LU601702B1 - Coccidioides albicans strain LQB-025 and its application - Google Patents

Abstract

The present invention relates to the technical field of biological control of plant pests and, in particular, to a Coccidioides albicans strain LQB-025 and its application. The strain provided by the present invention was deposited on March 30, 2016, with the General Microbiology Centre of the China Microbial Strain Deposit Management Committee under deposit number CGMCC No. 12110. The present invention also provides for the application of the Coccidioides albicans strain LQB-025 in the control of the rice stem borer and the rice weevil, as well as in the production of insecticides. The Coccidioides albicans strain LQB-025 provided by the present invention is capable of simultaneously exhibiting high pathogenicity against both the rice stem borer and the rice weevil, and significantly improves the preventive and control effects against these pests.

Description

Coccidioides albicans strain LQB-025 and its application LU601702

Technical area

The present invention relates to the technical field of biological

Control of plant pests, especially on the Coccidioides albicans strain LQB-025 and its application.

Technology in the background

The stemworm (Chilo suppressalis Walker), belonging to the butterfly family (Lepidoptera) and commonly known as the heartworm, stem borer, etc., is one of the most serious pests of rice in China. Besides rice, the stemworm can also infest other plants.

Wild rice, maize, sorghum, sugar cane, rapeseed, broad beans, wheat, as well as reeds and barn grass.

Lees grass and other weeds are damaged. The stem borer larvae cause damage to wilted leaf sheaths, withered seedlings, and white ears by feeding on the

Leaf sheaths, heart leaves and stems of rice are infested, and during the ripening period they damage the

The plant is damaged by semi-rotten thorns, leading to significant yield losses. The stem borer can typically reduce rice yields by 5-10%, and in severe cases by as much as 20-30%.

Rice water weevil (Lissorhoptrus oryzophilus Kuschel) belongs to Coleoptera,

Weevil family, marsh weevil subfamily, rice water weevil genus, primarily responsible for the growth of rice and other cereal crops; the adults feed on the

Leaves of rice; larvae feed on the rice roots, with a long period of time.

Damage, reproduction, and spread rapidly; resistant to drugs and other characteristics. Typically causes rice yield reductions of 15-20 percent, severe yield reductions of more than 50 percent, or even extinction; is a major quarantine pest of rice, with serious impacts on growth and...

Development of rice and rice production, rice weevil has become a major potential threat

Threat to China's rice production, China is listed as one of the most important countries to strengthen the prevention and control of the five invasive alien organisms in recent years.

Currently, the control of rice weevils and rice pole beetles in rice cultivation is primarily based on chemical control. However, the long-term use of chemicals not only leads to the pests developing resistance to a wide variety of common insecticides, but also to frequent outbreaks of stem borers and rice pole beetles, resulting in a continuous increase in the use of medications. Furthermore, the

The use of chemicals also pollutes the environment, which is detrimental to the sustainability of agricultural production. Therefore, it is of great importance to find an environmentally friendly, non-toxic, and highly efficient biological control method that can simultaneously combat two rice pests.

Beauveria bassiana is a filamentous fungus belonging to the genus Beauveria spp. in the subphylum

Deuteromycotina, class Hyphomycetes, order Moniliales, family Moniliaceae.

Beauveria spp. is a broad-spectrum entomopathogenic fungus that reproduces primarily asexually by producing conidia, but also sexually to form fruiting bodies. C. albicans has strong pathogenicity, can cause epidemics among its hosts, does not pollute the environment, and is easy to produce on a large scale. Therefore, C. albicans is widely used in pest control in agricultural production and is a very efficient microbial insecticide. C. albicans has a certain

Host specialization: Studies have shown that different regions of origin, different

Host sources of strains of pests on the target pathogenicity; the difference is very significant; different strains of lethal time (LT90) can vary several times to ten times. dé/601 702

Difference.

Currently, when C. albicans is used for on-site pest control, it is often due to the production of appropriate specialized strains for different target groups.

Pests that cause inconvenience to a certain degree and are not conducive to the application of C. albicans for further promoting biological control.

In light of this, the present invention is proposed.

