LU102610B1 - A subunit vaccine of Fowl adenovirus serotype-4 and its application - Google Patents

Abstract

The invention discloses a subunit vaccine of Fowl adenovirus (FAdV) serotype-4 and its application, and belongs to the technical field of veterinary biological products. The invention utilizes the baculovirus expression system to efficiently express the Fowl adenovirus serotype 4 Fiber-2 protein, that is, insert the Fiber-2 protein sequence containing the signal peptide after the p10 promoter and the PH promoter of the pFastBacTMDual plasmid. This allows the optimized Fiber-2 protein to achieve secretory expression and increase the expression level, and the expressed Fiber-2 protein maintains its original immunogenicity. The subunit vaccine prepared by adopting insect cells to express serum type 4 Fowl adenovirus Fiber-2 protein has high antigen expression, high antigen stability, high purity, good safety, strong immunogenicity, and it laid a solid foundation for industrial production of Fowl adenovirus subunit vaccine and diagnostic reagent.

Description

DESCRIPTION A subunit vaccine of Fowl adenovirus serotype-4 and its application

TECHNICAL FIELD The invention relates to the technical field of veterinary biological products, in particular to a subunit vaccine of Fowl adenovirus serotype-4 and application thereof.

BACKGROUND Fowl adenovirus (FAV) is a common infectious disease pathogen in poultry and wild fowl that is prevalent worldwide. Fowl adenovirus of subgroup I is divided into 5 species, A, B, C, D, E, and 12 serotypes. Among them, Fowl avianadenovirus serotype 8b (FAdV- 8b) mainly causes inclusion body hepatitis (Inclusion body hepatitis). hepatitis, IBH), Fowl adenovirus type 4 (Fowl avianadenovirus serotype 4, FAdV-4) is mainly an acute infectious disease in chickens with chicken inclusion body hepatitis and light yellow transparent liquid in the pericardium as the main clinical symptoms. It is also called clinically "Hydropericardium-hepatitis syndrome (HHS)". The disease has a rapid onset and rapid spread. It mainly causes 4 to 8 weeks old broiler infection, and the mortality rate can reach 30% to 70%. The disease was first reported in Ankara, Pakistan, and is therefore also called "Ankara Disease". Since the autumn of 2014, the number of HHS cases in China has gradually increased, especially in chicken flocks such as broilers (817 broilers), chai chicken, and commercial layers in Shandong Province. After June 2015, the disease has spread in a large area in China, causing huge economic losses to the poultry industry.

FAdV-4 is highly pathogenic to broiler chickens, and has spread to large areas of Asia, Central and South America, and some European countries. The economic loss caused by FAdV-4 to the poultry industry continues to grow rapidly. Therefore, proper disinfection, ventilation, and restriction of access to poultry keepers or visitors to houses and equipment may help prevent the occurrence of diseases. However, at present, the HHS vaccine can provide extensive protection for immunized chickens and minimize direct economic losses, therefore, it 1s the most fundamental means to control HHS.

Fiber-2 protein is one of the capsid proteins of FAdV-4. Studies have confirmed that Fiber-2 protein has good antigenicity and can effectively stimulate the body to produce neutralizing antibodies. Therefore, the preparation of Fowl adenovirus (FAdV-4) serotype 4 vaccine by genetic engineering is an important way to control the disease.

SUMMARY The purpose of the present invention is to provide a subunit vaccine of Fowl adenovirus serotype-4 and its application to solve the above-mentioned problems in the prior art.

In order to achieve the above purposes, the invention provides the following technical scheme: The present invention provides an antigen protein whose amino acid sequence is shown in SEQ ID NO.6.

The present invention also provides a gene encoding the antigen protein of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.5.

The present invention also provides a recombinant baculovirus vector containing the gene.

Furthermore, the gene according to claim 2 1s inserted after the baculovirus PH and/or P10 promoter.

The present invention also provides a host cell containing the recombinant baculovirus vector.

Further, the host cell is selected from Sf9 or High Five cells of an insect cell line.

The present invention also provides a subunit vaccine of Fowl adenovirus serotype-4, which contains the antigen protein.

Further, the vaccine also contains pharmaceutically acceptable excipients and/or adjuvants.

Further, the adjuvant is a white oil adjuvant.

The invention also provides an application of the antigen protein, the gene, and the recombinant baculovirus vector in preparing a medicine for preventing and treating chicken hydropericardial syndrome caused by Fowl adenovirus serotype 4.

Technical scheme: The subunit vaccine prepared by adopting insect cells SFO and High five to recombinantly express Fowl adenovirus Fiber-2 protein has high antigen expression, high antigen stability, high purity, good safety and strong immunogenicity. In addition, it can be applied to prepare genetic engineering subunit vaccines without purification, which lays a solid foundation for the industrial production of Fowl adenovirus subunit vaccines and diagnostic reagents.

