LT3944B - Method for the production of erythropoietin - Google Patents

Abstract

This invention describes the cloned genes of human erythropoietin (EPO) that allow the achievement of a very high expression. Also, the expression of these genes in vitro is described, as they produce active human EPO.

Description

The present invention relates to cloned human erythropoietin genes with extremely high expression levels, expression of said genes, and production of active human erythropoietin in vitro.

Erythropoietin (EPO) is a glycoprotein circulating in the body that stimulates the production of red blood cells in the higher body (see Carnot et al., Compt. Rend., 143: 384 (1906)). Therefore, EPO is sometimes referred to as an erythropoiesis stimulating factor.

The life span of human erythrocytes is approximately 120 days.

This means that the reticulo-endothelial system destroys approximately 1/120 of all erythrocytes daily and produces a relatively constant amount in close proximity each day to maintain erythrocyte balance continuously (Guyton, Textbook of Medical Physiology, pp. 56-60, WB Saunders Co., Philadelpha ( 1976)).

Erythrocytes are produced in the bone marrow during maturation and differentiation by erythroblasts, and EPO is a factor that acts on less differentiated cells and induces their differentiation into erythrocytes (Guyton, supra).

is a promising therapeutic agent for the clinical treatment of anemia, especially renal anemia. Unfortunately, EPO is not yet widely used in practical therapy because it is difficult to access.

The use of EPO as a therapeutic agent requires an evaluation of potential antigenicity issues. Therefore, it is better to produce EPO from human-supplied raw materials. For example, donor blood or urine from patients with aplastic anemia and related conditions (in which case high levels of EPO are produced) can be used. Unfortunately, the amount of these raw materials is limited. See, e.g., White et al., Rec. App Horm. Res., 16: 219 (1960); Espada et al., Biochem. Med. 3: 475 (1970); Fisher, Pharmacol.Rev., 24: 459 (1972) and Gordon, Vitam. Horm. (N.

Y.), 31: 105 (1973), the disclosure of which is incorporated by reference herein.

EPO is usually produced by concentrating and purifying patients' urine containing high levels of EPO, for example in patients with aplastic anemia and other related conditions. See, for example, U.S. Pat. 4,397,840; 4,303,650 and 3,865,801, which are part of the present invention. The limited resources of such urine impede the use of EPO in practice, and it is desirable to produce EPO from the urine of healthy individuals. The use of urine in healthy people is problematic because it contains significantly less EPO than the urine of individuals with anemia. In addition, there are some inhibitory factors in the urine of healthy individuals that inhibit erythropoiesis at sufficiently high concentrations, so that a satisfactory therapeutic effect can only be obtained with the use of highly purified EPO.

EPO can also be produced from sheep blood plasma. EPO, isolated from such plasma, has been formulated with satisfactory activity, stability and water solubility. See also: Goldwasser, Control Celiular Dif. Develop., Part A; pp. No. 487494 to Alan R. Liss, Ine., N.Y. (1981) (this article is incorporated herein by reference). However, it can be argued that sheep's EPO should be antigenic to the human body.

Thus, although EPO is a highly desirable therapeutic agent, the standard isolation and purification procedures used to work with natural raw material sources do not meet the mass production requirement of this compound.

Sugimoto et al. U.S. Pat. No. 4,377,513 describes an in vivo process for the industrial production of EPO containing human lymphoblastoid cells including Namalwa, BALL-1, NALL-1, TALL-1 and JBL.

Commercial literature reports on EPO produced by genetic engineering techniques, but neither the description nor the chemical composition of the product is published. This application discloses a process for the industrial production of proteins that have the biological properties of human EPO. In this way it is also possible to produce proteins that have a chemical composition that is different from the authentic EPO but has similar (and in some cases improved) properties. For convenience, any protein having the biological properties of human EPO may be referred to as EPO, whether or not these compounds are chemically identical to EPO.

The present invention describes the cloning, expression of EPO, and industrial production of active human EPO in vitro of a gene that expresses extremely high levels of human EPO. Expression vectors suitable for the preparation of EPO, expression cells, purification schemes and other processes are also described.

The EPO was obtained partially purified, then purified to homogeneity and digested with trypsin into specific fragments (details of these operations are given below). These fragments were purified and sequenced. Based on these sequences, EPO oligonucleotides were constructed and synthesized. These oligos were used to screen the human genome library to isolate the EPO gene.

The EPO gene was screened based on its DNA sequence, which matched most of the tryptic fragments sequenced. A portion of the genomic clone was used in a hybridization assay to demonstrate that EPO mRNA can be detected in human germline (20 weeks) mRNA. A human germinal liver cDNA library was prepared and screened. Three EPO cDNA clones were obtained (more than 750,000 recombinants screened). Two of these clones were found to be of maximum length, judging by the full coding sequence and the major 5 'and 3' untranslated sequence. These cDNAs were expressed both in monkey cells transformed with SV-40 virus (COS-1 cell line; Gluzman, Cell 23: 175-182 (1981)) and in Chinese hamster ovary cells (CHO cell line; Urlaub, G. and Chasin, LA Proc Natl Acad Sci USA 77: 4216-4280 (1980). EPO produced in COS cells is biologically active both in vitro and in vivo. EPO produced in CHO cells is also active both in vitro and in vivo.

The EPO cDNA clone has an interesting open reading frame consisting of 14-15 amino acids (or), with an initiator and terminator 20-30 nucleotides (nt) above the coding region. A representative sample of E. coli transfected with a cloned EPO gene was deposited in the American Type Culture Collection (Rockville, Maryland, No. ATCC 40153).

Table 1 shows the exon base sequence of 87 base pairs of the human EPO gene;

Figure 1 illustrates the determination of EPO mRNA in human germinal liver mRNA;

Table 2 shows the amino acid sequence of the EPO protein as determined by X-HEPOFL13. a nucleotide sequence;

Table 3 shows the nucleotide sequence of the EPO cDNA X-HEPOFL13 (schematically shown in Figure 2) and the amino acid sequence derived from this sequence;

FIG. Figure 3 shows the relative positions of DNA inserts of four independent human EPO genome clones;

FIG. Figure 4 shows the putative structure of introns and exons of the human EPO gene;

Table 4 shows the EPO 'gene shown in Figs. 4B, DNA sequence; FIG. 5A, 5B and 5C show the structure of vector 91023 (B); FIG. 6 shows a comparative analysis of EPO produced in COS-1 · cells and native EPO on an NDS polyacrylamide gel;

Table 5 shows the nucleotide and amino acid sequence of the XO-HEPOFL6 EPO clone;

Table 6 shows the nucleotide and amino acid sequences of the XO-HEPOFL8 EPO clone;

Table 7 shows the nucleotide and amino acid sequences of the XO-HEPOFL136 EPO clone;

FIG. Figure 7 is a schematic representation of plasmid pRK1-4;

FIG. θ is a diagram of plasmid pdBPV-MMTneo (342-12).

The present invention describes the cloning of EPO genes and the production of EPO by expression of these genes in vitro.

Numerous methods for the preparation of recombinant products have been described in the patent and scientific literature. In most cases, these techniques involve isolating or synthesizing the required gene sequence and expressing the sequence in a prokaryotic or eukaryotic cell using methods known to those skilled in the art. If the gene is isolated, purified and inserted into a transfer vector (cloned), then a sufficient amount of it is assured. The vector with the cloned gene is transferred to a suitable microorganism or cell line, such as a bacterium, yeast, mammalian cells such as COS-1 (monkey kidney), CHO (Chinese hamster ovary), insect cell lines and the like. A vector replicates when a microorganism or cell line proliferates and can be isolated using standard techniques. Thus, a constantly renewed source of the gene is generated for further manipulation, modification, and transfer to other vectors or to other loci of the same vector.

Frequently, expression is obtained by transferring a properly oriented and cloned gene in a suitable frame to an appropriate transfer vector site such that translational reading from a prokaryotic or eukaryotic gene synthesizes a protein precursor comprising the amino acid sequence encoded by the cloned gene together with the Met or N-terminal sequence. from a prokaryotic or eukaryotic gene. In other cases, transcriptional and translational initiation signals may be provided by appropriate fragments of the cloned gene. The synthesized protein precursor can be cleaved using a variety of specific site-specific protein cleavage techniques to provide the desired amino acid sequence, which is then purified by standard techniques. Occasionally, a protein having the desired amino acid sequence may be produced without the use of specific cleavage techniques or isolated into extracellular growth medium.

Isolation of the human EPO genomic clone

Human EPO was purified (as described below) to a homogeneous protein from the urine of patients with aplastic anemia. The purified EPO was completely digested with trypsin, and the resulting fragments were separated by HPLC reverse phase, isolated from the collected gradient fractions, and sequenced. The sequences of tripty fragments are underlined in Tables 2 and 3 and further discussed below. Two amino acid sequences, Val-Asn-Phe-Tyr-Ala-Trp-Lys and Val-Tyr-SerAsn-Phe-Leu-Arg, were selected for the construction of oligonucleotide probes (17 nt oligonucleotides 32-fold in the other, 18 nt oligonucleotides degenerate 128 times belonging to the first tryptic fragment and two groups containing 14 nt oligonucleotides degenerate 128 times belonging to the second peptide fragment). The 17-mer group, 32-degenerate, was used for screening the human genomic DNA library! In the Ch4A vector (22) according to a modification of the Woo or O'Malley amplification in situ procedure (Proc. Nat'l. Acad. Sci. U.S.A. 75: 3688, 1978) to produce screening filters.

The phages that hybridize with the 17-mer are collected, divided into several groups, and attempted to hybridize with the 14-mer and 18-mer groups. The phages that hybridize to the 17-mer, 18-mer and 14-mer groups were purified by the morphology of lice spots and the fragments subcloned into M13 vectors for sequencing by dideoxy chain termination (Sanger, F., Nicklen, S., and Coulson). ,

A.R., Proc. Nat'l. Acad. Sci., U.S.A. 74: 5463 (1977).

attttggatgaaagggagaatgatc

>> H> H> »4 Ω Ω sr o CA. Ω ^N H. Ω 2 > <Ω Ω Ω w H ® H S * Ω H Ω Ω Ω 2 Ω * o o Ω H r- > o ° * <Ω Ω °> w a A rf A > Ω > Ω P £> ra Ω A rt Ω H ro ro H> Ω Ω rf r * Ω C> r * Ω > z <- * 1 ¼ r + c; > 2 Ω r * rf r * > ^M > ω> Ω

CA £ 0 r *

O

O r * £ 3

O

CA.

O ro r *

CA «-►

CA.

A o

o £ 3

CA.

CA.

CA o

o

CD

CA.

P

CA o

o o

□ rf to

A

A £ 3

A

P

P o

o £ 0 <J Ω £. H

H>>w> ³ H

H * <

CO>

i? Ω Ω

CA.

O

CA £ 8

CA.

Oh o

r *

CA.

H ti

Ό

H>

H

Ω

Ω

Ω

H

Ω

Ω

C- <>> Ω £> ro i-9

Ω o

P

CA.

A

CA.

P o

o o

CA.

P o

r * o

o o

ro

CA.

