LU600477B1 - An sgrna targeting the knockout of the zebrafish sigirr gene and its crispr/cas9 system and applications - Google Patents

Abstract

This invention provides an sgRNA targeting the zebrafish SIGIRR gene for knockout, along with its CRISPR/Cas9 system and applications, belonging to the field of gene knockout technology. The invention offers an sgRNA for knocking out the zebrafish SIGIRR gene, a primer set for amplifying the sgRNA, and a CRISPR/Cas9 system for knocking out the zebrafish SIGIRR gene. The invention also provides a method for creating SIGIRR gene knockout zebrafish using CRISPR/Cas9 gene editing technology. The resulting SIGIRR gene knockout zebrafish are more susceptible to Edwardsiella piscicida and Mycobacterium marinum, show higher bacterial loads, increased harmful intestinal bacteria, and accelerated juvenile fish mortality. These fish can be used for research on bacterial infections in fish and for screening drugs related to antibacterial fish treatments.

Description

DESCRIPTION LU600477

AN SGRNA TARGETING THE KNOCKOUT OF THE ZEBRAFISH SIGIRR GENE

AND ITS CRISPR/CAS9 SYSTEM AND APPLICATIONS

TECHNICAL FIELD

This invention belongs to the field of gene knockout technology, particularly involving an sgRNA targeting the knockout of the zebrafish SIGIRR gene and its CRISPR/Cas9 system and applications.

BACKGROUND

The anti-inflammatory gene SIGIRR, also known as TIR8 or IL-1R8, is a conserved gene found in vertebrates, including fish, and belongs to the IL-1R family. It is also a critical signal transduction element in the Toll-like receptor (TLR) signaling pathway.

SIGIRR is a transmembrane protein that contains an extracellular Ig-like domain and an intracellular TIR domain. SIGIRR acts as a negative regulator in the IL-1R and TLR downstream signaling pathways, and its downregulation during inflammatory damage is considered an important condition.

Gene targeting technology, originating in the late 1980s, is an important method for studying gene function by making specific modifications to the genome. It can also be used to treat various genetic diseases in humans. This technology mainly utilizes methods like deletion mutations, gene inactivation, large chromosomal deletions, and foreign gene introduction to modify the genetic information of organisms. After stable inheritance in the germline, it expresses mutated traits, thus allowing the study of the role of specific genes in the growth and development of organisms. Consequently, these techniques have become a hotspot in modern molecular biology research.

Traditional gene targeting technology is based on embryonic stem cells (ESC) anld/600477 homologous recombination, leading to low efficiency. The artificial nuclease

CRISPR/Cas9, however, allows for more efficient and precise gene silencing in the organism’s genome.

It is simple to create, low-cost, and can simultaneously target multiple sites on a gene, enabling the silencing of any number of individual genes. However, this technology has certain drawbacks, including a relatively high off-target rate.

SUMMARY

In view of the above, the object of the present invention is to provide an sgRNA targeting the knockout of the zebrafish SIGIRR gene, a primer set for amplifying the sgRNA, and a CRISPR/Cas9 system for knocking out the zebrafish SIGIRR gene, which can efficiently knock out the zebrafish SIGIRR gene.

The invention also aims to provide a method for gene knockout selection to breed

SIGIRR gene knockout zebrafish, through CRISPR/Cas9 gene editing technology, to obtain SIGIRR gene knockout zebrafish.

Furthermore, the invention aims to provide the application of the SIGIRR gene knockout zebrafish in bacterial infection fish disease research and related drug screening.

To achieve the above objectives, the present invention provides the following technical solutions:

The invention provides an sgRNA targeting the knockout of the zebrafish SIGIRR gene, with the nucleotide sequence of the sgRNA as shown in SEQ ID NO: 1.

The invention also provides a primer set for amplifying the sgRNA, which includes an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in

SEQ ID NO: 3.

The invention further provides a CRISPR/Cas9 system targeting the knockout of the zebrafish SIGIRR gene, which includes the above sgRNA and Cas9 mRNA.

Preferably, the preparation method for the Cas9 mRNA includes the following steps: linearizing the pXT7-zCas plasmid with Xba I-QC, recovering the enzyme-digested product, and synthesizing Cas9 mRNA by in vitro transcription.

The invention also provides a kit for targeting the knockout of the zebrafish SIGIRR/600477 gene, which includes the above CRISPR/Cas9 system.

