LU503942B1 - Use of psoralen in therapeutic agents for human cutaneous T-cell lymphoma - Google Patents

Abstract

The present invention discloses the use of psoralen in therapeutic agents for human cutaneous T-cell lymphoma; Psoralen promotes apoptosis of Hut-78 by activating the expression of genes related to the apoptotic pathway in the human cutaneous T-cell lymphoma cell line Hut-78; Psoralen promotes cellular CASPASE 9 mRNA expression and can promote CASPASE 3 and FAS/FASL mRNA expression and downregulate BCL2 mRNA expression; offers a new idea for the treatment of human cutaneous T-cell lymphoma.

Description

Use of psoralen in therapeutic agents for human cutaneous T-Ze+#503942

Lymphoma

Technical part

The present invention belongs to the technical field of development of

Medicinal products for the treatment of human cutaneous T-cell lymphoma and particularly refers to the use of psoralen in the therapeutic agent for human cutaneous T-cell lymphoma.

Technology in the background

T-cell lymphoma is a group of malignant clonal proliferative diseases arising from T lymphocytes and is a relatively common type of lymphoma in Asian countries.

Natural killer/T cell lymphoma is a subtype of non-

Hodgkin's lymphoma and has the highest incidence of T-cell lymphomas, with the incidence in

China is much higher than in western countries. Peripheral T-cell lymphomas such as extranodal

NK/T cell lymphoma and cutaneous T cell lymphoma are highly aggressive and have a rapid

Disease progression, short survival and poor prognosis and pose a serious threat to the life and health of our population.

The psoralee fruit produced coumarins, flavonoids and monoterpene phenols as well

Leguminol, glutathione glucoside and cottonseed are isolated, of which coumarins, flavonoids and monoterpene phenols are the most important active ingredients. Psoralen and isosoralen are included

Group of coumarins. Psoralen has the chemical formula C11H6O3, is a colorless needle-like

Crystal, volatile and soluble in methanol, ethanol, benzene, chloroform and acetone; slightly soluble in water, ether and petroleum ether. The inhibitory effect of psoralen on T-cell lymphoma

Cell lines and their mechanism are not yet known.

Content of the invention

The present invention comes from studying the mechanism of action of

psoralen on human cutaneous T-cell lymphoma cell lines concluded that psoralen has a pro-apoptotic effect on human cutaneous T-cell lymphoma cells;

The use of psoralen in therapeutic agents for human cutaneous T-

cell lymphoma;

Preferably, psoralen promotes the apoptosis of Hut-78 by activating it

Expression of genes associated with the apoptotic signaling pathway in human cutaneous T cell

lymphoma cell line Hut-78;

Preferably, the psoralen promotes the mRNA expression of cellular CASPASE 9 and can promote the expression of CASPASE 3, FAS/FASL mRNA and downregulate the expression of BCL2 mRNA.

The beneficial effects of the present invention are:

The present invention of psoralen promotes apoptosis of human cutaneous T-

Cell lymphoma cell line Hut-78 cells used as a therapeutic agent for human cutaneous

T-cell lymphoma can be used and offers a new idea for the treatment of human cutaneous T-cell lymphoma.

Description of the attached drawings

Figure 1 shows the inhibitory effect of psoralen on the proliferation of Hut-78 cells; where A: empty group without administration; B: 50 µM, 100 µM, 200 µM and 400 µM psoralen significantly inhibited the growth of Hut-78 cells;

Figure 2 shows the effect of different concentrations of psoralen on the proliferation and apoptosis of Hut-78 cells (n = 8); where A: the effect of different concentrations 905942 of psoralen on the proliferation and apoptosis of Hut-78 cells; B: the IC50 curve of the

Inhibition of proliferation of Hut-78 cells by psoralen;

Figure 3 shows the effect of psoralen (400 uM) on apoptosis gene expression.

signaling pathway in Hut-78 cells (n = 3); A: Effect of psoralen on Bcl2 gene expression,

B: Effect of psoralen on Bax gene expression, C: Effect of psoralen on the

Gene expression of FAS, D: Effect of psoralen on gene expression of FASL; E: Effect of psoralen on caspase-3 gene expression; F: Effect of psoralen on caspase-8

gene expression; G: Effect of psoralen on caspase-9 gene expression.

