LT4019B - Polypeptides, dna sequences, cell, process for preparing strain cells factor, compositions, process for obtaining strain cells factor, process for preparing polymer-peptide adduct, method of transfection - Google Patents

Abstract

New factors of stem cells, oligonucleotides, for coding them and the methods of their production are found. Also, pharmaceutical compositions, including the above-mentioned factors, are discovered.

Description

This application is a continuation of application filed under registration No 573616, filed August 24, 1990, which is a continuation of application reg. No. 537198, filed June 11, 1990, which is a continuation of application reg. No. 422383, filed October 16, 1989; they are all included as footnotes in the description.

The present invention provides novel factors that stimulate primitive progenitor cells, including early hematopoietic progenitor cells, according to the DNA sequences encoding such factors. In part, the present invention relates to these novel factors, their fragments and polypeptide analogues, and sequences of DNA encoding these fragments and analogs.

Justification of the invention

The human hematopoietic system (hematopoietic system) activates a large number of white blood cells (neutrophils, macrophages, basophils, basal cells, eosinophils, T- and V-cells, red blood cells (erythrocytes) and thrombocytes (megakaryocytes, platelets).

The small amount of certain hematopoietic growth factors is thought to trigger the differentiation of a small number of 'stem cells', which are like primary blood cells, cause very rapid proliferation of these cells and result in the final differentiation of the mature blood cells of these lines. The hematopoietic regeneration system functions well under normal conditions. Meanwhile, when exposed to chemotherapy, irradiation, or natural myelodynamic lesions, there is a period in which the patient develops severe leukopenia, anemia, or thrombocytopenia.

Activation and utilization of hematopoietic factors accelerates bone marrow regeneration during this perilous period. In the presence of some viral lesions, e.g. For immune deficiency syndrome (AIDS), blood cells such as T-cells can be specifically destroyed. In such cases, enhanced T-cell production may have therapeutic activity.

Because hematopoietic factors exist in very small amounts, their detection and identification is based on a system of assays that only distinguish between different factors based on the stimulating effects that affect cultured cells under artificial conditions.

The use of recombinant genetic techniques has made it possible to understand the biological activity of individual growth factors. For example, amino acid sequences and DNA have been obtained for human erythropoietin (EPO), which stimulates the production of erythrophils (see Lin, U.S. Patent 4703008, incorporated herein by footnote). Recombinant methods have also been used to isolate complementary DNA granulocyte factor that stimulates colonies (G-CFS) (see Souza, U.S. Patent 4,810,643, incorporated herein by reference) and factor stimulating macrophage human granulocyte (GMCFS) colonies (Lee and (Proc. Nat. Acad. Sci. USA 1985, 82, pp. 4360-4364; Vong et al., Science, 1985, 228, pp. 810-814), murine granulocytic and human granulocytomacrophage-CFS (Yokota et al., Proc. Nat. Acad. Sci. USA 1984, 81, p. 1070; Fung et al., Nature, 1984, 307t, 233; Hoyhx et al., Nature, 1984, 309, vol. 763) and factor stimulating colonies on human macrophage (CFS-1) (Kavasaki et al., 1985, vol. 230, p. 291).

Cells forming colonies with high storm reproductive potential (HPPCFS) and their assay system were tested for factor effects (Zont, J. Exp. Med., 1984, 159 vol., Pp. 679-690). There are numerous reports in the literature that are active in the analysis of HPP-CFS. The sources of these factors are listed in Table 1. Below we discuss the better characterized factors.

Human spleen activity in the conditioned medium is expressed by the synergism factor (SF). Some human tissues, as well as human and mouse cell lines, produce a synergistic factor called SF-1, which interacts synergistically with CSF-1 to stimulate upstream HPP-CFS. The synergistic factor SF-1 is present in human spleen conduction cells, and is also found in human placental cells, 5637 (bladder carcinoma cell line) and EMT-6 (murine mammary carcinoma cell line). However, the identity of SF-1 cells was not established. Early reports include blocking the activity of interleukin-1 with SF-1 (Scebo et al., Blood, 1988, Vol. 71, pp. 962-968). However, recent reports have demonstrated that interleukin-1 (IL-1), in its interaction with CSF-1, cannot stimulate the formation of colonies derived from CSF-1 in combination with partially purified conditioning medium 5637 (MacNiec. Blood, 1989, 731). , 919 psi.).

The synergistic factor present in the uterus of the fertilized mouse is CSF-1. A synergistic factor is produced by VVEHL-3 cells (a murine myelomonocytic leukemia cell line) which appears to be identical to interleukin-3. Like CSF-1, IL-1 is also stimulated by hematopoietic precursors that are more mature than the SF-1 target.

It has been shown that TC-ί cells (stromal cells derived from bone marrow) contain another class of synergistic factor in the conditioning medium. This cell line produces a factor that stimulates early myeloid type as well as lymphoid type cells. It has been named Blood Lymph Factor Growth Factor-1 (HLG-1). It has a molecular weight of 120000 (MakNies et al., Exp. Hematol. 1988, 161, 383 psi.).

From known interleukins and CSF factors, IL-1, IL-3 and CSF-1 were found to have activity in the analysis of HPP-CSF. Other sources of synergistic activity are mentioned in Table I and not structurally identified. Based on the polypeptide sequence and biological activity profile, the invention provides a molecule that differs from IL-1, IL-3, CSF-1 and SF-1.

Table I

Source ¹

Conditioning medium for human spleen (CM)

Mouse Spleen CM

Rat spleen CM

Mouse Lung CM

Human Placental CM

Fertile Mouse CM

GTC-C CM

RH3 CM

PHA PBL

VVEHL-3B CM

EMT-6 CM

Footnote

Kriegler, Blood, 31888860, 503 (1982).

Bradley, Exp.Hematol.Today, Baum, 285 (1980) Bradley, supra, (1980).

Bradley, supra, (1980)

Kriegler, supra (1982)

Bradley, supra, (1980)

Bradley, supra, (1980)

Bradley, supra, (1980)

Bradley, supra, (1980)

McNience, Cell Biol. Int. Rep. 6,243 (1982).

McNience, Exp. Hematol., 15,854 (1987).

CML-Cells 5637 CM TC-1 CM

Kriegler, Exp. Hematol., 12,844 (1984) Stanley, Cell, 45, 667 (1986).

Song, Blood, 66, 273, (1985) ¹ CM - Conditioning medium

When administered parenterally, proteins are often (rapidly) cleared from the circulation and may therefore exhibit a relatively short period of pharmacological activity. As a result, frequent injections and correspondingly high doses of bioactive proteins may be required to maintain the therapeutic effect. Proteins known to be covalently modified to bind water-soluble polymers such as polyethylene glycol, polyethylene glycol polypropylene glycol polymers, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone or polyproline have a correspondingly high others, Enzymes and Drugs, edited by CHolcenberg et al., VileyInterscience, New York, pp. 367-383 (1981), Nevvmark et al., V.Appl. Biochem., 1982, 4, pp. 185-189; et al., Proc. Natl. Acad. Sci. 5A, 1987, 84 vol., pp. 1487-1491). In addition, such modifications can increase the solubility of proteins in aqueous solutions, prevent aggregation, enhance the physical and chemical stability of the protein, and significantly reduce the immunogenicity and antigenicity of the protein. As a result, the desired biological activity can be achieved by administering to the living organism such polymer-protein adducts less frequently or at lower doses than unmodified proteins.

Protein binding of polyethylene glycol (PEG) is particularly advantageous because PEG has very low mammalian toxicity (Karpenter et al., Toxicol., Appl. Farmacol. 1971, 18 vol., Pp. 35-40). For example, in the US, the use of polyethylene glycol and adenosine deaminase adduct is permitted in the treatment of human severe combined immunodeficiency syndrome. Another advantage achieved by PEG conjugation is that it effectively reduces the immunogenicity and antigenicity of heterologous proteins. For example, polyethylene glycol adduct with human protein may be useful in treating other types of mammalian disease without fear of immune response effects.

Polymers such as PEG can be conveniently attached to one or more reactive amino acid residues of the protein, such as the amino-terminal amino acids of the alpha amino group, the lysine chains of the epselon-amino group, the cysteine side chains of the sulfhydryl group, the aspartyl and glutamyl side chains. , an alpha-carboxylic group of a carboxy-terminal amino acid, a tyrosine side chain or an activated glycosyl chain attached to some residues of asparagine, serine or threonine.

Numerous forms of PEG-activated forms suitable for interaction with proteins have been described. Useful polyethylene glycol reagents for reaction with protein amino groups include active carbonic acid esters or carbonate derivatives, especially those in which the cleavable group is N-hydroxysuccinimide, para-nitrophenol, imidazole or 1-hydroxy-2-nitrobenzene-4sulfonate. Polyethylene glycol derivatives having maleimido or haloacetyl groups are useful reagents for the modification of sulfihydryl groups which are not protein-bound. Similarly, polyethylene glycol reagents having amino, hydrazino or hydrazide groups are useful in interaction with aldehydes formed in proteins by the action of hydrocarbon residues on periodate.

It is an object of the present invention to provide a factor that causes growth of early primary hematopoietic cells.

Summary of the Invention

The present invention provides novel factors, herein called "stem cell factors" (CSFs), which have the property of stimulating the growth of primitive primates, including early hematopoietic cells. These factors can also stimulate non-hematopoietic stem cells, such as neural stem cells and germinal stem cells. In addition, the present invention is directed to non-naturally occurring polypeptides that have a sufficient overlapping amino acid sequence relative to naturally occurring stem cell factor.

The present invention also provides an isolated DNA sequence used for the isolation of expression prokaryotic or eukaryotic host cell polypeptide products having amino acid sequences sufficiently similar to the natural stem cell factor sequence to provide sufficient hematopoietic biological activity of the naturally occurring stem cell factor. Such DNA sequences include:

a) the DNA sequences or their complementary strands shown in Figures 14B, 14C, 15B, 15C, 42 and 44;

(b) DNA sequences which have been hybridized to the sequences specified in (a) or fragments thereof;

(c) DNA sequences other than those of the genetic code that may hybridize to the DNA sequences in (a) and (b).

In addition, vectors containing such DNA sequences are formed and host cells transformed or transfected with such vectors. The present invention also encompasses methods of obtaining CSF using recombinant techniques and methods for treating lesions. Additionally, pharmaceutical compositions comprising CSF and antibody-specific binding to CSF are provided.

The invention also encompasses an effective method for isolating stem cells from a material containing CSF, the method further comprising the step of ion exchange, chromogenic separation and / or isolation by liquid chromatography.

The present invention provides a biologically active adduct having an extended cleavage period and increased potency in mammals, including CSF, covalently linked to a water-soluble polymer such as polyethylene glycol and polypropylene glycol, wherein said polymer is unsubstituted or substituted at one end of an alkyl group. In another aspect of the present invention there is provided a process for the preparation of the adduct described above comprising interaction of CSF with a water-soluble polymer having at least one terminal reaction group and purification of the resultant adduct to obtain a product with extended circulation time and increased biological activity.

Brief description of the figures

Figure 1 - Purification of mammalian CSF by anion chromatography.

Figure 2 - Purification of mammalian CSF by gel filtration chromatography

Figure 3 - Chromatogram of purification of mammalian CSF agglutinin (from sprouted wheat) on an agarose column

Figure 4 - Purification of mammalian CSF by cationic chromatography

Fig.5 - C ₄ chromatogram for purification of mammalian CSF

Fig.6- C ₄ fraction from a 5 shows electrophoresis (SDS) -poliakrilamidiniame gel (SDS-PAGE) with natriododecilsulfatu

Fig.7 - Analytical C ₄ chromatography of mammalian CSF C ₄

Figure 8 - C ₄ fractions by SDS-PAGE

Fig.9 - Purified mammalian CSF and deglycosylated mammal. CSF SDS-PAGE

Figure 10 - Analytical chromatography of purified mammalian CSF C ₄

Figure 11 shows the amino acid sequence of a mammalian CSF factor derived from a protein sequence.

FIG. 12 - Shown: A. Oligonucleotides complementary DNA of rat stem cell factor. B. Oligonucleotides in human stem cell factor DNA.

C. Universal Oligonucleotides

Figure 13 - Shown: A. Polymerase Cycle Reaction (PCR) Enhancement Scheme for Rat Factor (CSF) Complementary DNA. B. Polymerase Cycle Reaction (PCR) Enhancement Scheme for Human Factor (CSF) Complementary DNA.

Fig. 14 - Shown: A. Rat genomic DNA sequence search strategy. B. Nucleic acid sequence in rat genomic DNA. C. Nucleic acid sequence and amino acid sequence of complementary DNA of rat factor SCF in rat protein SCF.

FIG. 15 - Shown: A. Sequence search strategy for human genomic DNA. B. Nucleic acid sequence in human genomic DNA. C. Composition of the human factor CSF complementary DNA nucleic acid sequence and the human protein CSF amino acid sequence.

Figure 16 shows a comparison of the amino acid sequence of human, monkey, dog, mouse, and rat SCF protein.

Fig. 17 shows the SCF structure of a mammalian cell expression vector V19.8.

Figure 18 shows the structure of the mammalian CHO cell expression vector pDSVE.

FIG. 19 shows the structure of the E.coli expression vector pCFM 1156.

Figure 20 - Shown: A. Data for radioimmunoassay of mammalian SCF. B. SDS-PAGE of Immunoprecipitated Mammalian CSF.

Figure 21 - Western blot analysis of human recombinant CSF.

Figure 22 - Western blot analysis of rat recombinant CSF.

Figure 23 is a diagram showing the action of a rat COS-1 cell-produced recombinant SCF factor in bone marrow transplantation.

Fig. 24 shows the effect of recombinant rat CSF in the treatment of Styl mouse macrocytic anemia.

Figure 25 shows the number of peripheral white blood cell (WEC) -style mice treated with rat recombinant CSF.

Figure 26 shows platelet counts of Styl mice treated with rat recombinant CSF.

Figure 27 shows the differentiation number of Stile mice (WEC) treated with rat recombinant SCF ¹ ' ¹⁶⁴ PEG 25.

Figure 28 shows a set of Styl mouse lymphocytes treated with rat recombinant SCF ¹ ' ¹⁶⁴ PEG 25.

Figure 29 shows the effect of treatment of simple primates with recombinant CSF sequence with increasing number of peripheral WECs.

Figure 30 shows the effect of treatment of simple primates with recombinant CSF sequence with increased hematocrit and platelet count.

Figure 31 - Photographs: A. human bone marrow colonies stimulated with human recombinant SCF ¹ ' ¹⁶² . B. Rait-Gemz stained cells from colony Figs. 31A.

Figure 32 shows the SDS-PAGE fraction from the column with S-Sepharose from the chromatogram of Figure 33.

Fig. 33 is a chromatogram of recombinant human SCF isolated from E.coli on a column with S-Sepharose.

Fig.34 shows data for the SDS-PAGE fraction from column C ₄ from the chromatogram shown in Fig.35: A. with reducing agent, B. without reducing agent.

Fig.35 - provides a chromatogram of recombinant human SCF isolated from E. coli column C _4th

Figure 36 is a chromatogram of rat recombinant SCF isolated from CHO on a column with Q-Sepharose.

Fig.37 - provides a chromatogram of recombinant rat SCF isolated from CHO column C _4th

Fig. 38 - Data from the chromatogram of SDS-PAGE fraction from C ₄ column is shown in Fig. 37.

Fig.39 shows data for SDS-PAGE of recombinant rat SCF isolated from purified CHO before and after deglycosylation.

Fig. 40 - Shown: A. Gel filtration chromatogram of the recombinant rat pegylated SCF ¹ ' ¹⁶⁴ reaction mixture. B. Gel filtration chromatogram by recombination. rats in unmodified SCF ¹ ' ¹⁶⁴ .

Fig. 41 shows binding of labeled SCF with fresh leukemic blasts.

Figure 42 shows the complementary DNA sequence of human SCF derived from the fibrosarcoma cell line HT1080.

Figure 43 shows an autoradiogram of COS-7 cells expressing human SCF ¹ ' ²⁴⁸ and CHO cells expressing human SCF ¹¹⁶⁴ .

Figure 44 - Complementary DNA sequence of human SCF derived from bladder carcinoma cell line 5637.

Figure 45 shows an increase in the survival rate of irradiated mice after SCF treatment.

Fig.46 shows an increase in the survival rate of irradiated mice after bone marrow transplantation with 5% hip bone transplantation and treatment with SCF.

Fig.47 shows an increase in the survival rate of irradiated mice after bone marrow transplantation with 0.1 and 20% of hip bone transplantation and SCF treatment.

Many aspects and advantages of the present invention will be apparent to those skilled in the art of biochemistry upon reading the following detailed description, which shall be supplemented by illustrations of practical embodiments of the invention for the present day.

Detailed Description of the Invention

The present invention provides novel stem cell factors and DNA sequences that encode all or part of such SCF factors. As used herein, the term "stem cell factors" or SCFs are naturally occurring SCFs (e.g., human SCFs), as well as polypeptides of artificial origin (i.e., non-naturally occurring) that have amino acid sequences and glycosylation sufficiently similar to such naturally occurring stem cells. factors that determine the biological activity of the natural hematopoietic stem factor. Stem cell factor is characterized by its ability to stimulate the growth of early hematopoietic progenitors, which can mature and turn into erythroid, megakaryocyte, lymphocyte and macrophage cells. Treatment of mammals

CSF enables absolute proliferation of hematopoietic cells, both myeloid and lymphoid. One of the critical characteristics of stem cells is their ability to differentiate into myeloid and lymphoid cells (Weissman, Science, 1988, Vol. 241, p. 5862). An increase in granulocytes, monocytes, erythrocytes, lymphocytes and platelets was observed in Styl (Example 8B) mice with recombinant rat factor SCF. Exposure to simple primates for recombinant human SCF has been shown to increase myeloid and lymphoid cells (Example 8C).

Embryonic expression exists in SCF cells in migratory pathways and in chomingovian melanoblasts, germ cell hematopoietic centers, brainstem, and spinal chord.

Early primary hematopoietic cells accumulate in the mammalian bone marrow, which is affected by 5-fluorouracil (5-FU). The chemotherapeutic drug 5-FU selectively depletes subsequent hematopoietic precursors. The SCF factor is active in bone marrow after treatment with 5-FU.

The biological activity and tissue distribution profile of SCFs indicate its key role in embryogenesis and hematopoiesis as well as its potential in the treatment of various stem cell deficiencies.

The present invention provides DNA sequences that combine: activation of codons "desired" for expression in selected host mammals; providing a cleavage site when exposed to restriction endonuclease enzymes; providing additional primer, terminal, and intermediate DNA sequences that facilitate the construction of easy-to-express vectors. The present invention also provides DNA sequences that encode polypeptide analogs or secreted SCF that differ from naturally occurring forms of identity or multiple amino acid residues (e.g., deletion analogs that do not contain all residues for SCF; substitution analogs in which one or more specific residues are present). additive analogs in which one or more amino acid residues are attached to the terminal or medial portion of the polypeptide) and which possess some or all of the naturally occurring properties. The present invention is particularly applicable to DNA sequences encoding the entire length of the crude amino acid sequence as well as DNA sequences encoding the processed form of SCF.

The novel DNA sequences of the present invention include sequences useful for isolated expression in prokaryotic or eukaryotic host cells of polypeptide products having at least a portion of the parent structural conformation and one or more biological properties of the SCF of natural origin. Specifically, DNA sequences combine: a) DNA sequences shown in Figures 14B, 14C, 15B, 15C, 42 and 44, or their complementary helices; b) sequences hybridized (under hybridization conditions described in Example 3 or more stringent conditions) with the DNA sequences of Fig. 14B, 14C, 15B, 15C, 42 or 44 or fragments thereof; and c) DNA sequences which, other than degeneracy of the genetic code, can hybridize to the DNA sequences of Fig. 14B, 14C, 15B, 15C, 42 or 44. Specifically included in (b) and (c) are genomic DNA sequences encoding allelic variants of the SCF form. and / or encoding SCF from other mammalian species, and resulting DNA sequences encoding SCF, fragments of this factor, and analogs thereof. DNA sequences can activate codons that facilitate transcription and translation of information RNA in microbial hosts. Such resulting sequences can be readily constructed according to Alton et al. methods disclosed in PST WO 83/04053.

In other aspects of the present invention, the DNA sequences described herein that encode polypeptides having SCF activity are valuable because of the information they provide about the amino acid sequence of mammalian proteins that has so far been unavailable. These DNA sequences are also valuable as products useful in the large-scale synthesis of SCF with the aid of numerous recombinant methodologies. In other words, the DNA sequences of the present invention are used to work with novel and useful viral and circular DNA plasmid vectors, novel and useful transformed and transfected prokaryotic and eukaryotic host cells (including bacterial and yeast cells, and cultured mammalian cells, and cultures of such host cells suitable for expression of SCF and related products.

The DNA sequences of the present invention are also suitable for use as labeled examples in isolating human genomic DNA encoding SCF and other genes for related proteins, as well as complementary to DNA sequences and genomic DNA of other mammalian species.

DNA sequences may also be used in a variety of alternative protein synthesis pathways (e.g. insect cells) or in the context of genetic therapy in humans and other mammals. It is contemplated that the DNA sequences of the present invention may be useful in working with transgenic mammalian species that can be used as eukaryotic "hosts" for the production of SCF and its products in bulk. See also: In a joint article by Palmiter and others in the journal Science 1983. 2221, pp. 809-814.

The present invention provides isolated and purified naturally occurring SCFs (i.e., purified naturally occurring and made to have the same primary, secondary and tertiary glycosylation conformation and character as the naturally occurring material) as well as artificial polypeptides having a primary structural conformation (i.e., continuous amino acids). sequences) and glycosylation, sufficient duplicates of naturally occurring stem cell factor to exhibit naturally occurring biological activity of SCF. Such polypeptides combine derivatives and analogs.

In a particularly preferred variant of SCF, it is characterized as the product of exogenous DNA sequences produced by prokaryotic or eukaryotic host expression (e.g., in bacterial, yeast, higher plants, insect and mammalian cell cultures), obtained by cloning by genomic or complementary DNA or by genetic synthesis. That is, in the proposed SCF variant, it is characterized as recombinant SCF. Expression products in typical yeast (ass agomuse cerevisiae) or prokaryotic (e.g. E. coli) host cells are free from binding to any mammalian protein. Expression products in vertebrate (eg, mammalian, non-human (COS and CHO) and avian) cells are free from binding to any human protein. Depending on the host used, the polypeptides of the present invention may be glycosylated with mammalian carbohydrates or other eukaryotic carbohydrates, or may be non-glycosylated. The host cell may be replaced using techniques such as those described by Lii et al., J. Biol. Chem. 1989, 264 vols, 13848 pages, which is incorporated by reference. In addition, the polypeptides of the invention may include amino acid residues (at the 1-position) of the parent methionine.

In addition to allelic forms of naturally occurring SCF, the present invention also encompasses other SCF products such as peptide analogs of SCF. Such analogs activate fragments of SCF. Using the procedures of the above-mentioned Alton et al. Application (WO 83/04053), genes encoding expression of a microbial polypeptide having a primary conformation differing from the identity terms or disposition of one or more residues herein (e.g., alterations) can be readily constructed and obtained. , terminal and intermediate connections, and deletion). Alternatively, complementary DNA and genomic gene modifications can be readily accomplished by well-known techniques for locally directed mutagenesis and used for SCF degenerate analogs and derivatives. Such products participate in at least one of the biological properties of SCF, but may differ from the others. By way of example, the products of the invention may combine truncated products such as deletions or those which are more stable to hydrolysis (and thus may have more pronounced or longer-lasting effects than products of natural origin); or those substituted for removal or addition of one or more potential centers for Oglycosylation and / or N-glycosylation, or those having one or more cysteine residues removed or substituted, e.g., alanine or serine residues, and are potentially more readily released from the active form. microbial systems; or those that have one or more tyrosine residues substituted by phenylalanine and bind more easily or hardly to the target protein or receptor on the target cells. Further, the invention encompasses polypeptide fragments that duplicate only a portion of the continuous amino acid sequence or secondary SCF internal information, and these fragments may exhibit some SCF properties (e.g., receptor binding) rather than others (e.g., early hematopoietic cell growth activity). . Suffice it to mention that the activity is not necessary for any one or more of the products of the invention, but has therapeutic utility (see Weiland et al., Blood, 1982, Vol. 44, pp. 173-175), or benefits in other contexts such as SCF. antagonism analyzes. Competitive antagonists may be useful, for example, in the case of SCF overproduction or in human leukemia, where malignant cells overexpress SCF receptors, as demonstrated by SCF receptor overproduction in leukemic blasts (Ex. 13).

Useful polypeptide analogs of the invention include reports of immune properties of synthetic peptides which substantially duplicate the amino acid sequence retained in naturally occurring proteins, glycoproteins, and nucleoproteins. More specifically, relatively low molecular weight polypeptides have been shown to be involved in immune responses to physiologically relevant proteins such as viral antigens, polypeptide hormones, and 1.1. In such immune responses, polypeptides include: provocation of specific antibodies in immunologically active animals [(Lerner et al., Cell, 23, 309-310 (1981); Ross et al., Nature, 294, 654-656 (1981); Walter et al., 1981). Proc. Natl.Acad. Sci. USA, 77, 5197-5200 (1980); Lerner et al., Proc. Natl.Acad. Sci. USA, 78, 4882-4886 (1981); Wong et al. Proc. Natl.Acad. Sci. USA, 79, 5322-5326 (1982); Baron et al., Cell, 28, 395-404 (1982); Dressman et al., Nature, 295, 185-160 (1982). Lerner, Sci.Amer., 248, 66-74 (1983). See also Kaiser et al., Sci. 223, 249-255 (1984)] for reactive synthetic proteins that closely replicate the secondary structure of peptide hormones, but cannot replicate their original structural conformation, biological and immunological properties.

The present invention further encompasses a class of polypeptides encoded by DNA fragments complementary to the protein-coding helix of human k-RNA or genomic DNA SCF sequences, i.e. "Complementarily inverted proteins" as described (Tramontano et al., Nuc.Acid Res., 1984, 121, pp. 5049-5059).

SCF polypeptides of the present invention include, but are not limited to, SCF factors: 1148, 1-162, 1-164, 1-165, 1-183 (Fig. 15C); 1-185, 1-188, 1-189, and 1-248 (Fig.42); and 1-157, 1-160, 1-161, and 1-220 (Fig.44).