The invention further provides a method for gene knockout selection to breed SIGIRR gene knockout zebrafish, including the following steps: introducing the above

CRISPR/Cas9 system into zebrafish embryos, cultivating and screening to obtain SIGIRR gene knockout zebrafish.

Preferably, the method further includes the following steps: crossing the SIGIRR gene knockout zebrafish with wild-type zebrafish to obtain F1 embryos, and after cultivating and screening, obtaining F1 SIGIRR gene knockout zebrafish; then self- crossing the F1 SIGIRR gene knockout zebrafish to obtain homozygous SIGIRR gene knockout zebrafish.

The invention also provides the application of the SIGIRR gene knockout zebrafish prepared by the above method in bacterial infection fish disease research.

The invention also provides the application of the SIGIRR gene knockout zebrafish prepared by the above method in screening drugs for bacterial infections in fish.

Preferably, the bacteria are Edwardsiella piscicida or Mycobacterium marinum.

Compared with the prior art, the present invention has the following advantages:

The present invention designs appropriate targeting sites on the zebrafish SIGIRR gene, develops an sgRNA that efficiently and precisely knocks out the SIGIRR gene in the zebrafish genome, and uses CRISPR/Cas9 gene editing technology to select and breed SIGIRR gene knockout zebrafish, ultimately obtaining homozygous SIGIRR gene knockout zebrafish.

The SIGIRR gene knockout zebrafish constructed in the present invention exhibits a stable 4bp deletion near the target PAM region in its gene sequence.

These zebrafish are more susceptible to Edwardsiella piscicida and Mycobacteriuk/600477 marinum, with increased bacterial load in the fish and a higher content of harmful bacteria in the intestine, which accelerates the death of juvenile fish. This makes them useful as animal models for bacterial infection fish disease research and for screening drugs related to bacterial infections in fish.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1: Electrophoresis of target detection PCR products;

Figure 2: Sequencing peaks of FO generation SIGIRR-gRNA2:;

Figure 3: Mutation types of FO generation embryos of SIGIRR-gRNA2;

Figure 4: Male-female ratio of F2 generation SIGIRR-gRNA2;

Figure 5: Survival rate of wild-type zebrafish and SIGIRR-/- zebrafish infected with

Mycobacterium marinum;

Figure 6: Transcriptome sequencing results after SIGIRR loss;

Figure 7: SIGIRR loss leads to changes in zebrafish intestinal microbial flora;

Figure 8: SIGIRR loss leads to changes in zebrafish intestinal microbial phenotypes.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides an sgRNA targeting the knockout of the zebrafish

SIGIRR gene, where the nucleotide sequence of the sgRNA is as follows:

TGTAATACGACTCACTATAGGTTGTACTCGCTCTCGCAGGTTTTAGAGCTAGAAATA

GCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGGTGGCACCGAGTCGG

TGCTTTTTTT, as shown in SEQ ID NO:1.

The present invention also provides a primer set for amplifying the above sgRNA.

The primer set includes an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO3. The SEQ ID NO:2 sequence is

TGTAATACGACTCACTATAGGTTGTACTCGCTCTCGCAGGTTTTAGAGCTAGAAAT, and the SEQ ID NO:3 sequence is AAAAAAAGCACCGACTCGGTGCCAC.

The primer set uses zebrafish genomic DNA or plasmid vectors containing zebrafigh/600477

SIGIRR as templates for amplification, and the sgRNA template is then synthesized by in vitro transcription.

The present invention further provides a CRISPR/Cas9 system targeting the knockout of the zebrafish SIGIRR gene, which includes the above sgRNA and Cas9 mRNA.

By utilizing the specificity of the sgRNA, the system recognizes a specific DNA sequence of the SIGIRR gene, guiding the Cas? protein to the target sequence for cleavage. This results in a non-muitiple of three base pair deletion near the target PAM region of the SIGIRR gene, thereby preventing the normal biological function of the gene.

The preparation method of Cas9 mRNA in the present invention includes the following steps: linearizing the pXT7-zCas plasmid with Xba 1-QC, recovering the enzyme-digested product, and performing in vitro transcription to synthesize Cas9 mRNA. Preferably, the Cas9 mRNA is synthesized with a poly A tail, which increases its stability and efficiency. The pXT7-zCas plasmid used in this invention is purchased from

Baosheng Biological, and there are no specific restrictions on the Xba I-QC digestion method, product recovery method, or in vitro transcription method.

The present invention also provides a CRISPR/Cas9 system-targeted knockout kit for the zebrafish SIGIRR gene, which includes the above-mentioned CRISPR/Cas9 system. Preferably, the kit further includes reagents for gene knockout identification, which may include PCR amplification primers, PCR reagents, etc.

