LU600082B1 - An Engineered Near-Infrared Light Responsive Exosome, and a Preparation Method and Application Thereof - Google Patents

Abstract

The invention discloses an engineered near-infrared light responsive exosome and a preparation method and application thereof, and relates to the technical field of biomedicine. The preparation method of the engineered near-infrared light responsive exosome includes the following steps: transfecting a recombinant plasmid containing a CXCL9 coding gene into tumour cells to obtain cells expressing CXCL9; after receiving ultraviolet radiation, the cells expressing CXCL9 are incubated with photosensitizer to obtain cell culture supernatant; Separating the cell culture supernatant to obtain the engineered near-infrared responsive exosome. Under the irradiation of near infrared (NIR) light, the exosome can produce photothermal effect, directly kill tumour cells, and selectively release CXCL9 into tumour tissues. This selectively released CXCL9 can effectively attract T cells to tumours, reshape immune microenvironment, and enhance immune-mediated cancer cell destruction. FIG.1

Description

DESCRIPTION LU600082

AN ENGINEERED NEAR-INFRARED LIGHT RESPONSIVE EXOSOME, AND A

PREPARATION METHOD AND APPLICATION THEREOF

TECHNICAL FIELD

The invention relates to the technical field of biomedicine, in particular to an engineered near-infrared light responsive exosome, and a preparation method and application thereof.

BACKGROUND

Immunotherapy, by activating the body's immune system to identify and eliminate cancer cells, has shown remarkable potential in many malignant tumours.

However, patients’ different reactions to immunotherapy intervention emphasize the necessity of continuing research to optimize the therapeutic effect. A key factor for the success of immunotherapy is the degree of T cell infiltration into tumour microenvironment, which is usually related to improving the prognosis of patients.

The migration of T cells to tumour sites is mainly guided by the gradient of CXC chemokine receptor 3(CXCR3) and its ligands CXC chemokine (CXCL9, CXCL10 and CXCL11).

Recent studies have emphasized the key role of CXCLS in T cell recruitment, especially in enhancing the effectiveness of immunotherapy. Studies have shown that the increase of CXCLS level is related to the increase of T cell infiltration in melanoma patients and better clinical results. Similarly, a study also shows that

CXCL9 not only attracts T cells, but also regulates their functions and further promotes anti-tumour immunity. Although CXCL10 and CXCL11 also play a role in this process, CXCL9 plays a leading role in promoting T cell migration, which makes it a key target to enhance the effect of T cell-based immunotherapy. However, many tumours use various mechanisms to down-regulate the expression of CXCL9, which hinders the recruitment of T cells and impairs the overall effectiveness of these therapies. In order to solve this limitation, several methods have been explored, including direct injection of recombinant CXCL protein or virus vector encoding

CXCL9 into tumour. Although these strategies try to establish a chemokine gradient between tumours and peripheral tissues, their effects are limited. The short life span of recombinant proteins usually leads to insufficient recruitment of T cells, while viral LU600082 vectors may lead to the expression of non-specific chemokine, causing concerns about non-target effects and overall safety. Therefore, it is urgent to develop new strategies to enhance chemokine expression strongly and specifically in tumour microenvironment, so as to promote more effective T cell recruitment and activation.

SUMMARY

The purpose of the invention is to provide an engineered near-infrared light responsive exosome, and a preparation method and application thereof, so as to solve the problems existing in the prior art.. Under the irradiation of near infrared (NIR) light, the exosome can produce photothermal effect, directly kill tumour cells, and selectively release CXCL9 into tumour tissues. This selectively released CXCL9 can effectively attract T cells to tumours, reshape immune microenvironment, and enhance immune-mediated cancer cell destruction.

In recent years, remarkable progress has been made in the development of cell membrane-based nanovehicles, such as exosome and micro particles. In addition, these nanovehicles have the unique ability to inherit the functional characteristics of their parent cells, making them efficient tools for targeted drug delivery in chemotherapy and immunotherapy applications. At the same time, gene delivery systems, such as plasmids and viral vectors, have been widely used in engineering cells to express therapeutic proteins, demonstrating their practicability in gene therapy. By integrating these advances, engineered exosome represents a promising platform for targeted delivery of therapeutic agents (especially in the context of cancer immunotherapy).