The SCF factor can be purified using techniques known to those skilled in the art of biochemistry. The subject matter combines methods of purifying SCF from plasma containing SCF material, such as condition media or human urine, including one or more steps such as: purification of SCF-containing materials by ion-exchange chromatography (cationic or anionic chromatography) ; purification of SCF-containing materials by liquid chromatography using C4 or C6 immobilizing resins; purification by liquid chromatography using an immobilizing saucer, i.e. SCF binds to the immobilizing spindle and elutes using sugars that are competitors for such "binding". Details of the use of these methods will be apparent from the description of SCF purification in Examples 1, 10 and 11. The methodologies described in Ex. U.S. Patent 4,667,016 to Lay et al., Incorporated herein by reference, is also used to purify the stem cell factor.

SCF isoforms are isolated using standard procedures such as those set forth in U.S. Reg. No. 421444 October 13, 1989, entitled "Erythrodaric Isoforms" (co-management), incorporated herein by footnote.

The present invention also provides pharmaceutical compositions comprising therapeutically effective amounts of polypeptide products, together with appropriate solvents, preservatives, soluble additives, emulsifiers, promoters and / or carriers for use in SCF therapy. As used herein, the term "therapeutically effective amount" is an amount that provides a therapeutic effect in a particular condition and mode of administration. Such compositions are in liquid or lyophilized form or otherwise dried by formulation and include solvents with different contents of buffers (e.g. Tris-HCl, acetate, phosphate), pH and ionic regulators such as albumin or gelatin to prevent surface adsorption. ), detergents (e.g. Tween-20, Tween-80, Pluronic F68, gastric acid salts), solubilizing agents (e.g. glycerol, polyethylene glycol), antioxidants (e.g. ascorbic acid, sodium metabsulfite), preservatives (e.g. , thiomersal, benzyl alcohol, parabenzene), volumetric substances or concentration modifiers (e.g. lactose, mannitol), complexation of polymers such as polyethylene glycol covalently bonded to proteins (described below in Example 12), or introduction of the preparation into metal ions. / or in granular formulations of polymeric materials such as lactic acid, polyglycolic acid, hydrogels, etc., or liposomes, roemulsions, micelles, monolayer or multilayer carriers, erythrocyte shadows, or spheroplasts. Such compositions may affect the physical state, solubility, degree of stability in the living organism, and degree of SCF in the living body. The choice of composition will depend on the physical and chemical properties of the proteins having SCF activity. For example, a product derived from a membrane-bound form of SCF may require a formulation containing detergents. Formulations with controlled or constant release have a formulation of lipophilic forms (e.g., fatty acids, waxes, oils). The invention also encompasses granular compositions coated with polymers (e.g., poloxamers or poloxamines) and SCF bound to antibodies directed against tissue specific receptors, ligands or antigens, or bound to ligands at tissue specific receptors. Other embodiments of the invention include granular forms, protective sheaths, protease inhibitors or penetration enhancers for a variety of routes of administration including parenteral, respiratory, nasal or oral.

The invention also encompasses one or more additional hematopoietic factors such as EPO, G-CSF, GM-SCF, CSF-1, IL-1, IL-2, IL-3, IL-5, IL-6, IL-7 , IL-8, IL-9, IL-10, IL-11, IGF-1 or LIF (leukemia inhibition factor).

The polypeptides of the present invention may be "labeled" for incorporation with a detectable labeled material (e.g., with a radioactive labeled iodine-125 or biotinylation) to provide reagents suitable for detection and quantification of SCF or its receptor-containing cells in solid tissues and liquid samples. such as blood or urine.

Biotinylated SCF is used in combination with immobilized streptavidin to "flush" leukemic blasts from bone marrow in autologous bone marrow transplantation. Toxic conjugates of SCF such as ricin (Ur, Prog Clin.Biol.Res. 1989, 288 vols., Pages 403-412), diphtheria toxin (Moolten.J. Natl. Con. Inst. 1975, 55t. 473). -477) and radioisotopes are used in anti-neoplastic therapy (eg 13) or in the conditioning of bone marrow transplantation.

The nucleic acid products of the invention are useful when tagged (such as radio-labels and non-isotopic tags such as biotin) and used in the hybridization process, for locating the human SCF factor gene and / or locating any cognate gene on a chromosomal map. They are also used in the detection of human SCF gene lesions at the genetic level and used as genetic markers to identify neighboring genes and identify their lesions. The human SCF gene is encoded on chromosome 12 and the mouse SCF on chromosome 10 maps in environment 1.

SCF is used alone or in combination with other therapies to treat a number of hematopoietic lesions. SCF can be used to treat one or more of the hematopoietic factors, such as EPO, G-CSF, GM-SCF, CSF-1, IL-1-IL-11, IGF-1 or IIF.

There is a group of stem cell lesions that are characterized by a decrease in functional bone marrow mass caused by toxic, radiation or immunological lesions and can be cured with SCF. Platelet anemia is also a stem cell injury, in which case the hematopoietic tissues are replaced by adipose and pancytopenia. SCF enhances hematopoietic proliferation and is useful in the treatment of aplastic anemia (Ex. 8B). Stils mice are used as a model for human aplastic anemia (Jons, Exp. Hematol. 1983, 111, pp. 571-580). Promising results have been obtained with the use of a cytokine, GM-SCF, a related cytokine in the treatment of aplastic anemia (Antin et al., Blood, 1987, 70 vol, p. 129a). Paroxysmal Noctural Hemoglobinuria (PNG) is a stem cell injury characterized by the formation of defective platelets and granulocytes as well as abnormal red blood cells.

There are many diseases that can be cured by the SCF factor. These include: myelofibrosis, myelosclerosis, osteopetriosis, metastatic carcinoma, acute leukemia, multiple myeloma, Chodgkins disease, lymphoma, Gaucher disease, Niemann-Pick disease, Letterere-Sivo disease, refractory erythroblastic anemia, G sarcoidosis, primary splenic pancytopenia, miliary tuberculosis, fungal rashes, fulminant senticemia, malaria, vitamin B ₁₂ and folic acid deficiency, pyridoxine deficiency, Daimond Blakfan anemia, hypopigmental disorders such as piebaldism. The erythroid, megakaryocytic and granulocytic stimulating properties of SCF are illustrated in Figures 8B and 8C.

Hematopoietic stem cells, such as first germ cells, melanocytes developed from the nerve scar, commissural axons developed from the dorsal dorsal chord, crypt cells from normal mesonephritic and methanephritic hepatic ducts, and enhancement of enveloped growth at these sites improve their condition. SCF is used to treat neurological lesions and is a growth factor for nerve cells. SCF is used in non-body fertilization techniques and in infertility cases. SCF is useful in treating intestinal lesions caused by radiation or chemotherapy.

There are myeloproliferative stem cell lesions, such as polycythaemia, chronic myelogenous leukemia, myeloid mataplasia, primary thrombocythaemia, and acute leukemia, which can be treated with SCF, anti-SCF antibodies, or SCF-toxin conjugates.

There have been many cases of increased leukemic cell proliferation following exposure to hematopoietic cell growth factors G-SCF, GM-SCF and IL-3 (Deivei et al., 1988, Vol. 72, pp. 1944-1949). Because the success of many chemotherapeutic agents depends on the neoplastic cells being much more active in the developmental cycle than normal cells, SCF, as such or in combination with other factors, acts as a growth factor for neoplastic cells and increases their susceptibility to the toxic effects of chemotherapeutic agents. The increased expression of SCF receptors in leukemia blasts is shown in Example 13.

A series of recombinant hematopoietic factors have been investigated to determine their ability to reduce critical leukocyte depletion due to chemotherapy and radiation chemotherapy. While these factors are useful enough in this environment, there is an early hematopoietic detachment that is damaged in particular by radiation, and must be restarted before these later growth factors will return to optimal functioning. The use of SCF alone or in combination with these factors further reduces or eliminates the critical reduction in leukocytes and platelets caused by chemotherapy or radiation. In addition, SCF enables the dose to be increased in antineoplastic or illumination mode (Ex. 19).

SCF is useful for the expansion of early hematopoietic precursors in singenic, allogeneic, or anthologic bone marrow transplantation. The use of hematopoietic growth factors has been shown to prolong neutrophil tissue repair after transplantation (Donahvvu et al., 1986, 321 vol., 872-875 and Velt et al., J.Exp.Med. 1987, 165 vol. 941 Page -948). For bone marrow transplantation, the following three scenarios, alone or in combination, are used: (a) the donor is treated with a single SCF or with other hematopoietic factors prior to bone marrow extraction or peripheral blood leukapherosis to increase the number of cells suitable for transplantation; (b) the bone marrow is treated outside the body to activate it or to increase the number of cells before transplantation; and (c) the recipient is treated to enhance donor bone marrow acceptance.

The SCF factor is used in the genetic therapy of hematopoietic stem cells to enhance transfection (or infection with a retroviral vector). SCF can cultivate and multiply early hematopoietic progenitor cells suitable for transfection. The culture can be done with one SCF or with IL-6, IL-3, or both. Following transfection, these cells are harvested into bone marrow grafts in patients affected by genetic damage (Lim, Prs, Nali, Acad. Sci. 1989, 86, pp. 8892-8896). The genes used to treat genetic lesions are: adenosine deaminase, glycocerebrosidase, hemoglobin, and cystic fibrosis.

SCF is used in the treatment of immunodeficiency (AIDS) or severe combination conditions as such or in combination with other factors such as IL-7 (see Example 14). An illustration of this effect is the ability of SCF therapy to increase absolute levels of circulating lymphocyte T-helper (CD4, OKT4). These cells are the first cellular targets of the human immunodeficiency virus (HIV) leading to immunodeficiency patients with AIDS (Montanier, Nima T-Ceff Leukemia a / Lumphoma virus, ed. Galio, Cold spring harbor, Nevv Yor, 1984, pp. 369-370). ). In addition, SCF is used as an antidote to the myelosuppressive action of anti-HIV medications such as azidothymidine (AZD) (Gogi, Life Sci. 1989, 451, No. 4).

SCF is used to enhance hematopoiesis recovery after severe bleeding.

Treatment of a living organism with SCF is used as a reimmunization of the immune system in the fight against neoplasia (cancer). An example of a therapeutic benefit of direct enhancement of immune function with a recently cloned cytokine (IL-2) is described (Rosenberg et al., N.Eng.J.Med., 1987, 3131, 1485).

Administration of SCF with other agents, such as one or more hematopoietic factors, is effected gradually or immediately. Pre-treatment with SCF increases the amount of precursors which enables a terminal acting factor such as C-CSF or EPO. The route of administration may be intravenous, intraperitoneal, subcutaneous or intramuscular.

The present invention also encompasses antibody-specific stem cell factor binding. Below 7 e.g. describes the production of polyclonal antibodies. A further embodiment of the invention are monoclonal antibodies that specifically bind to SCF (see Example 20). Unlike traditional (polyclonal) antibody preparations, which typically include various antibodies directed against various determinants (epitopes), each monoclonal antibody is directed against a single determinant antigen. Monoclonal antibodies are used to improve the selection and specificity of diagnostic and analytical methods using antigen-antibody binding. In addition, they are used for neutralization or removal of SCF from plasma. A second advantage of monoclonal antibodies is that they can be synthesized using hybrid cells in culture not contaminated with other immunoglobulins. Monoclonal antibodies can be prepared from cultured hybridoma cell pellet fluid or from ascites induced by mouse hybridoma cell inoculum. This hybridoma technique is described in particular by Keller and Milstein (Eug.J.lmmun. 1976, Vol. 6, pp. 511-519), and has been used extensively for the production of hybrid cell lines that express high concentrations of antibodies to a number of specific antigens.

The following examples are intended to illustrate the invention in greater detail, but are not intended to limit the scope of the invention.

example.

Purification / Characterization of Stem Cells Derived from Buffalo Rat Liver Cell Conditioning Medium.

A. Non-biological tests.

1. HPP-SCF Test

There are many biological activities that can be attributed to the natural rat SCF factor as well as to the recombinant rat protein SCF. One such activity is its effect on early haematopoietic cells. This activity can be measured by assaying cells that form colonies with high proliferation potential (HPP-SCF) (Scebo et al., Supra, 1988). Mouse bone marrow taken from animals two days after treatment with 5-fluorouracil (5-FU) was used to investigate the effects of factor in early hematopoietic cells in the HPP-SCF system. The chemotherapeutic drug 5-FU selectively diminishes the subsequent precursors of hematopoiesis, leading to the detection of early precursor cells and factors that are involved in the activity of such cells. Rats are loaded with SCF on semi-solid agarized cultures in the presence of CF-1 or IL-6. Agarized cultures contain complete MakKois medium (D1BCO), 30% bovine serum, 0.3% agar and 2.10 ⁵ / ml bone marrow cells. Complete MakKois medium consists of: 1xMakKois medium supplemented with 0.1 mM pyruvate, 0.24x essential amino acids, 0.24x optional amino acids, 0.027% sodium bicarbonate, 0.24x vitamins, 0.72 mM glutamine, 25 pg / ml serine and 12 pg / ml L-asparagine . Bone marrow cells were obtained from Balb / c mice injected with 150 mg / kg 5-fluorouracil. Bones were removed 2 days after treatment with 5-FU and the bone marrow was washed out. The red blood cells were lysed with red blood cell lysis reagent (Bekton Dikenson) prior to plating. The test substance was placed in 30 mm plates with a viscous mixture. After 14 days, he counted colonies (> 1 mm in diameter) containing thousands of cells. This assay was used to purify a natural, mammalian, rat SCF factor.

In a typical assay, rat SCF induces proliferation of approximately 50 HPPCSF / 200000 cells. Rat SCF exhibits synergistic activity on murine bone marrow cells treated with 5-FU; HPP-SCF colonies were unable to form in the presence of single factors but had activity along with SCF and SCF-1 and IL-6 in this assay.

2. MC / 9 Study

Another beneficial biological activity of SCF in both naturally occurring and recombinant rats is the ability to induce the proliferation of a murine fetal cell line dependent on IL4, MC / 9 (ATCC CRL 8306). MC / 9 cells were cultured with an IL-4 source, according to protocol ATCC CRL 8306. The medium used in this bioassay was RPML 1640, 4% bovine serum, 5.10 ' ⁵ mol / L 2-mercaptoethanol, and 1x glutamine penstrap. MC / 9 cells multiplied rapidly upon exposure to SCG without the need for other growth factors. This proliferation is measured first by culturing the cells for 24 hours. growth factor-free, followed by 5,000 cells in each of 96 wells and cultured with the test sample for 48 hours with shaking for 4 hours. with 0.5 ³ H-thymidine (relative activity 20 kuri / mmol). The solution was then spilled onto a glass fiber filter and the specific radioactivity was then measured. This assay was used to purify rat SCF derived from mammalian cells after the ACA 54 gel filtration step, cf. see section 2 of this example. Typically, SCFs cause 4-10 fold increase in CPM over background.

3. CFU-GM

The activity of mammalian purified SCF, both naturally occurring and recombinant, independently of interfering factor colony stimulating agents (CSFs) was assessed in normal unexcavated mouse bone marrow. CFU-GM was used to test SCF activity on normal bone marrow (Broksmeer et al., Exp. Hemat. 5 vol. 1977, p. 87). Briefly, total bone marrow cell content after lysis of red blood cells is plated on a semi-solid agarized culture containing the test substance. After 10 days, counts of colonies containing more than 40 cells were counted. Agarized cultures can be dried on glass slides, and cell morphology can be determined with specific histological staining.

In normal mouse bone marrow, purified mammalian SCF was a highly potent SCF, stimulating the growth of colonies containing immature cells, neutrophils, macrophages, eosinophils, and megakaryocytes, without requiring other factors. Out of 200 thousand more than 100 such colonies grow within 10 days. As in rat, recombinant human SCF stimulates the production of erythroid cells in combination with EPO; 9 example

B. Conditioning medium

Buffalo rats (BRI), from American-type cultures (ATCC CRI 1442), cultured liver cells for SCF production on microparticles in a 20-liter perfused culture system. The system used a Biolafit (Model 1CC-20) fermenter, except for the nets, which were used to retain the microfluidic acid and the tubes for acidification. Nets with a pore diameter of 75 µm were protected from clogging by the microfluidic system by periodic flushing through a system of adjustable valves and pumps controlled by the ESM. Each network functions as a nutrient medium and as a harvesting site. This property of oscillating current enables the network to work without clogging. Acidification was effected through silicone hoses (50 ft / 15.4 m long, 0.25 d / 6.3 mm internal diameter, 0.03 d / 0.76 mm wall thickness). The culture medium used for the cultivation of ERL 3A cells consisted of minimal medium (Erlz, F. Gibko salts), 2 mmol glutamine, 3 g / L glucose, 2.95 g / L tryptose phosphate, 5% bovine serum and 5% calf serum. The final medium was the same except for sera. The reactor contained 2 Citodex (Pharmacia) micronutrients at a concentration of 5 g / L and was charged with 3.10 ⁹ cells of ERL 3A inoculum grown in shake vials and isolated by trypsinization. These cells were allowed to bind to microcarriers and grow on them for 8 days. The growth medium was perfused through the reactor according to glucose requirements. Glucose concentration was maintained at 1.5 g / l. After 2 days, the reactor was perfused with six volumes of serum-free medium to remove most of the serum (protein concentration less than 50 mg / ml). The reactor was then operated in an integrated mode until the glucose concentration dropped to 2 g / l. From this point on, the reactor was operating at a constant perfusion rate of about 10 l / day. The pH was maintained at 6.9 ± 0.3 by adjusting the carbon dioxide supply. Dissolved oxygen concentration was maintained at 20% higher than air saturation as pure oxygen was supplied as needed. The temperature was maintained at 37 ± 0.5 ° C.

Such a designated system generates approximately 336 I of serum-free medium and uses it as a raw material for natural mammalian cell derived rat SCF.

B. Cleaning

All cleaning operations are performed at 4 ° C unless otherwise stated.

1. Anion chromatography on DEAE cellulose

Conditioning media generated by culturing BRI 3A cells and serum free are clarified by filtration through 0.45 pm Sartocapsules (Sartorius company). Several different batches (41 I, 27 I, 39 I, 30.2 I, 37.5 I and 161 I) are individually concentrated, diafiltered / buffer exchange and subjected to ion exchange chromatography on DEAE-cellulose in the same manner for all batches. The DEAE-cellulose batches are then combined and further processed as a single sample, such as B2-5. 41 I treatment is described for illustration. The filtered conditioning medium is concentrated to 700 L using a tangential current ultrafiltration unit (Millipor Pellicon) with 4 cartridges with a polysulfonic (10,000 molecular weight) membrane. Total membrane area is -20 square feet (1.8 m ² ), flow rate is 1095 ml / min and filtration rate is 250-315 ml / min. Diafitration / buffer exchange was then performed on an anion exchange chromatography apparatus by adding 500 ml buffer (50 mmol / l) Tris-HCl pH-7.8 to the concentrate. Concentrate the solution to 500 ml using a tangential stream ultrafiltration apparatus and repeat this procedure 6 more times. The final concentrated / diafiltered preparation yields a volume of 700 ml. This preparation was run through an anion exchange column with DEAE-cellulose (5x20.4 cm; DE-52 resin, Batman), equilibrated in 50 mM Tris-HCl buffer pH 7.8. After the sample is applied to the column, the column is washed with 2050 ml Tris-HCl buffer and a salt gradient (0-300 mmol / l sodium chloride in Tris-HCl buffer, total volume 4I) is introduced. Fractions are taken at 15 ml at a flow rate of 167 ml / h. The chromatogram is shown in Fig.1. The number of columns corresponds to the biological activity in the HPP-CCF assay. Investigate 100 μΙ of the specified fractions. In this Figure 1. unfractionated fractions taken by column loading and flushed fraction. They had no biological activity.

The post-concentration, diafiltration / buffer exchange, and anion exchange chromatographic characteristics of all batches of conditioned media were identical. Protein concentrations in these batches were determined according to the Bradford method (Apl. Bioch. 1976, 72 vol., Pages 248-254) with bovine serum protein as a standard and ranged from 30 to 50 µg / ml. The total volume of the conditioning medium used for this preparation was about 336 μ \.

2. Gel-filtration chromatography ACA 54

Fractions containing the biological activity according to the method used on the DEAE-cellulose column are pooled. For each of the six batches of conditioning media discussed above (e.g., fraction 87-1114 in Figure 1) and concentrated to a total volume of 74 mL using agitated Amikon cuvettes and membranes in UM 10. This material is fed onto a gel filtration ACA. 54 (EKB) columns (Fig.2) were equilibrated with Tris-HCl buffer (50mmol / l), 50mmol / l sodium chloride at pH 7.4. Fractions are taken at 14 ml at a flow rate of 70 ml / h. Due to the elution of inhibitory factors with the active fractions, the peak of activity (HPP-CSF colony count) becomes cleaved. However, according to previous chromatograms, the activity of the bulk eluates correlates with the major protein peak and therefore these fractions are pooled.

3. Chromatography on agglutinin (from sprouted wheat-agarose.

Fractions 70-112 from the ACA 54 gel filtration column were pooled (500ml). The resulting mixture was split in half using an agglutinin (sprouted wheat) -agarose column (5x24.5cm; resin from EU Labaratoris, San-Mateo, California) (sprouted wheat agglutinin has the appropriate carbohydrate structure) made up to 20 mmol / L Tris-HCL buffer, 500 mmol / l sodium chloride at pH 7.4. After sample application, the column is washed with approximately 2200 mL of column buffer, followed by elution of the bound material with a solution of N-acetyl-D-glucosamine 350mmol / L in column buffer starting at fraction 210 (Fig.3). Add fractions of 13.25 ml at a flow rate of 122 ml / h. The results of one chromatographic test are shown in Fig.3. Fractions of the fractions that were assayed were dialyzed in saline with phosphate buffer. Dialysis agents (5 μΙ) are assayed in MC / ((Fig.3 pulses per min CPM value) and 10 μΙ in HPP-SCF assay (Fig.3 shows colony count). The active substance can be seen to bind to the column and elute with Nacetyl -D-glucosamine, while most of the impurities are passed through the column by sampling and rinsing.

4. High-speed cation exchange chromatography on S-Sepharose

Fractions 211-225 from agglutinin (from sprouted wheat) -agarose chromatography shown in Fig. 3 and equivalent fractions from the second experiment were pooled (375ml) and dialyzed in 25 mM sodium formate pH 4.2. Dialysis was carried out for 8 hours to reduce the duration of action of this acidic solution. At the end of this dialysis period, the volume of the sample was 480 mL at pH and sample permeability close to the dialysis buffer. During dialysis, a precipitate appears in the sample. They are removed by centrifugation for 30 min. 22000x9.8 m ² / sec. After centrifugation, the supernatant is applied to a high-speed column with S-Sepharose (3.3x10.25cm, resin fimos Pharmacia), which is added with sodium phosphate buffer. At a flow rate of 465 ml / h, take 14.2 ml fractions. After the sample is applied, the column is washed with 240 ml column buffer and eluted with a gradient of 0-750 mmol / l sodium chloride (sodium chloride dissolved in column buffer; total gradient volume 2200 ml) starting from fraction 45, elution profile is shown in Fig.4. Add 200 μΙ Tris (0.97 mol / l) to the collected fractions at pH 7-7.4. Number of pulses per minute (CPM) is also shown by the result obtained in the biological test MC / 9. Portions of the indicated fractions are dialyzed in saline with phosphate-buffered saline and 20 μΙ of the sample is given for testing. It can be seen from Fig.4 that most of the biologically active material passes through the column unbound. In contrast, most impurities bind and elute with a salt gradient.

5. Chromatography on hydrocarbon resins bound to silica gel

Fractions 4-40 from the column are combined with S-Sepharose (Fig. 4) to give 540 ml of the mixture. 450 ml of this mixture, with the same amount of buffer (25% ammonium acetate / 100 mmol / l / + 75% isopropyl alcohol), is flushed through a C4 column (Vidac Proteis C4; 2.4x2 cm) at 540 ml / h which is fed with buffer A (62.5% Ammonium acetate (60 mmol / l + 37.5% isopropanol). After sampling, the flow rate is reduced to 154 ml / h and the column is flushed with 200 ml of buffer A followed by a linear gradient from buffer A to buffer B (total volume 140). ml) and collect fractions of 9.1 ml Portions of the mixture obtained after the S-Sepharose column, Sample C4, bring the final mixture and the elution mixture to 40 pg / ml of bovine serum protein by adding the appropriate volumes of 1 mg / ml crude solution and Similarly, aliquots of gradient fractions of 40 μΙ are combined with 360 μΙ of phosphate buffered saline containing 16 mg of bovine serum protein and dialyzed against physiological saline. e in phosphate buffered saline These different fractions are analyzed in MC / 9 assay (aliquots of 6.3 μΙ of gradient fractions prepared; number of pulses per min-see Fig.5). The test results show that approximately 75% of the active substance is in the passing and wash fractions and 25% in the gradient fractions shown in Fig. 5. Concentrating gels on SDS-PAGE (Laemli Nature, 1970, 227, pp. 680-685) contain 4% acrylamide and resolution gels contain 12.5% acrylamide (aliquots of different fractions are shown in Fig.6). Aliquots of the gels to be demonstrated were dried under vacuum and then re-dissolved using 20 μΙ of sample treated buffer (non-reducing, i.e., no 2-mercaptoethanol) and boiled for 5 min. before applying the gel. Lanes A and B represent the crude column material (75 μΙ of 890 mL) and the eluted fraction (75 μΙ of 880 mL), respectively.

The numbered notations in the left part of the figure indicate the migration position of markers (reduced) having a molecular weight of 10 ³ higher than the indicated numbers. These markers are phosphorylase (mol. Wt. 97400), bovine serum protein (mol. Wt. 66200), egg protein (mol. Wt. 42700), carbonic anhydrase (mol. Wt. 31000), soy trypsin inhibitor (mol.sv. . 21500) and lysozyme (mol. Wt. 14400). Lanes 4-9 correspond to the facies taken after the gradient (60 μΙ of 9.1 mL). The gel was stained with silver (Morisey, Ann. Bioch. 1981, 117 vol., Pp. 307-310). Comparison of the A and B strips shows that most of the material that can be colored passes through the column. Colored material of 4-6 fractions slightly above and below in mol. The 31000-standard-based on biological activity coincides with the fractional gradient (Figure 5) and is a biologically active substance. It should be noted that this material is visually visible in lanes 4-6, but not in A or B because a much larger proportion of the total volume (0.66% of the sum of fractions 4-6, versus 0.0084% of the sum of A and B) was loaded in the first case. . From this column, 4-6 fractions were pooled.

