LT6177B - ISOLATION OF ENZYME COMPLEXES FROM Streptomyces gougerotii 101, PREPARATION AND APPLICATION OF MULTIENZYME BIOPREPARATIONS - Google Patents

ISOLATION OF ENZYME COMPLEXES FROM Streptomyces gougerotii 101, PREPARATION AND APPLICATION OF MULTIENZYME BIOPREPARATIONS Download PDF

Info

Publication number
LT6177B
LT6177B LT2014115A LT2014115A LT6177B LT 6177 B LT6177 B LT 6177B LT 2014115 A LT2014115 A LT 2014115A LT 2014115 A LT2014115 A LT 2014115A LT 6177 B LT6177 B LT 6177B
Authority
LT
Lithuania
Prior art keywords
enzyme
multi
composition
complexes
biopreparation
Prior art date
Application number
LT2014115A
Other languages
Lithuanian (lt)
Other versions
LT2014115A (en
Inventor
Grigiškis
Čipinytė
Tvaska
Urbanavičiūtė
Rimdeika
Mauricas
Original Assignee
Uab "Biocentras"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Uab "Biocentras" filed Critical Uab "Biocentras"
Priority to LT2014115A priority Critical patent/LT6177B/en
Publication of LT2014115A publication Critical patent/LT2014115A/en
Publication of LT6177B publication Critical patent/LT6177B/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/54Mixtures of enzymes or proenzymes covered by more than a single one of groups A61K38/44 - A61K38/46 or A61K38/51 - A61K38/53
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K8/00Cosmetics or similar toilet preparations
    • A61K8/18Cosmetics or similar toilet preparations characterised by the composition
    • A61K8/30Cosmetics or similar toilet preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • A61K8/66Enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K8/00Cosmetics or similar toilet preparations
    • A61K8/18Cosmetics or similar toilet preparations characterised by the composition
    • A61K8/96Cosmetics or similar toilet preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99Cosmetics or similar toilet preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILET PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILET PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/007Preparations for dry skin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/46Medical treatment of waterborne diseases characterized by the agent
    • Y02A50/468The waterborne disease being caused by a bacteria
    • Y02A50/473The waterborne disease being caused by a bacteria the bacteria being Escherichia coli, i.e. E. coli Infection

Abstract

This invention is attributed to the fields of biotechnology and biomedicine. The aim of this invention is to use enzymes extracted from Streptomyces gougerotii 101 in order to create multienzyme preparations with proteolytic, collagenasic, esterasic, amylolytic, lipasic, glucanasic, deoxyribunocleasic and lytic activities, and to employ them in the development of cosmetics, antibacterial preparations and preparations for wound care. Multienzyme biopreparation development technology is distinguishable by the fact that, as you change enzyme concentrations within, their application field changes too.

Description

1

LT 6177 B

FIELD OF THE INVENTION The present invention relates to the fields of pharmaceutical biotechnology and biomedicine. It involves the production of enzymes from the Streptomyces gougerotii 101 complexes, the preparation and practical application of multi-enzyme biopreparations.

BACKGROUND OF THE INVENTION A wound is a mechanical, chemical, thermal or other injury to the skin, mucosa or deeper tissue. Wound healing, initiated and regulated by central nervous and immune system systems, has four stages: inflammation, migration (granulation), epithelization, and scar maturation, shown in Figure 1. The same wound healing processes occur, regardless of their origin, contamination of tissue wounds, and other factors. Ignition stage

If the skin and the blood vessels beneath it are damaged, the wound produces a blood clot [3,6]. Platelets in the clot release cytokines and growth factor: PDGF, EGF, IGF-1, FGF, TGF-β. These substances work in two ways: activate nearby immune cells and transmit a signal to the central nervous system about inflammation, shown in Figure 2. [1,3]. The ignition stage is an important and complex process. In particular, the wound is open and there is a high risk of infection, since damaged and necrotizing tissues in the wound are a favorable medium for breeding pathogenic microorganisms. The overall immune response takes about 24 hours. Although inflammation for wound healing is a necessary process, it slows down the regeneration process and can even be harmful. In some cases, the inflammatory stage is complicated due to infection or acute inflammation and may last from 20 days to 2 years. Prolonged inflammation stops healing and other stages of the process, causing wounds to become difficult to heal and chronic, leading to hypertrophic scar interfering with the function of surrounding, non-injured tissues.

All factors and immune cells enter the wound healing stage through the wound system. The first ones come from neutrophils and dominate the site of the violation in the first 3 days [3]. Their main function is microbial and foreign body phagocytosis. After phagocytosis, neutrophils apopt, then 2

LT 6177 B removes wound-migrating macrophages. The maximum macrophage concentration in the wound is ~ 24-36 or. Macrophages as well as neutrophils fagocate microbes, other particles, cleanse the wound surface. Also, macrophages activate NK cells, which begin to synthesize gamma interferon IFNγ, which in turn activates the macrophages themselves. Also, macrophages perform another important function - they attract the site of damage and activate the acquired immune cells, T and B lymphocytes. Activated T-lymphocytes come to the site of damage by synthesizing IFNγ, which, as has been written, activates macrophages and enhances their effects. It should be noted that the immune system does not cope with all microorganisms and the infection can spread beyond the primary infection site, which can lead to sepsis - an acute inflammatory response of the whole organism.

There are a number of preparations to fight infection in wounds. These are iodine solutions as described in BETADINE® U.S. Pat. No. 5,986,162 A, an antiseptic such as SSD with antibacterial silver sulfadiazine described in U.S. Pat. No. 5,514,657 A, or Medihoney® antibacterial medicated honey described in EP2040721 B1. The US Food and Drug Administration Administration (FDA) confirmed that silver is a natural antibiotic to fight microorganisms. Sterile antibacterial bandages with silver are described in U.S. Patent Nos. 7704523 B2, WO 2004002384 A1, US 7005556 B1, US 20070275043 A1. Silver is also used in other instruments: colloidal solutions, hydrogels, etc. described in WO 2005018543 A2, US 6706279 B1. The antibacterial agent used in patent WO 2002100448 A1 is triclosan, however, the negative effects of this substance on the human endocrine system have been demonstrated in laboratory tests. WO 2013109004 A1 describes a wound coating agent of chitosan, a nanoparticle of silver nanoparticles having antibacterial and slow release characteristics, but the slow antibacterial effect also prolongs the time to fight infection. Antibacterial agents based on the inhibition of enzymes synthesized by pathogenic microorganisms, because they break down antibiotics, such as the inhibitor of beta-lactamase degraded by penicillin, described in US 20140194386 A1, have been developed. Another antibacterial agent is described in US 20140163038 A1 which inhibits the Fab enzyme involved in the bacterial fatty acid synthesis cycle, thereby inhibiting the growth and development of microorganisms. US 20140134210 A1 discloses an anti-infectious treatment method using antibiotics in combination with lysophosphatidylcholine, an immunostimulant which stimulates immune cells: monocytes, macrophages, T lymphocytes and neutrophils. Studies have shown 3

That the synergistic effect of these substances is more effective in treating the infection than when acting alone. US 20140171358 A1 discloses antibacterial compositions comprising one or more fatty acids: DGLA, 15-OHEPA and / or 15-HETrE, which are used alone or in combination with antibiotics. US 2014/0193889 A1 patent describes antimicrobial activity of lipases. Lipases degrade cell walls of microorganisms and components of cell membranes, thereby stopping their growth and multiplication. The known antibacterial medicine Flaminal® contains enzymes glucose oxidase and lactoperoxidase. SertaSil ™, an anti-infectious agent, contains the seratopeptidase enzyme described in WO2010079209 A2.