Based on these technological advances, the invention proposes an innovative therapeutic strategy, which involves genetically engineering tumour cells to overexpress CXCL9. This method makes it possible to create immunoregulatory tumour-derived exosome loaded with chemokine CXCL9 and photosensitizer cypate.

These exosome are designed to homing to tumour tissues, and under the irradiation of near infrared (NIR) light, cypate induces local photothermal effect, which not only directly ablates tumour cells, but also triggers the controlled release of CXCL9 in tumour microenvironment. Selective release of CXCL9 can effectively establish chemokine gradient, enhance the recruitment of T cells to tumour sites, and thus contribute to anti-tumour immune response.

Based on this, the invention provides the following scheme: LU600082 the invention provides a preparation method of an engineered near-infrared light responsive exosome, which includes the following steps: transfection of recombinant plasmid containing CXCL9 coding gene into tumour cells to obtain cells expressing CXCL9; after receiving ultraviolet radiation, the cells expressing CXCL9 are incubated with photosensitizer to obtain cell culture supernatant; separating the cell culture supernatant to obtain the engineered near-infrared responsive exosome

Further, the nucleotide sequence of the CXCL9 coding gene is shown in SEQ ID

NO.1

Further, the tumour cells are liver cancer cells.

Further, the ultraviolet irradiation time is 1h.

Further, the photosensitizer is cypate.

Further, the separation treatment adopts a differential centrifugation method.

The invention also provides an engineered near-infrared light responsive exosome prepared by the preparation method.

The invention also provides the application of the engineered near-infrared light responsive exosome in preparing medicines for treating liver cancer.

The invention also provides a medicine for treating liver cancer, and the active ingredient includes the engineered near-infrared light responsive exosome.

Further, the medicine also includes pharmaceutically acceptable excipients.

The invention discloses the following technical effects: the invention develops an innovative extracellular exosome (cypate@exo-

CXCL9) by engineering expression of chemokine cxcl9 and combining with photosensitizer cypate, which is specially used for targeting tumour tissues. Under the irradiation of near infrared (NIR) light, cypate produces photothermal effect, which directly kills tumour cells and selectively releases CXCL9 into tumour tissues. This selectively released CXCL9 can effectively attract T cells to tumours, reshape the immune microenvironment, and enhance the immune-mediated destruction of cancer cells. Improve the accuracy of immune regulation by promoting T cells to infiltrate more into tumours. This method not only enhances the activity of T cells, but also significantly improves their efficiency and accuracy of penetrating tumours, so that tumours can be removed more effectively and the key obstacle of insufficient T cell LU600082 recruitment in cancer treatment can be solved.

BRIEF DESCRIPTION OF THE FIGURES

In order to explain the embodiments of the invention or the technical scheme in the prior art more clearly, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the invention, and other drawings can be obtained according to these drawings without creative work for ordinary people in the field.

Fig. 1 is a graph showing the results of preparing extracellular bodies; where, A is a schematic diagram of the construction of recombinant plasmid containing CXCL9 sequence; B is the detection chart of CXCL9 expression level in tumour exosome; C is a statistical diagram of the expression level of CXCL9 in tumour exosome; D is the schematic diagram of preparing tumour cell exosome (cypate@EXO-CXCL9); E is the transmission electron microscope diagram of exosome cleavage of tumour cells under photothermal conditions; F-G is the detection chart of the changes of tumour cell exosome before and after photothermal irradiation; H is a schematic diagram of the changes of exosome in tumour cells before and after photothermal irradiation;

Fig. 2 shows the results of T cell recruitment and immune activation experiments in vitro; where, A is the schematic diagram of cross-hole migration induced by cypate@EXO-CXCL9; B is a confocal laser scanning microscope (CLSM) image of different material groups; C is the quantitative analysis chart of recruited T cells; D is the statistical chart of IFN-y secreted by T cells in different material groups; E is the statistical chart of cell activity after different treatments; F is the detection chart of

IFN-y level in tumour supernatant after treatment in different material groups; G is the test result diagram of DC cell ratio after treatment of different material groups; H the test results of the proportion of M1-type macrophages treated with different material groups; | is the test result diagram of the proportion of M2-type macrophages treated by different material groups; In F-I, | stands for PBS, Il stands for EXO, Ill stands for EXO-CXCL9, IV stands for cypate@EXO, and V stands for cypate@EXO-CXCL9;