Content of the invention

A first objective of the present invention is to provide a strain LQB-025 of Coccidioides albicans that is able to simultaneously exhibit high pathogenicity against the

to have rice stem borers and rice water weevils, which are capable of the

Prevention and control effect against the rice stem borer and the

to significantly improve the rice water weevil, and which is biologically well characterized, environmentally friendly, non-polluting and not easily led to drug resistance.

To achieve the above-mentioned purpose, the technical solution adopted in the present invention is as follows:

A Coccidioides albicans strain LQB-025, where the Coccidioides albicans strain LQB-025 was discovered on March 30, 2016, at the General Microbiology Centre of China Microbial Species Deposit

The deposit was made with the Management Committee under deposit number CGMCC No. 12110.

Furthermore, the colony culture of the Coccidioides albicans strain LQB-025 shows a fluffy appearance in the early stage and later forms a creamy-powdery spore layer with uniform

Thickness of the spore layer, which is slightly raised in the middle; the mycelium is hyaline with segregation and branching and is colorless and smooth; the conidium stalk is usually flask-shaped and occurs either singly or in groups; and the conidium is unicellular, colorless and spherical or oval, measuring 2-3 µm x 2-2.5 µm.

Use of the above-mentioned Coccidioides albicans strain LQB-025 in the

Control of the stem borer.

Use of the above-mentioned Coccidioides albicans strain LQB-025 in the

Control of the rice weevil.

Use of the above-mentioned Coccidioides albicans strain LQB-025 in the

Production of insecticides.

Add one or more dispersants, wetting agents, emulsifiers, defoamers,

Regulator etc. as an aid or adsorption carrier in the powder from Coccidioides albicans-

Spore powder is mixed in a specific ratio and then processed into powder, wettable powder, suspension agent or microparticle agent.

The content of conidia of the Coccidioides albicans strain LQB-025 in the insecticide is 40-10 billion spores/g of the fungicide.

The advantageous effects of the present invention compared to the prior art are: (1) The Coccidioides albicans strain LQB-025 provided by the present invention is a Coccidioides albicans strain with high pathogenicity for the

Rice stem borer and rice weevil, which significantly improves and clearly surpasses the control effect of the original, laboratory-preserved strain (strain XJ8) on the rice stem borer and the rice weevil, and the strain has good biological properties and is environmentally friendly, non-polluting and not easy to produce. 601 702

Drug resistance. (2) The Coccidioides albicans strain LQB-025 provided by the present invention can be used for the production of insecticides that are convenient to use and have a good effect on the prevention and control of

Rice stem borers and rice weevils are the main pests of rice.

Description of the attached drawings

To understand the technical solutions in their specific embodiments or in the current state of development,

To illustrate the technology of the present invention more clearly, the accompanying

Drawings used in the description of the specific embodiments or the state of the art

The techniques used are briefly described below. Of course, the accompanying [details/components] are also included.

The drawings in the following description show some of the embodiments of the present

Invention, and for a person of ordinary expertise in the field, other accompanying drawings can be obtained on the basis of these drawings without creative work.

Figure 1 shows the colony morphology of Coccidioides albicans LQB-025 provided by the present invention;

Figure 2 shows a morphological diagram of the conidia of Coccidioides albicans LQB-025 provided by the present invention.

Detailed description

The technical solutions of the present invention are clearly and completely described below in conjunction with the accompanying drawings, and it is obvious that the described embodiments are part of the embodiments of the present invention.

The invention and not all embodiments are included. Starting from the embodiments of the present invention, all other embodiments that could be described by a person of normal ability are excluded.

Technical expertise can be acquired without creative work, in the

Scope of protection of the present invention.

The Coccidioides albicans strain LQB-025 provided by the present invention was deposited on March 30, 2016, with the General Microbiology Centre of the China Microbial Strain Deposit Management Committee under deposit number CGMCC No. 12110.

Embodiment 1 Isolation and identification of Coccidioides albicans strain LQB-025 (1) Isolation and purification

After the naturally infected adult rice weevils, which were found in the rice fields in the city

Once the spores of C. albicans were collected in Gongzhuling, Jilin Province, and had sufficiently hardened, the white powdery substance on the body surface was carefully shaken into a sterilized triangular flask containing a 0.1% Tween-80 sterilizing aqueous solution, and the spores were uniformly dispersed by thorough shaking.

