LU601702B1 - Coccidioides albicans strain LQB-025 and its application - Google Patents
Coccidioides albicans strain LQB-025 and its applicationInfo
- Publication number
- LU601702B1 LU601702B1 LU601702A LU601702A LU601702B1 LU 601702 B1 LU601702 B1 LU 601702B1 LU 601702 A LU601702 A LU 601702A LU 601702 A LU601702 A LU 601702A LU 601702 B1 LU601702 B1 LU 601702B1
- Authority
- LU
- Luxembourg
- Prior art keywords
- lqb
- strain
- coccidioides
- albicans
- rice
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01M—CATCHING, TRAPPING OR SCARING OF ANIMALS; APPARATUS FOR THE DESTRUCTION OF NOXIOUS ANIMALS OR NOXIOUS PLANTS
- A01M1/00—Stationary means for catching or killing insects
- A01M1/02—Stationary means for catching or killing insects with devices or substances, e.g. food, pheronones attracting the insects
- A01M1/04—Attracting insects by using illumination or colours
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01M—CATCHING, TRAPPING OR SCARING OF ANIMALS; APPARATUS FOR THE DESTRUCTION OF NOXIOUS ANIMALS OR NOXIOUS PLANTS
- A01M1/00—Stationary means for catching or killing insects
- A01M1/10—Catching insects by using Traps
- A01M1/106—Catching insects by using Traps for flying insects
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
- A01P7/00—Arthropodicides
- A01P7/04—Insecticides
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Pest Control & Pesticides (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Environmental Sciences (AREA)
- Insects & Arthropods (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Health & Medical Sciences (AREA)
- Agronomy & Crop Science (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Virology (AREA)
- Dentistry (AREA)
- Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Catching Or Destruction (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Die vorliegende Erfindung bezieht sich auf das technische Gebiet der biologischen Bekämpfung von Pflanzenschädlingen und insbesondere auf einen Coccidioides albicans-Stamm LQB-025 und seine Anwendung. Der durch die vorliegende Erfindung bereitgestellte Stamm wurde am 30. März 2016 im General Microbiology Centre des China Microbial Strain Deposit Management Committee mit der Hinterlegungsnummer CGMCC Nr. 12110 hinterlegt.Die vorliegende Erfindung sieht auch die Anwendung des Coccidioides albicans-Stammes LQB-025 bei der Bekämpfung des Reisstengelbohrers und des Reiskäfers sowie bei der Herstellung von Insektiziden vor. Der Coccidioides albicans-Stamm LQB-025, der durch die vorliegende Erfindung bereitgestellt wird, ist in der Lage, gleichzeitig eine hohe Pathogenität gegen den Reisstängelbohrer und den Reisrüssler aufzuweisen, und verbessert die Vorbeugungs- und Bekämpfungswirkung gegen den Reisstängelbohrer und den Reisrüssler erheblich.The present invention relates to the technical field of biological control of plant pests and, in particular, to a Coccidioides albicans strain LQB-025 and its application. The strain provided by the present invention was deposited on March 30, 2016, with the General Microbiology Centre of the China Microbial Strain Deposit Management Committee under deposit number CGMCC No. 12110. The present invention also provides for the application of the Coccidioides albicans strain LQB-025 in the control of the rice stem borer and the rice weevil, as well as in the production of insecticides. The Coccidioides albicans strain LQB-025 provided by the present invention is capable of simultaneously exhibiting high pathogenicity against both the rice stem borer and the rice weevil, and significantly improves the preventive and control effects against these pests.
Description
Coccidioides albicans Stamm LQB-025 und seine Anwendung LU601702Coccidioides albicans strain LQB-025 and its application LU601702
Technischer BereichTechnical area
Die vorliegende Erfindung bezieht sich auf das technische Gebiet der biologischenThe present invention relates to the technical field of biological
Bekämpfung von Pflanzenschädlingen, insbesondere auf den Coccidioides albicans-Stamm LQB- 025 und dessen Anwendung.Control of plant pests, especially on the Coccidioides albicans strain LQB-025 and its application.
Technologie im HintergrundTechnology in the background
Der Stängelbohrer (Chilo suppressalis Walker), der zur Familie der Schmetterlinge (Lepidoptera) gehört und allgemein als Herzwurm, Stängelbohrer usw. bekannt ist, ist einer der schwerwiegendsten Schädlinge an Reis in China. Neben Reis kann der Stängelbohrer auchThe stemworm (Chilo suppressalis Walker), belonging to the butterfly family (Lepidoptera) and commonly known as the heartworm, stem borer, etc., is one of the most serious pests of rice in China. Besides rice, the stemworm can also infest other plants.
Wildreis, Mais, Sorghum, Zuckerrohr, Raps, Ackerbohnen, Weizen sowie Schilf, Scheunengras,Wild rice, maize, sorghum, sugar cane, rapeseed, broad beans, wheat, as well as reeds and barn grass.
Lees Gras und andere Unkräuter schädigen. Die Larven des Stängelbohrers verursachen Schäden an verwelkten Blattscheiden, verwelkten Sämlingen und weißen Ähren, indem sie dieLees grass and other weeds are damaged. The stem borer larvae cause damage to wilted leaf sheaths, withered seedlings, and white ears by feeding on the
Blattscheiden, Herzblätter und Stängel von Reis befallen, und in der Reifezeit schädigen sie dieLeaf sheaths, heart leaves and stems of rice are infested, and during the ripening period they damage the
Pflanze durch halbfaule Stacheln, was zu erheblichen Ertragseinbußen führt. Der Stängelbohrer kann die Reiserträge in der Regel um 5-10 % verringern, in schweren Fällen sogar um 20-30 %.The plant is damaged by semi-rotten thorns, leading to significant yield losses. The stem borer can typically reduce rice yields by 5-10%, and in severe cases by as much as 20-30%.
Reis Wasser Rüsselkäfer (Lissorhoptrus oryzophilus Kuschel) gehört zu Coleoptera,Rice water weevil (Lissorhoptrus oryzophilus Kuschel) belongs to Coleoptera,
Rüsselkäfer Familie, Sumpf Rüsselkäfer Unterfamilie, Reis Wasser Rüsselkäfer Gattung, vor allem für das Wachstum von Reis und anderen Getreidepflanzen, die erwachsenen nagen an denWeevil family, marsh weevil subfamily, rice water weevil genus, primarily responsible for the growth of rice and other cereal crops; the adults feed on the
Blättern des Reises, Larven ernähren sich von den Reiswurzeln, mit einer langen Zeit derLeaves of rice; larvae feed on the rice roots, with a long period of time.
Beschädigung, Reproduktion und Verbreitung von schnell, resistent gegen Drogen und Widerstand und andere Merkmale. In der Regel durch Reis verursacht Ertragsminderung von 15-20 Prozent, schwerwiegende Ertragsminderung von mehr als 50 Prozent, oder sogar das Aussterben, ist ein wichtiger Quarantäneschädling auf Reis, ernsthafte Auswirkungen auf das Wachstum und dieDamage, reproduction, and spread rapidly; resistant to drugs and other characteristics. Typically causes rice yield reductions of 15-20 percent, severe yield reductions of more than 50 percent, or even extinction; is a major quarantine pest of rice, with serious impacts on growth and...
Entwicklung von Reis und Reisproduktion, Reis Rüsselkäfer hat sich zu einer großen potenziellenDevelopment of rice and rice production, rice weevil has become a major potential threat
Bedrohung für Chinas Reisproduktion, China wird als einer der wichtigsten, um die Prävention und Kontrolle der fünf invasiven fremden Organismen in den letzten Jahren zu stärken aufgeführt.Threat to China's rice production, China is listed as one of the most important countries to strengthen the prevention and control of the five invasive alien organisms in recent years.
Gegenwärtig basiert die Bekämpfung von Reiszünsler und Reiskäfer im Reisanbau hauptsächlich auf chemischer Bekämpfung. Der langfristige Einsatz von Chemikalien führt jedoch nicht nur dazu, dass die Schädlinge gegen eine Vielzahl der gängigen Insektizide resistent werden, sondern auch zu häufigen Ausbrüchen von Stängelbohrer und Reiskäfer, was zu einem kontinuierlichen Anstieg des Medikamenteneinsatzes führt. Darüber hinaus wird durch denCurrently, the control of rice weevils and rice pole beetles in rice cultivation is primarily based on chemical control. However, the long-term use of chemicals not only leads to the pests developing resistance to a wide variety of common insecticides, but also to frequent outbreaks of stem borers and rice pole beetles, resulting in a continuous increase in the use of medications. Furthermore, the
Einsatz von Chemikalien auch die Umwelt verschmutzt, was der Nachhaltigkeit der landwirtschaftlichen Produktion nicht zuträglich ist. Daher ist es von großer Bedeutung, eine umweltfreundliche, schadstofffreie und hocheffiziente biologische Bekämpfungsmethode zu finden, die gleichzeitig zwei Reisschädlinge bekämpfen kann.The use of chemicals also pollutes the environment, which is detrimental to the sustainability of agricultural production. Therefore, it is of great importance to find an environmentally friendly, non-toxic, and highly efficient biological control method that can simultaneously combat two rice pests.