BRIEF DESCRIPTION OF THE FIGURES In order to explain the embodiments of the present invention or the technical solutions in the prior art more clearly, the following will briefly introduce the drawings that need to be used in the embodiments. Obviously, the drawings in the following description are only some of the present invention. For the embodiments, for those of ordinary skill in the art, other drawings may be obtained based on these drawings without creative labor.

Figure 1 shows the indirect immunofluorescence detection of SF9 cells infected by recombinant baculovirus rpFastBac™Dual-FAdV-4-Fiber-2; A is normal SF9 cells, B is pFastBac™Dual empty bacmid SF9 cells, and C is transfected recombinant baculovirus SF9 cells of rpFastBac™Dual-FAdV-4-Fiber-2.

DESCRIPTION OF THE INVENTION Various exemplary embodiments of the present invention will now be described in detail. The detailed description should not be considered as a limitation to the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and embodiments of the present invention.

It should be understood that the terms described in the present invention are only used to describe specific embodiments and are not used to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value within the stated range and any other stated value or intermediate value within the stated range 1s also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art in the field of the present invention. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In case of conflict with any incorporated document, the contents of this manual shall prevail.

Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present specification, which is obvious to those skilled in the art. Other embodiments derived from the description of the present invention will be obvious to the skilled person. The specification and examples of this application are only exemplary.

As used herein, "including", "comprising", "having", "containing", etc., are all open terms, which means including but not limited to.

Example 1 Cloning and optimization of Fiber-2 gene

The present invention isolated a highly pathogenic Fowl adenovirus serotype 4 strain in a chicken farm in Jinan, Shandong in 2017, and named it Fowl adenovirus type 4 FAdV- 4 SDJN0105 (SDJN0105 FAdv-4 SDJNO105) strain. It was deposited in the Culture Collection Center of Wuhan University, Wuhan, China on January 29, 2021, with the deposit number: CCTCC No: V2021 14; it was used as a template for amplification.

1. Cloning of Fiber-2 gene of Fowl adenovirus serotype 4 (1) Prepare the Fowl adenovirus genome, lyse the virus of the Fowl adenovirus serotype 4 isolate virus with cell lysate, then extract the viral genome with phenol, chloroform, and isoamyl alcohol, and finally precipitate with absolute ethanol and dissolve in 30uL sterilized ultrapure water, the Fowl adenovirus serotype 4 genome is obtained, and it is kept at -20°C for use.

(2) According to the Fowl adenovirus serotype 4 Fiber-2 gene sequence published in NCBI (accession number: MH006602), primers were designed and synthesized. The sequence information of the primers is as follows: FAdV-4-F (as shown in SEQ ID NO.1): 5’-atgctccgggeccctaaaagaaga -3°; FAdV-4-R (as shown in SEQ ID NO.2): 5’-ttacgggagggaggccgctggaca -3°.

(3) Take 1 uL of the Fowl adenovirus serotype 4 nucleic acid extracted in step (1) as a template, and use the primer pair described in step (2) for PCR amplification. After sequence determination, its nucleotide sequence is SEQ ID NO.3 According to the sequencing results, its amino acid sequence is deduced as SEQ ID NO 4.

2. Optimization of Fiber-2 gene

In order to make the Fiber-2 antigen protein can be secreted and expressed in insect cells, the GP67 signal peptide was added to the N-terminus of the Fiber-2 sequence obtained in step 1, and the codons were optimized to improve the expression efficiency of the antigen protein in insect cells. The nucleotide sequence of the optimized Fiber-2 gene is SEQ ID NO. 5, and the optimized and modified amino acid sequence is SEQ ID NO. 6, and the optimized and modified sequence can well express the antigen site.

Example 2: Construction of Recombinant Baculovirus Expressing Fiber-2 Gene The present invention designs primers and inserts recombinant fragments respectively for the PH and p10 promoters of pFastBac™Dual vector, and applies an expression system to construct a recombinant donor plasmid of the target gene of dual promoters.

The primer sequence designed for the PH promoter is as follows: PH-FAdV-4-F (as shown in SEQ ID NO.7):

CGGTCCGAAGCGCGCGGAATTCATGCTGCTCGTGAACCAGTCCCACCAG PH-FAdV-4-R (as shown in SEQ ID NO.8):

TATGATCCTCTAGTACTTCTCGACAAGCTTTTAGGGCAGGGAGGCAGCTG GAC ; The primer sequence designed for p10 promoter is as follows: P10-FAdV-4-F (as shown in SEQ ID NO.9):

ACCCGGGATCTCGAGCCATGGATGCTGCTCGTGAACCAGTCCCACCAG ; P10-FAdV-4-R (as shown in SEQ ID NO.10): GCTGATGCATAGCATGCGGTACCTTAGGGCAGGGAGGCAGCTGGAC,

1. Take restriction enzymes EcoRI and Hind III to digest the pFastBac™Dual vector with restriction enzymes EcoRI and Hind III to digest the downstream sequence of the PH promoter of the vector, mark the 1.5ml centrifuge tube that needs to be used, add samples and mix in the centrifuge tube according to the following Uniformity: The reaction system is 20uL, and the sample is added as shown in Table 1: Table 1 PFastBac™Dual carrier Restriction enzyme EcoRI Restriction endonuclease Hind II ddH,O Make up to 20uL Place the centrifuge tube in a constant temperature water bath at 37°C for 15min- 20min. After that, the double enzyme digestion products were recovered by gel.