For gradient dilution of the prepared spore suspension, a sterile spreading rod was dipped into different dilutions of the C. albicans spore solution and distributed evenly on the

PDA medium plate, which was placed in an environment with a temperature of 26°C and a relative humidity of 90% for cultivation.

When a single colony grows out, it is removed with a sterile inoculation needle and transferred to a new PDA medium plate for individual cultivation;

Cultivation is then continued to ensure that no otherdyt/601 702

Scattered bacteria are present.

The obtained C. albicans strain was transferred to the PDA oblique medium and 10-15

Cultivated for several days at 25°C and 90% relative humidity, and then stored in a 4°C refrigerator after a large number of conidia had emerged. (2) Morphological identification:

The isolated Coccidioides albicans LQB-025 strain was inoculated on PDA plates and cultured at 26°C to determine the morphological characteristics of the colony, including spore-producing cells.

To observe the structure, shape, and size of the spores.

The isolated Coccidioides albicans LQB-025 strain was inoculated for 15 days in an incubator at 26°C and 95% relative humidity, and the plate was treated with 0.1% aqueous solution.

Tween-80 was rinsed, centrifuged, and resuspended in 0.1% aqueous Tween-80 and used to form a

Spore suspension diluted to 1 x 10⁻⁶ spores/ml. After inoculating the plate with PDA-

The medium was placed in an incubator to observe the morphological characteristics of the colony, the spore-forming structure, and the shape and size of the spores.

Figure 1 shows the colony morphology of Coccidioides albicans LQB-025 provided by the present invention; Figure 2 shows the conidia morphology of Coccidioides albicans LQB-025 provided by the present invention. As shown in Figures 1 and 2, the colony gradually changed from white to creamy white, was initially fluffy, and later formed a creamy-powdery spore layer of uniform thickness and a slightly raised center; the mycelium was transparent, with segregation and

branching and was colorless and smooth; the conidiophore stalk was mostly vase-shaped and was either solitary or arranged in groups; and the conidiophores were unicellular, colorless, and had a globular or oval shape and a size of 2–3 µm × 2–2.5 µm. (3) ITS sequence determination and molecular identification of the strain:

The strain's DNA was analyzed according to the guidelines of Biotek Fungal Genomic DNA.

Extraction kit extracted. The primers ITS4 and ITSS were used for rRNA amplification.

The extracted DNA served as a template for PCR amplification and sequencing with universal primers for the fungal ITS5 region.

The PCR reaction system comprised 20 µl, and the reaction conditions were as follows:

Pre-denaturation at 95°C for 8 min; 95°C for 30 s, 52°C for 30 s, 72°C for 30 s, 33 cycles;

Extended cooking time at 72°C for 10 minutes.

The sequences of the primers ITS4 and ITSS are shown in SEQ ID No.: 1 and SEQ ID No.: 2;

SEQ ID NO: 1: TCCTCCGCTTATTGATATATGC (5' to 3' end)

SEQ ID NO.: 2: GGAAGTAAAAGTCGTAACAAGG (S' to 3' end)

The ITS sequencing results of the C. albicans strain of the present invention show 99.3% homology with C. tritici in the NCBI sequencing results.

Database shown, which indicates that the strain is C. albicans (Beauveria bassiana).

Version 2 Biological indicators of the C. albicans strain LQB-025

Spore production, spore germination rate, stem growth rate, and the

Pathogenicity of C. albicans strains are important indicators that demonstrate the excellent

Fig histories of the stem reflect. (1) Determination of spore production

The spore production of the strain reflects the propagation capacity of the strain, dt&}601 702

The ability of the spores to spread in the environment and the extent of the spread is one of the most important indicators for measuring the advantages and disadvantages of a strain.

First, C. albicans voice was prepared as conidial suspensions at a concentration of 51 x 10⁻⁶ spores/ml with 0.1% Tween-80 sterile water. The solid PDA plate medium was inoculated with 200 µL of conidial suspension, evenly distributed with a sterilized glass rod, and then incubated for 10–15 days at a temperature of 25°C and a relative humidity of 1000°C.