Detailed description

The technical solutions in the embodiments of the present invention are presented in

The embodiments of the present invention will be clearly and fully described below in conjunction with the accompanying drawings, and it will be clear that those described

Embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments achieved by one skilled in the art without any creative work are within the scope of the present invention.

Embodiment 1

The use of psoralen in therapeutic agents for human cutaneous T-

cell lymphoma;

Preferably, psoralen promotes the apoptosis of Hut-78 by activating it

Expression of genes associated with the apoptotic signaling pathway in human cutaneous T cell

lymphoma cell line Hut-78;

Preferably, the psoralen promotes the mRNA expression of cellular CASPASE 9 and can promote the expression of CASPASE 3, FAS/FASL mRNA and downregulate the expression of BCL2 mRNA.

Embodiment 2

An experiment to confirm the effect of psoralen on apoptosis and those associated with the

Apoptosis-related gene expression in Hut-78 cells; 1. Materials: The human T-cell lymphoma cell line Hut-78 was developed by the Center of

Excellence in Molecular Cell Science, Chinese Academy of Sciences. Psoralen (purity>98%) was approved by the Chinese Academy of Food and Drug Administration

Drug monitoring acquired. RPMI 1640 medium (Ginco) was purchased from Life Technology; fetal bovine serum (Gibco) was purchased from Life Technology. CCK-8 reagents,

RNA extraction kits and reverse transcription reagents were purchased from TransGen Biotech (Beijing) Co. The RNA amplification primers were purchased from Sangon Biotech (Shanghai)

Co. acquired. 2. Method 1) Hut-78 cell culture

Hut-78 cells were grown in RPMI-1640 medium with 20% fetal bovine serum (100Usml™!

penicillin and 100pugeml™ streptomycin double antibodies) at 37°C in a 5% CO2

Incubator cultivated and passed on; 2) Determination of cell proliferation and apoptosis

Logarithmic growth stage Hut-78 cells were seeded at a concentration of 1.0x10* cells/well and cultured overnight in 96-well cell culture plates. The

Experiments were divided into the following groups: empty group (no 503942

drug treatment), drug-treated group (after pretreatment with 25, 50, 100, 200 and 400 μM psoralen for 24 h). After treatment, 10 µl of CCK-8 assay

Reagent added to each well of the 96-well cell culture plate, and the proliferation and

Apoptosis of Hut-78 cells in each of the drug-treated groups was measured separately. 3) Determination of the IC50 of psoralen

Logarithmic growth stage Hut-78 cells were seeded at a concentration of 1.0x10* cells/well and cultured overnight in 96-well cell culture plates. The

Experiments were divided into the following groups: empty group (none

drug treatment), drug-treated group (after pretreatment with 25, 50, 100, 200 and 400 μM psoralen for 24 h). After treatment, 10 µl of CCK-8 assay

Reagent was added to each well of the 96-well cell culture plate. Determination of IC50 values for inhibition of proliferation and apoptosis of Hut-78 cells by psoralen. 4) Analysis of apoptosis-related gene expression

The cells were grouped and grouped according to the method described above

Drug treatment method treated, after treatment the RNA was with the

Trizol method extracted and the RNA concentration with the Nanodrop Protein Nucleic Acid

Analyzer determined. 2 µg of total RNA was removed and reverse-engineered

Transcription kit (Thermo) converted into cDNA. The above transcript product cDNA, diluted 1:5 with ddH20, was used as a template for quantification of the expression of BCL2-, BAX-,

CASPAS 3, CASPASE 9 and FAS/FASL genes in cells according to the operating instructions of the

Full-format Gold SYBR Green fluorescence quantification kits were used, with GAPDH serving as an internal reference gene. The PCR reaction conditions are as follows: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles of amplification reactions at 95°C for 5

seconds and 60°C for 34 seconds. 3. Results 1) Inhibitory effect of psoralen on the proliferation of Hut-78 cells