A

A o

r *

CA r *

CA r *

CA ro

P

FA ro ·

Table

O cn o_> _J o

co O

L ° ί mc ¹ d

° J to <·

OO = □> - Ld O —i {23

OO = c>

o

CL

Ld t t o {23

K L- =>

ę \ {LjJ Ld

O

CLd

See

OO

See

C2

See

OO

See

See

CL

See

CL <2 _l <C

Φ

LJ Bi

L v

LJ c

co <

o

LJ ω

> »Υ

a u >>

rn

U ο

5 = without h

<

Or 3 □ L H without β e L O ' o ~ < CO < tn < L co > 1 • vd • M «L d UI o H a co £ o JZ < Oh, CL CJ X W h ^! c Λ M O h < o Mr. <a k— * H > 3 O O m ΪΟ LJ »* without c! b u (0 * - < <1 H o 3 Asp L CL • O O d O 14th CL < cu and 3 • -d CB < V 0 >

Table 2 (continued) ca re tn re

K r

re

C

Oh

O

Table 3. cccegagcc ggaccggggc caccgcgccc gctctgctccg acaccgcgcc

4J 00 O H > - o U a u 4 CJ 00 CU u CJ CJ 00 y u u ca H 3 CJ u >> CJ (4 H u CJ H 4 u 00 00 3 < 4 -O 00 a 4 O O < > H CJ 00 «J CJ ca CJ O 00 4 no CJ 00 *** □ EP CJ 00 u 4 CJ 3 CJ > 8th cu 4 8th u y 4U > 8th > · CJ u 4 4 CJ u CJ CJ CJ CJ 00 <0 oo u ' 8th CJ H e CJ H u 1 X < 4 CJ 00 eo 3 H CJ v o co CJ u CJ S u 00 y 00 3 CJ H 4J u > 4 CJ u 00 y 00 S CJ CJ y <0 00 H 00 y 00 u y 00 B CJ H y 00 4 o 00 y Q0 y 00 y 3 u 00 y □ H 4J ej 4 CJ 00 00 « CJ bJ o y 00 cn H y 00 y O 00 oo 00 4J B O com a y 4 U y 00 y y 4J y 00 B CJ H 4 b y u 00 CJ B H H y y 4 b U y y u u CJ y y y 00 S oo y £ 1 H y oo y y 3 CJ bJ H 4 a 00 00 a 00 y y S CJ (9 y u he y n H 00 CJ y y u a y oo a y 00 CJ

while {M 4 {Λ U> S cj s

t) «<O k - <O n

= X V) u e <

cu

M H O Ji O <H <

³ $ 2 4

Oh o

C H ΐϊ

CJ

5K u U o cj ca <

e u S xcj co o H e u h

B U si o u β H O r-t CJ n <o e fi B>, CJ {Λ U H

4g

0,0 lJo She, o

H <

(J 4h *

C * H

I

310 <

C CJ - 'o et CJ O 4 CJ Ό <O

U CJ c q rH

Oh o

5 * 8

O CJ

CJ> 8

O <CJ CJ

U CJ and H

X <

eco £ 3 o

O «09 4

CJ

O

CJ • -i <

O eoo P O / <CJ

SS u

CJ £ 8 <CJ o u

U O O CJ co H

CJ

U

O

CJ

H

H

P CJ

e.3

O.CJ «<<o

SS (U CJ

CJ 0 fl> CJ

O U H O 41 CJ

CO <

O 0 H> CJ

CJ

CJ o

CJ

H

O

CJ ii

CJ o u

CM <J - <CO o O c o -t <

o o o

5S

O CJ

SS J u '<o

CJ O β H n 4 O

CJ

O

O >> O

O o o c o

O CJ

2-8 H H

CJ e

O CJ <0 H> CJ

O cr \ O

U

CJ

CJ o

<

o e »o o

SK c

co

P

4i

C.CJ not ¹ <<»<

□ H U H 4 CJ>, O 4 O o o gtgggaacca tgaagacagg atgggggctg gcctctggct ctcatggggt ccoagttttg tgtattctc

n rt oo rt rt 00 H o cn o r · o Γ » rt 00 rt n n O X M d. o M 00 oo d rr d r » O u n C. H 0 Γ » 00 o d r » rr 00 U d d 00 00 CJ 00 oo 00 oo rt > > M * Uh Γ) n co d 00 d 00 O s H x n * 1 rr n 00 d rt n o o o ► 0 rf 00 rt rt d rt n Cj rt 00 rt d > H o > o > n a · o rt > ω > n > ? o H o rr rt d rt rt rt o o o < O > n rt rt rt rt d o ►- < H d O > - » o rt 00 d rt rt os: o r * o d d d rt rt d n 00 rt rt d 00 rt 00 n 00 Oh rt rt o > H H o > n rt 00 00 co D > > < o r- * n 00 00 oo rt rt O Ό o n d rr ΓΤ d rt rt rt O rr d rt d rt > > r * H cn H ω O r ( O \ o o n (0 > W cn o rt > * t Cj rt OO d Oh n H > > o > Π rt d d n 00 O • C3 r- —- 03 n n n d λ > H 3 a-to 00 OO 00 rt d rt 00 n r> rt rt d rt n Cj n co 00 rt rt H • TJ Ο d n rt d d rt O H 3 * o rf o 00 00 rt n 00 O rt H d CO rt d CO d rt 00 00 D 00 00 rt rt rt 00 o r * o * 0 H rt n n O c > o 00 o rt rt π 00 rt O > r- o r n n rt rt rr d OO o -1 UI H rt o CJ rt rt Π d rt o 0 o O c n rt d d d rt rt rt rt rt 00 00 rt rt n O rt d 00 rt d n o O > n 00 rt 00 OO rt n o H · n r | rt 00 00 rt 00 00 rt > S! > rt rt oo 00 d rt rt rt rt o rt oo rt rt 00 > f > H > s; n X o a > OO rt d Oh d 00 00 o r ¹ ' > oo Cj n d oo d 00 H A H Ι- rt 00 rt d d 00 rt O e Π Ο 00 oc rt CO 00 00 d 00 Cj rt rt 00 oo rr n rt 00 d d co d ► r · > H o 00 rt rt d η rt > < O X CU P d rt rt rr rt O a H 1 oo rt d rt rt rt rt o n d d 00 rt d O t- O > H A O H * O e H d oo rt d 00 rt rt rt H H O > o oo rt d rt d rt S » < > u n 00 rr 00 rt oo d O 1-1 O o n CJ rt o d rt rt n 00 OO co 00 rt rt n P d rt d rt rt > H > H rt P rt d co d rt p 3 · o rt rt Oh 00 d 00 rt > Π H * t 00 rt rt rt 00 rt rt o rt r> rt n 00 rt o O H * 3 o t— · H X o · < O rt o d d rt d rt n Cj 00 00 rt d rt d o O n > n oo 00 d n CJ rt > t- · o • n rt d d rt 00 rt o c o rt oo Oh n d rt rt d 00 00 d n rt rt d oo rt n rt 00 rt rt 00 Cj 00 rt d 00 d o r * rt Cj n d 00 rt rt o C o > < r ~ \ no r — i · *. ie

Table 3 (continued)

130

Ribbon 1 shows the sequence of a region that hybridizes to a 32-fold degenerate 17-mer in one of the clones. The open reading frame of this DNA sequence contains nucleotides that can accurately encode the tryptic moiety that was used to construct the 17-mer group structure. In addition, DNA sequence analysis has shown that the 17mer hybridized region is located in an 87 bp exon surrounded by a potential splice acceptor and donor sites.

Further confirmation that these two clones (herein denoted as λHEPO1 and λ-ΗΕΡΟ2) are EPO genomic clones were obtained by sequencing additional exons containing other information encoding tripty fragments.

Isolation of EPO cDNA clones

Northern blot analysis of human germ (20 weeks) (Derman, E., et al., Cell 23: 731, 1981) was performed using a 95 nt single-stranded sample prepared from the M13 clone containing part of the 87 bp exon described in Table 1. As shown in Figs. 1, a strong signal can be detected in germ liver mRNA. This band was reliably identified as mRNA EPO using the same germ liver mRNA sample for bacteriophage λ cDNA library screening (Toole,

J.J., et al., Nature in Press. 1984).

The ratio of several hybridizing clones to the recombinant tested was 1: 250,000. The complete nucleotide sequence and the predicted amino acid sequence for these clones (X-HEPOFL13 and X-HEPOFL8) are shown in Tables 5 and 6. EPO coding information is located at the 5 'end of the cDNA. , which has a highly hydrophobic leader of 27 amino acids and a mature protein of 166 amino acids.

The N-terminus of the mature protein was identified based on the N-terminal sequence of the protein secreted into the urine of individuals with aplastic anemia (Table 1) as described by Goldwasser (Blood Suopi. 1, 58, xlii (abstr), 1981).

Sue and Sytkowski (Proc. Nat'l. Acad. Sci. U.S.A. 80: 36513655,1983) and Yanagava (J, Biol. Chem. 259: 2707-2710,1984).

It is not yet known whether this N-terminus (Ala-Pro-Pro-Arg -) is the true N-terminus of circulating EPO or whether it is degraded in the kidney or urine.

The amino acid sequences underlined in Tables 2 and 3 are those triple moieties of the N terminus or portion thereof having the protein sequence obtained. The predicted amino acid sequence is completely identical to the tryptic fragments sequenced, confirming that the isolated gene encodes a human EPO.

Structure and sequence of the human EPO gene

FIG. Figure 3 shows the relative positions of DNA inserts of four independent human EPO genomic clones. Hybridization analysis of these cloned DNAs with oligonucleotide samples and other samples prepared from two classes of EPO cDNA clones allows for the localization of the EPO gene in the 3.3 kb region shown in Figs. 3 bold line. The complete sequence analysis of this region (see Ex. 4) and comparison with the cDNA clones allows to map the intron and exon structure of the EPO gene shown in Figs. 4. The EPO gene is divided into five exons. Part of exon I, exon II, III, IV and part of exon v contain protein-coding information. Exon I and V residues encode 5 'and 3' untranslated sequences, respectively.

Accelerated EPO expression in COS cells

To demonstrate that biologically active EPO can be expressed in a cell culture system in vitro, the COS cell expression system was investigated (Hewick, R.M., et al.

J. Biol. Chem. 256: 7990-7997,1981)

For accelerated studies the vector p91023 (B) described in E.g. 5. This vector contains the major late promoter of the adenovirus, the SV40 polyadenylation sequence, the SV40 replica, the SV.40 enhancer, and the adenovirus VA gene. A cDNA insert from X-HEPOFL13 (see Table 6) was inserted into the p91023 (B) vector, below the adenovirus major late promoter. This new vector is designated pPTFL13.

24 hours after transfection of this construct with t COS-1 cell strain M6 (Horowitz et al., J. Mol. Appl. Genet. 2: 147-149 (1983)), the cells are washed, serum-free, and harvested 48 hours later. . The level of EPO secretion into the medium is measured by a quantitative RIA method adapted to EPO. As shown in Table 8, (Example 6) expresses immunologically active EPO. The biological activity of EPO produced from COS-1 cells was also investigated. A separate experiment was performed in which the vector, EPO cDNA from X-HEPOFL13, was transfected into COS-1 cells and the media harvested as described above. The amount of EPO in the medium was determined by one of two in vitro bioassays: ³ Htrimidine and CFU-E (Krystal, G. Exo. Hematol. 11: 649-660, 1983; Bersch, N. and Golde, D.W., In vitro Aspects of Ervthroooiesis). MJ Murphy (Ed.) New York: SpringerVerlag, 1978) and one of two in vivo assays; with hypoxic mice and starved rats (Cotes, P.

M. and Bangham, D. R. Nature 191: 1065, 1961; Goldwasser,

E. and Gross, M. Methods in Enzmol. 37: 109-121, 1975) (see Table 9, Ex. 7). These results demonstrate that COS-1 cells produce biologically active EPO. In Western blot data, analysis of polyclonal anti-EPO antibodies shows that EPO produced in COS-1 cells exhibits the same motility as native urine produced by NDS-polyacrylamide gel (eg, 8). Therefore, it can be concluded that COS-1-produced EPO can be similarly glycosylated as native EPO.

Other vectors containing various promoters may also be utilized in COS cells or other mammalian or eukaryotic cells. Examples of such promoters useful in the practice of the present invention include the SV40 early and late promoter, the mouse metallothionein gene promoter, the promoter found in avian or mammalian retroviruses, the baculovirus polyhedron gene promoter, and the like. Other examples of cells useful in the practice of the present invention include E. coli, yeast, mammalian cells such as CHO (Chinese hamster ovary), C127 (monkey epithelium), 3T3 (mouse fibroblasts) CV-1 (green monkey kidney) and insects. cells such as' from Spodoptera frugiperda and Drosophila methanogaster. These alternative promoters and / or cell types may influence the level and timing of EPO expression by producing a cell-specific type of EPO, or by growing large amounts of EPO-producing cells at lower cost and under easier control conditions.

An expression system that retains the benefits of expression in mammalian cells, but less time spent developing a highly productive cell line, is composed of an insect cell line and a DNA virus that replicates in that cell line. This virus is called nuclear polyhedrosis virus. It consists of a double-stranded circular DNA genome of 128 kb in size. The nuclear capsid has an elongated shape and comes in two forms: the neoclastic form when the virus is membrane-encapsulated and the occluded form when the virus is in the crystal of an infected cell's nuclear protein. These viruses can be cultured in a standard manner in vitro in insect cell culture and can be treated using all standard animal virological methods. Cell culture medium is a standard nourishing saline solution containing 10% fetal calf serum.

In vitro cultivation of viruses begins when the unoccupied virus (NOV) enters the cell and penetrates into the nucleus where it replicates. This is nuclear replication. During the initial phase of virus addition (8-18 hours post-infection), nuclear capsids regroup in the nucleus and then spread through the plasma membrane as NOV, thus spreading the infection throughout the cell culture. In addition, some nuclear capsids then remain (18 and more hours after infection) in the nucleus and become trapped in a protein substance called polyhedral inclusion bodies. This form does not infect cell culture. The matrix is made up of a protein called polyhedrin with a molecular weight of 33 kd. Each PaB is approximately 1 mm in diameter and can contain up to 100 PaB per core. The late stage of infection produces very high levels of polyhedrin, up to 25% of the total protein in the cell.