The present invention further provides a method for generating SIGIRR gene knockout zebrafish, which includes the following steps: introducing the above

CRISPR/Cas9 system into zebrafish embryos, followed by culturing and screening to obtain SIGIRR gene knockout zebrafish. in the CRISPR/Cas9 system of the present invention, the preferred concentration of

Cas9 mRNA is 300 na/uL, and the preferred concentration of sgRNA is 100 ng/uL. The preferred delivery method is microinjection.

As an optional implementation, the method involves injecting one-cell stage wil§l600477 type zebrafish embryos using a Picoliter Microinjector, with an injection volume of 1 nl (containing 0.3 ng of Cas9 mRNA and 0.1 ng of sgRNA) per fertilized egg, an injection time of 1 ms, and injection into the yolk of the embryo.

The method for generating SIGIRR gene knockout zebrafish further includes the following steps: crossing the SIGIRR gene knockout zebrafish with wild-type zebrafish to obtain F1 embryos, followed by culturing and screening to obtain F1 zebrafish with SIGIRR gene deletion. The F1 zebrafish are then self-crossed to obtain homozygous SIGIRR gene knockout zebrafish.

Preferably, the genomic DNA from the F1 generation is extracted and subjected to

PCR amplification. The PCR products are purified and sent to the company for sequencing to detect whether the F1 individuals carry the mutation and the type of mutation. F1 individuals with the same mutation type (same number of mutated bases and the same mutated base) are raised to sexual maturity and bred to obtain homozygous

SIGIRR gene knockout zebrafish. The forward PCR primer for detecting the target site is

SIGIRR-cexu-1F: GAAGGGAGCAGGTGAGCA, as shown in SEQ ID NO:4, and the reverse primer is SIGIRR-cexu-1R: CTAAAATCGTGTCAGGGA, as shown in SEQ ID

NO:5.

The present invention further provides the use of the homozygous SIGIRR gene knockout zebrafish obtained by the above method in the study of bacterial infections in fish and in the screening of drugs related to bacterial infection in fish. Preferably, the bacteria are Edwardsiella piscicida or Mycobacterium marinum.

The following examples illustrate the technical solutions provided by the present invention in detail but should not be understood as limiting the scope of the invention. All materials and reagents used in the following examples can be obtained from commercial sources uniess otherwise specified.

Example 1

Construction of SIGIRR Gene Knockout Zebrafish Using CRISPR/Cas® Gene

Knockout Technology:

The specific steps are as follows:

1. Plasmid Acquisition: Purchase the pXT7-zCas9 plasmid (Cas? mRNA templald/600477 plasmid) from Baosheng Biological. 2. sgRNA Target Site Design:

Before designing the sgRNA for the target site, first search and download the DNA sequence, MRNA sequence, exons, introns, and amino acid sequences of the zebrafish

SIGIRR gene from the gene database on the NCBI website (hitp:/Awvww ncbi.nim.nih.govipubmed/). Then, based on the gene information, select target sites on the CRISPR/Cas9 target site prediction website CETop (http-//crispr. COS.uniheidelberg.de/) that meet the requirements, have high scores, and low off-target efficiency. The specific design principles are as follows:

The target site can be on the sense or antisense strand, but it should be located in the nucleotide sequence corresponding to the functional domain of the encoded protein or upstream of it.

In principle, the target site should be in the exon region within the first two-thirds of the CDS of the gene. Avoid choosing sites in the 5’-UTR and 3-UTR regions.

Pay attention to avoiding the presence of the same reading frame’s start codon downstream of the first start codon.

The base sequence near the target site should be as complex as possible and not contain many consecutive repeat sequences.

The length of the sgRNA target site should be 18-23 base pairs.

The Y end of the sgRNA should contain the PAM sequence (NGG, where N is any base). The two bases adjacent to the 5’ end should ideally be GG, and the third base should be G/A. À single G is acceptable, but the transcription efficiency of the T7 promoter in vitro will be slightly lower. » Avoid consecutive T bases at the end of the target site sequence. The GC content should be controlled within the range of 40%-60%.

After selecting two or more target sites, perform a sequence alignment on NCBI to ensure that no identical sequences are present. Design primers near the target site and perform PCR amplification followed by sequencing and comparison to avoid gene mutations near the target site or the presence of heterozygous samples that might affect the experiment.

