LU502414A1 - DlCNR8 gene for regulating single fruit weight trait of longan and the application of its protein - Google Patents

Abstract

The present application provides a longan single fruit weight trait regulation gene DlCNR8, a nucleotide sequence of which is expressed by SEQ ID No.1. In the present application, a DlCNR8 gene is cloned, the sequence structure, evolution relation and tissue expression of the gene are analyzed, a fusion protein expression vector (35S: DlCNR8=GFP) containing enhanced Green Fluorescent Protein (GFP) is constructed and is transferred into Arabidopsis mesophyll protoplast cells through a PEG mediation method, and the subcellular localization condition of the gene is observed through a laser confocal microscope. At the same time, an over-expression vector is constructed and is converted into Mico Tom tomatoes for functional analysis. The result shows that the DlCNR8 gene performs negative regulation on fruit weight by acting on downstream proteins to regulate the cell division rate like tomato FW2.2. The result not only lays an important foundation for the development of fruit weight/size theoretical research of longan and other fruit trees, but also provides important gene resources and molecular markers for the subsequent breeding of large-fruit longan new varieties by utilizing molecular assisted breeding.

Description

DESCRIPTION DICNRS gene for regulating single fruit weight trait of longan and the application of its protein Technical Field The present application relates to the field of molecular biotechnology, in particular to a longan single fruit weight trait regulation main effect QTL and application of a candidate gene D/CNRS to control of fruit development.

Background Deeply analyzing the genetic mechanism of longan single fruit weight and mining the key genes regulating longan single fruit weight traits are of great significance for accelerating the cultivation of large-fruit high-quality longan varieties and longan industry.

As a complex quantitative trait, single fruit weight is easily influenced by genetic background and environment, and there is no clear corresponding relationship between phenotype and genotype (Lu Bobin.

Development of Logan Microsatellite Markers, Breeding Application and Breeding of Excellent Hybrid Lines [D]. South China Agricultural University, 2014). Therefore, QTL analysis based on genetic map is an effective way to analyze the single fruit weight trait.

In recent years, with the progress of genetic means, molecular biology technology and bioinformatics platform, some QTLs or genes controlling plant grain or fruit weight traits have been found in rice, tomato and other model plants, such as An-1, An-2, GN4-1, GW2, qSWS, GS2, GSS, GW8, GS3 and GL7/GW7 of rice and fruit weight (fw)1.1, fw2.2, fw2.3, fw3.1, fw3.2, fw4.1 and fw9.1 of tomato ( Zhou Y, Tao Y, Yuan Y, Zhang Y, Miao J, Zhang R, Yi C, Gong Z, Yang Z, Liang G Characterisation of a novel quantitative trait locus, GN4-1, for grain number and yield in rice (Oryza sativa L.) [J]. Theoretical and Applied Genetics, 2018: 1-12; Zhu G Wang S, Huang Z, Zhang S, Liao Q, Zhang C, Lin T, Qin M, Peng M, Yang C, Cao X, Han X, Wang X, van der Knaap E, Zhang Z, Cui X, Klee H, Fernie AR, Luo J, Huang S.

Rewiring of the fruit metabolome in 1 tomato breeding [J]. Cell, 2018, 172(1): 249-261). These genes increase or decrease LUS02414 the number of cells by regulating the frequency of cell division or the duration of cell cycle, and ultimately affect the yield.

Among them, Fw2.2 is the first QTL related to fruit weight cloned from plants, which is located at the terminal of tomato chromosome No. 2. Fw2.2 large fruit allele increases the fruit weight by increasing the number of cells, resulting in the increase of fruit placentation and small column area.

The contribution rate of this locus to fruit weight gain reaches 30% (Li Z, He C.

Physalis floridana Cell Number Regulator] encodes a cell membrane-anchored modulator of cell cycle and negatively controls fruit size [J]. Journal of experimental botany, 2014, 66(1): 257-270). FW2.2-like (FWL) gene widely exists in animals and plants.