Fig. 3 results of anti-tumour efficiency test; where, À is the schematic diagram of the treatment timeline in Hep 1-6 tumour-bearing mouse model; B is the tumour image extracted after different processing; C is the change chart of tumour volume during treatment; D is the statistical chart of the average weight of mice after different LU600082 treatments; E is the statistical chart of the average weight of the tumour after different treatments; F is the statistical chart of survival rate of mice after different treatments;

G is the histological analysis diagram of the tumour after different treatments; H is the

TUNEL stain of tumour tissue samples after different treatments; | is the histological analysis diagram of the main organs after different treatments;

Fig. 4 is the result of immune activation experiment in vivo, Among them, A is the immunofluorescence analysis chart of T cells, M1 macrophages and M2 macrophages in Hep 1-6 tumour-bearing mice after different treatments; B is the flow cytometry analysis chart of T cell activation state (CD4*/CD8*) in tumour tissue after different treatments; C is the flow cytometry analysis chart of IFN-y secretion in tumour tissue after different treatments; D is the flow cytometry analysis chart of DC cells (CD80*/CD86*) in tumour tissues after different treatments; E is the flow cytometry analysis chart of M1 cells (F4/80*/CD86*) in tumour tissues after different treatments; F is the flow cytometry analysis chart of M2 cells (F4/80*/CD206*) in tumour tissues after different treatments; G is the statistical chart of the relative level of TNF-a in tumour tissue supernatant after different treatments; H is the statistical chart of the relative level of IFN-y in tumour tissue supernatant after different treatments.

DESCRIPTION OF THE INVENTION

A number of exemplary embodiments of the invention will now be described in detail, and this detailed description should not be considered as a limitation of the invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the invention.

It should be understood that the terminology described in the invention is only for describing specific embodiments and is not used to limit the invention. In addition, for the numerical range in the invention, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Intermediate values within any stated value or stated range, as well as each smaller range between any other stated value or intermediate values within the stated range are also included in the invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

Unless otherwise specified, all technical and scientific terms used herein have LUV600082 the same meaning as commonly understood by one of ordinary skill in the art to which this invention relates. Although the invention only describes the preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In case of conflict with any incorporated document, the contents of this specification shall prevail.

It is obvious to those skilled in the art that many improvements and changes can be made to the specific embodiments of the invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to the skilled person from the description of the invention. The description and example of that invention are exemplary only.

The terms "including", "comprising", "having" and "containing" used in this article are all open terms, which means including but not limited to.

Embodiment 1 1. Materials and methods 1.1 Materials

Enzyme-linked immunosorbent assay (ELISA) kits for interferon-y (IFN-y) and tumour necrosis factor-a (TNF-a) are purchased from Lianke Biology.

PE labelled anti-mouse CD11b(Biolegend, product number 101208, dilution ratio 1:1000); FITC labelled anti-mouse F4/80(Biolegend, product number 123108, dilution ratio 1:1000); APC labelled anti-mouse CD206(Biolegend, product number 141708, dilution ratio 1:1000); APC labelled anti-mouse CD45(Biolegend, product number 147710, dilution ratio 1:1000); PE labelled anti-mouse CD3(Biolegend, product number 100206, dilution ratio 1:1000); FITC labelled anti-mouse CD8(Biolegend, product number 100706, dilution ratio 1:1000); APC labelled anti-mouse

CD11c(Biolegend, product number 117310, dilution ratio 1:1000); PE labelled anti- mouse CD80(Biolegend, product number 104708, dilution ratio 1:1000); Pacific Blue labelled anti-mouse CD86(Biolegend, product number 105022, dilution ratio 1:1000). 1.2 Animal and ethical statements

Animal and ethical statement: Balb/c mice (female, 18+2g, 6-8 weeks old) are purchased from Shanghai slack Animal Technology Co., Ltd. (Shanghai, China).