As previously mentioned, approximately 75% of the elicited activity passes through the C4 column (Fig. 5). This material was repeatedly purified by chromatography on C4 resin, practically as described above, except that a much larger column (1.4x7.8 cm) was used and the flow rate was reduced (50-60 mL / h) by about 50%. the eluted fraction had a passing fraction and a 50% gradient fraction analogous to SDS-PAGE active gradient fractions in the assay, (Fig.6) The active fractions were pooled (29 mL).

Analytical column C4 worked in practice as described, and fractions were analyzed by both biological methods. As shown in Figure 7, the biological activities of the fractions from this analytical column are eluted in MC / 9 as well as in HPP-CSF. SDS-PAGE analysis (Fig.8) revealed the presence of a protein with molecular weight. 31000, the presence of a column fraction which also retains the substance having biological activity in both assays.

The active substance corresponding to the second (relatively lower) peak of activity recorded by chromatography on S-Sepharose (e.g. Fig. 4, fractions 62-72, early fraction in salt gradient) was also purified by C4 chromatography. It exhibited the same characteristics on SDS-PAGE and had the same Ngal amino acid sequence (see Example 2D) as the material obtained by C4 chromatography from the passing fractions on S-Sepharose.

6. Summary of cleaning

The purification steps summarized above 1-5 are given in Table 2.

table

Summary data for mammalian CSF factor purification

Stage

Turis, ml

Protein content, mg ⁵

Conditioning medium 335700 13475 DEAE Cellulose ¹ 2900 2164 ACA-54 1513 Agglutinin (from wheat sprouts) -agarose ² 375 431 S-Sepharose 540 ^{4 5} 10th Resin C4 ³ 57.3 0.25-0.40 '

The values shown represent the sum of the sizes for the different batches described in the text.

² As described in the example above, the material that appears in the preparation for chromatography on S-Sepharose during dialysis of this example was removed by centrifugation. After centrifugation, the sample contained approximately 264 mg of protein.

³ Sequential alignment of active gradient fractions from two runs on C4 column as described.

^{4 In the} next step (this example above) only 450 ml of this material was used.

⁵ Except in the cases discussed above, evaluation by the Bradford method (see above, 1976) was based on the intensity of silver staining after SDS-PAGE and after analysis of the amino acid composition as described in Example 2 section.

D. Glycosidase treatment by SDS-PAGE

The SDS-PAGE data of the combined gradient fractions after two passes on the C4 large dimension column are shown in Fig.9. The first C4 column was loaded with 60 μΙ of mixture (lane 1) and the second C4 column with 40 μΙ of mixture (lane 2). These gel strips were painted silver. The molecular weight markers were the same as described in Fig.6. As mentioned, diffusely migrating material with a higher and lower molecular weight compared to marker 31000 is a biologically active substance. High degree of heterogeneity is determined by glycosylation heterogeneity.

To characterize glycosylation, the purified material is treated with iodine isotope J125, treated with multiple glycosidases and analyzed by SDS-PAGE (under reconstituted conditions) by autoradiography. The results are shown in Fig.9. Lanes 3 and 9 are iodinated material without any glycosidase treatment. Lanes 4 and 8 correspond to isotope labeled material treated with glycosidases as described below: Lane 4-Neuraminidase, 5-Neuraminidase and O-Glucanase, 6-N-Glucanase, 7-Neuraminidase and N-Glucanase. Treatment conditions: 5 mmol / l 3 - ((3cholamidopropyl) dimethylammonium) -1-propanesulfonate (CHAPS), 33 mmol / l 2-mercaptoethanol, 10 mmol / l Tris-HCl buffer, pH 7-7.2, 3 hours at 37 ° C . Neuraminidase (from Arthrobacter ureafaciens, Calbiochem) was used at a final concentration of 0.23 U / ml. O-Glucanase (Genzim; endo-alpha-N-acetylgalactosaminase) was used at a concentration of 45 mU / ml; N-glikanazė (Genzim; peptide: N-glycosidase F; peptide-N ⁴ (N-acetyl-beta-gliukozaminil asparaginamidazė) using 10 U / ml.

The results obtained were analogous to those in Fig. 9 for treatment with labeled purified SCF by glycosidases and for silver evaluation after SDS-PAGE.

Various control cultures were performed as necessary. These consisted of: culturing in an appropriate buffer without glucosidose to confirm that the results were affected by the addition of glycosidase preparations. Culturing with glycosidated proteins (e.g., glycosylated recombinant human erythropoietin) are known substrates for glycosidases to confirm that the glycosidase enzymes used were active; and culturing with glycosidases but not substrates to confirm that the visual evaluation of the gel strips is not affected or obstructed by the glycosidases alone.

Among other things, glycosidase treatment was performed with endo-beta - () acetylglucosamidase F (endo F; () E () Diupon) and with endo-beta - () - acetylglucosaminidase H (endo H; firm () E () Diupon). ) and in these cultivation operations under appropriate control. Endo treatment conditions were as follows: 3 min. boil in 1% w / w SDS, 100 mmol / L 2-mercaptoethanol, 100 mmol / L ethylenediaminetetraacetic acid, 320 mmol / L sodium phosphate, pH 6; followed by a 3-fold dilution with Nonidet Pi-40 (1.17 volume% final concentration), sodium phosphate (200 mmol / l final volume) and endo F (7 U / ml final concentration). Endo H treatment conditions were analogous except that SDS concentration was 0.5% (w / v) and endo H was used at a concentration of 1 µg / ml. The results with endo F were the same as with N-glycanase whereas endo H did not react with the purified SCF material.

A number of conclusions can be drawn from the above glycosidase experiments. Various treatments with N-glycanase (which is eliminated as complex as well as high-mannose N-linked carbohydrate (Tarentino et al. Biochem. 1985, 24 vol. 46654671)) endo F, which acts analogously to N-glycanase (Elder and Alexander, Proc.Nat.Acad.Sci. USA, 1982, 79 vol., Pp. 4540-4544), endo H, which removes large mannose and some N-linked hybrid type carbohydrates (Tarentino et al., Meth. Enzym. 1978, Vol. 50C, pp. 574-580), a neurominadase that removes sialic acid residues, and an O-glucanase that removes some O-linked carbohydrates (Lambin et al., Bioch. Soc. Trans, 1984, 12 vol. Pp. 599-600), suggests the following: There are both N- and O-linked carbohydrates, a greater proportion of N-linked carbohydrates are of the complex type, and sialic acid is present, with a minority included in the O-binding functionalities. The amino acid sequence data (Example 2) can be ga any information about N-linking centers is lost. The fact that N-glycanase endo-F and N-glycanase / neuraminidase treatment apparently can convert SDH-PAGE heterogeneous material into more homogeneous forms of migration is consistent with the finding that all of this material is the same polypeptide. , whose heterogeneity is induced by glycosylation of heterogeneity. It is also noteworthy that the small forms obtained by combinations with different glycosidases have a molecular weight of 18 to 20,000, relative to the molecular weight of the markers used in SDS-PAGE.

Confirmation that the diffusive-migratory material is close to the region in which the molecular weight. is 31,000 at SDS-PAGE is a biologically active substance having the same basic polypeptide chain, the fact that the amino acid sequence data obtained from material migrating in the field (e.g. after electrophoresis and treatment with bromocyano, 2 for example) corresponds to that shown for an isolated gene whose expression by recombinant DNA leads to a biologically active substance (Example 4).

example. Amino acid sequence analysis of mammalian SCF factor

A. Reverse Phase Reverse Phase Chromatography (HPLC) of the purified protein

Approximately 5 pg SCF factor purified as shown in e.g. 1 (concentration 0.117 mg / ml) was allowed to reverse on a HPLC system using a C4 low porosity column (Widak, pore width 30 mm, column size 2x15 cm). The protein elutes in a linear gradient from 97% mobile phase A (0.1% trifluracetic acid) / 3% mobile phase B (90% acetonitrile in 0.1% triftoacetic acid) to 30% mobile phase A / 70% mobile phase B for 70 min, followed by a transient elution for a further 10 min at a flow rate of 0.2 ml / min. Upon completion of chromatography with blank buffer 5C, a single symmetric peak is observed with a retention time of 70.05 min, as shown in Fig.10. Under these conditions, no peaks could be observed from the major contaminating proteins.

B. Sequencing of protein bands after electrophoresis

The SCF factor purified as in Example 1 (0.5-1.0 nanomolar) is treated with () -glucanase, an enzyme that specifically binds asparagine-bound carbohydrate functional groups that are covalently attached to proteins (see, for example, 1D). 6 ml of the mixed material from the 4-6 column C4 (Fig.5) fraction was dried in vacuo, then added with 150 μΙ CHAP5 solution (14.25 mmol / l), 100 mmol / l 2-mercaptoethanol, 335 mmol / l sodium phosphate pH -8.6 and cultured. 95 min At 37 ° C. An additional 300 μΙ of 74 mmol / L sodium phosphate solution, 15 U / ml // -glucanase pH-8.6 was added and cultured for 19 h. The sample was then loaded onto a 9-18% SDS-polyacrylamide gradient gel (0.7 mm thick. 20x20 cm). Protein bands were electrophoretically transferred onto polyvinyl difluoride (PVDF from Millipor Corp.) in gel using 10 mmol / L Caps buffer (pH 10.5) at a constant current of 0.5A for 1 h. (Macudaira, J. Biol. Chem. 1987, 261 vol., Pp. 10035-10038). For visualization, the transferred protein bands were stained with Coomasi Blue. Bands were detected which had a molecular structure. sv 29-33 thousand. and 26 thousand, i.e. deglycosylation was only partially completed (as compared to 1D, e.g., Fig. 9). The first bar corresponds to the unbreakable material and the last one to the N-linked carbohydrate material. A portion of the gel is cut and placed (40% molecular weight 29-33000 and 80% protein with molecular weight 26000) into a protein sequence analyzer (Appl Biosystem Ine. Model 477). Protein sequence analysis is performed using software provided by the manufacturer (Hevik et al., J. Biol. Chem. 1981, 256 vol., Pp. 7990-7997), and assayed for phenylthiohydantoin amino acids in a stream using reverse phase high performance liquid chromatography with C18 in micropores. Both sides showed no signals

20-23 sequence cycles, which is why both of these materials are assumed not to undergo sequence analysis using methodology with Edman chemistry. In such a sequencing test, the background level is 1-7 picomoles, which is far below the amount of protein present in the bands. These data suggest that the protein in the bands is blocked by Fat.

C. In situ cleavage of electrophoretically transferred protein with cyanogen bromide and sequence analysis

To confirm that the protein was actually blocked, the membrane was removed from the sequence analyzer (part B) and cleaved in situ with cyanobromide CNBr (5% solution in 70% formic acid) at 45 ° C for 1 h. The sequences were then dried and analyzed. Strong sequence signals corresponding to internal peptides obtained by cleavage of the methionyl-peptide bond with cyanogen bromide were recorded. Both bands gave identical mixed sequence signals, listed below for the first five cycles.

Cycles Amino acids identified

Asp, Glu, Vai, Ile, Leu

Asp, Tre, Glu, Ala, Pro, Vai

Asn, Ser, His, Pro, Leu

Asp, Asn, Ala, Pro, Leu

Ser, Tyr, Pro

In addition, both bands gave identical signals throughout the 20 cycles. Initial yields were 40-115 picomoles per band, which molecule. sv 26,000 and 40-150 picomoles 29-33k. for the tape. These values were compared with the output values of the protein loaded into the sequence analyzer. These results confirm that the protein bands corresponding to the SCF factor had a blocked N-terminus. Methods used to obtain useful information on the sequences of Ngal-blocked proteins include: (a) N-terminal deprotection (see section D), and (b) peptide generation by cyanogen bromide internal cleavage (see section E), trypsin (see section F) ) and protease (Glu-Si) from Staphiloccocus aureus (U-8 strain) (see section C). Sequence analysis can be performed after removal of the amino acids blocked at the N-terminus or after isolation of the peptide fragments. Examples are detailed below.

D. Sequence Analysis of Stem Cell Factor BRL Treated with Pyroglutamic Acid Aminopeptidase

It was difficult to predict the chemical nature of the blocking function at the terminal amino group of SCF. This blockage may be post-translational in the living organism (F.Vorld, Ap.Rev.Bioch. 1981, 50t., Pp. 783-814) or may occur during purification outside the body. Two post-translational modifications were commonly observed. Acetylation of the corresponding N-terminal amino acids, such as Ala, Ser, etc., which is catalyzed by N-alpha-acetyl transferase, can occur. This can be confirmed by isolation and mass-spectrophotometric analysis of the N-terminal blocked peptide. If the terminal amino group of the protein is glutamine, its gamma-amide deamidation may occur. This may be followed by cyclization to activate gamma-carboxylate and the free N-terminal to form pyroglutamate. The enzyme pyroglutamate aminopeptidase can be used to detect glutamate. This enzyme removes the residual pyroglutamate leaving a free terminal amino group. Edman chemistry can then be used for sequence analysis.

SCF (purified as Example I 400 picomoles) is cultured in 50 mM sodium phosphate buffer (pH 7.6 containing dithiothreitol and ethylenediaminetetraacetic acid) with 1.5 units of pyroglutamic acid from calf liver (pE-AP) amidopeptidase at 37 ° C for 16 hours. . The reaction mixture is then transferred to a protein sequence analyzer. The main sequence can be identified in 46 cycles. The initial yield was approximately 40% and the final yield was 94.2%. The N-terminal sequences of SCF, including pyroglutamic acid, were:

pE-AP cleavage site 10 pyroGlu-Glu-lle-Cys-Arg-Asn-Pro-Val-Tre-Asp-Asn-Val-Lys-Asn-lle-Tre-Lys-Leu-ValAla30

Asn-Leu-Pro-Asn-Asp-Tyr-Met-lle-Tre-Leu-Asn-Tyr-Val-Ala-Gly-Met-Asp-Val-Leu-ProSerHis-xxx-Trp-Leu-Arg-Asp- ........... xxx, position 43 unencrypted. These results indicate that

SCF contains pyroglutamic acid as the N-terminal group.

E. Bromcian Peptide Isolation and Analysis.

The SCF factor purified as shown in Example 1 (20-28 µg; 1.0-1.5 nanomolar) is treated with N-glycanase as described in Example 1. In this case, the complete conversion to the substance of the molecule is recorded. sv This sample was dried and cleaved with cyanogen bromide in 70% formic acid (5% bromocyanide) for 18 hours. at room temperature.

The digested product was diluted with water, dried and redissolved in 0.1% trifluoroacetic acid. Bromcyano peptides were isolated by reverse phase liquid high performance chromatography using a low porosity C4 column and elution conditions identical to those described in section A of this example. Several major peptide fractions were isolated and their sequence analyzed. The results are presented in the following table:

Follow

Peptic Exposure das duration T-1 7.1 T-2 ¹ 28.1 T-3 32.4 T-4 ² 40.0 T-5 ³ 46.4

T-7 ⁴ 72.8

T-8 73.6

E-S-L-K-K-P-E-T-R

V-S-V- (J-K l-V-D-D-L-V-A-A-M-E-E-N-A-P-K

N-F-T-P-E-E-F-F-S-I-F- {J-R

a. L-V-A-N-L-P-N-D-Y-M-1-T-L-N-Y-V-A-G-M-D-V-L-P-S-H-C-WL-R

b. SlDAFKDFMVASDTSDCVLS - (_) - (_) - LG-ESLKKPETR- (N) -FTPEEFFSIF- (JR ESLKKPETRNFTPEEFFSlFD-R ¹⁾ Amino acids 12.13 and 25 were not detected Peptide b was not fully analyzed.

² (N) CB-15 was not detected; it was assumed to be at a potential N-binding center for glycosylation. The peptide was not fully analyzed.

³ Designates the center where Asn can be converted to Asp by removal of N-binding sugar by Nglycanase.

⁴ A single letter code was used: A-Ala, C-Cys, D-Asp, E-Glu, F-fen, G-Gly, H-His, l-lle, K-Lys, L-Leu, M-Met , N-Asn, P-Pro, O-Glin, R-Arg, S-Ser, T-Thre, V-Val, WTrp and U-Tyr.

Isolation and analysis of tryptic fragments of BRL stem cell factor.

Purified SCF as in Example 1. (20 pg) in 160 μΙ bicarbonate molar solution was degenerated with 1 pg trypsin at 37 ° C. 3.5 or. The degeneration product was immediately transferred to the column with reverse phase C4 (low porosity). High performance liquid chromatography was performed under identical elution conditions as described in Section A of this Example. All peaks in the eluted peptides had retention periods different from those observed in non-degenerate SCF (section A). Analysis of the isolated peptide sequences is given in:

Peptide Detention duration Follow CB-4 15.5 L-P-P— SB-6 ¹ 22.1 a. I-T-L-N-Y-V-A-G- (M) b. V-A-S-D-T-S-D-C-V-L-S - (_) - (_) - L-G-P-E-K-D-S-R-V-S V - (_) - K ~~ SB-8 28.0 D-V-L-P-S-H-C-W-L-R-D- (M) CB-10 30.1 (CB-8 sequence) CB-15 ² 43.0 EENAPKNVKESLKKPTR- (N) -FTPEEFF- SlFD ³ -RSlDA ------ CB-14 IR CB-16 37.3 both peptides have identical sequence to CB-15

^{1 At} position 4, the amino acid is not encrypted.

^{2 At} position 12, the amino acid is not encrypted.

³ At position 20 and 21 in the sixth peptide T-5, the amino acids were not encrypted: they were assigned the structure of the sugar O-binding centers.

^{4 At} position 10, no amino acid was detected; concluded that it is at the center of potential N-binding of Asn glycosylation.

at position no amino acid was detected.

Isolation and detection of BRL-SCF peptide sequences after Saurens Glu-C protease cleavage

The SCF was purified according to Example 1 (20 mg / 150ml in 0.1 M ammonium bicarbonate solution) and treated with Glu-C protease cleavage at a 1:20 protease-substrate ratio. The process took place at 6 p.m. At 37 ° C. The product was investigated by high performance reverse phase liquid chromatography. The 5 main fractions were collected and distributed as follows:

Peptide Detention duration Follow S-1 5.1 N-A-P-K-N-V-K-E S-2 27.7 S-R-V-S-V- (N) -K-P-F-M-L-P-P-U-A- (A) S-3 46.3 sequence unspecified S-5 71.0 S-L-K-K-P-E-T-N-F-T-P-E-E-F-F-S-I-F- (N) -R-S-I-D-A-F-K-D- F-M-U-A-S-D S-6 72.6 S-L-K-K-P-E-T-R-N-F-T-P-E-E-F-F-S-I-F- (N) -R-S-I-D-A-F-K

DFMUASDTSD ^{1 The} amino acid at position 6 of peptide S-2 was not detected: this may have been the position where the O-linked sugar is attached. Low yields were found at position 16 of peptide S-2 Ala.

² S-3 peptide can be an N-terminal blocked peptide, a derivative of SCF N-residue, ³ (N) has been assigned a potential site for N-linked sugar attachment.

H, Sequence analysis of SCF after BNPS-cleavage.

SCF (2mg) was dried to constant weight with 10 ml of ammonium bicarbonate by vacuum centrifugation and then redissolved in 100 ml of glacial acetic acid. 1020-fold molar excess of BNPS-skatole was added to the solution and the mixture was thermostated at 50 ° C for 60 min. The reaction mixture was then dried by vacuum centrifugation. The dried residue was then extracted with 100 mL of water and again with 50 mL of water. The combined extracts were then analyzed as described above. The following sequence was observed:

Leu-Arg-Asp-Met-Val-Thr-His-Leu-Ser-Val-Ser-Leu-Thr-Thr-Leu-Leu-Asp-Lys-Phe-SerAsn30 lle-Ser-Glu-Gly-Leu-Ser - (Asn) -Tyr-Ser-lle-lle-Asp-Lys-Leu-Gly-Lys-lle-Val-Asp-

Position 28 was not accurately determined: it was identified as Asn at the N-binding site of potential glycosylation.

I. Determination of BRL SCF C-qalo Amino Acids.

An aliquot of SCF-protein (500 picomoles) was placed in 10 mM sodium acetate buffer, pH 4.0 (final volume 90 mL) and Brij-35 up to 0.05% w / v was added. A 5 ml aliquot was taken for protein quantification. 40 ml of the sample was diluted to 100 ml with the above buffer, followed by addition of carboxypeptidase P (Penicillium janthinellum) in a ratio of 1: 200 enzyme-substrate. The process was run at 25 ° C; An aliquot of 20 ml was taken at 0, 15, 30, 60 and 120 min. The process was terminated by adding trifluoroacetic acid to a final concentration of 5% each time. Samples were dried and amino acid release was determined by reaction with dabsyl chloride (dimethylaminobenzenesulfonyl chloride) 0.2 mM NaHCO3 (pH 9.0) at 70 ° C for 12 min. (Chang et al., Meth. Enzym. 90, 41-48, 1983). The resulting amino acids (16 per sample) were analyzed by narrow-channel reverse phase HPLC modified by Chang et al. (Techn. In Protein Chem, T. Hugli, ed. Ac.Press, NY (1989), 305-311 pp.). Quantitative results were obtained at each indicated time point against standard known amino acids (1 picomole). Initially, degraded glycine was observed. During incubation, the only amino acid that increased in amount was alanine. After 2 hours of incubation, the total amount of Ala 25 picomoles: equivalent to 0.66 mole of Ala released from the mole protein was determined. This result indicates that the natural SCF molecule in mammals contains Ala in the form of a carboxylic residue, which is consistent with the C-terminal S-2 peptide sequence analysis which contains the C-terminal Ala. This finding is also in agreement with the known specificity of carboxypeptidase, PtLu et al., J.Chromat. 447, 351364 (1981). For example, splitting is terminated if the Pro-Val sequence is matched. The S-2 peptide has the sequence S-R-V-S-V- (T) -K-P-F-M-L-P-P-V-A- (A) and is resolved by the C-terminal peptide SCF (see section of this example).

The C-terminal sequence —P-V-A- (A) limits protease cleavage to Ala only. The amino acid composition of peptide S-2 is shown to be performed on 1 Thr, 2 Ser, 3 Pro, 2 Ala, 3Val, 1 Met, 1 Leu, 1 Phe, 1 Lys, 1Arg, a total of 16 residues. The identified 2 Ala residues indicate that there may be 2 Ala residues at the C-terminus of this peptide (see table in section G). This way the BRL SCF ends with Ala 185.

1. SCF sequences

Combining the results obtained after intact SCF analysis of the N- and C- fragments after removal of its N-terminal pyroglutamic acid, (2) CNBr-peptides, (3) trypsin peptides, (4) 4 Glu and C-peptidase fragments end of the sequences (fig 11). N-terminal sequence begins and ends pirogliutaminine acid Met ^'48. The C-terminal sequence has 84/85 amino acids (positions 82 to 164/165). The sequence from 49 to 81 positions was not observed in any of the isolated peptides. The sequence of the more large peptide after BNPS-skatole cleavage was as described in Section H of this example. From these additional data, as well as from the DNA sequence derived from rat SCF (Ex. 3), the C- and Ngal sequences can be understood and the overall sequence can be determined as shown in Fig.11. At the N-terminus of the molecule is pyroglutamic acid; C-gal-Ala as evidenced by the pyroglutamate aminopeptidase and carboxypeptidase process respectively.

It follows from the sequence data that Asn-72 is glycosylated; Asn-109 and Asn 120 appear to be glycosylated on some molecules. Asn-65 can be detected by analyzing sequences and, at the same time, can only be partially glycosylated, if at all. Ser-142, Thr-143, Thr-155, which were deduced from the DNA sequence, could not be detected by amino acid analysis and may have resulted in an O-linked carbohydrate attachment site. These possible carbohydrate attachment sites are shown in Fig.11. N-linked carbohydrate is highlighted in bold; O-linked carbohydrate is indicated in simple font.

K. BRL SCF amino acid composition analysis

For amino acid composition analysis, material from C4 column, Fig.7, obtained by concentration and buffer exchange in 50 mM ammonium bicarbonate was prepared. Two samples of 70ml were individually hydrolyzed with 6N HCl containing 0.1% phenol and 0.05% 2-mercaptoethanol at 110 ° C for 24 hours. in a vacuum. The hydrolyzates were dried, placed in sodium citrate buffer and analyzed by ion-exchange chromatography (Beckman Model 6300 amino acid analyzer).

The results are shown in Table 3. The use of 164 amino acids (from protein sequence data) to determine amino acid composition is more in line with the expected values than the use of 193 amino acids (as determined from PCR-DNA sequence data (Fig. 14C).

table

Quantitative amino acid composition of mammalian SCF

Amino acid sequences Guessed

Moles per mole protein residue molecule

Amino acid Test 1 Test 2 (A) (B) Asn 24.45 24.28 25th 28th Thr 10.37 10.43 11th 12th Ser 14.52 2:30 PM 16th 24th Glu 11.44 11.37 10th 10th Pro 10.90 10.85 9th 10th Gly 5.81 6.20 4 5 Ala 8.62 8.35 7/8 8th Cys not found not found 4 4 Or 14.03 13.96 15th 15th Met 4.05 3.99 6th 7th lle 8.31 8.33 9th 10th Leu 17.02 16.97 16th 19th Tyr 2.86 2.84 3 7th Phe 7.96 7.92 8th 8th His 2.11 2.11 2 3 Lys 10.35 11.28 12th 14th Trp not found not found 1 1 Arg 4.93 4.99 5 6th Total: 158 158 164/165 193

Calculated molecular weight-18424.

¹ Based on 158 residues of protein sequence analysis (except Cys and Trp).

² Theoretical values were calculated from protein sequence data (A) and DNA sequence data (B).

³ Based on 1 -64 sequence.