Stored at 90% humidity. Using a perforator with a diameter of 0.8 cm from the center of the colony to the edge of the midpoint, a specific area of the colony was extracted, transferred to a small triangular flask, 0.1% sterile Tween-80 water was added, and the flask was fully vortexed to oscillate in a vortex oscillator to disperse the spores evenly in the spore suspension. Each Petri dish was sampled at three points corresponding to the triangle, and each strain was repeated five times. The number of spores was determined by hematocrit plate, which was then used to calculate the average

Spore production per square centimeter of each strain was converted. The original strain

XJ8, which is stored in our laboratory, was used as a control strain (CK) for the experiment.

The spore production of C. albicans strains is shown in Table 1.

Table 1. Spore production of C. albicans strains.

EE

Spore production (x10%/cm?)

Difference

tribes

Repeat/repeat/repeat| Repeat |Repeat

Mean 5% 1% eo [inet con nen po | 79 [78 [3m | 30 | 30 [wen [wa

PA jar [vw [aw [av [ow [oem EE

As can be seen from Table 1, the average spore production of C. albicans-

(1) The spore production of strain LQB-025 was 2.97 x 10⁻⁶/cm², which was significantly higher than that of the CK strain with an average spore production of 2.33 x 10⁻⁶/cm², with the difference to the CK strain being highly significant. (2) Determination of the spore germination rate

The rate of spore germination reflects the infection and pathogenicity of the

Tribe reflects and is an important index for measuring the potential of a tribe.

The C. albicans strain was immersed in a conidia suspension with a concentration of 1x10’

Spores/ml were prepared with 0.1% Tween-80 sterile water and then inoculated into the liquid medium. Oscillation culture (150 rpm) was performed at 25+1°C. The number of germinated spores was examined microscopically after 14 hours. Mirror dilutions of 20-30 spores were used for each viewing area. Each inspection of five viewing areas required at least 100 spores to ensure the visible bud tube length was equal to or greater than the spore length and diameter. The spore diameter was used as a standard. Statistics on the spore germination rate were recorded. The sample was stored in our laboratory.

The original strain XJ8 was used as the control strain (CK).

The spore germination rate of the C. albicans strain is shown in Table 2.

Table 2 Spore germination rate of C. albicans voices

Significant J601702

Germination rate (%) .

Difference

Tribes - - - - -

Repeat|Repeat|Repeat[Repeat|Repeat]

Average 5% 1% lungl | lung I | lung II | lung IV | lung V

LQB-025 | 9432 | 9528 | 94.69 | 9487 | 9595 | 95.02+0.26 a | A 94.16 | 91.14 | 95.17 | 9635 | 96.09 | 9458031 | a | A

As shown in Table 2, the average spore germination rate of the C. albicans strain LQB-025 was 95.02% and the average spore germination rate of the CK-

The stem's growth rate was 94.58%, which is not a significant difference and is not statistically significant. (3) Determining the stem's growth rate

The speed of nutrient growth of the strain is one of the most important indicators that reflects the excellent properties of the strains.

The Coccidioides albicans strain was inoculated onto a PDA slant medium and incubated during a

Cultivated at a temperature of 25°C and a relative humidity of 90%. After 10-15 days

During cultivation, the conidia were extracted to prepare a conidial suspension containing a

To prepare a concentration of 1 x 10⁶ conidia/ml in 0.1% Tween-80 sterile water. Then, the conidia suspension with a concentration of 1 x 10⁶ conidia/ml was treated with a

Micropipette aspirated and inoculated into the center of the PDA solid medium, one dot per dish, and 5 repetitions were performed for each strain. Dish 8 was then

They were stored for days at a temperature of 25 °C and a relative humidity of 90%, and the diameter of the colony was measured crosswise with calipers.

The growth rate was recorded and the average growth rate (mm/d) was calculated.

The original strain XJ8, stored in our laboratory, was used as a control strain (CK).

The growth rates of the C. albicans strains are listed in Table 3.

Table 3 Growth rates of C. albicans strains a Significant

Average growth rate (mm/d) .