2. According to the method described in step 1, change the restriction endonucleases to Nco I and Kpn I to double digest the downstream sequence of the P10 promoter of the pFastBac™Dual vector, and then collect the digested product by gel.

3. Seamless cloning According to the system shown in Table 2, the seamless connection kit was used to connect the vector with the recombinant sequence. Table 2 PFastBac™Dual Linearization vector 60ng-80ng 2 x HIFI Onestep Assembly Cloning Mix Fiber-2 gene optimized in step 2 of Example 1 ddH,O Make up to 10uL The mixture was gently mixed and reacted at 50°C for 30 min and placed on ice at the end of the reaction.

4. Conversion reaction (1) Take the DH5a competent cells and place them on ice, avoiding violent shaking, add 10 uL of the connection reaction solution to the competent cells, and let stand the solution on 1ce for 30 minutes; (2) After heat shock at 42°C for 90s, immediately 1ce bath for 2min; (3) Add 900 uL of non-resistant LB liquid medium to the mixture, and culture with shaking at 37°C and 120 rpm for 1 hour;

(4) Centrifuge the bacteria solution at 10000rpm for 90s, discard the supernatant, add 100uL of non-resistant LB liquid culture medium to resuspend the bacteria precipitate, take 50uL of resuspension solution and evenly coat it on Amp” resistant LB solid medium, and then invert it in a 37°C incubator for overnight culture; (5) After a single colony grows on the plate, pick it and inoculate it into Amp” resistant LB liquid medium, shake the bacteria overnight at 37°C and 120 rpm, centrifuge the bacterial solution and extract the plasmid with a plasmid extraction kit. The recombinant plasmid is sent to a sequencing company for sequencing.

5. Transformation reaction and preparation of recombinant bacmid After the identification of the recombinant plasmid is correct, transform it into DH10Bac competent cells. The method is the same as that in step 4. First, culture it in a liquid medium without antibiotics in a shaker at 37°C for 4 hours, then take the centrifuged bacterial solution and spread it evenly on LB The blue-white spot tertiary antibody was screened on a solid medium, and incubated at 37°C for 48 hours. Afterwards, blue-white spot screening was carried out. White spot colonies were picked and streaked on LB solid medium for purification and screening. After repeated screening, the white spots were picked out in liquid medium with the same resistance and cultured with shaking at 37°C for 16 hours. The bacmid small extraction kit extracts the recombinant bacmid.

(7) PCR identification

The extracted bacmid DNA was identified by PCR, and the plasmids with positive identification were sent to a sequencing company for sequencing, and those with positive sequencing were used for transfection of SFO cells.

The identification primer sequence is as follows: Fiber-2-F (as shown in SEQ ID NO.11): ATGCTGCTCGTGAACCAGTCCCACCAG; Fiber-2-R (as shown in SEQ ID NO.12): TTAGGGCAGGGAGGCAGCTGGAC; Example 3 expression of recombinant plasmid in SF9 cells

1. Cultivation of SF9 cells SFO cells were cultured adherently, and the cells were plated in a 6-well plate to ensure that the cells grew well and were in the logarithmic growth phase. They were cultured in SF900II medium containing 1% double antibody at 27°C, and the cells were cultured for 48-72h for passage. The cell counting plate controls the cell culture density (1x106-2x106 cells/mL), cultured at 27°C for 1 hour to make the cells adhere to the wall.

2. Transfection of recombinant bacmid DNA into SF9 cells Take the Cellfectin II Reagent for insect cells to transfect recombinant bacmid DNA according to the method provided in the instructions:

(1) Spread SF9 cells in a 6-well plate with 2% FBS-sf900 II medium, 2mL cell suspension per well (1x106 cells/well), and allow the cells to adhere to the wall for 60 minutes at room temperature;

(2) Add 8 pL of Cellfectin II Reagent transfection reagent to 100 uL of serum-free cell culture medium, shake gently to mix, and place at room temperature for 30 minutes;

(3) Determine the concentration of the bacmid to be transfected, and mix 2 pg of recombinant bacmid DNA with 100 uL of serum-free cell culture medium, and let it stand at room temperature;

(4) Mix the above two mixtures, put them at room temperature and let them stand for about 30 minutes to form a recombinant bacmid-liposome complex;

(5) Slowly add the mixed recombinant bacmid-liposome complex to the cultured cells in the 6-well plate, and incubate at 27°C for 3-5h;

(6) After the incubation is completed, carefully aspirate the supernatant and add 10% FBS-SF900 II medium, and incubate at 27°C for 5-6 days, and carefully observe the cell status during this period;

(7) After the cells swell, become larger, and fall off, collect the supernatant and mark it as P1 generation recombinant baculovirus;

(8) Infect newly cultured SF9 cells with P1 recombinant baculovirus rpFastBac™Dual-FAdV-4-Fiber-2 to increase the recombinant baculovirus content and pass to the third generation.