The zebrafish SIGIRR exon sequence LU600477

IS.ATGTGGCGCTGTCACTTCATTCTCTTCCTGACATGTCTCGCGAACTCTCATTCTG

CAGATTCCCTTTGTGGCAGCTCTCCAGAGTTCAAGCATGATCGAACACAGTCAGTG

TCGAGTACGCTTGGTCACAGTGTGGTCCTCACCTGCACGGCCTCCATGGGTTTGA

ACGGAACAGATTTAGATTGTGAAGACCACCCGGAGTGGATGAAAGACGGCTTACA

GCTCACAAACCTCACAATTTATCCTCAAAATAGTAAAGAATGGTATACTGATGATGA

GGGTCGCATGGAAAGCAGTGAATTAACTCTAACCCTGCGAGATCGGGCTGATTIT

GGAGTGTATTACTGCATAGTGAGGAACAGCACAGCACAATTCACCGTGAAGGAATA

TAAGTCCCCCAGTCACACAGGAGCAGTGGTGGCTTCAGTGGTTATGTTGGTTGTA

CTCGCTCTCGCAGCGGTGGTCTATTCCAAGTGCAGACTCAACTTTAAACTGTGGTA

TAAGAATATTTACGGAGAGTATGAGATCAACGATGGTAAAATGTATGATGCCTACAT

CTCGTATGTCAACAATGAGAATGACAGGAAGTTTGTCAATTTTATCCTGAAGCCACA

TTTGGAGAACAAGTACAGTCATAAGCTGTTGCTCAATGACACAAACATCCTTCCTG

GAGCTGAGCCGTCAGCTGAGCTGCTGATGAACATAAGCCGATGTCGAAGGTTGAT

TGTGGTTCTCTCTCAGTCATACCTGGAGCAGGAGTGGTGCACTACCAATTTTAGAC

AGGGTTTGTGGCACCTGATCGAGCTGTCAAGGAAGCCCATTTTCATTATATTTCAG

TCCCAGCAGAAGCAAATAAGCCAGGACATCAGTCAGCAGCTGAGACAACACCAGC

CTTGTATCACTATGATCACCTGGGGCGCACATTCCATGACTCCTTCTTCAGGGTTC

TGGAAGGAACTTGCACTGGTAATGCCACGTAAGGTTACGTTTCACAGGGAATCTGC

AGGTGATCCACAGACTTTGTTACAGGGTGATAAAGCTCCCATGCTCACCCAGCAG

CCTGATTACCTGGACTGCAGACTGGACCCCGATCCGGCAGGAGACCTGGGTTTGC

GTTTGCCCATCTACAAGACCCTTCCCACCAAAGCTCCGGTGCTTCCTGCGGCTCCT

GGCCCGACAGGTGAAGCAAAACCTTCAGAGATAGATGTGTCTGACCTTGGTTTGA

GGAACTACTCTGCCCGCAGAGACTTTTACTGCCTGGTCACGGATGATGATTTATGA

. As shown in SEQ ID NO: 5. The underlined part is the target site.

The nucleotide sequence of the final designed sgRNA is shown as SEQ ID NO:1 (referred to as sgRNAZ2 in subsequent experiments).

After the target site design, forward and reverse primers required for amplifying tHé/600477 sgRNA were obtained. A T7 promoter sequence was added to the 5 end of the target sequence, and a primer sequence for the upstream sgRNA scaffold was added to the 3’ end.

The resulting sequence is the upstream primer sequence required for amplifying the zebrafish gene knockout site, named SIGIRR-gRNA-F, as shown in SEQ ID NO:2. The universal reverse primer sgRNA-R sequence comes from the downstream sequence of pMD19-T sgRNA, named SIGIRR-gRNA-R, as shown in SEQ ID NO:3. (3) sgRNA Synthesis

Step 1: Synthesis of sgRNA Template

Using the zebrafish whole genome as a template, PCR amplification of SIGIRR- gRNA-F and SIGIRR-gRNA-R was performed. Initially, a small-scale amplification was carried out. 4 uL of the PCR product was taken using an enzyme-free tip and subjected to 2% agarose gel electrophoresis to separate the target band. The target fragment was approximately 120 bp. After confirming that the band size met expectations, PCR amplification was continued to obtain a higher concentration sgRNA template for in vitro transcription (ideally over 500 ng/uL). Eight additional PCR samples with the same system were amplified, with 50 uL/gel well of the largest fragment of the agarose gel subjected to electrophoresis at 100V for 20 minutes.