The disadvantage of all these preparations is that they only perform one function, and in order to achieve effective wound healing, it is necessary to eliminate all possible causes that complicate wound healing. Grease ointments and antibiotic preparations should not be used, because fatty ointments promote inflammation and flaking, the antibiotic does not get into the necrosis, the antibiotic concentration in the wound is inadequate. Antibiotics are in a narrow spectrum - do not affect fungi and viruses, quickly develop a strain of antibiotic resistant microbes. The main causes of disturbing wound healing processes are non-viable, necrotic tissue in the wound and bacteria causing infection [3]. According to scientific literature, early and full-fledged removal of non-viable tissues results in faster wound epithelialisation, reduced risk of scarring and improved functional recovery [5,8]. Macrophages and neutrophils cleanse the wound surface from microbes, cell debris and initiate tissue repair as a result of the inflammatory wound healing phase [7]. necrotic tissues [1]. In addition, inhibitors of these proteases, which inhibit the action of proteases on the wound bottom, are secreted into the wound in order not to damage viable tissues [3]. This inhibition involves the removal of necrotic tissue from the wound, thereby prolonging not only the inflammatory phase but also the entire wound healing period. In addition to these protective functions, inflammatory cells are an important source of growth factors and cytokines that initiate the phase of wound healing proliferation [2, 3]. Wound treatments are varied. US Patent No. 20140207050 A1 discloses a method of using an electrostimulation inducing local and deep anesthetics 4

EN 6177 B, which in turn improves blood circulation and increases oxygen concentration in the wound, thereby improving the wound healing process and avoiding complications.

In order to prevent wound healing and complications, it is necessary to promote the removal of dead tissues during the inflammatory phase. Tissue Removal is a medical removal of dead, dead, damaged or infected tissue to improve and promote wound healing and recovery of healthy tissue. Noncectomy techniques are several: surgical, mechanical, autolytic, enzymatic, and the like. Autolytic necrectomy enhances natural autolytic processes in the wound, maintains a moist environment, and regulates exudate excess. Autolytic necectomy is a long process that cannot be applied to infected wounds [2]. Mechanical removal of necrotic tissues can damage healthy tissues both in and around the wound and is non-selective. Surgical necrectomy is painful, can cause bleeding, use painkillers and lose some healthy tissue. Enzymatic necrectomy is a highly selective and topical method for treating wounds and healing wounds. This method uses exogenous enzymes, usually proteases, which work with endogenous enzymes in the wounds.

Enzymes that do not have a necrectomy can be cut off from plants, microorganisms and animals. In medical preparations for non-necrectomy, plant protease bromelain is often used as the active ingredient, as described in US 2013/0156745 A1, US 8119124 B2 and US 8,128,589 B2. Bromelain is a cysteine endopeptidase isolated from pineapple. NexoBrid contains bromelain, which is used to treat skin burns.

Accuzyme® contains the active substance enzyme papain, which performs the function of noncectomy. Papain - Proteinase cleaved from papaya fruit. Its advantage over other proteinases is that it works in the wide pH range from 3 to 12. However, one papain is ineffective and is therefore used in conjunction with urea, which denatures the non-viable proteins, helping the papain to break them down. Performed clinical studies did not show significant effect on wound healing rate [9] ·

The enzymes of animal origin are described in patent RU 2280076 C1. The enzymes extracted from the Kamchatka crab are characterized by collagenase, protease, ribonuclease, deoxyribonuclease, phosphodiesterazine, phosphatase, amylase, lipase and 5 \ t

LT 6177 B with glucanase activity. For this reason, mixtures of these enzymes or single enzyme preparations can be widely applied in biotechnology, medicine, cosmetology. The authors of the patent argue that this multi-enzyme preparation is suitable for the treatment of purulent wounds and is more effective than preparations containing only collagenase or protease, but no preparation and research on its application has been described.

The combination of two enzymes fibrinolysin and deoxyribonuclease is used in preparation Elase®. Fibrinolysin breaks down fibrin and dissolves the blood clot, also inactivates fibrinogen and several clotting factors. This enzyme expands the blood vessels in the bottom of the wound. By breaking fibrin and necrotic tissue in the wound, it helps to penetrate the macrophages into the wound. Dry fibrinolysine is stable but loses its activity after 6 to 8 hours of dissolution. The products of the fibrinolysin reaction are not absorbed and should be removed from the wound surface [2],

Deoxyribonuclease is produced from cattle pancreas. This enzyme breaks down the nucleic acid and reduces the viscosity of the exudate. It is soluble in water and active in a wide pH range but loses activity at room temperature [2].

In theory, these enzymes should improve wound healing, since exudate is mainly composed of fibrin and nucleoproteins. In clinical studies, the effectiveness of this product in the removal of necrotic tissue and granulation was investigated and physiological saline was used for control. Only 19 out of 34 patients demonstrated the benefit of this treatment [4]. Endopeptidase trypsin extracted from pancreatic juice removes necrotic tissues without causing damage to viable tissues. In clinical trials, this enzyme has been shown to increase reepithesis, increase blood circulation and reduce edema formation in wounds. However, more extensive clinical trials should be conducted to determine the efficacy of this enzyme in wound healing processes. The best-known preparations with trypsin are Xenaderm® and Granulex® [2].

There are also a number of enzymatic preparations of microbiological origin used to treat wounds.

The Santyl® preparation for wound cleansing and treatment contains collagenases of microbiological origin that have been eliminated from Clostridium histoliticum. This protease selectively breaks down different types of collagen in the necrotic tissue of the wound, 6

However, it is not effective against keratin, fats and fibrin. The optimum pH for this collagenase is 6 to 8 [10].

Varidase® also contains two enzymes: streptokinase and streptodorzine. Streptokinase is produced by β-haemolytic streptococci. This enzyme transforms plasminogen into plasmin j, thereby promoting fibrinolysis of wound exudate. Streptodorna is produced by hemolytic streptococci. This enzyme is deoxyribonuclease, which undergoes hydrolysis of DNA without causing any damage to viable cells [2].

US 2003/0198631 A1 discloses a medical enzyme preparation for a non-cryptoment containing extracellular metalendopeptidase Thermolysin, which is cleaved from the microorganism Bacillus thermoproteolyticus. This protease has a high specificity for two proteins: collagen and fibrin. Due to this specificity, this preparation performs only a few functions in a complex wound healing process. Selection of substrates for enzymes currently available on the market for wound cleansing and treatment may result in slower and incomplete removal of necrotic tissue. In addition, their effects are limited to all processes in the wound healing process.

Migration (granulation) and epithelial stages

When the wound is cleaned of microbial and necrotic tissue, fibroblasts, keratinocytes and endothelial cells synthesize growth factor. Table 1. Cells synthesize growth factors.

Cell Synthesized Growth Factor Keratinocytes TGF-β, TGF-α, IL-1 Fibroblasts IGF-1, bFGF, TGF-β, PDGF, KGF, CTGF Endothelial cells bFGF, PDGF, VEGF These synthesized substances promote cell migration, proliferation, new capillaries and extracellular protein synthesis [3.8].

The so-called granulation tissue forms in the damaged area. He 7

LT 6177 B is formed from endothelial cells, fibroblasts, keratinocyte inflammatory macrophages, lymphocytes and intercellular matrix. Proteases play an important role in cell migration. Collagenase, elastase and trypsin degrade desmosomes and hemidesmosomes, thereby helping fibroblasts and endothelial cells to separate from the bottom of the reference membrane and freely migrate to the wound cavity [2,3]. In addition, inhibitors of these proteases, which inhibit the action of proteases on the wound bottom, are secreted into the wound so that they do not damage viable tissues [3]. This inhibition takes the removal of necrotic tissue from the wound, thus prolonging not only the inflammatory stage, but also the entire wound healing period. Collagen fibrils are constantly remodeled by proteases secreted by neutrophils, macrophages, fibroblasts, endothelial and epithelial cells. In parallel, re-epithelialisation is the covering of the wound with the epithelial cell layer and the formation of new blood vessels [3,6,7]. Fibroblasts synthesize collagen, elastin and proteoglycans that form the primary scar.

