LT6177B - ISOLATION OF ENZYME COMPLEXES FROM Streptomyces gougerotii 101, PREPARATION AND APPLICATION OF MULTIENZYME BIOPREPARATIONS - Google Patents

Abstract

This invention is attributed to the fields of biotechnology and biomedicine. The aim of this invention is to use enzymes extracted from Streptomyces gougerotii 101 in order to create multienzyme preparations with proteolytic, collagenasic, esterasic, amylolytic, lipasic, glucanasic, deoxyribunocleasic and lytic activities, and to employ them in the development of cosmetics, antibacterial preparations and preparations for wound care. Multienzyme biopreparation development technology is distinguishable by the fact that, as you change enzyme concentrations within, their application field changes too.

Description

TECHNICAL FIELD

The present invention relates to the fields of pharmaceutical biotechnology and biomedicine.

It involves the preparation of enzymes from complexes of Streptomyces gougerotii 101, the preparation and practical application of multi-enzyme biopreparations.

TECHNICAL LEVEL

Wound - mechanical, chemical, thermal or other injury to the skin, mucous membranes or deeper tissues. Wound healing, initiated and regulated by the central nervous and immune systems, has four stages; inflammation, migration (granulation), epithelialization, and scar maturation are depicted in Figure 1. These stages of wound healing undergo the same processes, regardless of their origin, tissue wound contamination and other factors.

Ignition stage

When the skin and the blood vessels below it are damaged, a blood clot is formed in the wound [3,6]. Platelets in the clot release cytokines and growth factors: PDGF, EGF, IGF-1, FGF, TGF - β. These substances work in two ways: they activate adjacent immune cells and send a signal to the central nervous system about inflammation, as shown in Figure 2. [1,3]. The ignition stage is an important and complex process. First of all, the wound is open and therefore poses a high risk of infection, as damaged and necrotic tissues present in the wound are a favorable medium for the growth of pathogenic microorganisms. The overall immune response takes about 24 hours. Although inflammation is a necessary process for wound healing, it slows down the regeneration process and can even be harmful. In some cases, due to infection or acute inflammation, the inflammatory stage is complicated and may last from 20 days to 2 years. Prolonged inflammation stops healing and other stages of the process, making wounds difficult to heal and chronic, and hypertrophic scar formation may occur, interfering with the function of the surrounding, uninjured tissues.

When all factors and immune cells enter the wound through the circulatory system, the inflammatory stage of wound healing begins. Neutrophils arrive first and dominate the lesion site within the first 3 days [3]. Their main function is phagocytosis of microbes and foreign bodies. After phagocytosis, neutrophils undergo apoptosis and are then removed by wound-migrating macrophages. Maximum macrophage concentration in the wound is approximately 24-36 hours. Macrophages, like neutrophils, phagocytes microbes, other particles, and clean the wound surface. Macrophages also activate NK cells, which begin to synthesize interferon gamma IFNγ, which in turn activates the macrophages themselves. Macrophages also play another important role in attracting to the lesion site and activating acquired immune cells, T and B lymphocytes. Activated Thymphocytes arrive at the lesion site to synthesize IFNγ, which has been reported to activate macrophages and potentiate their effects. It should be noted that not all microorganisms are affected by the immune system and the infection may spread further from the primary site of infection, which may lead to sepsis, an acute inflammatory response of the entire body.

There are a number of preparations for combating infection in wounds. These include iodine solutions as disclosed in BETADINE® in U.S. Pat. No. 5,986,162 A, antiseptic agents in the form of SSDs with the silver sulfadiazine antibacterial agent described in US5514657 A, or Medihoney® antibacterial medicinal honey described in EP2040721 B1. The FDA has confirmed that silver is a natural antibiotic to combat microorganisms. Sterile antibacterial bandages have been developed with silver as described in US 7704523 B2, WO 2004002384 A1, US 7005556 B1, US 20070275043 A1. Silver is also used in other applications: colloidal solutions, hydrogels, etc. described in WO 2005018543 A2, US 6706279 B1. The antimicrobial agent used in WO 2002100448 A1 is triclosan, but laboratory tests have shown its adverse effect on the human endocrine system. WO 2013109004 A1 describes wound dressing material made of chitosan - silver nanoparticles, which have antibacterial and slow release properties, but the slow antibacterial effect also prolongs the time to fight infection. Antibacterial agents based on the inhibition of enzymes synthesized by pathogenic microorganisms have been developed because they degrade antibiotics, such as the inhibitor of beta-lactamase, which is broken down by penicillin, described in US 20140194386 A1. Another antibacterial agent is described in US 20140163038 A1 which inhibits the Fab enzyme involved in the bacterial fatty acid synthesis cycle, thereby inhibiting the growth and development of microorganisms. US 20140134210 A1 describes a method of anti-infective treatment using antibiotics in combination with an immunostimulatory agent, lysophosphatidylcholine, which stimulates immune cells: monocytes, macrophages, T lymphocytes and neutrophils. Studies have shown that the synergistic effects of these substances are more effective in the treatment of infection than when acted alone. US 20140171358 A1 describes antibacterial compositions comprising one or more fatty acids: DGLA, 15-OHEPA and / or 15HETrE, used alone or in combination with antibiotics. US 2014/0193889 A1 describes the antimicrobial activity of lipases. Lipases degrade cell walls and cell membrane components of microorganisms, thereby inhibiting their growth and reproduction. Flaminal® is a well-known antibacterial medicine containing glucose oxidase and lactoperoxidase enzymes. The anti-infective agent SertaSil ™ contains the enzyme serathiopeptidase described in patent WO2010079209 A2.

The disadvantage of all these preparations is that they serve only one function, and in order to achieve effective wound healing, it is necessary to eliminate all possible causes that impede wound healing. Fatty ointments and antibiotic preparations should not be used, since fatty ointments promote inflammation and flatulence, the antibiotic is excluded from necrosis, and the antibiotic concentration in the wound is insufficient. Antibiotics have a narrow spectrum of action against fungi and viruses, and rapid development of antibiotic-resistant strains of microbes. The main causes of disruption of wound healing processes are non-viable, necrotic tissue in the wound and bacteria causing infection [3]. According to scientific literature, early and complete removal of nonviable tissues results in faster wound epithelialization, reduces the risk of scarring and ensures better functional recovery [5,8].