Since PiB has no effect on the in vitro replication cycle, the polyhedrin gene can be deleted from the viral chromosome without causing any damage to the viral viability in vitro. Using the virus as an expression vector, we replaced the coding region of the polyhedrin gene with foreign DNA that we sought to express under the control of the polyhedrin. promoter. A viral phenotype that does not form PI is obtained.

This system has been used by several researchers, including Pennock et al. And Smith et al. Pennock et al. (Gregory D. Pennock, Charles Shoeraaker, and Lois K. Miller, Molecular and Cell Biology 3:84, pp. 399-406) described the high level expression of a bacterial protein, β-galactosidase, under the control of a polyhedrin promoter.

Another expression vector constructed from nuclear polyhedrosis virus was proposed by Smith et al. {Gale E. Smith, Max

D. Summers and M.J. Fraser, Molecular and Cell Biology, May 16, 1983, pp.2156-2165). The authors demonstrated the efficacy of the proposed vector in expressing β-interferon. As expected, the synthesized product was glycosylated and secreted from insect cells. Example 14 describes modifications of a plasmid containing the polyhedron gene of the Autographa californica nuclear polyhedrosis virus (AcNPV), which allows for easy insertion of the EPO gene into the plasmid for transcriptional control by the polyhedrin promoter. The resulting DNA is co-transfected with the wild-type AcNPV intact DNA chromosome into insect cells. Due to gene recombination, the AcNPV polyhedrin gene region is replaced by DNA from the plasmid. The resulting recombinant virus can be detected in subsequent generations of viruses by their DNA present

EPO gene. It is expected that insect cells infected with the virus will produce EPO.

Examples 10 and 11 (CHO), 13 (C127 and 3T3) and 14 (insect cells) illustrate EPO expression in CHO, C127, 3T3 cells and insect cells.

Recombinant EPO produced in CHO cells as shown in Example 11 was purified using known column chromatography techniques. The relative amounts of carbohydrates in the glycoprotein were determined by two independent methods [(i) Reinhold, Methods in Enzymol. 50: 244-249 (Methanolysis) and (ii) Takemoto, H. et al. Biochem. 145: 245 (1985) (pyridylamine coupled with independent determination of sialic acid)]. The results obtained by both methods were very good. Several analyzes were performed and the mean values were compared with N-acetylglucosamine, which is considered to be level 1.

Carbohydrate

Relative number of moles

N-acetylglucosamine 1

Hexoses: 1.4

Galactose 0.9

Manosis 0.5

Of N-acetylneuramine. acid 1

Fucose 0.2

N-acetylgalactosamine 0.1

It is worth noting that a significant amount of fucose and Nacetylgalactosamine have been repeatedly detected by use

K independent carbohydrate analysis methods. The presence of nacetylgalactosamine indicates that the protein is of the 0-glycosylation type. O-glycosylation is also confirmed by SDS-PAGE (electrophoresis on a polyacrylamide gel in the presence of sodium dodecyl sulfate) of a glycoprotein cleaved by various combinations of glycosidic enzymes. More specifically, after enzymatic removal of all N-linked protein carbohydrates, the enzyme 19 endo-F N-glycosidase reduces the molecular weight of the protein by SDS-PAGE analysis by exposure to neuraminidase.

The in vitro biological activity of purified recombinant EPO was measured according to G. Krystal, Exp. Hematol. 11: 649 (1983) (spleen cell proliferation assay), and protein content was determined by analysis of amino acid composition. Multiple assays showed that the estimated specific activity of purified recombinant EPO in vitro is greater than 200,000 IU / mg protein. The mean value was from. 275,000 to 300,000 IU / mg protein. In addition, values greater than 300,000 were obtained. In vivo activity ratio (polycythaemic test in mice, Kazal and Ers.lev, Am. Clinical Lab. Sci., Vol. B, p. 91 (1975)) / in vitro ranged from 0.7 to 1.3.

It is interesting to compare the characteristic of the glycoprotein above with that of recombinant CHO-produced EPO described earlier in International Application IPA Publication No. WO85 / 02610 (published June 20, 1985). The corresponding comparative analysis of carbohydrates, described on page 65 of this application, provides zero values for fucose and N-acetylgalactosamine and a hexane: N-acetylgalactosamine ratio of 15.09: 1. The absence of N-galactosamine indicates that the glycoprotein described is not O-glycosylated. In contrast, the recombinant EPO of the present invention, produced in CHO cells and described above, contains a significant amount of repeated measurements of fucose and Nacetylgalactosamine and less than one tenth of the relative amount of hexose and is O-glycosylated. Furthermore, the high specific activity of the above-described recombinant EPO produced in CHO cells may be directly related to the characteristic glycosylation of the protein.

Biologically active EPO produced in prokaryotic or eukaryotic organisms using the cloned EPO genes of the present invention can be used in vivo by medical and veterinary practitioners in the treatment of mammals. The amount of active ingredient will, of course, depend on the severity of the disease being treated, the route of administration, and the specific activity of the active EPO, but it will be up to the treating physician or veterinarian. The amount of active EPO prescribed by the attending physician is known as the "EPO effective therapeutic" amount. For example, in the treatment of induced hypoproliferative sheep anemia associated with chronic renal failure, the effective daily amount of EPO was 10 UU / kg for 15 to 40 days. See also: Eschbach et al., J. Clin. Invest., 74: 434 (1984).

Active EPO may be administered by any appropriate treatment. It is preferable to administer EPO to blood-treated mammals. It will be appreciated by those skilled in the art that the most appropriate route may vary with the disease being treated.

Although it is possible to use EPO as a pure or substantially pure compound, it is more suitable to use EPO as a pharmaceutical formulation or formulation.

Compositions of the present invention for both medicine and veterinary use contain the active EPO protein described above in combination with one or more pharmaceutically acceptable carriers and sometimes other therapeutic ingredients. Carriers should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient. It is desirable that the composition does not contain oxidizing agents and other substances known to be incompatible with peptides. The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of combining the active ingredient with a carrier comprising one or more accessory ingredients. In general, the dosage form is prepared by mixing the active ingredient with a liquid carrier or a crushed solid carrier, or both, and, if necessary, giving the product the desired form.

Formulations suitable for parenteral administration are usually sterile aqueous solutions of the active ingredient, which are usually isotonic with the patient's blood. These dosage forms can be readily prepared by dissolving the solid active ingredient in water and either sterilizing the resulting solution as such or packing it in multidose containers such as sealed ampoules or vials.

The EPO / cDNA referred to herein denotes a mature EPO / cDNA gene located upstream of the ATG codon and EPO / cDNA encoding allelic variants of the EPO protein. One of the alleles is shown in Tables 2 and

3. The EPO protein comprises a 1-methionine derivative (Met-EPO) and allelic variants of the EPO protein. The mature EPO protein, the sequence of which is given in Table 2, begins with the following sequence: Ala-Pro-Pro-Arg -.... The start of the sequence is designated as "1. Met-EPO starts with the following sequence: Met-Ala-Pro-Pro-Arg-. . . .

The following are examples which help to understand the scope of the present invention. The full scope of the invention is within the scope of the invention. It will be appreciated that the methodologies herein may contain modifications, but do not distort the spirit of the invention. All temperatures are in degrees Celsius and are uncorrected. The terms "micron" or "micro" are denoted as μ, for example, microliter, micromole, and so on. is ,, μΐ, ,, μηι and so on.

EXAMPLES

Example 1: Isolation of EPO Genomic Clone

EPO was isolated from the urine of patients with aplastic anemia according to the procedure described previously (Miyake, et al., J.

Biol. Chem., 252: 5558 (1977)), except that the preparation is stored at 80 ° C for 5 minutes in place of phenol treatment to inactivate neuraminidase. The final purification step was fractionation through a Vydac HPLC column (Separation Group) using a gradient of 0 to 95% acetonitrile in 0.1% trifluoroacetic acid over 100 minutes. The gradient of EPO outflow was determined by analyzing the major peaks by gel electrophoresis and determining the N-terminal sequence

EPO is present at about 53% acetonitrile and accounts for about 40% of the total protein allowed for reverse phase chromatography. Fractions containing EPO concentrated to 100 μΐ, pH adjusted to 7.0 by addition of ammonium bicarbonate, and digested with 2% trypsin in TPCK (Worthington) for 18 hours at 37 ° C. The tryptic peptide mixture was fractionated by reverse phase HPLC as described above. Optical densities are recorded at 280 and 214 nm. Well-separated peaks are collected, dried to dryness, and analyzed at the N-terminus using Applied Biosystems

Model 480 A gas phase sequencer. The sequences in Tables 2 and 3 are underlined. As described above, two such tryptic fragments were selected for the production of oligonucleotide probes.

Based on the Val-Asn-Phe-Tyr-Ala-Trp-Lys sequence (amino acids 46 to 52 in Tables 2 and 3), a 17-mer was synthesized 32 times,

TTCCANGCGTAGAAGTT and the 18-mayor, 128 times,

CCANGCGTAGAAGTTNAC.

Based on the Val-Tyr-Ser-Asn-Phe-Leu-Arg sequence (amino acids 144 to 150 in Tables 2 and 3), two groups of 14-mer were synthesized, each degenerate 32 times

TACACCTAACTTCCT and TACACCTAACTTCTT, which differ primarily in the position of the leucine codon. The oligonucleotides were labeled at the 5 'end of ³² P using polynucleotide kinase (New England Biolabs) and γ ³² P-ATP (New England Nuclear). The oligonucleotides had a specific activity of 1000 to 3000 Ci / mmol for the oligonucleotide. Screening of the human genomic DNA library λ bacteriophage (Lawn et al., Cell, 15: 1157, 1978) was performed using the in si tu amplification technique first described by Woo et al., Proc. Nat'l. Acad. Sci. USA 75: 3688, 1978). Approximately 3.5 x 10 ³ phages are placed in Petri dishes (6000 phages per 150 mm diameter plate), with NZCYM medium and incubated at 37 ° C until small but noticeable spots (approximately 0.5 mm diameter) appear. Cool to 4 ° C and maintain at this temperature for 1 hour. Duplicate stain replicates were transferred onto nylon membranes (New England Nuclear) and incubated overnight at 37 ° C in plates with fresh NZCYM medium. The filters are denatured and neutralized by maintaining a thin layer of 0.5 N NaOH - 1 M NaCl and 0.5 M Tris (pH 8) - 1 M NaCl, respectively, for 10 minutes.

The filters are heated for 2 hours at 80 ° C, washed 5 times with SSC, 0.5% NDS for 1 hour. Cell debris is removed by gentle sweeping with a damp cloth. This sweeping reduces the background adhesion of the probe to the filter. The filters are then washed with water and prehybridized for 3 to 4 hours at 48 ° C in 3M tetramethylammonium chloride, 10 mM NaPO 4 (pH 6.8), 5x Denhardt's solution, 0.5% NDS and 10 mM EDTA. ³² P-labeled 17-mer (concentration 0.1 pmol / ml) is then added and hybridization is continued for 72 hours at 48 ° C. After hybridization, the filters were washed extensively in duplicate SSC (0.3 M NaCl - 0.03 M Na Citrate, pH 7) at room temperature and 1 hour in 3M TMAC1 - 10 mM NaPC> 4 (pH 6.8) at room temperature for 5 to 15 minutes. temperature. Approximately 120 strong dual signals were detected after 2 days of autoradiography using an intensifying screen. Positive signals were collected, grouped at 8, overlaid, and rescreened with three replicates using half of the 14-mer group on each of the two filters and 127 = mayor on the third filter. The procedure for the 17-mer hybridization and hybridization was the same as described above except that the 14-mer hybridization was carried out at 37 ° C. After autoradiography, the probe is removed from the 17-mer filter by keeping it in 50% formamide for 20 minutes at room temperature and the filter is rehybridized at 52 ° C with an 18 mer probe. Two independent phages hybridize with all three probes. From one of these phages, the DNA (here designated as λ HEPO1) was completely digested with Sau3A and subcloned into M13 for use in DNA sequence analysis to complete the dideoxy chain according to Sanger and Coulson (Proc. Nat'l. Acad.

Sci., U.S.A. 74: 5463 (1977). Also described herein is the nucleotide sequence of the open reading frame encoding the triple fragment of EPO (underlined region) and the amino acid sequence thereof. Intron sequences are denoted by lower case letters, exon sequences (87 nt) by upper case letters. Sequences that correspond to the consensus splice acceptor (a) and donor (b) sites are underlined (see Table 4).