The amino acid sequence similarity of these regulators is generally very low, but they all contain PLAC8 domain.

FWL gene is involved in many biological processes such as plant growth and development and environmental response.

Studies have confirmed that FWL gene is involved in the plant absorption and transport of heavy metal ions (Qiao K, Tian Y, Hu Z, Chai T.

Wheat cell number regulator CNR10 enhances the tolerance, translocation, and accumulation of heavy metals in plants [J]. Environmental science & technology, 2018, 53(2): 860-867), the formation and nitrogen fixation process of root nodules (Qiao Z, Brechenmacher L, Smith B, Strout GW, Mangin W, Taylor C, Russell SD, Stacey GLibault M.

The GmFWLI1 (FW2-2-like) nodulation gene encodes a plasma membrane microdomainassociated protein [J]. Plant, cell & environment, 2017, 40(8): 1442-1455), the division of cells (Li Z, He C.

Physalis floridana Cell Number Regulatorl encodes a cell membrane-anchored modulator of cell cycle and negatively controls fruit size [J]. Journal of experimental botany, 2014, 66(1): 257-270), etc.

FWL, which regulates the growth of plant organs by participating in cell division and changing the number of cells, is also called Cell Number Regulator (CNR) (Guo M, Rupe MA, Dieter JA, Zou J, Spielbauer D, Duncan KE, Howard RJ, Hou Z, Simmons CR.

Cell Number Regulator 1 affects plant and organ size in maize: implications for crop yield enhancement and heterosis [J]. Plant Cell, 2010, 22(4):1057). At present, the research on the mechanism of CNR involved in regulating fruit weight is only limited to the 2 model plants tomato and physalis, and the regulation pathway is not clear. There are LUS02414 few reports on Fw2.2/CNR gene in woody fruit trees, and there are only a few reports on pear and avocado (Dahan Y, Rosenfeld R, Zadiranov V, Irihimovitch V. A proposed conserved role for an avocado fw2.2-like gene as a negative regulator of fruit cell division [J]. Planta, 2010,232(3):663.; Jia T, Bin Z, Luo S, Li X, Wu B, Li J. Cloning, localization and expression analysis of two fw2. 2-like genes in small-and large-fruited pear species [J]. Journal of Integrative Agriculture, 2016, 15(2): 282-294). Its specific functions are unknown. Summary One purpose of the present application is to provide a longan single fruit weight trait regulation gene. Another purpose of the present application is to provide a protein expressed by the longan single fruit weight trait regulation gene. Another purpose of the present application is to provide application of the longan single fruit weight trait regulation gene. The purposes of the present application are realized by adopting the following technical solutions: A longan single fruit weight trait regulation gene DI/CNRS, wherein a nucleotide sequence of the longan single fruit weight trait regulation gene DICNRS is expressed by SEQ ID No.1. A longan single fruit weight trait regulation protein, wherein an amino acid sequence of the longan single fruit weight trait regulation protein is expressed by SEQ ID No.2. The present application further provides a vector containing the coding gene. The present application further provides engineering bacteria containing the vector. The present application further provides application of the gene to longan single fruit weight trait regulation.

3

Further, the application is to infect the plant with the engineering bacteria to obtain a LUS02414 transgenic plant with a regulated single fruit weight trait.

The present application has the following beneficial effects: In the early stage of the present application, 200 parts of 'Fengliduo' (female parent) x 'Dawuyvuan' (male parent) hybrid F1 generation and parent plants were used as materials.

These materials were sequenced by using RAD-seq technology and SNP markers were developed to construct a high-density genetic map of longan.

A total of 12 stable QTL loci associated with the single fruit weight trait were screened by linkage localization analysis based on the data of single fruit weight for two consecutive years.

One of the genes located in the QTL region of 1g10 linkage group encodes a cell number regulator gene: DICNRS gene.