Rando puberty

Rando's maturation lasts from several months to several years, depending on the origin and size of the wounds. A simple scar or chest wound scar matures for 1 or 2 months, and can take 30 to more months in cases of burns. Fibroblasts with defective tissue defects increase collagen synthesis, leading to hypertrophic and keloid scarring. Therefore, it is appropriate to use collagenase preparations at this stage.

Patent VVO2010079209 A2 discloses a composition - SertaSil ™ is for treating a variety of wounds whose main active ingredient is the proteolytic enzyme seratopeptidase. This protease is secreted from the uncomfortable microorganism Serratia E15. The patent describes the functions of this preparation in wounds: it fights infection, effectively removes necrotic tissue, relieves pain, regulates exudate, regulates wound moisture balance, reduces wound inflammation and edema, reduces bleeding.

WO 2011104630 A1 describes an enzyme complex consisting of proteases, carbohydrolases and lipases isolated from the culture of the fungus Conidiobolus brefeldianus. These enzymes can be used alone or in combination. Authors provide possible uses for: leather (animal fur) processing, detergents, food, 8

EN 6177 B for the production of textile, silk and waste resulting from the process, analytical tools, pharmaceuticals, cosmetics, molecular biology, etc. However, there are currently no known treatments for wounds containing these enzymes or combinations thereof.

US 2013/0202581 A1 describes compositions for treating wounds using three pancreatic hydrolases: protease, lipase and amylase. The authors describe that these enzymes can be used at different concentrations to form preparations for wound healing. It is also mentioned that these hydrolases stimulate epidermal cells to accelerate the healing of wounds, without scarring after the healing process. It is also noted that the compositions of these enzymes are not effective against infections caused by Staphylococcus aureus and Escherichia coli.

Also, enzymes are used in cosmetic products, usually in the form of skin scrubs. Enzyme-based skin cleansers contain no acid and disintegrating granules that can irritate the skin. The essence of these scrubs is that the dead skin cells are dissolved by enzymes. On the skin care market there are products that operate on a similar principle. The enzymes used in the production of cosmetics can be distinguished from different sources. Below are some examples of these sources. US 5,705,166, US 6,416,769 B1 and US 8,377,434 B2 disclose enzymes for use in the manufacture of skin scrubs isolated from unripe papaya fruits. Patents CA 2377357 describe enzymes used for the manufacture of cosmetic products isolated from cod (Gadus morchua). US 4,556,554 and US 2010/0080787 A1 describe enzyme complexes used in skin care cosmetics. U.S. Patent No. 6,551,606 B1 discloses the use of an enzyme complex isolated from milk of coconut (Cocos nucifera). US 2005/0249720 discloses enzyme complexes for cosmetic products isolated from pineapple, mango and papaya.

The above-described methods of wound healing and skin care do not completely solve all the problems associated with their therapy: there are no universal complex preparations having antibacterial activity, selectively eliminating necrotic tissues, stimulating the body's immune system, reducing scar formation and acting at all stages of healing; there are no complex bio-preparations whose application depends on the enzymes 9

LT 6177 B concentrations; no complex bio-preparations for controlling the rate of wound healing; There are no complex bio-preparations for skin care and skin diseases.

Therefore, the object of our invention is to provide such an effective multi-enzyme biopreparation that does not have the aforementioned shortcomings to be easily adapted to treating different wounds, skin care products, and antibacterial agents. In addition, it would function in all wound healing processes along with the immune system, have a broad spectrum of antibacterial activity, selectively remove necrotic tissues, reduce scar formation, accelerate healing time and be suitable for the treatment of wounds of various origins and types. It is also suitable for multi-enzyme biopreparation for skin care and skin care. OBJECTIVE OF THE INVENTION The object of the invention is to provide a process for the production of complexes of enzymes isolated from Streptomyces gougerotii microorganism 101 and their use in the production of multi-enzyme biopreparations. The essence of the present invention is to provide enzyme complexes isolated from Streptomyces gougerotii 101, multi-enzyme biopreparations that aid the human immune system and have proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activities for use in wound healing, pathogenic microorganisms removal and skin. care. The method of treating skin disorders and wounds described in the present invention differs from the known in the art by using multi-enzyme biopreparations consisting of enzymes with proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activity produced by Streptomyces gougeroti 101.

The second difference is that the composition and activity of the enzyme complexes produced by Streptomyces gougerotii 101 can be changed in the culture medium using different inducers: yeast (A) or collagen (B). 10

LT 6177 B

The third difference is that the composition and activity of the enzymes produced by Streptomyces gougerotii 101 can be changed in the culture medium by changing the inductor concentrations.

The fourth difference is that for the production of a multi-enzyme biopreparation, enzyme complexes A and B can be used together and separately.

The fifth difference is that concentrations of enzyme complexes A and B used in the multi-enzyme biopreparation may vary from 0 to 100 percent. The sixth difference is that the method of preparing a multi-enzyme biopreparation may comprise the following steps: a) preparing the complexes of enzymes A and B; b) concentration and fractionation of enzyme complexes A and B; c) treating complexes of enzymes A and B with major protein deposition agents such as inorganic salts (e.g. NH4SO4, CaCk), ketones (e.g. CH3COCH3), saturated aliphatic alcohols (e.g. CH3CH2OH, CH3CHOHCH3), etc .; d) chromatographic separation of complexes A and B; e) stabilizing complexes A and B with saturated aliphatic polyhydric alcohols having a length of carbon skeleton of not less than C3 (eg glycerol, sorbitol, polyvinyl alcohol); f) optionally mixing A and B complexes.

The seventh difference is that, when preparing a multi-enzyme biopreparation, it can be concentrated by uItraining or vacuum evaporation. The eighth difference is that it can be fractionated by ultrafiltration using 5.10, 15 and 50 kDa membranes when preparing a multi-enzyme biopreparation.

The ninth difference is that the multi-enzyme biopreparation lyses a number of microorganisms: Micrococcus lysodeicticus, Staphylococcus nolus, Staphylococcus aureus, Streptococcus haemolyticus, Streptococcus paracitrovorum, Pseudomonas aeruginosa, Escherichia coli 078, Escherichia coli 12K, Pseudomonas 11

LT 6177 B fluorescens, Saccharomyces cerevisiae, Saccharomyces vini, Candida utilis.

The tenth difference is that the multi-enzyme biopreparation can be used for pharmaceutical or cosmetic compositions in combination with an acceptable excipient for pharmaceutical or cosmetic approaches, promoting wound healing and improving skin condition.

The eleventh difference is that the multi-enzyme biopreparation can be used to stimulate the immune system for treating different wounds, both in skin care and treatment, and in the treatment of bacterial diseases.

The twelfth difference is that a multi-enzyme biopreparation with increased lipase activity can be used in a composition for the treatment of chronic and difficult healing wounds.

The thirteenth difference is that the multi-enzyme biopreparation with increased lysing and glucanase activity can be used in a composition for treating infected wounds.

The 14th difference is that the multi-enzyme biopreparation with increased proteolytic and collagenase activity can be used in a composition for the treatment of necrotic wounds.

The fifteenth difference is that the multi-enzymatic biopreparation with reduced enzymatic activity can be used in a composition for skin care and treatment of skin disorders. The sixteenth difference is that the multi-enzyme biopreparation can be used in a composition for the treatment of antibacterial diseases.

The septinolar difference is that compositions with a multi-enzyme biopreparation may have a consistency of liquid, grease and hydrogel.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Principal scheme of physiological and biochemical processes of wound healing;

FIG. 2. Preparation of basic and operational Streptomyces gougerotii 101 cultural banks (Phase I);

FIG. 3. Streptomyces gougerotii 101 strain enzyme biosynthesis, inducer 12

EN 6177 B yeast (stage II);

FIG. 4. Streptomyces gougerotii 101 strain enzyme biosynthesis, inducer collagen (Stage III);

FIG. 5. Obtaining a multi-enzyme complex A from a culture fluid (Stage IV);

FIG. 6. Obtaining a multi-enzyme complex B from a culture fluid (step V);

FIG. 7. Composition of multi-enzyme complexes A and B after concentration (SDS-PAGE electrophoresis method);

FIG. 8. Principal scheme of preparation of enzyme complex A (inductor yeast);

FIG. 9. Principal scheme of preparation of enzyme complexes B (inductor collagen);

FIG. 10. Principal scheme of application of multi-enzyme biopreparations;

FIG. 11. Principal use scheme of multi-enzyme biopreparations.