Example 2: Nothern blot analysis of human embryonic liver mRNA

Agarose (0.8%) formaldehyde gel is electrophoresed with 5 µg human germinal liver mRNA (prepared from 20-week-old germ liver) and adult human liver mRNA and transferred to a nitrocellulose filter using the method of Derman et al., Cell, 23: 731 (1981). )). Prepare a single-stranded probe from sample M13 containing the insert shown in Table 1. The 20-mer was selected as a primer using the same tripty fragment as the original 17-mer probe. The probe is prepared according to Anderson et al., Proc. Nat'l. Acad. Sci. , having a 74 nt coding sequence), the small fragment is separated from the M13 sample by chromatography on a Sepharose C14B column with 0.1N NaOH0.2M NaCl. The filter is hybridized until the probe activity reaches about 5 x $ 10 pulses per minute.

(cpm) (12 hours at 68 ° C), washed in duplicate SSC at 68 ° C and exposed for 6 days with an intensifying screen. In the adjacent lane, a single spot (1200 nt) marker of mRNA is indicated by an arrow (Fig. (Fig.1). 1).

Example 3: Germ cDNA

Prepare a probe identical to that described in Figs. 2, and screened for germinal liver cDNA libraries prepared in vector X-Ch21A (Toole et al., Nature in Press, (1984), using standard lice stain screening procedures (Benton Davis, Science 196; 180-182, 1977). Three independent positive clones (designated X-HEPOFL6 (135 bp), X-HEPOFL8 (700 bp), and λ15 HEPOFL13 (1400 bp) were isolated after screening with 1 x 10 ^ lice spots. The entire insert of X-HEPOFL13 and X-HEPOFL6 was sequenced by subcloning into M13 (Tables 7 and 5, respectively) Only single fragments were sequenced in insert X-HEPOFL8 - the residue was judged to be identical to the other two clones (Table 6). 5 'and 3' untranslated sequences are denoted by small letters The coding region is capitalized.

According to Tables 2 and 3, the expected amino acid sequence is given after the nucleotide sequence and numbered, starting with the first amino acid of the mature protein. The putative leader peptide in the amino acid sequence is capitalized. The cysteine residues in the mature protein sequence are additionally labeled with SH and the N glycosylation sites asterisked. The underlined amino acids denote residues as determined by sequencing the N terminus of the protein or by sequencing the triple fragments of EPO as described in Example 1. The underlined dashes denote those residues, i.e., unambiguous, in the fragments. cDNA clones X-HEPOFL6, X-HEPOFL8 and λ35 HEPOFL13 were deposited in the American Type Culture Collection, Rockville, Maryland;

CCTGCCTCGCTGTGGCTTCTCCTGTCCCTCCTGTCGCTCCCTCTGGCCCTCCCAGTCCTGGGCCCCCCACCAcic ProAlaTrpLeuTrpLcuI.euLeuSerLeuLeuSerLeuProLeuGlyLeuProValLeuGlyAlaProProArg CTCATCTGTCACACCCCACTCCTCCACACGTACCTCTTCCACGCCAACCACCCCCACAATATCACGgtgagaccc 1350 LeulleCyaAspScrArgValLeuCluArgTyrLeuLeuCluAlaLysCluAlaCluAsnlleThr cttccccngcncattccacagaactcncgctcagggct tcagggaactcctcccagatccaggaacctggcactt

o 99 P 09 fl fl rt O O n 09 rt fl fl 09 P p 09 rt P rt C9 09 n n n fl fl 09 fl • 09 09 n rt P 09 09 P a n o fl P rt 09 09 fl 09 o 09 09 P P 09 o H n 09 fl fl 09 P rt p * 5 P Π fl P fl • o O • n fl 09 P 'Fl rr 'Rr P 09 P rt n 09 09 n n > P fl 09 rr 09 fl 09 09 99 09 rt 09 09 > > n 09 P fl 09 fl rr fl 09 rt P 09 09 09 o o n P fl fl fl fl 09 rt p rt rt rr 09 09 o n Cl 09 P fl P fl 09 09 09 rr P 09 09 P o Cl n rr fl fl fl fl 09 • rf 09 09 P P P rt o o o fl P 09 rr fl fl fl O 09 09 P 09 rt n o . n fl 09 09 fl fl rr n Cj fl n 09 09 rt o Cl n fl fl P fl P rt rr oo fl rr 09 09 P o > n rt fl 09 fl 09 fl rt o 00 09 09 09 09 > Cl • o 09 rr fl • fl 09 * fl n □ 09 P 09 09 fl o Cl o 09 fl fl rt P P Π (*> P rt P 09 09 s> H H 00 rt rt fl 09 09 P n 09 P fl rt fl O H H n fl fl fl fl 09 P n n P p P C9 fl rr O n H fl fl P fl rr fl o 09 P fl fl 09 n Cl O n n  P fl 'P 09 09 fl • 99 P C9 fl P 09 n M o C) o n fl fl fl rr fl a 09 rt rt 09 09 09 * <n Cl H Cl fl fl 09 fl P M n rt 09 09 rt fl 09 <o Cl o Cl P fl P fl 09 (D P 09 09 99 rt P fl p H Cl , o Cl fl P fl 09 fl 0 P 09 rt oo rt H-O > • o Cl fl 09 • fl 09 ¹ rr 3 o rt fl 09 fl P = Cl H > Cl fl 09 fl C9 P rr n 09 09 09 fl rt M.> o n Cl fl fl P P fl fl> rr 09 fl fl 09 rt rt © o > Cl fl 09 09 09 rt H- ¹ r * fl rt rt 09 fl 09 o a Cl n Cl P rt 09 fl rt Π> · C P 09 09 09 fl 09 09 Cl n Cl fl fl 09 fl rr rr 09 09 rt P fl rt Cl o H fl fl fl fl 09 Π 09 rt P rt fl fl 09 Cl n Cl fl rr fl P fl n 09 P 09 09 09 P P Cl n Cl 09 09 fl 09 09 n rt 09 fl P rr 09 09 Cl , n Cl fl fl 09 fl 09 n rt fl fl 09 09 09 rt Cl n H 09 fl '09 fl P n 09 fl P 09 fl P P Cl n Cl fl n 09 rt P n 09 rt fl 09 fl 09 fl o o Cl P fl P rt fl o 99 99 fl 09 P 09 rt Cl n Cl fl rt 09 rt rt n 09 09 p P 09 rt fl H H Cl 09 09 fl fl fl 90 P 09 fl P Π 00 09 Cl O H fl fl P . fl P • n fl 09 rt 09 99 09 fl H O Cl P rt 09 fl 09 o O 09 rt P 09 fl 09 Cl > Cl fl fl fl P fl rr 09 rt P P 09 rt 09 Cl o Cl P rt fl 09 P 99 09 09 rt 09 09 09 09 H . > Cl fl 09 fl P P P P 09 Π 09 P 09 fl Cl o Cl P P • fl r * 'N o P 09 rt rt fl 09 rt > n Cl rt fl fl P n n 09 99 09 rt n rt 09 C) n Cl 09 fl P 00 n n 99 rt Π rt rt rt 09 Cl o > fl fl rt fl P rr P 09 fl 00 09 fl 09 Cl n Cl P fl 09 P 09 o fl rt p 09 09 P fl Cl n Cl 09 09 P • 09 09 • P 99 09 09 09 09 P 09 Cl n P 09 fl fl fl 99 P fl P 09 09 09 fl Cl H C) rr 09 fl rt P O 99 P 09 09 09 00 rt Cl n Cl P rt fl fl rr n fl fl 09 09 P P fl Cl H Q. P 09 P fl fl rt rt P 09 rt 09 fl * fl o • n H fl 09 - fl 09 • rt 99 09 n 09 rt rt fl fl Cl n Cl P fl P Π fl 09 09 09 P n fl 09 09 Cl H H 09 fl fl fl n Π 09 09 P rt fl 09 Π Cl n Cl fl fl 09 P 09 r » 09 fl 09 09 rt fl fl Cl o Cl fl fl fl 99 P P fl P Π fl rt 09 fl > > H fl rr P • rt 09 • rt P 09 fl rt 09 P 09 Cl n Cl fl P fl fl rt O 09 fl rt 09 09 fl fl Ω o Cl 09 fl oo fl fl rt P P n rt 09 rt fl H o Cl P fl rr fl rt 99 99 09 rt 09 09 rt fl Cl Cl Cl fl fl O P fl rt P 09 09 fl P oo '09 Cl -  n Cl fl fl • rt P fl rt fl P rt fl rt rt 09 Cl n > fl rt 09 09 09 n 09 rt fl P 09 fl 09 H H Cl fl 09 fl 09 fl rt rt rt P 09 09 P rt o Cl Cl fl 09 P 09 fl P 99 09 fl rt fl P fl > Cl Cl 09 fl 09 rt O 09 09 P P 09 P 00 fl Cl Cl o 09 09 fl • 09 P • > 09 P fl 09 P 09 Π Cl o Cl fl P P fl P 09 rt fl P P P rt Cl n > fl fl 09 09 09 H P 09 P 09 P fl 09 > H Cl P fl fl Π P n rt P 09 P P fl rt Cl o Cl 09 fl fl P fl d 09 P 09 09 fl fl rt Cl o Cl P fl fl P fl r * r * σ * »~ · N) o O V » o Ln o u * O o O o o o o

ggtttggggtggagttgggaagctagacactgcccccctacataagaataagtctggtggccccaaaccatacct 1500

U oo

U

Oh u

Q.

OO ω

oo «3

U

U u

oo c

o υ

oo

U s · oo

U u

<J <0. u a u

-Lt s

be c

d

GJ

With

CC <0 u

ec ω, a

u

CC u

, CC a 00 00 <0 «C oo u

u jj u

a

o s < rH o O o 42 (-> <y < o S o u < < u u < ►J o o. o ) H H t_) a o r-1 o < E- U < H H O U H JZ p CL C 3 S «J > a O > 4

o o

co o

m σχ o

o

CM <9

O0 a

oo u

oo <C

U c

oo

CC «3

CO a

oo o

u

CO oo co

CC oo a

co a

CO a

oo <0 u

u oo u

CC o

O

00 00 00 4 4 00 co 42 he C 42 4 U 4 42 U 00 00 CO 42 a 42 00 4 4 u 00 4 4 U 00 00 00 4 42 CC ca 42 4 42 00 u 42 00 4 42 42 42 4 U 42 00 4 4 42. O «3 4 4 42 00 42 00 4 4 42 42 00 4 U 42 he 4 4 42 <0 ca U U U 4 4 u 42 4 00 ca u U U co 4 00 42 42 oo ca 4 00 U s ca 42 00 42 42 U 4. U 42 42 42 U 42 4 42 U U O 00 4 00 00 4 ca U u 00 U 00 «0 42 4 42 u 4 4 00 O u 4 00 42 4 co U 00 00 U 00. 4 4 . e 42 42 42 00 00 4J * ca U 00 4 4 00 42 00 u U CO U u a 42 00 42 00 oc 42 42 4 00 44 4 u U 4 oo 42 00 a 00 4 4U oo u 42 v 4 ca. u a 44 U u u 00 o 42 u 42 oo u 42 a 4 4 oo 00 42 00 4 4 o 83 4 00 <j 4 ca 00 00 U 42 42 42 42 42 ca 83 00 42 u 4 42 4 42 4 oc U. 42 4 O 00. 42 4 42 eo 42 00 U ca 42 4 u 00 00 u 42 o 4 <0 a OO o U CJ u 42 42 00 u u U <J 00 u 4 00 OO 4 42 U 00 00 42 00 4 00 ca. U 4 U 4. 00 u 42 42 00 83 4 00 4 42 U 4 oo 00 4 00 O 42 42 4 u U 00 OO 42 00 4 oo 42 4 00 00 42 (J a oo 4 4 00 4 42 U CJ 4 4 u · 42 00 00 4. o 42 42 42 00 00 42 00 00 4 42 00 00 4 4 υ 4 42 U 4

ttcattcaacaagtcttnttgcataccttctgtttgctcagcttggtgcttggggctgctgaggggcaggaggga 2250 Deposit Numbers (accession nurabers) ATCC 40156, ATCC 40152 and ATCC 40156, respectively.

Example 4: Genome structure of EPO gene

The relative sizes and localization of four independent genomic clones (λ-ΗΕΡΟ1, 2, 3, and 6) in the HAelII / AluI library are shown by overlapping lines in Figs. 3. The bold line represents the localization of the EPO gene. Scale (Kb) and positions of known restriction endonuclease cleavage sites are shown. Both strands of the region containing the EPO gene were completely sequenced using deletion series generated by exonuclease III in this region. The arrangement of the five exons encoding EPO mRNA is shown in Figs. 4. The exact boundary of exon I 5 'is currently unknown. The part of the zone that encodes the 'whitespace' is tricked. The complete nucleotide sequence of the region is given

Table 4. Known boundaries for each exon are marked with vertical dashes. Genomic clones λ-HEPOFL1, λHEPOFL2, X-HEPOFL3 and X-HEPOFL6 are deposited in the American Type Culture Collection, Rockville, Maryland; accession numbers ATCC 40154, ATCC 40155, ATCC 40150 and ATCC 40151, respectively.