Step 2: Recovery of sgRNA Template

The DNA band obtained from PCR electrophoresis was recovered using the OMEGA gel recovery Kit. Important notes: The electrophoresis chamber and gel template must be cleaned thoroughly before use, and fresh 1xTAE electrophoresis buffer should be prepared. Gel cutting must be done quickly to prevent DNA mutations caused by prolonged UV exposure. Additionally, enzyme-free tubes and tips should be used throughout the recovery process, and a newly opened OMEGA gel recovery kit should be used to avoid enzyme contamination.

Step 3: In vitro Transcription to Synthesize sgRNA

Synthesize sgRNA in vitro according to the instructions of the in vitro transcription kit

MAXI script T7 Kit Ambion. The in vitro transcription system is:

10 x Transcription Buffer 1uL LU600477 (dissolve at room temperature first, then vortex and mix well before microcentrifugation, and finally add the transcription system) 10 mM ATP 0.5uL 10 mM GTP 0.5uL 10 mM CTP 0.5uL 10 mM UTP 0.5uL

T7RNA polymerase 1uL sgRNA template recovered after synthesis 1UL

Enzyme-free water/DEPC water to 10uL

Add all the above solutions, vortex and mix well, and then add RNA Inhibitor.

RNA Inhibitor 0.5uL

Incubate the transcription product at 37°C for 4 hours, then aliquot 0.5 uL of the transcription product. Use 2% agarose gel electrophoresis to check the RNA transcription. Observe the brightness and integrity of the electrophoretic bands. If the

RNA bands are faint, additional PCR samples from earlier steps can be pooled during the gRNA purification experiment to increase the recovery concentration. If the transcription bands exhibit noticeable trailing, it indicates RNA degradation, and a new synthesis should be performed. If the transcription bands are clear and without trailing, add 1 UL of

DNase | to the reaction solution and incubate at 37°C for an additional 30 minutes to remove the DNA template.

Step 4: sgRNA Precipitation and Recovery

Use the phenol-chloroform-isoamyl alcohol extraction method to precipitate and recover sgRNA. The sgRNA nucleotide sequence is shown as SEQ ID NO:1. (4) Cas9 mRNA Synthesis

Step 1: Linearization of the Cas9 mRNA Template Plasmid

The pXT7-zCas plasmid must be linearized using the restriction enzyme Xba I-QC.

The digestion reaction setup is as follows:

Linearized plasmid: 1 ug 10 x Reaction buffer: 5 uL

Restriction enzyme Xba I-QC: 5 U LU600477

RNase-free H20: up to 50 uL

Incubate at 37°C for 1 hour.

After digestion, check the reaction using electrophoresis. A 0.5 uL sample of the digested product is electrophoresed against the plasmid solution as a control. Run a 1% agarose gel to ensure complete digestion. Once the plasmid is fully linearized, purify and recover the digested product.

Step 2: Recovery of Cas9 mRNA Plasmid Digestion Product

Use the phenol-chloroform-isoamyl alcohol extraction method to recover the Cas9

MRNA plasmid digestion product.

Step 3: In vitro Transcription to Synthesize Cas9 mRNA

Follow the instructions provided in the T7 MMESSAGE mMACHINE Transcription Kit manual for in vitro transcription to synthesize the Cas9 mRNA for microinjection.

Note: Samples should be handled on ice, and all reagents except for T7 Enzyme Mix and 2xNTP/CAP should be brought to room temperature and vortexed briefly before use.

All reagents must be microcentrifuged to prevent loss or contamination from materials on the tube walls.

Add a poly A tail to the reaction product (adding a poly A tail improves the stability and efficiency of the Cas9 mRNA). Use the Tailing Kit from Ambion and follow the instructions in the manual. After mixing, incubate the reaction at 37°C for 1 hour.

Before adding E-PAP enzyme (stored on ice), aliquot 0.5 pL of the mixture and incubate with the enzyme reaction mixture. After completion, run the two samples together on a 1% agarose gel for comparison. The electrophoretic product should be approximately 2000 bp. The reaction product with the poly A tail should be slightly larger.

Step 4: Precipitation and Recovery of Cas9 mRNA

Use the phenol-chloroform-isoamyl alcohol extraction method to recover the Cas9 mRNA.

(5) Microinjection LU600477

Prepare 2 uL of microinjection solution: thaw the previously prepared sgRNA and

Cas9 mRNA stored at -80°C and place on ice. Adjust the final concentration of sgRNA to 100 ng/uL and Cas9 mRNA to 300 ng/L.