DETAILED DESCRIPTION OF THE INVENTION We have developed a multi-enzyme biopreparation technology based on the production of complexes of enzymes synthesized by Streptomyces gougerotii 101 and their use in the manufacture of pharmaceutical, cosmetic and antibacterial compositions. The enzymes that make up the multi-enzyme biopreparation have an effect: a) the proteases start to act at an early stage of wound healing and are involved in all subsequent stages. First of all, they perform a noncectomy function, break down a complex clot system. Proteases also lyse necrotic tissues, exudate and proteins contained therein, thus shortening the time of the inflammatory stage. They block histamine and bradykinin, a stimulant of pain, accelerate the degradation of inflammatory stimulants and toxic substances, stimulate and regulate functional macrophage activity. These enzymes are involved in the migration stage, degrading desmosomes and hemidesmosomes. This helps fibroblasts and endothelial cells to separate from the underlying membrane of the wound and freely migrate into the wound cavity; 13

B) Glucanase lyses the walls of microbial cells and thus stops their development in the wound, thus preventing infection. Also due to the action of glucanases in multi-enzyme biopreparations, the β-glucans that are produced activate the phagocytes, stimulate the synthesis of interferon-γ and thus stimulate the body's immune system and accelerate wound healing processes; c) DNRase hydrolyses the DNA of degraded cells, which accelerates the wound clearance from necrotic tissue. This enzyme selectively splits the nucleic acid and reduces the viscosity of the exudate, thus facilitating the movement and migration of cells involved in wound healing processes; d) Lipase increases the amount of growth factors in the wound, which accelerates angiogenesis, proliferation and migration of keratinocytes and fibroblasts, activates endothelial cells and promotes collagen synthesis. As a result of lipase action, prostaglandin synthesis is reduced, resulting in reduced tissue swelling around the wound; e) amylase regulates EGF growth factor release that activates proliferation and migration of fibroblasts and keratinocytes in the wound. Also accelerates wound closure; f) Elastase stimulates the innate immune system in the early stages and participates in late tissue regeneration and regeneration; g) Collagenase selectively decomposes collagen into smaller molecules which are then hydrolysed by other proteases. Collagenase is effective in cleaning the affected area from necrotic tissue, accelerating the formation of granular tissue. Collagenase improves the migration of keratinocytes and epithelial cells to the site of damage and their proliferation, which accelerates epithelial wound coverage and new tissue formation. Collagenase reduces the amount of collagen synthesized by fibroblasts during maturation of the scar and thus prevents the formation of scarring and scarred scars, i. normalizing collagen levels, the scar softens and h) enzymes with lysing activity are involved in cell wall destruction of microorganisms, thus stopping their development in the wound and preventing infection and complications. The wound is an open pathway for pathogenic microorganisms, and the necrotic tissues and exudate that are present in the egg provide favorable conditions for their breeding. The overall immune response takes about 24 hours, during this time the wound processes 14

LT 6177 B may be irreversible and may cause infection. It is therefore advisable to treat wounds immediately after injury with multi-enzyme biopreparation formulations that remove all factors that stop or complicate wound healing. In particular, the compositions of the multi-enzyme biopreparation have a broad lysis activity, disrupt the pathogenic microorganisms present in the wound. It also hydrolyses denatured proteins, liquefies wound necrotic tissues, stimulates the growth of granular tissue and accelerates wound cleansing and healing, reduces swelling and inflammation of adjacent tissues. Collagenase in a multi-enzyme biopreparation dissolves hardened caked blood layer, necrotic tissue, and breaks down excess collagen, which prevents the risk of skin scarring by treating flaking wounds. Removing necrotized tissue with multi-enzyme biopreparation formulations eliminates protein-free and circulatory-free media, favoring microbial breeding, thus reducing bacterial wound contamination and stopping the infection process. In this way, conditions for further wound healing - tissue regeneration and local circulation improvement - are created.

Also, additional substances in the multi-enzyme biopreparation composition such as sodium alginate increase the absorption of exudate. Polyethylene glycol forms polymeric cells that immobilize enzymes and inhibit the loss of enzyme activity, which reduces the amount of bandages per day. Glycerol attracts, retains and binds water. Compositions with a higher glycerol concentration create a longer-lasting moist environment in the wound at all stages of the healing process. Moisture in epithelial cells is needed to make it easier to move away from re-epithelial fireplaces located at the edges of the wound and fill the wound area. In dry wounds, these cells move to the bottom of the wound. By maintaining a moist environment in wounds, cells can migrate across the entire wound area, causing the wounds to heal faster.

BEST IMPLEMENTATION OPTIONS

PRODUCENTO Streptomyces gougerotii 101 DESCRIPTION

Enzyme complexes with proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activity are obtained from the strain of actinomycet Streptomyces gougerotii 101 by in-depth growth.

EN 6177 B. Streptomyces gougerotii 101 strain (Biocentras UAB microorganism collection registration number K-91) was extracted from the soil in south-eastern Lithuania. Its characteristics are:

Morphological

The cultured surface micelle is white or colorless with an average thickness of 0.6 to 0.8 microns. Spores oval or oblong, smooth surface.

Cultural

For cultivation of Streptomyces gougerotii 101 on agarized maize no. 2, a rich micelle is formed (surface white and substrate light brown). A white surface and sandy substrate micelle forms on the agarized oat medium.

Physiological and biochemical

Aerobic, optimal growth temperature + (28-30) ° C, pH (7.0-7.5). Hydrolyses starch, casein, collagen, twine 80, β-glucans and DNA. It breaks and peptonizes milk, liquefies gelatin, lyses cells of yeast and bacteria. Assimilates glucose, sucrose, fructose, xylose, does not absorb or only weakly mannitol and raffinose. The indexes of proteolytic, collagenase, DNRase, esterase, yeast lysing, beta-glucanase, bacterial lysing and amylolytic activity were evaluated for hydrophysical activity of S. gougerotii 101 strain synthesized enzymes. To determine these enzyme activity indices, the strain was displaced into Petri dishes with a rigid medium supplemented with sodium caseinate, collagen, DNA, Twin 80, baking yeast cells, baking yeast beta-glucan, Mycrococcus lysodictic cells, and starch. Enzyme activity indexes were calculated after 96 h incubation at 30 ° C, dividing the diameter of the hydrolysis zones of the respective substrates by the diameter of the colonies. The results are shown in Table 2. 16

LT 6177 B

Table 2. Activity indexes of hydrolytic enzymes synthesized by S. gougerotii 101 strain

Enzyme activities

Streptomyces gougerotii 101 strain 16S rRNA gene consensus sequence (SEQ ID NO: 1)

GGACGAACGCTGGCGGCGTGCTTAACACAT GCAAGTCGAACGAT GAAG CCCTTCGGGGTGGATTAGTGGCGAACGGGTGAGTAACACGTGGGCAATCTGCC CTGCACTCTGGGACAAGCCCTGGAAACGGGGTCTAATACyGGATATGACCGTCC ATCGCATGGTGGrTGGTGTAAAGCTCCGGCGGTGCAGGATGAGCCCGCGGCCT ATCAGCTAGTTGGTGAGGTAGTrGCTCACCAAGGCGACGACGGGTAGCCGGCC TGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG GAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGC CGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGAAGAAG CGAAAGTGACGGTACCTGCAGAAGAAGCGCCGGCTAACTACGT enzyme complex obtained from Streptomyces gougerotii 101, at the production stage Phase I

In particular, to obtain enzyme complexes having optimal proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activities, Streptomyces gougerotii 17 is performed.