As a result of the inflammatory wound healing phase, macrophages and neutrophils clear the wound surface from microbes, cell debris and initiate tissue repair [7]. Growth factor TNF-α stimulates protease synthesis in neutrophils and macrophages: elastase, myeloperoxidase, necrotic tissue [1]. Inhibitors of these proteases are also secreted into the wound, which inhibit the action of the proteases at the bottom of the wound so as not to damage viable tissues [3]. This inhibition results in the removal of necrotic tissue from the wound, thus prolonging not only the inflammatory stage but also the entire wound healing period. In addition to these protective functions, inflammatory cells are an important source of growth factors and cytokines that initiate the wound healing proliferation phase [2, 3].

There are many different ways to treat wounds. U.S. Pat. No. 20140207050 A1 describes a method using electrostimulation with anesthetics to induce local and deep muscle contraction, which in turn improves blood circulation and increases oxygen concentration in the wound, thereby improving the wound healing process and avoiding complications.

In order to heal the wound and avoid complications, it is necessary to promote the removal of dead tissue at the inflammatory stage. Tissue removal - The medical removal of dead, dying, damaged or infected tissue to improve and promote wound healing and healthy tissue recovery. There are several types of necrectomy: surgical, mechanical, autolytic, enzymatic, and so on. Autolytic necrectomy enhances the natural autolytic processes in the wound, maintains a moist environment and regulates excess exudate. Autolithic necrectomy is a long process that cannot be applied to infected wounds [2]. Mechanical removal of necrotic tissue can damage healthy tissue, both in the wound and adjacent areas, and is non-selective. Surgical necrectomy is painful, may result in bleeding, use of painkillers, and loss of some healthy tissue. Enzymatic necrectomy is a highly selective and topical method for the treatment of wounds and difficult to heal wounds. This method employs exogenous enzymes, usually proteases, which act in conjunction with endogenous enzymes produced in wounds.

Enzymes performing necrectomy may be isolated from plants, microorganisms and animals. The herbal protease bromelain, often used as an active ingredient in medical preparations for necrectomy, is described in US 2013/0156745 A1, US 8119124 B2 and US 8,128,589 B2. Bromelain is a cysteine endopeptidase isolated from pineapple. NexoBrid containing bromelain is used to treat skin burns.

Accuzyme® contains the active substance papain, which acts as a necrectomy. Papain - Proteinase cut from papaya fruit. It has the advantage over other proteinases that it operates in a wide pH range of 3 to 12. However, one papain is ineffective, so it is used in combination with urea, which by denaturing non-viable proteins, helps papain break down. Clinical studies have not shown significant effects on wound healing rates [9] ·

Animal enzymes are described in patent RU 2280076 C1. Enzymes isolated from Kamchatka crab exhibit collagenase, protease, ribonuclease, deoxyribonuclease, phosphodiesterase, phosphatase, amylase, lipase and glucanase activities. For this reason, mixtures of these enzymes or single enzyme preparations can be widely applied in biotechnology, medicine, cosmetology. The patent claims that this multi-enzyme preparation is useful for the treatment of purulent wounds and is more effective than preparations containing only collagenase or protease, but no preparation and application studies have been described.

The combination of the two enzymes fibrinolysin and deoxyribonuclease is used in Elase®. Fibrinolysin breaks down fibrin and dissolves blood clots, as well as inactivating fibrinogen and several coagulation factors. This enzyme dilates blood vessels at the bottom of the wound. By breaking down fibrin and necrotic tissue in the wound, it helps macrophages enter the wound. Fibrinolysin in dry form is stable, but loses its activity after 6 to 8 hours. The products of the fibrinolysin reaction are not absorbed and must therefore be removed from the wound surface [2],

Deoxyribonuclease is produced from bovine pancreas. This enzyme breaks down nucleic acids and reduces the viscosity of exudate. It is water soluble and active over a wide range of pH but loses activity at room temperature [2].

In theory, these enzymes should improve wound healing since the exudate is predominantly composed of fibrin and nucleoproteins. Clinical trials investigated the efficacy of this product in removing necrotic tissue and promoting granulation, and saline was used for control. Treatment results demonstrated the benefit of this product in only 19 of 34 patients [4].

Endopeptidase trypsin secreted from pancreatic juice performs necrotic tissue removal without damaging viable tissues. Clinical studies have shown that this enzyme can increase reepithelialization, increase blood circulation and reduce wound edema. However, more detailed clinical studies should be conducted to determine the efficacy of this enzyme in wound healing processes. The best known preparations with trypsin are Xenaderm® and Granulex® [2].

A number of enzymes of microbiological origin are also known for use in the treatment of wounds.

Santyl® preparation for wound cleaning and healing contains collagenase of microbiological origin isolated from Clostridium histoliticum. This protease selectively degrades different types of collagen present in wound necrotic tissues but is ineffective against keratin, fat, and fibrin. The optimum operating pH for this collagenase is 6 to 8 [10].

Varidase® also contains two enzymes, streptokinase and streptodornase. Streptokinase is produced by β-hemolytic streptococci. This enzyme converts plasminogen to plasmin, thereby promoting wound exudate fibrinolysis. Streptodornase is produced by hemolytic streptococci. This enzyme is a deoxyribonuclease, which performs hydrolysis of DNA without causing any damage to viable cells [2].

US 2003/0198631 A1 describes a medical enzyme preparation for necrectomy containing the extracellular metal endopeptidase Thermolysin isolated from the microorganism Bacillus thermoproteolyticus. This protease has high specificity for two proteins: collagen and fibrin. Because of this specificity, this preparation performs only a few functions in a complex wound healing process.