Beauveria Bassiana ist ein Fadenpilz, der zur Gattung Beauveria spp. im UnterstammBeauveria bassiana is a filamentous fungus belonging to the genus Beauveria spp. in the subphylum
Deuteromycotina, Klasse Hyphomycetes, Ordnung Moniliales, Familie Moniliaceae gehört.Deuteromycotina, class Hyphomycetes, order Moniliales, family Moniliaceae.
Beauveria spp. ist ein entomopathogener Breitspektrum-Pilz, der sich hauptsächlich ungeschlechtlich vermehrt, indem er Konidien produziert, aber auch sexuell, um Fruchtkörper zu bilden. C. albicans hat eine starke Pathogenität, kann Epidemien unter den Wirten auslösen, verschmutzt die Umwelt nicht und ist leicht in großem Maßstab zu produzieren, weshalb C. albicans weithin bei der Schädlingsbekämpfung in der landwirtschaftlichen Produktion eingesetzt wird und ein sehr effizientes mikrobielles Insektizid ist. C. albicans hat eine gewisseBeauveria spp. is a broad-spectrum entomopathogenic fungus that reproduces primarily asexually by producing conidia, but also sexually to form fruiting bodies. C. albicans has strong pathogenicity, can cause epidemics among its hosts, does not pollute the environment, and is easy to produce on a large scale. Therefore, C. albicans is widely used in pest control in agricultural production and is a very efficient microbial insecticide. C. albicans has a certain
Wirtsspezialisierung, Studien haben gezeigt, dass verschiedene Herkunftsregionen, verschiedeneHost specialization: Studies have shown that different regions of origin, different
Wirtsquellen von Stämmen von Schädlingen auf das Ziel der Pathogenität der Unterschied ist sehr signifikant, verschiedene Stämme der tödlichen Zeit (LT90) kann mehrere Male auf zehn Mal dé/601 702Host sources of strains of pests on the target pathogenicity; the difference is very significant; different strains of lethal time (LT90) can vary several times to ten times. dé/601 702
Unterschied.Difference.
Derzeit, wenn die Verwendung von C. albicans für die Schädlingsbekämpfung vor Ort, ist es oft wegen der Herstellung von entsprechenden spezialisierten Stämme für verschiedene Ziel-Currently, when C. albicans is used for on-site pest control, it is often due to the production of appropriate specialized strains for different target groups.
Schädlinge, die Unannehmlichkeiten zu einem gewissen Grad verursacht und ist nicht förderlich für die Anwendung von C. albicans für die weitere Förderung der biologischen Kontrolle.Pests that cause inconvenience to a certain degree and are not conducive to the application of C. albicans for further promoting biological control.
In Anbetracht dessen wird die vorliegende Erfindung vorgeschlagen.In light of this, the present invention is proposed.
Inhalt der ErfindungContent of the invention
Ein erstes Ziel der vorliegenden Erfindung ist es, einen Stamm LQB-025 von Coccidioides albicans bereitzustellen, der in der Lage ist, gleichzeitig eine hohe Pathogenität gegen denA first objective of the present invention is to provide a strain LQB-025 of Coccidioides albicans that is able to simultaneously exhibit high pathogenicity against the
Reisschädlingsstängelbohrer und den Reiswasserrüssler zu haben, der in der Lage ist, dieto have rice stem borers and rice water weevils, which are capable of the
Vorbeugung und den Bekämpfungseffekt gegen den Reisschädlingsstängelbohrer und denPrevention and control effect against the rice stem borer and the
Reiswasserrüssler wesentlich zu verbessern, und der biologisch gut charakterisiert, umweltfreundlich, nicht verschmutzend und nicht leicht zu einer Arzneimittelresistenz zu führen ist.to significantly improve the rice water weevil, and which is biologically well characterized, environmentally friendly, non-polluting and not easily led to drug resistance.
Um den oben genannten Zweck zu erreichen, ist die technische Lösung, die in der vorliegenden Erfindung angenommen wird, wie folgt:To achieve the above-mentioned purpose, the technical solution adopted in the present invention is as follows:
Ein Coccidioides albicans-Stamm LQB-025, wobei der Coccidioides albicans-Stamm LQB- 025 am 30. März 2016 im General Microbiology Centre of China Microbial Species DepositA Coccidioides albicans strain LQB-025, where the Coccidioides albicans strain LQB-025 was discovered on March 30, 2016, at the General Microbiology Centre of China Microbial Species Deposit
Management Committee hinterlegt wurde, mit der Hinterlegungsnummer CGMCC No. 12110.The deposit was made with the Management Committee under deposit number CGMCC No. 12110.
Ferner zeigt die Koloniekultur des Coccidioides albicans-Stammes LQB-025 im Frühstadium ein flauschiges Aussehen und bildet später eine cremig-pulvrige Sporenschicht mit gleichmäßigerFurthermore, the colony culture of the Coccidioides albicans strain LQB-025 shows a fluffy appearance in the early stage and later forms a creamy-powdery spore layer with uniform
Dicke der Sporenschicht, die in der Mitte leicht erhaben ist; das Myzel ist hyalin mit Entmischung und Verzweigung und ist farblos und glatt; der Konidienstiel ist meist flaschenförmig und steht entweder einzeln oder in Gruppen; und das Konidium ist einzellig, farblos und kugelförmig oder oval mit einer Größe von 2 - 3 um x 2 - 2,5 um.Thickness of the spore layer, which is slightly raised in the middle; the mycelium is hyaline with segregation and branching and is colorless and smooth; the conidium stalk is usually flask-shaped and occurs either singly or in groups; and the conidium is unicellular, colorless and spherical or oval, measuring 2-3 µm x 2-2.5 µm.
Verwendung des oben genannten Coccidioides albicans Stammes LQB-025 bei derUse of the above-mentioned Coccidioides albicans strain LQB-025 in the
Bekämpfung des Stängelbohrers.Control of the stem borer.
Verwendung des oben genannten Coccidioides albicans-Stammes LQB-025 bei derUse of the above-mentioned Coccidioides albicans strain LQB-025 in the
Bekämpfung des Reiswasserrüsslers.Control of the rice weevil.
Verwendung des oben genannten Coccidioides albicans-Stammes LQB-025 bei derUse of the above-mentioned Coccidioides albicans strain LQB-025 in the
Herstellung von Insektiziden.Production of insecticides.
Fügen Sie ein oder mehrere Dispergiermittel, Benetzungsmittel, Emulgatoren, Entschäumer,Add one or more dispersants, wetting agents, emulsifiers, defoamers,
Regulator usw. als Hilfsmittel oder Adsorptionsträger in das Pulver aus Coccidioides albicans-Regulator etc. as an aid or adsorption carrier in the powder from Coccidioides albicans-
Sporenpulver ein, das in einem bestimmten Verhältnis gemischt wird, und verarbeiten Sie es dann zu Pulver, benetzbarem Pulver, Suspensionsmittel oder Mikropartikelmittel.Spore powder is mixed in a specific ratio and then processed into powder, wettable powder, suspension agent or microparticle agent.
Der Gehalt an Konidien des Coccidioides albicans-Stammes LQB-025 in dem Insektizid beträgt 40-10 Milliarden Sporen/g des Fungizids.The content of conidia of the Coccidioides albicans strain LQB-025 in the insecticide is 40-10 billion spores/g of the fungicide.
Die vorteilhaften Wirkungen der vorliegenden Erfindung im Vergleich zum Stand der Technik sind: (1) Der Coccidioides albicans-Stamm LQB-025, der durch die vorliegende Erfindung bereitgestellt wird, ist ein Coccidioides albicans-Stamm mit hoher Pathogenität für denThe advantageous effects of the present invention compared to the prior art are: (1) The Coccidioides albicans strain LQB-025 provided by the present invention is a Coccidioides albicans strain with high pathogenicity for the
Reisstängelbohrer und den Reiskäfer, der die Kontrollwirkung des ursprünglichen, im Labor konservierten Stammes (Stamm XJ8) auf den Reisstängelbohrer und den Reiskäfer wesentlich verbessert und deutlich übertrifft, und der Stamm hat gute biologische Eigenschaften und ist umweltfreundlich, nicht umweltverschmutzend und nicht leicht zu produzier& 601 702Rice stem borer and rice weevil, which significantly improves and clearly surpasses the control effect of the original, laboratory-preserved strain (strain XJ8) on the rice stem borer and the rice weevil, and the strain has good biological properties and is environmentally friendly, non-polluting and not easy to produce. 601 702
Medikamentenresistenz. (2) Der Coccidioides albicans-Stamm LQB-025, der durch die vorliegende Erfindung bereitgestellt wird, kann für die Herstellung von Insektiziden verwendet werden, die bequem zu verwenden sind, und hat eine gute Wirkung auf die Vorbeugung und Bekämpfung vonDrug resistance. (2) The Coccidioides albicans strain LQB-025 provided by the present invention can be used for the production of insecticides that are convenient to use and have a good effect on the prevention and control of
Reisstängelbohrer und Reiskäfer, die die Hauptschädlinge von Reis sind.Rice stem borers and rice weevils are the main pests of rice.
