned into an anti-CD32B ch-MAb, 2B6. This allowed us to capture the weight and mutant antibodies on the glass slide via the soluble anti-CD32B protein (Fig. 34A)). Three of the four mutants tested in CDC were also examined in Biacore. All 3 showed improved Kapagada in large part compared to wild-type Fc (Fig. 34B). The Biacore format for Clq binding to 2B6 mutants demonstrates improved binding of mutants with P396L mutation (Fig. 35). The D270E mutation can reduce the binding of Clq to different degrees. A summary of the kinetic analysis of FcyR and Ciq binding is described in the following table 25.

TABLE 25: KINETIC ANALYSIS OF FcgR and UNION OF Clq A MUTANTE 2B6. 6. 13. DESIGNATION OF Fc VARIANTS WITH UNION DECREASE TO FcyRIIIB Based on the selection of Fc mutants that reduce the binding to Fc? RIIB and increases the binding to FcyRIIa 131H a number of mutations including D270E. Each mutation was individually tested to bind to the Fc receptors. of low affinity and its allelic variants. D270E had the binding characteristics that were suggested that could specifically reduce the binding of FcyRIIB. D270E was tested in combination with mutations that were previously identified based on their improved binding to FcR.

RESULTS As shown in Tables 26 and 27 and Figs. 36 and 37 in addition to the D270E mutation, it improves the binding of Fc? RIIIA and FcyRIIA Hl 31 and reduces the binding to FcyRIIB. Fig. 38 shows the data plot of MDC CCDA against Kapagada as determined for CD32A H131H by binding to selected mutants.

TABLE 26: ADDITION OF MUTATION D270E IMPROVES THE UNION OF FCYRIIIA AND FCYRIIA H131 AND REDUCES THE UNION OF FCYRIIB TABLE 27: KINETIC CHARACTERISTICS OF MUTANTS 4D5 The invention described and claimed herein should not be limited in scope by the specific embodiments described herein since these embodiments are intended as an illustration of various aspects of the invention. Any equivalent embodiment is intended to be within the scope of this invention. In addition, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Said modifications are intended to be within the scope of the appended claims. Through this application different publications were cited. Its contents are incorporated by reference in the present application in its entirety for any purpose.

Claims (48)

1. CLAIMS 1. - A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification in relation to a wild-type Fc region, such that said polypeptide can be linked to an Fc? R with an altered affinity in relation to a polypeptide comprising a wild type Fc region, provided that said modification of at least one amino acid is: (I) not only a substitution in any of positions 255, 258, 267, 269 , 270, 276, 278, 280, 283, 285, 289, 292, 293, 294, 295, 296, 300, 303, 305, 307, 309, 332, 329, 332, 331, 337, 338, 340, 373 , 376, 416, 419, 434, 435, 437, 438, 439; or (II) does not have: (a) an alanine in any of positions 256, 290, 298, 312, 333, 334, 359, 360, 326, or 430; (b) a lysine at position 330; (c) a threonine at position 339; (d) a methionine at position 320; (e) a serine, asparagine, aspartic acid, or glutamic acid at position 326; (f) a glutamine, glutamic acid, methionine, histidine, valine or leucine at position 334; (g) a lysine or glutamine at position 335; (h) an asparagine at position 268; (i) a glutamine at position 272; (k) a glutamine, serine, or aspartic acid at position 286; (1) a serine at position 290; (m) a methionine, glutamine, glutamic acid, or arginine at position 320; (n) a glutamic acid at position 322; or (0) a methionine at position 301. 2. A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that the polypeptide binds specifically to Fc? RIIIA with a higher affinity with which a comparable polypeptide comprising the wild-type Fc region binds to Fc? RIIIA, provided that said modification of at least one amino acid is : (1) not only a substitution at positions 329, 331, or 332, or (II) does not have: (a) an alanine in any of positions 256, 290, 298, 312, 333, 334, 359, 360, 326, or 430; (b) a lysine at position 330; (c) a threonine at position 339; (d) a methionine at position 320; (e) a serine, asparagine, aspartic acid, or glutamic acid at position 326; (f) a glutamine, glutamic acid, methionine, histidine, valine or leucine at position 334; (g) a lysine or glutamine at position 335. 