The enzyme selectivity of substrate products currently available on the market for wound cleaning and healing may lead to slower and incomplete removal of necrotic tissue. In addition, their effects are limited by all the processes that take place in the wound healing stages.

Migration (granulation) and epithelialization stages

Once the wound has been cleared of germs and necrotizing tissues, fibroblasts, keratinocytes and endothelial cells synthesize growth factors.

table. Cell-synthesized growth factors.

The cell The growth factor is synthesized Keratinocytes TGF-β, TGF-α, IL -1 Fibroblasts IGF-1, bFGF, TGF-β, PDGF, KGF, CTGF Endothelial cells bFGF, PDGF, VEGF

These synthesized substances promote cell migration, proliferation, formation of new capillaries, and extracellular protein synthesis [3,8].

The lesion forms a so-called granulation tissue. It is formed from endothelial cells, fibroblasts, keratinocyte inflammatory macrophages, lymphocytes and the extracellular matrix. Proteases play an important role in the cell migration stage. Collagenase, elastase, and trypsin degrade desmosomes and hemidesmosomes and thereby help fibroblasts and endothelial cells separate from the basement membrane at the base of the wound and migrate freely into the wound cavity [2,3]. The wound also secretes inhibitors of these proteases, which inhibit the action of the proteases at the bottom of the wound to prevent them from damaging viable tissues [3]. This inhibition results in the removal of necrotic tissue from the wound, thus prolonging not only the inflammatory stage but the entire wound healing period. Collagen fibrils are continuously remodeled by proteases secreted by neutrophils, macrophages, fibroblasts, endothelial and epithelial cells. In parallel, re-epithelialization occurs, covering the wound with an epithelial cell layer and forming new blood vessels [3,6,7]. Fibroblasts synthesize collagen, elastin, and proteoglycans, which form the primary scar.

Maturation of the scar

Scar maturation lasts from several months to several years, depending on the origin and size of the wounds. The scars of normal cuts or scalp wounds in 1 to 2 months, and in cases of burns it can take up to 30 months. Impaired function of tissue-defective fibroblasts increases collagen synthesis, leading to hypertrophic and keloid scars. Therefore, it is expedient to use preparations containing collagenases at this stage.

WO2010079209 A2 describes a composition, SertaSil ™, for the treatment of a variety of wounds, the active ingredient of which is the proteolytic enzyme serathiopeptidase. This protease is isolated from the non-pathogenic microorganism Serratia E 15. The patent describes the wound's functions: combats infection, effectively removes necrotic tissue, relieves pain, regulates exudate volume, regulates wound moisture balance, reduces wound inflammation and edema, and reduces bleeding.

WO 2011104630 A1 describes an enzyme complex consisting of proteases, carbohydrolases and lipases isolated from the culture of the fungus Conidiobolus brefeldianus. These enzymes can be used alone or in combination. The authors provide potential applications for the treatment of leather (animal fur), detergents, food, textiles, silk production and utilization of waste generated during the process, analytical tools, pharmaceuticals, cosmetics, molecular biology, etc. However, no wound healing preparations containing these enzymes or combinations thereof are currently known.

US 2013/0202581 A1 describes wound healing compositions using three pancreatic hydrolases: protease, lipase and amylase. The authors describe that these enzymes can be used in varying concentrations in formulations for wound healing. It is also mentioned that these hydrolases stimulate wound healing by stimulating the cells of the epidermis and without scarring after the healing process. It is also noted that the compositions of these enzymes are not effective against infections caused by Staphylococcus aureus and Escherichia coli.

Enzymes are also used in cosmetic products, most often in skin scrubs. Enzyme-based skin cleansers are free of acid and scrubbing granules that can cause skin irritation. The essence of the action of these scrubs is that dead skin cells are dissolved by enzymes. There are similar products in the skin care market. The enzymes used in the production of cosmetics can be isolated from different sources. Here are some examples of these sources: U.S. Patent Nos. 5,705,166, 6,416,769 B1 and 8,377,434 B2 describe enzymes for the production of exfoliators from unripe papaya fruits. Patent CA 2377357 describes enzymes isolated from cod (Gadus morchua) used in the manufacture of cosmetic products. US 4,556,554 and US 2010/0080787 A1 describe enzyme complexes for use in skin care cosmetic products. U.S. Patent No. 6,551,606 B1 describes a used enzyme complex isolated from coconut (Cocos nucifera) milk. US 2005/0249720 describes complexes of enzymes isolated from pineapple, mango and papaya fruits used in cosmetic products.

The wound healing and skin care methods described above do not completely solve all the problems associated with their therapy:

no universal complex preparations with antibacterial activity, selectively removing necrotic tissues, stimulating the body's immune system, reducing scar formation, and active at all stages of healing;

no complex biopreparations with enzyme concentration dependent applications;

no complex biopreparations to control wound healing rate;

there are no complex biopreparations for skin care and skin diseases.

Therefore, it is an object of the present invention to provide an effective multi-enzyme biopreparation that does not have the drawbacks listed above, is readily applicable to both wound healing, skin care products and antibacterial agents. In addition, it would function functionally in all wound healing processes in conjunction with the immune system, would have a broad spectrum antibacterial effect, selectively remove necrotic tissue, reduce scar formation, accelerate healing time and be suitable for wound healing of various origins and types. Also a multi-enzyme biopreparation for skin care and skin conditions.

THE SUBSTANCE OF THE INVENTION

The object of the invention is to provide a technology for the production of complexes of enzymes isolated from Streptomyces gougerotii 101 microorganisms and their use in the production of multi-enzyme biopreparations.

SUMMARY OF THE INVENTION The present invention is directed to the development of multienzyme biopreparations of enzyme complexes isolated from Streptomyces gougerotii 101, which aid in the human immune system and which are useful for the proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclear and for supervision.

The method of treating skin disorders and wounds described herein differs from known methods in the use of multi-enzyme biopreparations consisting of proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing enzymes produced by Streptomy.

The second difference is that the composition and activity of the enzyme complexes produced by Streptomyces gougerotii 101 can be altered in culture medium using different inducers: yeast (A) or collagen (B).