Beschreibung der beigefügten ZeichnungenDescription of the attached drawings
Um die technischen Lôsungen in den spezifischen Ausführungsformen oder im Stand derTo understand the technical solutions in their specific embodiments or in the current state of development,
Technik der vorliegenden Erfindung deutlicher zu veranschaulichen, werden die begleitendenTo illustrate the technology of the present invention more clearly, the accompanying
Zeichnungen, die bei der Beschreibung der spezifischen Ausführungsformen oder des Standes derDrawings used in the description of the specific embodiments or the state of the art
Technik verwendet werden, im Folgenden kurz beschrieben. Natürlich sind die begleitendenThe techniques used are briefly described below. Of course, the accompanying [details/components] are also included.
Zeichnungen in der folgenden Beschreibung einige der Ausführungsformen der vorliegendenThe drawings in the following description show some of the embodiments of the present
Erfindung, und für eine Person von gewôhnlichem Fachwissen auf dem Gebiet, kônnen andere begleitende Zeichnungen auf der Grundlage dieser Zeichnungen ohne kreative Arbeit erhalten werden.Invention, and for a person of ordinary expertise in the field, other accompanying drawings can be obtained on the basis of these drawings without creative work.
Bild 1 zeigt die Koloniemorphologie von Coccidioides albicans LQB-025, die durch die vorliegende Erfindung bereitgestellt wird;Figure 1 shows the colony morphology of Coccidioides albicans LQB-025 provided by the present invention;
Bild 2 zeigt ein morphologisches Diagramm der Konidien von Coccidioides albicans LQB- 025, die durch die vorliegende Erfindung bereitgestellt werden.Figure 2 shows a morphological diagram of the conidia of Coccidioides albicans LQB-025 provided by the present invention.
Detaillierte BeschreibungDetailed description
Die technischen Lösungen der vorliegenden Erfindung werden im Folgenden in Verbindung mit den beigefügten Zeichnungen klar und vollständig beschrieben, und es ist offensichtlich, dass die beschriebenen Ausführungsformen ein Teil der Ausführungsformen der vorliegendenThe technical solutions of the present invention are clearly and completely described below in conjunction with the accompanying drawings, and it is obvious that the described embodiments are part of the embodiments of the present invention.
Erfindung und nicht alle Ausführungsformen sind. Ausgehend von den Ausführungsformen der vorliegenden Erfindung fallen alle anderen Ausführungsformen, die von einer Person mit normalerThe invention and not all embodiments are included. Starting from the embodiments of the present invention, all other embodiments that could be described by a person of normal ability are excluded.
Fachkenntnis auf dem Gebiet der Technik ohne schöpferische Arbeit erzielt werden, in denTechnical expertise can be acquired without creative work, in the
Schutzbereich der vorliegenden Erfindung.Scope of protection of the present invention.
Der Coccidioides albicans-Stamm LQB-025, der durch die vorliegende Erfindung bereitgestellt wird, wurde am 30. März 2016 unter der Hinterlegungsaummer CGMCC No. 12110 beim General Microbiology Centre of the China Microbial Strain Deposit Management Committee hinterlegt.The Coccidioides albicans strain LQB-025 provided by the present invention was deposited on March 30, 2016, with the General Microbiology Centre of the China Microbial Strain Deposit Management Committee under deposit number CGMCC No. 12110.
Ausführungsform 1 Isolierung und Identifizierung von Coccidioides albicans Stamm LQB- 025 (1) Isolierung und AufreinigungEmbodiment 1 Isolation and identification of Coccidioides albicans strain LQB-025 (1) Isolation and purification
Nachdem die natürlich infizierten adulten Reiskäfer, die auf den Reisfeldern in der StadtAfter the naturally infected adult rice weevils, which were found in the rice fields in the city
Gongzhuling, Provinz Jilin, gesammelt wurden, ausreichend versteift waren, wurde die weiße pulverförmige Substanz auf der Körperoberfläche vorsichtig in einen sterilisierten Dreieckskolben geschüttelt, der eine sterilisierende wässrige Lösung mit 0,1 % Tween-80 enthielt, und die Sporen von C. albicans wurden durch ausreichendes Schütteln gleichmäßig dispergiert. Nach derOnce the spores of C. albicans were collected in Gongzhuling, Jilin Province, and had sufficiently hardened, the white powdery substance on the body surface was carefully shaken into a sterilized triangular flask containing a 0.1% Tween-80 sterilizing aqueous solution, and the spores were uniformly dispersed by thorough shaking.
Gradientenverdünnung der vorbereiteten Sporensuspension tauchte man einen sterilen Spreizstab in verschiedene Verdünnungen der C. albicans-Sporenlösung und verteilte sie gleichmäßig auf derFor gradient dilution of the prepared spore suspension, a sterile spreading rod was dipped into different dilutions of the C. albicans spore solution and distributed evenly on the
PDA-Mediumplatte, die man zur Kultivierung in eine Umgebung mit einer Temperatur von 26°C und einer relativen Luftfeuchtigkeit von 90 % stellte.PDA medium plate, which was placed in an environment with a temperature of 26°C and a relative humidity of 90% for cultivation.
Wenn eine einzelne Kolonie herauswächst, wird sie mit einer sterilen Inokulationsnadel entnommen und auf eine neue PDA-Medium-Platte zur individuellen Kultivierung übertragen;When a single colony grows out, it is removed with a sterile inoculation needle and transferred to a new PDA medium plate for individual cultivation;
anschließend wird die Kultivierung fortgesetzt, um sicherzustellen, dass keine anderdyt/601 702Cultivation is then continued to ensure that no otherdyt/601 702
Streubakterien vorhanden sind.Scattered bacteria are present.
Der erhaltene C. albicans-Stamm wurde auf das PDA-Schrägmedium übertragen und 10-15The obtained C. albicans strain was transferred to the PDA oblique medium and 10-15
Tage lang bei 25°C und 90 % relativer Luftfeuchtigkeit kultiviert und dann im 4°C-Kühlschrank gelagert, nachdem eine große Anzahl von Konidien herausgewachsen war. (2) Morphologische Identifizierung:Cultivated for several days at 25°C and 90% relative humidity, and then stored in a 4°C refrigerator after a large number of conidia had emerged. (2) Morphological identification:
Der isolierte Coccidioides albicans LQB-025-Stamm wurde auf PDA-Platten beimpft und bei 26°C kultiviert, um die morphologischen Merkmale der Kolonie, die sporenproduzierendeThe isolated Coccidioides albicans LQB-025 strain was inoculated on PDA plates and cultured at 26°C to determine the morphological characteristics of the colony, including spore-producing cells.
Struktur sowie die Form und GrôBe der Sporen zu beobachten.To observe the structure, shape, and size of the spores.
Der isolierte Coccidioides albicans LQB-025-Stamm wurde 15 Tage lang in einem Inkubator bei 26°C und 95 % relativer Luftfeuchtigkeit inokuliert, und die Platte wurde mit 0,1 % wässrigemThe isolated Coccidioides albicans LQB-025 strain was inoculated for 15 days in an incubator at 26°C and 95% relative humidity, and the plate was treated with 0.1% aqueous solution.
Tween-80 gespült, zentrifugiert und in 0,1 % wässrigem Tween-80 resuspendiert und zu einerTween-80 was rinsed, centrifuged, and resuspended in 0.1% aqueous Tween-80 and used to form a
Sporensuspension von 1x10” Sporen/ml verdünnt. Nach der Beimpfung der Platte mit PDA-Spore suspension diluted to 1 x 10⁻⁶ spores/ml. After inoculating the plate with PDA-
Medium wurde sie in einen Inkubator gestellt, um die morphologischen Merkmale der Kolonie, die sporenbildende Struktur sowie die Form und Größe der Sporen zu beobachten.The medium was placed in an incubator to observe the morphological characteristics of the colony, the spore-forming structure, and the shape and size of the spores.
Bild 1 zeigt die Koloniemorphologie von Coccidioides albicans LQB-025, die durch die vorliegende Erfindung bereitgestellt wird; Bild 2 zeigt die Konidienmorphologie von Coccidioides albicans LQB-025, die durch die vorliegende Erfindung bereitgestellt wird. Wie in den Bildern 1 und 2 gezeigt, änderte sich die Kolonie allmählich von weiß zu cremeweiB, war anfangs flauschig und bildete später eine cremig-pulvrige Sporenschicht mit gleichmäBiger Dicke der Sporenschicht und einem leicht erhabenen Zentrum; das Myzel war transparent, mit Entmischung undFigure 1 shows the colony morphology of Coccidioides albicans LQB-025 provided by the present invention; Figure 2 shows the conidia morphology of Coccidioides albicans LQB-025 provided by the present invention. As shown in Figures 1 and 2, the colony gradually changed from white to creamy white, was initially fluffy, and later formed a creamy-powdery spore layer of uniform thickness and a slightly raised center; the mycelium was transparent, with segregation and
Verzweigung und war farblos und glatt; der Konidienstiel war meist vasenfôrmig und war entweder einzeln oder in Gruppen angeordnet; und die Konidiophoren waren einzellig, farblos und hatten eine kugelfôrmige oder ovale Form und eine Größe von 2 - 3 um x 2 - 2,5 um. (3) ITS-Sequenzbestimmung und molekulare Identifizierung des Stammes:branching and was colorless and smooth; the conidiophore stalk was mostly vase-shaped and was either solitary or arranged in groups; and the conidiophores were unicellular, colorless, and had a globular or oval shape and a size of 2–3 µm × 2–2.5 µm. (3) ITS sequence determination and molecular identification of the strain:
Die DNA des Stammes wurde nach den Richtlinien des Biotek Fungal Genomic DNAThe strain's DNA was analyzed according to the guidelines of Biotek Fungal Genomic DNA.