Mice are kept in animal facilities under constant environmental conditions (room temperature 21+1°C; relative humidity 40-70%; 12h light/dark cycle). All mice can get LU600082 food and water. All animal experiments are carried out according to the agreement approved by Guizhou Medical University (approval number 2400625). 1.3 Plasmid construction

Specific primers are designed to amplify the transmembrane sequence (TM) and cDNA sequence of chemokine CXCL9. The 381 bp sequence of CXCL9 is obtained by using CCDS database (reference number CCDS39152.1). By polymerase chain reaction (PCR), these two key nucleic acid sequences are amplified and inserted into pcDNAS.1-FLAG-EGFP vector (purchased from Wuhan Miaoling Biotechnology Co.,

Ltd.), and the recombinant plasmid containing CXCL9 sequence is constructed by using Nco | and Sal | restriction sites. 1.4 Preparations of exosome

Using Lipofectamine 2000 (or other designated transfection reagent), the recombinant plasmid containing CXCL9 sequence is transfected into tumour cells (hepatoma cell Hep 1-6). 24h after transfection, the transfected cells are irradiated with ultraviolet (UV) for 1h, and then incubated with photosensitizer cypate(CAS

No.95837-47-1) for 12h. The high-sugar DMEM (10%FBS) containing cypate is used for incubation, in which the content of cypate is 10mg/mL. Cell culture supernatant is collected and centrifuged at low speed (400g, 10min) to remove cells and debris.

Subsequently, the supernatant is centrifuged at a higher speed (2000g centrifugation for 15min, followed by 10,000g centrifugation for 30min) to remove cell debris. The exosome (cypate@EXO-CXCL9) containing cypate is separated from the cell culture supernatant by ultracentrifugation (centrifugation at 100,000g for 2h).

Other types of exosome are prepared by similar methods, including blank exosome (EXO), exosome containing only CXCL9 (EXO-CXCL9) and exosome containing only cypate (cypate@EXO). 1.5 T cell isolation and recruitment

The C57BL/6 mice are euthanized by cervical dislocation, and then disinfected in alcohol for 15min. Then the spleen is excised, chopped and homogenized to obtain a single cell suspension. After filtering through a 70um cell screen, the cells are centrifuged at 1500rpm for 3 minutes to obtain spleen cell precipitation. Red blood cell lysis buffer is added to lyse red blood cells, and then the lysis process is terminated with culture medium. T cells are purified from spleen cell population by magnetic bead separation to obtain CD3* T cells. T cells are cultured in RPMI 1640 medium containing 10wt% fetal bovine serum (FBS), 1 mM sodium pyruvate, 10 mM LU600082

HEPES buffer, 55 pM B- -mercaptoethanol and 10 ng/mL mouse recombinant interleukin -2(IL-2), which is derived from Peprotech. Before the experiment, the cells are stimulated with soluble anti-mouse CD3 (monoclonal antibody clone 145-2C11) and anti-mouse CD28 (monoclonal antibody clone 37.51), both of which are purchased from BioLegend Company and carried out according to the agreement provided by the manufacturer. Pre-activated T cells are placed in the upper chamber of the cross-well plate, and the lower chamber contains different material groups, including PBS, EXO, EXO-CXCL9 and cypate@EXO-CXCL9. After incubation, the cells under the transmembrane are fixed with 4% formaldehyde (PFA) and stained. T cells migrating across the lower side of the porous membrane are observed and quantified by fluorescence microscope. 1.6 MTT experiment

Pre-activated T cells are placed in the upper chamber of the cross-hole plate, and the lower chamber is pre-inoculated with tumour cells and macrophages from bone marrow. Adding different material groups including PBS, EXO, cypate@EXO,

EXO-CXL9, cypate@EXO-CXL9, PBS+NIR, EXO+NIR, cypate@EXO+NIR, EXO-

CXL9+NIR and cypate@EXO-CXL9+NIR for treatment. After 24h incubation, MTT activity experiment is conducted to evaluate the cell activity. 1.7 Immunofluorescence analysis

Tumour samples from mice are sliced and fixed with 4% formaldehyde for 15min.

After permeating with 0.5% Triton X-100 in PBS for 10min, the nonspecific binding sites is blocked with 5% bovine serum albumin in PBS. Then, the slices are incubated with primary antibody (CST, dilution ratio 1:500) overnight at 4°C, and then incubated with fluorescent secondary antibody (1:300) at room temperature for 2h.