The selection of stem cells and culture of cells is prepared for cell culture. Stages II and III

The production of multi-enzyme biopreparations begins with the biosynthesis of Streptomyces gougerotii 101 enzymes, which produce a cultural fluid. Streptomyces gougerotii 101 produces enzymes with proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activity during biosynthesis. The composition of the synthesized enzymes and their activity is regulated by the change of the inducer (yeast A or collagen B) and their amounts. Stages IV and V

After the Streptomyces gougerotii 101 enzyme biosynthesis, the culture fluids A and B are centrifuged, filtered, concentrated by vacuum evaporation or ultrafiltration. The resulting concentrates A and B are depleted using basic protein deposition agents. After further centrifugation, the resulting precipitate is dissolved and the resulting suspension is centrifuged again. Table 2. Enzymatic activities of multi-enzyme complexes A and B.

No. Enzymatic activity Multi-enzyme complex A (inductor yeast) Multi-enzyme complex B (inducer collagen) 1. Proteolytic activity, v / cm3 10-22 5-7.5 2. Collagenase activity, v / cm3 700-1180 700-930 3. Lipase activity , v / cm3 100-145 10-20 4. Glucanase activity, v / cm3 5-7.5 2-3.4 5. DNRase activity, v / cm3 0.21 - 6. Amylase activity, v / cm3 2-5 1 -3 7. Esterase activity, v / cm3 15000-18000 12000-16000 8. Lysing activity, v / cm3 20-60 80-100

Unit of proteolytic activity is the amount of enzyme preparation that liberates 1 micromole of tyrosine per minute at hydrolysis of casein or sodium caseinate at pH 8.0 and 37 ° C. 18

LT 6177 B

A unit of collagenase activity is the amount of enzyme which, by hydrolysis of collagen within 5 hours at pH 7.5 and 37 ° C, releases one micromole of α-leucine. Unit of activity is the amount of enzyme which liberates 1 nanomolar of p-nitrophenol from substrate p-nitrophenyl palmitate in 1 minute at 40 ° C.

Unit of glucanase activity is the activity of a preparation that breaks down 0.1 pmol of insoluble P-1,3-glucan in 1 min under optimal conditions (pH = 7.0; 50 ° C). A unit of DNR activity is the amount of enzyme which, at a temperature of 37 ° C, breaks down 1pg of DNA in 10 minutes.

A unit of amylase activity - a unit of bacterial α-amylase (S.A. Rapidaz) is the amount of enzyme that breaks 1mg of starch to erythrodecstrins within 1 min at pH 5.6 - 5.8 and at 30 ± 0.2 ° C.

Unit of esterase activity is the amount of enzyme which liberates 1 nanomolar of p-nitrophenol from substrate p-nitrophenyl butyrate in 1 minute at 40 ° C.

Unit of lysing activity is the amount of enzyme which decreases the optical density of 0.1 reaction mixture at 30 ° C for 30 min at 37 ° C (Micrococcus lysodeikticus substrate).

Depending on the antibacterial properties of the multi-enzyme biopreparation, it was used to disrupt pathogenic microorganisms isolated from the nasopharynx, the throat, the teeth, the abscesses of the patients. The multi-enzyme biopreparation disrupts the cell walls of various pathogenic and non-pathogenic microorganisms, especially lysing streptococci and staphylococci, which are spread as infectious disease agents. The multi-enzyme complex lysates Clostridium perfringens bacteria that cause gaseous gangrene (Table 3). 19

Table B 3. Antimicrobial activity of multi-enzyme biopreparation.

Microorganisms Part of lysed cells,% Incubation time 15 min. Micrococcus lysodeicticus 32 Staphylococcus albus 50 Staphylococcus aureus 60 Streptococcus haemolyticus 40 Streptococcus agalacitae 45 Streptococcus paracitrovorum 30 Pseudomonas aeruginosa 40 Clostridium perfringens 30 Escherichia coli 35 Pseudomonas fluorescens 10 Bifidobacterium species 0 Saccharomyces cerevisiae 15 Saccharomyces vini 0 Candida utilis 20 Bacillus subtilis 0 Aspergillus niger 0 Aspergillus awamori 0 Penicillium funiculosum 0

Preclinical studies of the multi-enzyme biopreparation were performed. In the pre-clinical phase, the following were performed: toxicological, pharmacological and efficacy studies (permission of the State Food and Veterinary Service to perform laboratory tests on animals No141). All studies were done according to pre-prepared and signed plans. All toxicological studies were conducted according to the OECD methodology. Mice, rabbits and guinea pigs were used for research. In all toxicological tests, the concentrate of the multi-enzyme preparation under investigation, which has a proteolytic and collagenase activity of 6 times the activity of the proposed drug formulation, was used (as indicated in the EU Directives). In summary, it can be concluded that the scope and results of the toxicological studies carried out suggest that the test product is safe in terms of toxicity. Conclusions:

Skin sensitization study in guinea pigs - finding no redness, no swelling, no reaction to provocative sample negative - preparation is skin sensitized; Acute Skin Irritation Test for Rabbit - Conclusion - The average skin irritation score is zero - the preparation does not irritate the skin; 20

Acute eye irritation test for rabbits - conclusion - rabbit eye irritation has been evaluated at 0.25 points, therefore it is advisable to keep it in the eye so that it does not get in the eyes - slightly burns the eyes;

Repeated Dose (28 Days) Dermal Toxicity Test - In a repeated dose toxicity study in C57W mice, a 0.8 v / cm preparation was found to be non-toxic. Gastrointestinal acute toxicity study in C57W mice is a low-risk preparation. The efficacy of treatment for burns using different concentrations of the test preparation was investigated: 0.5 v / cm3, 0.8 v / cm3, 1.0 v / cm3, 1.6 v / cm3 according to proteolytic activity. The study included healthy adult male rats of the VVistar population. The results of the studies showed that the optimum proteolytic activity of the test drug in the treatment of thermal burns is 0.8 v / cm3. The use of the investigated complex enzyme preparation with proteolytic activity of 0.8 v / cm3 for the treatment of grade I-III thermal skin burns reduces the duration of treatment by an average of 20%. There are no scars left in the treatment for burns, which may be more relevant for treating face, hand, and leg burns.

The scope and results of non-clinical studies indicate that the multi-enzyme biopreparation is safe in terms of toxicity and can be used in the manufacture of pharmaceutical, cosmetic and antibacterial compositions.

Use of multi-enzyme complexes

The use of a multi-enzyme biopreparation is distinguished into three parts. These biopreparations can be used in the manufacture of pharmaceutical, antibacterial and cosmetic compositions. The application depends on the activity concentration of the multi-enzyme biopreparations and on the selected enzyme complex A or B. In the first case, multi-enzyme biopreparation compositions are developed for the treatment of wounds of various origin and nature. The second is the formulation of multi-enzyme biopreparations for the production of antibacterial agents. The third is the formulation of multi-enzyme biopreparations for skin care and skin care. 21

LT 6177 B

Concentrations of enzyme complexes A and B may be varied in multi-enzyme biopreparation compositions for treating wounds. The concentration of enzyme complex A and B may be 0-100%.