The introduction of a known average amount standard into the analysis of the amino acid composition also enables the protein to be quantified in the sample: The sample size to be analyzed was 0.117 mg / ml.

example

Cloning of rat and human SCF genes

A. Amplification and clustering of rat SCF cDNA fragments

Determination of the amino acid sequences of the rat SCF protein fragments allowed the formation of a linked, specific rat SCF oligonucleotide sequence. Oligonucleotides are taken as a hybridization assay for the separation of rat bases from the rat cDNA genome and as a primer in the assay for the application of cDNA fragments using the polymerase cyclic reaction (PCR) strategy (Mullis et al., Meth. In Enzym. 155, 335-350 (1987)). (Beansage et al., Tetrahedron Lett, 22, 1859-1862, 1981); (Mc Bride et al., Tetrahedron Lett, 24, 245-248, 19983); their sequences are shown in Figure 12A. -Thymin; C-cytosine; G-guanine; l -inosine. The oligonucleotides designated "*" in Fig. 12A, which have limitations in recognizing endonuclease sequences, are 5 'to 3'.

Using rat 32-phosphor-labeled ologonucleotide assays, rat genomic liver cDNA and two BRL cDNA bank data 219-21 and 219-22 (Fig. 12A) were selected based on the amino acid sequences obtained in Example 2. In these experiments with standard method cDNA cloning, no SCF clones were isolated (Maniatis et al., Molec.Cloning, Cold Spring Harbor, 212-246, 1982).

Alternative approximation and the resulting sequences of SCF nucleic acids isolated involved the use of PCR techniques. According to this methodology, a region of DNA surrounded by two primary DNAs is selectively amplified in the in vitro thermocirculator using multiple replication cycles catalyzed by an acceptable DNA polymerase (such as Tag DNA polymerase) in the presence of triphosphate deoxynucleoside. The specificity of PCR amplification is based on two primary oligonucleotides, flanking DNA fragments that amplify and hybridizing to the opposite helix. PCR with bidirectional specificity for the detection of DNA regions in a complex mixture is achieved using two primers with sequences sufficiently specific for this region. PCR with one-sided specificity uses one spatial-specific primer and a second one that can occupy the overlapping site present in all or most of the DNA molecules of the respective mixture. (Loh et al., Csi. 243, 217-220, 1989).

DNA products in successful amplifications contain sources of DNA sequences (Gylbensten, Biotechniques, 7, 700-708, 1989) and can serve to provide labeled hybridization products of greater length and specificity than oligonucleotides. PCR with appropriate sequence products can also be designed to clone into plasmid carriers which appear to have the character of an encoded peptide product.

The basic strategy for obtaining rat SCF cDNA sequence is presented in Figure 13A. The small arrows indicate PCR-amplification, the large-DNA sequence reaction. PCR 90.6 96.2 with cDNA-sequencing was used to obtain the partial nucleic acid sequence of rat SCF cDNA. In these PCR primers were mixed oligonucleotides based on the amino acid sequence shown in Figure 11. Using sequence information from PCR 90.6 and 96.2, unique sequence primers (224-27 and 224-26, Fig.12A) were prepared for use in subsequent amplification and clustering reactions. DNA containing the 5'-end of the cDNA was obtained by PCR

90.3, 96.6 and 625.1 using one-way specificity PCR. The complementary DNA sequence at the C-terminus of the SCF protein was obtained by PCR 90.4. The DNA sequence coded for the residue in rat SCF cDNA region was obtained from PCR products. PCR 630.1, 630.2, 84.1 and 84.2 as described in Section C of this example below. The technology used to obtain rat SCF cDNA is described below.

RNA was prepared from BRL cells as described by Okayama et al., Meth.Enzym. 154: 3-28 (1987). PolyA + RNA was isolated by means of an oligo (T) cellulose column as described in Jakobson Meth in Enzym, 152 vol., 254-261 (1987).

The first helical cDNA was synthesized using 1 mg BRLpolyA + RNA as a template and (dT) 12-18 as a primer provided by the Mo-MLV reverse transcriptase enzyme (Bethesda Reseach Lab). Spiral degradation of RNA occurred with 0.14 M NaOH at 84 ° C for 10 min. or incubation in boiling water bath for 5 min. An excess of ammonium acetate was added to neutralize the solution; The cDNA was first extracted with phenol / chloroform followed by chloroform / isoamyl alcohol and precipitated with ethanol. When available, oligo (dC) - a primer in a PCR reaction with a single-stranded specificity for the 3'-end aliquot of a cDNA with a terminal transferase from a calf thyroid gland (Boeringer Manheim) - was added as previously described (Deng et al., Meth. Enz. 100: 96-103 (1983).

In the last descriptions, unless specifically discussed, denaturation was performed for 1 min at 94 ° C in each PCR cycle; extension-3 or 4 min. 72 ° C. Annealing temp. and duration varied from PCR to PCR, often compromising between the two PCRs. Higher annealing times were used to reduce the concentration of the primer in order to accumulate less material with the primer (Watson, Amplific. 2, 56, 1969); at high product concentration in PCR, lower duration and higher primer concentration are used to increase yield.

The primary factor in determining annealing temperature was the evaluation and targets of primer Td coupling. (Suggs et al., Daylopmen.Biol.Using Purified Genes, Browville, D.D., Fox, C.F. Acad, NY, 683-693, 1981). The enzymes used here were obtained from suppliers: Stratagene, Promega, or Perkin-Elmer Cetus. Reaction binders were used as recommended by the suppliers. Amplifications were performed by either Soy Tempcycle or Perkin-Elmer Cetus DNA thermosus. Amplification of SCF cDNA fragments was typically performed by agar gel in the presence of ethidium bromide and observed DNA binding by fluorescence under UV stimulation. At times, when small fragments were expected, PCR products were analyzed using polyacrylamide gel electrophoresis. Confirmed that the observed junctions are fragments of cDNA, the corresponding amplifications of the junctions with one or more of the primers inside were observed. Final confirmation was obtained from the PCR product of didix ordering (Sanger et al., Proc. Natl.Acad.Sci., 74, 5463-5467, 1967) and comparing these products with the peptide sequence information of SCF.

The first PCR experiments used shuffled oligonucleotides based on the SCF protein sequence (Gould, Proc.Natl.Acad.Sci, USA, 86, 1934-1938, 1989). Below is a description of the PCR amplification performed to obtain DNA sequences in rat cDNA, of encoded amino acids, 25 to 162.

PCR 90.6 BRL cDNA was appended with 4 picomoles of 222-11 and 223-6 of 20 ml each. An aliquot of PCR 90.6 product was analyzed electrophoretically on an agar gel and observed a coupling close to the desired size. 1 ml of PCR 90.6 product was further amplified with 20 pM 222-11 and 223-6 primers, each at 50 ml for 15 cycles, annealing at 45 ° C. Part of this product was further amplified for 25 cycles at 222-11 and 219-25 primers (PCR 96.2), and this gave a uniform coupling in agar gel electrophoresis. Asymmetric amplification of PCR product 96.2 with the same primers yielded a matrix that was reconstituted. Next, the product sequences of SCF 96.2 were selectively amplified using the PCR amplification product with primers 22222 and 219-21. These PCR products were used as a reference and isotope-labeled samples.

In order to distinguish between the 5 'end of the rat SCF cDNA, (dC) _n- containing sequences, acceptable for the poly (dG) -'ends', were used as non-specific. PCR 90.3 had (dC) 12 (10 pM) and 223-6 (4 pM) as primers and BRL cDNA as standard. The reaction product appeared as an aggregate with a very large molecule. sv., staying close to the application limit in agar gel electrophoresis.

ml of product solution was amplified with 25 pM (dC) at 12 and 10 pM in 25 ml of 223-6 for 15 cycles annealed at 45 ° C. 0.5 ml of this product was then amplified in 25 cycles with primers 219-25 and 201-7 (PCR 96.6). Fig.12C shows the sequence 201-7. There was no coupling in agar gel electrophoresis. After 25 cycles of PCR (annealing at 40 ° C), there was one visible linkage. After blotting, one bright hybrid coupling was seen. An additional 20 cycles of PCR (625.1) (45 ° C annealing) were performed using primers 201.7 and 224-27. Following asymmetric PCR amplification, there was an arrangement that resulted in a sequence longer than the N-terminus of the peptide-encoded pre-SCF.

This sequence was used for the planning of oligonucleotide primer 227-29 having a 5'-end encoded portion of rat SCF cDNA.

Similarly, the 3'-DNA sequence terminating with 162 amino acids was obtained by PCR 90.4 arrangement (see Fig. 13A).

B. Cloning of RCF Genomic DNA

PCR results, by extension of the encoded rat SCF cDNA as described in Section A, were used to construct the rat genome sequences (obtained from

ClonTech.Lab., No RI1022j). A bacteriophage primer library, EMBL-3sP6 / T7, was constructed using DNA obtained from adult male S praque Davvley rats. The library has 2.3x10 ⁶ independent clones with an average size of 16kD.

PCR was used to generate the ³² P-tags used to construct the library. PCR (Fig. 13A) was performed in reaction with 16.7 mM ³² P (alpha) -dATP, 200 mM dGTP, 200 mM dCTP, 200 mM dTTP, reaction buffer provided with Pertin Elmer Cetus, Tag polymerase (Pertin Elmer Cetus) 0.05 units / ml, 0.5 mM 219 ' ² 6, 0.05 mM 223-6, and 1 ml of standard 90.1 containing primer binding sites. PCR2 was run under analogous conditions except that primers and standard were replaced by using 0.5 mM 222-11.0.05 mM 219-21 and 1 ml standard obtained in PCR 96.2.

About 10 ⁶ bacteriophages were placed in plates as described by Maniatis et al., 1982. Plates were transferred onto Gene Screen Filters (22 x 22 cm; Nen / Du Pont) which were denatured, neutralized and dried according to the supplier's instructions. Each plate was filtered twice.

The filters were pre-hybridized with 1 M NaCl, 1% bovine serum albumin, 0.1% ficol, 0.1% polyvinylpyrrolidone (hybridization solution) for 16 h at 65 ° C and stored at -20 ° C. The filters were transferred to fresh hybridization solution with ³² P-labeled PCR product at 1.2x10 ⁵ crm / ml and hybridized for 14 h. 65 ° C. The filters were washed with 0.9 M NaCl, 0.09 M sodium citrate, 0.1% SDS, pH 7.2 (washing solution) for 2 h. room temperature followed by a second wash for 30 min. in fresh water at 65 ° C. Bacterophage clones in plates corresponding to radioactive spots were removed from the plates and sorted with PCR1 and PCR2 e.g.

DNA from positive clones was subjected to BamHI, Sphl or Ssti endonucleases and the resulting fragments subcloned (Fig. 19) and sequenced. An arrangement scheme for rat genomic SCF DNA is shown in Figure 14A. In the upper part of the figure is the DNA of rat genomic SCF. Line spacing - areas that have not been fixed. Large boxing - axons of the coded parts of the SCF gene. The arrows indicate the areas that have been arranged and used to connect the rat gene SCF sequences. The rat SCF sequence is shown in Figure 14B.

Using PCR1 for the rat genomic library, clones corresponding to amino acids 19 to 176 of the encoded SCF were isolated. To obtain clones for axons, a library was selected using oligonucleotide 228-30 samples in the 19 amino acid coding region. The same set of filters as for PCR1 was prehybridized and hybridized in solution with ³² P-labeled oligonucleotide 228-30 (0.03 pM / ml) at 50 ° C for 16 h. Filters were washed for 30 min. at room temperature in the rinse solution followed by a second rinse in fresh aqueous solution for 15 min at 45 ° C. Bacterophage clones were removed from the plates and sorted with 228-30 e.g. DNA from positive clones was exposed to endonucleases and subcloned. Studies 228-30 enabled the production of clones corresponding to coded amino acids from 20 to 18 axons.

Several attempts have been made to isolate clones corresponding to axons (a) having 5'untranslated regions and -25 to -21 amino acid coding regions. No rat SCF clones were isolated in this area.

C. Cloning of rat cDNA for expression in mammalian cells

To determine whether the rat SCF active polypeptide product can be expressed or secreted in mammalian cells, rat SCF (SCF ¹ ' ¹⁶² , SCF ¹ ' ¹⁶⁴ ) and SCF ¹ ' ¹⁹³ protein expression systems known from gene translation were used (Figs. 14C).

The expression vector used in these experiments contains the pVC119, SV40, and HTLV sequences. The vector was used for autonomous replication in mammalian and E.coli cells and for expression of exogenous DNA under the control of viral DNA sequences. This vector is designated V19.8 at E.coli DH5 by Amer. TypeCultureColIect., 12301 Parklavvn Drive Rockville, M (ATCC # 68124). This vector is a derivative of pSVDM19 described in U.S. Patent No. 4,810,643.

Rat SCF of cDNA was introduced into plasmid carrier V19.8. The cDNA sequence is shown in Figure 14C. This construct used DNA synthesized in PCR reactions 630.1 and 630.2 as shown in Fig.13A. These PCRs are independent amplifications and used synthetic oligonucleotide primers 227-29 and 227-30. The sequences for these primers were obtained from cDNA generated by PCR as described in this example. In Section A. The 50ml reaction mixture was from reaction buffer (from Perkin Elmer Cetus kit), 250 mM dATP, 250 mM dCTP and 250 mM dGTP, 250 mM dTTP, 200 mg oligo (dT), 1 pM 227-29, 1 pM 22730, and 2.5 units. Tag polymerases (Perkin Elmer Cetus). cDNA was amplified over 10 cycles with denaturation temp. 94 ° C for 1 min, hardening temp. 37 ° C for 2 min, extension temp. 72 ° C for 1 min. Following these PCR cycles, 10 pM 227-29 and 10 pM 22730 were added to each reaction. Amplification was performed for 30 cycles under the same conditions except that the annealing temp. was up to 55 ° C. PCR products were exposed to Hind III and Sstll endonucleases. V19.8 acted in a similar manner to HindIII and SstII and, in one case, acted on the plasmid carrier against calf gastric phosphatase, in another case, isolated a large fragment of the digested product from the agar gel. cDNA was ligated to V19.8 using polynucleotide ligase T4. The ligation products were transformed into a competent strain. E.coli DH5 as described (Okajama et al., Supra, 1987). DNA was obtained from bacterial strains and arranged according to the Sangeria dideoxy method. Fig.17 shows V19.8. These plasmids were used for transfection of mammalian cells as described in Examples 4 and 5.

The rat SCF1-164 expression transporter was constructed according to the method used in SCF1-162, where cDNA was synthesized by PCR amplification and introduced into V19.8. cDNA was synthesized by PCR amplification with V19.8 containing the SCF ¹ ' ¹⁶² cDNA (V19.8: SCF ¹ ' ¹⁶² ) as a template, 227-29 as a primer for the 5 'end of the gene and 237-19 as a primer for the 3' of the gene. to the end. The duplication reaction (50 mL) contained 1x reaction buffer, 250 mM dATP, dCTP, dGTP, dTTP, 2.5 units Tag polymerase, 20mg V19.8: SCF ¹ ' ^162, and 20 pM primer. cDNA was amplified in 35 cycles of 94 ° C for 1 min, 55 ° C for 2 min, 72 ° C for 2 min. The resulting products were exposed to HindllII and Sstll endonuclease and inserted into V19.8. the transporter has an amino acid SCF coding region from -25 to 164. The 193 amino acids of cDNA (rat SCF ¹ ' ¹⁹³ predicted from the translation of the DNA sequences, Fig. 14C) were also inserted into V19.8, analogous to SCF ¹ ' ^162. in Reactions 84.1 and 84.2 (Fig.13A) with the help of oligonuleotides 227-29 and 230-25. The two amplification reactions start with different RNA preparations. According to section A of this example, the PCR reaction yielded sequence 227-29; 230-25 were obtained from rat genomic DNA (Fig. 15B). Reactions (50 mL) contained reaction buffer 1x, (Perkin Elmer Cetus) followed by 250 mM dATP, dCTP, dGTP, dTTP, 200 mg oligo (dT) / 10 pM 227-29, 10 pM 230-5 and 2.5 Tag (Perkin). Elmer Cetus).

cDNA was amplified in 5 cycles, 94 ° C for 1.5 min, 50 ° C for 2 min, 72 ° C for 2 min. After these cycles, amplification was continued for another 35 cycles under the same conditions except that the annealing was at 60 ° C. PCR amplification products were exposed to HindIII, Sstll endonucleases; V19.8 DNA was exposed to HindIII and Sstll isolated a large fragment from the agar gel. The cDNA was ligated to V19.8 by polynucleotide ligase T4. The ligands were transformed into a competent E. coli strain and arranged in DNA prepared from individual clones. These plasmids were used for transfection of mammalian cells e.g.

Amplification and arrangement of the human CSF cDNA PCR product

Human SCF cDNA was obtained from hepatoma HepS2 cell line (ATCC HB 8065) by PCR amplification shown in Figure 13B. Amplification was performed with primers sequenced from rat SCF.

RNA was prepared according to Maniatis et al., (1982). PolyA + RNA was obtained using oligo (dT) cellulose according to the supplier's (ColIab.Res. I no) instructions.

The first strand cDNA was prepared in the same manner as the BRL cDNA except that the synthesis was initiated by the 2 mM oligonucleotide 228-28 shown in Figure 12C having a short 3 'sequence linked to a longer unique sequence. Part of the unique sequence 228-28 determines the target site for PCR amplification with primer 228-29. Human cDNA sequences for cognate rat cDNA sequences were amplified from HepG2 by PCR using primers 227-29 and 228-29 (PCR 22.7; see Figure 13B); 15 cycles of annealing at 60 ° C followed by 15 cycles of 55 ° C.

Agar gel electrophoresis did not reveal the junctions, only the stains were heterogeneous in DNA size. The following PCR was performed with 1 ml of PCR 22.7 product using rat SCF 222-11 and 228-29 primers (PCR 24.3; 20 annealing cycles at 55 ° C). The agar gel again contained heterogeneous DNA stains. Two-way specific PCR amplification of PCR 24.3 products with 222-11 and 227-30 primers (PCR 25.10, 20 cycles) increased the product's normal core binding to the value of the rat SCF cDNA PCR product. Product arrangement of asymmetric PCR (PCR 33.1) DNA using primer 224-24 yielded about 70 human SCF sequences.

Amplification of PCR 22.7 in 1 ml of product with 224-25 and 228-29 primers (PCR 24.7, 20 cycles) followed by 224-25 and 227-30 primers (PCR 41.11) gave one major joint of the same size as the rat. In the case of SCF, and after asymmetric amplification (PCR 42.3) gave highly homogeneous sequences compared to rat SCF sequences using primer 224-24. Unique oligonucleotides were synthesized and mapped to human SCF cDNA; their sequences are shown in Fig.12B.

To generate a PCR-generated, coded rat SCF sequence used for expression and activity, a duplicate human SCF, PCR was performed with primers 227-29 and 22730 for 1 ml PCR product 22.7, 50 ml volume (PCR 39.1). Amplification was performed by SoyTempcycter.

Because of the unknown discrepancies between human SCF cDNAs and the unique 227-30 primer in rat SCF, only 37 ° C was used for the first three cycles, followed by 55 ° C. A clear junction of the same size (about 590 Dp) as the rat homologue appeared and amplified the diluted small portions by PCR 39.1 and PCR with Accessory PCR (PCR 41.1). Due to the presence of more than one junction in PCR 41.1 products, the following PCRs were made to detect at least part of the sequences for cloning. Ordinary intense coupling was observed after PCR for 23 cycles with primers 231-27 and 227-29 (PCR 51.2). Asymmetric PCR with 227-29 and 231-27 and arrangement confirmed the presence of human SCF cDNA sequences. PCR 41.1 SCD cDNA cloning into V19.8 was performed as described in Section C for rat SCF ^{1 162} PCR fragments. DNA from individual bacterial clones was arranged by the Sanger dideoxy method.

E. Cloning of human SCF genomic DNA

For a sample of PCR7 consisting of PCR-amplified cDNA, see p. 13B, used to construct a library containing human genomic sequences. A band assay suitable for a portion of human SCF cDNA (see below) was used to transfer positive platelets. PCR7 sample was prepared starting from PCR product 41.1 (see Fig. 13B). PCR 41.1 product was amplified with primers (PCR 58.1). PCR 58.1 product was diluted 1000 times in 50 ml of reaction mixture containing 20 pM 233-13 and amplified for 10 cycles. The addition of 10 pM 227-30 resulted in an additional 20 cycles of PCR. An additional 80 pM of 233-13 was added, the reaction volume was increased to 90 ml and the PCR was extended by 15 cycles. Reaction products were diluted 200 times in 50 mL and added with 20 peakM 231-27 and 20 peakM 233-13, and the PCR continued for 35 cycles of annealing temp. 48 ° C in reaction 96.1. P-32-labeled PCR performed similarly, except: PCR 96.1 diluted 100-fold in 50 mL volume; 5 used pikoM 231 -27 as the sole primer; 45 PCR cycles were performed at 94 ° C for 1 min, 48 ° C for 2 min, 72 ° C for 2 min.

Ribbon sample 1 contained ³² P-labeled RNA suitable for the DNA sequences of nucleotides 2-436hSCF shown in Fig. 15B, DNA 41 was exposed to HindIII and EcoRI by constructing the vector 41.1 (Fig.13B), cloned into the plasmid carrier pGEM3 (polyLinker). Promega, Madison, Wisconsin). Recombinant pGEM3: SCF plasmid DNA was exposed to HindIII. ³² P-labeled sample I was obtained from plasmid DNA by transcription with T7 RNA according to the instructions given by Promega. The reaction included (3 ml) 250 mg of plasmid DNA and 20 mM ³² P-STR (catalog No NEG-008H, NevvEngiand Nuclear (NEN) with additional unlabeled STR.

The human genomic library was obtained from stratogen (LaJolIa, CA; cat.No 946203). The library was constructed in the bacterial phage carrier LambadaFix II using DNA derived from the placenta of the Caucasian hedgehog. The library had 2,000,000 plagues, with an average average size of more than 15kD. About 1,000,000 bacteriophages were placed in a plate as described by Maniatis et al. (Supra, 1962). The loads were transferred onto Gene Screen Pius filters (22 sq. Cm; NEN Dupont) according to instructions. Each plate had two flutes. The filters were prehybridized with 6xSSC (0.9 m NaCl, 0.09 M sodium citrate, pH 7.5), 1% SDS at 60 ° C. Hybridized the filters in fresh solution 6xSSC, 1% SDS containing ³² P-labeled PCR7 sample at 200,000 srm / ml and hybridized for 20 h. 62 ° C.

The filters were washed with 6xSSC, 1% SDS for 16 h. 62 ° C. Bacterophage specimens corresponding to radioactive spots were removed from the plate re-sorted with PCR7 Ribbon Sample I as follows: Filters were prehybridized with 6xSSC, 1% SDs, and hybridized for 18 h. 62 ° C, 0.25 M Na3PO ₄ , (pH 7.5), 0.25 M NaCl, 0.001 M EDTA, 15% formamide, 7% SDS and 1x10 ⁶ srm / ml. The filters were washed with 6xSSC, 1% SDS for 30 min. 62 ° C. DNA from positive clones was exposed to BamH, Sphl or Sstl endonucleases and the resulting fragments were subcloned into pNC119.

PCR 7 sample obtained a clone containing the coding amino acids 40 to 176, the axon and this clone transferred to the ATCC (deposit # 40681). To obtain a clone for additional axons in SCF, the human genomic library was sorted by ribo sample 2 and oligonucleotide sample 235-29. Sorted as usual except: Hybridization with 23529 samples was performed at 37 ° C and washes after 1 hour. 37 ° C and 44 ° C. Positive clones were sorted with riboprobe 2, 3 and oligonucleotide samples 235-29 and 236-31. Rib samples and 3 were obtained using analogous rib sample 1 except: scream. pGEM3: hSCF plasmid DNA was exposed to endonuclease P and used (SPE RNA polymerase (Promega) for ribe sample 2e or Psi (ribbed sample 3) and (d) for the synthesis of ribose sample).

Figure 15A shows the strategy used to arrange human genomic DNA.

F. 5'-end sequence of human SCF cDNA

Arrangement of PCR 9 products initiated with two genospecific primers yields a sequence of regions delimited by the 3'-ends of the primers. PCR 9, as shown in Example 3A, can yield sequences of flanked regions. One-way PCR was used to extend sequences of the human SCF 5 'untranslated region.

First-line cDNA was obtained from poly (A +) RNA from human cancer cyst cell line 5637 (ATCC HTB 9) using oligonucleotide 228- (Fig. 12C) as a primer as described in Example 3. Prolongation of this DNA with 6 residues following PCR amplification with (dC) n primers did not result in extension of the cDNA fragments.

Second-line syntheses of PCR products initiated with oligonucleotides 228-28 (Fig.12C) yielded little sequence information. But the "tail" first-line 5637 cDNA (about 50 ng) and 2 peak 228-28 was incubated with Klionov polymerase and 0.5 peak each with dATP, dCTP, dGTP and dTTP at 10-12 ° C for 30 min, ml of 1x Nick translation buffer (Maniatis et al., Molecular Cloning, Cold Spring Harbor Lab., 1982).

Amplification of the resulting cDNA with 228-29, in combination with SCF-primers (in order: 235-30, 233-14, 236-31, and 235-29) gave the appearance of complex mixtures containing spots on an agar gel. The enrichment of the SCF fragments was: the intensity of the specific binding of the product was observed when the comparative products were amplified with two primers (227-29 and 235-29), e.g. Attempts to retrieve a number of products by individual sizes, isolating stains from an agarized gel, and preamplifying the PCR did not, in most cases, yield a well-defined linkage containing SCF sequences.

One PCR 16.17 reaction, with only 235-29, influenced the growth of the junction, which grew by initiation with the aid of 235-29 at an unknown site, 5 'coding region attachments, as shown on the map Fv II and Fst I with enzymes and PCR analysis with primers. This product was gel purified and re-amplified with 235-29, sorted according to the Zanger Dideoxy Method using ³² P-labeled 228-30 primers. The resulting sequence was the base for construction of oligonucleotide 254-9 (Fig. 12B). Using the 3'-directed primer in subsequent PCR combinations with the 5'-directed SCF primers, sequences of desired sizes were obtained. Nucleotides with 180 to 204 human SCF cDNA sequences (Figure 15C) were obtained after Zanger arrangement of such PCR products.