Example 5: Construction of vector p91023 (b)

The transformation vector used was pAdD26SVpA (3) described by Kaufman et al., Mol.Cell. Biol. 2: 1304 (1982).

The structure of this vector is presented in Figs. 5Ά. Briefly, this plasmid contains the murine dihydrofolate reductase (DFHR) cDNA gene, whose transcription is controlled by the major late promoter of adenovirus 2 (Ad2). The 5 'splice site is labeled with adenovirus DNA, and the 3' splice site predicted by the immunoglobulin gene is located between the Ad2 major late promoter and the DFHR coding sequence. The early polyadenylation site of SV40 is below the DHFR coding sequence. The prokaryotic portion of pAdD26SVpA (3) is from pSVOd (Mellon et

Table 5 gacaggaag gacgagctgg gacagagacg tggggatgaa o

oh

a.

fb

U

X 3 • J CJ U CJ β CJ o x <: Csl _j <:

o

u H n u 3 o O u fb O kf o O α χ o o «Η O O 01 H o 01 CJ 01 o χ H < vO <CJ 00 CJ - ⁴ cn < to H ** u

co H S CJ B9 CJ v u C CJ <0 CJ > 4 o ω h rb CJ * “* TJ rb < rb CJ u H J CJ <u t-l < U u <O rJ u 3 U e h C CJ <H - «<: * (0 «C rb 60 > CJ CJ u << CJ CJ α o <0 AJ u O < 3 U ³ 9 XCJ AJ c; cj U H rb 3 rb CJ AJ cu cj ►J H CJ CJ CJ CJ CJ CJ 60 AJ 3 CJ 3 CJ C H rb U 60 CJ k] fb U CJ o fb J CJ u < << W fb> CJ b CJ <CJ U AJ <0 X CJ b CJ 3 CJ 3 CJ 3 U AJ U CJ X < o f- rb < Cl fb U U CJ H H -J H 3 u • J o 60 60 AJ 3 CJ eo CJ b U b CJ rM U u ω h u CJ CJ CJ s b «H Cl J CJ << CZJ < b. < > O O H 3 3 «CJ 60 CJ α H 60 a cj rb * C XX XCJ b CJ «Η O α ft. CJ CJ CJ M CJ t- << <O u AJ Cl 3 CJ 3 CJ cn cj cn cj 2 5 AJ ω h (U f- -4 < X < rb <- U • Y u ►J CJ S CJ J < CJ CJ α 60 AJ K u -b O ³ * 5 Oh, CJ b CJ ω u C H b CJ Cl CJ M H > O CJ CJ H H CZ1 t-1 U u 3 CJ 60 < com fb C3 CJ 3 CJ 60 ω h o u CJ O rb O o rb CJ o Cl (b U 3 CJ »4 <CJ n <CJ m <CJ r * Yeah α u α 3 CJ u CJ n H b f- 3 O AJ CJ H o cj T * X o X < α H u J CJ w < V3 CJ H H H «» 3 O u Oh u 0. CJ X u Cl CJ (9 O cj cj in < rb CJ X fb * -i O u M H <CJ CJ CJ ft. tb <O AJ U AJ 3 O 0) fb b CJ ^c b 3 O AJ CJ H X CJ X CJ M < oh H Cl X CJ ω U H H < << O o Cl d 3 CJ O U b CJ rb fb XCJ u U f— rb fb x cj CO t-1 »- <o J CJ > b < H < > CJ U CJ α 3 H □ α CJ u cn < C CJ 60 CJ (-1 O H rb t-l X ”S. β J CJ J CJ ►b < • J Oh o O <9 Cl CL. O M CJ C fb u α 0.0 o a cj b CJ * cn «C JZ CJ U o AJ H H <CJ << H < H H AJ (J 3 CJ O < 3 CJ O.U. O CJ H b CJ rb «C cn < Π H J CJ ft. cj CJ CJ <CJ > O Cl AJ to 0. U 0 < co CJ O < ³ < AJ oh cj b CJ -b CJ b CJ • H <· U H H o. cj <CJ ft. CJ Oh o 60 O <9 < ^u Γ3 CJ □ CJ rb CJ < 60 □ CJ • b α * 4 * C n H <9 H 6U <CJ - <CJ Oh o > CJ > O

u V CJ 60 U <9 H H b CJ > U ►M < <CJ

«Α <0 CJ Cl 3 • b CJ 3 ~ fb <U <U ft. H n «e 3 < b f- >> «4 rb < X U r4 < 3 3 H «C O. H R 3 0. u «N < X · <. M < <CJ r4 < <3 rb CJ ^C S2 β H <0 H r. 3 > CJ 3 O <3 α H tg 3 b fb b < rb 3 X 3 = CJ <3 f- < 3 CJ X < CJ 3 41 H rb 3 - H rJ CJ 3 3 «< C CJ P ³ b < rb < Cl fb X o CJ u 3 U fb < □ 3 Π fb 60 < Cl H rb 3 b 3 rJ CJ <3 <3 0 CJ Oh MO 0 3 3 b CJ - b 3 m o H O.U. - <3 - J 3 □ U 3 ί- 0 < - * < ο H b 3 3 3 J U C. 3 0.3 3 3 C t- b 3 O f- - 3 fb H U 3 <3 0 3 b H rs H b 3 J = 3 rb 3 ft. U f- < C 3 C 3 b 3 b < -4 < J = 3 Cl 3 O CJ H < H H b CJ 3 3 <3 3 CJ 3 Cl H -b 3 (Λ (b J 3 <3 b fb b 3 β 3 Cl 3 O 3 rb 3 M H V) < <3 C 3 60 3 ft. fb <n < b 3 <n < < <3 <3 -b 3 ³ h 0 < <0 H 0 fb b 3 > 3 3 3 ft. 3 3 O X3 0 H Cl fb -4 U b 3 r4 fb O 3 ft. 3

gtgggaacca tgaagacagg aCgggggctg gcctctggct ctcacggggC ccaagttttg tgtattcttc

o rt 00 rr n oo H O W o r n n 00 n o n 2 * 5 s H » 00 00 Co. rt 3 rt O 3 o e ft 00 n to Γ » rt 00 (0 e> P 03 00 > ► (o 00 oo oo 03 rt H M n 00 to oo 3 00 O r | H 3 * rt n Oh P o n 009 O 0 rt 00 o rt β) n n Co. o 00 o P > H O> O 3- O r | ► * 1 > 09

rr rr i) rf rt n o o n < n rr rt n n to o »- H 3 n rt 09 3 n n o * < O t- to to n n to n 00 n rt 3 00 n 00 n 09 00 rt rt o> H H rr rt 09 oo 00 Π > w > * < O 00 00 oo n O n ό O ri rt rt 3 o n n n rr 3 o to n

n Ί »o n> 09 θ 'O K

to rt oo to 00 n H n rr to to n co O 00 n n n to n > 00 00 oo rt to n 00 n n rt rr to n n to n 00 00 n n to n rr to to rt to rt n · oo oo n ft 00 00 rt to 00 to n oo 00 to 00 00 rr rt rr 00

f o

r ·· {D

H · ro ·

CH rt

Λ cn

00 O n o n 00 rt 2> - £ ' n n rt o rt to 00 O n tn 3 to to n n n to rt Ω09 O < o rt 3 3 to o Π cn rt n n 09 00 n n n to n 3 00 n to n o o oo n 09 00 o n o t- n oo 00 n 00 00 n > * < rt oo oo 3 o rt rt rt to n 09 n O • 00

00 o 3 09 to 00 00 00 3 O 3 00 to 00 rt 09 O 3 to oo o oo 09 n 09 00 00 to 00 3 rt a 00 Oh rr o rr 09 3 to OO to to 09 n rt to o rt to 3 3 rt o rt O 00 n 3 n rt n n to o 3 3 oo rt to

oo rt to 90 rt n o n 00 rt to O to o n 00 rr 00 O 00 to n to rt to to n o o 90 90 00 00 rt n n to to n to O rt rt to rt to 00 to n rt n 90 00 to oo o 00 rt O n 00 n n to rt O rt n 00 rt

>> <n «o r · H Λ o c

H H >> <O 1 a o o * <

n to to rt to n n to 00 00 rt to n to Cl a n 00 00 to n to n > H * o rt to to rt 90 o O C 00 00 o to Π Π to 00 oo to O rt n to 00 n o rr 00 rt <0 00 to 00 O to 00 to d ► rt to n to 00 rt rt a M OO 00 rt 90 to O rt n to

ctcgcCgcgc cgcgccgcac cgcgctgtcc ccccggagcc ggaccggggc caccgcgccc gctctgctccg acaccgcgcc

od 00 00 u o d cu R cj u > o O CM to U SS ►j u o o a o M H 3 o <e o u > O ω R > - (U u U H J cj <u

u R <9 U 3 O jC CJ O -j o O v H H < M3 <o 00 J U

4J a C o <8 O R r < > - « < U u 4 O

OO 3 < 0d -4 < n U O 0d 4J 6J M CJ 00 »-L < oo a o

U

4J >. o 4J 3 u U CJ CJ

eo ¢ 3

u r » ω H u t X <

U

U a

u cd u

U u

a oo

U o

oo e

o u

4J OO

U 00

O0 u u

u o

u C3

0d oo u 00

U 00

U 03 co oo

Od U f3 U

U 00 u u

4J 4J

U 00 u 00 u «3 υ υ u u u u u u a oo

Od u u oo u a

00 00 <3 00 U u C5 u 0d u 00 63 U O a u u 00 u 00

CJ □ CJ C R B O B CJ 3 H - · < * «Ο · £ R < * 4 > O CJ CJ <i O O CJ CJ o < 3 U ³ S2 xcj CJ a U «J H d r o —To CL, CJ ►4 H CJ o U CJ CJ CJ 3 a 3 O C R -4 CJ 60 0 ω H 41 H «< B R b O j CJ • J U <· Ί > CJ <CJ > 4 CJ b CJ □ CJ 3 O 3 O J u >. 3 «R -4 < «R CJ O f-R ►4 R O O «4 CJ 3 CJ ooo b U U u R CJ U H t-CJ «1 o 4> β t! U CJ · << cn < Σ < > U o R 3 O a cj 00 u R d CJ »-T <C s >> o b CJ d X CL, CJ CJ CJ ω R << «D O 3 a 3 CJ a cj the O ³ M H 4 »R d < > »< ►4 u ►4 CJ a u J < O CJ d CJ r4 O ³ 5 0.0 b O 3 CJ B R -t < b O 4) U (Λ R > O O CJ R R cn R 3 O eo < 19 R β U 3 CJ U R O b O o -4 CJ AIR O 4) R _J CJ - <u m <CJ «Λ <CJ r- d CJ 3 U m a O R b H 3 CJ d H 4J U M > .O >> < 4) R d U cn < 00 CJ R R R d CJ d CJ O. CJ >> CJ o o a cj u CJ tn · < d O JC h d ^u cn H <CJ CJ CJ £ b R i o 3 CJ o H U U B R 3 CJ E R 3 XCJ J = CJ 5 * 5 41 R • j CJ cn cj ti R < ►J a 3 a o CJ b O d R > ^ CJ d R 'd R λ a R r-t O d CJ d < R < > CJ o o 3 H 3 CJ V CJ a < C CJ U H a r d R d < rJ U r4 CJ R < ►4 < O CJ r. o 00 CJ C R b CJ 0.0 2 o b CJ * a «C J = U b O R H <CJ <· < R < R R 3 U o · < 3 CJ 0.0 r4 O w H b CJ -I < «< R 3 CJ Cm CJ CJ CJ <CJ > CJ Oh, CJ o < <9 O o < ³ i 2 a b a d CJ b U H t-l Cm CJ C CJ Cb CJ O CJ «C CJ <9 CJ 3 CJ d O r4 < J CJ -H O d K R R < CJ - * <CJ CJ CJ > CJ > o

o o O 1r.

n <H 3 O Ιc, ra —i C • H = n r. c- r

Cl> C, Ί O 00

Cl

H

Ci> -> 1 -

Cifci O n> n i ~ H tu n tH ra o c o o n t>

o> n in a>

n n> · - n o

H

O

Cl cn - ra rj n o

0.3

I

H n H ο · α o

• t o

rM ra • n fi n re \ D

O

O <H 3 O> -> cn - o ra o -9 n O

-9 H > H > n · ι O 3- o-o Ci n H o n > ra > > »- to> H n 3 > <o O o o o < >

O ln η γη ra o c o> n> ~ · Ci ti n r -9 O O C ci r- j H ra o O c

H cn O n O h n O £ c o>

Γ> HH a n rH n o c o> o n nm o

H o

> ►— »0)