The third difference is that the composition and activity of the enzymes produced by Streptomyces gougerotii 101 can be varied in the culture medium by varying the concentrations of the inducers.

The fourth difference is that enzyme complexes A and B can be used together and separately for the production of a multi-enzyme biopreparation.

The fifth difference is that the concentrations of enzyme complexes A and B used in the multi-enzyme biopreparation can vary from 0 to 100 percent.

The sixth difference is that the method of obtaining a multi-enzyme biopreparation may include the following steps:

(a) preparation of A and B enzyme complexes;

b) concentrating and fractionating the A and B enzyme complexes;

c) treatment of A and B enzyme complexes with basic protein precipitating agents such as inorganic salts (e.g. NH4SO4, CaCl2), ketones (e.g. CH3COCH3), saturated aliphatic alcohols (e.g. CH3CH2OH, CH3CHOHCH3), etc .;

d) chromatographic separation of complexes A and B;

(e) stabilization of complexes A and B with saturated aliphatic polyhydric alcohols having a carbon skeleton of at least C3 (eg glycerol, sorbitol, polyvinyl alcohol);

f) optionally mixing A and B complexes.

The seventh difference is that, when preparing a multi-enzyme biopreparation, it can be concentrated by ultrafiltration or vacuum evaporation.

The eighth difference is that, when preparing a multi-enzyme biopreparation, it can be fractionated by ultrafiltration using membranes of 5.10, 15 and 50 kDa.

The ninth difference is that the multi-enzyme biopreparation lyses a series of microorganisms: Micrococcus lysodeicticus, Staphylococcus albus, Staphylococcus aureus, Streptococcus haemolyticus, Streptococcus paracitrovorum, Pseudomonas aeruginosa, Escherichia coli 078, Escherichia coli 078.

The tenth difference is that the multi-enzyme biopreparation can be used in pharmaceutical or cosmetic compositions in combination with a pharmaceutical or cosmetic-acceptable excipient to promote wound healing and skin improvement.

The eleventh difference is that the multi-enzyme biopreparation can be used to stimulate the immune system in the treatment of different wounds, both in skin care and treatment and in the treatment of bacterial diseases.

The twelfth difference is that a multi-enzyme biopreparation with increased lipase activity can be used in a composition for the treatment of chronic and difficult-to-heal wounds.

The thirteenth difference is that the multienzyme biopreparation with increased lysing and glucanase activity can be used in a composition for the treatment of infected wounds.

The fourteenth difference is that the multienzyme biopreparation with increased proteolytic and collagenase activity can be used in a composition for the treatment of necrotic wounds.

The fifteenth difference is that the multi-enzyme biopreparation with reduced enzymatic activity can be used in a composition for skin care and treatment of skin conditions.

The sixteenth difference is that the multi-enzyme biopreparation can be used in a composition for antibacterial treatment of diseases.

The seventeenth difference is that compositions with multienzyme biopreparations may be in the form of a liquid, ointment, and hydrogel.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Principal scheme of physiological and biochemical processes of wound healing;

FIG. 2. Preparation of the basic and working culture banks of Streptomyces gougerotii 101 (Phase I);

FIG. 3. Biosynthesis of Streptomyces gougerotii 101 strain enzymes, inducer of yeast (Phase II);

FIG. 4. Biosynthesis of Streptomyces gougerotii 101 strain, inducer collagen (Stage III);

FIG. 5. Preparation of the multienzyme complex A from the culture fluid (step IV);

FIG. 6. Preparation of the multienzyme complex B from the culture fluid (step V);

FIG. 7. Composition of multienzyme complexes A and B after concentration (SDS PAGE electrophoresis method);

FIG. 8. Schematic diagram of enzyme complex A preparation (yeast inducer);

FIG. 9. Schematic diagram of enzyme complex B preparation (inductor collagen);

FIG. 10. Basic scheme of application of multi-enzyme biopreparations;

FIG. 11. Schematic diagram of the use of multi-enzyme biopreparations.

DETAILED DESCRIPTION OF THE INVENTION

Our technology for producing a multi-enzyme biopreparation is based on the production of enzyme complexes synthesized by Streptomyces gougerotii 101 microorganisms and their use in the preparation of pharmaceutical, cosmetic and antibacterial compositions. The enzymes that make up a multi-enzyme biopreparation have the effect of:

(a) Proteases enter the early stages of wound healing and participate in all subsequent stages. In particular, they perform a necrectomy function, breaking down a complex clot system. Proteases also lyse necrotic tissues, exudate and proteins contained therein, thereby reducing the time course of the inflammatory stage. They block the pain stimulants histamine and bradykinin, accelerate inflammation stimulants and the degradation of toxic substances, and stimulate and regulate the functional activity of macrophages. These enzymes are involved in the migration stage, degrading desmosomes and hemidesmosomes. It helps fibroblasts and endothelial cells to separate from the basement membrane of the wound bottom and migrate freely within the wound cavity;

(b) Glucanase lyses the walls of microbial cells, thereby inhibiting their development in the wound, thereby preventing infection. Also, the action of glucanases in multi-enzyme biopreparations results in β-glucans produced activating phagocytes, stimulating γ-interferon synthesis, thereby stimulating the body's immune system and accelerating wound healing processes;

c) DNAse hydrolyzes the DNA of disrupted cells, which accelerates wound clearance from necrotic tissue. This enzyme selectively degrades nucleic acids and reduces the viscosity of the exudate, thereby facilitating the movement and migration of cells involved in wound healing processes;

d) Lipase enhances wound growth factors that accelerate angiogenesis, keratinocyte and fibroblast proliferation and migration, activate endothelial cells and promote collagen synthesis. As a result of lipase action, prostaglandin synthesis is reduced, leading to a reduction in tissue swelling around the wound;

e) Amylase regulates the release of EGF growth factor, which activates proliferation and migration of fibroblasts and keratinocytes in the wound. It also speeds up wound closure;

(f) elastase stimulates the innate immune system in the early stages and is involved in tissue repair and regeneration in the later stages;

g) Collagenase selectively cleaves collagen into smaller molecules which are then hydrolyzed by other proteases. Collagenase is effective in cleaning the lesion from necrotic tissue, accelerating granulation tissue formation. Collagenase improves the migration of keratinocytes and epithelial cells to the lesion site and their proliferation, which accelerates epithelial wound cover and new tissue formation. The action of collagenase reduces the amount of collagen synthesized by fibroblasts during scar maturation and thus prevents the formation of raised and rough scar, i.e. normalization of collagen levels results in softening and scarring of the scar

(h) enzymes with lysing activity are involved in disrupting the cell wall of microorganisms, thereby inhibiting their development in the wound and preventing infection and complications.