Extraction Kit extrahiert. Die Primer ITS4 und ITSS wurden für die rRNA-Amplifikation verwendet.Extraction kit extracted. The primers ITS4 and ITSS were used for rRNA amplification.
Die extrahierte DNA diente als Vorlage für die PCR-Amplifikation und Sequenzierung mit universellen Primern für die pilzliche ITS5-Region.The extracted DNA served as a template for PCR amplification and sequencing with universal primers for the fungal ITS5 region.
Das PCR-Reaktionssystem umfasste 20 ul, und die Reaktionsbedingungen waren wie folgt:The PCR reaction system comprised 20 µl, and the reaction conditions were as follows:
Vordenaturierung bei 95°C für 8 min; 95°C für 30 s, 52°C für 30 s, 72°C für 30 s, 33 Zyklen;Pre-denaturation at 95°C for 8 min; 95°C for 30 s, 52°C for 30 s, 72°C for 30 s, 33 cycles;
Verlängerung bei 72°C für 10 min.Extended cooking time at 72°C for 10 minutes.
Die Sequenzen der Primer ITS4 und ITSS sind in SEQ ID Nr.: 1 und SEQ ID Nr: 2 dargestellt;The sequences of the primers ITS4 and ITSS are shown in SEQ ID No.: 1 and SEQ ID No.: 2;
SEQ ID Nr: 1: TCCTCCGCTTATTGATATATGC (5' bis 3' Ende)SEQ ID NO: 1: TCCTCCGCTTATTGATATATGC (5' to 3' end)
SEQ ID Nr.: 2: GGAAGTAAAAGTCGTAACAAGG (S' bis 3' Ende)SEQ ID NO.: 2: GGAAGTAAAAGTCGTAACAAGG (S' to 3' end)
Die ITS-Sequenzierungsergebnisse des C. albicans-Stammes der vorliegenden Erfindung sind in den Sequenzierungsergebnissen mit 99,3 % Homologie mit C. tritici in der NCBI-The ITS sequencing results of the C. albicans strain of the present invention show 99.3% homology with C. tritici in the NCBI sequencing results.
Datenbank dargestellt, was zeigt, dass es sich bei dem Stamm um C. albicans (Beauveria bassiana) handelt.Database shown, which indicates that the strain is C. albicans (Beauveria bassiana).
Ausfiihrungsform 2 Biologische Indikatoren des C. albicans-Stammes LQB-025Version 2 Biological indicators of the C. albicans strain LQB-025
Die Sporenproduktion, die Sporenauskeimungsrate, die Stammwachstumsrate und dieSpore production, spore germination rate, stem growth rate, and the
Pathogenität von C. albicans-Stäimmen sind wichtige Indikatoren, die die hervorragendenPathogenicity of C. albicans strains are important indicators that demonstrate the excellent
Figenschaften des Stammes widerspiegeln. (1) Bestimmung der SporenproduktionFig histories of the stem reflect. (1) Determination of spore production
Die Sporenproduktion des Stammes spiegelt die Vermehrungsfähigkeit des Stammes, dt&}601 702The spore production of the strain reflects the propagation capacity of the strain, dt&}601 702
Fähigkeit der Sporen, sich in der Umwelt zu verbreiten, und das Ausmaß der Verbreitung wider und ist einer der wichtigsten Indikatoren zur Messung der Vor- und Nachteile eines Stammes.The ability of the spores to spread in the environment and the extent of the spread is one of the most important indicators for measuring the advantages and disadvantages of a strain.
Zunächst wurden C. albicans-Stimme zu Konidiensuspensionen in einer Konzentration von 51x10” Sporen/ml mit 0,1% Tween-80 sterilem Wasser aufbereitet. Das feste PDA-Plattenmedium wurde mit 200 uL Konidiensuspension beimpft, mit einem sterilisierten Glasstab gleichmäBig verteilt und dann 10-15 Tage lang bei einer Temperatur von 25°C und einer relativenFirst, C. albicans voice was prepared as conidial suspensions at a concentration of 51 x 10⁻⁶ spores/ml with 0.1% Tween-80 sterile water. The solid PDA plate medium was inoculated with 200 µL of conidial suspension, evenly distributed with a sterilized glass rod, and then incubated for 10–15 days at a temperature of 25°C and a relative humidity of 1000°C.
Luftfeuchtigkeit von 90% gelagert. Mit einem Perforator mit einem Durchmesser von 0,8 cm in der Mitte der Kolonie bis zum Rand des Mittelpunkts wurde ein bestimmter Bereich der Kolonie entnommen, in einen kleinen Dreieckskolben übertragen, 0,1 % steriles Tween-80-Wasser hinzugefügt und im Vortex-Oszillator vollständig in Schwingung versetzt, um die Sporen gleichmäßig in der Sporensuspension zu verteilen. Jede Petrischale wurde an drei Punkten entsprechend dem Dreieck beprobt, und jeder Stamm wurde fünfmal wiederholt, und die Anzahl der Sporen wurde mittels Hämatokritplatte bestimmt, die schlieBlich in die durchschnittlicheStored at 90% humidity. Using a perforator with a diameter of 0.8 cm from the center of the colony to the edge of the midpoint, a specific area of the colony was extracted, transferred to a small triangular flask, 0.1% sterile Tween-80 water was added, and the flask was fully vortexed to oscillate in a vortex oscillator to disperse the spores evenly in the spore suspension. Each Petri dish was sampled at three points corresponding to the triangle, and each strain was repeated five times. The number of spores was determined by hematocrit plate, which was then used to calculate the average
Sporenproduktion pro Quadratzentimeter jedes Stammes umgerechnet wurde. Der OriginalstammSpore production per square centimeter of each strain was converted. The original strain
XJ8, der in unserem Labor aufbewahrt wird, wurde als Kontrollstamm (CK) für den Versuch verwendet.XJ8, which is stored in our laboratory, was used as a control strain (CK) for the experiment.
Die Sporenproduktion der C. albicans-Stämme ist in Tabelle 1 dargestellt.The spore production of C. albicans strains is shown in Table 1.
Tabelle 1 Sporenproduktion von C. albicans-Stimmen.Table 1. Spore production of C. albicans strains.
EEEE
Sporenproduktion (x10%/cm?)Spore production (x10%/cm?)
UnterschiedDifference
Stämmetribes
Wiederho/Wiederho/Wiederho| Wiederhol |WiederhoRepeat/repeat/repeat| Repeat |Repeat
Mittelwert 5% 1% eo [inet con nen po | 79 [78 [3m | 30 | 30 [wen [waMean 5% 1% eo [inet con nen po | 79 [78 [3m | 30 | 30 [wen [wa
PA jar [vw [aw [av [ow [oem EEPA jar [vw [aw [av [ow [oem EE
Wie aus Tabelle 1 ersichtlich, betrug die durchschnittliche Sporenproduktion des C. albicans-As can be seen from Table 1, the average spore production of C. albicans-
Stammes LQB-025 2,97x10%cm?, was signifikant höher war als die des CK-Stammes mit einer durchschnittlichen Sporenproduktion von 2,33x10%/cm?, wobei der Unterschied zum CK-Stamm hoch signifikant war. (2) Bestimmung der Sporen-Keimungsrate(1) The spore production of strain LQB-025 was 2.97 x 10⁻⁶/cm², which was significantly higher than that of the CK strain with an average spore production of 2.33 x 10⁻⁶/cm², with the difference to the CK strain being highly significant. (2) Determination of the spore germination rate
Die Geschwindigkeit der Sporenkeimung spiegelt die Infektion und Pathogenität desThe rate of spore germination reflects the infection and pathogenicity of the
Stammes wider und ist ein wichtiger Index zur Messung des Potenzials eines Stammes.Tribe reflects and is an important index for measuring the potential of a tribe.