Collect the culture supernatant and store it at -80°C for later use.

3. Identification of expression products Indirect immunofluorescence detection (IFA) (1) SF9 cells were cultured in a 6-well plate for 48 hours, and the third-generation recombinant baculovirus rpFastBac™Dual-FAdV-4-Fiber-2 was infected with insect cells SF9 and cultured at 27°C for 72 hours. At the same time, the control cells transfected with pFastBac™Dual vector and Normal SF9 cells served as the negative control group.

(2) After culturing the cells for 72 hours, aspirate the supernatant and wash with PBS.

(3) Add 200 pL of pre-cooled 4% paraformaldehyde solution to each well for fixation for 10 minutes, wash with PBS 3 times, and let stand for 2 minutes each time.

(4) Add 200uL of 0.2% Triton X-100 (diluted with PBS) to each well, let it stand at room temperature for 15 minutes to complete the permeabilization of the cells, and wash 3 times with PBS.

(5) Take His-tagged mouse monoclonal antibody as the primary antibody, with a dilution of 1:2000, 200 uL per well, at 37°C for 1 hour; discard the primary antibody, and wash with PBS 3 times.

(6) Add 200 pL of the goat anti-mouse FITC-labeled secondary antibody diluted 1:2000, and let it act at 37°C for 1 hour; discard the secondary antibody and wash with PBS 3 times.

(7) Add 100uL DAPI into each hole, act at room temperature for 5-15min, wash with PBS for 3 times in dark, wrap with tin foil, leave 100uL PBS in each hole, and observe and take pictures under inverted fluorescence microscope. Results as shown in fig. 1, specific fluorescence was observed in SF9 cells transfected with recombinant baculovirus rpFastBac™Dual -FAdV-4-Fiber-2, but no specific fluorescence was found in control cells transfected with pFastBac"MDual vector and normal SF9 cells, indicating that the target antigen protein was correctly expressed in Sf9 cells and the recombinant baculovirus was correctly constructed.

Example 4 Preparation and immunogenicity test of subunit vaccine

1. Preparation of subunit vaccine The 3rd generation recombinant baculovirus stock solution was inoculated into High Five cells according to the volume ratio of 1: 100, and the cell culture supernatant was obtained about 24h after inoculation. After dialysis, the protein was quantified according to the BCA protein concentration determination kit method of Biyuntian Company. The expression of Fiber-2 protein was determined to be 6.0mg/ml.

The secreted and expressed Fowl adenovirus Fiber-2 protein and white oil adjuvant were mixed in a volume ratio of 3:5 to prepare three specifications of subunit vaccines. The Fiber-2 protein content in the three subunit vaccines was 25ug/ml, 50ug/ml, and 100ug/ml respectively.

2. Subunit vaccine immunogenicity test Take 40 SPF chickens aged 21 days and divide them into 4 groups, 10 in each group. The vaccine immunization group was subcutaneously injected with the Fiber-2 subunit vaccine prepared in step 1 above, and the immunization doses were Sug/0.2ml and 10ug.

/0.2ml and 20ug/0.2ml, the blank control group was injected with 0.2ml saline subcutaneously into the neck as the challenge control.

All test chickens were raised in the isolators. 21 days after immunization, they were challenged with the Fowl adenovirus type 4 FAdV-4 SDINO105 (SDJN0105 FAdv-4 SDJNO105) virus solution stored in our laboratory by intramuscular injection and observed for 14 days.

The number of morbidity, death and protection was recorded, and the results are shown in Table 3. Table 3 Results of immunogenicity test of Fiber-2 protein subunit vaccine nt Immunization . cases deaths rate Tw [ww [ww] oo The results showed that the challenge control group all died of illness, while the 1st- 3rd immune group produced better immune protection against the immunizing agent, the immune effect was good, and when the immunization dose was Sug/0.2ml, it could give The chickens provide complete protection and the effect is remarkable.

Therefore, the Fowl adenovirus Fiber-2 protein subunit vaccine prepared by the method of the present invention can provide effective immune protection to chickens.

The above-mentioned embodiments only describe the preferred mode of the present invention, and do not limit the scope of the present invention.

Without departing from the design spirit of the present invention, those of ordinary skill in the art have made various contributions to the technical solutions of the present invention.