3. The polypeptide according to claim 2, wherein at least said amino acid modification comprises a group of substitutions selected from the group consisting of substitution in: (1) position 339 with valine and at position 347 with histidine; (2) position 251 with proline and position 415 with isoleucine; (3) position 185 with methionine, at position 218 with asparagine, at position 292 with leucine and at position 399 with glutamic acid; (4) position 290 with proline and position 142 with proline; (5) position 141 with valine, at position 268 with leucine, at position 288 with glutamic acid and at position 291 with serine; (6) position 133 with methionine, at position 149 with tyrosine, at position 205 with glutamic acid, at position 334 with asparagine, and at position 384 with lysine; (7) position 125 with leucine, in position 215 with isoleucine, and at position 408 with isoleucine; (8) position 395 with isoleucine; (9) position 247 with histidine or leucine; (10) position 396 with histidine or leucine; (11) position 392 with arginine; (12) position 415 with isoleucine and at position 251 with phenylalanine; (13) position 301 with cysteine, at position 252 with leucine and at position 192 with threonine; (14) position 315 with isoleucine; (15) position 132 with isoleucine; (16) position 162 with valine; (17) position 348 with methionine, in position 334 with asparagine, at position 275 with isoleucine, at position 202 with methionine, and at position 147 with threonine; (18) position 310 with tyrosine, in position 289 with alanine, and in position 337 with glutamic acid; (19) position 119 with phenylalanine, at position 371 with serine, at position 407 with valine and at position 258 with aspartic acid; (20) position 409 with arginine and position 166 with asparagine; (21) position 408 with isoleucine, at position 215 with isoleucine and at position 125 with isoleucine; (22) position 385 with glutamic acid and in position 247 with histidine; (23) position 379 with methionine; (24) position 219 with tyrosine; (25) position 282 with methionine; (26) position 276 with isoleucine, at position 334 with asparagine, and at position 348 with methionine; (27) position 401 with valine; (28) position 280 with leucine and in position 395 with serine; (29) position 222 with asparagine; (30) position 246 with threonine and position 319 with phenylalanine; (31) position 243 with isoleucine and at position 379 with leucine; (32) position 246 with threonine and in position 396 with histidine; (33) position 268 with aspartic acid and at position 318 with aspartic acid; (34) position 288 with asparagine, in position 330 with serine, and in position 396 with leucine; (35) position 243 with leucine, in position 255 with leucine, and in position 318 with lysine; (36) position 334 with glutamic acid, at position 359 with asparagine, and at position 366 with serine; (37) position 377 with phenylalanine; (38) position 334 with isoleucine; (39) position 244 with histidine, at position 358 with methionine, at position 379 with methionine, at position 384 with lysine, and at position 378 with methionine; (40) position 217 with serine, at position 378 with valine and at position 408 with arginine; (41) position 247 with leucine, in position 253 with asparagine and in position 334 with asparagine; (42) position 288 with methionine and in position 334 with glutamic acid; (43) position 334 with glutamic acid and in position 380 with aspartic acid; (44) position 256 with serine, at position 305 with isoleucine, at position 334 with glutamic acid and at position 390 with serine; (45) position 372 with tyrosine; (46) position 246 with isoleucine and at position 334 with asparagine; (47) position 335 with asparagine, at position 370 with glutamic acid, at position 378 with glutamic acid, at position 394 with methionine, and at position 424 with leucine; (48) position 320 with glutamic acid and position 326 with glutamic acid; (49) position 224 with leucine; (50) position 375 with cysteine and position 396 with leucine; (51) position 233 with aspartic acid and at position 334 with glutamic acid; and (52) position 334 with glutamic acid, at position 359 with asparagine, at position 366 with serine and at position 386 with arginine. 4. A polypeptide characterized in that it comprises a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification in relation to a wild-type Fc region such that the polypeptide specifically binds to Fc? RIIIA with a higher affinity with which a comparable polypeptide comprising the wild-type Fc region binds to Fc? RIIIA and said polypeptide further binds specifically to Fc? RIIIB with a lower affinity with that a comparable polypeptide comprising the region of wild-type Fc binds to an Fc? RIIIB, as long as the variant Fc region does not have an alanine at any of positions 256, 298, 333 or 334. 