Multi-enzyme biopreparation compositions for wound healing: 1. Hydrogel for necrotic wounds

Ingredients Concentration,% Enzyme Complex A (70%) + B (30%) 20 Sodium alginate 3 Polyethylene glycol 20 Glycerol 7 Water 50 2. Hydrogel for Grade III burns

Ingredients Concentration,% Enzyme Complex A (50%) + B (50%) 30 Sodium alginate 3 Polyethylene glycol 20 Glycerol 6 Water 40 Sea buckthorn oil 1 3. Hydrogen for burns I and II

Ingredients Concentration,% Enzyme Complex A (60%) + B (40%) 20 Sodium alginate 3 Polyethylene glycol 20 Glycerol 6 Water 50 Sea buckthorn oil 1 4. Hydrogel for ulcers and ulcers

Ingredients Concentration,% Enzyme Complex A (20%) + B (80%) 20 Sodium Alginate 3 22

LT 6177 B

Polyethylene glycol 20 Glycerol 5 Water 50 Sea buckthorn oil 1 Calendula tincture 1 5. Hydrogen for infected wounds

Ingredients Concentration,% Enzyme Complex A (90%) + B (10%) 30 Sodium alginate 3 Polyethylene glycol 20 Glycerol 7 Water 40

THE EFFICIENCY OF MULTIPLE-ENVIRONMENTAL BIOPRAPHY COMPOSITION DRAWINGS

A multi-enzymatic biopreparation formulation of hydrogels for randomized, controlled, single-blind, wound therapy parallel groups was performed. 80 patients with forearms and hands 2B ° skin thickness burns were selected. Burns treated with multi-enzyme biopreparation compositions - hydrogel applications on the wound surface, dressings with gauze bandages every day until complete burn wound epithelium. Patients were examined and the wounds were evaluated on the following days (from the day of burn): 0-3 (hospital admission); 7 (± 1); 14 (± 1); 21 (± 1). These days, clinical phenomena in the wound (wound length, width, depth, secretion, erythema, fluctuation, localized wound, pain / tenderness, swelling / induration, necrosis, fibrin, granulation, epithelization) have been evaluated and a wound photographed. Six months after the burn, the results were evaluated after the active scar remodeling process. Conclusions of Multi-enzyme Biopreparation Compositions - Hydrogels for Wound Treatment:

Effectively absorbs exudate surplus;

Effectively cleans the wound surface from non-viable tissues;

Effectively inhibits infection; 23

LT 6177 B

Supports wet environment in wound;

Creates an optimal microclimate;

Prevents wounds from drying out;

There is no redness of the edges of the wound;

Does not cause pain between dressings;

Encourages faster wound closure;

Does not cause side effects;

No scarring after treatment;

Wounds of any type and size have on average epithelized within 18 days.

Concentrations of A and B enzyme complexes of multi-enzyme biopreparations for skin care and skin treatment can vary. The concentration of enzyme complex A and B may be 0-100%.

Multi-enzyme biopreparation formulations for skin care and treatment: 1. Frostbite / Burn

Ingredients Concentration,% Enzyme Complex A (50%) + B (50%) 10 Glycerol 60 Sea buckthorn oil 5 Water 25 2. Lotion for sour cream

Ingredients Concentration,% Enzyme Complex A (50%) + B (50%) 10 Glycerol 60 Water 30 3. Lotion for Scar

Ingredients Concentration,% Enzyme Complex A (10%) + B (90%) 10 24

Glycerol 60 Tincture of calendula 5 Water 25

LT 6177 B

Creams: 5. Skin scrub

Ingredients Concentration% Enzyme Complex A (20%) + B (80%) 5 Glycerol 4 Water 70 Polyethylene glycol 1 Sorbitan stearate 5 Sorbitan oleate 5 Coconut oil 10 6. Dried skin

Ingredients Concentration,% Enzyme Complex B (100%) 10 Glycerol 20 Water 40 Polyethylene glycol 2 Sorbitan stearate 6 Sorbitan oleate 6 Coconut oil 10 Sea buckthorn oil 7 7. Foot care

Ingredients Concentration,% Enzyme Complex A (20%) + B (80%) 20 Glycerol 20 Water 30 Polyethylene glycol 1.5 Sorbitan stearate 10 Sorbitan oleate 10 25

Coconut oil 5 Mint oil 3.5 8. Scar removal

Ingredients Concentration,% Enzyme Complex B (100%) 30 Glycerol 20 Water 20 Polyethylene glycol 1 Sorbitan stearate 10 Sorbitan oleate 10 Coconut oil 8 Calendula tincture 1

LT 6177 B

Antibacterial composition of multi-enzyme biopreparation: 1. Antibacterial oral mucosa spray

Ingredients Concentration,% Enzyme Complex A (100%) 10 Glycerol 15 Water 70 Sea buckthorn oil 0.5 Mint oil 0.5 Tincture of marigold 4 26

LT 6177 B

ABBREVIATIONS B cells are blood cells, white blood cells that determine the humoral response of the body. T cells - blood cells belonging to the leukocyte agranulocyte group, one of the lymphocyte populations. NK cells are lymphocytes that have no T and B cell-specific determinants on their surface. PDGF - platelet-derived growth factor. EGF - epidermal growth factor. IGF-1- insulin-like growth factor. FGF - fibroblast growth factor. TGF - β - transforming growth factor - β. TGF - a - Transforming Growth Factor - a. IL-1 - Interleukin 1 family (IL-1 family) is a group of 11 cytokines that play a central role in the processes of immune and inflammatory reactions. IFNγ - gamma interferon is a dimerized soluble cytokine. bFGF is the major growth factor for fibroblasts. KGF - keratinocyte growth factor. CTGF - Factor growth factor. VEGF - vascular endothelial growth factor. 27

LT 6177 B

References 1. Schultz, Gregory S., et al. " Wound bed preparation: a systematic approach to wound management. " Wound repairand regeneration 11.s1 (2003): S1-S28. 2. Falabella, Anna F. " Debridement and wound bed preparation. &Quot; Dermatologic Therapy 19.6 (2006): 317-325. 3. VVerner, Sabine, and Richard Grose. " Regulation of wound healing by cytokines. " Physiological reviews 83.3 (2003): 835-870. 4. Pugen, Rupert, et al. " Prospective randomized double-blind study of collagenase and fibrinolysin / deoxyribonuclease in pressure ulcers. " Age and ageing 31.2 (2002): 126-130. 5. Ramundo, Janet, and Mikei Gray. " Enzymatic wound debridement. " Journal of VVound Ostomy & Continence Nursing 35.3 (2008): 273-280. 6. Wang, Xiao-Jing, et al. " Role of TGFp-mediated inflammation in cutaneous wound healing. " Journal of Investigative Dermatology Symposium Proceedings. Vol. 11. No. 1. Nature Publishing Group, 2006. 7. Tsirogianni K.A., Moutsopoulos, N.M., Moutsopoulos H.M. Vound Healing: Immunological Aspects, Injury, Int. J. Care Injured, 2006, 37S: S5 - S12. 8. Martin, Paul. " VHound healing-aiming for perfect skin regeneration. " Science 276.5309 (1997): 75-81. 9. Curtis, R., et al. " Accuzyme (R) Papain-Urea Ointment v Collagenase Santyl (R) Ointment in the Treatment of Partial Thickness Burn VVounds: 191. " Journal of Burn Care & Research 23 (2002): S136. 10. Shi, Lei, and Dennis Carson. " Collagenase Santyl ointment: selective agentfor wound debridement. " Journal of VVound Ostomy & Continence Nursing 36.6S (2009): S12-S16. 11. Kang, Jeehoon, et al. " Activated platelet supernatant can augment the angiogenic potential of bone marrovv by G-CSF. " Journal of molecular and cellular cardiology (2014). 12. Van Meijer, M., and H. Pannekoek. " Structure of plasminogen activator 28

LT 6177 B inhibitor 1 (PAI-1) and its function in fibrinolysis: an update. &Quot; Fibrinolysis 9.5 (1995): 263-276.