Der C. albicans-Stamm wurde in eine Konidiensuspension mit einer Konzentration von 1x10’The C. albicans strain was immersed in a conidia suspension with a concentration of 1x10’
Sporen/ml mit 0,1% Tween-80 sterilem Wasser hergestellt, und dann in das flüssige Medium beimpft, (25+1)°C Oszillationskultur (150r/min), und die Anzahl der gekeimten Sporen wurde mikroskopisch nach 14h untersucht. Mirror Verdünnung zu jedem Sichtfeld von 20-30 Sporen, jedes Mal, wenn der Spiegel Inspektion von fünf Sichtfeldern, nicht weniger als 100 Sporen, um sichtbare Knospe Rohrlänge gleich oder größer als die Lange der Spore Durchmesser als die Spore wurde als Standard, Statistiken der Spore Keimrate gekeimt. Der in unserem Labor aufbewahrteSpores/ml were prepared with 0.1% Tween-80 sterile water and then inoculated into the liquid medium. Oscillation culture (150 rpm) was performed at 25+1°C. The number of germinated spores was examined microscopically after 14 hours. Mirror dilutions of 20-30 spores were used for each viewing area. Each inspection of five viewing areas required at least 100 spores to ensure the visible bud tube length was equal to or greater than the spore length and diameter. The spore diameter was used as a standard. Statistics on the spore germination rate were recorded. The sample was stored in our laboratory.
Originalstamm XJ8 wurde als Kontrollstamm (CK) verwendet.The original strain XJ8 was used as the control strain (CK).
Die Sporenkeimungsrate des C. albicans-Stammes ist in Tabelle 2 dargestellt.The spore germination rate of the C. albicans strain is shown in Table 2.
Tabelle 2 Sporenkeimungsrate von C. albicans-StimmenTable 2 Spore germination rate of C. albicans voices
. Signifikanter-J601702Significant J601702
Keimrate (%) .Germination rate (%) .
UnterschiedDifference
Stämme - - - - -Tribes - - - - -
Wiederho|Wiederho|Wiederho[Wiederho|WiederhoRepeat|Repeat|Repeat[Repeat|Repeat]
Mittelwert 5% 1% lungl | lung I | lung II | lung IV | lung VAverage 5% 1% lungl | lung I | lung II | lung IV | lung V
LQB-025 | 9432 | 9528 | 94.69 | 9487 | 9595 | 95.02+0.26 a | A 94.16 | 91.14 | 95.17 | 9635 | 96.09 | 9458031 | a | ALQB-025 | 9432 | 9528 | 94.69 | 9487 | 9595 | 95.02+0.26 a | A 94.16 | 91.14 | 95.17 | 9635 | 96.09 | 9458031 | a | A
Wie aus Tabelle 2 hervorgeht, betrug die durchschnittliche Sporenkeimungsrate des C. albicans-Stammes LQB-025 95,02 % und die durchschnittliche Sporenkeimungsrate des CK-As shown in Table 2, the average spore germination rate of the C. albicans strain LQB-025 was 95.02% and the average spore germination rate of the CK-
Stammes 94,58 %, was keinen großen Unterschied darstellt und nicht signifikant ist. (3) Bestimmung der Wachstumsrate des StammesThe stem's growth rate was 94.58%, which is not a significant difference and is not statistically significant. (3) Determining the stem's growth rate
Die Schnelligkeit des Nährstoffwachstums des Stammes ist einer der wichtigsten Indikatoren, der die hervorragenden Eigenschaften der Stämme widerspiegelt.The speed of nutrient growth of the strain is one of the most important indicators that reflects the excellent properties of the strains.
Der Coccidioides albicans-Stamm wurde auf ein PDA-Schrägmedium beimpft und bei einerThe Coccidioides albicans strain was inoculated onto a PDA slant medium and incubated during a
Temperatur von 25°C und einer relativen Luftfeuchtigkeit von 90 % kultiviert. Nach 10-15 TagenCultivated at a temperature of 25°C and a relative humidity of 90%. After 10-15 days
Kultivierung wurden die Konidien entnommen, um eine Konidiensuspension mit einerDuring cultivation, the conidia were extracted to prepare a conidial suspension containing a
Konzentration von 1x10’ Konidien/ml in 0,1 % Tween-80 sterilem Wasser herzustellen. Dann wurden SuL der Konidiensuspension mit einer Konzentration von 1x10’ Konidien/ml mit einerTo prepare a concentration of 1 x 10⁶ conidia/ml in 0.1% Tween-80 sterile water. Then, the conidia suspension with a concentration of 1 x 10⁶ conidia/ml was treated with a
Mikropipette aufgesaugt und in die Mitte des PDA-Festmediums beimpft, ein Punkt pro Schale, und für jeden Stamm wurden 5 Wiederholungen durchgeführt. Anschließend wurde die Schale 8Micropipette aspirated and inoculated into the center of the PDA solid medium, one dot per dish, and 5 repetitions were performed for each strain. Dish 8 was then
Tage lang bei einer Temperatur von 25 °C und einer relativen Luftfeuchtigkeit von 90 % gelagert, und der Durchmesser der Kolonie wurde mit einem Messschieber über Kreuz gemessen, dieThey were stored for days at a temperature of 25 °C and a relative humidity of 90%, and the diameter of the colony was measured crosswise with calipers.
Wachstumsrate wurde aufgezeichnet und die durchschnittliche Wachstumsrate (mm/d) berechnet.The growth rate was recorded and the average growth rate (mm/d) was calculated.
Der in unserem Labor aufbewahrte Originalstamm XJ8 wurde als Kontrollstamm (CK) verwendet.The original strain XJ8, stored in our laboratory, was used as a control strain (CK).
Die Wachstumsraten der C. albicans-Stämme sind in Tabelle 3 aufgeführt.The growth rates of the C. albicans strains are listed in Table 3.
Tabelle 3 Wachstumsraten von C. albicans-Stämmen a SignifikanterTable 3 Growth rates of C. albicans strains a Significant
Durchschnittliche Wachstumsrate (mm/d) .Average growth rate (mm/d) .
UnterschiedDifference
Stämme - - - - -Tribes - - - - -
Wiederho| Wiederhol [Wiederho|Wiederho| Wiederhol . 1%Repeat| Repeat [Repeat|Repeat| Repeat. 1%
Mittelwert 5% lung I ung II | lung III | lung IV | ung VAverage 5% lung I lung II | lung III | lung IV | lung V
LQB-025 | 3.619 3.704 3.704 | 3.816 3.687 3.706+0.13 La | A 3.470 | 3.606 | 3.694 | 3.670 | 3.405 3.570+0.10 |» | BLQB-025 | 3,619 3,704 3,704 | 3,816 3,687 3,706+0.13 La | A 3,470 | 3,606 | 3,694 | 3,670 | 3,405 3,570+0.10 |» | b
Anmerkung: Die Daten in derselben Spalte, gefolgt von unterschiedlichen Kleinbuchstaben (GroBbuchstaben), zeigen an, dass der Unterschied auf dem Niveau von Poos (Poo1) durch denNote: Data in the same column followed by different lowercase letters (uppercase letters) indicate that the difference is at the Poos level (Poo1) due to the
Duncan-Test signifikant ist, so wie in der folgenden Tabelle.The Duncan test is significant, as shown in the following table.
Wie aus Tabelle 3 ersichtlich ist, war die Wachstumsrate des C. albicans-Stammes LQB-025 schneller, mit einer durchschnittlichen Wachstumsrate von 3,706 mm/d, die signifikant hoher war als die durchschnittliche Wachstumsrate des CK-Stammes in der Kontrollgruppe. Nach derAs can be seen from Table 3, the growth rate of the C. albicans strain LQB-025 was faster, with an average growth rate of 3,706 mm/day, which was significantly higher than the average growth rate of the CK strain in the control group. After the
Messung der neuen komplexen polaren Abweichung nach Duncan erreichten die Unterschiede zwischen der Kolonie-Wachstumsrate des Stammes LQB-025 und des CK-Stammes auf demMeasurement of the new complex polar deviation according to Duncan revealed differences between the colony growth rate of strain LQB-025 and the CK strain on the
Niveau von a = 0,01 ein hoch signifikantes Niveau. (4) Bestimmung der insektiziden Aktivität in InnenräumenA level of a = 0.01 is a highly significant level. (4) Determination of insecticidal activity indoors
Die Pathogenität des Stammes steht in direktem Zusammenhang mit der insektizidd/601702The pathogenicity of the strain is directly related to the insecticidal/601702
Wirkung des Stammes, die ein äußerst wichtiger Indikator fiir die hervorragenden Eigenschaften des Stammes ist.The effect of the strain, which is an extremely important indicator of the strain's outstanding qualities.
Insekten für den Versuch: Uberwinternde überlebende Stängelbohrerlarven wurden imInsects for the experiment: Overwintering surviving stem borer larvae were in the
Frühjahr von Reisstoppeln gesammelt und dann verpuppt, gefiedert, Eier gelegt und geschlüpft, nachdem sie aus der Stagnation in Innenräumen freigelassen wurden, wurden die Larven mit künstlichem Futter aufgezogen, und wenn sie sich bis zum Alter von 3 Jahren entwickelt hatten, wurden sie dem Biotest von C. albicans-Stämmen in Innenräumen unterzogen; adulte Reis-Collected from rice stubble in spring, the larvae pupated, feathered, laid eggs, and hatched after being released from indoor stagnation. They were then reared on artificial food and, once they had developed to the age of 3, subjected to bioassay against C. albicans strains indoors.