As shown in Figure 1, 25 µM psoralen was able to do this compared to the empty group

did not significantly inhibit growth of Hut-78 cells after 24 hours of pretreatment with psoralen, while 50 µM, 100 µM, 200 µM and 400 µM psoralen did not significantly inhibit the growth of Hut-78 cells.

cells could significantly inhibit (*** P < 0.001, ** P < 0.01, * P < 0.05). 2) The cell viability experiment (CCK-8) of human lymphoma cell line

HUT-78 at the cellular level with the drug psoralen

The experimental results showed that psoralen inhibited the apoptosis of human T-

Lymphoma cell line Hut-78 was able to promote at the cellular level and the cell viability of the T-

Lymphoma cell line HUT-78 was significantly inhibited at a drug concentration of 50 uM, with a statistically significant difference (*p < 0.05) and an IC50 value of approx. 220.8 uM, the correlation results are shown in Figure 2. 3) Effect of psoralen on the expression of apoptosis-related genes in Hut-78-

cells

It has been shown that the apoptotic reaction is mediated frontally by BCL2//BAX/Fas/FasL,

Caspase 3/Caspase 8/Caspase 9 signaling pathway can be triggered. In accordance with the

literature, our results (Figure 2) showed that the administration of psoralen increased the mRNA

Expression of BCL2//BAX/Fas/FasL, caspase 3/caspase 8/caspase 9 significantly increased in Hut-78 cells. This suggests that psoralen can inhibit the activation of Hut-78-Zellét/503942 by regulating the expression of BCL2//BAX/Fas/FasL, caspase 3/caspase 8/caspase 9 genes, which in turn promotes apoptosis promoted by Hut-78.

The primer sequences are listed in Table 1. As shown in Figure 2, promoted 50 µM

Psoralen significantly increased cellular mRNA expression compared to the empty group

CASPASE 9 (P < 0.05) and showed a trend to promote mRNA expression of

CASPASE 3 and FAS/FASL and to downregulate the mRNA expression of BCL2, but had no significant effect on the mRNA level of BAX in Hut-78 cells.

Table 1 Primer names and sequences of apoptosis-related genes

Primer sequence (up to 3)

Human Bcl2 forward primer GCACGCTGGGAGAACAGGGTACGAT

Human Bcl2 reverse primer TCCTCCACCACCGTGGCAAA

Human Bax forward primer GCCCACCAGCTCTGAGCAGATCAT

Human Bax reverse primer CAACCACCCTGGTCTTGGATCCA

Human Fas forward primer TCAAGGAATGCACACTCACCA

Human Fas Reverse Primer AGAAGAAGACAAAGCCACCCC

Human FasL forward primer CCAGTCCACCCCCTGAAAA

Human FasL reverse primer CCAGAGGCATGGACCTTGAG

Human caspase 3 forward primer GCAAACCTCAGGGAAACATT

Human caspase 3 reverse primer TTTTCAGGTCAACAGGTCCA

Human caspase 8 forward primer AAGTGCCCAAACTTCACAGCAT

Human caspase 8 reverse primer CTCTTCAAAGGTCGTGGTCAAAG

Human caspase 9 forward primer TGGTGGAAGAGCTGCAGGTGGA

Human caspase 9 reverse primer CAGGGCTCCATGCTCAGGATGTAAG

Human GAPDH forward primer AAGATCATCAGCAATGCCTCC

Human GAPDH reverse primer TGGACTGTGGTCATGAGTCCTT

Claims (3)

Claims LU503942 1. The use of psoralen in therapeutic agents for human cutaneous T-cell lymphoma. 5 2. The use of psoralen in the therapeutic agent for human cutaneous T-cell lymphoma according to claim 1, characterized in that the psoralen promotes the apoptosis of Hut-78 by activating the expression of genes associated with the apoptotic signaling pathway in the human cutaneous T-cell lymphoma cell line Hut-78. 3. The use of psoralen in the therapeutic agent for human cutaneous T-cell lymphoma according to claim 1, characterized in that the psoralen promotes the mRNA expression of cellular CASPASE 9 and promotes the expression of CASPASE 3, FAS / FASL mRNA and downregulated the expression of BCL2 mRNA.