To obtain a larger sequence at the 5 'end of hSCF cDNA, a first line of cDNA from 5637 poly A + RNA (about 300 ng) was prepared using an SCF-specific primer (2 picomoles 233-14) in 16 ml of the mixture containing 0.2 units of MMLU reverse transcriptase and 500 mM of each dNTP. After extraction with phenol / chloroform and chloroform and ethanol precipitation (from 1 M ammonium acetate), the nucleic acids were suspended in 20 ml of water, placed in a boiling water bath for 50 min, then chilled and eluted with 80 mM dATP in CaCl ₂ -containing. in buffer (Dengand W, Meth. Enzim. 100, 96-103). The first-line cDNA with (dA) n-tail product was purified by phenol-chloroform extraction and ethanol precipitation and resuspended in 20 ml of 10 mM Tris pH 8.0 and 1 mM EDTA. Enrichment and amplification of the 5 'fragments of human SCF cDNA, about 20 ng (dA) n-5637, was performed as follows: The first 26 single-stranded PCR runs were performed with SCF-primer 236-31 or with primer mix containing (dT) n-sequences or 3 'end, e.g. primer 221-1 or mixture 220-3, 220-7 and 22011 (Fig. 12C). The products of these PCRs (1 mL) were then amplified in a second PCR containing 221-12 and 235-29. At 370 bp, the parent compound was observed for each agar gel. A gel sample containing part of this joint was removed with a Pasteur pipette tip and transferred to a small tube. 10 ml of water were added and dissolved in a heating unit where the temp. 84 ° C.

PCR with 221-12 and 235-29 (8 picomoles each) was inoculated in 40 mL with 2 mL of reconstituted gel. After 15 cycles, light diffusion coupling, about 370 bp, was observed when analyzed on agar gel. Performed asymmetric PCR to form matrices with upper and lower threads: For each reaction, 4 ml of product and 40 picomoles of 221-12 or 235-29 primers, 100 ml volume was exposed to 25 PCR cycles (1 min, 95 ° C; 30 sec, 55 sec) ° C; 4 sec, 72 ° C). Direct arrangement of PCR product mixes initiated with 221-12 (after standard extraction and ethanol precipitation) with ³² P-labeled 262-13 (Fig. 12B) enabled the 5 'sequence from nucleotide 1 to 179 (Fig. 15C).

G. Amplification and arrangement of human coding for genomic DNA in the first axon of SCF

Screening of the human genomic library with SCF oligonucleotide probes did not yield amplification and cloning of clones containing the first region of the first coding axon, followed by the use of a one-way PCR technique for the genome sequences surrounding this axon.

Primer extension in denatured human placental DNA (from Sigma) was performed with DNA polymerase I (Klionov enzyme, large fragment) using non-SCF primers 228-28 or 221-11 at low temperature (12 ° C), which influences initiation at many different centers. Each reaction was then diluted 5 times in Tag I DNA polymerase buffer containing Tag I polymerase and 100 mM each dNTP, elongated for 10 min at 72 ° C. The product was enriched with SCF oligonucleotides in the first axon (as 254-9) in a PCR reaction with non-SCF primers (228-29 and 221-11). Electrophoresis showed that most products were short (<300 bp). To lengthen, a portion of each gap in the gel was cut and eluted. After ethanol precipitation and resuspension in water, the gel-purified products were cloned into the pGEM4 derivative containing the Stil portion as Hind III fragment to Stil.

Colonies with ³² P-labeled SCF first axon oligonucleotides were seeded. Several positive colonies were identified with the help of Zanger. The sequence extending downward from the first axon through the corresponding junction of the exonitron to the next intron is shown in Fig. 15B.

H. Amplification and arrangement of SCF cDNA encoding mouse, monkey, and canine regions

The first loading cDNA was prepared from total RNA or poly A + RNA from monkey liver (obtained from Clontechi) and cell line NIH-3T3 (mouse, ATCC CRL 1858), and D17 (canine, ATCC CCL 183). The primer used in DNA synthesis was either a nonspecific 228-28 or an SCF primer (227-30, 237-19, 237-20, 230-25 or 241-6). PCR was amplified with 22729 and one of 227-30, 237-19 or 237-20 gave a wild-type fragment that was arranged either directly or by cloning into V19.8 or pGEM.

Additional sequences at the 5 'end of the SCF cDNA were obtained from PCR using the SCD-specific primer, combination 254-9 and 228-29.

Additional sequences at the 3 'end were obtained after 230-25 DNA (in the case of mouse) or 241-6 initiated cDNA (in the case of a monkey) with 230-25 or 241-6, and 3' for the primed SCF primer, PCR. In similar cases, amplification of DNA D17 did not result in binding of SCF PCR products. The nonspecific 228-28 was used to initiate the first loading of total RNA D 17 synthesis, resulting in the resulting mixture enriched with SCF sequences using PCR 3'-end SCF primers, 227-29 or 225-31 in combination with 228-29. The product mixture was cloned into pGEM4 derivatives (Promega, Madison, Wisconsin) having the Stil region at the blunt end of the fragment. The resulting heterogeneous library was seeded with radiolabeled 237-20, and several positive clones were rearranged to yield the dog's SCF3'gal sequences. The amino acid sequences of human (Figure 42), monkey, dog, mouse, and rat SCF mature proteins are shown in Figure 16.

Known SCF-amino acid sequences are homologous throughout their length. Identical overlaps in the signal peptide sequences are in the coding regions of the amino terminus of the mature protein as compared to rat SCF. It is labeled No 1. The dog's cDNA sequence has an indeterminate amino acid sequence, which is the result of valine at codon 129. The human, monkey, dog, mouse amino acid sequences are presented without any inserts or clippings. The dog's amino acid sequence has one additional residue at position 130. Human and monkeys differ only in one position, in the conversion of valine (human) to alanine (monkey) at position 130. The predicted SCF sequence up to or after the putative process center at residue 164 is very consistent with the species.

example

Expression of recombinant rat SCF in COS-1 cells

For transient expression in COS-1 cells (ATCC SRL 1650), carrier V19.8 (Ex. 3C) carrying the genes SCF1-164 and SCF1-193 transfected in duplicate 60 mm plates (Wigler et al., Cell, 14, 725-731, 1978). The V19.8 SCF plasmid is shown in Figure 17. As a control, the carrier was also transfected. Floating surface culture tissues were harvested at different post-transfection moments and analyzed for biological activity. Table 4 summarizes results for Hpp-SCF, Table 5 for MC / 9 ³ Hymimidine data from typical transfection experiments. The results of biological samples floating on the surface of COS-1 cells transfected with those plasmids are shown in Tables 4 and 5; C-terminal rat SCF with C-terminal amino acid at position 162 (V19.8 rat SCF1-162), SCF1-162 containing glutamic acid at position 81. (V19.8 rats SCF1-162 (Glu 81)) and SCF1-162 containing Ala 19 pz. (V19.8, rat SCF1-162 (Alai 9)). Amino acid substitutions were the products of PCR performed on SCF1-162 amplification as shown in Example 3. Individual V19.8 clones of rat SCF1-162 were rearranged and two clones were found to have amino acid substitutions. As shown in Tables 4 and 5, recombinant rat SCF is active in the samples used for purification of natural mammalian SCF.

table

HPP-SCF Surface Surface COS-1 Cells Transfected with Rat SCF DNA

An example Volume of test substance (ml) Colony # / 200000 cells V19.8 (no inserts) 100 0 50 0 25th 0 12th 0 V19.8 rats SCF1-162 100 50 50 50 25th 50 12th 50 6th 30th 3 8th V19.8, rat. SCF1-162 (Glu81) 100 26th 50 10th 25th 2 12th 0 V19.8, rat. SCF1-162 (Ala19) 100 41 50 18th 25th 5 12th 0 6th 0 3 0

table

MC / 9 ³ H-thymidine data for surface COS-1 from cell. transfections with rat SCF DNA,

An example Test substances volume (ml) *) cpm

V19.8 (no inserts)

1.936

2.252

2.182

1.682

V19.8 rats SCF1 -162 25 11,648

11.322

11,482

9,638

V19.8, rat. SCF1-162 (Glu81) 25 6.220

5.384

3.962

1980

V19.8, rat. SCF1-162 {Ala19 25 8.396

6,646

4.566

*) cpm - caunt per minute (pulses per minute)

Recombinant rats SCF et al. factors were assayed by analysis of human CFU-GM (Broxmaer et al., 1977) by measuring the proliferation of normal bone marrow cells; data 6 tables Surface COS-1 data at 4 days post-transfection with V19.8 SCF1-162 in combination with other factors are shown in Table 6. Colony Numbers - Mean of triplicate cultures.

Recombinant rat SCF exhibits synergistic activity on normal bone marrow cells in CFU-GM assays. In the experiment (Table 6), SCF acted in combination with human GMSCF, LI-3 and human. SCF-1. In other studies, synergism also occurred with G-SCF.

Human bone marrow proliferation after 14 days with SCF had an effect; groups had <40 cells.

table

Screening of surface COS-1 cells transfected with rat SCF DNA in human CFUGM

Example Number of colonies / 1,000,000 cells (± EM)

Physiologist. solution

GM-SCF 7 ± 1 G-SCF 24 ± 1 IL-3 5 ± 1 SCF-1 0 SCF1-162 0 GM-SCF + SCF ¹ ' ¹⁶² 29 ± 6 G-SCF + SCF ¹ ' ¹⁶² 20 ± 1 IL-3 + SCF ¹ ' ¹⁶² 11 ± 1 SCF-1 + SCF ¹ ' ¹⁶² 4 ± 0

example

Expression of recombinant SCF in Chinese hamster ovary cells

This example applies to a stable mammalian expression system, SCF secretion from CHO (ATCC CCL 61, dHFR-).

A, Recombinant rat SCF

V19.8 (Fig.17) was a carrier for expression used to obtain SCF. The selectable marker for stable genes contained the dihydrofolic reductase plasmid pDSVE I, a gene. pDSVE 1 (Figure 18) is a derivative engineered by pDSVE under the action of a saline enzyme and ligated to an oligonucleotide moiety.

5 'TCGAC CCGGA TCCCC 3'

3 'GGGCCT AGGGG AGCT 5'

The carrier pDSVE is described in U.S. Pat. 025344 and 152045, in footnotes. Part of the V19.8 and pDSVE transporter has long homologies, including the bacterial replication source CO 1 EI and the ampilin resistance gene and the 2-40 replication source. This determines homologous recombination during the transformation process and, in connection with this, leads to transformation.

Calcium phosphate precipitate was prepared in V19.8 SCF constructs and pDSVE-1 in the presence of 10 mg of murine DNA carrier using 1 or 0.1 mg of pDSVE-1 exposed to endonuclease FVUI and 10 mg of V19.8 SCF. Colonies were selected for gene expression by DHFR from pDSVE-1. Colonies that grow in the absence of hypoxanthine and thymidine were selected by cloning cylinders and expanded as cells. lines. The upper layer cells were assayed for MC / 9 ³ H thymidine uptake. The results are shown in Table 7.

table

Absorption of stable CHO surface cells from transfected rat CHO-DNA cells, MC / 9 ³ H thymidine

Transfected DNA

Transfers. DNA Conditioning media to be tested volume Pulse / min V19.8 SCF ¹ ' ¹⁶² 25th 33926 12th 34973 6th 30657 3 14714 1.5 7160 there is no 25th 694 12th 1082 6th 860 3 672 1 1354

B. Recombinant human SCF

SCF expression in CHO cells was achieved using the pDSVRa2 expression transporter described in serNo 501904 dated 29.03.1990 in the footnotes. This vector contains a gene for selection and clone amplification based on the expression of the gene DHFR. The clone pDSVRa2 SCF was generated in a two-step process. V19.8 SCF was exposed to BamHI and ligated to pGEM3. DNA from pGEM3SCF was exposed to HindIII and SalI and ligated to pDSRa2 exposed to HindIII and SalI. The process was repeated for human genes by encoding the COOH-terminus at amino acid positions 162, 164 and 183 (Fig. 15C) and 248 at Fig. 42.

The generated cell lines were screened with methotrexate (Shimre, Meth.in Enzym. 151, 85-104, 1987) at 10 nm to increase the expression of the DHFR and SCF genes. Scream. human SCF expression levels were analyzed by radioimmunoassay, such as 7 and / or induction of colony formation in vitro using human peripheral blood

leukocytes. The assay was performed as described in Example 9 (Table 12) except that incubation was with 20% oxygen, 5% carbon dioxide and 75% nitrogen in human EPO (10 units / ml). Table 8 - Results of a typical experiment. Expression of the human SCF1-164 of the CHO clone was placed in the ATCC (CRL 10557, 25.09.1990) and named HiSCF17.

table

Analysis of HPBL Colonies from Conditioning Media from CHO-Stable Cell Line Transfected with Human SCF DNA

Transfected DNA Average sample (ml) Colony count / 100000 pDSRa2 hSCF ¹ ' ¹⁶⁴ 50 53 25th 45 12.5 27th 6.25 13th pDSRa2 hSCF ¹ ' ¹⁶² 10th 43 5 44 2.5 31st 1.25 17th 0.625 21st none (CHO control) 50 4

example

Expression of recombinant SCF in E.coli

A. Recombinant rat SCF

This example is the expression of SCF polypeptides in E.coli encoding DNA sequences / Met1 / rat SCF ¹ ' ¹⁹³ (Fig. 14C). Although any carrier can be used for protein expression, the following DNA plasmid, pCFM1156 (Fig.19), is used. This plasmid is readily constructed from pCFM 836 (U.S. Pat. No. 4,710,473) by cleaving two endogenous parts of NdeI using the T4 polymerase following blunt-end ligation and replacing the small DNA sequence between dal and Kpn1 with the small nucleotides shown below.

5 'CGATTTGATTCT AGAAGGAGGAAT AAC ATA TGGTTA ACG CGT TGG AAT TCGGTAC 3'

3 'TAAACTAAGATCTTTCCTCCT TAT TGTATACC AATTGCG CAACCTTAA C 5'

Controlled protein expression in pCF M 1156 plasma using a synthetic stimulator. A synthetic oligonucleotide linker was prepared for the first three amino acid residues of the rat SCF polypeptide (Glu, Gln, lle) by providing the Met initiation codon and restoring the codon.

5 'TATGCAGGA 3'

3 'ACGTCCTCTA 5' with Nd ei and Bglll residues. The small nucleotide and fragment of the rat SCF gene was inserted into pCFNI 156 by ligation at a unique position in the NdeI and Sstil plasmid shown in Figure 19. The pCEMI plasmid of SCF1-193 expression is the product of this reaction.

Plasmid pCFM 1156 rat SCF1-193 was transfected into competent FM E.coli cells. Plasmid selection was based on resistance to the marker gene antibiotic (canomycin). Plasmids were separated from cultured cells and synthetic polygonucleotides by DNA sequencing and confirmed their binding to the rat SCF gene by DNA sequencing.

Plasmid pCFM I 156 rat SCF ¹ ' ¹⁶² coded (Met' ¹ ) rat SCF ^{1 162} polypeptide fragment from EcoRL to SstII was isolated from V19.8 rat SCF ¹ ' ¹⁶² and ligated into pCEM rat SCF ¹ ' ^{193 at} unique positions such that by replacement of the coding regions by carboxylic residues in the rat SCF gene.

Plasmid pCFM 1156 rat SCF ¹ ' ¹⁶⁴ and pCEM 1156 SCF ¹ ' ¹⁶⁵ encoded (Met ' ¹ ) rat SCF ¹ ' ¹⁶⁴ and (Met ¹ ) rat SCF ¹ ' ¹⁶⁵ polypeptides, respectively, had EcoRL and SstlI fragments from PCR DNA, encoding the 3 'end of SCF and reversed the position of the carboxyl terminus of the DNA encoded SCF gene. DNA amplification was performed with primers 227-29 and 23719 in pCFM I 156 rat SCF ¹ ' ¹⁶⁴ and 227-29 and 237-20 in pCFM 1156 SCF ¹ ' ¹⁶⁵

B. Recombinant rat SCF

This example describes expression in E.coli cells of a human SCF polypeptide by encoding DNA (Met ¹ ) in human SCF ¹ ' ¹⁶⁴ and (Met' ¹ ) in human SCF ¹ ' ¹⁸³ (Fig. 15C). The plasmid with V19.8 human SCF ¹ ' ¹⁶² carrying the human SCF ¹ ' ¹⁶² gene was used as a template for PCR amplification of the human SCF gene.

Oligonucleotide primers 227-29 and 237-19 were used for PCR DNA generation and acted on the endonucleases Pstl and Sstl. By providing a Met initiation codon and restoring codons for the first four amino acids of the human polypeptide SCF (Glu, Gly, Ile, Cys), a synthetic oligonucleotide linker with NdeI and Pstl ends was prepared.

5'TATGGAAGGTATCTGCA 3 '

3 'ACCTTCCATAG 5'

A small oligolinker derived from the human SCF gene was ligated into pCEM 1156 (as previously described) at unique sites in the NdeI and Pstl plasmid shown in Figure 19.

Plasmid pCEM 1156 human SCF ¹ ' ^{164 was} transformed into FM5 E.coli competent cells. Plasmid cells were selected for resistance to the marker gene antibiotic (canomycin). The plasmids were separated from the cultured cells and the DNA gene sequences were confirmed by DNA sequencing.

Plasmid pCEM 1156 human SCF ¹ ' ¹⁸³ coding polypeptide (Met' ¹ ) human polypeptide SCF ¹¹⁸³ (Fig. 15C), restriction fragments from EcoRL to HindIII encoding the carboxyl terminus of the human SCF gene, was isolated from pGEM human SCF 114-183 (described in below), restricting fragments from Sstl to EcoRI encoding the N-terminus of the human SCF gene and was isolated from pCEM 1156 human SCF1-164, and a large fragment from HindIII and Sstl from pCEM 1156. Three DNA fragments were ligated together to form pCEM 1156 human SCF1183, which was transformed into FMS E.coli. After selection for canomycin resistance, plasmid DNA was isolated and the correctness of the DNA sequences was verified by arrangement.

Plasmid pGEM3 human SCF114-183 is a derivative of pGEM3 which has an EcoRI-SpHI fragment spanning nucleotides 609 to 820, shown in Figure 15C. EcoRI-Sphl activation was isolated from PCR using oligonucleotide primers 235-31 and 241-6 (Fig.12C) and PCR 22.7 (Fig.13B) as a template. Sequence 241-6 is based on the human sequence from the 3'-end of an axon having a 176 amino acid codon.

Fermentation of CEcoli to form human SCF ¹ ' ¹⁶⁴

To obtain SCF ¹ ' ¹⁶⁴ , fermentation was performed in 16-liter fermenters using FM5 E.coli K12 containing the plasmid pCFM 1156 in human SCF 1-164. The culture strains were stored at -80 ° C in 17% glycerol in Luria medium. For seeding, 100 ml of the thawed strain was transferred to a 500 ml two-liter Erlenmeyer flask of Luria medium and left overnight at 30 ° C on a shaker (250 rpm).

The following fermentation conditions were used to obtain the E.coli biomass used as starting material for purification of human SCF ¹ ' ¹⁶⁴ .

The strain culture was aseptically transferred to a 16 liter fermenter containing 8 L of medium (see Table 9). The cultures were grown to an optical density OD ₆ oo = 3.5. Using a peristaltic pump, the fermenter was used to sterilize the inoculum (inoculation 1, Table 10), controlling the inoculation rate. The growth rate of the drill was exponential and the growth rate was 0.15 l / h. During the growth phase, the temperature was about 30 ° C. Dissolved oxygen concentration in the fermenter was controlled automatically with 50% oxygen saturation, air supply control, agitation rate, vessel pressure, and oxygen supply control. pH 7.0 was adjusted automatically using phosphoric acid and ammonia. At an OD _{6 of} 30, the temperature is raised from 30 ° C to 42 ° C and induction is thereby achieved. At the same time, inoculation 1 was terminated and inoculation 2 (Table 11) was started at a rate of 200 ml / h. About 6 hours later. after raising the temperature, the fermenter contents were cooled to 15 ° C. The yield of SCF 1-164 was approximately 30 mg / OD-L. The biomass was centrifuged at Beckman J6-B, 3000xg for 1 h. The biomass was stored in a 70 ° C refrigerator.

The method selected in SCF 1-164 is analogous to the method described above except for the following modifications:

I

1. Seeder 1 is not dispensed until the culture OD ₆ oo reaches 5-6.

2. The feed rate of the drill increases at a slower rate, resulting in a lower growth rate (approximately 0.08).

3. Culture is induced at an OD ₆ of 20.

4. Inoculate 2 at a rate of 300 ml / h.

All other operations are analogous to those described above, including the medium.

According to this process, the yield of SCF ¹ ' ¹⁶⁴ was obtained at about 35-40 mg / OD-1 in the presence of OD-25.

table

Medium composition: Yeast extract Glucose g / l 5 g / l

K ₂ HPO ₄

KH ₂ PO ₄

MgSO ₄ 7H ₂ O

NaCl

Foam extinguisher DowF-2000 5 ml / l

3.5 g / l 4 g / l 1 g / l

0.625 g / l

Vitamin solution ml / l

Metal trace solution 2 ml / l

Metal trace solution: FeCl3x6H ₂ O - 27 g / l; ZnCl ₂ x 4H ₂ O - 2 g / l; CaCl ₂ x 6H ₂ O - 2 g / l; Na ₂ MoO ₄ x 2H ₂ O - 2 g / l; CuSO ₄ x 5H ₂ O -1.9 g / l; concentrated HCL, 100 mL / L.

Vitamin solution: riboflavin 0.42 g / l; pantothenic acid 5.4 g / l; niacin 6.0 g / L, pyridoxine 1.4 g / L; biotin 0.06 g / l; folic acid 0.04 g / l.

table

Medium composition: Yeast extract Glucose MgSO.7H ₂ O Vitamin solution g / l 450 g / l

8.6 g / l ml / l

Metal trace solution 10 ml / l

Metal trace solution: FeCl3x6H ₂ O - 27 g / l; ZnCl ₂ x 4H ₂ O - 0.2 g / l; CaCl ₂ x 6H ₂ O - 2 g / l; Na ₂ MoO ₄ x 2H ₂ O - 2 g / l; CuSO ₄ .5H ₂ O -1.9 g / l; concentrated HCL, 100 mL / L.

Vitamin solution: riboflavin 0.42 g / l; pantothenic acid 5.4 g / l; niacin 6g / L, pyridoxine 1.4g / L; biotin 0.06 g / l; folic acid 0.04 g / l.

Table Seeding Composition: Tripton Yeast Extract Glucose

172 g / l Example 86 g / l 258 g / l

Immunoassays for the detection of SCF

Radioimmunoassay procedures (RIPs) were used to quantify SCF in samples and were performed as follows.

The SCF preparation from BRL 3A cells purified as in Example 1 was incubated with antiserum for 2 hours. 37 ° C. After 2 or. incubation tubes with samples were chilled on ice, ¹²⁵ J-SCF was added, and the tubes were incubated at 4 ° C. 20 or. each tube contained 500 ml incubation mixture of 50 ml diluted antiserum, -60,000 ort ¹²⁵ JSCF (3.8x10 ⁷ sp / mg) 5 ml trazylol, and 0-400 ml standard SCF with buffer (phosphate buffered saline, 0.1% calf albumin) serum, 0.05% triton Χ-100, 0.025% azide) while maintaining a constant volume. The antiserum contained rabbit blood from a second test immunized with 50% pure SCF from BRL 3A. The final dilution of antiserum in the sample was 1: 2000.

Antibody ¹²⁵ J-SCF bound was precipitated by addition of 150 ml Staph A (Calbiochem). After 1 or. at room temperature, the samples were centrifuged and the pellet was washed twice with 0.75 mL Tris-HCl pH 8.2 containing 0.15 M NaCl, 2 mM EDTA, 0.05% Triton Χ-100. The washed sediment was converted to gamma counter with a ^125% J-SCF binding percentage. Serum-free connections were calculated and separated from final values to correct for nonspecific deposition. A typical RIP is shown in Fig.20. ^J-125 SCF-connection box with the unlabeled standard, the percentage of inhibition is dose dependent (Figure 20) and as shown in Fig.20B, testing immuno-precipitated sediment by SDS-PAGE and autoradiography par ¹²⁵ J-CSF-protein (see FIG .20B) portion of 1- ¹²⁵ J-SCF, 2,3,4, and 5-immuno-precipitated ¹²⁵ J-SCF, compared to 0.2, 100 and 200 g SCF standard, respectively. As determined by both methods, the decrease in precipitated antibodies observed in RIP tubes and the decrease in immunoprecipitated ¹²⁵ J-SCF-protein coupling (migration at about M _r = 31,000) and polyclonal antiserum recognized standard SCF purified according to Example 1.

We also used Western procedures to detect recombinant SCF isolated in E.coli in COS-1, CHO cells. Partially purified, expressed in E.coli, rat SCF ¹ ' ¹⁹³ (Ex. 10), expressed in COS-1 rat SCF ¹¹⁶⁴ and SCF ¹ ' ¹⁹³ , as well as human SCF ¹ ' ¹⁶² (Ex. 4 and 9). ), and expressed as a cell in CHO rat SCF ^1-162 ( ^Example 5)

SDS-PAGE. After electrophoresis, protein bonds were transferred to a 0.2 mM nitrocellulose apparatus with Bio-Rad Transbiot at 60 V for 5 hours. The nitrocellulose membrane was blocked for 4 hours. in phosphate buffer pH 7.6 containing 10% goat serum followed by 14 hours. incubated at room temperature with 1: 200 dilution of each rabbit preimmune or immune serum (immunization described above). Serum-antibody complexes were monitored using peroxidase-conjugated goat anti-rabbit IgG reagents (Vector Laboratories) and color reagent 4-chloro-1 naphthol.

Two examples of Western analysis are shown in Figures 21 and 22. Figure 21 areas Zi in 5-200 ml were obtained from COS-1 human EPO cells (COS-1 transfected with V19.8 EPO); 8 area colored molecular weight markers.

1-4 incubated with preimmune serum. Immune serum specifically recognizes a diffuse bond M _r = 30,000 daltons with SCF ' ¹ ' ¹⁶² derived from COS-1 cells but not with human EPO derived from COS-1 cells.