Wasserkäfer, die im Frühjahr vom Feld gesammelt wurden, und dann die gesunden und aktiven lebenden Würmer wurden als das Insekt für den Versuch ausgewählt, nachdem sie für 10 d inWater beetles collected from the field in spring, and then the healthy and active live worms were selected as the insect for the experiment after being kept in a water bath for 10 days.
Innenräumen aufgezogen wurden.were raised indoors.
Der C. albicans-Stamm wurde auf ein PDA-Plattenmedium beimpft und 10-15 Tage lang bei 25°C und 90 % relativer Luftfeuchtigkeit bebrütet. Anschließend wurden die Konidien zu einerThe C. albicans strain was inoculated onto a PDA plate medium and incubated for 10–15 days at 25°C and 90% relative humidity. The conidia were then transferred to a
Konidiensuspension mit einer Konzentration von 1,5x10° Konidien/ml in 0,1 % sterilem Tween- 80-Wasser verarbeitet. Die Konidiensuspension wurde in ein autoklaviertes Halssprühgerät gegossen, und die Larven des dritten Stadiums des Stängelbohrers (oder der erwachsenenA conidial suspension with a concentration of 1.5 x 10⁻⁶ conidia/ml in 0.1% sterile Tween-80 water was processed. The conidial suspension was poured into an autoclaved neck sprayer, and the third-stage larvae of the stem borer (or the adult) were sprayed.
Reiskäfer) für den Test wurden in ein sterilisiertes Emaille-Tablett gelegt, und dann wurde dieRice weevils were placed in a sterilized enamel tray for the test, and then the
Sprühinokulation mit einem Halssprühgerät für jeden Stamm durchgeführt (drei Mal proSpray inoculation was performed using a neck sprayer for each strain (three times per
Wiederholung je nach Sprühgerät), und es wurden vier Wiederholungen für jeden Stamm eingerichtet, mit 20 Larven des dritten Stadiums des Stängelbohrers (oder der erwachsenen(Repeat depending on the sprayer), and four replicates were set up for each strain, with 20 third-stage larvae of the stem borer (or the adult
Reiskäfer) für jede Wiederholung. Nach der Sprühinokulation wurden die Larven des 3. Stadiums (oder die erwachsenen Reiskäfer) einzeln in mit Filterpapierstreifen versehene Fingerröhrchen gesetzt. Die Öffnung des Fingerrohrs wurde mit einem Wattebausch verschlossen, um dieRice weevils) for each replication. After spray inoculation, the 3rd-stage larvae (or the adult rice weevils) were individually placed into finger tubes lined with filter paper strips. The opening of the finger tube was sealed with a cotton ball to prevent the
Belüftung aufrechtzuerhalten. Die Kontrollen wurden mit der gleichen Menge an sterilem Wasser mit 0,1 % Tween-80 geimpft. Sowohl die Behandlungen als auch die Kontrollen wurden bei einerto maintain ventilation. The controls were vaccinated with the same amount of sterile water containing 0.1% Tween-80. Both the treatments and the controls were administered at a
Temperatur von 25 °C und 90 % relativer Luftfeuchtigkeit bebrütet. Die Fingerröhrchen wurden drei Tage lang mit Wasser gefüllt, um eine hohe Luftfeuchtigkeit aufrechtzuerhalten, und dieThe embryos were incubated at a temperature of 25°C and 90% relative humidity. The finger tubes were filled with water for three days to maintain high humidity, and the
Anzahl der infizierten toten Würmer wurde ab dem zweiten Tag täglich untersucht und gezählt, und die Anzahl der steifen Würmer wurde für eine kumulative Gesamtzahl von 15 Tagen aufgezeichnet, und schließlich wurde die kumulative Mortalitätsrate gezählt. Der OriginalstammThe number of infected dead worms was examined and counted daily from the second day onward, and the number of stiff worms was recorded for a cumulative total of 15 days, and finally the cumulative mortality rate was calculated. The original strain
XJ8, der in unserem Labor aufbewahrt wird, wurde als Kontrollstamm (CK) für den Versuch verwendet.XJ8, which is stored in our laboratory, was used as a control strain (CK) for the experiment.
Die Pathogenität von C. albicans-Stämmen gegen den Stängelbohrer ist in Tabelle 4 dargestellt.The pathogenicity of C. albicans strains against the stem borer is shown in Table 4.
Die Pathogenität von C. albicans-Stämmen gegen den Reiswurzelbohrer ist in Tabelle 5 dargestellt.The pathogenicity of C. albicans strains against the rice rootworm is shown in Table 5.
Tabelle 4 Pathogenität von C. albicans-Stämmen gegen StängelbohrerTable 4 Pathogenicity of C. albicans strains against stem borers
Anzahl Korrigi Zeit bis der Todesfälle | erte Toxizität zurNumber of corrections, time until deaths | measured toxicity
Sterblich KorrelatiMortal Correlations
Stämm | Testwür ; Sterblic | Korrelatio Sterblic keit onskoeffi e mer Wi | Wi | Wi | Wi hkeitsra | nsgleichun hkeit (%) zient (Kopf) | ed | ede | ede | ede te (%) |g (Tage)tribe | testwurst ; Mortal | Correlatio mortality onskoeffi e mer Wi | Wi | Wi | Wi hkeitsra | nequality (%) cient (head) | ed | ede | ede | ede te (%) |g (days)
olu | lun | lun | lun LU601 702 ng |gll|8 |golu | lun | lun | lun LU601 702 ng |gll|8 |g
I IT | IVI IT | IV
LQB- y = 1.084x |r = | 5.290. 19 119 |19 | 18 | 93.75 93 Aa 025 +0.546 0.9842 54 y=0.885x |r = | 5.880.LQB- y = 1.084x |r = | 5,290. 19 119 |19 | 18 | 93.75 93 Aa 025 +0.546 0.9842 54 y=0.885x |r = | 5,880.
CK 19 |18 | 17 | 18 | 90.00 89.47b +1.075 0.9759 53CK 19 |18 | 17 | 18 | 90.00 89.47b +1.075 0.9759 53
Aus Tabelle 4 und Tabelle 5 geht hervor, dass die Pathogenität des C. albicans-Stammes EHTables 4 and 5 show that the pathogenicity of the C. albicans strain EH
M-068 sowohl beim Stängelbohrer als auch beim Reiswurzelbohrer stärker war, mit einerM-068 was stronger in both the stem borer and the rice root borer, with a
Mortalitätsrate von 93,75 % bzw. 75,00 % und einer korrigierten Mortalitätsrate von 93,42 % bzw. 73,68 %, die höher waren als die des Kontrollstammes (CK) beim Stängelbohrer und beimMortality rates of 93.75% and 75.00% respectively, and a corrected mortality rate of 93.42% and 73.68% respectively, which were higher than those of the control strain (CK) in the stem borer and in the
Reiswurzelbohrer, wobei sich alle Werte signifikant vom Kontrollstamm (CK) unterschieden.Rice rootworm, with all values differing significantly from the control strain (CK).
Tabelle 5 Pathogenität von C. albicans-Stäimmen auf den Reiswurzelbohrer.Table 5 Pathogenicity of C. albicans strains to the rice rootworm.
Anzahl derNumber of
Todesfälle CoDeaths Co
Zeit bisTime until
Anzah ; ; | KorrigiNumber ; ; | Correction
Wi | Wi | Wi . Toxizität zur lder | Wi Sterblich erte KorrelatiWi | Wi | Wi . Toxicity to the liver | Wi Mortal correlations
Stämm ede | ede | ede . Korrelatio SterblicTribe ede | ede | ede. Correlatio Mortality
Testw | ed keit Sterblic onskoeffi . e rho | rho | rho nsgleichun hkeit ürmer | erh (%) | hkeitsra zient lun | lun | lun g (Tage) (Kopf) | olu te (%) g | 8 | 8 LToo ngTestw | ed keit mortal onskoeffi . e rho | rho | rho n equivalence ürmer | erh (%) | hkeitsra cient lun | lun | lun g (days) (head) | olu te (%) g | 8 | 8 LToo ng
Im | HI | IVIn | HI | IV
I y =I y =
LQB- r= 8.03+ 14 | 15 | 15 | 16 | 75.00 | 73.68a | 0.746x + 025 0.9616 0.77 0.287 y = r= 9.14+LQB- r= 8.03+ 14 | 15 | 15 | 16 | 75.00 | 73.68a | 0.746x + 025 0.9616 0.77 0.287 y = r= 9.14+
CK 15 | 14 | 14 | 14 | 7125 | 69.74b | 0.682x + 0.9963 0.88 0.051CK 15 | 14 | 14 | 14 | 7125 | 69.74b | 0.682x + 0.9963 0.88 0.051
Aus Tabelle 4 ist ersichtlich, dass der LT9o-Wert des C. albicans-Stammes EH M-068 auf denTable 4 shows that the LT90 value of the C. albicans strain EH M-068 is based on the
Stängelbohrer nur 5,29 Tage beträgt, was niedriger ist als der LT90-Wert des CK-Stammes von 5,88Stem borer's lifespan is only 5.29 days, which is lower than the LT90 value of the CK strain of 5.88.