The nuclei are stained with Hoechst for 15min, and the samples are visualized with laser confocal microscope (AIR HD25). 1.8 Flow cytometry analysis

Pre-activated T cells are added to the upper chamber of the cross-well plate, and the lower chamber is inoculated with mouse hepatoma cells (Hep 1-6). Different material groups are added for treatment, followed by incubation for 24h. The concentration of IFN-y secreted by T cells is measured by flow cytometry. The procedure includes resuspending the supernatant with FACS buffer, filtering by membrane, and adding 100uL into a 2mL Eppendorf tube. After incubating with antibody for 1h and swirling, the sample is centrifuged at 2200rpm for 3min, the LU600082 supernatant is removed, and 500uL FACS buffer is added for analysis. 1.9 Antitumor and safety evaluation of exosome

The antitumor effect of exosome is further verified in Hep 1-6 loaded Balb/c mouse model. Hep 1-6 cells are injected into the right hind leg of mice. When the tumour volume reached about 100mm°, the mice are divided into four groups and treated by injecting different nano-drugs through the tail vein. 12h after injection, mice are treated with laser and non-laser treatment. The treatment cycle lasted for 21 days, and the injection is given once every three days, with a dose of 1mg/kg each time, with a total of five injections. At the end of 20 days of treatment, mice are euthanized, tumour tissues are collected, fixed with 4% formaldehyde and embedded in paraffin.

Slices with a thickness of 4mm are mounted on a glass slide and stained with hematoxylin and eosin (H&E). The expression levels of T cells, macrophages and other immune cells infiltrated in the tumour are evaluated by immunofluorescence staining. TUNEL experiment is carried out according to the manufacturer's instructions. One Step TUNEL apoptosis detection kit (Roche) is used, and the nucleus is stained by DAPI. Tumour tissue and mouse spleen cells are homogenized or digested in dyeing buffer to prepare single cell suspension, and various antibodies are used to detect immune cells, including dendritic cells (DC cells), macrophages and T cells. Using FITC-coupled DC antibody (anti-mouse CD11c, BioLegend, 117306, dilution ratio 1:200), PE-coupled CD80 antibody (BioLegend, 104708, dilution ratio 1:200) and APC-coupled CD86 antibody (Bio Legend, 105012, dilution ratio 1:200) for staining. 2. Results 2.1 Preparation of exosome

Hepatocellular carcinoma (HCC) is still one of the most common malignant tumours in the world. Because of its high metastatic potential and frequent resistance to conventional treatment, it poses a major treatment challenge. Although the progress of traditional treatment strategies is limited, immunotherapy has become a promising alternative. The key factor to regulate tumour growth and metastasis is the infiltration of T cells into tumour microenvironment. In order to enhance T cell recruitment and improve the therapeutic effect of immunotherapy, the invention develops a new method, which uses exosome derived from engineered tumour cells for local release of CXCL9 triggered by near infrared (NIR) light. This innovative strategy aims at effectively recruiting and activating T cells, thus enhancing the anti- LU600082 tumour immune response.

In order to generate exosome specially loaded with CXCL9, the invention adopts molecular cloning technology. The coding gene sequence (SEQ ID NO.1) of CXCL9 is obtained from the Consensus CDS(CCDS) database (www.ncbi.nim.nih.gov/CCDS/), with a length of 381 bp (refer to CCDS39152.1). The gene sequence encoding CXCLS is cloned into Nco | and Sal | restriction sites of pcDNAS.1-FLAG-EGFP vector, resulting in a recombinant plasmid expressing

CXCL9 (A in Figure 1). The recombinant plasmid also includes an enhanced green fluorescent protein (EGFP) gene for tracking protein expression. After the plasmid is transfected into tumour cells, remarkable green fluorescence is observed under a fluorescence microscope, which confirmed that the construction of recombinant plasmid and the expression of CXCL9 protein are successfully completed in the invention.