The wound is an open pathway for pathogenic microorganisms, and the necrotic tissues and exudate present therein facilitate their growth. The overall immune response takes about 24 hours, during which time the wound processes can be irreversible and the infection can start. Therefore, it is expedient to treat the wounds immediately after injury with compositions of a multi-enzyme biopreparation that eliminates all factors that inhibit or complicate wound healing. In particular, multienzyme biopreparation formulations exhibit broad lysing activity and disrupt pathogenic microorganisms in the wound. It also hydrolyses denatured proteins, liquefies wound necrotizing tissues, stimulates granulation tissue growth and accelerates wound cleansing and healing, reduces adjacent tissue swelling and inflammation. Collagenase, a multi-enzyme biopreparation, dissolves the hardened layer of coagulated blood, necrotic tissues and degrades excess collagen, which prevents the formation of skin scarring in the treatment of purulent wounds. Removing necrotizing tissues with multienzyme biopreparation formulations eliminates proteinaceous and non-circulating media, favoring microbial growth, thereby reducing bacterial wound contamination and stopping the infection process. This enables further wound healing - tissue regeneration and local blood flow improvement.

Also, excipients such as sodium alginate in the multienzyme biopreparation composition increase the absorption of the exudate. Polyethylene glycol forms polymeric lattices that immobilize enzymes and stop the decrease in enzyme activity, which reduces the amount of bandages per day. Glycerol attracts, retains and binds water. Compositions with a higher concentration of glycerol create a longer lasting moist environment in the wound, at all stages of healing. The epithelial cells need moisture to move more easily from the foci of re-epithelialization at the edges of the wound to fill the wound area. In dry wounds, these cells move to the bottom of the wound. Maintaining a moist environment in wounds allows cells to migrate throughout the wound area, resulting in faster wound healing.

PREFERRED EMBODIMENTS

DESCRIPTION OF PRODUCENT Streptomyces gougerotii 101

Enzyme complexes with proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activities are obtained from the actinomycete Streptomyces gougerotii 101 strain by deep cultivation. Streptomyces gougerotii strain 101 (Biocentras UAB micro-organism collection number K-91) was isolated from soil in southeastern Lithuania. It has the following characteristics:

Morphological

Culture surface micelle white or colorless, with an average hyphae thickness of 0.6-0.8 microns. Spores ovate or oblong, smooth surface.

Cultural

When culturing Streptomyces gougerotii 101 on agarized maize no. 2, a rich micelle is formed (white on the surface and light brown on the substrate). A white surface and beige substrate mycelium forms on the agarized oat medium.

Physiological and biochemical

Aerobic, optimal growth temperature + (28-30) ° C, pH (7.0-7.5). It hydrolyses starch, casein, collagen, twin 80, β-glucans and DNA. It contracts and peptonizes milk, liquefies gelatin, lyses the cell walls of yeast and bacteria. It assimilates glucose, sucrose, fructose, xylose, does not assimilate, or only slightly mannitol and raffinose. Indices of proteolytic, collagenase, DNAase, esterase, yeast lysing, betaglucanase, bacterial lysing, and amylolytic activities were measured to evaluate the hydrolytic activity of the enzymes synthesized by S. gougerotii 101 strains. To determine the activity index of these enzymes, the strain was plated on Petri dishes with rigid medium supplemented with sodium caseinate, collagen, DNA, twin 80, baker's yeast cells, baker's yeast beta-glucan, Mycrococcus lysodeikticus cells and starch. Enzyme activity indices were calculated after 96 h of incubation at 30 ° C by dividing the diameter of the hydrolysis zones of the respective substrates by the diameter of the colonies. The results are shown in Table 2.

Table 2. Activity indices of hydrolytic enzymes synthesized by S. gougerotii 101 strain

Enzyme activities

The 16S rRNA gene consensus sequence of Streptomyces gougerotii 101 strain (SEQ ID NO: 1)

GGACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGATGAAG

CCCTTCGGGGTGGATTAGTGGCGAACGGGTGAGTAACACGTGGGCAATCTGCC

CTGCACTCTGGGACAAGCCCTGGAAACGGGGTCTAATACyGGATATGACCGTCC

ATCGCATGGTGGrTGGTGTAAAGCTCCGGCGGTGCAGGATGAGCCCGCGGCCT

ATCAGCTAGTTGGTGAGGTAGTrGCTCACCAAGGCGACGACGGGTAGCCGGCC

TGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG

GAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGC

CGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGAAGAAG

CGAAAGTGACGGTACCTGCAGAAGAAGCGCCGGCTAACTACGT

ENZYME COMPLEXES OBTAINED FROM Streptomyces gougerotii 101,

PRODUCTION PHASES

Phase I

In particular, Streptomyces gougerotii is performed to obtain enzyme complexes with optimal proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activities.

101 strain selection and cell banks prepared for culture storage.

Phases II and III

The production of multi-enzyme biopreparations begins with the biosynthesis of Streptomyces gougerotii 101 enzymes, which produces culture fluid. Streptomyces gougerotii 101 produces enzymes with proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activities during biosynthesis. The composition and activity of the enzymes synthesized are regulated by varying the inducers (yeast A or collagen B) and their amounts in the medium.