The Dlo 011045.1 (DICNRS) of the main effect QTL (qSFW-10-3) was determined as a candidate gene controlling the single fruit weight trait through qRT-PCR by using the fruits of different developmental stages of the large fruit strain FD105 and small fruit strain of F1 generation.

Subsequently, we cloned the ORF full length of this gene and analyzed its sequence structure, evolution relationship, tissue expression, etc. qRT-PCR analysis showed that this gene was differentially expressed in the fruits of the large fruit strain FD105 and small fruit strain FD21 of F1 generation at different developmental stages.

The present application cloned the DICNR8 gene, analyzed the sequence structure, evolution relationship and tissue expression of the gene, constructed a fusion protein expression vector (35S: DICNR8-GFP) containing an enhanced Green Fluorescent Protein (GFP), transferred it into Arabidopsis mesophyll protoplast cells by adopting a PEG mediated method, and observed the subcellular localization situation of the gene with a laser confocal microscope.

At the same time, the over-expression vector was constructed and transformed into Mico Tom tomato for functional analysis.

The results show that the DICNR8 gene contained the conserved domain PLACS of the cell number regulator, which has a closer relationship with the members of CNR8 subfamily from citrus and other fruit trees, has tissue expression specificity, and has the highest expression in young fruits.

The results of subcellular localization show 4 that the gene is distributed in points on the plasma membrane. The expression in LUS02414 60-80DAP is significantly regulated up in the critical period of fruit development of the small fruit strain FD21 of F1 generation. The fruit of over-expression transgenic strains is also significantly smaller than that of wild-type Mico Tom tomato. The above results show that the DICNRS gene, like tomato FW2.2, can negatively regulate fruit weight by regulating cell division rate through downstream proteins. This result will not only lay an important foundation for the theoretical research on fruit weight/size of longan and other fruit trees, but also provide important gene resources and molecular markers for the subsequent use of molecular assisted breeding to carry out the breeding of new large fruit longan varieties.

Description of the Drawings FIG 1 illustrates a localization map of DICNRS in linkage map.

FIG 2 illustrates a PCR amplification plot of a longan DICNRS gene.

FIG 3 illustrates a comparison diagram of CNR protein sequences among different species, wherein a box portion represents an amino acid sequence of a PLACS domain.

FIG 4 illustrates a phylogenetic tree analysis diagram of similar sequences in longan DICNR and GenBank.

FIG 5 illustrates a relative expression chart of DICNRS in different tissues of longan, wherein different letter targets indicate significant differences.

FIG 6 illustrates a relative expression chart of DICNRS in fruit development of different F1 generations.

FIG 7 illustrates a change chart of pulp weight of FD21 and FD105 in five time periods.

FIG 8 illustrates subcellular localization of DICNRS protein in Arabidopsis mesophyll protoplasts; GFP: green fluorescent protein; Chloroplast: chloroplast spontaneous fluorescence; Bright: bright field; Merged: two kinds of fluorescence and bright field are merged; scale : 10um. LUS02414 FIG 9 illustrates a phenotype map of fruit development of DICNRS transgenic tomato.

Description of the Embodiments The following examples are used for describing the present application, instead of limiting the scope of the present application.

Example 1: Cloning of Target Gene Materials and Methods

1.1 Plant Materials Three groups of 'Sijimi' longan with the same growth and tree age (9 years) were selected as sampling trees, and the flowers, flower buds, leaves, peels, pulps, roots, seeds, stems, young fruits (the whole fruit 60 days after flowering) and the like of 'Sijimi' longan were taken as materials for tissue expression analysis. Three groups of F1 large fruit strain FD105 and small fruit strain FD21 longan with the same growth and tree age (10 years) were selected as sampling trees, and the longan flesh 60, 70, 80, 90 and 100 days after flowering was taken as materials for fruit development analysis. All tests were repeated for 3 times. After sampling, it was immediately put into liquid nitrogen for quick freezing and transferred to a -80°C refrigerator for storage for future use.