O

3ra> 1-9 O, 3O S I n ici o

O Ve>

<i>

O

Ci>

> 1 year

ίο c

O cn 'S re a

H

-C

I-I

3 »cn I- O 3 ra <

(n £> O »1 n m> 2 h ra o r» o n> Ιο c o <H to O ίο n o l— ns o n> ιΟ 3

O O> ΙΟ 3 n> o I— n 3 σ 'o

· - O n n £ c o s> ΙΟ a cn> cn n ra o i

H c * -9 ra o c

O O> ιΟ C £>> V) H 3> 1-4 H ιΟ ra> H X> O-O H -i o

Ci>

Ci

O ►9>

Oh o

►9 n

>

1-1

OT ra ra c

H · <

I-I rara c

rara c

c-IS) s; O

LO

n > co n o ra CP n o > n n O n p CO -) -) n 00 o n 0) o • o n n co P CP 30th o Γ- -9 η o c: n CO n o r fl> -9 H O CO O r ⁷ co n o n n et 0 n fl> n rr H * o Γ- n n (D- -9 η p Γ » -9 c: CO n O Γ- -9 η co n O c rt rt n o C3 n O j · * n P -9 n rr co O c CO oo P o co n -9 ΓΛ CO n O fr; n CO co o Γ- to rt n -) η n co o no c n co n P co co n 00 co o Γ- CO o P H η co rr co O c n 00 o n co n

H W

o n 3 O CO n n C0 m n P n Γ- n rr n 1-9 η m co n O c n n co 00 Co. co 00 O co n n u o co n n 00 00 n H o Ci Γ- > 2 i o n H η H ra n P n c: n H M co o P n co 00 n o o n n n n n Ci r rr co n K n K rt n f) n n n n Γ- o < «-9 η H > n c n r o co co o Cl n n · * · 30th rt o n > CO O > o n V) b rr rr O0 n < ►? Ω CO P n rr H > r 00 Π n Γ- > c co n 00 co Ci Γ- ►9 n n P • -9 η n > < n n Ci c: H n P n o n n co co n D n r? CO n Ci Γ ^- n 50 ΓΎ co n * < H O 00 n rr n

u

JC (X lj

H a

Ul <

—H fi υ

c

H υ

<

Cl

JC fl

Table 7 (continued)

130

Pro Pro Asp Beer Ala Ser Ala Ala Pro Leu Arg

.Υ

O <

CJ u

'J

CJ

o a u XJ O <0 <* · -H o XJ 4J to —- < u <0 to n a w to a U u c U u a o u to ia * —1 < u 3 u a o a u co u o «0 x CJ • -H u O u 00 u O u to U < U 00 co r " u u a to H < XJ u a CJ u 00 u u 3 U u a oo U X < u a u H r u v 4J □ o H ►J U a 4J 00 u a 4J co O u 4J u X < u O «3 u i n 00 <0 4-1 00 00 π 00 oo 3 o u oo <0 <U H to a oo U U to 00 a « U X < u < to a u 4-1 4-J u > »< u OO oo o o u 00 O o o a to o u to W o u u a o u a a υ-Ί u o to 3 «□ < u 4-1 to o 3 o O oh ^- * U υ to 4 4-1 4-J to U a o cj to a o M H Q. u c; »U H U u co U 3 o U 3 c H < a n <λ < • a oo u < < H u to M U sQ < □ CJ SO u O V) t-> »• 4 < < u n o u M CJ c. cj u a X < o < o 00 t- H < u 4- » U u oo u co -4 U X o u u 3 H r u a c O a ^e u OC < u < U O <_> < o H < <0 u CJ n □ o to o a u J3 H U CJ to C cu e * < < 4J U OO tk 4-J 3 u Ϊ0 o 4-f a O Xv u O u -J cj CZ> u H to u

CJ 4-f to to u c; u co 4J he U 00 CJ to 4J 4J υ u 00 (J U a to oo U <0 u 00 oo U o co 4J a a «O to to u u 4J 00 to <0 00 4-1 n co u ia 4J u 4-f co & Q u u ia 00 ia to 00 U 4-1 he c 4-f n ia he U CO co U 4J 00 00 oo U to a 4-J CO u co 00 u oo u a co 4U oo CJ u oo a 4-1 oo u co m u <0 4J u CO u 00 to 4J CQ 3 co to u U oo a 00 a to 4-1 u to u 4J CO oo 4J oo u OO 00 a co u 00 4J u a u co 00 4J oo a u to U e 3 to u a 4J ia 3 n 00 to ia U 3 CJ oo to U to 3 co u to CJ to 3 co 4-f co u 3 to U u 4U u 3 a CO 4-f u 4-1 3 u U o co U 3 u XJ CJ u U 3 u a CJ to to 3 00 to X to co 3 to <0 rj to he 3 to to CJ 4-1 CJ O 3 4-1 CJ 3 CO U to U CO U CO 3 ia CJ CJ to to U u to to to 00 a CJ CJ u to to 3 3 3 he CJ and 3 Π CO u a 3 3 a CO 4_l u to to u co 4U u to u to to CO o 3 a to oo ia ia u 3 to oo CJ CO e; 3 <0 4-1 U OO you 00 o u co 3 Π 3 a 00 ia a 3 3 cj 4-1 he u co U ia «0 4-1 4-1 ia 3 CO u 3 U n to a to ia u ia 3 00 U 4-f u ia 00 * 0 to U 3 3 co oc to <0 m CJ - * c co OC 03 * J to CJ fO 4-1 00 CJ ii CO to to 00 u • J 00 u » 4-1 he 3 u Of i. t U co 3

et al., Cell, 27: 279 (1981)). It does not contain pBR322 sequences which are known to inhibit replication in mammalian cells (Lusky et al., Nature, 293: 79 (1981)).

pAdD26SVpA (3) was converted to plasmid pCVSVL2 as shown in Figs. 5A. pAdD26SVpA (3) was converted to plasmid pAdD26SVpA (3) (d) by deleting one of the two PstI sites in pAdD26SVpA (3). This was accomplished by incomplete digestion of the plasmid with the restriction enzyme Pstl, which was deficient in this enzyme. This results in a subpopulation of linear plasmids with only one Pstl site cleaved. It is then exposed to the Klenow fragment, ligated to obtain annular plasmids. Pstl link deletion screening allows for localization between the 3 'and SV40 polyadenylation sequences.

The adenovirus leader consisting of three parts and the virus associated genes (VA genes) were inserted into pAdD26SVpA (3) (d) as shown in Figs. 5A. Initially, pAdD26SVpA (3) (d) is cleaved with PvuII to cut it over a 3 'region containing three elements that form a three-membered leader. PJAW 43 (Zain et al., Cell, 16: 851 (1979)) is then cleaved with Xhol, exposed to the Klenow fragment, cleaved with PvuII, and the 140 bp fragment containing the second leader is separated by acrylamide gel electrophoresis (6% Tris borate). in buffer; Maniatis et al., supra). The 140 bp fragment is then ligated with pAdD26SVpA (3) (d) digested with

PvuII. The ligation product is used to transform E. coli into a tetracycline resistant clone. Colony screening is performed according to the Grunstein-Hogness procedure using a 32p-labeled probe that hybridizes to the 140 bp fragment. DNA from positively hybridizing colonies was analyzed to determine if the reconstructed PvuII site from 140 bp DNA was 5 'or 3' to the second and third late leader of the adenovirus. The plasmid is designated tTPL and is shown in Figs. 5A.

The SV40 AvalID fragment containing the SV40 enhancer sequence is obtained by cleaving the SV40 DNA with AvalI, aligning the ends with the Poli Klenow fragment, ligating the Xhol linkers with the fragments, cleaving with the Xhol linkage, and isolating the fourth largest fragment (D) by electrophoresis. This fragment is then ligated with pTPL digested with XhoI to give plasmid pCVSVL2-TPL. The orientation of the SV40 D fragment in pCVSVL2-TPL is such that the SV40 late promoter is also oriented like the adenovirus major late promoter.

To insert the genes associated with adenovirus (VA) into pCVSVL2-TPL, a plasmid pBR322 containing Hind III type 2 adenovirus was initially constructed.

Bjfragment. Type 2 adenovirus DNA is digested with HindIII and fragment B is isolated by gel electrophoresis. This fragment is inserted into pBR322, which is previously digested with HindIII. E. coli is transformed into an ampicillin-resistant strain. Screening for recombinants was performed to determine if the HindIII B fragment was inserted and its orientation determined by restriction endonuclease digestion. Plasmid pBR322 - Ad HindIII B contains the HindIII B fragment of adenovirus type 2, the orientation of which is shown in Figs. 5B.

As shown in Figs. 5B, VA genes are conveniently obtained from plasmid pBR322 - Ad HindIIII B by digestion with Hpa I, addition of EcoR1 linkers and cleavage with EcoR1 followed by extraction of the 1.4 kb fragment. The fragment containing the EcoRl sticky ends is then ligated to the RIP EcoRl site which is previously cleaved with EcoRl. E. coli HB101 is transformed and screened for tetracycline-resistant colonies by screening hybridization screening for DNA specific for VA genes. DNA was synthesized from positively hybridizing clones and characterized by restriction endonuclease digestion. The resulting plasmid is designated p91023.

Both EcoRI sites p91023 as shown in Figs. 5C, were removed by complete digestion of p91023 with EcoRI. Two DNA fragments are obtained, one approximately 7 kb and the other approximately 1.3 kb. The latter fragment contains the VA genes. The ends of both fragments were aligned using the Poli Klenow fragment and ligated to each other. The plasmid p911023 (A), which contains the VA genes, is similar to p91023, except that it does not contain both EcoRI sites. This plasmid is identified by a Grunstein-Hogness screening method with a Va gene fragment and standard restriction site analysis.

One PstI site in p91023 (A) is deleted and replaced with the EcoRI site. p91023 (A) is completely digested with Pstl and exposed to the Poli Klenow fragment to obtain smooth ends. EcoRI linkers were ligated with p (1023 (A) blunt Pstl linker. Linear p91023 (A) with blunt Pstl · linker EcoRI linkers was separated from unalloyed linkers, completely cleaved with EcoRI and ligated again. Obtained by plasmid p91023 (B) shown in Figure 5C, having a structure similar to p91023 (A), but replacing the EcoRI site by a former Pstl site Plasmid p91023 (B) has been deposited and is available from the American Type Culture Collection (ATCC), Rockville, Maryland, under accession number ATCC 39754. .

Example 6:

Plasmid p91023 (B) inserted cDNA clones (X-EPOFL6 and λEPOFL13; Fig. 3) to form the respective plasmids pPTFL6 and pPTFL13. 8 µg of each purified DNA was used for transfection of COS cells (5 χ 10θ) using the DEAE-dextran method (see below). After 12 hours, the cells are rinsed and exposed to Chloroquine (0.1 mM) for 2 hours, rinsed again and left in media (10 ml) containing 10% fetal calf serum for 24 hours. The medium is then changed to non-serum teroe (4 ml) and maintained for 48 hours.

The amount of immunologically active EPO produced is quantified by the RIA method described by Sherwood and Goldwasser (Blood 54: 8885-893, 1979). Antibodies obtained from Dr. Judith Sherwood. The iodine preparation is prepared from the homogeneous EPO described in Figs. 1. The sensitivity of this test is approximately 1 ng / ml. The results are shown in Table 8 below.

Table 8

Vector pPTFL13 pPTFL6

Amount of EPO released into the medium (ng / ml)

330

Plasmid pPTFL13 has been deposited and is available from the American Type Culture Collection (ATCC), Rockville, Maryland, accession no. ATCC 39990.

Example 7.

EPO cDNA (X-HEPOFL13) is inserted into p91023 (B) vector and transfected into COS-1 cells. The cultivation conditions are the same as described in Fig. 6, except that the chloroquine stage is omitted.

The in vitro bioactivity of EPO was measured using a colony forming assay with mouse germinal liver cells as a source of CFU-E or an assay for H-thymidine uptake using spleen cells from mice injected with phenylhydrazine. The sensitivity of these tests is approximately 25 milliunits / ml.

The biological activity of EPO in vivo was measured using a hypoxic mouse or starving rat method. The sensitivity of these tests is approximately 100 milliunits / ml. No activity was found in the control medium. Measurement results obtained

The EPO expressed in clone EPOFL13 is shown below

Table 9. The activities reported herein are expressed in units / ml using commercial EPO of defined composition (Toyobo, Ine.).