Figure 22 Areas 1 and 7 of partially purified rat SCF ¹ ' ¹⁹³ obtained from E.coli', Areas 2 and 8 of rat SCF ¹ ' ¹⁹³ obtained from COS-1 cells from wheat grain purified on agglutinin-agarose; 4 and 9 - rat SCF ¹ ' ¹⁶² obtained from COS-1 cells from wheat grain, areas 5 and 10 purified on agglutinin-agarose; Lane 6 - rat SCF ' ¹ ' ¹⁶⁴ derived from wheat family CHO cells purified on agglutinin-agarose; and area 6, stained molecular weight markers.

Areas 1-5 and 6-10 were incubated with rabbit preimmune and immune serum, respectively. Derived from E.coli rat SCF ' ^{1 193} ( ^lanes 1 and 7) migrated with Mr = 24,000 daltons, while rat SCF' ¹ ' ¹⁹³ derived from CO-1 cells (lanes 2 and 8) migrated with Mr = 24 -36,000 Daltons. This difference in molecular weight was expected because mammalian cells, but not bacteria, are capable of glycosylation.

Transformation of encoded rat SCF ' ¹ ' ¹⁶² sequences into COS-1 cells (lanes 4 and 9) or CHO cells (lanes 5 and 10) yields expression of SCF with a lower molecular weight than when transfected with SCF ¹ ' ¹⁹³ ( ^lanes 2 and 8). areas).

Rat SCF ¹ ' ¹⁶² from COS-1 cells and CHO expression products are a series of relationships having a visible M _r between 24-36,000 daltons. The heterogeneity of the expressed SCF appears to be determined by carbohydrate variants where the polypeptide SCF is glycosylated at different sizes.

In general, Western analysis shows that rabbit immunized with mammalian natural SCF accepts recombinant SCF derived from E.coli cells, COS-1 and CHO, but does not accept any binding in a control sample composed of COS-1 derived EPO cells. Further maintaining the specificity of SCF antiserum in SCF, pre-immunized serum from the same rabbit did not react with any rat or human SCF expression product.

example

Activity of recombinant SCF in a living organism

A. Rats in SCF bone marrow transplantation

COS-1 cells were transfected with V19.8 SCF1-162 in a full set of experiments (T175 cm ² flask in place of 60 mm plates) as described in Example 4. Approximately 270 ml of the supernatant was collected and chromatographed on wheat grain agglutinin-agarose and Sepharose as described in Example 1. Recombinant SCF was evaluated in a bone marrow transplant model based on w / w ^v genetics. Mice w / w ^v have a type of cellular defect that, together with others, leads to mocrocyte anemia (large red cells) and enables bone marrow transplantation from normal animals without the need for irradiation in recipients (Russel et al., Sci. 144, 844-846, 1964). Normal donor species cells overgrow defective cells after transplantation.

In the example presented, there were 6 mature mice in each group. Bone marrow was collected from normal donor mice and transplanted into w / w ^v mice. The blood of the animal recipient was tested several times after transplantation; Bone marrow transplantation is performed by transferring peripheral blood from the recipient to the donor phenotype. Conversion from the recipient to the donor phenotype occurs by monitoring the subsequent red blood cell scattering profile (FASCAM, Becton Dickenson). The profile of each transplanted animal was compared with that of the control animal donors and recipients at each time point. Comparisons were made using computer programs based on Kolmogorov-Smirnov statistics for histogram analysis of running systems (Young.J.Histochem & Cytochem, 25, 935-941, 1977). An independent measure of quality of gain is the hemoglobin type as determined by electrophoresis of the hemoglobin recipient's blood (Wong et al.

Mol. & Cell. Biol., 9, 798-808, 1989), and agrees well with the properties of Kolmogorov-Smirnov statistics.

Approximately 300,000 cells were transplanted without SCF treatment (control group Figure 23) from C56BL / 6J donors for w / w ^v recipients. The second group received 300,000 cells treated with SCF (600 units / ml) at 37 ° C for 20 min. and co-administered (pre-treatment group, Fig. 23). One SCF unit was found to give semi-maximal stimulation in the MC / 9 bio-sample. The third group of mice was injected subcutaneously (sub-Q) at approximately 400 units. SCF / day, 3 days after transplantation of 30,000 donor cells (group of subcutaneous injections, Fig. 23). As shown in Figure 23, bone marrow healing is faster in both treated SCF groups than in the untreated control group. 29 days after transplantation, the pretreated group was converted to the donor type.

This example illustrates the benefits of SCF therapy for bone marrow transplantation.

B. Rat SCF activity in live mice

Mutations in the Sl-locus result in failure of hematopoietic, pigmented, testicular cells. The hematopoietic defect results in a reduction in red blood cell counts (Russel & Al Gordon, Regulation of Hematopoises, Vol. 1, 649-675, AppietonCent.-Crafts, NY, 1970), neutrophils (Ruscetti, Proc.Soc.Exp.Biol.Med. , 152, 398 (1976)), monocytes (Shibata, J.lmm. 135, 3905, 1985), megakaryocytes (Ebbe, Exp. Hemat. 6, 201, 1978), cell-killers (Clark, Immunogenetics, 12, 1978). 601, 1981) and mast cells (Hayachi, Dev.Biol, 109, 234, 1985). Bronchial mice are poor recipients of transplanted bone marrow because of their reduced ability to maintain natural cells (Banneman, ProgHematol, 8, 131, 1973).

The gene encoding SCF was deleted in bronchodilated (S1 / S1) mouse.

Bronchial mice are sensitive to SCF activity in an in vivo model. Different SCF recombinant proteins were assayed in Steel-Dickie (S1 / S1) mice at various time points. Steel mice (WCB6F1-S1OS1 ^d ), 6-10 weeks old, were obtained from Jackson Labs, Bar Harbor, M E. Peripheral blood was monitored on a cell counter SYSMEX F-800 (Baxter, Irvine, CA): red cells, hemoglobin, and platelets. For white blood cell counting (BCC), Goulter Channelizer 256 (Coulter Electronics, Marietta GA) was used. In an experiment, Figure 24, Steel-Dickie mice were treated with SCF1-164 produced by E.coli purified as 10 e.g. 100 mg / kg / day for 30 days followed by 30 mg / kg / day for 20 days. The protein was in saline (Abbots Lab, N.Chicago), IL + 0.1% bovine serum. The injections were given subcutaneously every day. Peripheral blood monitoring was performed via tail bleeding of 50 mL at the indicated time in Figure 24. Blood was collected with 3% EDTA in rinsed syringes and poured into rinsed EDTA microfuge tubes (Brinkmann, Westburg NY). Significant correction of macrocytic anemia in treated animals was observed compared to control animals. Upon discontinuation of the treatments, the treated animals returned to their original position of macrocytic anemia.

In the experiment shown in Figures 25 and 26, Steel-Dickie mice were treated with different forms of recombinant SCF as described above, but at a dose of 100 mg / kg / day for 20 days. Two forms of E.co//- rats prepared SCF, SCF ¹¹⁶⁴ and SCF ^1-193 derivatives as described in Example 10. Additionally, E.coli ^was modified by SCF ^1-164 by the addition of polyethylene glycol (SCF ^1-164 PEG 25) as tested in Example 12. The CHO derivative SCF ^1-164 obtained as Example 5 and purified as Example 11 was also screened. The animals' blood was drawn by cardiac puncture, 3% EDTA-flushed syringes and poured into EDTA-flushed tubes. The profiles of peripheral blood after 20 days of treatment are shown in Fig.25 for white blood cells (BKK) and Fig.26 for platelets. Different BKK SCF ^{1-164 for} PEG 25 group are shown in Fig.27. Absolute increases in neutrophils, monocytes, lymphocytes and platelets are recorded. Particularly strong effects are observed with SCF ^1-164 PEG 25.

Independent measurement of lymphocyte sets was also performed; data are shown in Fig.28. Murine equivalent of human CD4, or T3 helper cell marker is L3T4 (Dialin, J. Immun. 131, 2445, 1983).

Lut-2 is a murine antigen in cytoxic T-cells (Ledbetter, J.Exp.Med, 153, 1503, 1981). Monoclonal antibodies against these antigens were used to evaluate T-cell sets in treated animals.

Whole blood for the T-lymphocyte kit was stained as follows. 200 μΙ of whole blood was collected from animals individually into EDTA-treated tubes. Each blood sample was lysed with sterile deionized water for 60 sec and then rendered isotonic with 10xDilbecco's phosphate-buffered saline (FBF) (Gibco, Grand Islan, NY). This lysed blood was washed twice with IXDulbecco's phosphate-buffered saline (Gibco, Grand Island, NY) supplied with 0.1% bovine serum (Flow Lab. McLean, Va) and 0.1% sodium azide. Cell pellets (containing 200000-105 cells) were resuspended in 20 μΙ rat pre-mouse L 34T conjugated with phycoerythrin (FE) (Beckton Dickinson, Mountain Vievv) and 20 μΙ rat pre-mouse Lyt-2 conjugated with fluorescein isothiocyanate (4). ° C) for 30 min. (Beckton Dickinson). After incubation, cells were washed twice with IX FBR. Each blood sample was then analyzed on an AC sap cell analysis system (Beckton Dickinson, Mountain View, CA).

This system was standardized with standard pre-compensation procedures and calibration beads (Beckton Dickinson, Mountain Vievv, CA). These data showed absolute growth of both cellular T-helper and cytoxic T-cell.

C. SCF activity in living primates

Human SCF ¹ ' ¹⁶⁴ , isolated from E.coli (Ex. 6B) and reconstituted as Ex. 10, studied in vivo biological activity. Adult male baboons (Papio sp.) Were divided into 3 groups: 1) untreated, n-3; 2) SCF 100 mg / kg / day, n-6; 3) SCF 30 mg / kg / day, n6.

The treated animals received daily subcutaneous injections. Samples for complete blood, reticulocytic and platelet counts were taken on days 1, 6, 11, 15, 20 and 25 of treatment.

All animals underwent the procedure and had no adverse reactions to SCF therapy. The BKK count increased with animals receiving 100 mg / kg / day as shown in Fig.29. Differential counting was performed by Wright Giemsa peripheral blood stain staining and is also shown in Fig.29. Absolute growth of neutrophils, lymphocytes and monocytes was recorded. As shown in Figure 30, hematocrit and platelet growth at 100 mg / kg / day was also present.

Human SCF (hSCF 1-164 modified by the addition of polyethylene glycol as in Example 12) was also tested with baboons at a dose of 200 mg / kg / day, prolonged intravenous administration, and compared with unmodified protein. Animals received SCF from day 0 to day 28. The peripheral BKK results are shown in the following table. PEG-modified SCFs showed earlier growth of peripheral BKK than unmodified SCFs.

Treatment 200 mg / kg / day hSCF 1-164

Animals M88320 Animals M88129 day BC day BC 0 5800 0 6800 +7 107,000 7+ 7400 +14 12600 +14 209000 +16 22000 +21 18400 +22 31100 +23 24900 +24 28100 +29 13000 +29 9600 +30 23000 +36 6600 +37 12100 443 5600 +44 10700

+51 7800

Treatment 200 mg / kg / day PEG-hSCF 1-164

Animals M88350 Animals M89116 day BC day BC -7 12400 -5 7900 -2 11600 0 7400 +4 24700 46th 16400 +7 20400 +9 17100 +11 24700 +13 18700 +14 32600 +16 19400 +18 33600 +20 27800 +21 626400 +23 20,700 +25 16600 +27 20200 +28 26900 +29 18600 +32 9200 +33 7600

example

Recombinant human SCF activity

Human SCF corresponding to amino acids 1-162 obtained by PCR reaction described in ED, for example, was expressed in a COS-1 cell as described for Example 4 SCF. COS-1 was tested in human bone marrow fluid as well as in murine HPP-SCF and MC / 9 samples. Human protein was inactive at the assay concentration range in any murine assay; meanwhile, it was active in human bone marrow testing. Analytical culture conditions were as follows: healthy volunteers bone marrow centrifuged Fco11-Hypaque gradient (Pharmacia) and cultivated in the system of 2.1% methylcellulose, 30% fetal calf serum, 6x10 ^"5 M 2merkaptoetanolio, 2 mM glutamine, won medium (GIBCO), 20 units / ml of EPO and 1x105 ⁵ cells / ml for 14 days in an atmosphere containing 7% O ₂ , 10% CO ₂ and 83% N. Table 12 shows the colony numbers generated in the presence of recombinant human and rat SCF COS-1 sediment fluids. . Colonies of 0.2 mm or larger are indicated.

table

Growth of colonies affected by SCF in human bone marrow

Plasmid transfection Content of CM under investigation Colonies / 100,000 (μΙ) cell + standard deviation V 19.8 () 100 0 50 0 V19.8 Human SCF 1-162 100 33 ± 7 50 22 ± 3 V 19.8 Rats SCF 1-162 100 13 ± 1 50 10th

Colonies grown over 14 days are shown in Fig.31A. (12x magnification). The arrow marks a simple colony. By its size, such a colony resembles murine HPP-SCF colonies (0.5 mm average). Due to the presence of EPO, some of these colonies are hemoglobunized. By isolating such colonies and centrifuging them on slides using Cytospin (Shandon) with subsequent staining with White Gemza, a particular cell type had a non-differentiated cell with a high nuclear / cytoplasmic ratio as shown in Fig. 31B (magnified 400x). The arrows in Fig. 31B show the following structure: 1 arrow-cytoplasm; 2-nucleus; 3-vac. Non-submerged 4019 B cells as a class are large and become smaller depending on the degree of maturation (Digss et al., Morphology of Human Blood Cells, Abbot Labs, 3, 1978). The nucleus of the early cells corresponds to the cytoplasm in terms of hemopoietic maturity. In addition, the cytoplasm of immature cells stains the White Gemza deeper than the nucleus. As the cells mature, the nucleus acquires a darker color than the cytoplasm. The cellular morphology of human bone marrow derived from culture in the presence of recombinant SCF agrees with the finding that the target and the SCF product are relatively immature hematopoietic precursors.

Recombinant human SCF was tested in agarized colony assays for bone marrow effects in combination with other growth factors as described above. The results obtained are shown in Table 13.

Synergism occurs in the presence of G-SCF, GM-SCF, IL-3 and EPOn, increasing the degree of bone marrow target proliferation in individual SCF cases.

table

Synergism of recombinant human SCF in the presence of other factors that stimulate human colonies

Imitation Colony, 10 ⁵ cells / 14 days hG-SCF 32 ± 3 hG-SCF + hSCF 74 ± 1 hGM-SCF 14 ± 2 hCM-C + hSCF 108 ± 5 hLL-3 23 ± 1 hIL-3 + hSCF 108 ± 3 hEPO 10 ± 5 hEPO + iL-3 17 ± 1 hEPO + hSCF 86 ± 10 hSCF 0

Another activity of human recombinant SCF manifests itself in its ability to induce cellular proliferation (AMI) KG-1 (ATCC CCI 246) of acute human myelogenous anemia cell line on semi-solid agar. COS-1 precipitated fluid from the transfected cells was cloned onto agar KG-1 (Koefflor et al., Sci. 200, 1153-1154, 1978), using the procedure described except that the cells were seeded at 3000 / ml. Table 14 shows the mean results of triplicate cultures.

table

Cloning assay on semi-solid agar KG-1

Transfected plasmids Test volume, μΙ 30000 cell colony + avg. fall V19.8 25th 2 ± 1 V19.8 Human SCF1 -162 25th 14 + 0 12th 8 ± 0 6th 9 ± 5 3 6 ± 4 1.5 6 ± 6 V19.8 Rats SCF 1 -162 25th 6 ± 1 human GM-SCF 50/5 mg / ml 14 ± 5

example

Purification of recombinant SCF-expressed E.coli products

E.coli was fermented by human SCF ¹¹⁶⁴ according to the procedure of Example 6C. The biomass (wet weight biomass 912 g) was suspended in water to a volume of 4.6 L and disrupted three times through a laboratory homogenizer (Gaulin 15MP-8TBA) at 55158 kPa. Centrifugation gave a fraction of cell pellets (17700 x g, 30 min, 4 ° C), washed with water (resuspension and recent centrifugation), and finally suspended in water to 400 mL.

After centrifugation, the sediment fraction containing insoluble SCF (estimated amount of SCF 10-12 g) was added to 3950 ml of the respective mixture so that the final concentration of the components of the mixture was 8 M urea (high purity), 0.1 mM EDTA, 50 mM sodium acetate, pH 6. -7, SCF concentration was estimated as 1.5 mg / ml. To dissolve SCF, incubate at room temperature for 4 hours. The remaining undissolved material was removed by centrifugation (17700xg, 30 min, room temperature). Repeatedly (acidification in dissolved SCF), the precipitated fraction was slowly added with stirring to 39.15 l of the corresponding mixture so that the final concentration of the components was: 2.5 M urea (high purity,

0.01 mM EDTA, 5 mM sodium acetate, 50 mM Tris-HCL, pH 8.5, 1 mM glutathione, 0.02% (w / v) sodium azide. The SCF concentration was determined to be 150 µg / ml. After 60 or so. at room temperature (less than 20 hours can be stored), the mixture was concentrated twice using a Millipor Pelicon ultrafiltration unit with three polysulfone membranes, m.p. mass 10,000, in cartridges (total area 1.39 m ² ) and then diafiltered in 7 volumes of 20 mM Tris-HCl, pH8, respectively. The temperature during concentration (ultrafiltration) was 4 ° C, the flow rate was 5 l / min and the filtration rate was 600 ml / min. The final volume was 26.5 I. Using SDS-PAGE with or without samples, it is clear that a large fraction (> 80%) of the SCF fraction of the fraction is dissolved after centrifugation by incubation with 8 M urea and that after acidification, much is present in the system. SCF forms as shown by the SDS-PAGE of the unrestored sample. The basic form, which is like correctly acidified SCF (see below), migrates with M _{r of} about 17,000 (unreduced) relative molecular weights of the (reduced) markers described in Figure 9 with footnote. Many forms contain material migrating with M _r 18-20000 (unreduced), apparently having SCF with incorrect disulfide bonds; forming SCF polypeptide chains covalently linked to form dimers or large oligomers. The final steps of fractionation lead to the removal of residual E.coli impurities and unwanted forms of SCF, resulting in the purification of SCF to a homogeneous and biologically active state.

The pH of the ultrafiltrated retentate was adjusted to 4.5 by the addition of 375 ml of 10% (v / v) acetic acid and the material precipitated out. After 60 min, when most of the sediment was deposited on the bottom, the upper 24 L were decanted and filtered to clear through Sipo 30 SP filters at 500ml / hr. The filtrate was then diluted 1.5 times with water and 4 ° C. allowed a fast flow of 25 mM sodium acetate, pH 4.5, equilibrated through a column (9x18.5 cm) with S-Sepharose (Pharmacia). The column flow rate was 5 l / h and temperature 4 ° C. After skipping the sample, the column was washed with 5 volumes (6 L) of buffer and eluted with 0-0.23 M NaCl column buffer bound to the column material. The total volume of the gradient was 20 L and fractions were taken in 200 ml. The elution profile is shown in Fig.33. Aliquots of the fraction (10 μΙ) collected from the column with S-Sepharose were analyzed by SDS-PAGE with and without sample reduction (Fig.32A). From this analysis, it is apparent that practically all absorption was in the 280 nm region (Fig.32 and Fig.33) and could be attributed to SCF.

The correctly oxidized form first corresponds to the absorption peak (fraction 22-38, Fig. 33). Forms with a small amount that can be visually observed in fractions activate a mis-oxidized material with M _r 18-20,000 on SDS-PAGE (unreduced) to represent the main peak absorption arm (Fractions 10-21, Fig. 32B); and the disulfide bonded dimeric material is present throughout the absorption interval (fractions 10-38, Fig. 32B).

Fractions 22-38 were removed from the column with S-Sepharose and the pH of the resulting mixture was adjusted to 2.2 by the addition of approximately 11 mL of 6 N HCl and passed through a C4 Vudac column (height 8.4 cm, diameter 9 cm) equilibrated with 50% ethanol (v / v). 12.5 mM HCl solution (A) at 4 ° C. The resin was prepared by dry column resin suspension in 80% ethanol (v / v), 12.5 mM HCl (solution B) and equilibrated with solution (A). Prior to obtaining the samples, use an empty gradient from solution A to solution B (pit volume 6 L) and then equilibrate the column again with solution A. After receiving the samples, the column was washed with 2.5 IA and the SCF bound to the column material was eluted with solutions AB (total volume 18). I), velocity 2670 ml / h. 286 fractions of 50 mL were taken and aliquots analyzed for absorbance at 280 nm (Fig.35) as well as SDS-PAGE (25 μΙ from fraction) according to the above description (Fig.34A, reducing conditions; Fig.34B non-reducing). terms). Fractions 62-161 containing correctly oxidized SCF in a well purified state (relatively large amounts of incorrectly oxidized monomer with M _r 18-20000 (unreduced) were subsequently eluted in gradient medium (fractions 166-211), and the disulfide bonded dimeric material was also eluted later ( approximately 199-235 fractions) (Fig.35).

Methods were used to remove ethanol from the resulting mixture of 62-161 fractions and to concentrate SCF using ion-exchange resin with rapid O-sepharose flow (Pharmacia). The mixture (5 L) was diluted with water to a volume of 15.625 L, with an ethanol concentration of about 20% (v / v). Subsequently, 1 M Tris-base (135 mL) was added to adjust pH-8 and an additional 1 M Tris-HCl: pH 8 (23.6 mL) was added to give a total concentration of Tris 10 mM. Thereafter, 10 mM Tris-HCl was added at pH 8 (15.5 L) to bring the total system volume to 31.26 L and ethanol concentration to 10% (v / v). Subsequently, the material was passed through a column of Oepharose with 10 mM Tris-HCl equilibrated in a fast flow (6.5 cm height, 7 cm diameter) at 4 ° C. pH 8, followed by washing the column with 2.5 I column buffer. The flow rate during sampling and flushing was 5.5 l / h. In order to elute the SCF-bound material, 200 mM NaCl, 10 mM Tris-HCL, pH 8, 200 mL / h was passed through the column in the opposite direction. speed. Fractions were taken at 12 mL and analyzed at 280 nm absorbance and also by SDS-PAGE as described above. Fractions 16-28 (157 mL) were removed.

The mixture-containing SCF was then analyzed by two separate chromatography (78.5 mL each test) on a gel filtration column (5 x 138 cm) with Sephacryl S-200 HP (Pharmacia); after equilibration with phosphate buffer at 4 ° C. Fractions were taken at 15 ml at a flow rate of 75 ml / h. In each case, the main peak at an absorption wavelength of 280 nm. eluted with appropriate volumes of 1370-1835 ml. The fractions from the two indicated columns yielding the peaks were combined into a single mixture of 525 ml volume containing ca.

2.3 g SCF. This material was sterile filtered using Millipor Milipak membranes.

On the other hand, the material from the C4 column may be concentrated by ultrafiltration and subjected to buffer exchange prior to sterile filtration.

Isolated recombinant human SCF ^1-164 has a high purity grade (> 98% by SDS-PAGE for silver staining) and is considered to be pharmacologically pure. Using the methods described in Example 2, the resulting material was found to have the amino acid sequence corresponding to the resulting SCF gene analysis and to have the N-terminal amino acid sequence Met-Glu-Gly-lle ... as expected with the Met coding initiation codon, respectively. .

By methods comparable to those described for human SCF ^1-164- expressed E. coli, SCF ^1-164 (also in the form of an insoluble form of the cell) can be isolated in a purified state with a high degree of biological activity. Human SCF ^1-183 and rat SCF ^1-193 can be isolated in an analogous manner. Rats in the formation of SCF ^1-193 (oxidation tends to form various oxidized derivatives) may complicate removal by chromatography. Rat SCF ^1-193 and human SCF ^1-183 can be proteolytically degraded in the early stages of excretion. The primary site of proteolysis is between residues 160 and 170. Proteolysis can be minimized by controlling conditions such as SCF concentration, pH change, introduction of 2-5 mM EDTA into the system or other proteases (inhibitors), as well as the amount of degraded forms present in the system eliminated at appropriate stages of fractionation.

LT 4 019 B

While the use of urea as a stabilizer is stated to be a priority, other stabilizing agents, such as guanidine hydrochloride (e.g., 6 M and 0.25 M) as well as N-lauroyl sarcosine, can also be successfully used. Removal of the agents after replacement / acidification, purified SCF, by SDS-PAGE analysis, can be recovered using appropriate fractionation steps.

Also, although it is better to use 1 mM almost during duplication / oxidation. glutathione at a level or near efficacy, other conditions may be used. For example, using 1 mM glutathione, 2 mM glutathione and 0.2 mM oxidized glutathione, or 4 mM glutanion and 0.4 mM oxidized glutathione, or 1 mM 2-mercaptoethanol or other thiol reagents.

In addition to the described chromatographic techniques that can be used to isolate the SCF active form, hydrophobic chromatography (e.g., phenyl-Sepharose (Pharmacia) with a sample neutral pH of 1.7 M ammonium sulfate and gradient elution to reduce ammonium sulfate) may be employed. ; chromatography with immobilizing metals (e.g. using chelated Sepharose (Pharmacia) loaded with Cu ²⁺ ions, sample pH at near neutral using 1 mM imidazole) and hydroxylapatite chromatography (using neutral pH sample with 1 mM phosphate and gradient eluting with phosphate) ); as well as other methodologies known to those skilled in the art.

Other forms of human SCF that fully or partially correspond to the open coding amino acid sequence 1-248 or the open reading frame (Fig.44) may also be expressed in E.coli and isolated in pure form according to a procedure analogous to that described herein, as well as other methods known to those skilled in the art.

Purification and formulation of the forms containing the so-called transmembrane portion shown in Example 16 involves the utilization of detergents to include nonionic detergents as well as lipids to include phospholipid-containing liposomal structures.

example

Recombinant SCF from mammalian cells

A. Fermentation of CHO cells producing SCF

Recombinant strains of Chinese hamster ovary (CHO) cells, CHO pDSPa2hSCF1162, were cultured on microfeeders in a perfused culture system to obtain human SCF ¹ ' ¹⁶⁴ . The fermenter system was analogous to BRI 3A cell cultivation from Example 1B except that the culture medium used for CHO cells was a modified 1: 1 mixture of Dulbeck (DMEM) and nutritional Chams 12 medium (GIBCO) supplemented with 2 mM glutamine, to double the current concentration by diluting 1: 100 in Gibco medium) and 5% calf serum. The final medium was identical except for serum. The reactor was inoculated with 5.6x10 ⁹ CHO cells grown in 3 L flasks. Cells were grown to a concentration of 4 x ^{10 5} cells / ml. Subsequently, 100 g of pre-sterilized cytodex-2 micronutrient (Pharmacia) was added in 3 L of phosphate buffer. Cells were allowed to bind and cultured on these microcarriers for 4 days. The culture medium was perfused through the reactor according to glucose utilization. Glucose concentration was maintained at approximately 2.0 g / l. After 4 days, the fermenter was perfused with six volumes of serum-free medium to a protein concentration of <50 mg / ml.