SEQ ID NO 1:

ATGAAGTCCGCTGTTCTTTTCCTCTTGGGCATCATCTTCCTGGAGCAGTGTG

GAGTTCGAGGAACCCTAGTGATAAGGAATGCACGATGCTCCTGCATCAGCACCA

GCCGAGGCACGATCCACTACAAATCCCTCAAAGACCTCAAACAGTTTGCCCCAA

GCCCCAATTGCAACAAAACTGAAATCATTGCTACACTGAAGAACGGAGATCAAA

CCTGCCTAGATCCGGACTCGGCAAATGTGAAGAAGCTGATGAAAGAATGGGAA

AAGAAGATCAGCCAAAAGAAAAAGCAAAAGAGGGGGAAAAAACATCAAAAGAAC

ATGAAAAACAGAAAACCCAAAACACCCCAAAGTCGTCGTCGTTCAAGGAAGACT

ACATAA.

Exosome are isolated from transfected cells by ultraviolet (UV) stimulation and high-speed centrifugation. Enzyme-linked immunosorbent assay (ELISA) analysis showed that compared with PBS and the control group, the level of CXCL9 in exosome from EXO-CXCL9 and cypate@EXO-CXCL9 groups is significantly increased (0.4 ng/mL), indicating that the invention successfully integrated CXCL9 into exosome (C in Fig.1).

In order to further evaluate the influence of photothermal conditions on cypate@EXO-CXCL9 exosome, the morphological changes are examined by transmission electron microscope (TEM). Under NIR light irradiation, the exosome of cypate@EXO-CXCL9 showed fragmentation into smaller cell fragments (D and E in

Fig.1). Dynamic light scattering (DLS) analysis confirmed these findings, and showed that the particle size decreased significantly after NIR exposure (F, G and H in Fig. 1). LU600082

Generally speaking, these results prove that the exosome derived from NIR- responsive tumor cells have been successfully developed, which can release CXCL9 in a targeted manner, thus providing a novel and promising method for enhancing the effectiveness of immunotherapy for hepatocellular carcinoma. 2.2 T cell recruitment and cytotoxicity in vitro

The invention studies the ability of different materials to recruit CD8* T cells by cross-hole migration experiment. In this experimental setup, CD8* T cells are placed in the upper chamber, while mouse hepatoma cells (Hep 1-6) are cultured in the lower chamber. Various treatment groups, including PBS, EXO, EXO-CXCLS9, cypate@EXO and cypate@EXO-CXCL9, are introduced into the lower chamber.

Near infrared (NIR) irradiation and non-NIR conditions are applied to each group for comparative analysis. CD8* T cells are fluorescently labeled as Dil (green) to track their chemotaxis. In PBS group, it is observed that the green fluorescence signal of labeled T cells changed little within 120min, indicating that the recruitment ability of T cells is poor. In contrast, in the cypate@EXO-CXCL9+NIR group, the number of T cells in the inferior chamber is significant and increased with time, indicating efficient recruitment (A and B in Fig. 2). At 120min, the T cell count reached a peak of about 350,000 cells per well, which is significantly higher than that in PBS group (C in Fig. 2). However, compared with the control group, the recruitment of T cells in cypate@EXO-CXCL9 group did not increase significantly, which may be attributed to the insufficient release of CXCLS.

The invention evaluates the cytotoxic effect of these exosome on tumor cells in the lower chamber. In PBS, EXO, EXO-CXCLS9, cypate@EXO and cypate@EXO-

CXCLS treatment groups, the tumor cell activity did not change, which confirmed the biocompatibility of exosome. Similarly, in PBS+NIR, EXO+NIR and EXO-CXCL9+NIR groups, due to the lack of photosensitizer cypate, photothermal effect could not be induced, so there is no significant effect on tumor cell activity. However, in cypate@EXO+NIR group, the activity of tumor cells decreased significantly, which is driven by the photothermal effect of cypate under NIR laser irradiation. The most obvious cytotoxicity is observed in cypate@EXO-CXCL9+NIR group, in which the photothermal therapy triggered by NIR not only directly killed tumor cells, but also promoted the enhanced release of CXCL9, further promoting T cell recruitment and destruction of tumor cells (D in Fig. 2).

The invention measures the level of interferon-gamma (IFN-gamma) as an index LU600082 of T cell activation. Compared with the PBS control group, the cypate@EXO-

CXCL9+NIR group showed a significant increase in IFN-y production, which proved that these immunoregulatory exosome effectively stimulated the T cell-mediated immune response against tumor cells (E and F in Fig. 2).