Claims (17)

  1. 29 EN 6177 B DEFINITION OF THE INVENTION 1. A multi-enzyme biopreparation characterized in that it comprises the enzymes produced by Streptomyces gougerotii 101 which have proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activities and their complexes.
  2. 2. A multi-enzyme biopreparation according to claim 1, characterized in that the culture medium comprises enzymes produced by Streptomyces gougerotii 101 according to one of the inducers consisting of yeast (enzyme complex A) or collagen (enzyme complex B).
  3. 3. A multi-enzyme biopreparation according to claim 2, characterized in that the culture medium consists of different inductor concentrations.
  4. 4. A multi-enzyme biopreparation according to any one of claims 1 to 3, wherein the preparation comprises the A and B complexes together or separately.
  5. 5. A multi-enzyme biopreparation according to any one of claims 1 to 4, characterized in that the concentrations of the A and B complexes are from 0 to 100%.
  6. Process for preparing a multi-enzyme biopreparation according to any one of claims 1 to 5, comprising the steps of: a) preparing complexes of enzymes A and B; b) concentration and fractionation of enzyme complexes A and B; c) treating complexes of enzymes A and B with major protein deposition agents such as inorganic salts (e.g. NH4SO4, CaCte), ketones (e.g. CH3COCH3), saturated aliphatic alcohols (e.g. CH3CH2OH, CH3CHOHCH3), etc .; d) chromatographic separation of complexes A and B; e) stabilizing A and B complexes with saturated aliphatic polyhydric alcohols having a carbon skeleton length of at least C3 (e.g., glycerol, sorbitol, polyvinyl alcohol); f) optionally mixing A and B complexes.
  7. 7. A method for preparing a multi-enzyme biopreparation according to claim 6, wherein the enzyme complexes A and B are concentrated in step b) by ultrafiltration or vacuum evaporation.
  8. 8. A method for preparing a multi-enzyme biopreparation according to claim 6, characterized in that the A and B enzyme complexes are fractionated by ultrafiltration using 5,10,15 and 50 kDa membranes.
  9. 9. A multi-enzyme biopreparation according to any one of claims 1 to 5, characterized in that it lyses microorganisms: Micrococcus lysodeicticus, Staphylococcus nolus, Staphylococcus aureus, Streptococcus haemolyticus, Streptococcus paracitrovorum, Pseudomonas aeruginosa, Escherichia coli 078, Escherichia coli 12K, Pseudomonas fluorescens, Saccharomyces cerevisiae, Candida utilis.
  10. A cosmetic or pharmaceutical composition comprising a multi-enzyme biopreparation according to any one of claims 1 to 5 and 9, and a cosmetic or pharmaceutically acceptable excipient for use in promoting wound healing and improving skin condition.
  11. The cosmetic or pharmaceutical composition of claim 10 for use in stimulating the immune system, treating different wounds, skin care and treatment, and treating bacterial diseases.
  12. 12. The composition for use according to claims 10 and 11, wherein the composition with increased lipase activity is for the treatment of chronic and difficult healing wounds. 31 LT 6177 B
  13. 13. A composition for use according to claims 10 and 11, wherein the composition with increased lysing and glucanase activity is for treating infected wounds.
  14. 14. A composition for use according to claims 10 and 11, wherein the composition with increased proteolytic and collagenase activity is for the treatment of necrotic wounds.
  15. 15. A composition for use according to claims 10 and 11, characterized in that the composition with reduced enzymatic activity is intended for skin care and treatment of skin disorders.
  16. 16. A composition for use according to claims 10 and 11, wherein the composition is for the preparation of antibacterial agents.
  17. 17. A composition for use according to any one of claims 10 to 16, wherein the composition is a liquid, an ointment, and a hydrogel. I
LT2014115A 2014-10-10 2014-10-10 ISOLATION OF ENZYME COMPLEXES FROM Streptomyces gougerotii 101, PREPARATION AND APPLICATION OF MULTIENZYME BIOPREPARATIONS LT6177B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
LT2014115A LT6177B (en) 2014-10-10 2014-10-10 ISOLATION OF ENZYME COMPLEXES FROM Streptomyces gougerotii 101, PREPARATION AND APPLICATION OF MULTIENZYME BIOPREPARATIONS

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
LT2014115A LT6177B (en) 2014-10-10 2014-10-10 ISOLATION OF ENZYME COMPLEXES FROM Streptomyces gougerotii 101, PREPARATION AND APPLICATION OF MULTIENZYME BIOPREPARATIONS
PCT/IB2014/067226 WO2016055839A1 (en) 2014-10-10 2014-12-22 Extraction of enzyme complexes from streptomyces gougerotii 101, preparation of multienzyme biopreparations and their application
EP14833280.2A EP3204035A1 (en) 2014-10-10 2014-12-22 Extraction of enzyme complexes from streptomyces gougerotii 101, preparation of multienzyme biopreparations and their application

Publications (2)

Publication Number Publication Date
LT2014115A LT2014115A (en) 2015-05-25
LT6177B true LT6177B (en) 2015-07-27

Family

ID=52434904

Family Applications (1)

Application Number Title Priority Date Filing Date
LT2014115A LT6177B (en) 2014-10-10 2014-10-10 ISOLATION OF ENZYME COMPLEXES FROM Streptomyces gougerotii 101, PREPARATION AND APPLICATION OF MULTIENZYME BIOPREPARATIONS

Country Status (3)

Country Link
EP (1) EP3204035A1 (en)
LT (1) LT6177B (en)
WO (1) WO2016055839A1 (en)

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4556554A (en) 1981-06-01 1985-12-03 Germaine Monteil Cosmetiques Corp. Immobilized enzymes
US5705166A (en) 1992-06-22 1998-01-06 Arve; Richard Exfoliating skin cream
US6416769B1 (en) 2000-03-03 2002-07-09 Australian Importers, Ltd. Cosmetic compositions comprising exfoliating enzymes and uses thereof
US6551606B1 (en) 1999-06-10 2003-04-22 Coty B.V. Cosmetic product containing enzymes
US20030198631A1 (en) 2002-04-18 2003-10-23 Healthpoint, Ltd. Thermolysin enzymatic wound debrider
US20050249720A1 (en) 2004-05-05 2005-11-10 Perez Mary R Cosmetic skin formulation
RU2280076C1 (en) 2004-12-06 2006-07-20 Тихоокеанский Институт Биоорганической Химии Дальневосточного Отделения Российской Академии Наук Enzyme preparation from hepatopancreas of commercial crab species and method for production of the same
US20100080787A1 (en) 2002-12-18 2010-04-01 Basf Beauty Care Solutions France S.A.S. Cosmetic or dermopharmaceutical composition comprising an enzyme which is insoluble in an aqueous medium as well as its uses
WO2010079209A2 (en) 2009-01-08 2010-07-15 Golub Alexandr A Compositions for treating wounds and skin conditions
WO2011104630A1 (en) 2010-02-26 2011-09-01 Council Of Scientific & Industrial Research Enzymes from conidiobolus brefeldianus and process for preparation thereof
US8119124B2 (en) 2004-11-22 2012-02-21 Mediwound Ltd. Debriding composition from bromelain and methods of production thereof
US8128589B2 (en) 2004-01-27 2012-03-06 Ramot At Tel-Aviv University Ltd. Apparatus and methods for enzymatic debridement of skin lesions
US8377434B2 (en) 2006-07-27 2013-02-19 Amorepacific Corporation Cosmetic composition for exfoliating skin keratin
US20130156745A1 (en) 2011-12-20 2013-06-20 Kci Licensing, Inc. Composition for enzymatic debridement
US20130202581A1 (en) 2012-02-02 2013-08-08 Curelon Llc Enzyme compositions and use thereof for wound healing