Stages IV and V

The culture fluids A and B obtained after biosynthesis of 101 enzymes of Streptomyces gougerotii are centrifuged, filtered, concentrated by vacuum evaporation or ultrafiltration. The resulting concentrates A and B are precipitated using the main protein precipitation agents. After further centrifugation, the resulting precipitate is dissolved and the resulting suspension is centrifuged again.

table. Enzymatic activities of multienzyme complexes A and B.

No. Enzymatic activity Multi-enzyme complex A (inducer yeast) Multi-enzyme complex B (collagen inducer) 1. Proteolytic activity, v / cm ³ 10-22 5-7.5 2. Collagenase activity, v / cm ³ 700-1180 700-930 3. Lipase activity, v / cm ³ 100-145 10-20 4. Glucanase activity, v / cm ³ 5-7.5 2-3.4 5. DNAase activity, v / cm ³ 0.21 - 6th Amylase activity, v / cm ³ 2-5 1-3 7th Esterase activity, v / cm ³ 15000-18000 12000-16000 8th Lysing activity, v / cm ³ 20-60 80-100

A unit of proteolytic activity is the amount of enzyme preparation which liberates 1 micromole of tyrosine per minute by hydrolysis of casein or sodium caseinate at pH 8.0 and 37 ° C.

A unit of collagenase activity is the amount of enzyme which liberates 1 micromole of α-leucine by hydrolysis of collagen over 5 hours at pH 7.5 and 37 ° C.

A unit of lipase activity is the amount of enzyme which liberates 1 nanomolar pnitrophenol per minute from substrate p-nitrophenyl palmitate at 40 ° C, pH 8.0.

The unit of glucanase activity is the activity of the preparation which degrades 0.1 pmol of insoluble 3-1,3-glucan in 1 minute under optimal conditions (pH = 7.0; 50 ° C).

A unit of DNA activity is the amount of enzyme which cleaves 1 pg of DNA per 10 minutes at 37 ^° C.

The unit of amylase activity, a unit of bacterial α - amylase (S.A. Rapidaz), is the amount of enzyme which degrades 1 mg of starch to erythrodextrins at pH 5,6 - 5,8 and 30 ± 0,2 ° C within 1 minute.

Unit of esterase activity is the amount of enzyme which liberates 1 nanomolar pnitrophenol per minute from substrate p-nitrophenyl butyrate at 40 ° C and pH 8.0.

Unit of lysing activity is the amount of enzyme which, at 37 ° C and pH 8.0, decreases the optical density of the reaction mixture within 30 minutes (substrate Micrococcus lysodeikticus culture).

Due to the antibacterial properties of the multi-enzyme biopreparation, it has been used to disrupt pathogenic microorganisms isolated from the nasopharynx, throat, teeth, abscesses of patients. Multi-enzyme biopreparation destroys cell walls of various pathogenic and uncomfortable microorganisms, particularly lysing streptococci and staphylococci, which are common infectious agents. The multienzyme complex lyses Clostridium perfringens bacteria, which induce gangrene gaseous (Table 3).

table. Antibacterial activity of multienzyme biopreparation.

Microorganisms Share of lysed cells,% Incubation time 15 min. Micrococcus lysodeicticus 32 Staphylococcus albus 50 Staphylococcus aureus 60 Streptococcus haemolyticus 40 Streptococcus agalacitae 45 Streptococcus paracitrovorum 30th Pseudomonas aeruginosa 40 Clostridium perfringens 30th Escherichia coli 35 Pseudomonas fluorescens 10th Bifidobacterium species 0 Saccharomyces cerevisiae 15th Saccharomyces vini 0 Candida utilis 20th Bacillus subtilis 0 Aspergillus niger 0 Aspergillus awamon 0 Penicillium funiculosum 0

Preclinical studies of multi-enzyme biopreparation were performed. During the preclinical testing phase, the following were performed: toxicological, pharmacological and efficacy studies (permission of the State Food and Veterinary Service to perform laboratory animal tests No.0141). All studies were performed according to pre-prepared and signed plans. All toxicological studies were performed according to OECD methodologies. Mice, rabbits and guinea pigs were used for the study. All toxicological tests used (as specified in EU Directives) a multi-enzyme concentrate of the test product with 6 times the proteolytic and collagenase activity of the proposed formulation. In conclusion, the extent and results of the toxicological studies performed suggest that the test preparation is safe in terms of toxicity.

Conclusions:

Skin sensitization study in guinea pigs - conclusion - no redness, no swelling, no negative reaction to the provocation test - the preparation does not sensitize the skin;

Acute skin irritation test in rabbits - Conclusion - average skin irritation score is zero - the preparation is non-irritant;

Acute Eye Irritation Test in Rabbits - Conclusion - Rabbit eye irritation is estimated at 0.25 points and it is advisable to avoid eye contact with mild burns when using the product;

Repeated-dose (28-day) dermal toxicity test - A repeated dose toxicity study in C57W mice showed a non-toxic concentration of 0.8 v / cm.

Acute gastrointestinal toxicity study in C57W mice - preparation of low concern.

The efficacy of the treatment of burns at different concentrations of the test preparation was investigated: 0.5 v / cm ³ , 0.8 v / cm ³ , 1.0 v / cm ³ , 1.6 v / cm ³ according to proteolytic activity. Healthy adult male rats of the Vistar population were used for the study. The results of the studies showed that the optimum proteolytic activity of the investigational medicinal product in the treatment of thermal burns is 0.8 v / cm ³ . The use of a test complex enzyme preparation with a proteolytic activity of 0.8 v / cm ³ for the treatment of grade I-III thermal skin burns results in an average reduction of treatment duration of 20%. Treatment of burns does not leave scars, which may be more relevant in the treatment of burns on the face, hands, feet.

The scope and results of preclinical studies indicate that the multienzyme biopreparation is safe in terms of toxicity and can be used in the manufacture of pharmaceutical, cosmetic and antibacterial compositions.