5. The polypeptide according to claim 1 or 2, wherein said amino acid modification comprises at least one amino acid modification in the CH2 domain of the Fc region. 6. The polypeptide according to claim 5, wherein said amino acid modification comprises the substitution of Pro 247 with another amino acid in the same position. 7. The polypeptide according to claim 1 or 2, wherein said amino acid modification comprises at least one amino acid modification in the CH3 domain of the Fc region. 8. The polypeptide according to claim 7, wherein said amino acid modification comprises the substitution at position 396 with another amino acid in the same position. 9. The polypeptide according to claim 1 or 2, wherein said amino acid modification comprises at least one amino acid modification in the CH2 domain and at least one amino acid modification in the CH3 domain of the amino acid region. Fc. 10. The polypeptide according to claim 5, wherein said amino acid modification in the CH2 domain comprises substitution in the position 251, 292, 268, 288, 291, or 247 with another amino acid in the same position. 11. The polypeptide according to claim 7, wherein said amino acid modification in the CH3 domain it comprises substitution at position 347, 415, 399, 383, 384, 407, 395, or 396 with another amino acid in the same position. 12. The polypeptide according to claim 9, wherein it comprises at least one amino acid modification in the axis region of the Fc region. 13. The polypeptide according to claim 1 or 2, wherein said amino acid modification comprises at least one amino acid claim in the axis region of the Fc region. 14. The polypeptide according to any of claims 1, 2, or 4, wherein the Fc region of the parent polypeptide is a Fc region of human IgG. 15. The polypeptide according to claim 14, wherein the Fc region of human IgG is an Fc region of IgG1, IgG2, IgG3, or human IgG4. 16. The polypeptide according to claim 1, 2, or 4, wherein said polypeptide is an antibody. 17. The antibody according to claim 16, wherein said antibody is a monoclonal antibody, a humanized antibody, or a human antibody. 18. - A nucleic acid characterized in that it comprises a nucleotide sequence encoding the polypeptide of any of claims 1 or 2. 19. A therapeutic antibody that specifically binds to a cancer antigen, said therapeutic antibody characterized in that it comprises an Fc region. variant, wherein the variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, such that said therapeutic antibody that specifically binds to Fc? RIIIA with a higher affinity with which the therapeutic antibody comprising the wild-type Fc region binds to Fc? RIIIA, provided that said modification of at least one amino acid is: (a) not only a substitution at positions 329, 331, or 332, or (b) does not have: (i) an alanine in any of the positions 256, 290, 298, 312, 333, 334, 359, 360, or 430; (ii) a lysine at position 330; (iii) a threonine at position 339; (iv) a methionine at position 320; (v) a serine, asparagine, aspartic acid or a glutamic acid at position 326; (vi) a glutamine, a glutamic acid, a methionine, a histidine, a valine or a leucine at position 334. 20. A therapeutic antibody that specifically binds to a cancer antigen, said therapeutic antibody characterized in that it comprises a region of variant Fc, wherein said variant Fc region comprises at least one amino acid modification in relation to a wild-type Fc region, such that said therapeutic antibody, specifically binds to Fc? RIIIA with a higher affinity with the that a therapeutic antibody comprising the wild-type Fc region binds to Fc? RIIIA, and said therapeutic antibody binds specifically to Fc? RIIB with a lower affinity with which a therapeutic antibody comprising wild-type Fc binds to Fc? RIIB, provided that said variant Fc region not only has one alanine in any of positions 256, 298, 333, or 334. 21. The therapeutic antibody according to claim 26 or 27, wherein the cancer antigen is MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, N-acetylglucosaminyltransferase, pl5, beta-catenin, MUM-1, CDK4, HER-2 / neu, human papilloma virus-E6, human papillomavirus-E7, or MUC-1. 