Difference

Tribes - - - - -

Repeat| Repeat [Repeat|Repeat| Repeat. 1%

Average 5% lung I lung II | lung III | lung IV | lung V

LQB-025 | 3,619 3,704 3,704 | 3,816 3,687 3,706+0.13 La | A 3,470 | 3,606 | 3,694 | 3,670 | 3,405 3,570+0.10 |» | b

Note: Data in the same column followed by different lowercase letters (uppercase letters) indicate that the difference is at the Poos level (Poo1) due to the

The Duncan test is significant, as shown in the following table.

As can be seen from Table 3, the growth rate of the C. albicans strain LQB-025 was faster, with an average growth rate of 3,706 mm/day, which was significantly higher than the average growth rate of the CK strain in the control group. After the

Measurement of the new complex polar deviation according to Duncan revealed differences between the colony growth rate of strain LQB-025 and the CK strain on the

A level of a = 0.01 is a highly significant level. (4) Determination of insecticidal activity indoors

The pathogenicity of the strain is directly related to the insecticidal/601702

The effect of the strain, which is an extremely important indicator of the strain's outstanding qualities.

Insects for the experiment: Overwintering surviving stem borer larvae were in the

Collected from rice stubble in spring, the larvae pupated, feathered, laid eggs, and hatched after being released from indoor stagnation. They were then reared on artificial food and, once they had developed to the age of 3, subjected to bioassay against C. albicans strains indoors.

Water beetles collected from the field in spring, and then the healthy and active live worms were selected as the insect for the experiment after being kept in a water bath for 10 days.

were raised indoors.

The C. albicans strain was inoculated onto a PDA plate medium and incubated for 10–15 days at 25°C and 90% relative humidity. The conidia were then transferred to a

A conidial suspension with a concentration of 1.5 x 10⁻⁶ conidia/ml in 0.1% sterile Tween-80 water was processed. The conidial suspension was poured into an autoclaved neck sprayer, and the third-stage larvae of the stem borer (or the adult) were sprayed.

Rice weevils were placed in a sterilized enamel tray for the test, and then the

Spray inoculation was performed using a neck sprayer for each strain (three times per

(Repeat depending on the sprayer), and four replicates were set up for each strain, with 20 third-stage larvae of the stem borer (or the adult

Rice weevils) for each replication. After spray inoculation, the 3rd-stage larvae (or the adult rice weevils) were individually placed into finger tubes lined with filter paper strips. The opening of the finger tube was sealed with a cotton ball to prevent the

to maintain ventilation. The controls were vaccinated with the same amount of sterile water containing 0.1% Tween-80. Both the treatments and the controls were administered at a

The embryos were incubated at a temperature of 25°C and 90% relative humidity. The finger tubes were filled with water for three days to maintain high humidity, and the

The number of infected dead worms was examined and counted daily from the second day onward, and the number of stiff worms was recorded for a cumulative total of 15 days, and finally the cumulative mortality rate was calculated. The original strain

XJ8, which is stored in our laboratory, was used as a control strain (CK) for the experiment.

The pathogenicity of C. albicans strains against the stem borer is shown in Table 4.

The pathogenicity of C. albicans strains against the rice rootworm is shown in Table 5.

Table 4 Pathogenicity of C. albicans strains against stem borers

Number of corrections, time until deaths | measured toxicity

Mortal Correlations

tribe | testwurst ; Mortal | Correlatio mortality onskoeffi e mer Wi | Wi | Wi | Wi hkeitsra | nequality (%) cient (head) | ed | ede | ede | ede te (%) |g (days)

olu | lun | lun | lun LU601 702 ng |gll|8 |g

I IT | IV

LQB- y = 1.084x |r = | 5,290. 19 119 |19 | 18 | 93.75 93 Aa 025 +0.546 0.9842 54 y=0.885x |r = | 5,880.

CK 19 |18 | 17 | 18 | 90.00 89.47b +1.075 0.9759 53

Tables 4 and 5 show that the pathogenicity of the C. albicans strain EH

M-068 was stronger in both the stem borer and the rice root borer, with a

Mortality rates of 93.75% and 75.00% respectively, and a corrected mortality rate of 93.42% and 73.68% respectively, which were higher than those of the control strain (CK) in the stem borer and in the

Rice rootworm, with all values differing significantly from the control strain (CK).