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4557934A (en) * 1983-06-21 1985-12-10 The Procter & Gamble Company Penetrating topical pharmaceutical compositions containing 1-dodecyl-azacycloheptan-2-one
IL107578A (en) 1993-11-11 1998-07-15 Yissum Res Dev Co Topical antibacterial preparation comprising silver sulfadiazine and collagen
US5814094A (en) 1996-03-28 1998-09-29 Becker; Robert O. Iontopheretic system for stimulation of tissue healing and regeneration
US5986162A (en) 1998-03-20 1999-11-16 Dolisi; Frank Barrier protector for protecting a surgical patient from chemical burns caused by topical application of antiseptics
JP2003502071A (en) 1999-06-18 2003-01-21 ブジャーナソン・ヨーン・ブラーギ Use of the fish serine proteinase and their chemical and cosmetics
CA2323382C (en) 2000-10-17 2004-04-13 Pharma Mag Inc. Wound dressing
AUPR564301A0 (en) 2001-06-13 2001-07-12 Cooper, Barrie David Antibacterial material
US7704523B2 (en) 2002-04-26 2010-04-27 Lohmann & Rauscher Gmbh Microbial cellulose wound dressing for treating chronic wounds
GB0215023D0 (en) 2002-06-28 2002-08-07 Squibb Bristol Myers Co Wound dressing
US20090238811A1 (en) 2002-09-09 2009-09-24 Mcdaniel C Steven Enzymatic Antimicrobial and Antifouling Coatings and Polymeric Materials
JP2007502273A (en) 2003-08-14 2007-02-08 ミリケン・アンド・カンパニー Silver-containing wound care device, the structure and manufacturing method
GB0608437D0 (en) 2006-04-28 2006-06-07 Adv Med Solutions Ltd Wound dressings
EP2040721B1 (en) 2006-05-31 2013-05-08 Medihoney Pty Ltd Medicinal compositions containing honey
KR101315483B1 (en) 2011-06-23 2013-10-07 주식회사 아리바이오 A composition comprising antibiotics and lysophosphatidylcholine for enhancing immune or treating bacterial infection
KR101967174B1 (en) 2011-08-10 2019-04-09 얀센 사이언시즈 아일랜드 언리미티드 컴퍼니 Antibacterial piperidinyl substituted 3,4-dihydro-1H-[1,8]naphthyridinones
KR101377569B1 (en) 2012-01-19 2014-03-25 (주)시지바이오 Antimicrobial wound dressing and a method of manufacturing the same
US20120264705A1 (en) 2012-01-26 2012-10-18 Dignity Sciences Limited Antimicrobial compositions comprising 15-hetre and methods of use thereof
US9040504B2 (en) 2013-01-10 2015-05-26 VenatoRx Pharmaceuticals, Inc. Beta-lactamase inhibitors
US9180287B2 (en) 2013-01-18 2015-11-10 Diabetic Neuropathy Network, Inc. Use of local anesthesia and electrical stimulation in peripheral wound treatment

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4556554A (en) 1981-06-01 1985-12-03 Germaine Monteil Cosmetiques Corp. Immobilized enzymes
US5705166A (en) 1992-06-22 1998-01-06 Arve; Richard Exfoliating skin cream
US6551606B1 (en) 1999-06-10 2003-04-22 Coty B.V. Cosmetic product containing enzymes
US6416769B1 (en) 2000-03-03 2002-07-09 Australian Importers, Ltd. Cosmetic compositions comprising exfoliating enzymes and uses thereof
US20030198631A1 (en) 2002-04-18 2003-10-23 Healthpoint, Ltd. Thermolysin enzymatic wound debrider
US20100080787A1 (en) 2002-12-18 2010-04-01 Basf Beauty Care Solutions France S.A.S. Cosmetic or dermopharmaceutical composition comprising an enzyme which is insoluble in an aqueous medium as well as its uses
US8128589B2 (en) 2004-01-27 2012-03-06 Ramot At Tel-Aviv University Ltd. Apparatus and methods for enzymatic debridement of skin lesions
US20050249720A1 (en) 2004-05-05 2005-11-10 Perez Mary R Cosmetic skin formulation
US8119124B2 (en) 2004-11-22 2012-02-21 Mediwound Ltd. Debriding composition from bromelain and methods of production thereof
RU2280076C1 (en) 2004-12-06 2006-07-20 Тихоокеанский Институт Биоорганической Химии Дальневосточного Отделения Российской Академии Наук Enzyme preparation from hepatopancreas of commercial crab species and method for production of the same
US8377434B2 (en) 2006-07-27 2013-02-19 Amorepacific Corporation Cosmetic composition for exfoliating skin keratin
WO2010079209A2 (en) 2009-01-08 2010-07-15 Golub Alexandr A Compositions for treating wounds and skin conditions
WO2011104630A1 (en) 2010-02-26 2011-09-01 Council Of Scientific & Industrial Research Enzymes from conidiobolus brefeldianus and process for preparation thereof
US20130156745A1 (en) 2011-12-20 2013-06-20 Kci Licensing, Inc. Composition for enzymatic debridement
US20130202581A1 (en) 2012-02-02 2013-08-08 Curelon Llc Enzyme compositions and use thereof for wound healing

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CURTIS, R., ET AL.: "Accuzyme (R) Papain-Urea Ointment versus Collagenase Santyl (R) Ointment in the Treatment of Partial Thickness Burn Wounds", JOURNAL OF BURN CARE & RESEARCH, 2002, pages 136
FALABELLA, A F ET AL.: "Debridement and wound bed preparation", DERMATOLOGIC THERAPY, 2006, pages 317 - 325
MARTIN, PAUL: "Wound healing-aiming for perfect skin regeneration", SCIENCE, 1997, pages 75 - 81, XP002398362, DOI: doi:10.1126/science.276.5309.75
PUELLEN, R. ET AL.: "Prospective randomized double‐blind study of the wound‐debriding effects of collagenase and fibrinolysin/deoxyribonuclease in pressure ulcers", AGE AND AGEING, 2002, pages 126 - 130
SHI, LEI, AND DENNIS CARSON: "Collagenase Santyl ointment: a selective agent for wound debridement", JOURNAL OF WOUND OSTOMY & CONTINENCE NURSING, 2009, pages 12 - 16
TSIROGIANNI K. A. ET AL.: "Wound healing: Immunological aspects", INT. J. CARE INJURED, 2006, pages 5 - 12
VAN MEIJER, M., AND H. PANNEKOEK: "Structure of plasminogen activator inhibitor 1 (PAI-1) and its function in fibrinolysis: an update", FIBRINOLYSIS, 1995
WERNER, SABINE, AND RICHARD GROSE: "Regulation of wound healing by growth factors and cytokines", PHYSIOLOGICAL REVIEWS, 2003, pages 835 - 870, XP002672025, DOI: doi:10.1152/physrev.00031.2002

Also Published As

Publication number Publication date
WO2016055839A1 (en) 2016-04-14
LT2014115A (en) 2015-05-25
EP3204035A1 (en) 2017-08-16

Similar Documents

Publication Publication Date Title
Baltzis et al. Pathogenesis and treatment of impaired wound healing in diabetes mellitus: new insights
Cho et al. Dressing the part
Al-Waili et al. Honey for wound healing, ulcers, and burns; data supporting its use in clinical practice
Simon et al. Medical honey for wound care—still the ‘latest resort’?
US9155828B2 (en) Apparatus and methods for enzymatic debridement of skin lesions
Lusby et al. Honey: a potent agent for wound healing?
Wysocki Evaluating and managing open skin wounds: colonization versus infection
Eldor et al. New and experimental approaches to treatment of diabetic foot ulcers: a comprehensive review of emerging treatment strategies
US6682732B1 (en) Treatment of lesions
US6056955A (en) Topical treatment of streptococcal infections
Percival et al. The effects of pH on wound healing, biofilms, and antimicrobial efficacy
US6187743B1 (en) Composition and method for enhancing wound healing
AU718220B2 (en) Multifunctional enzyme
McCarty et al. The role of endogenous and exogenous enzymes in chronic wounds: a focus on the implications of aberrant levels of both host and bacterial proteases in wound healing
Molan Potential of honey in the treatment of wounds and burns
Chen et al. Recent insights into the causes of chronic leg ulceration in venous diseases and implications on other types of chronic wounds
Field et al. Overview of wound healing in a moist environment
Panuncialman et al. The science of wound bed preparation
Reiss et al. Matrix metalloproteinase-9 delays wound healing in a murine wound model
Falabella Debridement and wound bed preparation
Molan Why honey is effective as a medicine: 2. The scientific explanation of its effects
Nigam et al. Maggot therapy: the science and implication for CAM Part I—history and bacterial resistance
DE60222457T2 (en) Device for the controlled enzymatic removal and recovery of tissue
Schultz et al. Wound bed preparation: a systematic approach to wound management
Mathews et al. Wound management using honey