Table 9

EPO, secreted from cells, which are transfected EPO cDNA Test Activity RIA 100 ng / ml CFU-E 2 0.5 units / ml ³ H-Thy 3.1 1.8 units / ml hypoxic mice 1 units / ml starving rats 2 units / ml Example 8: EPO from COS cells analysis in NDS in a polyacrylamide gel

180 ng of EPO secreted into the medium by COS cells transfected with EPO (X-HEPOFL13) cDNA into vector 91023 (B) (described above) is analyzed by electrophoresis at 10%.

NDS in Laemlli polyacrylamide gel and transferred electronically onto nitrocellulose paper (Towbin et al., Proc. Natl. Acad. Sci. USA, 76: 4350 (1979)). The filter is tested with anti-EPO antibodies as described in Table 8, washed and re-tested with ¹²³ I-staphylococcal A protein. The filter is autoradiographed for 2 days. The native homogeneous EPO described in, e.g. 1, analyzed by electrophoresis before iodination (lane B) or after iodination (lane C) (see Fig. 6). Markers used include ³³ S methionine, serum albumin (68,000d) and ovalbumin (45,000d).

Example 9. RKI-4 Construction

From the plasmid PSV2DHFR (Subramani et al., Mol.Cell.Bio. 1: 854-864 (1981)), a Bam HI-PvuII fragment containing the SV40 early region promoter adjacent to the mouse dihydrofolate reductase (DHFR) gene, an SV40 enhancer, was isolated. a small t antigen intron and SV40 polyadenylation sequence (fragment A). Other fragments were obtained from the vector p91023 (A) (see above) as follows: p91023 (A) is cleaved by PstI at the sole PstI site adjacent to the adenovirus promoter to linearized the plasmid and then ligated with the synthetic PstI-EcoRI converter and resealed. (and created links PstI - EcoRI - PstI original PstI anchor site; 91023 (B ¹⁾⁾ or the plasmid at high DNA polymerase I fragment, in order to destroy the PstI links, and ligated with a synthetic Eco RI linker and closed ring (thus creating EcoRI site instead of of the original PstI site; 91023 (B)). Each of the resulting plasmids, 91023 (B ') and 91023 (B), was cleaved with Xba and EcoRI to give two fragments (F and G). By combining the fragment F of 91,023 (B) with fragment G of 91023 (B ') and fragment G from 91 023 (B) on the fragment F of 91 023 (B ¹⁾ generated by the two new plasmids containing the Eco RI - Pst I site or a Pst -EcoRI link instead of the original PstI link. The plasmid in which the PstI - EcoRI site PstI site is closest to the late major adenovirus promoter is designated p91023 (C).

The vector p91023 (C) was completely cleaved with Xhol restriction enzyme and the resulting linearized DNA was aligned using a large fragment of DNA polymerase I from E. coli. A 340 bp HindIII-EcoRI fragment containing the SV40 enhancer synthesized as follows is ligated with such DNA:

The HindIII-PvuII fragment from SV40, containing the SV40 original or a copy thereof, is inserted into plasmid c lac (Little et al.,

Mol. Biol. Med. 1: 473-488 (1983)). The vector c lac was synthesized by digesting DNA with BamHI, aligning the sticky ends, using a large fragment of DNA polymerase I, and digesting DNA with HindIII. The resulting plasmid (c SVHPlac) again has a BamHI site upon ligation with the blunt end of PvuII. The EcoRI HindIII fragment was synthesized from c SVHPlac and ligated with the EcoRI-HindIII fragment from PSVOd (Mellon et al., Supra), containing the original plasmid or a copy thereof. The resulting plasmid pSVHPOd is selected. A 340 bp fragment of EcoRI HindIII containing the SV40 original or enhancer is synthesized, the two ends aligned using a large DNA polymerase I fragment, and ligated with the Xhol cleaved, aligned end vector p91023 (c) described above. Plasmid (p91023 (C) / Xho / blunt ends + was obtained)

EcoRI / HindIII / SV40 with blunt ends + amplifier), in which the HindIII-EcoRI fragment was such that the BamHI site in it was closest to the VA gene, designated pES105. Plasmid pES105 is cleaved with BamHI and PvuII and only with PvuII, followed by isolation of the BamHI - PvuII fragment containing the adenovirus major late promoter (fragment B), the PvuII fragment containing the tetracycline resistance gene and other sequences (fragment C). Fragments A, B and C were ligated and the plasmid shown in Figs. 7, highlighted and labeled RK1-4. Plasmid RK1-4 is deposited with the American Culture Types Collection (ATCC), Rockville, Maryland, Deposit no. ATCC 39940.

Example 10: EPO Expression in CHO Cells (Method I)

DNA (20 gg) from plasmid pPTFL13 described above (Example 6) is digested with restriction endonuclease Clal to linearize the plasmid and ligated with plasmid pAdD26SVp (A) 1 (2 gg) DNA cleaved with Clal. intact dihydrofolate reductase (DHFR) gene under the control of the adenovirus major late promoter (Kaufman and Sharp, Mol. and Cell Biol. 2: 13041319 (1982)). DNA ligated in this way was used to transfect DHFR-negative CHO cells (DUKX-BII, Chasin LA and Urlaub G. (1980) PNAS 77 4216-4220) and, two days after the start of cultivation, cells containing at least one copy of the DHFR gene were selected in nucleotide-free α-medium supplemented with 10% dialyzed fetal bovine serum. Two weeks after the start of cultivation, colonies are removed from the starting plates in a selective medium, grouped at 10-100 colonies, inoculated and grown until they are fused in α-medium without nucleotides. Media supernatants are assayed for EPO by RIA before selection with methotrexate. Groups containing EPO were grown in medium containing methotrexate (0.02 μΜ), then subcloned and re-analyzed. EPO Cla 4 4.02-7 appeared to be the only subcloned group from EPO Cla 4 4.02 that released 460 ng / ral EPO i medium containing 0.02 μΜ ΜΤΧ (Table 10). EPO Cla 4 4.02-7 is the best cell line for producing EPO; it is deposited with the American Culture Types Collection (ATCC), Rockville, Maryland, deposit no. ATCC CRL8695. The gradual selection of this clone to increase ΜΤΧ concentration is now expected to result in cells with even higher expression of EPO. Methotrexate-resistant colonies from appropriate cultures cultured in methotrexate medium (0.02 μΜ) are selected in groups that are negative for RIA. These colonies are again identified by the EPO RIA method. Negative cultures are subcloned and further cultured with increasing concentrations of methotrexate.

Gradual selection by methotrexate (ΜΤΧ) was achieved by repeating cell culture media with increasing concentrations of methotrexate and selection cycles of residual live cells. The amount of EPO in culture supernatant by RIA and in vitro biological activity was measured at each cycle. The amounts of methotrexate used at each amplification step were 0.02 μΜ, 0.1 μΜ, and 0.5 μΜ. As shown in Table 10, significant amounts of EPO are secreted into the medium after 1 cycle of selection with 0.02 μΜ methotrexate.

Table 10

Amounts of EPO secreted into the medium

An example

Group 4 4 4 one colony clone (.02-7)

Test Collected a- in the medium Collected in cc-medium with 0.02 μΜ methotrexate RIA 17 ng / ml 50 ng / ml RIA 460 ng / ml

Example 11:

EPO expression in CHO cells - Method II

The DNA from clone X-HEPOFL13 is digested with EcoRI and the small RI fragment containing the EPO gene is subcloned into the plasmid

RK1-4 EcoRI site (see Example 10). This DNA (RKFL13) is used for direct (without digestion) transfection of DHFR-negative CHO cells. Selection and amplification are performed as described above in E.g. 10th

RKFL13 DNA was also inserted into CHO cells by other protoplast fusion and microinjection. Plasmid RKFL13 has been deposited with the American Type Culture Collection (ATCC), 'Rockville, Maryland, Deposit no. ATCC 39989.

Table 11

The amount of EPO secreted into the medium

Example Test

Colony RIA

Group A ³ H-Thy

Single RIA Colony ³ H-Thy Clone (0.02CZ)

Microinjection in RIA Group ³ H-Thy (DEPO) 1)

Collected in ather ng / ml

Collected in eutherapy with 0.02 μΜ methotrexate 42 ng / ml (group)

150 ng / ml (clone)

1.5 UU / mm 90 ng / ml 5.9 UU / ml ng / ml 1.8 UU / ml

160 ng / ml

The best clone of an individual colony was deposited with the American Culture Types Collection (ATCC), Rockville, Maryland, deposit no. ATCC CRL8695.

Example 12: Expression of EPO genomic clone in COS-1 cells

The vector pSVOd (Mellon et al., Supra) was used to express the EPO genomic clone. DNA from pSVOd is completely cleaved with HindIII and its ends aligned using the large DNA polymerase I fragment. The EPO genomic clone λΗΕΡΟ3 is completely cleaved with EcoRI and HindIII, a 4.0 kb fragment containing the EPO gene is isolated and its ends aligned as described above. The nucleotide sequence of this fragment from the HindIII site to the region above the polyadenylation signal is shown in Figs.

In Table 4, the EPO gene fragment was inserted into the pSVOd plasmid fragment and properly constructed recombinants of both orientations were isolated and screened.

In plasmid CZ2-1, the EPO gene is of 'a orientation (i.e., the 5' end of EPO is closest to the SV40 original), whereas in plasmid CZ1-3 the opposite orientation (orientation b).

Plasmids CZ1-3 and CZ2-1 are transfected into COS-1 cells as described, e.g. 7, the medium is harvested and immunologically active EPO is detected. In the culture supernatant of CZ2-1, EPO was found at approximately 31 ng / ml, and CZ1-3 at 16-31 ng / ml.

Similarly, genomic clones HEPO1, HEPO2 and HEPO6 can be inserted into COS cells.

Example 13: Expression in the pBPVEPO construct of C127 and 3T3 cells

A plasmid was constructed containing the EPO cDNA sequence under the control of the mouse metallothionein promoter and ligated with complete bovine papillomavirus DNA.

pEPO49f

Plasmid SP6 / 5 was obtained from Promega Biotec. this plasmid was completely digested with EeoRI and the 1340 bp EeoRI fragment from λHEPOFL13 was inserted using DNA ligase. The resulting plasmid with the 5 'end of the EPO gene closest to the SP6 promoter (by cleavage with BglI and HindIII) is designated pEPO49F. In this orientation, the BamHI site of the PSP6 / 5 polylinker is directly linked to the 5 'end of the EPO gene.

pMMTneo BPV

Plasmid pdBPV-MMTneo (342-12) (Law et al., Mol. And Cell

Biol. 3: 2110-2115 (1983)), shown in Figs. 8, completely digested with BamHI, and obtained two fragments, a large approximately 8 kb fragment containing the BPV genome and a smaller approximately 6.5 kb fragment containing the original pML2 replication and the ampicillin resistance gene, metallothionein promoter, neomycin resistance gene and SV40 polyadenylation signal. The digested DNA is ligated into the ring by exposure to DNA ligase, and plasmids containing only a 6.8 kb fragment are identified by digestion with EcoRI and BamHI restriction endonucleases. One of these plasmids is labeled pMMTneo BPV.

pEPQ15a pMMTneo BPV is completely digested with BglII. pEPO49f is completely cleaved with BamHI and BglII and the approximately 700 bp fragment containing the entire EPO coding region is gel isolated. pMMTneo BPV cleaved with BglII and 700 bp

The BamHI / BglII EPO fragment was ligated and the resulting plasmids containing EPO cDNA were identified by hybridization of the colonies with an oligonucleotide d (GGTCATCTGTCCCCTGTCC) probe specific for the EPO gene. Among the positively hybridizing plasmids, one plasmid (pEPO15a) was identified by cleavage with EcoRI and KpnI, in which the EPO cDNA is oriented such that the 5 'end of the EPO cDNA is closest to the metallothionein promoter.

pBPV-EPO

Plasmid pEPO15A is linearized by complete digestion with BamHI. The pdBPV-MMTneo- (342-12) plasmid is also completely digested with BamHI and two fragments of 6.5 kb and 8 kb are obtained. An 8 kb fragment containing the entire bovine papillomavirus genome is isolated in a gel. The pEP015a / BamHI and the 8 kb BamHI fragment were ligated to each other and the plasmid (pBPV-EPO) containing the BPV fragment was identified using a oligonucleotide d (P-CCACACCCGGTACACAC-OH) probe specific for the BPV genome. Cleavage of pBPV-EPO DNA with HindlII showed that the transcription direction of the BPV genome is the same as that of the metallothionein promoter (also present in pdBPV-MMTneo (342-12); see Figure 8). Plasmid pdBPVMMTneo (342-12) is available from the American Type Culture Collection (ATCC), Rockville, Maryland, accession no. ATCC 37224.