1.2 Cloning and Bioinformatics Analysis of DICNRS Gene Sequence The base sequence and amino acid sequence information of the DICNR8 gene (Dlo 011045.1) were obtained from longan genome database (NCBI Sequence Read Archive, SRA315202). Primer Premier 5.0 was used to design primers CNR8-S and CNR8-A (Table 1) according to the ORF sequence of the DICNRS8 gene. Tianyi Huiyuan Biotechnology Co., Ltd. (Guangzhou) was entrusted to synthesize them. The RNA was extracted from the leaves of 'Sijimi' longan by using the plant RNA extraction kit of Huayueyang Biotechnology (Beijing) Co., Ltd. The PrimeScript 6

RT-PCR kit of Takara was used. See the instructions for specific operation steps. LUS02414 Reverse transcribed cDNA was used as a template for PCR amplification and cloning of the DICNR8 gene. The amplification conditions were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30s, annealing at 60°C for 30s, extension at 72°C for 40s, 35 cycles (denaturation-extension); extension at 72°C for 10 min and storage at 4°C. The amplified product was cut, recovered, purified, linked to a pMD18-T vector, and transformed into a DH5wœ competent cell, positive clones were screened through PCR. Positive mono-clones were selected and sent to Tianyi Huiyuan Biotechnology Co., Ltd. (Guangzhou) for sequencing. Online software SMART program (http://smart. emblheidelberg.de/) was used to predict the protein domain. ExPASy (http://expasy.org/tools/) was used to analyze the isoelectric point and molecular weight of the protein. According to the cloned cDNA sequence, BLASTp was used to perform homology comparison to the amino acid sequence. At the same time, MEGA 5 software was used to perform homology comparison to the amino acid sequence homology and perform phylogenetic analysis. A Neighbor-Joining evolutionary tree was constructed, 1000 repetitions were adopted, and the others were default settings.

1.3 Expression Analysis qRT-PCR primers qCNR8-S and qCNRS8-A (Table 1) were designed according to the cloned DICNRS gene sequence. BLASTn was used for testing in NCBI to ensure the specificity of the primers. The Actin gene (Dlo 028674) of longan was used as the internal reference gene. See Table 1 for the specific primer sequence. Table 1 Information of primers used . Primer sequence LL Size of PCR

ATGGCAAACAACTACAACGA eNRg.A |TCAACCTCCACGTCCCATGCT elie cloning (SEQ ID No.4)

GTTGAGAGGCTTGGATCTGC 7

ACAACTACAACGA (SEQ ID No.7) Subcellular localization 759 conc (SEQ ID No.12) The instrument used for qRT-PCR reaction was Roche's lightCycler 480, and the PCR reaction enzyme was SYBR Green Master Mix of Takara. The reaction system was 20mL, in which the template cDNA was 40ng, the upstream and downstream primers were 250nM respectively, SYBR Green Master Mix is 10uL, and the rest was supplemented with ddH20. Reaction procedure: pre-denaturation at 94°C for Smin; 94°C for 10s, 59°C for 20s, 72°C for 30s. After 40 cycles, a melting curve (95 — 65°C,

0.1°C/s) was made. 2-22“ was used to calculate the relative expression of the DICNRS gene. All samples were repeated for 3 times, and negative control was set. Excel software was used for average statistics. SPSS software was used for one-way ANOVA to analyze the difference significance of the change of the target gene in different tissues and materials (P < 0.05). SigmaPlot 12.5 software was used for plotting. Example 2: Subcellular Localization Analysis According to the cloned DICNRS gene sequence, primers (with terminator removed) (Table 1) were designed to amplify the ORF full length of DICNR8. The PCR reaction procedure was as above. A PCR product was detected through 1% agarose gel electrophoresis, purified, then linked to a pMD18-T vector and transformed into DHSa. Single colonies were selected, and plasmids were extracted for sequencing 8 after PCR detection.