Tagen; aus Tabelle 5 ist ersichtlich, dass der LTeo-Wert des C. albicans-Stammes EH M-068 auf den Stängelbohrer nur 8,03 Tage beträgt, was niedriger ist als der LT90-Wert des CK-Stammes von 9,14 Tagen.days; from Table 5 it can be seen that the LTeo value of the C. albicans strain EH M-068 on the stem borer is only 8.03 days, which is lower than the LT90 value of the CK strain of 9.14 days.
Zusammenfassend lässt sich feststellen, dass der C. albicans-Stamm EH M-068 eine guteIn summary, it can be stated that the C. albicans strain EH M-068 is a good
Kontrollwirkung auf den Stängelbohrer und den Reiswurzelbohrer hat.It has a controlling effect on the stem borer and the rice root borer.
Ausführungsform 3 Bekämpfung von Stängelbohrer und Reiskäfer durch ein mit deh/601702Embodiment 3 Control of stem borer and rice weevil by means of a deh/601702
Paenibacillus sp. Stamm LQB-025 hergestelltes Insektizid 1) Feldtestmethode:Paenibacillus sp. strain LQB-025 insecticide produced 1) Field test method:
Im Mai-Juni 2016 wurde in der Stadt Gongzhuling in der Provinz Jilin ein Reisfeld mit einerIn May-June 2016, a rice field in the city of Gongzhuling in Jilin Province was equipped with a
Fläche von 300m? als Testbasis ausgewählt und insgesamt sechs Behandlungen nach demAn area of 300m² was selected as the test base, and a total of six treatments were carried out according to the...
Zufallsprinzip durchgeführt. Die Behandlungen I bis IV wurden alle mit Insektiziden behandelt, die den erfindungsgemäßen Coccidioides albicans-Stamm LQB-025 enthielten, wobei der Gehalt an Konidien des Coccidioides albicans-Stammes LQB-025 in den Insektiziden 5 MilliardenThe trials were conducted randomly. Treatments I to IV were all carried out with insecticides containing the Coccidioides albicans strain LQB-025 according to the invention, wherein the conidia content of the Coccidioides albicans strain LQB-025 in the insecticides was 5 billion.
Sporen/g des Pilzes betrug. Die Behandlungen I bis IV wurden mit 62,5 g/mu, 125 g/mu, 250 g/mu bzw. 500 g/mu besprüht, während die Behandlung V mit einem Biopestizid und die BehandlungThe spore count per gram of the fungus was [missing information]. Treatments I to IV were sprayed with 62.5 g/mL, 125 g/mL, 250 g/mL and 500 g/mL respectively, while treatment V was carried out with a biopesticide and the treatment [missing information].
VI mit Wasser als Kontrollversuch besprüht wurde. Die Behandlungen I bis VI wurden mit einerVI was sprayed with water as a control. Treatments I to VI were performed with a
Rückenspritze gleichmäßig auf die Stängel und Blätter des Reisfeldes gespritzt, und eineThe backpack sprayer sprayed evenly onto the stems and leaves of the rice field, and a
Anwendung erfolgte eine Woche nach dem Einpflanzen der Reissetzlinge (25. Mai), eine weitere alle 7 Tage. Im Stadium der Trächtigkeit (30. Juni) wurde einmal gesprüht, danach noch einmal im Abstand von 7 Tagen. (2) ErhebungsmethodeThe treatment was applied one week after planting the rice seedlings (May 25), and then every 7 days thereafter. One application was made at the gestation stage (June 30), followed by another application every 7 days. (2) Data collection method
Die Dichte der adulten Reiskäfer in den verschiedenen Behandlungen wurde 3 Tage nach der ersten und zweiten Anwendung (d.h. am 28. Mai und 5. Juni) erhoben, wobei 5 Punkte in jedemThe density of adult rice weevils in the different treatments was measured 3 days after the first and second applications (i.e., on May 28 and June 5), with 5 points in each
Feld nach dem Zufallsprinzip untersucht wurden und 100 Reispflanzenbüschel an jedem Punkt standen;The field was examined at random, with 100 rice plant clumps at each point;
Am 25. Juli untersuchten wir den Grad der Schädigung durch den Reiswurzelbohrer in Bezug auf das verwelkte Herz, die verwelkte Blattscheide und die weiße Ähre.On July 25th, we examined the degree of damage caused by the rice rootworm in relation to the wilted heart, the wilted leaf sheath, and the white ear.
Wirksamkeit der Insektizide gegen den Reiswurzelbohrer auf dem Feld Tabelle 5.Effectiveness of insecticides against the rice rootworm in the field (Table 5).
Insektizide gegen Stängelbohrer Feldwirksamkeit Tabelle 6.Insecticides against stem borers: Field efficacy, Table 6.
Tabelle 5 Insektizide gegen den Reiswurzelbohrer Feldwirksamkeit der Situation TabelleTable 5 Insecticides against the rice rootworm Field efficacy of the situation Table
Anzahl der Zahl der Anzahl der erwachsenen erwachsenen erwachsenenNumber of the number of the number of adults adults adults
Insekten vor der Käfer nach 3 Käfer nach 10 | KontrollwirkungInsects before the beetles after 3 beetles after 10 | Control effect
BehandlungTreatment
Behandlung Tagen Tagen (%) (Kopf/100 (Kopf/100 (Kopf/100Treatment days (%) (head/100 (head/100 (head/100
Büsche) Büsche) Büschel)Bushes) Bushes) Clumps)
Behandlung IM | 68 | M | 18 | 7% 6Treatment IM | 68 | M | 18 | 7% 6
Behandlung IV 75 39 16 78.67 € 1 «x | TT | 8 | ELTreatment IV 75 39 16 €78.67 1 «x | TT | 8 | EL
Wie aus Tabelle 5 ersichtlich, wurden die Behandlungen I bis IV mit Insektiziden behandelt, die den erfindungsgemäßen Coccidioides albicans-Stamm LQB-025 enthielten. Die Population der adulten Reiskäfer auf dem Feld begann 3 Tage nach der ersten Anwendung zu sinken, und 3As can be seen from Table 5, treatments I to IV were carried out with insecticides containing the Coccidioides albicans strain LQB-025 according to the invention. The population of adult rice weevils in the field began to decline 3 days after the first application, and 3
Tage nach der zweiten Anwendung war die adulte Population signifikant reduziert; Bei dd/601702Days after the second application, the adult population was significantly reduced; at dd/601702
Behandlungen I bis IV betrug der Bekämpfungseffekt auf dem Feld 3 Tage nach der zweitenFor treatments I to IV, the control effect in the field was 3 days after the second treatment.
Anwendung 46,25 %, 64,29 %, 77,94 % bzw. 78,67 %.Application rates of 46.25%, 64.29%, 77.94% and 78.67% respectively.
Mit der Erhöhung der Insektizid-Spritzmenge nahm die Wirkung der Feldkontrolle auf denWith the increase in the amount of insecticide sprayed, the effect of field control on the
Reiswurzelkäfer zu. Zusätzlich zu Behandlung 1 war der Feldkontroll-Effekt gegen denRice root beetle. In addition to treatment 1, the field control effect against the
Reiswurzelkäfer etwas geringer als bei den Behandlungen 2 bis 4, der Feldkontroll-Effekt gegen den Reiswurzelkäfer betrug mehr als 60 %, was viel höher war als bei der Kontrollgruppe ohneRice root beetle infestation was somewhat lower than in treatments 2 to 4; the field control effect against the rice root beetle was more than 60%, which was much higher than in the control group without treatment.
Insektizide; obwohl der Feldkontroll-Effekt von Behandlung 5, bei der chemische Pestizide gegen den Reiswurzelkäfer eingesetzt wurden, 98,75 % erreichte, aber die Kosten fiir chemischeInsecticides; although the field control effect of treatment 5, in which chemical pesticides were used against the rice root beetle, reached 98.75%, the cost of chemical
Pestizide sind hoch und sie können die Umwelt verschmutzen.Pesticide levels are high and they can pollute the environment.