Table 5 Pathogenicity of C. albicans strains to the rice rootworm.

Number of

Deaths Co

Time until

Number ; ; | Correction

Wi | Wi | Wi . Toxicity to the liver | Wi Mortal correlations

Tribe ede | ede | ede. Correlatio Mortality

Testw | ed keit mortal onskoeffi . e rho | rho | rho n equivalence ürmer | erh (%) | hkeitsra cient lun | lun | lun g (days) (head) | olu te (%) g | 8 | 8 LToo ng

In | HI | IV

I y =

LQB- r= 8.03+ 14 | 15 | 15 | 16 | 75.00 | 73.68a | 0.746x + 025 0.9616 0.77 0.287 y = r= 9.14+

CK 15 | 14 | 14 | 14 | 7125 | 69.74b | 0.682x + 0.9963 0.88 0.051

Table 4 shows that the LT90 value of the C. albicans strain EH M-068 is based on the

Stem borer's lifespan is only 5.29 days, which is lower than the LT90 value of the CK strain of 5.88.

days; from Table 5 it can be seen that the LTeo value of the C. albicans strain EH M-068 on the stem borer is only 8.03 days, which is lower than the LT90 value of the CK strain of 9.14 days.

In summary, it can be stated that the C. albicans strain EH M-068 is a good

It has a controlling effect on the stem borer and the rice root borer.

Embodiment 3 Control of stem borer and rice weevil by means of a deh/601702

Paenibacillus sp. strain LQB-025 insecticide produced 1) Field test method:

In May-June 2016, a rice field in the city of Gongzhuling in Jilin Province was equipped with a

An area of 300m² was selected as the test base, and a total of six treatments were carried out according to the...

The trials were conducted randomly. Treatments I to IV were all carried out with insecticides containing the Coccidioides albicans strain LQB-025 according to the invention, wherein the conidia content of the Coccidioides albicans strain LQB-025 in the insecticides was 5 billion.

The spore count per gram of the fungus was [missing information]. Treatments I to IV were sprayed with 62.5 g/mL, 125 g/mL, 250 g/mL and 500 g/mL respectively, while treatment V was carried out with a biopesticide and the treatment [missing information].

VI was sprayed with water as a control. Treatments I to VI were performed with a

The backpack sprayer sprayed evenly onto the stems and leaves of the rice field, and a

The treatment was applied one week after planting the rice seedlings (May 25), and then every 7 days thereafter. One application was made at the gestation stage (June 30), followed by another application every 7 days. (2) Data collection method

The density of adult rice weevils in the different treatments was measured 3 days after the first and second applications (i.e., on May 28 and June 5), with 5 points in each

The field was examined at random, with 100 rice plant clumps at each point;

On July 25th, we examined the degree of damage caused by the rice rootworm in relation to the wilted heart, the wilted leaf sheath, and the white ear.

Effectiveness of insecticides against the rice rootworm in the field (Table 5).

Insecticides against stem borers: Field efficacy, Table 6.

Table 5 Insecticides against the rice rootworm Field efficacy of the situation Table

Number of the number of the number of adults adults adults

Insects before the beetles after 3 beetles after 10 | Control effect

Treatment

Treatment days (%) (head/100 (head/100 (head/100

Bushes) Bushes) Clumps)

Treatment IM | 68 | M | 18 | 7% 6

Treatment IV 75 39 16 €78.67 1 «x | TT | 8 | EL

As can be seen from Table 5, treatments I to IV were carried out with insecticides containing the Coccidioides albicans strain LQB-025 according to the invention. The population of adult rice weevils in the field began to decline 3 days after the first application, and 3

Days after the second application, the adult population was significantly reduced; at dd/601702

For treatments I to IV, the control effect in the field was 3 days after the second treatment.

Application rates of 46.25%, 64.29%, 77.94% and 78.67% respectively.