Variations and improvements should fall within the protection scope determined by the claims of the present invention.

SEQUENCE LISTING LU102610 <110> Poultry Institute, Shandong Academy of Agricultural Sciences <120> A subunit vaccine of Fowl adenovirus serotype-4 and its application <130> PT1034 <160> 5 <170> BiSSAP 1.3.6 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FAdV-4-F <400> 1 atgctccggg cccctaaaag aaga 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FAdV-4-R <400> 2 ttacgggagg gaggccgctg gaca 24 <210> 3 <211> 1440 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence after PCR amplification <400> 3 atgctccggg cccctaaaag aagacattcc gaaaacggga agcccgagac cgaagcggga 60 ccttecccgg ctccaatcaa gcgcgccaaa cgcatggtga gagcatccca gcttgacctg 120 gtttatcctt tcgattacgt ggccgacccc gtcggaggge tcaacccgec ttttttggga 180 ggctcaggac ccctagtgga ccagggegga cagcttacge tcaacgtcac cgatcccatc 240 LU102610 atcatcaaga acagatcggt ggacttggcc cacgacccca gtctcgatgt caacgcccaa 300 ggtcaactgg cggtggccgt tgaccccgaa ggggccctgg acatcacccc cgatggactg 360 gacgtcaagg tcgacggagt gaccgtaatg gtcaacgatg actgggaact ggccgtaaaa 420 gtcgacccgt ccggeggatt ggattccacc gegggtggac tgggggtcag cgtggacgac 480 accttgctcg tggatcaggg agaactgggc gtacacctca accaacaagg acccatcact 540 gccgatagca gtggtatcga cctcgagatc aatcctaaca tgttcacggt caacacctcg 600 accggaagcg gagtgctgga actcaaccta aaagcgcagg gaggcatcca agccgacagt 660 tcgggagtgg gcgtttccgt ggatgaaagc ctacagattg tcaacaacac tctggaagtg 720 aaaccggatc ccagcggacc gcttacggtc tccgccaatg gcctagggct gaagtacgac 780 actaataccc tagcggtgac cgcgggcgct ttaaccgtgg tcggaggggg gagcgtcetec 840 acacccatcg ctacttttgt ctcgggaagt cccagcctca acacctacaa tgccacgacc 900 gtcaattcca gcgcgaacgc cttetettge gcctactacc ttcaacagtg gaacatacag 960 gggctccttg ttacctecct ctacttgaaa ttggacagcg ccaccatggg gaatcgecect 1020 ggggacctca actccgccaa tgccaaatgg ttcacctttt gggtgtccgc ctatctccag 1080 caatgcaacc cctccgggat tcaagcggga acggtcagec cctccaccge caccctcacg 1140 gactttgaac ccatggccaa taggagcgtg accagcccat ggacgtactc ggccaatgga 1200 tactatgaac catccatcgg ggaattccaa gtgttcagec cggtggtaac aggtgcctgg 1260 aacccgggaa acatagggat ccgegteete cecgtgecgg tttcggeectec cggagagcga 1320 tacacccttc tatgctatag tctgcagtgc acgaacgcga gcatttttaa tccaaacaac 1380 agcggaacca tgatcgtggg acccgtgete tacagctgtc cagcggecte cecteccgtaa 1440 <210> 4