Then, plasmids pBWA(V)HS-osgfp and DICNR8 were LUS02414 enzymatically digested with EcoR respectively, recovered and subjected to enzyme linkage.

The enzyme linked plasmids were transferred into E. coli DHSa.

After positive detection, correct strains were selected for sequencing, and then extraction was performed to obtain a plasmid pBWA(V)HS-DICNR8-osgfp.

Then, it was transferred into Arabidopsis mesophyll protoplasts by adopting a PEG mediated method (Yoo S D, Cho Y H, Sheen J.

Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis [J]. Nature Protocols, 2007, 2(7): 1565). Dark incubation was performed at 28°C for 24-48h and observation was performed by adopting a laser confocal microscope.

Meanwhile, pBWA(V)HS-osgfp was used as control.

Example 3: Construction of Over-expression Vector and Functional Verification of Transgenic Tomato A specific PCR primer OECNRS8-S/OECNRS-A (Table 1) was used for PCR amplification by using longan cDNA as a template.

The 5' terminal of the primer was respectively added with a BamH I digestion site, and the 5' terminal of the reverse primer was respectively added with a Sac I digestion site.

The obtained PCR product was linked to a pMD19-T vector and sequenced.

Finally, the correctly sequenced plasmids were extracted. pBI121 and the correctly sequenced plasmid were digested by using BamH I and Sac I respectively.

A plant expression vector containing the DICNRS8 target gene was constructed through T4 DNA ligase and named pBI121-DICNR8. The constructed over-expression vector pBI121-DICNR8 was transferred into Agrobacterium strain GV3101 by adopting a liquid nitrogen freeze-thaw method.

With reference to the literature (Arshad W, Waheed M T, Mysore K S, et al.

Agrobacterium-mediated transformation of tomato with rolB gene results in enhancement of fruit quality and foliar resistance against fungal pathogens[J]. PLoS One, 2014, 9(5): e96979), the DICNRS gene was transferred into tomato (Micro-Tom) by adopting an Agrobacterium tumefaciens gag infection method to obtain TO generation seeds.

Positive tomatoes were screened on MS solid medium containing 9

30ug/ml, and pBI121 plasmid specific primers were used to detect positive transgenic LU502414 tomato seedlings. T3 transgenic plants were cultured in the same environment as the wild type, and their fruit development phenotypes were compared. Example 4: Results and Analysis

1. Localization information of DICNRS gene In the early stage, we used 200 parts of 'Fengliduo' (female parent) x ‘Dawuyuan' (male parent) hybrid F1 generation and parent plants as materials. These materials were sequenced by RAD-seq technology and SNP markers were developed to construct a high-density genetic map of longan. A total of 12 stable QTL loci associated with the single fruit weight trait were screened by linkage localization analysis based on the data of single fruit weight for two consecutive years. The Dlo 011045.1 (DICNRB8) of the main effect QTL (qSFW-10-3) was determined as a candidate gene controlling the single fruit weight trait through qRT-PCR by using the fruits of different developmental stages of the large fruit strain FD105 and small fruit strain of F1 generation. This gene was located in the 10th linkage group of the longan genome. The specific location information was scaffold209:27358-29541 (FIG 1).

2. Cloning and Bioinformatics Analysis of DICNR8 Gene Longan pulp cDNA was used as a template. A fragment of about 700bp was amplified by using CNR8-S/CNRS-A (Table 1) (FIG 2). Sequencing results show that this gene (Dlo 011045.1) is 732bp in size, encodes 243 amino acids, and has a molecular weight of 26.34kDa and a theoretical isoelectric point of 5.35. It was named DICNR8 according to its genetic relationship with other CNR family members of crops. Amino acid sequence analysis shows that, in [Citrus sinensis CsCNR8 (Citrus sinensis, XP_006478313.1); Citrus clementina CcCNR8 (Citrus clementina, XP_006441807.2)], DICNRS contains a PLAC8 domain and is a member of the CNR family (FIG 3). BLASTp was used to perform homology search to the amino acid sequence of DICNRS. Then, MEGA 6.0 software was used to construct a phylogenetic tree (FIG

4). The results show that DICNRS is more closely related to the CNR8 members of LUS02414 citrus and grape from the perspective of evolution, and is divided into the CNRS subfamily.