Expression

The methods described below were used for EPO expression.

Method I

PBPV-EPO DNA was synthesized and approximately 25 µg was used to transfect CHO cells at ~ 1 x 10 ⁶ C127 (Lowy et al., J. of Virol. 26: 291-98 (1978)) using standard calcium phosphate precipitation techniques (Grahm et al. ., Virology, 52: 456-67 (1973)). Five hours after transfection, the transfection medium is removed, glycerol shock is performed, cells are rinsed and fresh α-medium supplemented with 10% fetal bovine serum is added. After 48 hours, the cells were trypsinized, dispersed in 1:10 DME medium containing 500 µg / ml G418 (Southern et al., Mol. Appl.

Genet. 1: 327-41 (1982)) and incubated for two to three weeks. Colonies resistant to G418 are isolated individually, placed in microtiter wells and grown to confluence in G418. The cells are then rinsed, fresh medium containing 10% fetal bovine serum is added and the medium is harvested 48 hours later. The treated medium was analyzed and found to be positive for EPO by RIA and in vitro bioassay.

Method II

C127 or 3T3 cells are co-transfected with 25 µg pBPV-EPO and 2 µg pSV2neo (Southern et al., Supra) as described in Method I. An approximately 10-fold molar excess of pBPV-EPO is used. Following transfection, the same procedure as described in Method I is followed.

Method III

C127 cells are transfected with 30 µg pBPV-EPO as described in Method I. After transfection and division (1:10), the medium is changed every three days. Approximately 2 weeks later, spots of BPV-transformed cells appear. Individual spots are collected individually into wells of a 1 cm microtiter plate, grown to confluent monolayer and assayed for EPO activity or antigenicity in the treated medium.

Example 14: Expression in insect cells. pIVEV EPOFL13 construction

Plasmid vector pIVEV has been deposited with the American Type Culture Collection (ATCC), Rockville, Maryland, deposit no. ATCC 39991. The vector is modified as follows:

pIVEVNI pIVEV is cleaved with EcoRI to linearize the plasmid, the ends aligned using a large DNA polymerase I fragment and one NotI linker

GGCGGCCGCC

CCGCCGGCGG

Inserted with ligated blunt end. The resulting plasmid is designated pIVEVNI.

pIVEVSI pIVEV is cleaved with SmaI to linearize the plasmid and one Sfil linker

GGGCCCCAGGGGCCC

CCCGGGGTCCCCGGG inserted by ligating blunt end. The resulting plasmid is designated pIVEVSI.

pIVEVSlBgKp

The pIVEVSI plasmid is cleaved with Kpnl for linearization and approximately 0-100 bp removed at each end by digestion with Bal31 double stranded exonuclease. The resulting ends are aligned using a large fragment of DNA polymerase I, and ligated to the blunt end, the R-Jtt polylinker is inserted? ⁰ -, ¹ .__ XbąI

In-lailI InEcokl Incial Kpnl

AGATCTCGA! OAATicTAG? A'rCGA '? GGTACci

TCTAGAGCTCTTAAGATCTAGCTACCATGG

Both orientations of the polylinker are obtained. The plasmid in which the polylinker is oriented such that the BglII site on the polylinker is closest to the promoter of the polyhedron gene is designated pIVEVSlBgKp. The plasmid in which the Kpnl site on the polylinker is closest to the promoter of the polyhedron gene is designated pIVEVSIKpBg. The number of base pairs removed from the region between the original Kpnl link pIVEVSI and the polyhedron promoter was not determined. pIVEVSlBgKp deposited with the American Culture Types Collection (ATCC), Rockville, Maryland, Deposit no. ATCC 39998.

pIEVSIBgKpNl pIVEVNI is completely digested with Kpnl and PstI to give two fragments. The larger fragment containing the replication and the 3 'end of the plasmid original is isolated on the gel (fragment A). pIVEVSlBgKp is completely digested with PstI and Kpnl, yielding two fragments. The smaller fragment containing the promoter of the polyhedron gene and the polylinker is isolated in the gel (fragment B). Fragments A and B are ligated using DNA ligase to form a new plasmid, pIVEVSIBgKpN1, which contains a partially deleted polyhedron gene into which the polylinker has been inserted, as well as a NotI site (instead of a disrupted EcoRI site) and a Sfil site that surrounds the polyhedron gene region.

pIVEPO pIVEVSI BGKpNI is completely cleaved with EcoRI to linearize the plasmid and a 1340 bp EcoRI fragment from Z-HEPOFL13 is inserted. Plasmids in which the EPO gene is so oriented that the 5 'end of the EPO gene is closest to the polyhedron promoter and the 3' end of the polyhedron gene is identified by cleavage with BglII. One of these plasmids having the above orientation is designated pIVEPO.

EPO expression in insect cells

Transformation of E. coli strain JM101-tgl produces a large amount of pIVEPO plasmid. The plasmid DNA was isolated using a clear lysate procedure (Maniatis and Fritsch, Cold Spring Harbor Manual) and then purified by centrifugation in a CsCl gradient. The DNA of the wild-type strain L-1 of the polyhedrosis virus (AcNPV) Autographa caiifornica is produced by phenolic extraction of virus particles followed by purification of the viral DNA in a CsCl gradient.

These two DNAs are co-transfected into Spodoptera frugiperda cells by IPLB-SF-21 (Vaughn et al., In Vitro Vol. B, pp. 213-17 (1977)) using a calcium phosphate transfection procedure (Potter and Miller, 1977). Wild-type AcNPV DNA and 10 µg pIVEPO were used for each plate of cotransfected cells. The plates are incubated for 5 days at 27 ° C. The supernatant is harvested and EPO expression level is determined by RIA in vitro bioassay.

Example 15: Purification of EPO

COS cell culture medium (12 L) containing up to 200 µg / L EPO is concentrated to 600 mL using 10,000 D ultrafiltration membranes, such as a Millipore Pellicon apparatus with a 5 square foot membrane. RIA is tested according to the procedure described in, e.g. 6. The ultrafiltration retentate is diafiltered against 4 ml of 10 mM sodium phosphate buffer, pH 7.0. Concentrated and diafiltered media contained 2.5 mg EPO (total protein 380 mg). The EPO solution is then concentrated to 186 ml and the precipitated proteins are removed by centrifugation at 110,000 g for 30 minutes.

The pH of the supernatant containing EPO (2.0 mg) is adjusted to 5.5 by addition of 50% acetic acid, stirred for 30 minutes at 4 ° C and the precipitate is removed by centrifugation for 30 minutes at 13000 g.

Carboxymethylsepharose chromatography

After centrifugation (20 ml) containing 200 µg of EPO (total protein 24 mg), the supernatant is applied to a column filled with CM-Sepharose (20 ml). The column is equilibrated with 10 mM sodium acetate (pH 5.5) and washed with 40 ml of the same buffer. EPO was eluted from CM-Sepharose with 100 mL of NaU (O-1) gradient in 10 mM sodium phosphate solution, pH 5.5. Fractions containing EPO (50 gg in two mg total protein) are collected and the resulting solution is concentrated to. 2 ml using Amicon YM10 ultrafiltration membrane.

Reverse Phase HPLC

The concentrated fractions after CM-Sepharose containing-EPO were further purified by reverse phase HPLC using Vydac.

C-4 column. The EPO is applied to a column that is leveled

10% eluent B (eluent A = 0.1% CF3CO2B in water;

eluent B - 0.1% CF3CO2H in acetonitrile), flow rate 1 ml / min. The column is washed with 10% B. The EPO is eluted with a B gradient (10-70% over 60 minutes). Fractions containing EPO (~ 40 µg EPO, total protein 120 µg) are collected and lyophilized. Lyophilized EPO was dissolved in 0.1 M Tris-HCl with 0.15 M NaCl at pH 7.5 and further purified by reverse phase HPLC .. Fractions containing EPO were collected and analyzed by NDS polyacrylamide gel (10%) by electrophoresis (Laemmli, U.K., Nature).

The collected fractions contain 15.5 gg EPO, total protein 25 gg.

The description of the present invention is set forth in more detail, more preferred examples being given. The authors would appreciate if those skilled in the art would, while introducing the improvements and modifications, in accordance with the specifications and drawings herein, depart from the spirit and scope of the present invention as set forth in the appended claims.

Claims (35)

DEFINITION OF INVENTION A method of producing a human cDNA clone expressing biologically active erythropoietin comprising the steps of: (a) cleaving the purified erythropoietin with trypsin; (b) forming a set of oligonucleotide probes based on the amino acid sequence of the tryptic fragments obtained in step (a); (c) screening the human genomic DNA library with oligonucleotide probes from step (b); (d) selecting clones that hybridize to the probes and sequencing these clones to determine whether they are erythropoietin clones; (e) identifying the erythropoietin clone from step (d); (f) utilizing a clone from step (e) for screening a cDNA library prepared from human embryonic liver; (g) selecting an erythropoietin clone from the germinal liver cDNA library in step (f). 2. A method of producing erythropoietin comprising culturing in a suitable medium host cells having substantially the same DNA sequence as shown in Table 3 operably linked to an expression control sequence; and separates the erythropoietin thus produced from cells and media, and Table 3 is within the scope of this definition. 3. A method of producing erythropoietin comprising culturing in an appropriate medium eukaryotic host cells having substantially the same DNA sequence as shown in Table 4 operably linked to an expression control sequence; and separates the erythropoietin thus produced from cells and media, and Table 4 is within the scope of this definition. 4. The method of claim 2 or 3, wherein the host cells are mammalian cells. 5. The method of claim 4, wherein the mammalian cells are 3T3 cells. 6. The method of claim 4, wherein the mammalian cells are Chinese hamster ovary (CHO) cells. 7. The method of claim 4, wherein said DNA sequence is in a vector further comprising bovine papillomavirus DNA. 8. A pharmaceutical composition comprising a therapeutically effective amount of erythropoietin, prepared by the method set forth in claims 2-7, with a pharmaceutically acceptable excipient. A recombinant DNA plasmid vector comprising a cDNA clone, X-HEPOFLI3. A microorganism or cell line transformed with a vector as described in claim 9. 11. A microorganism or cell line according to claim 10, characterized in that it is selected from E. coli, yeast, mammalian or insect cells. 12. The microorganism or cell line of claim 11, wherein said cells are 3T3, C127 or CHO cells. 13. The biologically active human erythropoietin, characterized in that it is produced by cultivating under controlled conditions in vitro microorganisms or cell line according to claim 11. 14. A recombinant DNA vector comprising a genomic DNA clone comprising the nucleotide sequence set forth in Table 4 and Table 4 within the scope of this claim. A mammalian cell line transformed with a vector according to claim 14. 16. The cell line of claim 15, wherein said mammalian cells are CHO cells. 17. The biologically active human erythropoietin, characterized in that it is produced by culturing under controlled conditions an in vitro cell line according to claim 15. 18. A cDNA sequence comprising a DNA sequence comprising the sequence of 1 to 166 amino acids as shown in Table 3, and Table 3 is within the scope of this claim. 19. The cDNA sequence of claim 18, wherein it comprises a DNA sequence encoding the leader amino acid sequence Met Gly ..... Leu Gly shown in Table 3, and Table 3 is within the scope of this claim. A recombinant DNA vector comprising a heterologous promoter and a cDNA sequence according to claim 18 or 19. A microorganism or cell line transformed with a vector according to claim 20. 22. The microorganism or cell line of claim 21, wherein said microorganism or cell line is selected from E. coli, yeast, mammalian or insect cells. 23. The microorganism or cell line of claim 22, wherein said cells are 3T3, C127 or CHO cells. A mammalian cell containing bovine papillomavirus DNA and a DNA coding for erythropoietin (EPO). 25. The cell of claim 24, wherein said cell is a C127 or 3T3 cell. 26. The cell of claim 25, wherein said erythropoietin (EPO) DNA is transcriptionally controlled by the murine metallothionein promoter. 27. The cell of claim 25, comprising DNA from pdBPV-MMTneo (342-12). Erythropoietin produced by the method specified in 3 or 4, wherein the specific activity is greater than about 200,000 UU / mg protein. Erythropoietin according to claim 28, characterized in that it has a specific activity greater than about 275,000 IU / mg protein. 30. Erythropoietin produced according to the method of claim 3 or 4, characterized in that it has a specific activity of about 275,000-300,000 IU / mg protein. 31. Erythropoietin according to claim 28, 29 or 30, characterized in that it is Oglycosylated. 32. The method of claim 2 or 3 wherein the culture medium contains a fetal serum. 33. The method of claim 32, wherein the host cells are mammalian cells. 34. The method of claim 33, wherein the mammalian host cells are COS, CHO, C127 or 3T3 cells. Biologically active erythropoietin, characterized in that it is produced according to claims 32-34.