<211> 1340

<212> PRT

<213> Artificial Sequence

<220>

<223> amino acid sequence after PCR amplification

<400> 4

Met Glu Thr Leu Glu Ala Arg Gly Ala Leu Ala Pro Arg Leu Tyr Ser

Ala Arg Gly Ala Arg Gly His Ile Ser Ser Glu Arg Gly Leu Ala Ser

Asn Gly Leu Tyr Leu Tyr Ser Pro Arg Gly Leu Thr His Arg Gly Leu 40 45 Ala Leu Ala Gly Leu Tyr Pro Arg Ser Glu Arg Pro Arg Ala Leu Ala 50 55 60 Pro Arg Ile Leu Glu Leu Tyr Ser Ala Arg Gly Ala Leu Ala Leu Tyr 65 70 75 80 Ser Ala Arg Gly Met Glu Thr Val Ala Leu Ala Arg Gly Ala Leu Ala 85 90 95 Ser Glu Arg Gly Leu Asn Leu Glu Ala Ser Pro Leu Glu Val Ala Leu 100 105 110 Thr Tyr Arg Pro Arg Pro His Glu Ala Ser Pro Thr Tyr Arg Val Ala 115 120 125 Leu Ala Leu Ala Ala Ser Pro Pro Arg Val Ala Leu Gly Leu Tyr Gly 130 135 140 Leu Tyr Leu Glu Ala Ser Asn Pro Arg Pro Arg Pro His Glu Leu Glu 145 150 155 160 Gly Leu Tyr Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Pro Arg Leu Glu 165 170 175 Val Ala Leu Ala Ser Pro Gly Leu Asn Gly Leu Tyr Gly Leu Tyr Gly 180 185 190 Leu Asn Leu Glu Thr His Arg Leu Glu Ala Ser Asn Val Ala Leu Thr 195 200 205 His Arg Ala Ser Pro Pro Arg Ile Leu Glu Ile Leu Glu Ile Leu Glu 210 215 220 Leu Tyr Ser Ala Ser Asn Ala Arg Gly Ser Glu Arg Val Ala Leu Ala 225 230 235 240 Ser Pro Leu Glu Ala Leu Ala His Ile Ser Ala Ser Pro Pro Arg Ser 245 250 255 Glu Arg Leu Glu Ala Ser Pro Val Ala Leu Ala Ser Asn Ala Leu Ala 260 265 270 Gly Leu Asn Gly Leu Tyr Gly Leu Asn Leu Glu Ala Leu Ala Val Ala 275 280 285 Leu Ala Leu Ala Val Ala Leu Ala Ser Pro Pro Arg Gly Leu Gly Leu 290 295 300 Tyr Ala Leu Ala Leu Glu Ala Ser Pro Ile Leu Glu Thr His Arg Pro 305 310 315 320 Arg Ala Ser Pro Gly Leu Tyr Leu Glu Ala Ser Pro Val Ala Leu Leu 325 330 335 Tyr Ser Val Ala Leu Ala Ser Pro Gly Leu Tyr Val Ala Leu Thr His 340 345 350 Arg Val Ala Leu Met Glu Thr Val Ala Leu Ala Ser Asn Ala Ser Pro 355 360 365 Ala Ser Pro Thr Arg Pro Gly Leu Leu Glu Ala Leu Ala Val Ala Leu 370 375 380 Leu Tyr Ser Val Ala Leu Ala Ser Pro Pro Arg Ser Glu Arg Gly Leu 385 390 395 400 Tyr Gly Leu Tyr Leu Glu Ala Ser Pro Ser Glu Arg Thr His Arg Ala 405 410 415 Leu Ala Gly Leu Tyr Gly Leu Tyr Leu Glu Gly Leu Tyr Val Ala Leu 420 425 430 Ser Glu Arg Val Ala Leu Ala Ser Pro Ala Ser Pro Thr His Arg Leu

Glu Leu Glu Val Ala Leu Ala Ser Pro Gly Leu Asn Gly Leu Tyr Gly 450 455 460 Leu Leu Glu Gly Leu Tyr Val Ala Leu His Ile Ser Leu Glu Ala Ser 465 470 475 480 Asn Gly Leu Asn Gly Leu Asn Gly Leu Tyr Pro Arg Ile Leu Glu Thr 485 490 495 His Arg Ala Leu Ala Ala Ser Pro Ser Glu Arg Ser Glu Arg Gly Leu 500 505 510 Tyr Ile Leu Glu Ala Ser Pro Leu Glu Gly Leu Ile Leu Glu Ala Ser 515 520 525 Asn Pro Arg Ala Ser Asn Met Glu Thr Pro His Glu Thr His Arg Val 530 535 540 Ala Leu Ala Ser Asn Thr His Arg Ser Glu Arg Thr His Arg Gly Leu 545 550 555 560 Tyr Ser Glu Arg Gly Leu Tyr Val Ala Leu Leu Glu Gly Leu Leu Glu 565 570 575 Ala Ser Asn Leu Glu Leu Tyr Ser Ala Leu Ala Gly Leu Asn Gly Leu 580 585 590 Tyr Gly Leu Tyr Ile Leu Glu Gly Leu Asn Ala Leu Ala Ala Ser Pro 595 600 605 Ser Glu Arg Ser Glu Arg Gly Leu Tyr Val Ala Leu Gly Leu Tyr Val 610 615 620 Ala Leu Ser Glu Arg Val Ala Leu Ala Ser Pro Gly Leu Ser Glu Arg 625 630 635 640 Leu Glu Gly Leu Asn Ile Leu Glu Val Ala Leu Ala Ser Asn Ala Ser 645 650 655 Asn Thr His Arg Leu Glu Gly Leu Val Ala Leu Leu Tyr Ser Pro Arg 660 665 670 Ala Ser Pro Pro Arg Ser Glu Arg Gly Leu Tyr Pro Arg Leu Glu Thr 675 680 685 His Arg Val Ala Leu Ser Glu Arg Ala Leu Ala Ala Ser Asn Gly Leu 690 695 700 Tyr Leu Glu Gly Leu Tyr Leu Glu Leu Tyr Ser Thr Tyr Arg Ala Ser 705 710 715 720 Pro Thr His Arg Ala Ser Asn Thr His Arg Leu Glu Ala Leu Ala Val 725 730 735 Ala Leu Thr His Arg Ala Leu Ala Gly Leu Tyr Ala Leu Ala Leu Glu 740 745 750 Thr His Arg Val Ala Leu Val Ala Leu Gly Leu Tyr Gly Leu Tyr Gly 755 760 765 Leu Tyr Ser Glu Arg Val Ala Leu Ser Glu Arg Thr His Arg Pro Arg 770 775 780 Ile Leu Glu Ala Leu Ala Thr His Arg Pro His Glu Val Ala Leu Ser 785 790 795 800 Glu Arg Gly Leu Tyr Ser Glu Arg Pro Arg Ser Glu Arg Leu Glu Ala 805 810 815 Ser Asn Thr His Arg Thr Tyr Arg Ala Ser Asn Ala Leu Ala Thr His 820 825 830 Arg Thr His Arg Val Ala Leu Ala Ser Asn Ser Glu Arg Ser Glu Arg 835 840 845 Ala Leu Ala Ala Ser Asn Ala Leu Ala Pro His Glu Ser Glu Arg Cys 850 855 860 Tyr Ser Ala Leu Ala Thr Tyr Arg Thr Tyr Arg Leu Glu Gly Leu Asn