3. Tissue expression characteristic analysis of DICNRS gene qRT-PCR results show that the DICNRS gene was expressed in 9 longan tissues, but the expression is tissue-specific, the expression in young fruits is the highest and is about 4 times that in seeds, the expression in leaves and pulp is the second (FIG 5).

4. Expression pattern of DICNRS gene during flower and fruit development Using the qRT-PCR technology, we analyzed the expression pattern of DICNR8 during fruit development of the large fruit strain FD105 and small fruit strain FD21 of the F1 generation. The results show that the DICNRS gene shows a significant upward trend in FD21 with fruit development 60-80 days after flowering (FIG 6). Similar to the change of pulp weight (FIG 7), the expression of DICNRS is regulated up by 4.1 and 10.8 times at 70 and 80 days after flowering, respectively. However, there is no significant change in fruit development stage of FD105. These results show that DICNRS8 may be involved in the development of pulp organs at an early stage.

5. Subcellular localization analysis of DICNRS gene In order to detect the localization of the DICNR protein in cells, a fusion protein expression vector (35S: DICNR8-GFP) containing enhanced Green Fluorescent Protein (GFP) was constructed, was transferred into Arabidopsis mesophyll protoplast cells by adopting a PEG mediated method and observed by using a laser confocal microscope. As shown in FIG 8, under the stimulation of 480nm wavelength, 35S: DICNR8-GFP only shows punctate fluorescence signals in the cytoplasm and upstream of cell membrane, while the 35S: GFP control group shows GFP signals in the whole cell without clear localization. These results show that the DICNRS protein may be localized on the cytoplasmic membrane.

6. Phenotypic analysis of DICNRS transgenic tomato 11

The transgenic results show that the fruits of tomato plants over-expressing DICNRS LUS02414 gene are smaller than those of wild type, and the yield also decreases significantly (FIG 9). The results show that the over-expression of the DICNR8 gene will significantly reduce the fruit weight, size and yield.

It is speculated that the longan DICNRS8 gene can negatively regulate the single fruit weight trait of plants by regulating the expression of downstream related genes. 12

Sequence List LU502414 Sequence List <110> Chongqing University of Arts and Sciences <120> DICNR8 gene for regulating single fruit weight trait of longan and the application of its protein <150> 202110007480.4 <151> 2021-81-05 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 732 <212> DNA <213> Artificial Sequence <400> 1 atggcaaaca actacaacga cgatactagc ggaaacgatt ctcatgagga atccagtcct 60 cttttgaaca accaacccaa gaatgaaaag caatctagcg ttgacggcaa ggccgccgtg 120 gttcctccge ctcagaagca ggtaccggtg cctggttgga cagctaatgg gctgccgttg 180 ggtcacggga gcgtgatggg tgagccgatg ggtcggaccc agtgggattc cagtctctge 240 gcttgtcttg gccgcaatga tgagttctge agcagcgatc ttgaagtttg tctccttgga 300 agtgtggctc cttgtgtgct ttatggaagc aatgttgaga ggcttggatc tgctcctggg 360 acattcgcta atcactgtgt gccttacact ggtctgtaca tgatcggtca agcctttttt 420 ggttggaatt gtcttgcacc atggttttca tatcctagtc gtacagctat tcgccggaag 480 tttaacctag agggtagtgt tgaggcactt aacaggtcat gtgggtgctg tggaagctgt 540 gtagaagatg acttgcaacg tgagaactgt gagtcagcat ttgattttgc aactcacgtc 600 ttctgccact tgtgtgectct ttgccaagaa ggtcgtgage tgcgtcggag gatgcctcat 660 cctgggttca atgctcagec tgtcttagtc atgattccge ctggggagca gagcatggga 720 cgtggaggtt ga 732 <210> 2 <211> 243 <212> PRT <213> Artificial Sequence <400> 2 Met Ala Asn Asn Tyr Asn Asp Asp Thr Ser Gly Asn Asp Ser His Glu 1 5 10 15 Glu Ser Ser Pro Leu Leu Asn Asn Gln Pro Lys Asn Glu Lys Gln Ser