Add 0.2 pL of 0.05% phenol red solution as a tracking dye (this volume is not included in the total volume). Inject the prepared solution into the tip of a pulled capillary glass needle or fill the microinjection needle.

Secure the microinjection needle and inject into single-cell stage wild-type zebrafish embryos using a Picoliter Microinjector. Adjust the injection pressure to control the volume injected into each fertilized egg to 1 nL (containing 0.3 ng of Cas9 mRNA and 0.1 ng of sgRNA). Set the injection time to 1 ms and inject into the yolk of the embryo. Inject at least 300 embryos per experiment and keep an equal number of uninjected wild-type embryos as controls. After injection, place the embryos into a petri dish and add 10-15 mL of methylene blue embryo culture solution (purchased from Merck Bio). Incubate the embryos at 28.5°C in a constant-temperature illuminated incubator. Regularly monitor the embryos, change the water, and record and remove any dead eggs.

Example 2

Verification of SIGIRR target site knockout efficacy in SIGIRR gene knockout zebrafish generated in Example 1:

Design of Target Site Detection Primers: SIGIRR target site PCR primers were designed using Primer 6.0 software. The forward primer is SIGIRR-cexu-1F (SEQ ID NO: 4), and the reverse primer is SIGIRR-cexu-1R (SEQ ID NO: 5).

DNA Extraction from Zebrafish Embryos: On the second day after microinjecting zebrafish embryos with a mixture of sgRNA and Cas9 mRNA, 20 embryos from both the injected group and the control group (un-injected) were randomly selected and placed in 1.5 mL centrifuge tubes. Genomic DNA was extracted using proteinase K lysis. Embryos were first washed two to three times with sterile water and then crushed using a micropipette tip. To each centrifuge tube, 500 uL of HOM buffer (lysis buffer) and 10 uL of proteinase K were added and mixed using a vortex mixer.

The mixture was incubated in a 55°C water bath for approximately 3 hours, with/600477 shaking every 30 minutes until the tissue was fully lysed and the solution became clear, signaling termination of digestion. Then, 500 pL of 5 M saturated NaCl and 300 pL of chloroform were added, mixed thoroughly, and centrifuged at 12,000 rpm for 10 minutes at 4°C.

The supernatant was carefully transferred into a clean 1.5 mL centrifuge tube, and 0.7 volume of isopropanol was added, mixed thoroughly, and then centrifuged at 13,000 rpm for 10 minutes at 4°C. After removing the supernatant, the DNA pellet was washed with 500 pL of 75% ethanol, mixed gently, and incubated for 5 minutes before another 10-minute centrifugation. The ethanol wash was repeated, and the remaining liquid was discarded.

The pellet was dried on absorbent paper for 5 minutes. After drying, 25 uL of sterile water was added to dissolve the DNA pellet. The DNA was vortexed and divided into aliquots: 2 uL for DNA concentration and purity measurement, and the remaining stored at -20°C.

Amplification of Knockout Target Site Sequence: The extracted zebrafish DNA was used as a template for PCR amplification of the target site using the designed primers.

The PCR reaction mixture contained 2 uL DNA template, 0.5 uM each of forward and reverse primers, 0.125 uL ExTaq high-fidelity enzyme, 2.5 uL ExTaq buffer, 2.5 uL dNTP

Mix, and sterilized water to a final volume of 25 uL. The PCR conditions were: 98°C for 2 minutes, followed by 35 cycles of 98°C for 30 seconds, 57°C for 30 seconds, and 72°C for 1 minute, with a final extension at 72°C for 5 minutes. 2 uL of the PCR product was analyzed by electrophoresis on a 1% agarose gel to check for the presence of the desired band.

Sequencing and Mutation Analysis: The PCR products with good amplification were scaled up to 50 uL, and the PCR products were purified by gel extraction for sequencing.

DNA concentration and purity were measured using a micro-ultraviolet spectrophotometer. The purified DNA was sent for sequencing to Shanghai Shenggong

Biotechnology Co., Ltd.

The sequencing results containing double peaks were aligned with the zebrafigh/600477 genomic DNA using the NCBI website or DNAMAN software to compare the control and injected groups, checking for mutations in the injected group DNA. Figure 2 shows that mutations were present in the injected group, confirming that at least one of the 20 embryos in the injected group contained a mutation.