Gly Leu Asn Thr Arg Pro Ala Ser Asn Ile Leu Glu Gly Leu Asn Gly 885 890 895 Leu Tyr Leu Glu Leu Glu Val Ala Leu Thr His Arg Ser Glu Arg Leu 900 905 910 Glu Thr Tyr Arg Leu Glu Leu Tyr Ser Leu Glu Ala Ser Pro Ser Glu 915 920 925 Arg Ala Leu Ala Thr His Arg Met Glu Thr Gly Leu Tyr Ala Ser Asn 930 935 940 Ala Arg Gly Pro Arg Gly Leu Tyr Ala Ser Pro Leu Glu Ala Ser Asn 945 950 955 960 Ser Glu Arg Ala Leu Ala Ala Ser Asn Ala Leu Ala Leu Tyr Ser Thr 965 970 975 Arg Pro Pro His Glu Thr His Arg Pro His Glu Thr Arg Pro Val Ala 980 985 990 Leu Ser Glu Arg Ala Leu Ala Thr Tyr Arg Leu Glu Gly Leu Asn Gly 995 1000 1005 Leu Asn Cys Tyr Ser Ala Ser Asn Pro Arg Ser Glu Arg Gly Leu Tyr 1010 1015 1020 Ile Leu Glu Gly Leu Asn Ala Leu Ala Gly Leu Tyr Thr His Arg Val 1025 1030 1035 1040 Ala Leu Ser Glu Arg Pro Arg Ser Glu Arg Thr His Arg Ala Leu Ala 1045 1050 1055 Thr His Arg Leu Glu Thr His Arg Ala Ser Pro Pro His Glu Gly Leu 1060 1065 1070 Pro Arg Met Glu Thr Ala Leu Ala Ala Ser Asn Ala Arg Gly Ser Glu 1075 1080 1085 Arg Val Ala Leu Thr His Arg Ser Glu Arg Pro Arg Thr Arg Pro Thr 1090 1095 1100 His Arg Thr Tyr Arg Ser Glu Arg Ala Leu Ala Ala Ser Asn Gly Leu 1105 1110 1115 1120 Tyr Thr Tyr Arg Thr Tyr Arg Gly Leu Pro Arg Ser Glu Arg Ile Leu 1125 1130 1135 Glu Gly Leu Tyr Gly Leu Pro His Glu Gly Leu Asn Val Ala Leu Pro 1140 1145 1150 His Glu Ser Glu Arg Pro Arg Val Ala Leu Val Ala Leu Thr His Arg 1155 1160 1165 Gly Leu Tyr Ala Leu Ala Thr Arg Pro Ala Ser Asn Pro Arg Gly Leu 1170 1175 1180 Tyr Ala Ser Asn Ile Leu Glu Gly Leu Tyr Ile Leu Glu Ala Arg Gly 1185 1190 1195 1200 Val Ala Leu Leu Glu Pro Arg Val Ala Leu Pro Arg Val Ala Leu Ser 1205 1210 1215 Glu Arg Ala Leu Ala Ser Glu Arg Gly Leu Tyr Gly Leu Ala Arg Gly 1220 1225 1230 Thr Tyr Arg Thr His Arg Leu Glu Leu Glu Cys Tyr Ser Thr Tyr Arg 1235 1240 1245 Ser Glu Arg Leu Glu Gly Leu Asn Cys Tyr Ser Thr His Arg Ala Ser 1250 1255 1260 Asn Ala Leu Ala Ser Glu Arg Ile Leu Glu Pro His Glu Ala Ser Asn 1265 1270 1275 1280 Pro Arg Ala Ser Asn Ala Ser Asn Ser Glu Arg Gly Leu Tyr Thr His 1285 1290 1295 Arg Met Glu Thr Ile Leu Glu Val Ala Leu Gly Leu Tyr Pro Arg Val