Ser Val Asp Gly Lys Ala Ala Val Val Pro Pro Pro Gln Lys Gln Val 40 45 Pro Val Pro Gly Trp Thr Ala Asn Gly Leu Pro Leu Gly His Gly Ser 50 55 60 Page 1

Sequence List LU502414 Val Met Gly Glu Pro Met Gly Arg Thr Gln Trp Asp Ser Ser Leu Cys 65 70 75 80 Ala Cys Leu Gly Arg Asn Asp Glu Phe Cys Ser Ser Asp Leu Glu Val 85 90 95 Cys Leu Leu Gly Ser Val Ala Pro Cys Val Leu Tyr Gly Ser Asn Val 100 105 110 Glu Arg Leu Gly Ser Ala Pro Gly Thr Phe Ala Asn His Cys Val Pro 115 120 125 Tyr Thr Gly Leu Tyr Met Ile Gly Gln Ala Phe Phe Gly Trp Asn Cys 130 135 140 Leu Ala Pro Trp Phe Ser Tyr Pro Ser Arg Thr Ala Ile Arg Arg Lys 145 150 155 160 Phe Asn Leu Glu Gly Ser Val Glu Ala Leu Asn Arg Ser Cys Gly Cys 165 170 175 Cys Gly Ser Cys Val Glu Asp Asp Leu Gln Arg Glu Asn Cys Glu Ser 180 185 190 Ala Phe Asp Phe Ala Thr His Val Phe Cys His Leu Cys Ala Leu Cys 195 200 205 Gln Glu Gly Arg Glu Leu Arg Arg Arg Met Pro His Pro Gly Phe Asn 210 215 220 Ala Gln Pro Val Leu Val Met Ile Pro Pro Gly Glu Gln Ser Met Gly 225 230 235 240 Arg Gly Gly <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 atggcaaaca actacaacga 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <400> 4 tcaacctcca cgtcccatge t 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 gttgagaggc ttggatctgc 20 Page 2

Sequence List LU502414 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 aggttaaact tccggcgaat 20 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <400> 7 cagtggtctc acaacatggc aaacaactac aacga 35 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <400> 8 cagtggtctc atacaacctc cacgtcccat gct 33 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <400> 9 cgggatcccg atggcaaaca actacaacga 30 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <400> 10 cgagctcgac ctccacgtcc catgct 26 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 attgttgagc agcttgtccg 20 Page 3

Sequence List LU502414 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 ggaacacaac tttggcgagt 20

Page 4

Claims (5)

1. A longan single fruit weight trait regulation gene D/CNR&, wherein a nucleotide sequence of the longan single fruit weight trait regulation gene DICNRS is expressed by SEQ ID No.1.

2. A regulation protein expressed by the longan single fruit weight trait regulation gene DICNRS according to claim 1, wherein an amino acid sequence of the regulation protein is expressed by SEQ ID No.2.

3. A vector containing the longan single fruit weight trait regulation gene according to claim 1.

4. Engineering bacteria containing the vector according to claim 3.

5. Application of the longan single fruit weight trait regulation gene according to claim 1 to longan single fruit weight trait regulation. 13