Mutant type detection at target site: to further validate the specificity and feasibility of the gene knockout target site design, the PCR purified product was subjected to TA cloning to detect mutation types. The TA cloning system used PMD-19T vector (0.5 EL),

DNA template (2 uL), Solution | (2.5 pL), mixed using a micropipette, and incubated in a water bath at 16°C for 4 hours. The ligated vector was then transformed into competent cells. Single colonies from the agar plates were picked, and after PCR identification, 20 positive clones were selected for sequencing using universal PMD-19T vector sequencing primers.

The remaining bacterial cultures and plates were stored at 4°C for future use.

Sequencing results were analyzed using SnapGene 5.0.8 software to view the peak diagrams, and sequence alignment was performed with DNAMAN 8.0 software. The results are shown in Figure 3.

The results showed that near the PAM region of the SIGIRR gene sequence in the knockout zebrafish, there were base deletions not in multiples of three, indicating that

CRISPR/Cas9 gene editing technology was successful in knocking out the SIGIRR gene in zebrafish.

Example 3 LU600477

Mutant Screening and Homologous Mutant Acquisition for SIGIRR Gene-Deleted

Zebrafish Constructed in Example 1: 1. Mutant Screening

The zebrafish obtained in Example 1 is the FO generation. By breeding FO zebrafish to sexual maturity, and then crossing them with wild-type mature zebrafish to produce the

F1 generation, a genetically stable mutant is obtained. For each FO generation, 20 F1 embryos are collected, and genomic DNA is extracted from the embryos. PCR verification is carried out using mutation detection primers, following the method of Example 2. After purifying and recovering the PCR products, sequencing is performed by a biological company to confirm the mutation type.

If mutations are detected in the F1 embryos with deletions or insertions that are not a multiple of three bases, the FO generation is retained and bred to continue producing F1 embryos. 2. Acquiring Homologous Mutants

F1 zebrafish from mutant FO generation, after sequencing and mutation analysis, are raised to approximately 3 months of age, reaching a size where their tail fins can be cut.

Each zebrafish is placed in a separate PVC plastic holding box, numbered, and a small piece of the tail fin is clipped.

The tail fin is cleaned twice with sterile water and placed in a centrifuge tube for genomic

DNA extraction. PCR amplification is conducted with mutation detection primers using the extracted genomic DNA, and the amplified product is purified and sequenced to check whether the F1 individual carries the mutation and to determine the mutation type.

F1 zebrafish with the same mutation type (both male and female) are bred to sexula600477 maturity and used as parents. They are then crossed to produce F2 generation zebrafish that may contain homologous mutants. After two months of feeding, F2 zebrafish are placed into separate PVC holding boxes, and fin samples are taken for genomic DNA extraction. PCR amplification products are purified and sequenced to identify homozygous mutants from the F2 generation.

After raising the F2 zebrafish to sexual maturity, genomic DNA is extracted for sequencing, and the sex ratio is recorded. The number of males and females in the wild- type (SIGIRR+/+), heterozygous (SIGIRR+/-), and homozygous (SIGIRR-/-) groups is statistically analyzed. The results are shown in Figure 4.

The data in Figure 4 show that in the F2 generation, homozygous mutants (SIGIRR-/-) account for about 16%, with a higher proportion of females.

Example 4 infection Experiment with Edwardsiella piscicida and Mycobacterium marinum in

SIGIRR-/- Zebrafish from Example 3: 1. Wild-type zebrafish and SIGIRR-/- zebrafish were artificially bred. Embryos from both groups were collected, and on day 4 of embryonic development, the hatched larvae were randomly divided into 9 groups (30 larvae per group). The larvae were transferred to small plastic fish tanks, with 100 mL of sterile water added. Three groups were used to determine the survival rate after infection with Edwardsiella piscicida; three other groups were used for Mycobacterium marinum infection; and the final three groups were used as bacterial-free controls. 2. Edwardsiella piscicida and Mycobacterium marinum bacterial suspensions were prepared and concentrated to a concentration of 9.7 x 10° CFU/mL. 3. The concentrated bacterial suspensions were added to the small plastic fish tanks. For each tank, 2.03 mL of bacterial suspension was added, achieving a final bacterial concentration of 2.0 x 10° CFU/mL in the tank, and gently mixed. No bacterial suspension was added to the control groups.

4. After 6 hours of infection at 28°C, 400 mL of sterile water was added to reach a totl}600477 volume of 500 mL. The survival of larvae was recorded daily, and dead fish were removed in a timely manner.

The results showed that SIGIRR-/- zebrafish were more susceptible to both Edwardsiella piscicida and Mycobacterium marinum infections. Compared to wild-type zebrafish, the

SIGIRR gene deletion increased bacterial load in the fish and accelerated the mortality of the larvae. The survival rate of zebrafish infected with Mycobacterium marinum is shown in Figure 5.