Ala Leu Leu Glu Thr Tyr Arg Ser Glu Arg Cys Tyr Ser Pro Arg Ala 1315 1320 1325 Leu Ala Ala Leu Ala Ser Glu Arg Leu Glu Pro Arg 1330 1335 1340 <210> 5 <211> 1569 <212> DNA <213> Artificial Sequence <220> <223> gene encoding the antigen protein <400> 5 atgctgctcg tgaaccagtc ccaccagggt ttcaacaagg agcacacaag caagatggtg 60 agcgccatcg tgctgtacgt gctgctggcc getgecgecec acagegettt cgctcaccac 120 caccaccatc acctccgtge ccctaagegt cgccacagcg aaaacggcaa gcctgaaact 180 gaagctggtc ctagccctge tcccatcaag cgcgctaagc gcatggtgcg cgccteccaa 240 ctggacctcg tgtacccctt cgactacgtg gctgacccag tcggeggtct gaaccctcca 300 ttcctgggtg gctccggcec cctggttgac cagggeggec agctgaccct gaacgtgact 360 gaccctatca tcatcaagaa ccgttcagtc gacctcgccc acgaccctag cctggacgtg 420 aacgctcagg gccagctcgc tgtggeccgtg gaccctgagg gcgctctgga catcacccca 480 gacggcctgg acgtcaaggt tgacggcgtg accgtcatgg tgaacgacga ctgggaactg 540 gctgtgaagg ttgacccttc cggcggactg gactccaccg ccggaggact cggcgtgagc 600 gttgacgaca ccctgetegt cgaccagggt gaactgggcg tgcacctgaa ccagcagggt 660 cccatcaccg ctgacagctc cggtatcgac ctcgaaatca acccaaacat gttcacagtg 720 aacacctcca ccggetececgg cgttctcgag ctcaacctga aggcccaggg tggtatccag 780 gctgactcca gcggtgtcgg cgtgtececgtt gacgagagcc tgcagatcgt taacaacacc 840 ctggaggtga agcctgaccc atccggtect ctgacagtta gcgctaacgg actcggcctg 900 aagtacgaca ctaacaccct cgccgttacc gcecggegecc tgaccgtegt gggcggcggt 960 agcgtgtcca ceecccatege cacettegtg ageggeteece catctctgaa cacatacaac 1020 gctaccaccg tgaacagctc cgetaacget ttcagctgtg cctactactt gcagcagtgg 1080 aacatccagg gcctgctcgt gactagcctg tacctgaagc tggacagcgc taccatgggc 1140 aaccgtcccg gtgacctgaa cagcgccaac gctaagtggt tcacattctg ggtcageget 1200 LU102610 tacctgcagc agtgcaaccc ctccggtatc caggccggta ccgtttcccc tagcacagct 1260 accctgactg acttcgagcc tatggccaac aggtctgtga ctagcccctg gacctactcc 13280 gctaacggat actacgagcc tagcatcggt gaattccagg tcttcagccc agtggtgaca 1380 ggcgcctgga acccaggtaa catcggcatc cgegtgetge ccgtgectgt gagcgcctca 1440 ggtgagcgct acacactgct ctgctactec ctgcagtgca ctaacgectc catcttcaac 1508 cctaacaaca gcggtaccat gatcgtgggt ccagtgctgt actcctgtcc agctgcctec 1568 ctgccctaa 1569

Claims (10)

CLAIMS :

1. The antigen protein is characterized in that the amino acid sequence of the antigen protein 1s shown in SEQ ID NO.6.

2. The gene encoding the antigen protein according to claim 1 is characterized in that its nucleotide sequence is shown in SEQ ID NO.5.

3. A recombinant baculovirus vector containing the gene of claim 2.

4. The recombinant baculovirus vector according to claim 3 is characterized in that the gene according to claim 2 is inserted after the PH and/or P10 promoter of baculovirus.

5. A host cell containing the recombinant baculovirus vector according to any one of claim 3 to claim 4.

6. The host cell according to claim 5, wherein the host cell is selected from Sf9 or High Five cells of insect cell lines.

7. The subunit vaccine of Fowl adenovirus serotype-4 is characterized in that the vaccine contains the antigen protein of claim 1.

8. The subunit vaccine of Fowl adenovirus serotype-4 according to claim 7, which is characterized in that the vaccine further comprises pharmaceutically acceptable excipients and/or adjuvants.

9. The subunit vaccine of Fowl adenovirus serotype-4 according to claim 8, which is characterized in that the adjuvant is white oil adjuvant.

10. The application of the antigen protein according to claim 1, the gene according to claim 2 and the recombinant baculovirus vector according to any one of claims 3 to 4 in preparing medicines for preventing and treating chicken pericardial hydrops syndrome caused by Fowl adenovirus serotype-4.