In addition, the invention also investigated the activation effect of exosomes on immune cells. CD8* T cells are placed in the upper chamber, while Hep 1-6 cells are cultured in the lower chamber. Various treatment groups, including PBS, EXO, EXO-

CXCL9, cypate@EXO and cypate@EXO-CXCLS9, are introduced into the lower chamber. Near infrared (NIR) irradiation and non-NIR conditions are applied to each group for comparative analysis. Subsequently, the supernatant of the lower chamber is co-cultured with dendritic cells (DCs) and macrophages, and the maturation of DCs and the activation level of macrophages are evaluated. The results showed that compared with the control group, the activation of DC in cypate@EXO+NIR group increased by 28% (G in Fig. 2). This enhancement is attributed to the photothermal effect of cypate under near infrared irradiation, which induces cell killing and the release of immunogenic molecules, thus promoting cell activation. The highest level of DC activation (25.6%) is observed in cypate@EXO-CXCL9+NIR group (G in Fig. 2). This is attributed to the ability of cypate to kill tumor cells, and the photothermal cracking of EXO releases CXCLS to recruit T cells and secrete IFN-y, which together enhance the activation of immune cells. Regarding the activation of macrophages, the cypate@EXO-CXCL9+NIR group showed the maximum polarization from M2 to

M1 phenotype, which increased by 32% (H and | in Fig. 2). This transformation indicates the activation of pro-inflammation, which is very important for effective anti- tumor immune response. Targeting the immunoregulatory exosome of tumors, and emphasizing their potential to significantly enhance T cell-mediated antitumor activity. 2.3 Anti-tumor effect in vivo

In order to evaluate the anti-tumor effect of NIR-responsive exosome in vivo, the invention establishes a Hep 1-6 tumor-bearing mouse model. Mice are injected with cypate@EXO-CXCL9 exosome once every five days, for a total of four injections (A in Fig. 3). After treatment, mice in PBS and EXO-CXCL9+NIR groups showed the rapid progress of tumor. In contrast, mice treated with cypate@EXO+NIR showed moderate inhibition of tumor growth (B in Fig. 3). Importantly, the cypate@EXO-

CXCL9+NIR treatment group showed more obvious tumor growth reduction than the control group (B and C in Fig. 3). At the time of dissection, the tumor weight of LU600082 cypate@EXO-CXCL9+NIR group is significantly smaller, which is consistent with the decrease in tumor volume observed during the study (D in Fig. 3). During the whole experiment, weight monitoring showed that there is no significant change among all treatment groups, indicating that exosome had good biocompatibility (E in Fig. 3).

Survival analysis further emphasized the therapeutic potential of NIR responsive exosome. The median survival time of mice treated with cypate@EXO+NIR is significantly prolonged, from 43 days in PBS group to 58 days. Notably, mice in cypate@EXO-CXCL9+NIR group showed the longest survival time, exceeding 60 days (F in Fig. 3). These findings indicated that the laser-triggered release of CXCL9 in exosome effectively recruited CD8+ T cells to the tumor site, and enhanced the immune-mediated tumor destruction. Hematoxylin and eosin (H&E) staining and

TUNEL staining revealed extensive cell death in tumor tissues of cypate@EXO-

CXCL9+NIR group (G and H in Fig. 3). In addition, the analysis of tissue sections of key organs including heart, liver, spleen, lung and kidney confirmed the excellent biocompatibility of exosome, and there is no evidence of injury or toxicity (| in Fig. 3).

In a word, these results indicate that NIR-responsive cypate@EXO-CXCL9 exosome effectively recruit CD8* T cells into tumor microenvironment, which leads to enhanced tumor regression and prolonged survival in vivo, while maintaining good safety characteristics. 2.4 In vitro immune activation

In order to comprehensively evaluate the immunological effect of NIR responsive exosome in vivo, the invention analyzes the infiltration of immune cells in tumor tissues of different treatment groups. CLSM is used to visualize the existence of M1- type macrophages (labeled with CD80-FITC), CD8* T cells (labeled with CD8-FITC) and M2-type macrophages (labeled with CD206-FITC) in tumor microenvironment. In the PBS control group, the infiltration of M1 macrophages and CD8* T cells is the smallest, while M2 macrophages dominated the tumor microenvironment (A in Fig. 4).