Tabelle 6 Feldkontrollwirkung von Insektiziden gegen StängelbohrerTable 6 Field control efficacy of insecticides against stem borers
ProzPercent
Ver entsVer ents
Gesa | blü | atz . MittlGesa | blü | atz . Mittl
Ver Rate Wei mtza | hte | der | Verwel Verwel ere wel der | We | Bspit | Anteil hl | He | verw kte kungsra Wirk kte verwelk | iBe | zigk | weißer der | rz- | elkte | Herzrat te der . - samkVer Rate Wei mtza | hte | der | Verwel Verwel ere wel der | We | Bspit | Teil hl | He | verw kte kungsra Wirk kte verwelk | iBe | zigk | weiße der | rz- | elkte | Herzrat te der . - samk
Sc ; ten Ah | eit AhrenSc ; ten Ah | eit Ahren
Pfla | Pfl | 2 e Scheide eit hei Scheide | re (% | (%) nzen | anz | Herz | (%) (%) (% de (%) ) en en ) (% )Pfla | Pfl | 2 e vagina with hot vagina | re (% | (%) nzen | num | heart | (%) (%) (% de (%) ) en en ) (% )
Beh andl 998 | 12 | 1.20 | 47.83a | 14 1.40 46.15a 5 | 0.50 | 37.50a | 43 83 ungBeh andl 998 | 12 | 1.20 | 47.83a | 14 1.40 46.15a 5 | 0.50 | 37.50a | 43 83 ung
II
Beh andl | 1186 0.76 | 60.87b | 10 | 0.84 | 61.54b | 4 | 0.34 55.56b | 5932 ungBeh andl | 1186 0.76 | 60.87b | 10 | 0.84 | 61.54b | 4 | 0.34 55.56b | 5932 ung
ITIT
Beh andl | 1008 0.79 | 65.20c 0.89 | 6538 | 3 | 0.30 | 66.67c | 65.76 ungBeh andl | 1008 0.79 | 65.20c 0.89 | 6538 | 3 | 0.30 | 66.67c | 65.76 ung
IIIIII
Beh andl | 1106 | 7 | 0.63 | 69.57c 0.72 | 69.23c | 3 | 027 | 66.67c | 68.49 ungBeh andl | 1106 | 7 | 0.63 | 69.57c 0.72 | 69.23c | 3 | 027 | 66.67c | 68.49 ung
IV andl ung LU601702 wllIV andl ung LU601702 wll
Ec 0EC 0
Wie aus Tabelle 6 ersichtlich ist, wurden bei den Behandlungen I bis IV unter Verwendung von Insektiziden, die mit dem erfindungsgemäßen C. albicans-Stamm LQB-025 hergestellt wurden, die drei Indizes für die Verwelkungsrate des Herzens, die Verwelkungsrate der Scheide und die Rate der weißen Ahren der Reispflanzen im Vergleich zur Kontrollgruppe CK deutlich reduziert. Unter ihnen erreichte die durchschnittliche präventive Wirkung der Behandlung drei und vier auf den Reisstängelbohrer mehr als 65%, was zeigt, dass das Insektizid, das mit demAs can be seen from Table 6, in treatments I to IV using insecticides prepared with the C. albicans strain LQB-025 according to the invention, the three indices for heart wilting rate, sheath wilting rate, and white ear rate of the rice plants were significantly reduced compared to the control group CK. Among these, the average preventive effect of treatments three and four on the rice stem borer reached more than 65%, which shows that the insecticide prepared with the
Coccidioides albicans-Stamm LQB-025 hergestellt wurde und durch die vorliegende Erfindung bereitgestellt wird, eine offensichtliche Wirkung auf den Reisstängelbohrer hat. Obwohl die durchschnittliche Wirksamkeit chemischer Pestizide gegen den Reisstängelbohrer in Behandlung 585,54% erreichte, sind chemische Pestizide teuer und verursachen leicht Umweltverschmutzung.The Coccidioides albicans strain LQB-025, produced and provided by the present invention, has a clear effect on the rice stem borer. Although the average efficacy of chemical pesticides against the rice stem borer reached 585.54% in treatment, chemical pesticides are expensive and readily cause environmental pollution.
Wie aus den kombinierten Tabellen 5 und 6 ersichtlich ist, haben die Insektizide, die denAs can be seen from the combined Tables 5 and 6, the insecticides that the
Coccidioides albicans-Stamm LQB-025 enthalten, der durch die vorliegende Erfindung bereitgestellt wird, offensichtliche Auswirkungen sowohl auf den Reiskäfer als auch auf denThe Coccidioides albicans strain LQB-025, which is provided by the present invention, contains obvious effects on both the rice weevil and the
Stängelbohrer, die die Hauptschädlinge im Reisproduktionsprozess sind.Stem borers, which are the main pests in the rice production process.
Schließlich ist zu beachten, dass die obigen Ausführungsformen nur zur Veranschaulichung der technischen Lösungen der vorliegenden Erfindung dienen und diese nicht einschränken.Finally, it should be noted that the above embodiments serve only to illustrate the technical solutions of the present invention and do not limit them.
Obwohl die vorliegende Erfindung im Detail unter Bezugnahme auf die vorstehendenAlthough the present invention is described in detail with reference to the foregoing
Ausführungsformen beschrieben wurde, sollte der Fachmann verstehen, dass es immer noch möglich ist, die in den vorstehenden Ausführungsformen aufgezeichneten technischen Lösungen zu modifizieren oder einige oder alle der darin enthaltenen technischen Merkmale durch gleichwertige zu ersetzen; Und diese Änderungen oder Ersetzungen nehmen nicht das Wesentliche der entsprechenden technischen Lösungen aus dem Anwendungsbereich der technischenAs the embodiments described above have been explained, the person skilled in the art should understand that it is still possible to modify the technical solutions recorded in the foregoing embodiments or to replace some or all of the technical features contained therein with equivalent ones; and these modifications or replacements do not remove the essential nature of the corresponding technical solutions from the scope of the technical description.
Lösungen der Ausführungsformen der vorliegenden Erfindung.Solutions to the embodiments of the present invention.
Claims (5)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| LU601702A LU601702B1 (en) | 2025-05-19 | 2025-05-19 | Coccidioides albicans strain LQB-025 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| LU601702A LU601702B1 (en) | 2025-05-19 | 2025-05-19 | Coccidioides albicans strain LQB-025 and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| LU601702B1 true LU601702B1 (en) | 2025-11-19 |
Family
ID=97723295
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| LU601702A LU601702B1 (en) | 2025-05-19 | 2025-05-19 | Coccidioides albicans strain LQB-025 and its application |
Country Status (1)
| Country | Link |
|---|---|
| LU (1) | LU601702B1 (en) |
-
2025
- 2025-05-19 LU LU601702A patent/LU601702B1/en active IP Right Grant
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DE69125890T2 (en) | Trichoderma harzianum strain, T-39, compositions containing the same and their use against B. Cinerea and S. Sclerotiorum | |
| Akello et al. | Beauveria bassiana (Balsamo) Vuillemin as an endophyte in tissue culture banana (Musa spp.) | |
| DE69417750T2 (en) | USE OF STREPTOMYCES WYEC 108 FOR CONTROLLING PLANT Pests | |
| CN106967618B (en) | Beauveria bassiana strain EHM-068 and its application | |
| Ogbebor et al. | Inhibition of conidial germination and mycelial growth of Corynespora cassiicola (Berk and Curt) of rubber (Hevea brasiliensis muell. Arg.) using extracts of some plants | |
| CN115074258B (en) | Beauveria bassiana Bals-1722 and its application | |
| DE69029739T2 (en) | ANTIFUNGAL MICROORGANISM | |
| WO2006121350A1 (en) | Entomopathogenic fungi and uses thereof | |
| Cheng et al. | Toxic effects of seven pesticides to aphid parasitoid, Aphidius gifuensis (Hymenoptera: Braconidae) after contact exposure | |
| CN111165485A (en) | Diatomite-beauveria bassiana pesticide composition and application thereof | |
| CN111543437B (en) | Parasitic nematode preparation, preparation method and application | |
| CN101451108B (en) | Verticillium lecanii for controlling fly pests and its application | |
| Faddilah et al. | Growth of fall armyworm, Spodoptera frugiperda JE Smith (Lepidoptera: Noctuidae) fed on young maize colonized with endophytic fungus Beauveria bassiana from South Sumatra, Indonesia | |
| DE69533807T2 (en) | Use of the fungus Gliocladium catenulatum for biological control of plant diseases | |
| CN120060013B (en) | Bacillus megaterium NBNC-104 for preventing and controlling root knot nematode, compound bacterial agent and application thereof | |
| LU601702B1 (en) | Coccidioides albicans strain LQB-025 and its application | |
| CN109699683A (en) | A kind of talcum matrix Java cordyceps sinensis spore preparation | |
| CN117965322B (en) | A kind of Metarhizium anisopliae Mrztsl2308 emulsion suspension for controlling Spodoptera litura and its preparation method and application | |
| DE69534876T2 (en) | NEMATICIDES AND METHODS OF BIOLOGICALLY COMBATING NEMATODES | |
| Henri et al. | Evaluation of the Sensitivity of Strains of phytophthora spp Cause of Brown Rot of Cocoa (Theobroma cacao L.) against to Limocide 60 ME (An Extract of Sweet Orange Essential Oil) | |
| CN104611241A (en) | Preparation for killing ostrinia nubilalis metarhizium anisopliae and application of preparation | |
| CN116676221A (en) | A high-efficiency Bacillus megaterium for killing plant parasitic nematodes and its application | |
| Hall et al. | The germination of resting spores of Entomophthora virulenta Hall and Dunn | |
| Bünzli et al. | Fungous diseases of lamellicorn larvae in Southern Rhodesia | |
| CN112625920B (en) | Application of disease and insect resistant endophytic fungi |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FG | Patent granted |
Effective date: 20251119 |