Use of multienzyme complexes

The application of a multi-enzyme biopreparation is divided into three parts. These biopreparations can be used in the manufacture of pharmaceutical, antibacterial and cosmetic compositions. The application depends on the activity concentration of the multi-enzyme biopreparations and on the enzyme complex A or B chosen. The second is the development of multienzyme biopreparation formulations for the production of antibacterial agents. The third is the development of multienzyme biopreparation compositions for skin care and treatment of skin disorders.

Concentrations of enzyme complexes A and B may vary in multi-enzyme biopreparation compositions for wound healing. The concentration of enzyme complex A and B may be 0-100%.

Multienzyme Biopreparation Compositions for Wound Healing:

1. Hydrogel for necrotic wounds

Ingredients Concentration,% Enzyme Complex A (70%) + B (30%) 20th Sodium alginate 3 Polyethylene glycol 20th Glycerol 7th Water 50

2. Hydrogel for grade III burns

Ingredients Concentration,% Enzyme Complex A (50%) + B (50%) 30th Sodium alginate 3 Polyethylene glycol 20th Glycerol 6th Water 40 Sea buckthorn oil 1

3. Hydrogel for grade I and II burns

Ingredients Concentration,% Enzyme Complex A (60%) + B (40%) 20th Sodium alginate 3 Polyethylene glycol 20th Glycerol 6th Water 50 Sea buckthorn oil 1

4. Hydrogel for ulcers and sores

Ingredients Concentration,% Enzyme Complex A (20%) + B (80%) 20th Sodium alginate 3

Polyethylene glycol 20th Glycerol 5 Water 50 Sea buckthorn oil 1 Marigold tincture 1

5. Hydrogel for infected wounds

Ingredients Concentration,% Enzyme Complex A (90%) + B (10%) 30th Sodium alginate 3 Polyethylene glycol 20th Glycerol 7th Water 40

EFFICIENCY OF A MULTI-BIOGRAPHICAL COMPOSITION FOR GAMES

A randomized, controlled, single-blind, parallel-group clinical trial of multienzyme biopreparation formulations, hydrogels for wound healing, was performed. 80 patients with 2B ° skin burns to the forearms and hands were selected. Burns were treated by applying multi-enzyme biopreparation compositions - hydrogels on the wound surface, bandages with gauze bandages every day until complete epithelization of the burn wound. Patients were examined and wounds evaluated on the following days (from the day of burn): 0-3 (admission to hospital hospital); 7 (± 1); 14 (± 1); 21 (± 1). These days, the clinical features of the wound (length, width, depth, discharge, erythema, fluctuation, local wound heat, palpation / palpation, swelling / induration, necrosis, fibrin, granulation, epithelialization) and wound imaging were evaluated. Six months after the burn, an evaluation of the results was made after an active scar remodeling process. Clinical findings of multienzyme biopreparation formulations - hydrogels for wound healing:

Effectively absorbs excess exudate;

Effectively cleans the wound surface of non-viable tissues;

Effectively inhibits infection;

Maintains a moist environment in the wound;

Creates an optimal microclimate;

Prevents wounds from drying out;

There is no redness of the wound edges;

Does not cause pain between bandages;

Promotes faster wound closure;

Does not cause side effects;

No scarring occurs after treatment;

Wounds of any type and size average epithelialize within 18 days.

Concentrations of enzyme complexes A and B may vary in the composition of a multi-enzyme biopreparation for skin care and treatment of skin disorders. The concentration of enzyme complex A and B may be 0-100%.

Multi-enzyme biopreparations for skin care and treatment:

1. Lotion for frostbite / burns

Ingredients Concentration, % Enzyme Complex A (50%) + B (50%) 10th Glycerol 60 Sea buckthorn oil 5 Water 25th

2. Lotion for print

Ingredients Concentration,% Enzyme Complex A (50%) + B (50%) 10th Glycerol 60 Water 30th

3. Lotion against scars

Ingredients Concentration,% Enzyme Complex A (10%) + B (90%) 10th

Glycerol 60 Marigold tincture 5 Water 25th

Creams:

5. Skin scrub

Ingredients Concentration% Enzyme Complex A (20%) + B (80%) 5 Glycerol 4 Water 70 Polyethylene glycol 1 Sorbitan stearate 5 Sorbitan oleate 5 Coconut oil 10th

6. For dry skin

Ingredients Concentration,% Enzyme Complex B (100%) 10th Glycerol 20th Water 40 Polyethylene glycol 2 Sorbitan stearate 6th Sorbitan oleate 6th Coconut oil 10th Sea buckthorn oil 6th

7. For foot care

Ingredients Concentration,% Enzyme Complex A (20%) + B (80%) 20th Glycerol 20th Water 30th Polyethylene glycol 1.5 Sorbitan stearate 10th Sorbitan oleate 10th

Coconut oil 5 Mint oil 3.5

8. Scar removal

Ingredients Concentration,% Enzyme Complex B (100%) 30th Glycerol 20th Water 20th Polyethylene glycol 1 Sorbitan stearate 10th Sorbitan oleate 10th Coconut oil 8th Marigold tincture 1

Multi-enzyme biopreparation antibacterial composition:

1. Antibacterial spray for oral mucosa

Ingredients Concentration,% Enzyme Complex A (100%) 10th Glycerol 15th Water 70 Sea buckthorn oil 0.5 Mint oil 0.5 Marigold tincture 4

ABBREVIATIONS

B cells - blood cells, white blood cells that determine the body's humoral response.

T cells are blood cells belonging to the leukocyte agranulocyte family, one of the lymphocyte populations.

NK cells - An altered lymphocyte lacking surface-specific determinants of T and B cells.

PDGF - platelet-derived growth factor.

EGF - epidermal growth factor.

IGF-1, an insulin-like growth factor.

FGF - Fibroblast growth factor.

TGF - β - transforming growth factor - β.

TGF - a - transforming growth factor - a.

IL - 1 - Interleukin 1 family (IL - 1 family) is a group of 11 cytokines that play a key role in the processes of immune and inflammatory responses.