Compared with the control group, the infiltration of immune cells in EXO-CXCL9+NIR treatment group has no significant change, which may be due to the lack of cypate, which prevents the generation of sufficient photothermal effect to destroy particles and release CXCL9, thus limiting the recruitment of CD8* T cells. In contrast, in cypate@EXO+NIR group, the photothermal effect of cypate induced a certain degree of immunogenic cell death, which changed the tumor microenvironment by increasing the infiltration of CD8* T cells and promoting the polarization of macrophages from LU600082

M2 to M1. The most obvious effect is observed in cypate@EXO-CXCL9+NIR group (A in Fig. 4), in which the combination of photothermal ablation and NIR-induced release of CXCLS led to a significant increase in CD8* T cell recruitment and a significant change in immune composition in tumor microenvironment. Flow cytometry analysis confirmed these findings, compared with PBS control group, the proportion of CD8* T cells (and CD4* lymphocytes) in cypate@EXO+NIR and cypate@EXO-CXCL9+NIR groups increased significantly, by 10% and 21% respectively. Notably, the cypate@EXO-CXCL9+NIR group showed the most significant enhancement in CD4* and CD8* T cell populations, with an increase of 20% compared with the control group (B in Fig. 4). In addition, the maturity of dendritic cells is significantly improved in cypate@EXO+NIR and cypate@EXO-CXCL9+NIR treatment groups, which increased by 6% and 17% respectively compared with the control group, suggesting the systemic anti-tumor immune activation (C in Figure 4).

The level of IFN-y produced by CD8* T cells in tumor tissue further showed that the cypate@EXO-CXCL9+NIR group showed the highest level of IFN-y, which increased by 20% compared with the control group (D in Fig. 4). Further examination of tumor- associated macrophages showed that M2-type macrophages decreased significantly (by 14% and 26% respectively) in the two treatment groups (E in Fig. 4), while M1- type macrophages increased correspondingly (by 8% and 25% respectively) (F in Fig. 4). Serum cytokine analysis showed that compared with PBS group, the levels of

TNF-a and IFN-y in EXO-CXCL9+NIR group did not change significantly (G and H in

Fig. 4). However, significant increases of these two cytokines are observed in cypate@EXO+NIR and cypate@EXO-CXCL9+NIR groups. Specifically, the levels of

TNF-a and IFN-y increased by 3 and 5 times, 4 and 6 times respectively. These findings highlight the strong immune response triggered by these therapeutic interventions.

The above-mentioned embodiments only describe the preferred mode of the invention, and do not limit the scope of the invention. Under the premise of not departing from the design spirit of the invention, various modifications and improvements made by ordinary technicians in the field to the technical scheme of the invention shall fall within the protection scope determined by the claims of the invention.

Claims (10)

CLAIMS LU600082

1. A preparation method of engineered near-infrared light responsive exosome, comprising the following steps: transfecting of recombinant plasmid containing CXCL9 coding gene into tumour cells to obtain cells expressing CXCL9; incubating the cells expressing CXCL9 with photosensitizer after receiving ultraviolet radiation to obtain cell culture supernatant; and separating the cell culture supernatant to obtain the engineered near- infrared responsive exosome.

2. The preparation method according to claim 1, wherein the nucleotide sequence of the CXCL9 coding gene is shown in SEQ ID NO.1.

3. The preparation method according to claim 1, wherein the tumor cells are liver cancer cells.

4. The preparation method according to claim 1, wherein the ultraviolet irradiation time is 1 hour.

5. The preparation method according to claim 1, wherein the photosensitizer is cypate.

6. The preparation method according to claim 1, characterized in that the separation treatment adopts a differential centrifugation method.

7. An engineered near-infrared light responsive exosome prepared by the preparation method according to any of claims 1-6.

8. An application of the engineered near-infrared light responsive exosome according to claim 7 in preparing medicines for treating liver cancer.

9. A medicine for treating liver cancer, characterized in that the active ingredient comprises the engineered near-infrared light responsive exosome according to claim

7.

10. The medicine according to claim 1, wherein the medicine further comprises pharmaceutically acceptable excipients.