The reactor was then operated in batch mode until the glucose concentration dropped to 2 g / l. After this, the reactor was operating at a constant perfusion rate of 20 l / day. The pH of the culture medium was 6.9 ± 0.3, maintained by regulating the rate of CO2 flow. Dissolved oxygen was maintained above 20% air saturation with pure oxygen as needed.

The temperature is maintained at 37 ± 0.5 ° C.

In the system described above, approximately 450 L of serum-free conditioning medium was obtained and used as starting material for purification of recombinant human SCF ¹ ' ¹⁶² .

In an analogous system, using CHO pDSPa2hSCF1-162, approximately 589 L of serum-free conditioning medium was obtained and used as raw material in rat SCF ^1-162.

B. Purification of Recombinant Expressed Rat SCF 1-162 Unless specifically labeled, all purification operations are performed at 4 ° C.

1. Concentration and Diafiltration

The conditioned serum-free medium obtained by culturing a cell pDSRa2 rat SCF ^1-162 strain according to a procedure described in section, of 0.45 gm filtered Sartokapsules (Sartorius). Several different batches (36 L, 101 L, 102 L, 200 L, 150 L) were individually concentrated and operated by diafiltration / buffer exchange. The operation described for illustration with 36 I. The filtered conditioning medium was concentrated to 500 ml using a Millippor Pelikon tangential ultrafiltration apparatus with three membranes of acetate cellulose, molec. mass 10000 (total membrane area 1.39 m ² , flow rate 220ml / min), in cartridges. This was followed by diafiltration / buffer exchange in anion exchange chromatography preparation by adding 2000 ml of 10 mM Tris-HCl, pH 6.7-6.8 to 500 ml volume to secondary concentrate, using a tangential jet ultrafiltration apparatus and repeating the operation 5 times. The concentrated / diafiltered preparation was finally 1000 ml. Concentration and diafiltration were the same for all batches of conditioned media. The protein content of the batches was determined by the Bradford method (Anal.Bioch. 72, 248-253, 1976) using calf albumin as a standard and was 70-90 pg / ml. The total volume of the conditioned medium was 589 I.

2. Anion-exchange flash chromatography with Q-Sepharose

Concentrated / diafiltered preparations from all five batches of conditioned media were pooled (total volume 5000ml). The pH was adjusted to 6.75 by addition of 1 M HCl, 2000 mL of 10 mM Tris-HCl, pH 6.7, 0.700 mm o.

The preparation was passed through an anion-exchange column with Q-Sepharose fast flow (36x14 cm; Sepharose fast flow, Pharmacia), equilibrated in 10 mM Tris-HCl buffer, pH 6.7. After omitting the sample, the column was rinsed with 28.700 mL Tris buffer. The column was then washed with 23,000 mL of a mixture of 5 mM acetic acid (1 mM glycine / 6 M urea), 20 μΜ CuSO ₄ at pH 4.5. It was then washed with 10 mM Tris-HCl, 20 mM CuSO ₄ at pH 6.7 buffer to bring the pH to neutral and remove urea and then used a salt gradient (0700 mM NaCl / 10 mM Tris-HCl, 20 µM CuSO ₄ , buffer). pH 6.7; total volume 40 L). Fractions were taken at 490 ml at a flow rate of 3,250 ml / h. The resulting chromatogram is shown in Fig.36. “MC / 9 imp / min.” Reflects biological activity at MC / 9; the above fractions were analyzed at 5 μΙ each. By elution eluates collected as well as washing solutions not shown; which had no biological activity in these fractions.

3. Chromatography on a hydrocarbon-bonded resin base.

In the assay shown in Fig.36, fractions 44-46 were pooled (11.200 mL) and EDTA was added to a final concentration of 1 mM. The material was loaded onto a C4 column (Vidak protein C4; 7x8 cm) at 200 ml / h equilibrated with buffer (A) in 10 mM Tris pH 6.7 (20% ethanol). After applying the sample, the column was washed with 1000 ml of buffer A. A linear gradient from Buffer A to Buffer B (10 mM tri with pH 6.7 / 94% ethanol) (total volume 6000 mL) was then used and fractions were taken at 30-50 mL. An aliquot of 0.5 ml aliquot of the C4 starting material, the assay and wash solutions as well as the gradient fraction was dialyzed with phosphate buffer, respectively. Such different fractions were assayed by MC / 9 analysis, with a 5 μΙ aliquot obtained in a fraction gradient; imp / min. Fig. 37.

SDS-PAGE data (Lazmli, Nature, 227, 680-685, 1970); Aliquots of different fractions with concentrating gels with 4% (w / v) acrylamide and Resolution gels with 12.5% (w / v / acrylamide) are shown in Fig.38. An aliquot of the gel samples (100 μΙ) was dried under vacuum and then redissolved in 20 μΙ of treatment buffer (reduction, e.g. with 2-mercaptoethanol) and refluxed for 5 min. before being applied to the gel. By the numbered marker molecules in the left corner. masses (reduced) as in Fig.6. The number lines represent the corresponding fractions collected in the last part of the gradient. Gels were stained with silver (Morisei, Ana.Bioch. 117, 307-310, 1981).

4. Anion-exchange flash chromatography with Q-Sepharose,

Fractions 98-124 from column C4 shown in Fig.36 (1050 mL) were decanted and diluted 1: 1 with 10 mM Tris-buffer pH 6.7, reducing ethanol concentration. The solution was then applied to anion exchange high-flow columns with Q-Sepharose (3.2x3cm, Q-Sepharose High Flow, Pharmacia), equilibrated in 10 mM Tris-HCl buffer, pH 6.7. rate 463 ml / h. After the sample, the column was washed with 135 ml of column buffer and the bound material was eluted by washing with 10 mM tris-HCl, 350 mM NaCl, pH 6.7. Reverse flow in the column was reversed to minimize the amount of eluant and 7.8 mL fractions were used during the elution.

5. Gel-filtration chromatography using Sephacryl S-200 HP

The eluted protein fractions from the salt wash step after the anion exchange high-flow column with Q-Sepharose were pooled (31 mL). 30 ml of this mixture was applied to a gel filtration column with Sefacryl S-200 (Pharmacia) (5x55.5 cm) equilibrated in phosphate buffer. Fractions of 6.8 ml were collected at 68 ml / h. The fractions corresponding to the 280 nm absorption peak were combined as the final purified product.

Table summarizes the cleaning results.

table

Results of purification of rat SCF expressed in mammals

Stage Container (ml) Total protein (mg) * Conditioning medium (almost) 7,000 28.420 Q-Sepharose fast 11.200 974 flow C4 resin 1.050 19th O-Sepharose fast 31st 20th flow Sephacryl S-200 H 82 19 **

* Determined by the Bradford method (see above, 1976) * Determined as 47.3 mg by quantitative amino acid analysis analogous to e.g. for the method described.

The purified rat SCF ¹ ' ¹⁶² N-terminal amino acid sequence is about half Gly-Glu-lle .... and half pyroGlu-GIn-ILE ... respectively for the method of Example 2 detection. The result indicates that rat SCF ¹¹⁶² is a product of proteolytic processing (cleavage residues are designated (-1) (Thr) and (+1) (Gln) in Fig. 14C). Analogously purified from conditioned media transfected CHO cells in human SCF ^1-162 (see below) had the N-terminal amino acid sequence Gln-Glu-lle as a processing product (cleavage between residues is represented by (-l) (Thr) and (+1) ) (Gln) Fig. 15C.

Using the sequence operations described above, it produces purified purified recombinant form SCF protein from CHO-expressing cells or naturally occurring human.

Additional purification techniques used to purify mammalian cell recombinant SCF derivatives include those set forth in Examples 1 and 10, as well as other methods known to those skilled in the art.

Other forms of human SCF that fully or partially correspond to the open reading frame encoded amino acids 1-248 shown in Figure 42, or encoded by another open reading frame cRNA (e.g., those depicted in the cDNA sequence, Figure 44), may also be expressed. in mammalian cells and isolated by purification methods analogous to this example as well as other methods known to those skilled in the art.

C. SDS-PAGE and glycosidation

The SDS PAGE pooled fractions from a gel filtration column with Sephacryl S-200 HP are shown in Fig. 39; such samples were applied at 2.5 μΙ (row 1). Painted silver. The molecular weight markers (position 6) were the same as in Fig.6. The substance that migrates slightly above and below the M _r 31000 marker is a biologically active substance; and the resulting heterogeneity is related to the heterogeneity of glycosylation.

For characterization, the purified glycosylation material was treated with high levels of glycosidases, analyzed by SDS-PAGE (under reducing conditions) and evaluated visually after staining with silver. The results obtained are shown in Fig.39. Position 2-Neuraminidase, Position 3-Neutraminidase and O-Glucanase, 4-Neuraminidase, N-Glucanase and N-Glucanase, 5-Neuraminidase and N-Glucanase, 7- N-Glucanase, 8-N-Glucanase without Substrate, 9- Nglycanase without substrate. The conditions were run in a system containing 10 mM 3- (cholamidopropyl (dimethylammonium) -1-propane sulfonate) (CHAP), 66.6 mM 2-mercaptoethanol 0.04% (w / v) sodium azide phosphate buffer, 30 min. at 37 ° C for incubation, and at half the concentrations indicated and with glycosidase for 18 h-37 ° C. Neuraminidase (from Arthrobacter vreafaciens provided by Callbiochem) was used at a final concentration of 0.5 units / ml. N-Glucanase (Genzim, endo-alpha-acetyl-galactosaminidase) was used at 7.5 millivnt / ml. N-glikanazę (Genzim peptide: N-glycosidase F; peptide-N ⁴ / N-acetilbeta gliukozaminil (aspartame amidase) using 10 units / ml levels.

Control incubations were performed when necessary. Such operations include: glycosidase-free incubation to confirm that the results obtained are related to the addition of glycosidase preparations; incubation in the presence of glycosylated proteins (e.g., glycosylated recombinant human erythropoietin) which are known substrates for glycosidases to confirm the activities of the glycosidase enzymes used; and incubation with glycodases but in the absence of substrate to obtain information on the role of glycosidase preparations, positive or negative, by visual observation of the bands on the gel (Figures 39, 8 and 9).

A number of conclusions can be drawn from the experiments described. Different treatments with Nglycanase (which remove both complex and high mannose N-linked carbohydrates (Tarentino et al., BioChem, 24, 4665-4671, 1988), neutraminidases (which remove sialic acid residues) and O-glycanases (which remove some Osuricids) carbohydrates) (Lambin et al., Biochem. Soc. Trans., 12, 599-600, 1984), leads to the conclusion that: both N-linked and O-linked carbohydrates exist in the system; and that sialic acid is present when in which cases, some amount of it forms 0.bound fragments The fact that N-glycanase treatment is capable of converting a heterogeneous material into a more homogeneous form according to SDS-PAGE indicates that the whole material is the same peptide and causes heterogeneity heterogeneity during glycosylation.

example

Preparation of Recombinant SCF ¹ ' ¹⁶⁴ PEC

Rats SCF ¹¹⁶⁴ , obtained by expression system according to the GA of Examples and 10 from recombinant E.coli, used as starting material for the modification of polyethylene glycol described below.

Methoxy polyethylene glycol-succinimidyl succinate (18.1 mg = 3.63 mol; SSMPEG = Sigma, No M3152, molecular weight = 5000) was added to 0.327 ml deionized water and 13.3 mg (0.727 mol) recombinant rat SCF ¹ ' ¹⁶⁴ , ¹ ml 138 mM sodium phosphate was added. , 62 mM NaCl, 0.62 mM sodium acetate, pH 8.0.

The resulting solution was gently shaken (100 rpm) at room temperature for 30 min. A 1 mL aliquot (10 mg protein) of the final reaction mixture was then passed through a gel-filtration column with Superdex 75, Pharmacia (1.6x50 cm) and eluted with 100 mM sodium phosphate buffer, pH

6.9 at 0.25 m / min at room temperature. 10 mL of eluant was discarded and then 1.0 mL fractions were taken. UV absorbance (280 nm) of the eluant was recorded continuously and the resulting spectrum was reported in Fig.40A. Fractions 25-27 were combined and sterilized by ultrafiltration through a 0.2 µm polysulfonic membrane (Gelman Sci., No. 4454) and the resulting solution was designated PEC-25. Analogously pooled fractions 28-32, sterilized by ultrafiltration, and indexed by PEC-32. The pooled fraction PEC-25 contained 3.06 mg of protein and the fraction PEC-32 had 3.55 mg of protein from the calculations using an A ₂₈ o (absorbance at 280 nm) calibration of 0.66 / 1 mg / mL of unmodified rat SCF ¹ ' ¹⁶⁴ . Unreacted rat SCF ¹ ' ¹⁶⁴ , containing 11.8% of total recombinant mixture protein, eluted in fractions 34-37. Analogic chromatographic conditions for granting unmodified rat ggpi _e-164 | k j _uavo jp _a main peak 45.6 ml (Fig.40B). Fractions 77-80 (Fig.40A) contained N-hydroxysuccinimide, a by-product of the reaction of SCF ¹ ' ¹⁶⁴ with SS-MPEC.

Potential reaction of rat SCF ¹¹⁶⁴ has an amino group of lysine residues and the alpha amino group of the N-terminus gliutamininėje residue. The PEG-25 pooled fraction contained 9. 3 moles of reactive amino groups per mole of protein as determined by spectrophotometric titration with trinitrobenzenesulfonic acid (TNBS) using the method described by Chabib (Anai.Biochem., 14: 328-336, 1966). Similarly, the pooled fraction PEG-32 had 10.4 moles, whereas unmodified rat SCF ¹ ' ¹⁶⁴ had 13.7 moles of reactive amino groups / mole protein, respectively. In this way, an average of 3.3 (13.7 0.4 MINUS) rat SCF ^{1 '164} amino combined fraction PEG-32 is modified in accordance with a SSMPEC. Similarly, an average of 4.4 rats in the mixed fraction of SCF ¹ ' ¹⁶⁴ amino acids PEG-25 are suitable for modification. Human CF / nSCF ¹ ' ¹⁶⁴ obtained according to Example 10. the methodology has also been modified using the above methodologies. 714 mg (38.5 moles) of SCF1-164 was reacted with 962.5 mg (192.5 moles) of SS-MPEG in 75 mL of 0.1 M sodium phosphate buffer. pH 8.0 at room temperature for 30 min. The reaction mixture was passed through a Sephacryl S-200 HR column (5 x 134 cm) and eluted using PB (Gibko Dulbeko phosphate buffer solution without CaCl ₂ and MgCl ₂ ) at 102 ml / h and fractions were taken at 14.3 ml. Fractions 39-53 of the analog mixture were combined by PEG-25 described above and shown in Fig.40A and found to contain 354 mg of protein. In vivo data for such a modified SCF in primates are provided in Example 8C.

example

Receptor expression of SCF in leukemia blasts

The leukemic blasts were collected from the peripheral blood of a patient mixed with leukemia. Cells were centrifuged at a density gradient and exposed to adhesive. Human SCF ¹¹⁶⁴ marked with iodine by the procedure described in Example 7, method. Cells were incubated with different concentrations of SCF according to Brodi, Blood, 75, 1622-1626, 1990. Receptor binding results are shown in Fig. 41. The calculated density of the receptor was approximately 70,000 receptors per cell.

example

Rat SCF activity in early lymphoid precursors

The activity of recombinant rat SCF ¹ ' ¹⁶⁴ (rrSCF1-164) for synergistic action with 11-7 to enhance linfoid cell proliferation was assayed in agarized cultures of mouse bone marrow. In this assay, colonies were formed with rrSCF ¹ ' ¹⁶⁴ only and contained monocytes, neutrophils, and blast cells when the colonies were stimulated with 11-7 alone or in combination with rrSCF ¹ ' ¹⁶⁴ and preferably had pre-B cells. Pre-B cells were characterized as B220 ⁺ , slg ′, cp ⁺ and were identified by FACS analysis of fused cells using fluorescent labeled antibodies to B220 (Kofman, Immunol.Rev. 69, 5, 1982) and surface Ig (goat ITC anti- K, Southern Biotechnology Association, Birmenham, Al); as well as analysis of cytoplasmic slides for cytoplasmic μ expression using fluorescent labeled antibodies (goat TRITC anti-μ, Southern Biotechnology Association). Recombinant human 11-7 (rh11-7) was obtained from the International Bio-Source (Westlike villi, JA). A synergistic increase in colony formation rate was observed when rrSCF1-164 was added in combination with the precursor B cell growth factor (Table 16), indicating the stimulatory action of rrSCF ¹ ' ¹⁶⁴ on early B cells.

table

Pre-B cell colony formation by stimulation of rrSCF1-164 in combination with ch117 action

Growth factors Number of colonies ¹

Saline 0 CF1-164 200 ng 13 ± 2 100 ng 7 ± 4 50 ng 4 ± 2 rh11 -7 200 ng 21 ± 6 100 ng 18 ± 6 50 ng 13 ± 6 25 ng 4 ± 2 rh11 -7 200 ng + rrSCF1-164 200 ng 60 ± 0 100 ng + 200 ng 48 ± 8 50 ng + 200 ng 24 ± 10 25 ng + 200 ng 21 ± 2

1-colony count per 5x10 ⁴ mouse bone marrow cells.

Each size is the mean ± SEM of three replicate tests.

example

Receptor Identification on SCF

A. c-kit is a receptor on SCF ¹¹⁶⁴

In response to the question whether SCF ¹ ' ¹⁶⁴ is a c-kit ligand, the complete murine c-kit cDNA (Qu et al., EMBO J., 7, 1003-1011, 1988) was amplified using PCR from the SCF1-164 cell line MC /. 9 (Nabeli et al., Nature, 291, 332-334, 1981), in the presence of primers constructed from published sequences. The ligand bonds and transmembrane domains of human c-kit encoding amino acids 1-549 (Jarden et al., EMBO J., 6, 3341-3351, 1987) were cloned from human erythroleukemia cell lines, HEI (Martin and Capajonnopulu, Sci. 216: 1233-1235 (1982). The cDNA c-kit was constructed into a mammalian expression vector V19.8 affected by transfection into a CO-1 cell and obtained membrane fractions for analysis using rat and human ¹²⁵ I-SCF1-164 as described below in Sections B and C. Table 17 provides data for a typical binding assay. Specific binding to ¹²⁵ L human SCF ¹ ' ¹⁶⁴ with COS-1 cells transfected with V19.8 alone was not found. However, COS-1 cells expressing the recombinant human hc-kit ligand binding, plus the transmembrane domains (hc-kitLTI) do not bind ¹²⁵ SCF ¹ . ¹⁶⁴ (Table 17). Addition of 200,000-fold molar excess of unlabeled human SCF ¹ ' ¹⁶⁴ lowers the degree of binding to background. Similarly, the CO-1 cells transfected with full-length murininiu c-kit (LTI-hckit) binds to rat ¹²⁵ 1SCF ^{1 164th} A small amount of bound rat ^SCF-125 1 ^{1 164} 1 detected COS cells while only transfektantuose V19.8 was again monitored netransfekuotose cells (Fig. Not shown), indicating that COS-1 cells express endogenous c-kit. The result obtained is consistent with the widespread proliferation of c-kit expression cells. Rats ¹²⁵ 1-SCF ¹ ' ¹⁶⁴ bind analogously to both human and murine c-kit, then when human ¹²⁵ 1SCF ¹ ' ¹⁶⁴ binds at a lower level of activity to murine c-kit (Table 17). These data are consistent with the SCF ¹ ' ¹⁶⁴ map of cross-reaction properties between fragments. Rat SCF ¹ ' ¹⁶⁴ induces human bone marrow proliferation at a relative activity analogous to SCF ¹ ' ¹⁶⁴ , whereas human SCF ¹ ' ¹⁶⁴ induces murine cell proliferation, which is 800 times less than that of rat protein.

Taken together, the results obtained above are said to support the fact that phenotypic abnormalities in expressed w or SI mutant mice are a consequence of primary receptor ligand binding to c-kit and are crucial for the development of various cell types.

Table gQpM64 _sus jgj j _{r m} as with recombinant c-kit Expressed in COS-1 cells The human SCF Plasmid ^{1 '164} CPM Bound ^a rat SCF ^{1' 164}

Transfected ¹²⁵ J-SCF ^{b 125} J-SCF + cold ^{c 125} J-SCF ^{d 125} J-SCF + cold ^e V19.8 2.160 2150 1.100 550 V19.8: hckit-LTI 59.350 2.380 70,000 1.100 V19.8: mckit-LI 9.500 1.100 52,700 600

a-mean value from two measurements; performed the experiment independently 3 times and obtained analogous results.

b-1.6 nM human ¹²⁵ J-SCF ¹ ' ¹⁶⁴ c-1.6 nM human ¹²⁵ J-SCF ¹¹⁶⁴ +320 nM unlabeled human SCF ¹ ' ¹⁶⁴ d-1.6 nM rats ¹²⁵ J-SCF ¹ ' ¹⁶⁴ e-1.6 nM rats ¹²⁵ J -SCF ¹ ' ¹⁶⁴ +320 nM unlabeled rat SCF ^{1 164}

B. Expression of recombinant c-kit on COS-1 cells by cDNA and murine c-kit clones was obtained using PCR methods (Saiki et al., Sci., 239, 487-491, 1988) from complete RNA isolated by an acidified phenol / chloroform extraction system. (Chomchinski and Sashi, Anal.Bioch, 162, 156-159, 1987), respectively, from the human erythroleukemia cell line HEI and cell MC / 9. The specific oligonucleotide sequence was constructed from published human and murine c-kit sequences.

Single-stranded cDNA was synthesized from complete RNA according to protocols for enzymatic Mo-M1V reverse transcription (Betesda Riserch Lab., Betesda, MD) using anti-sensitive c-kit oligonucleotides in place of the primer. Enhancement of the ligand binding and tyrosine kinase domains of the overlapping c-kit was performed using a pair of primers c-kit, respectively. Such regions were cloned into the expressed mammalian vector V19.8 (Fig.17) for expression of COS-1 cells. Multiple clone DNA sequencing enabled the detection of independent mutations that appeared in each clone, apparently during PCR amplification. Clones without such mutations were constructed from individual clones by deleting non-mutated fragments. Some differences with the published sequences were found in all or almost all clones; and it was concluded that real sequences are present in the cell lines used and may have allelic differences from the published sequences. The plasmids presented below were constructed in V19.8, V19.8: mckitLTI for complete murine c-kit; as well as V19.8: hckit-LI having ligand bonds plus the human c-kit transmembrane domain (amino acids 1-549).

Plasmids were transfected into COS-1 cells according to Example 4, respectively. methodology.

C. ^{Binding of 125} J-SCF ¹¹⁶⁴ to COS-1 cells expressing c-kit

Two days after transfection, COS-1 cells were scraped from the slide, washed with PBS, and frozen until further use.

After thawing, cells were resuspended in 10 mM Tris-HCl, 1 mM MgCl ₂ containing 1 mM PMSF, 100 µg / ml aprotinin, 25 µg / ml leupeptin, 2 µg / ml pepstatin, and 200 µg / ml TICK-HCl. The suspension was dispersed by 5-fold pipetting and incubated in ice for 1 min. and cells were homogenized in 15-20 Downs homogenizer cycles. Sucrose (250 mM) and nuclear fractions were added to the J homogenate and the remaining whole cells were centrifuged at 500 x g for 5 min. The supernatant was centrifuged at 25000xg for 30 min. At 4 ° C to settle remaining cell debris.

Human and rat SCF ¹ ' ^{164 was} labeled with radoactive iodine using chloramine-T (Chanter and Greenvod, Nature, 194, 495-496, 1962). The membrane fraction of COS-1 was incubated with ¹²⁵ J-SCF ¹ ' ¹⁶⁴ (1.6 nm) in the presence or absence of 200-fold molar excess of ^unlabeled SCF ^{1-164 in} binding buffer consisting of RPM 1 with 1% calf serum albumin and 50 mM. HEPES (pH 7.4) 1 or. at room temperature. After incubation, membranes were carefully plated on 150 μΙ phthalic oil and centrifuged for 20 min. Beckman microfuge 11 to separate membrane-bound ¹²⁵ J-SCF ¹ ' ¹⁶⁴ from unbound ¹²⁵ J-SCF ¹ ' ¹⁶⁴ . After centrifugation, the precipitate was discarded and the amount of membrane-bound ¹²⁵ J-SCF ¹ ' ^{164 was} evaluated.

example

Isolation of human SCF DNA

A. Construction of the HT-1080 cDNA library

Complete RNA was isolated from the HT-1080 human fibrosarcoma cell line (ATCC CCI 121) in an extraction system: thiocyanate-guanidine-phenol-chloroform acid (Chomchinski et al., Anal.Bioch. 162, 156, 1987), and poly (A). RNA was isolated using an oligo (dT) column from Clontech. The double-stranded DNA was obtained from 2 µg of poly (A) rnr by BRI (Betesdo Reach.Lab.) CDNA synthesis according to the supplier's recommended conditions. Approximately 100 ng of column-fractionated double-stranded DNA with an average size of about 2 kD was ligated with 300 ng of Sa 11 / Notl recycled vector pSPORT 1 (d'Alessio et al., Focus, 12, 47-50, 1990) and transformed into DN5a ( BI, Betesda, MD) cells by electroporation (Dayer et al., NucI.Acids Res., 16, 6127-6145, 1988).