IFNy - interferon gamma is a dimerized soluble cytokine. bFGF is a major growth factor for fibroblasts.

KGF - keratinocyte growth factor.

CTGF - connective tissue growth factor.

VEGF - vascular endothelial growth factor.

References

1. Schultz, Gregory S., et al. VVound bed preparation: A systematic approach to wound management. Vound repairand regeneration 11.s1 (2003): S1-S28.

2. Falabella, Anna F. Debridement and wound bed preparation. Dermatologic Therapy 19.6 (2006): 317-325.

3. Werner, Sabine, and Richard Grose. Regulation of wound healing by grovvth factors and cytokines. Physiological reviews 83.3 (2003): 835-870.

4. Pullen, Rupert, et al. Prospective randomized double-blind study of wound-debriding effects of collagenase and fibrinolysin / deoxyribonuclease in pressure ulcers. Age and Aging 31.2 (2002): 126-130.

5. Ramundo, Janet, and Mike Gray. Enzymatic wound debridement. Journal of VVound Ostomy & Continence Nursing 35.3 (2008): 273-280.

6. Wang, Xiao-Jing, et al. Role of TGFβ-mediated inflammation in cutaneous wound healing. Journal of Investigative Dermatology Symposium Proceedings. Vol.

11. No. 1. Nature Publishing Group, 2006.

7. Tsirogianni K.A., Moutsopoulos N.M., Moutsopoulos H.M.Vound Healing: Immunological Aspects, Injury, Int. J. Care Injured, 2006, 37S: S5 - S12.

8. Martin, Paul. VVound healing-aiming for perfect skin regeneration. Science 276.5309 (1997): 75-81.

9. Curtis, R., et al. Accuzyme (R) Papain-Urea Ointment v Collagenase Santyl (R) Ointment in the Treatment of Partial Thickness Burn VVounds: 191. Journal of Burn Care & Research 23 (2002): S136.

10. Shi, Lei, and Dennis Carson. Collagenase Santyl ointment: a selective agentfor wound debridement. Journal of Vound Sound Ostomy & Continence Nursing 36.6S (2009): S12-S16.

11. Kang, Jeehoon, et al. Activated platelet supernatant can augment angiogenic potential of human peripheral blood stem cells mobilized from bone marrow by G-CSF. Journal of Molecular and Cellular Cardiology (2014).

12. Van Meijer, M., and H. Pannekoek. Structure of plasminogen activator inhibitor 1 (PAI-1) and its function in fibrinolysis: an update. Fibrinolysis 9.5 (1995): 263-276.

Claims (17)

A multi-enzyme bio-preparation, characterized in that it comprises Enzymes produced by Streptomyces gougerotii 101 which possess proteolytic, collagenase, esterase, amylolytic, lipase, glucanase, deoxyribonuclease and lysing activities and complexes thereof. 2. The multi-enzyme biopreparation of claim 1, wherein the culture medium comprises enzymes produced by Streptomyces gougerotii 101 according to one of the inducers consisting of yeast (enzyme complex A) or collagen (enzyme complex B). 3. A multi-enzyme biopreparation according to claim 2, characterized in that the culture medium consists of different concentrations of inducers. A multi-enzyme biopreparation according to any one of claims 1 to 3, characterized in that the preparation comprises A and B complexes together or separately. 5. A multi-enzyme biopreparation according to any one of claims 1 to 4, wherein the concentrations of the A and B complexes are from 0 to 100%. 6. A process for the preparation of a multi-enzyme biopreparation according to any one of claims 1 to 5, comprising the steps of: (a) preparation of A and B enzyme complexes; b) concentrating and fractionating the A and B enzyme complexes; c) treatment of A and B enzyme complexes with basic protein precipitating agents such as inorganic salts (e.g. NH4SO4, CaCl2), ketones (e.g. CH3COCH3), saturated aliphatic alcohols (e.g. CH3CH2OH, CH3CHOHCH3), etc .; d) chromatographic separation of complexes A and B; (e) stabilization of complexes A and B with saturated aliphatic polyhydric alcohols having a carbon skeleton of at least C3 (eg glycerol, sorbitol, polyvinyl alcohol); f) optionally mixing A and B complexes. 7. A process for the preparation of a multi-enzyme biopreparation according to claim 6, wherein the enzyme complexes A and B in step b) are concentrated by ultrafiltration or vacuum evaporation. 8. A process for preparing a multi-enzyme biopreparation according to claim 6, characterized in that the A and B enzyme complexes are fractionated by ultrafiltration using 5, 10, 15 and 50 kDa membranes. 9. A multienzyme biopreparation according to any one of claims 1 to 5, characterized in that it lyses microorganisms: Micrococcus lysodeicticus, Staphylococcus atus, Staphylococcus aureus, Streptococcus haemolyticus, Streptococcus paracitrovorum, Pseudomonas aeruginosa, Escherichiae, Escherichiae Saccharomyces cerevisiae, Candida utilis. A cosmetic or pharmaceutical composition comprising a multi-enzyme biopreparation according to any one of claims 1 to 5 and 9 and a cosmetically or pharmaceutically acceptable excipient for use in promoting wound healing and skin improvement. A cosmetic or pharmaceutical composition according to claim 10 for use in stimulating the immune system, treating different wounds, treating and treating skin and treating bacterial diseases. 12. The composition for use according to claims 10 and 11, wherein the composition with increased lipase activity is for the treatment of chronic and difficult to heal wounds. 13. The composition for use according to claims 10 and 11, wherein the composition with increased lysing and glucanase activity is for the treatment of infected wounds. 14. The composition for use according to claims 10 and 11, wherein the composition with increased proteolytic and collagenase activity is for the treatment of necrotic wounds. 15. The composition for use according to claims 10 and 11, wherein the composition with reduced enzymatic activity is for skin care and treatment of skin disorders. 16. A composition for use according to claims 10 and 11, wherein the composition is for the production of antibacterial preparations. 17. A composition for use according to any one of claims 10 to 16, wherein the composition is in the form of a liquid, ointment and hydrogel.