22. A pharmaceutical composition characterized in that it comprises a pharmaceutically acceptable carrier and a therapeutically effective amount of one or more of (i) the polypeptides of claims 1 or 2; or (ii) one or more of the antibodies of claims 17, 18, 26 or 27. 23. The pharmaceutical composition according to claim 19 or 20, further characterized in that it comprises one or more additional anticancer agents. 24. The pharmaceutical compositions according to claim 23, wherein said anticancer agents is a chemotherapeutic agent, a radiation therapeutic agent, a hormonal therapeutic agent, or an immunotherapeutic agent. 25. A nucleic acid characterized in that it comprises a nucleotide sequence encoding a heavy chain of an antibody of claim 16. 26.- The use of a therapeutically effective amount of one or more of the antibodies of claims 16, 19 or 20, to treat or manage cancer in a patient having a cancer characterized by an antigen for cancer. 27. - The use of a therapeutically effective amount of a molecule comprising a variant Fc region for treating an autoimmune disorder in a patient in need thereof, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, said molecule binds specifically to Fc? RIIB with a higher affinity than a comparable molecule comprising the wild type Fc region, and said molecule binds specifically to Fc? RIIIA with a lower affinity to a comparable molecule comprising the wild-type Fc region. 28. The use of said therapeutically effective amount of a molecule comprising a variant Fc region of claim 27, wherein the autoimmune disorder is rheumatoid arthritis, psoriatic arthritis, ankylosing spondylites, Rieter syndrome, psoriasis, or lupus erythematosus. 29. The use of a therapeutically effective amount of a molecule comprising a variant Fc region for treating an infectious disease in a patient in need thereof, wherein said variant Fc region comprises at least one amino acid modification in relationship with a wild type Fc region, such that said molecule binds specifically to Fc? RIIIB with a higher affinity than a comparable molecule comprising the wild-type Fc region, and said molecule further binds specifically to RcyRIIIA with an affinity of less than one to that of a comparable molecule comprising the wild-type Fc region. 30. The polypeptide according to claim 1 or 2, wherein the polypeptide specifically binds to Fc? RIIIA with a higher affinity with which a comparable polypeptide comprising the wild-type Fc region binds to Fc? RIIA. 31. The antibody according to claim 16, further characterized in that said antibody binds specifically to Fc? RIIIA with a higher affinity with which a comparable antibody comprising the wild-type Fc region binds to Fc? RIIIA. 32. A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification in relation to a wild-type Fc region, such that the polypeptide specifically binds to Fc? RIII with a higher affinity than that of a comparable polypeptide comprising the wild type Fc region, and said polypeptide further binds specifically to Fc? RIIb with a lower affinity with which a comparable polypeptide comprising the wild-type Fc region is joins Fc? RIIB, where said amino acid modification comprises a group of substitutions selected from the group consisting of a substitution in: (1) position 243 with isoleucine and position 379 with leucine; (2) position 288 with asparagine, in position 330 with serine and in position 396 with leucine; (3) position 243 with leucine and position 255 with leucine; (4) position 288 with methionine and at position 334 with glutamic acid; (5) position 316 with aspartic acid, at position 378 with valine and at position 399 with glutamic acid; (6) position 315 with isoleucine, at position 379 with methionine and at position 399 with glutamic acid; (7) position 243 with isoleucine, at position 379 with leucine and at position 420 with valine; (8) position 392 with threonine and in position 396 with leucine; (9) position 293 with valine, at position 295 with glutamic acid and at position 327 with threonine; (10) position 268 with asparagine and at position 396 with leucine; (11) position 319 with phenylalanine, at position 352 with leucine and at position 396 with leucine; (12) position 248 with methionine; (13) position 247 with leucine and in position 420 with valine; (14) at position 334 with glutamic acid and at position 292 with leucine. 33. The polypeptide according to claim 32, wherein the antibody has an increased CCDA activity relative to a comparable antibody comprising the wild-type Fc region. 34.