B. Screening for the cDNA library

About 2.2x10 ⁵ primary transformants divided into 44 groups, each containing approximately 5,000 individual clones. Plasmid DNA was obtained from each group by CTAB-DNA precipitation (Del Sal et al., Biotechnigue, 7, 514-519, 1989).

gg of each plasmid DNA was exposed to a limited enzyme Not 1 and separated by delelectrophoresis. Linearized DNA was transferred onto GenSkreen Plus membrane (Diupon) and hybridized with ³² P-labeled PCR-generating human SCF cDNA (Ex. 3) under the conditions described previously (Leen et al., Proc. Nat.Acad.Sci., USA, 82, 7580-8584 (1985). As a result of hybridization, 3 groups with positive signal were identified. These colony groups were repeatedly screened according to the colony hybridization technique (Leen et al., Gene, 44, 201-209, 1986) until one colony was obtained from each group. The cDNA sizes in these three isolated clones were 5.0-5.4 kD. Restriction of the enzymes and determination of the nucleotide sequences at the 5 'end showed that 2 of the three clones were identical to each other (10-1 a and 21-7a). Both such clones have an encoded region and about 200 kD of the 5 'untranslated region (5' UTR). The third clone (26-1a) is 400 kD shorter at the 5 'end than the other two clones. Such a human SCF cDNA sequence is shown in Fig.42. Of particular note is the hydrophobic transmembrane sequence beginning at amino acid region 186-190 and ending at amino acid 212.

C. pDSRa2hSCF ^{1 '248} construction pDSRa2hSCF ^{1' 248} generated by using a plasmid 10-1 (according to the profile 16B), and ^one pGEM3hSCF ^'164 as follows: the Hind III pCEM3 SCF ^1' M13 ¹⁶⁴ transposed p18. Nucleotides above the ATG initiating codon were replaced by site-directed mutagenesis by CTTTCCTT ATC to GCCGCCGCC ATC using anti-insensitive oligonucleotide

5′-TCT TCT TCA TGG CGC CGG CAA GCT T 3 ′ and mutagenesis systems are controlled in vitro with oligonucleotides by Amersh.Corp. methodologies to achieve M13mp18 hSCF ^K1 ' ¹⁶⁴ . Such DNA was exposed to HIND III and inserted into pDSRa2 by HIND III: clone pDSRa2 hSCF ^K1 ' ¹⁶⁴ . DNA from pDSRa2 hSCF ^K1 ' ¹⁶⁴ was exposed to Xdal and obtained DNA at blunt ends by the addition of Klionov and four dNTPs. After such termination of the DNA reaction, it was additionally exposed to the enzyme S mouse. Clone 10-1a was acted on by Dral to form a blunt end 3 'and Spel cleaves this link inside the gene as did pDSRa2 ^{hSCF K1164} , and 10-1a. Such DNAs were co-ligated to generate pDSRa2 hSCF ^K1 ~ ²⁴⁸ generation.

D. Transfection of COS cells and immunostaining in the presence of pDSRa2 hSCF ^K1 ' ²⁴⁸ DNA.

COS-7 cells (ATCC SR I 1651) were transfected with DNA as described above. In a 4x10 ⁶ cell system, 0.8ml of DEM + 5% FBS was electroporated at 1600V in the presence of 10 pg of pDSRa2 hSCF ^{K1 248} DNA or 10 pg of pDSRa2 vector DNA (control vector). After electroporation, two plates with a diameter of 60 mm were repeatedly spun out. After 24 or. medium was replaced by fresh complete medium.

After 72 or. after transfection, each plate was labeled with ³⁵ S-media according to Jarden et al. (PNAS 87, 2569-2573, 1990). The cells were rinsed with phosphate buffer for 30 min. incubated with DMEM-free methionine and cysteine (Met-CysDMEM).

The medium was decanted and 1 ml of Met-Cys-DMEM containing 100 pCi / ml of Tran ³⁵ S-tag (ICN) was added to each plate. Cells were incubated for 8 hours. At 37 ° C. The culture medium was centrifuged to remove cell debris and frozen at -20 ° C.

Aliquots of labeled conditioned media COS / pDSRa2 hSCF ^K1 ' ²⁴⁸ and vector control COS / pDSRa2 were co- ^{immunoprecipitated} with clones 17 of the S-labeled cell ³⁵ S-labeled CHO / pDSRa2 hSCF ^K1164 medium (see Example 5) according to Jarden et al. 6, 3341-3351, 1987). One ml of each conditioning medium e.g. exposed to 10 pi preimmune rabbit serum (## 1379 PI). Samples were incubated for 5 hours. at 4 ° C. 100 µl of a 10% suspension of Staphylococcus aureus (Pansorbin, Calbiochem) in 0.15 M NaCl, 20 mM Tris pH 7.5, 0.2% triton Χ-100 was added to each tube. Samples were incubated for another 1 hour. 4 ° C temp. Immune complexes were centrifuged at 13.000xg for 50 min. Supernatants were added to new tubes and incubated with 5 µl of rabbit polyclonal serum (## 1381 TB4) purified as shown in Example 11, respectively, from CHOhSCF ¹ ' ¹⁶² overnight at 5 ° C. Adds 100 pi of pansorbin per hour and precipitates the immune complexes as described above.

After centrifugation, the remaining precipitate was washed with flush buffer (0.5% Nadezoxycholate, 50 mM NaCl, 25 mM Tris pH 8), three times with aqueous buffer (0.5 M NaCl, 20 mM Tris pH 7.5, 0.2% Triton Χ-100) and once with 20 mM Tris pH 7.5. The pellet was resuspended in 50 µl of 10mM Tris pH 7.5, 0.1% SDS, 0.1 M β-mercaptoethanol. The SCF protein was eluted by boiling for 5 min. The samples were centrifuged at 13000xg for 5 min. and secreted the supernatant.

Glycosidases were acted as follows: 3 μΙ of 75 mM CHAP containing 0.6 mU O-glucanase and 0.02 U of neuraminidase was added to 25 μΙ incubated for 3 hours. at 37 ° C, immune sample complexes. Added the same volume of 2x PACE buffer and boiled for 3 min. The cooked and uncooked samples were electrophoresed on a 15% SDS-polyacrylamide reducing gel overnight at 8 mA. The gel was fixed in a methanol-acetic acid system with Enlightening (NeN) for 30 min., Dried and exposed to Kodak XAR-5 film at -70 ° C.

Figure 43 shows an autoradiogram of the results obtained. Positions 1 and 2 include samples of control COS / pDSRa2 cultures, positions 3 and 4 of positions COS / pDSRa2 hSCF ^{K1 248} , positions 5 and 6 of positions 6 and COS / pDSRa2 hSCF ^{K1164 are} non- ^digested immune precipitates; 2, 4 and 6 were disrupted in the presence of glycanases as described above. The left shows the molecular weights of the markers. Treatment with SCF COS-transfected pDSRa2 hSCF ^K1 ' ²⁴⁸ clearly shows that it is analogous to the treatment of hSCF ^K1 ' ¹⁶⁴ secreted from CHO and transfected with pDSRa2 hSCF ^KV164 (e.g., 11). The result confirms the fact that the intrinsic SCF site of proteolytic action is close to 164 amino acids.

example

Quaternary structure analysis of human SCF

Calibration of the Gel Filtration Column (ACA 54) described in Example 1, for example, purification of SCF from BRI cell culture fluid, molecular weight standards and elution of purified SCF from other gel filtration calibration columns is known to purify SCF from BRI cell media. molecular weight of about 70000-90000 compared to molecular weight standards. In contrast to this, the mol. mass by SDS-PAGE is about 2800035000.

Although glycosylated proteins are known to behave abnormally in such assays, the results obtained support the fact that rat SCF, a derivative of BRI, can exist as a non-covalently bound dimer under non-denaturing conditions. Similar results are found with recombinant forms of SCF (e.g., rat and human SCF ¹ ' ¹⁶⁴ , which are

E.coli derivatives, while rat and human SCF ^{1 162} are CHO cell derivatives), because the molecular size determined by gel filtration under non-denaturing conditions is twice as high under gel filtration under denaturing conditions (e.g., SDS or SDS-PAGE). method) on a case by case basis.

In addition, analysis of the sedimentation rate, which corresponds to a molecular weight to give the molecular weight values of 36,000 recombinant human SCF ¹¹⁶⁴ in E. coli. This size is also almost twice as large as that obtained by SDS-PAGE (about 18000-19000). Therefore, while it is known that there may be a large number of oligomeric derivatives (including monomers), it appears that in some cases dimers predominate in solution.

example

Isolation of human SCF cDNA clones from 5637 cell line

A. Construction of library 5637 cDNA.

Complete RNA was isolated from human bladder carcinoma cells (ATCC HTB-9) using extraction methods with the acid thiocyanate guanidine-phenol-chloroform system (Chomchinski et al., Anal.Bioch. 162, 156, 1987) and poly (A) RNA. isolated using oligo (dT) back columns provided by Klontex. Two-stranded cDNA was obtained from 2 µg of poly (A) RNA using kit B I for cDNA synthesis under conditions recommended by the supplier. About 80 ng was fractionated in a column of double-stranded cDNA, where on average 2kD was ligated with 300 ng of the SalI / Notl vector pSPORT I (d'Alessio et al., Focus, 12, 47-50, 1990) and transformed into cells by DN5a electroporation (Dover et al. ., NucI.Acids, Res, 16, 6127-6145, 1988).

B. Construction of a cDNA Library

About 1.5x105 primary transformants were divided into 30 portions, each containing approximately 5,000 individual clones. Plasmid DNA was obtained from each batch by CTAB-DNA precipitation method (Del Sal et al., Biotechniques, 7, 514-519, 1989). Two µg of each batch of plasmid DNA was digested with NotI and subjected to gel electrophoresis. Linear DNA was transferred onto a Henskrin Plus membrane (Liupon) and hybridized with cDNA ³² -P-labeled human full-length SCF isolated from the HT1080 line (Ex. 16) using conditions previously described (Leen et al., Proc.Natl.Acad.Sci). , USA, 82, 7580-7584, 1985).

7 batches with positive signal were identified in hybridization. Batch colonies were re-sorted by cDNA ³² -P-labeled human SCF PCR (Example 3), according to the ^93- colony hybridization procedure (Leen et al., Gene, 44, 201-209, 1986) until only one of four batches remained. . The size of the four clones isolated was about 5.3 kD. The restriction enzyme digestion and nucleotide sequence analysis of the 5'-end clones enabled the identification of four clones. The sequence of such human cDNA is shown in Figure 44. The Fig. 44 cDNA is encoded by a polypeptide having the amino acid sequence 149-177 of Fig. 42 replaced by a single Gly residue.

example

Increase in survival after lethal irradiation with SCF

A. In vivo activity of SCF influencing survival after lethal irradiation.

SCF-assisted survival in mice following lethal irradiation was investigated. Female BAIb / c mice at 10-12 weeks of age were used as test subjects. Groups were 5 mice each and mice were selected for each experiment by weight. Mice were irradiated in single doses of 850 and 950 rad. The mice were administered only the factor or factor with normal bone marrow cells in BAIb mice. In the first case, rat PEG SCF (20 pig / kg) isolated from E.coli and modified by the addition of polyethylene glycol according to Example 12 was injected intravenously into the mice within 24 hours after irradiation. and control animals with saline. 4 hours later after irradiation, mice were injected intravenously with different doses of bone marrow cells from normal BAib mice. Rat PEG-SCF ¹ ' ¹⁶⁴ treatment was performed by adding 200 pg / kg rat PEG-SCF ¹ ' ¹⁶⁴ to the cell suspension for 1 hour. pre-injection and single injection of the factor with cells.

After irradiation 850 rad. dose in mice administered rat PEG-SCF ¹ ' ¹⁶⁴ or saline. The results obtained are shown in Fig.45. Administration of rat PEC-SCF ¹ ' ¹⁶⁴ significantly prolonged the survival time of the mice after irradiation compared with the control group (P <0.001). Mice injected with saline survived for an average of 7.7 days, whereas mice with PEC-SCF ¹ ' ¹⁶⁴ survived for an average of 9.4 days (Fig.45).

The results in Fig.45 are the summed data for different experiments using 30 mice per test group.

Survival of mice treated with PEG-SCF ¹ ' ¹⁶⁴ shows the influence of SCF on bone marrow cells of irradiated animals. Preliminary studies of the haematological parameters of such animals show some increase in platelet levels 5 days after irradiation compared to control animals. However, at 7 days post-irradiation, platelet levels were only slightly different from the control group. No differences were found in the structure of bone marrow cells at RBC and SBC levels.

B. Survival of transplanted mice treated with SCF

A 10% dose of normal BAIb / c mouse bone marrow cells transplanted into 850 rad irradiated mice can save 90% and more animals (data not shown). Therefore, 850 rad dose using dosing transplant to 5% of the hip bone to determine the rat PEG-SCF ^{1 164} influence survival. At this dose, it was expected that a high percentage of mice without SCF could not survive; if rat PEG-SCF ¹ ' ¹⁶⁴ can stimulate transplanted cells, it may be more likely to survive. As shown in Fig.46, about 30% of control mice survive 8 days after irradiation. Treatment with rat PEC-SCF ¹ ' ¹⁶⁴ significantly enhances survival, although 95% of such mice survive to the extreme, even for 30 days (Fig.46). The results in Fig. 46 are the average of 4 separate experiments using 20 mice in the control and the same treated PEG-SCF ¹ ' ¹⁶⁴ groups. At much higher doses of irradiation, exposure to rat PEG-SCF ¹ ' ^{164 in} combination with bone graft also significantly increases survival (Fig.47). Control mice irradiated 950 rad dose and transplanted 10% of the hip bone, was killed on 8, when about 40% of the mice exposed rat PEG-SCF ^{1 164} survived 20 days and 20% of control mice transplanted 20% of the hip bone survived for 20 days after 80% animals exposed to SCF survived this time (Fig.47).

example

Production of a monoclonal antibody against SCF

Female BAIb mice, 8 weeks old (C.River, Wilmington, MA), were injected subcutaneously with 20 µg of human SCF ¹ ' ¹⁶⁴ expressed in E.coli, Freund's complete stimulator (H37-Pa; Difco lab., Detroit, MI). . Re-immunized with 50 g of this antigen in Freund's stimulator for 14, 38 and 57 days. Three days after the last injection, 2 mice were slaughtered and their spleens were taken with the myeloma line SP 2/0 according to the method described by Novinsky et al., (Virology 93, 111-116, 1979).

Cell culture medium SP 2/0 and hybridoma medium was modified with Dulbeck's medium Igla (DMEM) (Gibco, Ohio) supplemented with 20% thermodeactivated calf serum (Fibro, Chem., NY), 110 mg / ml sodium pyruvate, 100 units / ml streptomycin. (Gibco). After cell fusion, the hybrids were selected in HAT medium containing 10 ' ⁴ M hypoxanthine, 4x10 ^-7 M aminopterin and 1.6x10' ⁵ M thymidine for two weeks, followed by culturing in media containing hypoxanthine and thymidine for two weeks.

The hybridoma sorted as follows: Polystyrene reservoirs (Costar, MA) were sensitized with 0.25 µg human SCF ¹ ' ¹⁶⁴ (E.coli) in 50 μΙ 50 mM bicarbonate buffer, pH 9.2 for two hours at room temperature, then overnight at 4 ° C. Plates were then blocked with 5% BSA / PBS for 30 min. at room temperature, followed by incubation in a hybridoma culture pellet for 1 h. At 37 ° C.

The solution was decanted and bound antibodies were incubated with 1: 500 goat anti-mouse IgG conjugate with peroxidase (Boeringer Manhaim Biochemicals, I N) for 1 h. 37 ° C. Plates were washed with wash buffer (KPI, Haitsburg, MD), then developed with H2O2 and ABT (KPI). Measured colorimetrically at 405 nm.

Cell hybridoma cultures secreting specific SCF ¹ ' ¹⁶⁴ (E.coli) antibodies were analyzed by ELISA. The hybridoma was subcloned by the limiting dilution method. 55 reservoirs of the tested hybrids exhibited activity against human SCF ¹ ' ¹⁶⁴ (E.coli) ·, 9 of which exhibited activity against human SCF ^1-162 (CHO).

Some hybridoma cells were cloned as follows:

Monoclone IgG type Reaction to human SCF ¹ ' ¹⁶² (CHO) 4012-13 IgGI there is no 6C9A IgGI there is no 8H7A IgGI is

Hybridomas 4C12-13 and 8H7A were deposited with ATCC on September 26, 1990.

Although the present invention has been described in terms of premature implementation, it should be understood that modifications and modifications may be apparent to those skilled in the art. Therefore, the following formula is intended to be encompassed within the scope of the present invention.

DEFINITION OF INVENTION

Claims (3)

DEFINITION OF INVENTION A non-naturally occurring polypeptide comprising an amino acid sequence substantially repeating the sequence found in a naturally occurring stem cell factor that results in the haemopoietic biological activity of a natural stem cell factor. 2. Purified polypeptide naturally occurring stem cell factor. 3. A polypeptide according to claims 1 and 2, characterized in that it is a product of expression of a prokaryotic or eukaryotic exogenous DNA sequence. 4. The polypeptide of claim 3, which is a product of CHO cell expression. 5. The polypeptide of claim 3, wherein the exogenous DNA sequence is a cDNA sequence. 6. The polypeptide of claims 1 and 2, wherein said stem cell factor is a human stem cell factor. 7. The polypeptide of claim 3, wherein the exogenous DNA sequence is a genomic DNA sequence. 8. The polypeptide of claim 3, wherein the exogenous DNA is sequenced on an autonomously replicating plasmid DNA or viral vector. 9. The polypeptide of claim 1, wherein the polypeptide comprises, in whole or in part, the human stem cell factor amino acid sequence shown in Figures 15B, 15C, 42 and 44, and Figures 15B, 15C, 42 and 44 are part of this definition, or any allelic variant found in nature. 10. The polypeptide of claim 1, characterized in that it has in vivo biological activity of naturally occurring stem cell factor. 11. A polypeptide according to claim 1, characterized in that it exhibits in vitro biological activity of naturally occurring stem cell factor. 12. The polypeptide of claims 1 and 2, further comprising being covalently linked to a detectable tag. An isolated DNA sequence used for the expression of a polypeptide product having an amino acid sequence substantially duplicating the naturally occurring stem cell factor sequence and resulting naturally occurring stem cell factor hematopoietic activity in a prokaryotic or eukaryotic cell, where DNA is indicated: a) The DNA sequences shown in Figures 14B, 14C, 15B, 15C, 42, 44, and Figs. 14B, 14C, 15B, 15C, 42 and 44 are part of this definition, or chains complementary thereto; b) DNA sequences that hybridize to the DNA sequences of a) or fragments thereof; and (c) DNA sequences hybridising to the DNA sequences referred to in (a) and (b), bearing in mind the degeneracy of the genetic pool. 14. A prokaryotic or eukaryotic host cell, characterized in that it has been transformed or transfected with the DNA sequence of claim 13, such that the host cell expresses the indicated polypeptide product. The polypeptide product of the expression of the DNA sequence of claim 13 in prokaryotic or eukaryotic cells. An isolated DNA sequence encoding a polypeptide expressed in a prokaryotic or eukaryotic cell having an amino acid sequence substantially duplicating the naturally occurring stem cell factor sequence, which enables it to possess the biological activity of the naturally occurring stem cell factor. 17. The sequence of claim 16, wherein it is a cDNA sequence. 18. The sequence of claim 16, wherein it is a genomic DNA sequence. 19. The sequence of claim 16, wherein it encodes a human stem cell factor. 20. The DNA sequence of claim 19, wherein it has one or more codons desired for expression in E.coli cells. 21. The DNA sequence of claim 16, wherein it corresponds to the sequences shown in Figures 15B, 15C, 42 and 44, and Figures 15B, 15C, 42 and 44 form part of this definition. 22. The DNA sequence of claim 16, wherein it has one or more codons desired for expression in yeast cells. 23. The DNA sequence of claim 16, wherein it is covalently linked to a detection tag. A DNA sequence encoding a polypeptide fragment or polypeptide analogue of a naturally occurring stem cell factor. 25. The DNA sequence of claim 24, wherein it encodes a stem cell methionylated factor. A biologically functional plasmid or viral DNA vector comprising the DNA sequence of claim 16. 27. A prokaryotic or eukaryotic host cell, characterized in that it is stably transformed or transfected with a DNA vector according to claim 16. The polypeptide product of expression of the DNA sequence of claim 16 in prokaryotic or eukaryotic cells. A polypeptide having a partial or complete amino acid sequence shown in Figures 15C, 42 or 44 and 15C, 42 and 44 being part of this definition and having one or more naturally occurring stem cell factor biological activities. A polypeptide having a partial or complete secondary conformation of a naturally occurring stem cell factor and having a partial or complete amino acid sequence shown in Figs. 15C, 42 or 44, and wherein Figs. 15C, 42 and 44 are part of this definition, and stem cell factor biological properties. 31. A method of producing a stem cell factor comprising: culturing prokaryotic or eukaryotic host cells, transforming or transfecting DNA according to claim 13 in suitable culture media, and isolating the desired polypeptide products of expression of the DNA sequence of said vector. 32. Compositions, characterized in that they contain isolated and purified human stem cell factor that is not bound to any human protein in glycosylated or non-glycosylated form. 33. A pharmaceutical composition comprising an effective amount of a polypeptide according to claim 1 and a pharmacologically acceptable solvent, adjuvant or carrier. 34. The polypeptide of claim 1, wherein said polypeptide is for increasing the degree of bone marrow maturation during transplantation, and for increasing bone marrow recovery by treating bone marrow aplasia or myelosuppression caused by radiation, chemical agents, or chemotherapy, 35. A DNA sequence encoding a human stem cell factor analogue selected from the group consisting of: (a) (Met ' ¹ ) stem cell factor; and (b) a stem cell factor in which one or more cysteines are replaced by alanine or serine. The polypeptide product of the DNA sequence of claim 35, expressed in prokaryotic or eukaryotic host cells. 100 37. A pharmaceutical composition comprising a recombinant stem cell factor having an amino acid sequence of a human factor and a pharmacologically acceptable solvent, adjuvant or carrier. 38. Antibodies, characterized in that they specifically bind to a stem cell factor. 39. The antibody of claim 38, which is a monoclonal antibody. 40. A method of efficiently isolating a stem cell factor from an SCF-containing material, comprising the step of ion-exchange chromatographic separation of such material. 41. The method of claim 40, wherein said ion-exchange chromatographic separation is anion-exchange chromatographic separation. 42. The method of claim 40, further comprising the step of separating the reverse phase liquid chromatography. A polypeptide having the natural activity of stem cell hematopoietic hematopoietic factor and having the amino acid sequence set forth in Figures 15C, 42 or 44 and 15C, 42 and 43 being part of this definition, or any allelic variant, derivative, deletion thereof. analogue or additive analogue, characterized in that it is a product of exogenous DNA expression in prokaryotic or eukaryotic cells. 44. The polypeptide of claim 43, wherein it is selected from the group consisting of: SCF ^{1 148} , SCF ^{1 162} , SCF ¹ ' ¹⁶⁴ , SCF ¹ ' ¹⁶⁵ , (presented in Fig. 15C); SCF ¹ ' ¹⁸⁵ , SCF ¹¹⁸⁸ , SCF ¹ ' ¹⁸⁹ , and SCF ¹ ' ²⁴⁸ , (presented in Fig. 42); SCF ¹ ' ¹⁵⁷ , SCF ¹ ' ¹⁶⁰ , SCF ¹ ' ¹⁶¹ , and SCF ¹²²⁰ (shown in Fig. 44), and Figs. 15C, 42 and 44 are part of this definition. 45. A biologically active composition comprising a polypeptide according to claim 44 covalently linked to a water-soluble polymer. 46. The composition of claim 45, wherein said polymer is selected from the group consisting of polyethylene glycol or a copolymer of polyethylene glycol and polypropylene glycol, said polymer being substituted or unsubstituted at one end of the alkyl group. 47. The composition of claim 45, wherein the polypeptide is (Met ' ¹ ) SCF ¹ '. 164 101 48. The composition of claim 45, wherein said polymer has an average molecular weight of 1000-100000 D. 49. The composition of claim 45, wherein said polymer has an average molecular weight of 4000-40000 D. 50. The composition of claim 45, wherein said polymer is unsubstituted polyethylene glycol or monomethoxy polyethylene glycol. 51. The composition of claim 45, wherein said polymer is coupled to said peptide by a reaction using an active carboxylic acid ester or carboxy derivative of said polymer. 52. The composition of claim 45, wherein one or more amino groups of said protein are bound to said polymer by reaction with N-hydroxysuccinimide, p-nitrophenol or 1-hydroxy-2-nitro-benzene-4-sulfonate polymer ether. 53. The composition of claim 45, wherein one or more free cysteine sulfhydryl groups are conjugated to said polymer by reaction with a maleimide or a haloacetylated polymer derivative. 54. The composition of claim 45, wherein the polypetide is a glycosylated product and the polymer is coupled by reaction of its amino-hydrazine or hydrazide derivative with one or more aldehyde groups obtained by oxidation of carbohydrate moieties. 55. A process for preparing a biologically active polymer-polypeptide adduct, wherein the polypeptide of claim 45 is reacted with a water-soluble polymer under conditions that allow the covalent attachment of the polymer to said polypeptide and isolation of the resulting adduct. 56. A method of transfecting the genes of early hematopoietic progenitors, which comprises: 1) culturing precursor precursor cells in the presence of SCF; and 2) transfection of cultured cells in stage 1) with a gene. 57. The method of gene transfer to a mammal, which comprises the steps of: 1) culturing precursor precursor cells in the presence of SCF; 2) transfecting cultured cells with a gene in step 1); and 102 3) uses transfected cells in mammals. 58. The polypeptide of claim 43, wherein it is selected from the group consisting of: (Met ' ¹ ) SCF ^{1 148} , (Met' ¹ ) SCF ^{1 162} , (Met ' ¹ ) SCF ^{1 164} , (Met' ¹ ) SCF ¹ ' ¹⁶⁵ , (Met' ¹ ) SCF ¹ ' ¹⁸³ , (15C) .); (Met ' ¹ ) SCF ¹ ' ¹⁸⁵ , (Met ' ¹ ) SCF ¹ ' ¹⁸⁸ , (Met ' ¹ ) SCF ¹ ' ¹⁸⁹ , (Met ' ¹ ) SCF ¹ ' ²⁴⁸ , (Fig. 42); (Met ' ¹ ) SCF ¹ ' ¹⁵⁷ , (Met ' ¹ ) SCF ¹ ' ¹⁶⁰ , (Met ' ¹ ) SCF ¹ ' ^161, and (Met ' ¹ ) SCF ¹ ' ²²⁰ 1 HPP-CFC Colony count