Fish bodies from the Mycobacterium marinum infection group (wild-type zebrafish and SIGIRR-/- zebrafish) were taken separately, and total RNA was extracted from the whole fish (using the Trizol kit) for transcriptome sequencing (sent to Meiji Biotech for sequencing). The transcriptome sequencing results after SIGIRR deletion are shown in

Figure 6, and the KEGG pathway enrichment analysis of differentially expressed genes between wild-type zebrafish and SIGIRR-/- zebrafish is shown in Table 1

Table 1 KEGG pathway enrichment analysis of differentially expressed genes between

WT and SIGIRR-/- zebrafish

KEGG Description P value pathway id map04215 Apoptosis-multiple species 0.00215169 map04218 Cellular senescence 0.016321344 map04672 Intestinal immune network for IgA 0.172288768 production map04115 p53 signaling pathway 0.20790526 map04668 TNF signaling pathway 0.263345075 map04620 Toll-like receptor signaling pathway 0.33948305 map05321 Inflammatory bowel disease 0.437689041 map04062 Chemokine signaling pathway 0.498238594 map04010 MAPK signaling pathway 0.681763905 map04630 JAK-STAT signaling pathway 0.849792355 map04064 NF-kappa B signaling pathway 0.94142969

Figure 6 and Table 1 show that the phenomenon of intestinal apoptosis in zebrafish is more serious after SIGIRR gene deletion.

The intestinal tissues of the wild-type zebrafish and SIGIRR-/- zebrafish infected with

Edwardsiella piscicola were taken and sent to Meiji Biotech for bacterial metagenomic sequencing. The results are shown in Figures 7 and 8. Figures 7 and 8 show that after

SIGIRR gene deletion, the number of Cetiella and Firmicutes in the zebrafish intestine increased significantly (Figure 7), and the proportion of Gram-positive and anaerobic bacteria increased (Figure 8).

The results show that after the anti-inflammatory gene SIGIRR was knocked out, the resistance of zebrafish to Edwardsiella piscicola and Mycobacterium marinum was weakened, the inflammation after bacterial infection was stronger, the apoptosis was more serious, the fish mortality rate was higher, and there were more harmful intestinal bacteria.

The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims (10)

CLAIMS LU600477

1. An sgRNA targeting the knockout of the zebrafish SIGIRR gene, characterized in that the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.

2. A primer set for amplifying the sgRNA of claim 1, characterized in that the primer set includes an upstream primer shown in SEQ ID NO: 2 and a downstream primer shown in SEQ ID NO: 3.

3. A CRISPR/Cas9 system targeting the knockout of the zebrafish SIGIRR gene, characterized in that the CRISPR/Cas9 system includes the sgRNA of claim 1 and Cas9 MRNA.

4. The CRISPR/Cas9 system of claim 3, characterized in that the preparation method of the Cas9 mRNA includes the following steps: linearizing the pXT7-zCas plasmid with Xba I-QC, recovering the digestion product, and in vitro transcription to synthesize Cas9 MRNA.

5. A kit for targeting the knockout of the zebrafish SIGIRR gene, characterized in that it includes the CRISPR/Cas9 system of claim 3 or claim 4.

6. A method for gene knockout and breeding SIGIRR gene knockout zebrafish, characterized in that it includes the following steps: introducing the CRISPR/Cas9 system of claim 3 or claim 4 or the CRISPR/Cas9 system of claim 5 into zebrafish embryos, culturing and selecting to obtain SIGIRR gene knockout zebrafish.

7. The method of claim 6, characterized in that it further includes the following steps#600477 the SIGIRR gene knockout zebrafish are hybridized with wild-type zebrafish to obtain F1 generation embryos, which are cultured and selected to obtain the SIGIRR gene knockout F1 generation zebrafish; the SIGIRR gene knockout F1 generation zebrafish are interbred to obtain SIGIRR gene knockout homozygous zebrafish.

8. The application of SIGIRR gene knockout zebrafish obtained by the method of claim 6 or claim 7 in the study of bacterial infection diseases in fish.

9. The application of SIGIRR gene knockout zebrafish obtained by the method of claim 6 or claim 7 in the screening of drugs related to antibacterial infection in fish.

10. The application of claim 8 or claim 9, characterized in that the bacteria are Edwardsiella piscicida or Mycobacterium marinum.