With the increase in the amount of insecticide sprayed, the effect of field control on the

Rice root beetle. In addition to treatment 1, the field control effect against the

Rice root beetle infestation was somewhat lower than in treatments 2 to 4; the field control effect against the rice root beetle was more than 60%, which was much higher than in the control group without treatment.

Insecticides; although the field control effect of treatment 5, in which chemical pesticides were used against the rice root beetle, reached 98.75%, the cost of chemical

Pesticide levels are high and they can pollute the environment.

Table 6 Field control efficacy of insecticides against stem borers

Percent

Ver ents

Gesa | blü | atz . Mittl

Ver Rate Wei mtza | hte | der | Verwel Verwel ere wel der | We | Bspit | Teil hl | He | verw kte kungsra Wirk kte verwelk | iBe | zigk | weiße der | rz- | elkte | Herzrat te der . - samk

Sc ; ten Ah | eit Ahren

Pfla | Pfl | 2 e vagina with hot vagina | re (% | (%) nzen | num | heart | (%) (%) (% de (%) ) en en ) (% )

Beh andl 998 | 12 | 1.20 | 47.83a | 14 1.40 46.15a 5 | 0.50 | 37.50a | 43 83 ung

I

Beh andl | 1186 0.76 | 60.87b | 10 | 0.84 | 61.54b | 4 | 0.34 55.56b | 5932 ung

IT

Beh andl | 1008 0.79 | 65.20c 0.89 | 6538 | 3 | 0.30 | 66.67c | 65.76 ung

III

Beh andl | 1106 | 7 | 0.63 | 69.57c 0.72 | 69.23c | 3 | 027 | 66.67c | 68.49 ung

IV andl ung LU601702 wll

EC 0

As can be seen from Table 6, in treatments I to IV using insecticides prepared with the C. albicans strain LQB-025 according to the invention, the three indices for heart wilting rate, sheath wilting rate, and white ear rate of the rice plants were significantly reduced compared to the control group CK. Among these, the average preventive effect of treatments three and four on the rice stem borer reached more than 65%, which shows that the insecticide prepared with the

The Coccidioides albicans strain LQB-025, produced and provided by the present invention, has a clear effect on the rice stem borer. Although the average efficacy of chemical pesticides against the rice stem borer reached 585.54% in treatment, chemical pesticides are expensive and readily cause environmental pollution.

As can be seen from the combined Tables 5 and 6, the insecticides that the

The Coccidioides albicans strain LQB-025, which is provided by the present invention, contains obvious effects on both the rice weevil and the

Stem borers, which are the main pests in the rice production process.

Finally, it should be noted that the above embodiments serve only to illustrate the technical solutions of the present invention and do not limit them.

Although the present invention is described in detail with reference to the foregoing

As the embodiments described above have been explained, the person skilled in the art should understand that it is still possible to modify the technical solutions recorded in the foregoing embodiments or to replace some or all of the technical features contained therein with equivalent ones; and these modifications or replacements do not remove the essential nature of the corresponding technical solutions from the scope of the technical description.

Solutions to the embodiments of the present invention.

Claims (5)

Claims LU601702 1. A Coccidioides albicans strain LQB-025, characterized in that the Coccidioides albicans strain LQB-025 was deposited on March 30, 2016 at the General Microbiology Center of the China Microbial Strain Deposit Control Committee under deposit number CGMCC No. 12110. 2. The Coccidioides albicans strain LQB-025 according to claim 1, characterized in that the colonies of the Coccidioides albicans strain LQB-025 have a fluffy appearance in the early phase of culture and in a later phase form a creamy, powdery spore layer with a uniform thickness and a slightly raised center; the mycelium is hyaline, with segregation and branching, colorless and smooth, with a width of 2.7-3.6 µm; the conidia stalk is mostly flask-shaped, solitary or bundled; and the conidia are unicellular, colorless, globular or egg-shaped, with a size of 2-3 pm x 2-2.5 µm. 3. The application of the Coccidioides albicans strain LQB-025 according to claim 1 in the control of the stem borer. 4. The application of the Coccidioides albicans strain LQB-025 according to claim 1 in the control of the rice weevil. 5. The use of the Coccidioides albicans strain LQB-025 according to claim 1 in the manufacture of insecticides.