- A polypeptide comprising a variant Fc region, wherein the variant Fc region comprises a substitution at position 396 with leucine, and at least one amino acid modification, wherein at least one amino acid modification comprises substitution in: (a) position 255 with leucine; (b) position 370 with glutamic acid; (c) position 392 with threonine; (d) position 221 with glutamic acid, position 270 with glutamic acid, position 308 with alanine, position 311 with histidine, and position 402 with aspartic acid; and (e) position 243 with leucine, position 305 with isoleucine, position 378 with aspartic acid and position 404 with serine. 35. A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification, wherein said amino acid modification comprises substitution at position 284 with methionine, at position 298 with asparagine, at position 334 with glutamic acid, at position 355 with tryptophan and at position 416 with threonine. 36. A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification in relation to a wild type Fc region, such that said polypeptide is bound to an Fc? R with an altered affinity in relation to a polypeptide comprising a wild-type Fc region, provided that said amino acid modification is not in the Fc-Fc? R interface region. 37.- A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification in relation to a wild type Fc region, such that said polypeptide has an altered CDC activity in relation to a polypeptide comprising a wild type Fc region, provided that at least said amino acid modification is not in the Fc-Fc? R interface region. 38.- A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification in relation to a wild-type Fc region, such that the polypeptide has a CCDA activity altered in relation to a polypeptide comprising a wild type Fc region, provided that at least one amino acid modification is not in the Fc-Fc? R interface region. 39.- The polypeptide according to claim 37, wherein the polypeptide further has an altered CCDA activity. 40. The polypeptide according to claim 36, further characterized in that the polypeptide has an enhanced CDC activity so that the polypeptide has an improved binding affinity of Clq. 41. The polypeptide according to claim 37, further characterized in that the CDC activity is improved so that the polypeptide has an improved binding affinity of Clq. 42.- The polypeptide according to claim 36, wherein the polypeptide has a improved CDC activity in such a way that the binding affinity to Clq is not altered. 43. The polypeptide according to claim 37, wherein the CDC activity is improved so that the binding affinity to Clq is not altered. 44. A polypeptide characterized in that it comprises a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification, wherein at least said amino acid modification comprises substitution in: (a) position 247 with leucine; at position 421 with lysine and at position 270 with glutamic acid; (b) position 419 with histidine, at position 396 with leucine, and at position 270 with glutamic acid; (c) position 370 with glutamic acid, at position 396 with leucine and at position 270 with glutamic acid; (d) position 255 with leucine, at position 396 with leucine and at position 270 with glutamic acid; (e) position 240 with alanine, at position 396 with leucine and at position 270 with glutamic acid; (f) position 392 with threonine, at position 396 with leucine and at position 270 with glutamic acid; (g) position 292 with proline and position 305 with isoleucine; (h) position 270 with glutamic acid, at position 316 with aspartic acid and at position 416 with glycine; and (i) position 284 with methionine, at position 292 with leucine and at position 370 with asparagine. 45. A polypeptide characterized in that it comprises a variant Fc region, wherein the variant Fc region comprises at least one amino acid modification relative to a wild type Fc region, such that said polypeptide is bound to an Fc? R with an altered affinity compared to a polypeptide comprising the wild-type Fc region, wherein at least one amino acid modification is in the CH1 domain of the Fc region. 46.- The polypeptide according to claim 45, wherein the polypeptide is an antibody. 47. The polypeptide according to claim 46, wherein the antibody has an enhanced CCDA activity relative to a comparable antibody comprising the wild-type Fc region. 48. The polypeptide according to claim 46, wherein the antibody has an enhanced CDC activity relative to a comparable antibody comprising the wild-type Fc region.